#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CGN	57530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151502428	151502428	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:151502428G>A	ENST00000271636.7	+	12	2283	c.2150G>A	c.(2149-2151)cGg>cAg	p.R717Q	SNORA44_ENST00000517031.1_RNA	NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	711	Glu-rich.				transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTGGGGCAGCGGCGGGCCGCA	0.652																																					p.R717Q		.											.	CGN-93	0			c.G2150A						.						30.0	37.0	34.0					1																	151502428		2203	4300	6503	SO:0001583	missense	57530	exon12			GGCAGCGGCGGGC	AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.2150G>A	1.37:g.151502428G>A	ENSP00000271636:p.Arg717Gln	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	208	105	NM_020770	0	0	0	1	1	A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	ENST00000271636.7	37	CCDS999.1	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267974	0.40095	.	.	ENSG00000143375	ENST00000271636	T	0.64438	-0.1	5.27	5.27	0.74061	.	0.472495	0.21879	N	0.067773	T	0.62332	0.2419	L	0.50919	1.6	0.29222	N	0.87387	D	0.76494	0.999	P	0.60068	0.868	T	0.58685	-0.7593	10	0.39692	T	0.17	-10.0013	16.3784	0.83418	0.0:0.0:1.0:0.0	.	711	Q9P2M7	CING_HUMAN	Q	717	ENSP00000271636:R717Q	ENSP00000271636:R717Q	R	+	2	0	CGN	149769052	0.901000	0.30685	0.933000	0.37362	0.335000	0.28730	2.924000	0.48876	2.439000	0.82584	0.563000	0.77884	CGG	.		0.652	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034900.3	NM_020770	
SHE	126669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154471704	154471704	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:154471704A>G	ENST00000304760.2	-	2	688	c.602T>C	c.(601-603)tTa>tCa	p.L201S	TDRD10_ENST00000368482.4_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	201										breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATAGTCTTCTAAAATGATGAC	0.448																																					p.L201S		.											.	SHE-95	0			c.T602C						.						129.0	108.0	115.0					1																	154471704		2203	4300	6503	SO:0001583	missense	126669	exon2			TCTTCTAAAATGA	AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.602T>C	1.37:g.154471704A>G	ENSP00000307369:p.Leu201Ser	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	133	39	NM_001010846	0	0	0	0	0	Q8TEQ5	Missense_Mutation	SNP	ENST00000304760.2	37	CCDS30877.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.353420	0.82243	.	.	ENSG00000169291	ENST00000304760	T	0.31510	1.49	5.02	5.02	0.67125	.	0.102997	0.42821	D	0.000657	T	0.41050	0.1142	M	0.72894	2.215	0.42961	D	0.9944	D	0.89917	1.0	D	0.69307	0.963	T	0.22836	-1.0205	10	0.27082	T	0.32	-29.5539	13.7207	0.62725	1.0:0.0:0.0:0.0	.	201	Q5VZ18	SHE_HUMAN	S	201	ENSP00000307369:L201S	ENSP00000307369:L201S	L	-	2	0	SHE	152738328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.237000	0.89807	2.099000	0.63709	0.533000	0.62120	TTA	.		0.448	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087910.2	NM_001010846	
OR10J5	127385	broad.mit.edu	37	1	159505502	159505502	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:159505502G>A	ENST00000334857.2	-	1	340	c.296C>T	c.(295-297)aCa>aTa	p.T99I		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					GAACATTTGTGTAGCACAGCC	0.463																																					p.T99I													.	OR10J5-71	0			c.C296T						.						128.0	111.0	117.0					1																	159505502		2203	4300	6503	SO:0001583	missense	127385	exon1			ATTTGTGTAGCAC		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.296C>T	1.37:g.159505502G>A	ENSP00000334441:p.Thr99Ile	Somatic	220	1		WXS	Illumina HiSeq	Phase_I	232	7	NM_001004469	0	0	0	0	0	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	37	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	G	0.914	-0.718207	0.03182	.	.	ENSG00000184155	ENST00000334857	T	0.02837	4.14	4.32	2.43	0.29744	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00936	0.0031	L	0.35542	1.07	0.09310	N	1	B	0.24043	0.096	B	0.24974	0.057	T	0.46830	-0.9163	9	0.38643	T	0.18	.	8.3927	0.32537	0.196:0.0:0.804:0.0	.	99	Q8NHC4	O10J5_HUMAN	I	99	ENSP00000334441:T99I	ENSP00000334441:T99I	T	-	2	0	OR10J5	157772126	0.005000	0.15991	0.004000	0.12327	0.225000	0.24961	1.462000	0.35266	0.561000	0.29186	0.467000	0.42956	ACA	.		0.463	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
IGFN1	91156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201166405	201166405	+	Silent	SNP	C	C	T	rs370452044		TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:201166405C>T	ENST00000335211.4	+	5	457	c.327C>T	c.(325-327)taC>taT	p.Y109Y	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Silent_p.Y109Y	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	109	Ig-like 1.					nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TAAATGCGTACGGAGAGGCCG	0.557																																					p.Y109Y		.											.	IGFN1-71	0			c.C327T						.	C		1,1383		0,1,691	172.0	157.0	162.0		327	-2.2	0.1	1		162	0,3182		0,0,1591	no	coding-synonymous	IGFN1	NM_001164586.1		0,1,2282	TT,TC,CC		0.0,0.0723,0.0219		109/3709	201166405	1,4565	692	1591	2283	SO:0001819	synonymous_variant	91156	exon5			TGCGTACGGAGAG	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.327C>T	1.37:g.201166405C>T		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	130	41	NM_001164586	0	0	10	35	25	F8WAI1|Q9NT72	Silent	SNP	ENST00000335211.4	37	CCDS53455.1																																																																																			.		0.557	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
CR1	1378	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	207669654	207669654	+	Silent	SNP	G	G	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:207669654G>C	ENST00000367049.4	+	1	42	c.42G>C	c.(40-42)ccG>ccC	p.P14P	CR1_ENST00000367050.4_3'UTR|CR1_ENST00000367053.1_Silent_p.P14P|CR1_ENST00000367052.1_Silent_p.P14P|CR1_ENST00000400960.2_Silent_p.P14P|CR1_ENST00000367051.1_Silent_p.P14P	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	14					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CTGTCGGGCCGCCGGCGCCCG	0.632																																					p.P14P		.											.	CR1-93	0			c.G42C						.						21.0	27.0	25.0					1																	207669654		1819	4077	5896	SO:0001819	synonymous_variant	1378	exon1			CGGGCCGCCGGCG	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.42G>C	1.37:g.207669654G>C		Somatic	39	0		WXS	Illumina HiSeq	Phase_I	48	6	NM_000573	0	0	0	0	0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	ENST00000367049.4	37	CCDS44308.1																																																																																			.		0.632	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
PROX1	5629	broad.mit.edu;bcgsc.ca	37	1	214170147	214170147	+	Missense_Mutation	SNP	C	C	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:214170147C>A	ENST00000366958.4	+	2	877	c.269C>A	c.(268-270)gCa>gAa	p.A90E	PROX1_ENST00000435016.1_Missense_Mutation_p.A90E|PROX1_ENST00000498508.2_Missense_Mutation_p.A90E|PROX1_ENST00000261454.4_Missense_Mutation_p.A90E	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	90					aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TTTCCAGGAGCAACCATAATT	0.488																																					p.A90E													.	PROX1-654	0			c.C269A						.						85.0	83.0	84.0					1																	214170147		2203	4300	6503	SO:0001583	missense	5629	exon2			CAGGAGCAACCAT	U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.269C>A	1.37:g.214170147C>A	ENSP00000355925:p.Ala90Glu	Somatic	156	1		WXS	Illumina HiSeq	Phase_I	162	8	NM_001270616	0	0	0	0	0	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	ENST00000366958.4	37	CCDS31021.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981386	0.74474	.	.	ENSG00000117707	ENST00000471129;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	5.77	5.77	0.91146	.	0.048799	0.85682	D	0.000000	T	0.38719	0.1051	L	0.44542	1.39	0.80722	D	1	D	0.58268	0.982	P	0.59825	0.864	T	0.02950	-1.1090	10	0.72032	D	0.01	-2.6486	20.3627	0.98863	0.0:1.0:0.0:0.0	.	90	Q92786	PROX1_HUMAN	E	90	ENSP00000419517:A90E;ENSP00000420283:A90E;ENSP00000355925:A90E;ENSP00000400694:A90E;ENSP00000261454:A90E	ENSP00000261454:A90E	A	+	2	0	PROX1	212236770	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.677000	0.68142	2.885000	0.99019	0.655000	0.94253	GCA	.		0.488	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089727.6	NM_002763	
FMN2	56776	hgsc.bcm.edu	37	1	240255571	240255571	+	Silent	SNP	C	C	G	rs71929261|rs140531536	byFrequency	TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:240255571C>G	ENST00000319653.9	+	1	392	c.162C>G	c.(160-162)ggC>ggG	p.G54G		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	54					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G197delG(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGAgggggcggcggcggcg	0.662																																					p.G54G		.											.	FMN2-145	1	Deletion - In frame(1)	prostate(1)	c.C162G						.						2.0	3.0	3.0					1																	240255571		1816	3578	5394	SO:0001819	synonymous_variant	56776	exon1			AGGGGGCGGCGGC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.162C>G	1.37:g.240255571C>G		Somatic	5	0		WXS	Illumina HiSeq	Phase_I	9	4	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.662	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
FH	2271	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	241661272	241661272	+	Splice_Site	SNP	T	T	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:241661272T>G	ENST00000366560.3	-	10	1429		c.e10-2			NM_000143.3	NP_000134.2	P07954	FUMH_HUMAN	fumarate hydratase						cellular metabolic process (GO:0044237)|fumarate metabolic process (GO:0006106)|homeostasis of number of cells within a tissue (GO:0048873)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|tricarboxylic acid cycle enzyme complex (GO:0045239)	fumarate hydratase activity (GO:0004333)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|skin(2)	26	Ovarian(103;0.103)	all_cancers(173;2.37e-314)|all_epithelial(177;5.17e-286)|Breast(1374;1.06e-10)|Acute lymphoblastic leukemia(190;4.93e-10)|all_neural(198;0.00118)	OV - Ovarian serous cystadenocarcinoma(106;0.0214)	Colorectal(1306;2.33e-53)|COAD - Colon adenocarcinoma(196;1.05e-44)|KIRC - Kidney renal clear cell carcinoma(1967;0.000109)		TGTCATACCCTGAAGAAAAAA	0.378			"""Mis, N, F"""			"""lieomyomatosis, renal"""			Hereditary Leiomyomatosis and Renal Cell Cancer																												.	Melanoma(148;1573 2486 7381 46575)	.	yes	Rec		hereditary leiomyomatosis and renal cell cancer	1	1q42.1	2271	fumarate hydratase		"""E, M"""	.	FH-416	0			c.1391-2A>C						.						101.0	99.0	100.0					1																	241661272		2203	4300	6503	SO:0001630	splice_region_variant	2271	exon11	Familial Cancer Database	HLRCC, Reed syndrome, Hereditary Multiple Leiomyomata of Skin and Uterus	ATACCCTGAAGAA	BC003108	CCDS1617.1	1q42.1	2014-09-17			ENSG00000091483	ENSG00000091483	4.2.1.2		3700	protein-coding gene	gene with protein product		136850					Standard	NM_000143		Approved	fumarase	uc001hyx.3	P07954	OTTHUMG00000039597	ENST00000366560.3:c.1391-2A>C	1.37:g.241661272T>G		Somatic	125	0		WXS	Illumina HiSeq	Phase_I	121	32	NM_000143	0	0	2	9	7	B1ANK7	Splice_Site	SNP	ENST00000366560.3	37	CCDS1617.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.987598	0.74589	.	.	ENSG00000091483	ENST00000366560	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.0202	0.64550	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FH	239727895	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.531000	0.73820	2.188000	0.69820	0.528000	0.53228	.	.		0.378	FH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095490.1	NM_000143	Intron
