#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SNIP1	79753	ucsc.edu	37	1	38019775	38019775	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:38019775C>A	ENST00000296215.6	-	1	128	c.56G>T	c.(55-57)gGg>gTg	p.G19V	SNIP1_ENST00000468040.1_Intron|DNALI1_ENST00000541606.1_5'Flank|DNALI1_ENST00000296218.7_5'Flank	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	19					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				CACCACGTCCCCGTCCCGGTG	0.652																																					p.G19V													.	SNIP1-227	0			c.G56T						.						38.0	35.0	36.0					1																	38019775		2202	4295	6497	SO:0001583	missense	79753	exon1			ACGTCCCCGTCCC		CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.56G>T	1.37:g.38019775C>A	ENSP00000296215:p.Gly19Val	Somatic	84	0		WXS	Illumina HiSeq		55	5	NM_024700	0	0	0	0	0	Q96SP9|Q9H9T7	Missense_Mutation	SNP	ENST00000296215.6	37	CCDS419.1	.	.	.	.	.	.	.	.	.	.	C	9.945	1.218512	0.22373	.	.	ENSG00000163877	ENST00000296215	T	0.14640	2.49	5.68	-2.41	0.06562	.	0.458709	0.21366	N	0.075702	T	0.07234	0.0183	N	0.19112	0.55	0.46678	D	0.999157	P	0.36065	0.535	B	0.37346	0.247	T	0.27191	-1.0081	10	0.46703	T	0.11	-0.0057	6.0189	0.19618	0.1232:0.4174:0.0:0.4595	.	19	Q8TAD8	SNIP1_HUMAN	V	19	ENSP00000296215:G19V	ENSP00000296215:G19V	G	-	2	0	SNIP1	37792362	0.013000	0.17824	0.325000	0.25375	0.001000	0.01503	-0.950000	0.03889	-0.332000	0.08489	-1.093000	0.02169	GGG	.		0.652	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012169.2	NM_024700	
ZNF684	127396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	41012446	41012446	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:41012446A>G	ENST00000372699.3	+	5	702	c.451A>G	c.(451-453)Aga>Gga	p.R151G	ZNF684_ENST00000493756.1_3'UTR	NM_152373.3	NP_689586.3	Q5T5D7	ZN684_HUMAN	zinc finger protein 684	151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(2)|lung(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			TAAATATAATAGAAGTTATAC	0.299																																					p.R151G		.											.	ZNF684-90	0			c.A451G						.						35.0	39.0	38.0					1																	41012446		2197	4296	6493	SO:0001583	missense	127396	exon5			TATAATAGAAGTT		CCDS454.1	1p34.2	2013-01-08			ENSG00000117010	ENSG00000117010		"""Zinc fingers, C2H2-type"", ""-"""	28418	protein-coding gene	gene with protein product	"""hypothetical protein MGC27466"""					12477932	Standard	NM_152373		Approved	MGC27466	uc001cft.2	Q5T5D7	OTTHUMG00000007359	ENST00000372699.3:c.451A>G	1.37:g.41012446A>G	ENSP00000361784:p.Arg151Gly	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	50	35	NM_152373	0	0	0	0	0	Q2NKY4	Missense_Mutation	SNP	ENST00000372699.3	37	CCDS454.1	.	.	.	.	.	.	.	.	.	.	A	1.875	-0.459201	0.04508	.	.	ENSG00000117010	ENST00000372699	T	0.05717	3.4	3.87	0.211	0.15236	.	0.866547	0.09619	N	0.777770	T	0.06234	0.0161	L	0.41492	1.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37337	-0.9710	10	0.66056	D	0.02	.	7.0072	0.24844	0.6969:0.0:0.3031:0.0	.	151	Q5T5D7	ZN684_HUMAN	G	151	ENSP00000361784:R151G	ENSP00000361784:R151G	R	+	1	2	ZNF684	40785033	0.004000	0.15560	0.000000	0.03702	0.007000	0.05969	0.763000	0.26517	-0.060000	0.13132	-0.326000	0.08463	AGA	.		0.299	ZNF684-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019260.3	NM_152373	
FPGT-TNNI3K	100526835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	74905226	74905226	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:74905226T>G	ENST00000370899.3	+	22	2271	c.2234T>G	c.(2233-2235)aTc>aGc	p.I745S	TNNI3K_ENST00000326637.3_Missense_Mutation_p.I644S|TNNI3K_ENST00000370891.2_Missense_Mutation_p.I745S|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.I758S	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		CGGTACACCATCAAAGCAGAT	0.478																																					p.I745S		.											.	.	0			c.T2234G						.						164.0	136.0	145.0					1																	74905226		2203	4300	6503	SO:0001583	missense	100526835	exon22			ACACCATCAAAGC			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.2234T>G	1.37:g.74905226T>G	ENSP00000359936:p.Ile745Ser	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	70	26	NM_001199327	0	0	2	2	0		Missense_Mutation	SNP	ENST00000370899.3	37		.	.	.	.	.	.	.	.	.	.	