ITGA8	8516	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	15688856	15688856	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr10:15688856T>C	ENST00000378076.3	-	12	1549	c.1196A>G	c.(1195-1197)gAt>gGt	p.D399G		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	399					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						ATTGTATCCATCTTGGTTCAG	0.468																																					p.D399G		.											.	ITGA8-230	0			c.A1196G						.						96.0	89.0	92.0					10																	15688856		2203	4300	6503	SO:0001583	missense	8516	exon12			TATCCATCTTGGT	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1196A>G	10.37:g.15688856T>C	ENSP00000367316:p.Asp399Gly	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	101	7	NM_003638	0	0	0	0	0	B0YJ31|Q5VX94	Missense_Mutation	SNP	ENST00000378076.3	37	CCDS31155.1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.698910	0.88830	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.75589	-0.95	5.09	5.09	0.68999	.	0.093018	0.64402	D	0.000001	D	0.89322	0.6682	H	0.94264	3.515	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.69142	0.962;0.943	D	0.92371	0.5905	10	0.87932	D	0	.	14.8578	0.70355	0.0:0.0:0.0:1.0	.	384;399	F5H818;P53708	.;ITA8_HUMAN	G	399;384	ENSP00000367316:D399G	ENSP00000367316:D399G	D	-	2	0	ITGA8	15728862	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.040000	0.89188	1.897000	0.54924	0.460000	0.39030	GAT	.		0.468	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046987.1	NM_003638	
TRPM5	29850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	2432685	2432685	+	Silent	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr11:2432685C>T	ENST00000155858.6	-	18	2687	c.2679G>A	c.(2677-2679)gcG>gcA	p.A893A	TRPM5_ENST00000533060.1_Silent_p.A893A|TRPM5_ENST00000452833.1_Silent_p.A895A|TRPM5_ENST00000528453.1_Silent_p.A893A	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GGTGCAGCAGCGCCTGGGTGG	0.632																																					p.A893A	NSCLC(1;49 61 17205 18850 43201)	.											.	TRPM5-137	0			c.G2679A						.						33.0	37.0	36.0					11																	2432685		2202	4295	6497	SO:0001819	synonymous_variant	29850	exon18			CAGCAGCGCCTGG	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2679G>A	11.37:g.2432685C>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	88	27	NM_014555	0	0	0	0	0		Silent	SNP	ENST00000155858.6	37	CCDS31340.1																																																																																			.		0.632	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	
MAML2	84441	hgsc.bcm.edu	37	11	95825362	95825362	+	Silent	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr11:95825362C>T	ENST00000524717.1	-	2	3117	c.1833G>A	c.(1831-1833)caG>caA	p.Q611Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	611					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q611Q(2)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgttgctgctgctgctgct	0.542			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q611Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	c.G1833A						.						39.0	44.0	42.0					11																	95825362		2057	4042	6099	SO:0001819	synonymous_variant	84441	exon2			TTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1833G>A	11.37:g.95825362C>T		Somatic	232	0		WXS	Illumina HiSeq	Phase_I	238	12	NM_032427	0	0	56	56	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.542	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
MAML2	84441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	11	95825407	95825407	+	Silent	SNP	C	C	T	rs61901862		TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr11:95825407C>T	ENST00000524717.1	-	2	3072	c.1788G>A	c.(1786-1788)caG>caA	p.Q596Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	596					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q596Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgctgctgtt	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q596Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	1	Substitution - coding silent(1)	kidney(1)	c.G1788A						.						28.0	35.0	33.0					11																	95825407		2119	4148	6267	SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1788G>A	11.37:g.95825407C>T		Somatic	246	0		WXS	Illumina HiSeq	Phase_I	274	55	NM_032427	0	0	413	427	14	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|0.250;T|0.750		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
TRPC6	7225	ucsc.edu	37	11	101340201	101340201	+	Missense_Mutation	SNP	C	C	T	rs138519687		TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr11:101340201C>T	ENST00000344327.3	-	10	2865	c.2441G>A	c.(2440-2442)gGa>gAa	p.G814E	TRPC6_ENST00000360497.4_Missense_Mutation_p.G759E|TRPC6_ENST00000532133.1_Missense_Mutation_p.G736E|TRPC6_ENST00000348423.4_Missense_Mutation_p.G698E	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	814					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.G814E(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		ttcatgacttcctaaaattcc	0.284																																					p.G814E	Colon(166;1315 1927 11094 12848 34731)												.	TRPC6-93	1	Substitution - Missense(1)	skin(1)	c.G2441A						.						74.0	72.0	73.0					11																	101340201		2198	4295	6493	SO:0001583	missense	7225	exon10			TGACTTCCTAAAA	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2441G>A	11.37:g.101340201C>T	ENSP00000340913:p.Gly814Glu	Somatic	50	0		WXS	Illumina HiSeq		42	4	NM_004621	0	0	0	0	0	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	37	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	C	9.959	1.222338	0.22457	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.77750	-0.95;-1.02;-0.86;-1.12	4.43	2.45	0.29901	.	2.229520	0.01753	N	0.030032	T	0.63827	0.2544	N	0.14661	0.345	0.28120	N	0.930653	B;B;B	0.30406	0.032;0.278;0.008	B;B;B	0.30316	0.055;0.114;0.011	T	0.57985	-0.7716	10	0.40728	T	0.16	-2.2809	5.3878	0.16227	0.0:0.66:0.2253:0.1147	.	759;698;814	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	E	814;736;698;759	ENSP00000340913:G814E;ENSP00000435574:G736E;ENSP00000343672:G698E;ENSP00000353687:G759E	ENSP00000340913:G814E	G	-	2	0	TRPC6	100845411	1.000000	0.71417	0.999000	0.59377	0.912000	0.54170	1.258000	0.32944	1.082000	0.41137	-0.145000	0.13849	GGA	.		0.284	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
OR8G5	219865	bcgsc.ca	37	11	124135723	124135723	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr11:124135723T>C	ENST00000524943.2	+	1	1001	c.1001T>C	c.(1000-1002)gTt>gCt	p.V334A	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	334						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		GATGTCCACGTTGCCCTGAAG	0.408																																					p.V334A	Ovarian(169;523 1969 8640 31295 51256)												.	.	0			c.T1001C						.						56.0	55.0	55.0					11																	124135723		2026	4204	6230	SO:0001583	missense	219865	exon1			TCCACGTTGCCCT	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.1001T>C	11.37:g.124135723T>C	ENSP00000477014:p.Val334Ala	Somatic	247	2		WXS	Illumina HiSeq	Phase_1	254	16	NM_001005198	0	0	0	0	0	B2RND3|Q6IEU6	Missense_Mutation	SNP	ENST00000524943.2	37																																																																																				.		0.408	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
ACAD8	27034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	134131026	134131026	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr11:134131026G>A	ENST00000281182.4	+	7	900	c.794G>A	c.(793-795)gGc>gAc	p.G265D	ACAD8_ENST00000374752.4_Missense_Mutation_p.G138D|ACAD8_ENST00000524547.1_3'UTR|ACAD8_ENST00000537423.1_Missense_Mutation_p.G188D|ACAD8_ENST00000543332.1_Missense_Mutation_p.G167D	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	265					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	GAGGGGCAGGGCTTCCTCATT	0.587																																					p.G265D	GBM(65;238 1125 33403 41853 48889)	.											.	ACAD8-90	0			c.G794A						.						70.0	66.0	67.0					11																	134131026		2201	4297	6498	SO:0001583	missense	27034	exon7			GGCAGGGCTTCCT	AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.794G>A	11.37:g.134131026G>A	ENSP00000281182:p.Gly265Asp	Somatic	175	0		WXS	Illumina HiSeq	Phase_I	170	74	NM_014384	0	0	11	21	10	B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	ENST00000281182.4	37	CCDS8498.1	.	.	.	.	.	.	.	.	.	.	G	34	5.343370	0.95783	.	.	ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000543332;ENST00000374752;ENST00000537915	D;D;D;D	0.99961	-9.25;-9.25;-9.25;-9.25	5.44	5.44	0.79542	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.99971	0.9990	H	0.97874	4.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.996	D	0.96958	0.9699	10	0.87932	D	0	.	19.2501	0.93921	0.0:0.0:1.0:0.0	.	188;138;265	B7Z5W4;Q6ZWP6;Q9UKU7	.;.;ACAD8_HUMAN	D	265;188;167;138;227	ENSP00000281182:G265D;ENSP00000443763:G188D;ENSP00000438302:G167D;ENSP00000363884:G138D	ENSP00000281182:G265D	G	+	2	0	ACAD8	133636236	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.793000	0.99091	2.561000	0.86390	0.561000	0.74099	GGC	.		0.587	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384	
MYO1A	4640	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	57440666	57440666	+	Silent	SNP	G	G	A	rs561295735	byFrequency	TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr12:57440666G>A	ENST00000442789.2	-	8	809	c.522C>T	c.(520-522)ctC>ctT	p.L174L	MYO1A_ENST00000544473.1_Silent_p.L12L|MYO1A_ENST00000300119.3_Silent_p.L174L	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	174	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						TGACACCACCGAGGGGGGATC	0.498													G|||	6	0.00119808	0.0	0.0	5008	,	,		20056	0.0		0.0	False		,,,				2504	0.0061				p.L174L		.											.	MYO1A-231	0			c.C522T						.						98.0	93.0	94.0					12																	57440666		2203	4300	6503	SO:0001819	synonymous_variant	4640	exon7			ACCACCGAGGGGG	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.522C>T	12.37:g.57440666G>A		Somatic	168	0		WXS	Illumina HiSeq	Phase_I	188	15	NM_005379	0	0	0	0	0	Q9UQD7	Silent	SNP	ENST00000442789.2	37	CCDS8929.1																																																																																			.		0.498	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379	
FREM2	341640	broad.mit.edu;bcgsc.ca	37	13	39438496	39438496	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr13:39438496A>G	ENST00000280481.7	+	16	7952	c.7736A>G	c.(7735-7737)aAg>aGg	p.K2579R		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2579					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GGAAACCACAAGTGCTCCAAC	0.438																																					p.K2579R													.	FREM2-100	0			c.A7736G						.						105.0	94.0	98.0					13																	39438496		2203	4300	6503	SO:0001583	missense	341640	exon16			ACCACAAGTGCTC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7736A>G	13.37:g.39438496A>G	ENSP00000280481:p.Lys2579Arg	Somatic	199	1		WXS	Illumina HiSeq	Phase_I	129	11	NM_207361	0	0	0	0	0	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	6.849	0.525823	0.13066	.	.	ENSG00000150893	ENST00000280481	T	0.18174	2.23	5.81	-0.748	0.11087	.	0.352897	0.31233	N	0.008018	T	0.05318	0.0141	N	0.05012	-0.13	0.34872	D	0.743695	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.42766	-0.9432	10	0.07175	T	0.84	.	6.1782	0.20455	0.6157:0.122:0.2623:0.0	.	2579;2579	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	R	2579	ENSP00000280481:K2579R	ENSP00000280481:K2579R	K	+	2	0	FREM2	38336496	1.000000	0.71417	0.985000	0.45067	0.980000	0.70556	2.923000	0.48868	-0.095000	0.12351	-0.280000	0.10049	AAG	.		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
CFL2	1073	hgsc.bcm.edu	37	14	35182529	35182529	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr14:35182529C>T	ENST00000341223.3	-	2	393	c.242G>A	c.(241-243)cGa>cAa	p.R81Q	CFL2_ENST00000555765.1_Missense_Mutation_p.R64Q|CFL2_ENST00000556161.1_Missense_Mutation_p.R64Q|CFL2_ENST00000298159.6_Missense_Mutation_p.R81Q	NM_001243645.1|NM_021914.7	NP_001230574.1|NP_068733.1	Q9Y281	COF2_HUMAN	cofilin 2 (muscle)	81	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament depolymerization (GO:0030042)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of actin filament depolymerization (GO:0030836)|regulation of dendritic spine morphogenesis (GO:0061001)|sarcomere organization (GO:0045214)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|nucleus (GO:0005634)				breast(3)|endometrium(2)|lung(3)	8	Breast(36;0.0361)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;6.07e-06)|Lung(238;2.23e-05)|Epithelial(34;0.0387)|all cancers(34;0.0814)	GBM - Glioblastoma multiforme(112;0.0424)		CAAAGCATATCGGCAATCATT	0.378																																					p.R81Q		.											.	CFL2-289	0			c.G242A						.						113.0	108.0	109.0					14																	35182529		2203	4300	6503	SO:0001583	missense	1073	exon2			GCATATCGGCAAT	AF087867	CCDS9649.1, CCDS9650.1, CCDS58311.1	14q13.2	2014-09-17			ENSG00000165410	ENSG00000165410			1875	protein-coding gene	gene with protein product	"""nemaline myopathy type 7"""	601443				8800436	Standard	NM_138638		Approved	NEM7	uc001wsh.3	Q9Y281	OTTHUMG00000029536	ENST00000341223.3:c.242G>A	14.37:g.35182529C>T	ENSP00000340635:p.Arg81Gln	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	94	5	NM_021914	0	0	7	7	0	G3V5P4	Missense_Mutation	SNP	ENST00000341223.3	37	CCDS9650.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521545	0.85600	.	.	ENSG00000165410	ENST00000341223;ENST00000298159;ENST00000555765;ENST00000556161	D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92	6.02	6.02	0.97574	Actin-binding, cofilin/tropomyosin type (3);	0.000000	0.85682	D	0.000000	D	0.95351	0.8491	H	0.96805	3.885	0.80722	D	1	D	0.71674	0.998	D	0.66847	0.947	D	0.95938	0.8944	10	0.72032	D	0.01	-0.5517	20.5407	0.99260	0.0:1.0:0.0:0.0	.	81	Q9Y281	COF2_HUMAN	Q	81;81;64;64	ENSP00000340635:R81Q;ENSP00000298159:R81Q;ENSP00000452451:R64Q;ENSP00000452188:R64Q	ENSP00000298159:R81Q	R	-	2	0	CFL2	34252280	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.747000	0.85070	2.865000	0.98341	0.655000	0.94253	CGA	.		0.378	CFL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276639.1	NM_138638	
PRC1	9055	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	91517424	91517424	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr15:91517424G>T	ENST00000361188.5	-	11	2614	c.1403C>A	c.(1402-1404)cCt>cAt	p.P468H	PRC1_ENST00000361919.3_Missense_Mutation_p.P468H|PRC1-AS1_ENST00000556200.1_RNA|PRC1_ENST00000394249.3_Missense_Mutation_p.P468H|PRC1-AS1_ENST00000554388.1_RNA|PRC1_ENST00000442656.2_Missense_Mutation_p.P427H					protein regulator of cytokinesis 1									p.P468R(1)		endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					AGGTGTTCGAGGAGCGCTGCC	0.498																																					p.P468H		.											.	PRC1-92	1	Substitution - Missense(1)	ovary(1)	c.C1403A						.						201.0	170.0	180.0					15																	91517424		2198	4298	6496	SO:0001583	missense	9055	exon11			GTTCGAGGAGCGC	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1403C>A	15.37:g.91517424G>T	ENSP00000354679:p.Pro468His	Somatic	274	0		WXS	Illumina HiSeq	Phase_I	249	21	NM_199413	0	0	22	29	7		Missense_Mutation	SNP	ENST00000361188.5	37	CCDS45352.1	.	.	.	.	.	.	.	.	.	.	G	18.91	3.723028	0.68959	.	.	ENSG00000198901	ENST00000394249;ENST00000361919;ENST00000361188;ENST00000555455;ENST00000442656	T;T;T;T	0.37752	1.18;1.18;1.18;1.18	5.37	5.37	0.77165	.	0.293466	0.39146	N	0.001451	T	0.61413	0.2345	M	0.71581	2.175	0.38985	D	0.959022	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.75484	0.976;0.976;0.976;0.986	T	0.63989	-0.6512	10	0.59425	D	0.04	-9.2179	18.9064	0.92464	0.0:0.0:1.0:0.0	.	427;468;438;468	O43663-3;F8W9B5;O43663-2;O43663	.;.;.;PRC1_HUMAN	H	468;468;468;71;427	ENSP00000377793:P468H;ENSP00000354618:P468H;ENSP00000354679:P468H;ENSP00000409549:P427H	ENSP00000354679:P468H	P	-	2	0	PRC1	89318428	1.000000	0.71417	0.781000	0.31783	0.590000	0.36582	6.445000	0.73456	2.788000	0.95919	0.650000	0.86243	CCT	.		0.498	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981	
DCUN1D3	123879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	20871250	20871250	+	Silent	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr16:20871250G>A	ENST00000324344.4	-	3	1158	c.873C>T	c.(871-873)ctC>ctT	p.L291L	DCUN1D3_ENST00000563934.1_Silent_p.L291L|ERI2_ENST00000564349.1_Intron	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	291					negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		GCCCTGAGCTGAGTGCACCTC	0.577																																					p.L291L		.											.	DCUN1D3-92	0			c.C873T						.						73.0	63.0	66.0					16																	20871250		2201	4300	6501	SO:0001819	synonymous_variant	123879	exon3			TGAGCTGAGTGCA	BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.873C>T	16.37:g.20871250G>A		Somatic	170	0		WXS	Illumina HiSeq	Phase_I	212	91	NM_173475	0	0	4	6	2	B3KVY4	Silent	SNP	ENST00000324344.4	37	CCDS10592.1																																																																																			.		0.577	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254415.2	NM_173475	
CDH8	1006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	61687954	61687954	+	Missense_Mutation	SNP	A	A	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr16:61687954A>C	ENST00000577390.1	-	12	2912	c.1958T>G	c.(1957-1959)aTt>aGt	p.I653S	CDH8_ENST00000299345.6_Missense_Mutation_p.I653S|CDH8_ENST00000577730.1_Missense_Mutation_p.I653S	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	653					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATCTTTGATAATTAATGGTTC	0.388																																					p.I653S		.											.	CDH8-161	0			c.T1958G						.						81.0	78.0	79.0					16																	61687954		2203	4300	6503	SO:0001583	missense	1006	exon12			TTGATAATTAATG	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1958T>G	16.37:g.61687954A>C	ENSP00000462701:p.Ile653Ser	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	177	54	NM_001796	0	0	0	0	0	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	ENST00000577390.1	37	CCDS10802.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.367372	0.82463	.	.	ENSG00000150394	ENST00000299345	T	0.78246	-1.16	5.7	5.7	0.88788	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.72558	0.3475	L	0.39566	1.225	0.80722	D	1	B	0.23249	0.082	B	0.29663	0.105	T	0.68573	-0.5373	10	0.38643	T	0.18	.	15.1545	0.72730	1.0:0.0:0.0:0.0	.	653	P55286	CADH8_HUMAN	S	653	ENSP00000299345:I653S	ENSP00000299345:I653S	I	-	2	0	CDH8	60245455	1.000000	0.71417	0.984000	0.44739	0.916000	0.54674	9.251000	0.95483	2.164000	0.68074	0.533000	0.62120	ATT	.		0.388	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
RPL13	6137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	89627425	89627425	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr16:89627425C>T	ENST00000393099.3	+	1	307	c.58C>T	c.(58-60)Cgg>Tgg	p.R20W	RPL13_ENST00000452368.3_Missense_Mutation_p.R20W|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000567815.1_Missense_Mutation_p.R20W|RPL13_ENST00000311528.5_Missense_Mutation_p.R20W	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	20					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GGACTGGCAGCGGCGCGTGGC	0.711																																					p.R20W		.											.	RPL13-90	0			c.C58T						.						14.0	15.0	15.0					16																	89627425		2144	4198	6342	SO:0001583	missense	6137	exon2			TGGCAGCGGCGCG	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.58C>T	16.37:g.89627425C>T	ENSP00000376811:p.Arg20Trp	Somatic	48	0		WXS	Illumina HiSeq	Phase_I	86	41	NM_001243131	1	2	298	617	316	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Missense_Mutation	SNP	ENST00000393099.3	37	CCDS10979.1	.	.	.	.	.	.	.	.	.	.	c	31	5.083913	0.94050	.	.	ENSG00000167526	ENST00000311528;ENST00000452368;ENST00000393099	T;T;T	0.32753	1.44;1.44;1.44	4.7	2.4	0.29515	.	0.117520	0.53938	U	0.000041	T	0.54679	0.1873	M	0.90705	3.14	0.48511	D	0.999666	D;D;D	0.61697	0.987;0.99;0.99	D;P;P	0.63793	0.918;0.851;0.851	T	0.60105	-0.7328	10	0.87932	D	0	-9.0218	7.8657	0.29535	0.2806:0.6293:0.0:0.0901	.	20;20;20	F5H1S2;A8K4C8;P26373	.;.;RL13_HUMAN	W	20	ENSP00000307889:R20W;ENSP00000438959:R20W;ENSP00000376811:R20W	ENSP00000307889:R20W	R	+	1	2	RPL13	88154926	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.902000	0.63266	1.107000	0.41642	0.563000	0.77884	CGG	.		0.711	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