T	10.84	1.464750	0.26335	.	.	ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000557284;ENST00000370891;ENST00000326637	D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.056318	0.64402	D	0.000001	T	0.41328	0.1154	N	0.03983	-0.305	0.42989	D	0.994482	B;P;B	0.37276	0.183;0.589;0.372	B;B;B	0.32677	0.131;0.15;0.114	T	0.58451	-0.7634	10	0.08837	T	0.75	.	16.0467	0.80725	0.0:0.0:0.0:1.0	.	644;745;745	Q59H18;Q59H18-1;Q59H18-4	TNI3K_HUMAN;.;.	S	745;745;745;644	ENSP00000359936:I745S;ENSP00000450895:I745S;ENSP00000359928:I745S;ENSP00000322251:I644S	ENSP00000322251:I644S	I	+	2	0	RP11-653A5.2;AC093158.1	74677814	1.000000	0.71417	1.000000	0.80357	0.760000	0.43138	5.774000	0.68906	2.197000	0.70478	0.454000	0.30748	ATC	.		0.478	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	protein_coding	OTTHUMT00000026438.3		
GBP7	388646	hgsc.bcm.edu	37	1	89598981	89598981	+	Missense_Mutation	SNP	T	T	A	rs369457817		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:89598981T>A	ENST00000294671.2	-	10	1760	c.1622A>T	c.(1621-1623)tAt>tTt	p.Y541F		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	541						membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		TTCTCTCATATAGTTTTCCCT	0.438																																					p.Y541F		.											.	GBP7-92	0			c.A1622T						.						311.0	277.0	289.0					1																	89598981		2202	4300	6502	SO:0001583	missense	388646	exon10			CTCATATAGTTTT	AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.1622A>T	1.37:g.89598981T>A	ENSP00000294671:p.Tyr541Phe	Somatic	152	1		WXS	Illumina HiSeq	Phase_I	117	7	NM_207398	0	0	0	0	0		Missense_Mutation	SNP	ENST00000294671.2	37	CCDS720.1	.	.	.	.	.	.	.	.	.	.	T	5.441	0.266483	0.10294	.	.	ENSG00000213512	ENST00000294671	T	0.52526	0.66	3.49	0.919	0.19392	Guanylate-binding protein, C-terminal (3);	2.126890	0.02428	N	0.083298	T	0.06826	0.0174	N	0.01352	-0.895	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.13045	-1.0524	10	0.45353	T	0.12	.	3.8536	0.08965	0.5682:0.2068:0.0:0.225	.	541	Q8N8V2	GBP7_HUMAN	F	541	ENSP00000294671:Y541F	ENSP00000294671:Y541F	Y	-	2	0	GBP7	89371569	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.009000	0.12765	0.053000	0.16036	-1.223000	0.01593	TAT	.		0.438	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029401.1	NM_207398	
AMPD1	270	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	115218255	115218255	+	Silent	SNP	G	G	C			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:115218255G>C	ENST00000520113.2	-	12	1689	c.1674C>G	c.(1672-1674)tcC>tcG	p.S558S	AMPD1_ENST00000353928.6_Silent_p.S525S|AMPD1_ENST00000369538.3_Silent_p.S554S			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	558					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TGGGACTCTTGGAGGAGAACA	0.468																																					p.S558S													.	AMPD1-293	0			c.C1674G						.						189.0	179.0	183.0					1																	115218255		2203	4300	6503	SO:0001819	synonymous_variant	270	exon12			ACTCTTGGAGGAG	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1674C>G	1.37:g.115218255G>C		Somatic	173	0		WXS	Illumina HiSeq	Phase_I	150	44	NM_000036	0	0	0	0	0	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	ENST00000520113.2	37	CCDS876.2																																																																																			.		0.468	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
TDRD5	163589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	179609042	179609042	+	Missense_Mutation	SNP	A	A	C			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:179609042A>C	ENST00000367614.1	+	10	1948	c.1589A>C	c.(1588-1590)cAt>cCt	p.H530P	TDRD5_ENST00000294848.8_Missense_Mutation_p.H530P|TDRD5_ENST00000444136.1_Missense_Mutation_p.H530P	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	530	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CAGCCGGGACATCTCTGTTGT	0.418																																					p.H530P		.											.	TDRD5-94	0			c.A1589C						.						