SPAG7	9552	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	4871031	4871031	+	Silent	SNP	A	A	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr17:4871031A>C	ENST00000206020.3	-	1	136	c.69T>G	c.(67-69)acT>acG	p.T23T	SPAG7_ENST00000575142.1_Silent_p.T12T|RP5-1050D4.3_ENST00000576752.1_RNA|SPAG7_ENST00000573366.1_5'Flank|SPAG7_ENST00000571023.1_5'UTR	NM_004890.2	NP_004881.2	O75391	SPAG7_HUMAN	sperm associated antigen 7	23						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(3)|ovary(2)|urinary_tract(1)	10						CCTTGCGCCGAGTCTCCTGGT	0.627																																					p.T23T													.	SPAG7-91	0			c.T69G						.						94.0	105.0	101.0					17																	4871031		1986	4146	6132	SO:0001819	synonymous_variant	9552	exon1			GCGCCGAGTCTCC	AF047437	CCDS42240.1	17p13.2	2008-07-18				ENSG00000091640			11216	protein-coding gene	gene with protein product		610056				9653160	Standard	NM_004890		Approved	FSA-1, ACRP, MGC20134	uc002gae.3	O75391		ENST00000206020.3:c.69T>G	17.37:g.4871031A>C		Somatic	63	1		WXS	Illumina HiSeq	Phase_I	76	20	NM_004890	0	0	24	47	23	Q96EU5	Silent	SNP	ENST00000206020.3	37	CCDS42240.1																																																																																			.		0.627	SPAG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438747.1	NM_004890	
SLC52A1	55065	hgsc.bcm.edu;bcgsc.ca	37	17	4937586	4937586	+	Silent	SNP	G	G	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr17:4937586G>T	ENST00000424747.1	-	3	910	c.198C>A	c.(196-198)acC>acA	p.T66T	SLC52A1_ENST00000254853.5_Silent_p.T66T|SLC52A1_ENST00000512825.2_Silent_p.T66T	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	66					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)										GCCTCCACAGGGTCACCACCA	0.642																																					p.T66T		.											.	.	0			c.C198A						.						49.0	50.0	50.0					17																	4937586		2203	4300	6503	SO:0001819	synonymous_variant	55065	exon3			CCACAGGGTCACC	AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.198C>A	17.37:g.4937586G>T		Somatic	36	0		WXS	Illumina HiSeq	Phase_I	79	4	NM_017986	0	0	0	0	0	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	Silent	SNP	ENST00000424747.1	37	CCDS11066.1																																																																																			.		0.642	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1	NM_017986	
ITGA3	3675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48148253	48148253	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr17:48148253A>G	ENST00000320031.8	+	5	1040	c.710A>G	c.(709-711)tAt>tGt	p.Y237C	ITGA3_ENST00000544892.1_Missense_Mutation_p.Y12C|ITGA3_ENST00000007722.7_Missense_Mutation_p.Y237C	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	237					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TTATCTGAGTATAGTTACAAG	0.502																																					p.Y237C		.											.	ITGA3-229	0			c.A710G						.						206.0	211.0	209.0					17																	48148253		2203	4300	6503	SO:0001583	missense	3675	exon5			CTGAGTATAGTTA	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.710A>G	17.37:g.48148253A>G	ENSP00000315190:p.Tyr237Cys	Somatic	236	0		WXS	Illumina HiSeq	Phase_I	237	94	NM_005501	0	0	198	403	205	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	37	CCDS11558.1	.	.	.	.	.	.	.	.	.	.	A	15.96	2.986557	0.53934	.	.	ENSG00000005884	ENST00000544892;ENST00000007722;ENST00000538917;ENST00000320031	T;T;T	0.57107	0.42;0.42;0.42	5.69	3.33	0.38152	.	0.874333	0.10328	N	0.687966	T	0.52108	0.1714	L	0.54323	1.7	0.27793	N	0.942745	D;P	0.56968	0.978;0.898	P;B	0.48901	0.594;0.379	T	0.43442	-0.9391	10	0.46703	T	0.11	.	5.9462	0.19219	0.6614:0.173:0.0:0.1656	.	237;237	P26006-1;P26006	.;ITA3_HUMAN	C	12;237;223;237	ENSP00000446133:Y12C;ENSP00000007722:Y237C;ENSP00000315190:Y237C	ENSP00000007722:Y237C	Y	+	2	0	ITGA3	45503252	0.979000	0.34478	0.526000	0.27913	0.985000	0.73830	1.665000	0.37449	0.961000	0.38030	0.533000	0.62120	TAT	.		0.502	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000366298.1	NM_005501	
ABCA6	23460	broad.mit.edu;bcgsc.ca	37	17	67081770	67081770	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr17:67081770C>T	ENST00000284425.2	-	31	4199	c.4025G>A	c.(4024-4026)gGa>gAa	p.G1342E	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1342	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					CACTACCTCTCCAGCAGTTGG	0.343																																					p.G1342E													.	ABCA6-159	0			c.G4025A						.						92.0	81.0	85.0					17																	67081770		2203	4300	6503	SO:0001583	missense	23460	exon31			ACCTCTCCAGCAG	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4025G>A	17.37:g.67081770C>T	ENSP00000284425:p.Gly1342Glu	Somatic	262	1		WXS	Illumina HiSeq	Phase_I	335	15	NM_080284	0	0	0	0	0	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126830	0.56721	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	D	0.97888	-4.59	4.66	4.66	0.58398	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.49305	D	0.000142	D	0.99378	0.9781	H	0.99404	4.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98055	1.0390	10	0.87932	D	0	.	17.0615	0.86548	0.0:1.0:0.0:0.0	.	1342	Q8N139	ABCA6_HUMAN	E	1342;202	ENSP00000284425:G1342E	ENSP00000284425:G1342E	G	-	2	0	ABCA6	64593365	1.000000	0.71417	0.999000	0.59377	0.085000	0.17905	6.669000	0.74462	2.576000	0.86940	0.650000	0.86243	GGA	.		0.343	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
ASXL3	80816	broad.mit.edu;ucsc.edu	37	18	31224902	31224902	+	Missense_Mutation	SNP	A	A	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr18:31224902A>G	ENST00000269197.5	+	3	182	c.182A>G	c.(181-183)aAc>aGc	p.N61S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	61					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CTTCACACTAACACTCGAATA	0.393																																					p.N61S													.	ASXL3-49	0			c.A182G						.						101.0	89.0	93.0					18																	31224902		1862	4111	5973	SO:0001583	missense	80816	exon3			ACACTAACACTCG	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.182A>G	18.37:g.31224902A>G	ENSP00000269197:p.Asn61Ser	Somatic	81	1		WXS	Illumina HiSeq	Phase_I	47	5	NM_030632	0	0	0	0	0	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	A	18.75	3.689578	0.68271	.	.	ENSG00000141431	ENST00000269197	T	0.20738	2.05	5.57	4.41	0.53225	.	.	.	.	.	T	0.21550	0.0519	M	0.62723	1.935	0.34860	D	0.742502	B	0.32653	0.379	B	0.23716	0.048	T	0.28004	-1.0057	9	0.87932	D	0	.	11.4354	0.50064	0.9295:0.0:0.0705:0.0	.	61	Q9C0F0	ASXL3_HUMAN	S	61	ENSP00000269197:N61S	ENSP00000269197:N61S	N	+	2	0	ASXL3	29478900	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.017000	0.64047	1.063000	0.40649	0.533000	0.62120	AAC	.		0.393	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
TCEB3B	51224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	44560193	44560193	+	Silent	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr18:44560193G>A	ENST00000332567.4	-	1	1795	c.1443C>T	c.(1441-1443)gaC>gaT	p.D481D	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	481					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						AGGTCATGGAGTCAGAATCCG	0.582																																					p.D481D		.											.	TCEB3B-156	0			c.C1443T						.						60.0	66.0	64.0					18																	44560193		2203	4300	6503	SO:0001819	synonymous_variant	51224	exon1			CATGGAGTCAGAA	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1443C>T	18.37:g.44560193G>A		Somatic	197	0		WXS	Illumina HiSeq	Phase_I	153	63	NM_016427	0	0	0	0	0	Q9P2V9	Silent	SNP	ENST00000332567.4	37	CCDS11932.1																																																																																			.		0.582	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
ZNF799	90576	ucsc.edu	37	19	12501560	12501560	+	Missense_Mutation	SNP	T	T	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr19:12501560T>C	ENST00000430385.3	-	4	1852	c.1652A>G	c.(1651-1653)gAa>gGa	p.E551G	CTD-3105H18.14_ENST00000435033.1_Intron|ZNF799_ENST00000419318.1_Missense_Mutation_p.E519G	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						GTGAATTCTTTCATGTCGTAG	0.393																																					p.E551G													.	ZNF799-74	0			c.A1652G						.						93.0	96.0	95.0					19																	12501560		2202	4300	6502	SO:0001583	missense	90576	exon4			ATTCTTTCATGTC	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1652A>G	19.37:g.12501560T>C	ENSP00000411084:p.Glu551Gly	Somatic	171	3		WXS	Illumina HiSeq		201	1	NM_001080821	0	0	6	10	4		Missense_Mutation	SNP	ENST00000430385.3	37	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.811876	0.32053	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.18657	2.2;2.2	1.53	-0.919	0.10478	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20414	0.0491	M	0.62209	1.925	0.09310	N	1	B	0.17852	0.024	B	0.29353	0.101	T	0.40720	-0.9548	9	0.62326	D	0.03	.	3.0258	0.06090	0.2117:0.1463:0.0:0.642	.	551	Q96GE5	ZN799_HUMAN	G	519;551	ENSP00000415278:E519G;ENSP00000411084:E551G	ENSP00000415278:E519G	E	-	2	0	ZNF799	12362560	0.000000	0.05858	0.005000	0.12908	0.094000	0.18550	-1.204000	0.03017	-0.358000	0.08162	0.352000	0.21897	GAA	.		0.393	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2	NM_001080821	
ZNF709	163051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	12574997	12574997	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr19:12574997C>T	ENST00000397732.3	-	4	1910	c.1739G>A	c.(1738-1740)aGg>aAg	p.R580K	ZNF709_ENST00000428311.1_Missense_Mutation_p.R580K|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	580					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						AGTGTGAGTCCTTTCATGCAT	0.423																																					p.R580K	GBM(33;565 669 12371 29134 51667)	.											.	ZNF709-90	0			c.G1739A						.						139.0	147.0	144.0					19																	12574997		2202	4300	6502	SO:0001583	missense	163051	exon4			TGAGTCCTTTCAT	AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.1739G>A	19.37:g.12574997C>T	ENSP00000380840:p.Arg580Lys	Somatic	176	0		WXS	Illumina HiSeq	Phase_I	199	57	NM_152601	0	0	0	0	0	A8K4E6	Missense_Mutation	SNP	ENST00000397732.3	37	CCDS42504.1	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656147	0.67586	.	.	ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000428311	T;T	0.18338	2.22;2.22	2.89	1.85	0.25348	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17577	0.0422	L	0.45581	1.43	0.22127	N	0.99935	B	0.27498	0.18	B	0.33121	0.158	T	0.24190	-1.0167	9	0.48119	T	0.1	.	9.5077	0.39058	0.0:0.8844:0.0:0.1156	.	580	Q8N972	ZN709_HUMAN	K	580	ENSP00000380840:R580K;ENSP00000404127:R580K	ENSP00000404127:R580K	R	-	2	0	ZNF709;CTD-2192J16.17	12435997	0.000000	0.05858	0.050000	0.19076	0.605000	0.37080	-0.136000	0.10405	0.797000	0.33971	0.655000	0.94253	AGG	.		0.423	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344088.1	NM_152601	
CILP2	148113	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19654855	19654855	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr19:19654855G>A	ENST00000291495.5	+	8	1586	c.1501G>A	c.(1501-1503)Ggc>Agc	p.G501S	CILP2_ENST00000586018.1_Missense_Mutation_p.G507S	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	501						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						GGAGCCCATCGGCTTCACCGC	0.672																																					p.G501S													.	CILP2-91	0			c.G1501A						.						27.0	30.0	29.0					19																	19654855		2203	4300	6503	SO:0001583	missense	148113	exon8			CCCATCGGCTTCA	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1501G>A	19.37:g.19654855G>A	ENSP00000291495:p.Gly501Ser	Somatic	76	1		WXS	Illumina HiSeq	Phase_I	86	32	NM_153221	0	0	0	0	0	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.549039	0.27652	.	.	ENSG00000160161	ENST00000291495	T	0.45276	0.9	3.76	3.76	0.43208	Carbohydrate-binding-like fold (1);	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	L	0.35793	1.09	0.58432	D	0.999992	P;P	0.52692	0.955;0.955	B;B	0.41619	0.361;0.252	T	0.05886	-1.0858	10	0.15952	T	0.53	-24.9444	13.1257	0.59354	0.0:0.0:1.0:0.0	.	501;501	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	S	501	ENSP00000291495:G501S	ENSP00000291495:G501S	G	+	1	0	CILP2	19515855	1.000000	0.71417	0.926000	0.36857	0.540000	0.34992	4.647000	0.61418	1.657000	0.50732	0.423000	0.28283	GGC	.		0.672	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
FPR3	2359	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	52327625	52327625	+	Silent	SNP	T	T	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr19:52327625T>A	ENST00000339223.4	+	2	803	c.624T>A	c.(622-624)atT>atA	p.I208I	FPR3_ENST00000595991.1_Silent_p.I208I	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	208					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)			NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						ACTTCATTATTGGCTTCAGCG	0.458																																					p.I208I		.											.	FPR3-501	0			c.T624A						.						146.0	118.0	128.0					19																	52327625		2203	4300	6503	SO:0001819	synonymous_variant	2359	exon2			CATTATTGGCTTC		CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.624T>A	19.37:g.52327625T>A		Somatic	242	0		WXS	Illumina HiSeq	Phase_I	155	67	NM_002030	0	0	0	0	0		Silent	SNP	ENST00000339223.4	37	CCDS12841.1																																																																																			.		0.458	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466914.1	NM_002030	
LRRTM4	80059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	77746638	77746638	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr2:77746638G>T	ENST00000409093.1	-	3	693	c.357C>A	c.(355-357)aaC>aaA	p.N119K	LRRTM4_ENST00000409884.1_Missense_Mutation_p.N119K|LRRTM4_ENST00000409088.3_Missense_Mutation_p.N119K|LRRTM4_ENST00000409282.1_Missense_Mutation_p.N120K|LRRTM4_ENST00000409911.1_Missense_Mutation_p.N120K			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	119					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		AAGTAATTTTGTTGGAGCTTA	0.373																																					p.N119K		.											.	LRRTM4-94	0			c.C357A						.						158.0	140.0	145.0					2																	77746638		1842	4084	5926	SO:0001583	missense	80059	exon3			AATTTTGTTGGAG	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.357C>A	2.37:g.77746638G>T	ENSP00000386357:p.Asn119Lys	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	100	27	NM_024993	0	0	0	0	0	Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	ENST00000409093.1	37	CCDS46346.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526251	0.44969	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69	5.96	4.91	0.64330	.	0.044427	0.85682	D	0.000000	D	0.87873	0.6287	H	0.96489	3.83	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.89990	0.4107	10	0.87932	D	0	.	11.0841	0.48076	0.1556:0.0:0.8444:0.0	.	120;119;119	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	K	120;119;119;119;120	ENSP00000387228:N120K;ENSP00000387297:N119K;ENSP00000386357:N119K;ENSP00000386236:N119K;ENSP00000386286:N120K	ENSP00000386236:N119K	N	-	3	2	LRRTM4	77600146	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.981000	0.49329	2.826000	0.97356	0.655000	0.94253	AAC	.		0.373	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328225.1	NM_024993	
MAP3K19	80122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	135738691	135738691	+	Missense_Mutation	SNP	C	C	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr2:135738691C>G	ENST00000375845.3	-	9	3650	c.3620G>C	c.(3619-3621)tGt>tCt	p.C1207S	MAP3K19_ENST00000392917.3_Missense_Mutation_p.C339S|MAP3K19_ENST00000358371.4_Missense_Mutation_p.C1094S|MAP3K19_ENST00000392918.3_Missense_Mutation_p.C341S|MAP3K19_ENST00000375844.3_Missense_Mutation_p.C389S|MAP3K19_ENST00000392915.1_3'UTR|MAP3K19_ENST00000315513.3_Missense_Mutation_p.C68S	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	1207	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										ACGCCTGGCACAGCCAAAGTC	0.458																																					p.C1207S		.											.	.	0			c.G3620C						.						113.0	112.0	112.0					2																	135738691		2203	4300	6503	SO:0001583	missense	80122	exon9			CTGGCACAGCCAA	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.3620G>C	2.37:g.135738691C>G	ENSP00000365005:p.Cys1207Ser	Somatic	66	0		WXS	Illumina HiSeq	Phase_I	80	24	NM_025052	0	0	0	0	0	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167028	0.78339	.	.	ENSG00000176601	ENST00000375845;ENST00000358371;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000437365;ENST00000315513	T;T;T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95;1.95;1.95	5.88	5.88	0.94601	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.50627	D	0.000113	T	0.27384	0.0672	N	0.05031	-0.125	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.998;0.999;0.999;0.999;1.0	T	0.31613	-0.9937	10	0.25106	T	0.35	.	19.2304	0.93836	0.0:1.0:0.0:0.0	.	339;1094;341;389;1207	B7ZMH9;Q56UN5-3;Q56UN5-4;Q56UN5-5;Q56UN5	.;.;.;.;YSK4_HUMAN	S	1207;1094;389;341;339;597;68	ENSP00000365005:C1207S;ENSP00000351140:C1094S;ENSP00000365004:C389S;ENSP00000376650:C341S;ENSP00000376649:C339S;ENSP00000392827:C597S;ENSP00000321160:C68S	ENSP00000321160:C68S	C	-	2	0	YSK4	135455161	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.616000	0.83018	2.782000	0.95742	0.655000	0.94253	TGT	.		0.458	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
KIAA1755	85449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	36870194	36870194	+	Silent	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr20:36870194C>T	ENST00000279024.4	-	3	610	c.339G>A	c.(337-339)gaG>gaA	p.E113E		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	113										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CAGACTGCTCCTCCTGGGGCT	0.557																																					p.E113E		.											.	KIAA1755-95	0			c.G339A						.						92.0	90.0	90.0					20																	36870194		2203	4300	6503	SO:0001819	synonymous_variant	85449	exon3			CTGCTCCTCCTGG	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.339G>A	20.37:g.36870194C>T		Somatic	129	0		WXS	Illumina HiSeq	Phase_I	184	36	NM_001029864	0	0	1	1	0	Q9C0A8	Silent	SNP	ENST00000279024.4	37	CCDS33467.1																																																																																			.		0.557	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
RBM11	54033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	15599303	15599303	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr21:15599303G>T	ENST00000400577.3	+	5	544	c.535G>T	c.(535-537)Gat>Tat	p.D179Y	RBM11_ENST00000468643.1_3'UTR	NM_144770.3	NP_658983.3	P57052	RBM11_HUMAN	RNA binding motif protein 11	179					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(U) RNA binding (GO:0008266)|protein homodimerization activity (GO:0042803)			endometrium(3)|kidney(3)|lung(7)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		TCATGTTCCAGATCTTGAGGC	0.458																																					p.D179Y		.											.	.	0			c.G535T						.						199.0	186.0	190.0					21																	15599303		1928	4131	6059	SO:0001583	missense	54033	exon5			GTTCCAGATCTTG	AF130358	CCDS46635.1	21q11	2013-02-12			ENSG00000185272	ENSG00000185272		"""RNA binding motif (RRM) containing"""	9897	protein-coding gene	gene with protein product						12036298	Standard	NM_144770		Approved		uc002yjo.4	P57052	OTTHUMG00000074263	ENST00000400577.3:c.535G>T	21.37:g.15599303G>T	ENSP00000383421:p.Asp179Tyr	Somatic	371	1		WXS	Illumina HiSeq	Phase_I	364	149	NM_144770	0	0	9	11	2	Q6YNC2|Q8NBA1|Q8NFF6	Missense_Mutation	SNP	ENST00000400577.3	37	CCDS46635.1	.	.	.	.	.	.	.	.	.	.	G	8.231	0.804684	0.16467	.	.	ENSG00000185272	ENST00000400577	T	0.08546	3.08	2.74	1.85	0.25348	.	0.523863	0.19918	N	0.103153	T	0.08758	0.0217	L	0.51422	1.61	0.09310	N	1	P	0.40144	0.704	B	0.41571	0.36	T	0.16689	-1.0394	10	0.62326	D	0.03	-7.9775	4.814	0.13358	0.2974:0.0:0.7026:0.0	.	179	P57052	RBM11_HUMAN	Y	179	ENSP00000383421:D179Y	ENSP00000383421:D179Y	D	+	1	0	RBM11	14521174	0.201000	0.23410	0.002000	0.10522	0.803000	0.45373	0.649000	0.24843	0.712000	0.32039	0.430000	0.28490	GAT	.		0.458	RBM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157818.1	NM_144770	
SEPT5	5413	ucsc.edu	37	22	19710008	19710008	+	3'UTR	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr22:19710008C>T	ENST00000455784.2	+	0	1236				GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000406395.1_3'UTR|SEPT5_ENST00000383045.3_3'UTR|SEPT5_ENST00000438754.2_3'UTR	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5						cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					GGACCAGTGACGCTCGCCGCG	0.706																																					.													.	.	0			.						.						29.0	29.0	29.0					22																	19710008		2181	4281	6462	SO:0001624	3_prime_UTR_variant	0	.			CAGTGACGCTCGC	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.*1C>T	22.37:g.19710008C>T		Somatic	45	0		WXS	Illumina HiSeq		48	4	.	0	0	4	4	0	O15251|Q96MY5	RNA	SNP	ENST00000455784.2	37	CCDS13764.1																																																																																			.		0.706	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
ATXN7	6314	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	63981359	63981359	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr3:63981359C>T	ENST00000295900.6	+	12	2411	c.1861C>T	c.(1861-1863)Cat>Tat	p.H621Y	ATXN7_ENST00000398590.3_Missense_Mutation_p.H621Y|ATXN7_ENST00000484332.1_Missense_Mutation_p.H476Y|ATXN7_ENST00000487717.1_Missense_Mutation_p.H621Y|ATXN7_ENST00000538065.1_Missense_Mutation_p.H621Y	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	621					cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		GGTACCAGCTCATGGAACCAC	0.527																																					p.H621Y													.	ATXN7-90	0			c.C1861T						.						171.0	176.0	175.0					3																	63981359		2194	4281	6475	SO:0001583	missense	6314	exon12			CCAGCTCATGGAA	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.1861C>T	3.37:g.63981359C>T	ENSP00000295900:p.His621Tyr	Somatic	343	1		WXS	Illumina HiSeq	Phase_I	373	107	NM_000333	0	0	5	7	2	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	37	CCDS43102.1	.	.	.	.	.	.	.	.	.	.	C	17.12	3.309327	0.60414	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.13778	2.56;2.56;2.56;2.56;2.57	5.16	4.27	0.50696	.	0.168276	0.52532	D	0.000062	T	0.25606	0.0623	L	0.35723	1.085	0.41667	D	0.98921	D;B;B	0.69078	0.997;0.018;0.01	D;B;B	0.75484	0.986;0.011;0.005	T	0.02184	-1.1199	10	0.21540	T	0.41	-8.2112	14.9298	0.70906	0.1444:0.8556:0.0:0.0	.	476;621;621	E9PHP9;O15265-2;O15265	.;.;ATX7_HUMAN	Y	621;621;621;621;476	ENSP00000381590:H621Y;ENSP00000295900:H621Y;ENSP00000420234:H621Y;ENSP00000439585:H621Y;ENSP00000428277:H476Y	ENSP00000295900:H621Y	H	+	1	0	ATXN7	63956399	1.000000	0.71417	0.982000	0.44146	0.990000	0.78478	5.146000	0.64845	1.155000	0.42497	0.650000	0.86243	CAT	.		0.527	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1	NM_000333	