206.0	197.0	200.0					1																	179609042		2203	4300	6503	SO:0001583	missense	163589	exon10			CGGGACATCTCTG	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1589A>C	1.37:g.179609042A>C	ENSP00000356586:p.His530Pro	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	325	51	NM_173533	0	0	0	0	0	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.562855	0.65538	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.08984	3.03;3.03;3.03	5.33	4.19	0.49359	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.062123	0.64402	D	0.000003	T	0.16727	0.0402	L	0.32530	0.975	0.35819	D	0.824489	D;D	0.76494	0.999;0.999	D;D	0.73380	0.977;0.98	T	0.09122	-1.0689	10	0.54805	T	0.06	-11.2483	10.2602	0.43423	0.9209:0.0:0.0791:0.0	.	530;530	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	P	530	ENSP00000356586:H530P;ENSP00000294848:H530P;ENSP00000406052:H530P	ENSP00000294848:H530P	H	+	2	0	TDRD5	177875665	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.266000	0.51569	0.854000	0.35336	0.533000	0.62120	CAT	.		0.418	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
C11orf70	85016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	101937281	101937281	+	Missense_Mutation	SNP	C	C	G			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr11:101937281C>G	ENST00000434758.2	+	4	362	c.334C>G	c.(334-336)Cat>Gat	p.H112D	C11orf70_ENST00000534360.1_Intron|C11orf70_ENST00000526781.1_Missense_Mutation_p.H112D	NM_032930.2	NP_116319.2	Q9BRQ4	CK070_HUMAN	chromosome 11 open reading frame 70	112										breast(1)|kidney(1)|lung(5)|ovary(1)|prostate(2)|skin(2)	12	all_epithelial(12;0.0137)	Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.0137)	Lung(13;0.245)	BRCA - Breast invasive adenocarcinoma(274;0.0335)		GTCATTTTTTCATCGGTTATA	0.303																																					p.H112D		.											.	C11orf70-91	0			c.C334G						.						107.0	101.0	103.0					11																	101937281		2200	4294	6494	SO:0001583	missense	85016	exon4			TTTTTTCATCGGT	AK094851	CCDS8313.1, CCDS8313.2, CCDS53698.1	11q22.1	2012-05-31			ENSG00000137691	ENSG00000137691			28188	protein-coding gene	gene with protein product							Standard	NM_032930		Approved	MGC13040	uc001pgp.3	Q9BRQ4	OTTHUMG00000167320	ENST00000434758.2:c.334C>G	11.37:g.101937281C>G	ENSP00000414390:p.His112Asp	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	66	37	NM_032930	0	0	2	13	11	E9PJU1	Missense_Mutation	SNP	ENST00000434758.2	37	CCDS8313.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.099|0.099	-1.155573|-1.155573	0.01686|0.01686	.|.	.|.	ENSG00000137691|ENSG00000137691	ENST00000529204|ENST00000434758;ENST00000526781;ENST00000423732	.|.	.|.	.|.	5.53|5.53	-5.51|-5.51	0.02568|0.02568	.|.	.|0.382417	.|0.32769	.|N	.|0.005664	T|T	0.04998|0.04998	0.0134|0.0134	N|N	0.00032|0.00032	-2.585|-2.585	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.46261|0.46261	-0.9204|-0.9204	6|9	0.87932|0.02654	D|T	0|1	-3.2945|-3.2945	9.2395|9.2395	0.37486|0.37486	0.1423:0.5247:0.3329:0.0|0.1423:0.5247:0.3329:0.0	.|.	.|112	.|Q9BRQ4	.|CK070_HUMAN	L|D	3|112;112;74	.|.	ENSP00000432322:F3L|ENSP00000392150:H74D	F|H	+|+	3|1	2|0	C11orf70|C11orf70	101442491|101442491	1.000000|1.000000	0.71417|0.71417	0.222000|0.222000	0.23844|0.23844	0.555000|0.555000	0.35460|0.35460	0.684000|0.684000	0.25364|0.25364	-0.778000|-0.778000	0.04566|0.04566	-0.474000|-0.474000	0.04947|0.04947	TTC|CAT	.		0.303	C11orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394144.1	NM_032930	
GYS2	2998	broad.mit.edu	37	12	21728873	21728873	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr12:21728873C>T	ENST00000261195.2	-	3	676	c.422G>A	c.(421-423)gGc>gAc	p.G141D		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	141					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ATAAGGAATGCCGACACTGCA	0.418																																					p.G141D	Colon(149;9 1820 3690 10544 50424)												.	GYS2-523	0			c.G422A						.						145.0	132.0	136.0					12																	21728873		2203	4300	6503	SO:0001583	missense	2998	exon3			GGAATGCCGACAC		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.422G>A	12.37:g.21728873C>T	ENSP00000261195:p.Gly141Asp	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	152	5	NM_021957	0	0	0	0	0	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	37	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589443	0.86851	.	.	ENSG00000111713	ENST00000261195	T	0.68479	-0.33	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	L	0.37507	1.11	0.80722	D	1	P	0.51933	0.949	P	0.55545	0.778	T	0.64558	-0.6379	10	0.25106	T	0.35	-20.376	18.9212	0.92526	0.0:1.0:0.0:0.0	.	141	P54840	GYS2_HUMAN	D	141	ENSP00000261195:G141D	ENSP00000261195:G141D	G	-	2	0	GYS2	21620140	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	7.194000	0.77789	2.781000	0.95711	0.650000	0.86243	GGC	.		0.418	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