TRIO	7204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	14497115	14497115	+	Missense_Mutation	SNP	G	G	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr5:14497115G>C	ENST00000344204.4	+	50	8032	c.8008G>C	c.(8008-8010)Gta>Cta	p.V2670L	TRIO_ENST00000344135.5_Missense_Mutation_p.V169L|TRIO_ENST00000537187.1_Missense_Mutation_p.V2494L	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2670					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CAGCAACAAGGTATCTGTGAA	0.498																																					p.V2670L		.											.	TRIO-562	0			c.G8008C						.						122.0	103.0	109.0					5																	14497115		2203	4300	6503	SO:0001583	missense	7204	exon50			AACAAGGTATCTG	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8008G>C	5.37:g.14497115G>C	ENSP00000339299:p.Val2670Leu	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	154	43	NM_007118	0	0	0	0	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	37	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	31	5.094039	0.94149	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000344135	T;T;T	0.68025	-0.3;-0.21;-0.26	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.77253	0.4103	L	0.52759	1.655	0.32172	N	0.581488	D	0.67145	0.996	D	0.67900	0.954	T	0.81075	-0.1097	10	0.59425	D	0.04	.	17.1098	0.86672	0.0:0.0:1.0:0.0	.	2670	O75962	TRIO_HUMAN	L	2670;2494;2357;169	ENSP00000339299:V2670L;ENSP00000446348:V2494L;ENSP00000339291:V169L	ENSP00000339291:V169L	V	+	1	0	TRIO	14550115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.441000	0.97557	2.461000	0.83175	0.655000	0.94253	GTA	.		0.498	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
RICTOR	253260	broad.mit.edu	37	5	38947463	38947463	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr5:38947463G>A	ENST00000357387.3	-	32	4247	c.4217C>T	c.(4216-4218)tCt>tTt	p.S1406F	RICTOR_ENST00000296782.5_Missense_Mutation_p.S1430F	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CACTGAGGAAGATCGTTGCAG	0.388																																					p.S1406F													.	RICTOR-849	0			c.C4217T						.						132.0	120.0	124.0					5																	38947463		2203	4300	6503	SO:0001583	missense	253260	exon32			GAGGAAGATCGTT		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4217C>T	5.37:g.38947463G>A	ENSP00000349959:p.Ser1406Phe	Somatic	247	0		WXS	Illumina HiSeq	Phase_I	257	6	NM_152756	0	0	4	4	0		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751872	0.89753	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.56275	0.76;0.47	5.69	5.69	0.88448	.	0.095984	0.64402	D	0.000001	T	0.62060	0.2397	L	0.43152	1.355	0.58432	D	0.999994	D;D	0.54207	0.965;0.965	P;P	0.54312	0.748;0.748	T	0.63866	-0.6540	10	0.87932	D	0	-7.8353	19.8165	0.96571	0.0:0.0:1.0:0.0	.	1406;1430	Q6R327;Q6R327-3	RICTR_HUMAN;.	F	1406;1430	ENSP00000349959:S1406F;ENSP00000296782:S1430F	ENSP00000296782:S1430F	S	-	2	0	RICTOR	38983220	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.139000	0.77314	2.683000	0.91414	0.655000	0.94253	TCT	.		0.388	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
HCP5	10866	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	31431638	31431638	+	RNA	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr6:31431638C>T	ENST00000414046.2	+	0	710					NR_040662.1		Q6MZN7	HCP5_HUMAN	HLA complex P5 (non-protein coding)						defense response (GO:0006952)					urinary_tract(1)	1						tccctgggttccacacgaact	0.567																																					.													.	HCP5-68	0			.						.						77.0	84.0	82.0					6																	31431638		2203	4300	6503			10866	.			TGGGTTCCACACG	D88650		6p21.3	2012-10-16	2011-08-02		ENSG00000206337	ENSG00000206337		"""Long non-coding RNAs"""	21659	non-coding RNA	RNA, long non-coding		604676	"""HLA complex P5"""			8462994, 10199916	Standard	NR_040662		Approved	D6S2650E, P5-1	uc003ntl.3	Q6MZN7	OTTHUMG00000031282		6.37:g.31431638C>T		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	63	28	.	0	0	8	8	0	Q04490	RNA	SNP	ENST00000414046.2	37																																																																																				.		0.567	HCP5-001	KNOWN	basic	sense_overlapping	sense_overlapping	OTTHUMT00000076614.4	NR_040662	
TNXB	7148	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	32037362	32037362	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr6:32037362C>T	ENST00000375244.3	-	15	5756	c.5555G>A	c.(5554-5556)cGt>cAt	p.R1852H	TNXB_ENST00000375247.2_Missense_Mutation_p.R1852H			P22105	TENX_HUMAN	tenascin XB	1934					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGGGCCCACACGCTTGCCGTG	0.672																																					p.R1852H		.											.	TNXB-90	0			c.G5555A						.						27.0	34.0	32.0					6																	32037362		2155	4268	6423	SO:0001583	missense	7148	exon15			CCCACACGCTTGC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5555G>A	6.37:g.32037362C>T	ENSP00000364393:p.Arg1852His	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	127	8	NM_019105	0	0	3	3	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	C	19.43	3.825390	0.71143	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.05025	3.51;3.51	5.5	4.44	0.53790	.	0.000000	0.46758	D	0.000265	T	0.22205	0.0535	M	0.93594	3.435	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.09530	-1.0670	10	0.66056	D	0.02	.	12.1698	0.54152	0.0:0.9037:0.0:0.0963	.	1852	P22105-3	.	H	1852	ENSP00000364393:R1852H;ENSP00000364396:R1852H	ENSP00000364393:R1852H	R	-	2	0	TNXB	32145340	0.757000	0.28394	0.251000	0.24312	0.105000	0.19272	2.166000	0.42406	2.598000	0.87819	0.591000	0.81541	CGT	.		0.672	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
EYA4	2070	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	133849920	133849920	+	Missense_Mutation	SNP	G	G	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr6:133849920G>T	ENST00000367895.5	+	20	2361	c.1897G>T	c.(1897-1899)Gca>Tca	p.A633S	EYA4_ENST00000525849.1_Missense_Mutation_p.A610S|EYA4_ENST00000431403.2_Missense_Mutation_p.A633S|EYA4_ENST00000430974.2_Intron|EYA4_ENST00000452339.2_Missense_Mutation_p.A579S|EYA4_ENST00000355167.3_Missense_Mutation_p.A633S|EYA4_ENST00000355286.6_Missense_Mutation_p.A610S|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000531901.1_Missense_Mutation_p.A639S	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	633					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TCTCCACCAAGCACTGGAATT	0.453																																					p.A633S	Melanoma(57;398 1237 3528 4702 7415)	.											.	EYA4-578	0			c.G1897T						.						260.0	238.0	245.0					6																	133849920		2203	4300	6503	SO:0001583	missense	2070	exon20			CACCAAGCACTGG	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1897G>T	6.37:g.133849920G>T	ENSP00000356870:p.Ala633Ser	Somatic	277	0		WXS	Illumina HiSeq	Phase_I	291	15	NM_172105	0	0	3	3	0	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	ENST00000367895.5	37	CCDS5165.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636157	0.87760	.	.	ENSG00000112319	ENST00000452339;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	D;D;D;D;D;D;D	0.93247	-3.19;-3.19;-3.19;-3.19;-3.19;-3.19;-3.19	6.07	6.07	0.98685	EYA (1);	0.000000	0.85682	D	0.000000	D	0.97021	0.9027	M	0.83483	2.645	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999	D;D;D;D;D	0.91635	0.999;0.996;0.996;0.999;0.998	D	0.96683	0.9505	10	0.87932	D	0	-22.8527	20.6593	0.99626	0.0:0.0:1.0:0.0	.	639;579;610;633;633	F2Z2Y1;E7EN58;O95677-2;O95677-4;O95677	.;.;.;.;EYA4_HUMAN	S	579;633;633;610;639;610;633	ENSP00000395916:A579S;ENSP00000356870:A633S;ENSP00000347294:A633S;ENSP00000347434:A610S;ENSP00000432770:A639S;ENSP00000433219:A610S;ENSP00000404558:A633S	ENSP00000347294:A633S	A	+	1	0	EYA4	133891613	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.837000	0.99465	2.885000	0.99019	0.655000	0.94253	GCA	.		0.453	EYA4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000042282.2	NM_004100	
PMS2P3	5387	broad.mit.edu;bcgsc.ca	37	7	75145521	75145521	+	RNA	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr7:75145521G>A	ENST00000418756.1	-	0	643					NR_028059.1		Q13401	PM2P3_HUMAN	postmeiotic segregation increased 2 pseudogene 3						mismatch repair (GO:0006298)|regulation of transcription, DNA-templated (GO:0006355)	mismatch repair complex (GO:0032300)	nucleic acid binding (GO:0003676)			lung(1)	1						GAAATCCACAGCCACATCTTT	0.473																																					.	NSCLC(70;602 1339 5301 18528 38453)												.	PMS2P3-131	0			.						.						19.0	19.0	19.0					7																	75145521		2111	4125	6236			5387	.			TCCACAGCCACAT	D38437		7q11.23	2010-10-26	2010-10-26	2010-10-26	ENSG00000127957	ENSG00000127957			9128	pseudogene	pseudogene			"""postmeiotic segregation increased 2-like 3"", ""postmeiotic segregation increased 2-like 3, pseudogene"""	PMS2L9, PMS2L3		8586419	Standard	NR_028059		Approved	PMS5, PMSR3	uc022agi.1	Q13401	OTTHUMG00000156049		7.37:g.75145521G>A		Somatic	501	0		WXS	Illumina HiSeq	Phase_I	603	216	.	0	0	32	33	1	A6NG70|Q3MJ29	RNA	SNP	ENST00000418756.1	37																																																																																				.		0.473	PMS2P3-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000342862.2	NR_028059	
CCDC132	55610	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	92932815	92932815	+	Missense_Mutation	SNP	T	T	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr7:92932815T>G	ENST00000305866.5	+	17	1533	c.1405T>G	c.(1405-1407)Tgg>Ggg	p.W469G	CCDC132_ENST00000535481.1_Missense_Mutation_p.W189G|CCDC132_ENST00000544910.1_Missense_Mutation_p.W439G|CCDC132_ENST00000541136.1_Missense_Mutation_p.W280G|CCDC132_ENST00000317751.6_Missense_Mutation_p.W200G	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	469						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			GAATGAGACTTGGGAACTTTG	0.348																																					p.W469G		.											.	CCDC132-90	0			c.T1405G						.						141.0	135.0	137.0					7																	92932815		1823	4079	5902	SO:0001583	missense	55610	exon17			GAGACTTGGGAAC	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1405T>G	7.37:g.92932815T>G	ENSP00000307666:p.Trp469Gly	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	42	16	NM_017667	0	0	6	8	2	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Missense_Mutation	SNP	ENST00000305866.5	37	CCDS43617.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084073	0.76642	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751	T	0.73681	-0.77	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.86033	0.5836	M	0.80982	2.52	0.80722	D	1	D;D;D	0.57899	0.967;0.981;0.967	D;D;D	0.70487	0.932;0.969;0.932	D	0.88196	0.2880	10	0.87932	D	0	-0.9767	15.0541	0.71897	0.0:0.0:0.0:1.0	.	189;439;469	B4DS55;F5H5U7;Q96JG6	.;.;CC132_HUMAN	G	469;439;280;189;200	ENSP00000325582:W200G	ENSP00000307666:W469G	W	+	1	0	CCDC132	92770751	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	7.794000	0.85869	2.200000	0.70718	0.460000	0.39030	TGG	.		0.348	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341687.1	NM_017667	
FLNC	2318	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	128482660	128482660	+	Missense_Mutation	SNP	G	G	A	rs369935650		TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr7:128482660G>A	ENST00000325888.8	+	15	2558	c.2297G>A	c.(2296-2298)cGg>cAg	p.R766Q	FLNC_ENST00000346177.6_Missense_Mutation_p.R766Q	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	766					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CACCCCGAGCGGGTAAAGGTG	0.692											OREG0018297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R766Q													.	FLNC-141	0			c.G2297A						.	G	GLN/ARG,GLN/ARG	0,3844		0,0,1922	20.0	26.0	24.0		2297,2297	3.4	1.0	7		24	1,7821		0,1,3910	no	missense,missense	FLNC	NM_001127487.1,NM_001458.4	43,43	0,1,5832	AA,AG,GG		0.0128,0.0,0.0086	possibly-damaging,possibly-damaging	766/2693,766/2726	128482660	1,11665	1922	3911	5833	SO:0001583	missense	2318	exon15			CCGAGCGGGTAAA	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2297G>A	7.37:g.128482660G>A	ENSP00000327145:p.Arg766Gln	Somatic	112	1	1565	WXS	Illumina HiSeq	Phase_I	144	16	NM_001127487	0	0	0	0	0	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	g	19.02	3.744937	0.69418	0.0	1.28E-4	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85484	-1.99;-1.99	5.52	3.39	0.38822	Immunoglobulin E-set (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.385179	0.24571	N	0.037392	T	0.76990	0.4065	L	0.38175	1.15	0.33779	D	0.624033	B;P	0.35107	0.434;0.484	B;B	0.36666	0.135;0.23	T	0.81247	-0.1019	10	0.72032	D	0.01	.	6.4307	0.21794	0.3702:0.0:0.6298:0.0	.	766;766	Q14315-2;Q14315	.;FLNC_HUMAN	Q	766	ENSP00000327145:R766Q;ENSP00000344002:R766Q	ENSP00000327145:R766Q	R	+	2	0	FLNC	128269896	0.027000	0.19231	0.996000	0.52242	0.479000	0.33129	2.236000	0.43052	1.349000	0.45751	0.645000	0.84053	CGG	.		0.692	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
KIF13B	23303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	29037680	29037680	+	Nonsense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr8:29037680G>A	ENST00000524189.1	-	8	699	c.661C>T	c.(661-663)Cga>Tga	p.R221*	KIF13B_ENST00000521515.1_Nonsense_Mutation_p.R221*	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	221	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GCATGGGATCGGCTACTCTCC	0.438																																					p.R221X		.											.	KIF13B-22	0			c.C661T						.						192.0	192.0	192.0					8																	29037680		1932	4134	6066	SO:0001587	stop_gained	23303	exon8			GGGATCGGCTACT	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.661C>T	8.37:g.29037680G>A	ENSP00000427900:p.Arg221*	Somatic	319	0		WXS	Illumina HiSeq	Phase_I	380	150	NM_015254	0	0	3	3	0	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Nonsense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	G	35	5.587513	0.96590	.	.	ENSG00000197892	ENST00000524189;ENST00000521515	.	.	.	4.77	2.84	0.33178	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.45	0.61165	0.0:0.0:0.7156:0.2844	.	.	.	.	X	221	.	ENSP00000429201:R221X	R	-	1	2	KIF13B	29093599	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	1.457000	0.35212	1.203000	0.43233	0.563000	0.77884	CGA	.		0.438	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
WWP1	11059	broad.mit.edu;bcgsc.ca	37	8	87443954	87443954	+	Missense_Mutation	SNP	G	G	A	rs554041348		TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr8:87443954G>A	ENST00000517970.1	+	14	1890	c.1583G>A	c.(1582-1584)cGc>cAc	p.R528H	WWP1_ENST00000349423.2_Missense_Mutation_p.R310H|WWP1_ENST00000341922.2_Missense_Mutation_p.R398H|WWP1_ENST00000265428.4_Missense_Mutation_p.R528H	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	528	WW 4. {ECO:0000255|PROSITE- ProRule:PRU00224}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						AAAGATCCTCGCAATGGGAAG	0.388													G|||	1	0.000199681	0.0	0.0	5008	,	,		18477	0.0		0.0	False		,,,				2504	0.001				p.R528H													.	WWP1-659	0			c.G1583A						.						91.0	90.0	90.0					8																	87443954		2203	4300	6503	SO:0001583	missense	11059	exon14			ATCCTCGCAATGG	AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1583G>A	8.37:g.87443954G>A	ENSP00000427793:p.Arg528His	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	149	6	NM_007013	0	0	26	28	2	O00307|Q5YLC1|Q96BP4	Missense_Mutation	SNP	ENST00000517970.1	37	CCDS6242.1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986456	0.93044	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	T;T;T;T	0.61980	0.06;0.06;0.14;0.19	5.35	5.35	0.76521	WW/Rsp5/WWP (4);	0.302657	0.33272	N	0.005098	D	0.85592	0.5732	H	0.97732	4.065	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.60236	0.871;0.747	D	0.90859	0.4737	10	0.72032	D	0.01	.	19.0481	0.93030	0.0:0.0:1.0:0.0	.	310;528	Q9H0M0-6;Q9H0M0	.;WWP1_HUMAN	H	528;528;398;310	ENSP00000427793:R528H;ENSP00000265428:R528H;ENSP00000340564:R398H;ENSP00000342665:R310H	ENSP00000265428:R528H	R	+	2	0	WWP1	87513070	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.744000	0.98853	2.498000	0.84270	0.563000	0.77884	CGC	.		0.388	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374755.1	NM_007013	
PHF20L1	51105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133829702	133829702	+	Missense_Mutation	SNP	T	T	G			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr8:133829702T>G	ENST00000395386.2	+	12	1790	c.1491T>G	c.(1489-1491)tgT>tgG	p.C497W	PHF20L1_ENST00000395390.2_Missense_Mutation_p.C472W|PHF20L1_ENST00000220847.7_5'UTR	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	497							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GTAATGAATGTCCCAGGGCAG	0.478																																					p.C497W		.											.	PHF20L1-92	0			c.T1491G						.						74.0	67.0	70.0					8																	133829702		2203	4300	6503	SO:0001583	missense	51105	exon12			TGAATGTCCCAGG	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.1491T>G	8.37:g.133829702T>G	ENSP00000378784:p.Cys497Trp	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	74	9	NM_016018	0	0	8	9	1	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964653	0.53507	.	.	ENSG00000129292	ENST00000395383;ENST00000361997;ENST00000395386;ENST00000315808;ENST00000395382;ENST00000395390	T;T;T;T;T	0.52057	0.73;0.68;1.42;0.7;1.43	5.27	3.01	0.34805	.	.	.	.	.	T	0.36524	0.0970	L	0.29908	0.895	0.80722	D	1	B;P;P	0.41569	0.32;0.602;0.755	B;B;B	0.43950	0.134;0.283;0.437	T	0.05451	-1.0884	9	0.38643	T	0.18	-0.054	6.933	0.24451	0.0:0.4761:0.0:0.5239	.	472;497;497	F8W9L8;A8MW92;A8MW92-4	.;P20L1_HUMAN;.	W	501;472;497;497;367;472	ENSP00000378781:C501W;ENSP00000355301:C472W;ENSP00000378784:C497W;ENSP00000324519:C497W;ENSP00000378788:C472W	ENSP00000324519:C497W	C	+	3	2	PHF20L1	133898884	0.394000	0.25246	0.875000	0.34327	0.928000	0.56348	1.393000	0.34497	0.385000	0.24970	0.477000	0.44152	TGT	.		0.478	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308949.3	NM_016018	
SPATA31D1	389763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	84608041	84608041	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr9:84608041G>A	ENST00000344803.2	+	4	2703	c.2656G>A	c.(2656-2658)Gtt>Att	p.V886I		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	886					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGACCACTGCGTTGATACTTC	0.438																																					p.V886I		.											.	.	0			c.G2656A						.						100.0	85.0	90.0					9																	84608041		1867	4118	5985	SO:0001583	missense	389763	exon4			CACTGCGTTGATA		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2656G>A	9.37:g.84608041G>A	ENSP00000341988:p.Val886Ile	Somatic	290	0		WXS	Illumina HiSeq	Phase_I	201	96	NM_001001670	0	0	0	0	0		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	6.075	0.382087	0.11524	.	.	ENSG00000214929	ENST00000344803	T	0.49432	0.78	2.92	-1.61	0.08399	.	1.757670	0.03395	N	0.202455	T	0.37237	0.0996	L	0.50333	1.59	0.09310	N	1	B	0.15141	0.012	B	0.10450	0.005	T	0.06144	-1.0843	10	0.23302	T	0.38	0.4107	2.1957	0.03910	0.1774:0.3151:0.3841:0.1234	.	886	Q6ZQQ2	F75D1_HUMAN	I	886	ENSP00000341988:V886I	ENSP00000341988:V886I	V	+	1	0	FAM75D1	83797861	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.475000	0.00987	-0.318000	0.08665	-0.171000	0.13296	GTT	.		0.438	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402325.1	NM_001001670	
DIRAS2	54769	ucsc.edu;bcgsc.ca	37	9	93375537	93375537	+	Silent	SNP	C	C	T	rs201919906		TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr9:93375537C>T	ENST00000375765.3	-	2	961	c.573G>A	c.(571-573)aaG>aaA	p.K191K		NM_017594.3	NP_060064.2	Q96HU8	DIRA2_HUMAN	DIRAS family, GTP-binding RAS-like 2	191					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			kidney(1)|large_intestine(6)|lung(3)|skin(2)	12						TGCCTTTGAGCTTCTCTTTCC	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		22124	0.001		0.0	False		,,,				2504	0.0				p.K191K													.	DIRAS2-659	0			c.G573A						.						192.0	171.0	178.0					9																	93375537		2203	4300	6503	SO:0001819	synonymous_variant	54769	exon2			TTTGAGCTTCTCT	AB076889	CCDS6687.1	9q22.32	2014-05-09			ENSG00000165023	ENSG00000165023			19323	protein-coding gene	gene with protein product		607863				12194967	Standard	NM_017594		Approved	Di-Ras2, DKFZp761C07121	uc004aqx.1	Q96HU8	OTTHUMG00000020196	ENST00000375765.3:c.573G>A	9.37:g.93375537C>T		Somatic	405	3		WXS	Illumina HiSeq		295	115	NM_017594	0	0	0	0	0	B3KVM2	Silent	SNP	ENST00000375765.3	37	CCDS6687.1																																																																																			C|0.999;T|0.000		0.567	DIRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053012.1		