FAR2	55711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	29485566	29485566	+	Silent	SNP	T	T	C			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr12:29485566T>C	ENST00000536681.3	+	11	1537	c.1291T>C	c.(1291-1293)Ttg>Ctg	p.L431L	FAR2_ENST00000182377.4_Silent_p.L431L|FAR2_ENST00000547116.1_Silent_p.L334L	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	431					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						GTTGAACTGGTTGGAATACAT	0.398																																					p.L431L		.											.	FAR2-90	0			c.T1291C						.						92.0	89.0	90.0					12																	29485566		2203	4300	6503	SO:0001819	synonymous_variant	55711	exon11			AACTGGTTGGAAT	AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.1291T>C	12.37:g.29485566T>C		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	102	45	NM_018099	0	0	8	9	1	F8VV73|Q9H0D5|Q9NVW8	Silent	SNP	ENST00000536681.3	37	CCDS8717.1																																																																																			.		0.398	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403479.2	NM_018099	
TRHDE	29953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	72680574	72680574	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr12:72680574A>G	ENST00000261180.4	+	2	989	c.893A>G	c.(892-894)tAt>tGt	p.Y298C		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	298					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						CAAGCAACCTATTTATCTTTA	0.408																																					p.Y298C		.											.	TRHDE-93	0			c.A893G						.						170.0	160.0	164.0					12																	72680574		2203	4300	6503	SO:0001583	missense	29953	exon2			CAACCTATTTATC	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.893A>G	12.37:g.72680574A>G	ENSP00000261180:p.Tyr298Cys	Somatic	155	1		WXS	Illumina HiSeq	Phase_I	274	103	NM_013381	0	0	13	20	7	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	37	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	A	19.45	3.830477	0.71258	.	.	ENSG00000072657	ENST00000261180	T	0.05025	3.51	5.93	5.93	0.95920	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.32224	0.0822	M	0.88450	2.955	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.17048	-1.0382	10	0.72032	D	0.01	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	298	Q9UKU6	TRHDE_HUMAN	C	298	ENSP00000261180:Y298C	ENSP00000261180:Y298C	Y	+	2	0	TRHDE	70966841	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.327000	0.79147	2.281000	0.76405	0.533000	0.62120	TAT	.		0.408	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
LRRIQ1	84125	bcgsc.ca	37	12	85441091	85441091	+	Missense_Mutation	SNP	G	G	T			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr12:85441091G>T	ENST00000393217.2	+	6	582	c.521G>T	c.(520-522)tGg>tTg	p.W174L		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	174	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TTTGAGGCTTGGCAAGAGAAA	0.343																																					p.W174L													.	LRRIQ1-95	0			c.G521T						.						76.0	84.0	81.0					12																	85441091		2203	4300	6503	SO:0001583	missense	84125	exon6			AGGCTTGGCAAGA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.521G>T	12.37:g.85441091G>T	ENSP00000376910:p.Trp174Leu	Somatic	120	1		WXS	Illumina HiSeq	Phase_1	204	13	NM_001079910	0	0	0	0	0	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.5|21.5	4.162023|4.162023	0.78226|0.78226	.|.	.|.	ENSG00000133640|ENSG00000133640	ENST00000533414|ENST00000256007;ENST00000378580;ENST00000393217	.|D	.|0.84589	.|-1.87	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	.|0.234668	.|0.36200	.|N	.|0.002733	D|D	0.91085|0.91085	0.7194|0.7194	M|M	0.62723|0.62723	1.935|1.935	0.37344|0.37344	D|D	0.910531|0.910531	.|D;D;D	.|0.89917	.|1.0;0.998;1.0	.|D;D;D	.|0.91635	.|0.999;0.991;0.998	D|D	0.93375|0.93375	0.6738|0.6738	5|10	.|0.87932	.|D	.|0	.|.	16.2441|16.2441	0.82431|0.82431	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|174;174;174	.|Q96JM4-2;Q96JM4;C9JI57	.|.;LRIQ1_HUMAN;.	C|L	72|174	.|ENSP00000376910:W174L	.|ENSP00000256007:W174L	G|W	+|+	1|2	0|0	LRRIQ1|LRRIQ1	83965222|83965222	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.805000|3.805000	0.55575|0.55575	2.359000|2.359000	0.80004|0.80004	0.585000|0.585000	0.79938|0.79938	GGC|TGG	.		0.343	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