GRIPAP1	56850	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	48840222	48840222	+	Missense_Mutation	SNP	C	C	T			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chrX:48840222C>T	ENST00000376441.1	-	15	1271	c.1237G>A	c.(1237-1239)Gag>Aag	p.E413K	GRIPAP1_ENST00000376444.3_Missense_Mutation_p.E368K|GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.E360K|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.E382K	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	413						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GTCAACTGCTCCTTCTCCTGC	0.507																																					p.E413K		.											.	GRIPAP1-227	0			c.G1237A						.						268.0	196.0	221.0					X																	48840222		2203	4300	6503	SO:0001583	missense	56850	exon15			ACTGCTCCTTCTC	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1237G>A	X.37:g.48840222C>T	ENSP00000365624:p.Glu413Lys	Somatic	232	0		WXS	Illumina HiSeq	Phase_I	245	17	NM_020137	0	0	27	27	0	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	37	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	-	17.86	3.491722	0.64074	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	4.34	4.34	0.51931	.	0.072191	0.53938	D	0.000057	T	0.40670	0.1126	L	0.50333	1.59	0.40778	D	0.983142	D;D;P	0.65815	0.995;0.982;0.873	P;P;B	0.59487	0.858;0.831;0.385	T	0.30909	-0.9962	10	0.46703	T	0.11	-19.9581	15.2526	0.73559	0.0:1.0:0.0:0.0	.	360;303;413	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	K	382;368;413;382;360	ENSP00000365608:E382K;ENSP00000365627:E368K;ENSP00000365624:E413K;ENSP00000365606:E360K	ENSP00000365606:E360K	E	-	1	0	GRIPAP1	48725166	1.000000	0.71417	0.996000	0.52242	0.011000	0.07611	5.495000	0.66912	1.925000	0.55765	0.522000	0.50473	GAG	.		0.507	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
PCDH11X	27328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	91133625	91133625	+	Missense_Mutation	SNP	C	C	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chrX:91133625C>A	ENST00000373094.1	+	2	3231	c.2386C>A	c.(2386-2388)Cca>Aca	p.P796T	PCDH11X_ENST00000406881.1_Missense_Mutation_p.P796T|PCDH11X_ENST00000504220.2_Missense_Mutation_p.P796T|PCDH11X_ENST00000373088.1_Missense_Mutation_p.P796T|PCDH11X_ENST00000361655.2_Missense_Mutation_p.P796T|PCDH11X_ENST00000298274.8_Missense_Mutation_p.P796T|PCDH11X_ENST00000373097.1_Missense_Mutation_p.P796T|PCDH11X_ENST00000361724.1_Missense_Mutation_p.P796T|PCDH11X_ENST00000395337.2_Missense_Mutation_p.P796T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	796					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ACCAGTGACCCCAAATACTGA	0.438																																					p.P796T	NSCLC(38;925 1092 2571 38200 45895)	.											.	PCDH11X-193	0			c.C2386A						.						145.0	118.0	127.0					X																	91133625		2203	4300	6503	SO:0001583	missense	27328	exon2			GTGACCCCAAATA	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.2386C>A	X.37:g.91133625C>A	ENSP00000362186:p.Pro796Thr	Somatic	691	1		WXS	Illumina HiSeq	Phase_I	497	213	NM_001168363	0	0	0	0	0	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.399277	0.00198	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.15	2.3	0.28687	Protocadherin (1);	0.414782	0.27245	N	0.020252	T	0.25382	0.0617	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B;B;B;B	0.22909	0.077;0.017;0.035;0.035;0.035;0.044;0.077;0.032	B;B;B;B;B;B;B;B	0.25987	0.062;0.026;0.039;0.039;0.039;0.065;0.062;0.062	T	0.14559	-1.0468	10	0.22109	T	0.4	.	15.2794	0.73770	0.0:0.4515:0.5485:0.0	.	796;796;796;796;796;796;796;796	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	T	796	ENSP00000378746:P796T;ENSP00000362186:P796T;ENSP00000362189:P796T;ENSP00000355040:P796T;ENSP00000362180:P796T;ENSP00000423762:P796T;ENSP00000355105:P796T;ENSP00000384758:P796T;ENSP00000298274:P796T	ENSP00000298274:P796T	P	+	1	0	PCDH11X	91020281	0.999000	0.42202	0.001000	0.08648	0.003000	0.03518	1.394000	0.34509	0.053000	0.16036	-0.226000	0.12346	CCA	.		0.438	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
LAMP2	3920	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	119581842	119581842	+	Missense_Mutation	SNP	G	G	A			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chrX:119581842G>A	ENST00000200639.4	-	5	731	c.595C>T	c.(595-597)Ccc>Tcc	p.P199S	LAMP2_ENST00000434600.2_Missense_Mutation_p.P199S|LAMP2_ENST00000538785.1_Missense_Mutation_p.P88S|LAMP2_ENST00000371335.4_Missense_Mutation_p.P199S|LAMP2_ENST00000540603.1_Missense_Mutation_p.P152S			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	199	Hinge.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						TGTATGGTGGGTGCCACTGTT	0.408																																					p.P199S		.											.	LAMP2-131	0			c.C595T						.						229.0	204.0	212.0					X																	119581842		2203	4300	6503	SO:0001583	missense	3920	exon5			TGGTGGGTGCCAC	X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.595C>T	X.37:g.119581842G>A	ENSP00000200639:p.Pro199Ser	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	125	9	NM_013995	0	0	100	100	0	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Missense_Mutation	SNP	ENST00000200639.4	37	CCDS14599.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623881	0.46840	.	.	ENSG00000005893	ENST00000434600;ENST00000538785;ENST00000200639;ENST00000371335;ENST00000540603	T;T;T;T;T	0.66995	-0.15;0.23;-0.24;-0.13;-0.13	5.98	3.11	0.35812	.	0.053375	0.85682	D	0.000000	T	0.81823	0.4904	M	0.88704	2.975	0.19775	N	0.99996	D;D;D;D;D	0.76494	0.997;0.995;0.996;0.999;0.995	D;D;D;D;D	0.73708	0.965;0.965;0.941;0.981;0.965	T	0.72802	-0.4183	10	0.72032	D	0.01	-7.1395	10.4302	0.44403	0.0:0.1116:0.5665:0.3219	.	152;88;199;199;199	B4E2S7;B7Z2R9;P13473-2;P13473;Q6Q3G8	.;.;.;LAMP2_HUMAN;.	S	199;88;199;199;152	ENSP00000408411:P199S;ENSP00000440506:P88S;ENSP00000200639:P199S;ENSP00000360386:P199S;ENSP00000440479:P152S	ENSP00000200639:P199S	P	-	1	0	LAMP2	119465870	0.975000	0.34042	0.079000	0.20413	0.014000	0.08584	1.620000	0.36976	1.244000	0.43870	0.600000	0.82982	CCC	.		0.408	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058099.1		
ATP1B1	481	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	169094224	169094232	+	In_Frame_Del	DEL	AAAAGTACA	AAAAGTACA	-			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	AAAAGTACA	AAAAGTACA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr1:169094224_169094232delAAAAGTACA	ENST00000367816.1	+	4	858_866	c.329_337delAAAAGTACA	c.(328-339)gaaaagtacaaa>gaa	p.KYK111del	ATP1B1_ENST00000499679.3_In_Frame_Del_p.KYK55del|ATP1B1_ENST00000367815.4_In_Frame_Del_p.KYK111del|ATP1B1_ENST00000367813.3_In_Frame_Del_p.KYK103del			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	111					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					AGGTTCCTGGAAAAGTACAAAGATTCAGC	0.392																																					p.110_113del		.											.	ATP1B1-540	0			c.329_337del						.																																			SO:0001651	inframe_deletion	481	exon3			.	U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.329_337delAAAAGTACA	1.37:g.169094224_169094232delAAAAGTACA	ENSP00000356790:p.Lys111_Lys113del	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	133	29	NM_001677	0	0	0	0	0	Q5TGZ3	In_Frame_Del	DEL	ENST00000367816.1	37	CCDS1276.1																																																																																			.		0.392	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083696.1		
RBM45	129831	broad.mit.edu	37	2	178988920	178988920	+	Frame_Shift_Del	DEL	A	A	-			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr2:178988920delA	ENST00000286070.5	+	8	1227	c.1135delA	c.(1135-1137)aaafs	p.K381fs		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	383					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A382fs*7(2)|p.?(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TCCATCATGCAAAAAAAAAGC	0.353																																					p.K379fs													.	RBM45-22	3	Deletion - Frameshift(2)|Unknown(1)	large_intestine(2)|skin(1)	c.1135delA						.			3,107,4156		0,0,3,40,27,2063	69.0	75.0	73.0			4.7	1.0	2		75	6,163,8085		0,0,6,55,53,4013	no	codingComplex	RBM45	NM_152945.2		0,0,9,95,80,6076	A1A1,A1A2,A1R,A2A2,A2R,RR		2.0475,2.5785,2.2284			178988920	9,270,12241	2203	4300	6503	SO:0001589	frameshift_variant	129831	exon8			TCATGCAAAAAAA	AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.1135delA	2.37:g.178988920delA	ENSP00000286070:p.Lys381fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	134	8	NM_152945	0	0	0	0	0	Q6NYL0|Q8NFC9	Frame_Shift_Del	DEL	ENST00000286070.5	37	CCDS33335.1																																																																																			.		0.353	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	NM_152945	
ATP2A1	487	hgsc.bcm.edu;bcgsc.ca	37	16	28913639	28913640	+	Frame_Shift_Ins	INS	-	-	C			TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr16:28913639_28913640insC	ENST00000357084.3	+	17	2723_2724	c.2456_2457insC	c.(2455-2460)cgccccfs	p.RP819fs	ATP2A1_ENST00000536376.1_Frame_Shift_Ins_p.RP694fs|ATP2A1_ENST00000395503.4_Frame_Shift_Ins_p.RP819fs	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	819					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						ATCATGGACCGCCCCCCCCGGA	0.658																																					p.R819fs		.											.	ATP2A1-93	0			c.2456_2457insC						.																																			SO:0001589	frameshift_variant	487	exon17			.		CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2464dupC	16.37:g.28913647_28913647dupC	ENSP00000349595:p.Arg819fs	Somatic	113	0		WXS	Illumina HiSeq	Phase_I	116	32	NM_004320	0	0	0	0	0	A8K5J9|B3KY17|O14984	Frame_Shift_Ins	INS	ENST00000357084.3	37	CCDS10643.1																																																																																			.		0.658	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254686.2	NM_004320	
CSMD1	64478	broad.mit.edu	37	8	2808726	2808727	+	Frame_Shift_Ins	INS	-	-	G	rs374654290		TCGA-F9-A4JJ-01A-11D-A25F-10	TCGA-F9-A4JJ-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0e4d764c-5196-4566-ae92-e291608bcd73	05c628cd-15ec-47b2-851d-fdcd131c5172	g.chr8:2808726_2808727insG	ENST00000520002.1	-	67	10668_10669	c.10113_10114insC	c.(10111-10116)cccgccfs	p.A3372fs	CSMD1_ENST00000400186.3_Frame_Shift_Ins_p.A3195fs|CSMD1_ENST00000542608.1_Frame_Shift_Ins_p.A3194fs|CSMD1_ENST00000537824.1_Frame_Shift_Ins_p.A3371fs|CSMD1_ENST00000602557.1_Frame_Shift_Ins_p.A3372fs|CSMD1_ENST00000602723.1_Frame_Shift_Ins_p.A3195fs			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3372						integral component of membrane (GO:0016021)		p.P3370P(1)|p.P3099P(1)		breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GTTAGAGTGGCGGGTTGTCTTT	0.485																																					p.A3371fs													.	CSMD1-86	2	Substitution - coding silent(2)	prostate(2)	c.10111_10112insC						.																																			SO:0001589	frameshift_variant	64478	exon66			GAGTGGCGGGTTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.10114dupC	8.37:g.2808729_2808729dupG	ENSP00000430733:p.Ala3372fs	Somatic	155	0		WXS	Illumina HiSeq	Phase_I	151	9	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Frame_Shift_Ins	INS	ENST00000520002.1	37																																																																																				.		0.485	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