OR11G2	390439	broad.mit.edu	37	14	20666485	20666485	+	Missense_Mutation	SNP	A	A	G			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr14:20666485A>G	ENST00000357366.3	+	1	991	c.991A>G	c.(991-993)Agg>Ggg	p.R331G		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	331						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		atatagtCTTAGGAACAAAGA	0.373																																					p.R331G													.	OR11G2-70	0			c.A991G						.						93.0	99.0	97.0					14																	20666485		2203	4300	6503	SO:0001583	missense	390439	exon1			AGTCTTAGGAACA		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.991A>G	14.37:g.20666485A>G	ENSP00000349930:p.Arg331Gly	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	157	5	NM_001005503	0	0	0	0	0	Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	CCDS32032.1	.	.	.	.	.	.	.	.	.	.	a	16.59	3.166574	0.57476	.	.	ENSG00000196832	ENST00000357366	T	0.40476	1.03	4.94	4.94	0.65067	.	0.000000	0.51477	D	0.000085	T	0.76800	0.4038	H	0.99042	4.41	0.25750	N	0.985068	D	0.69078	0.997	D	0.65773	0.938	T	0.77099	-0.2713	10	0.87932	D	0	.	13.7206	0.62725	1.0:0.0:0.0:0.0	.	331	Q8NGC1	O11G2_HUMAN	G	331	ENSP00000349930:R331G	ENSP00000349930:R331G	R	+	1	2	OR11G2	19736325	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	5.215000	0.65241	2.077000	0.62373	0.533000	0.62120	AGG	.		0.373	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1		
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	324	52		WXS	Illumina HiSeq		535	83	NM_145301	0	0	2	97	95	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	78355391	78355391	+	Silent	SNP	C	C	G			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr17:78355391C>G	ENST00000582970.1	+	57	13985	c.13842C>G	c.(13840-13842)ggC>ggG	p.G4614G	RNF213_ENST00000336301.6_Silent_p.G2687G|CTD-2047H16.4_ENST00000575034.1_RNA|CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Silent_p.G4663G|CTD-2047H16.4_ENST00000573394.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4614					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATCCAAAAGGCTTTCTGCAGC	0.562																																					p.G4614G		.											.	RNF213-577	0			c.C13842G						.						109.0	94.0	99.0					17																	78355391		2203	4300	6503	SO:0001819	synonymous_variant	57674	exon57			AAAAGGCTTTCTG	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.13842C>G	17.37:g.78355391C>G		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	182	99	NM_001256071	0	0	20	41	21	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	ENST00000582970.1	37	CCDS58606.1																																																																																			.		0.562	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RPRD1A	55197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	33606995	33606995	+	Silent	SNP	C	C	T	rs202026701		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr18:33606995C>T	ENST00000399022.4	-	6	828	c.657G>A	c.(655-657)gcG>gcA	p.A219A	RPRD1A_ENST00000588737.1_Silent_p.A183A|RPRD1A_ENST00000590898.1_Silent_p.A183A|RPRD1A_ENST00000357384.4_Silent_p.A219A|RPRD1A_ENST00000337059.5_Silent_p.A183A|RPRD1A_ENST00000319040.6_Silent_p.A219A	NM_018170.3	NP_060640.2	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing 1A	219					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)		p.A219A(1)		NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(2)	12						GCAACATACACGCATCCTCTA	0.373																																					p.A219A		.											.	RPRD1A-154	1	Substitution - coding silent(1)	lung(1)	c.G657A						.	C		0,4406		0,0,2203	90.0	85.0	87.0		657	-5.7	1.0	18		87	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	RPRD1A	NM_018170.3		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		219/313	33606995	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	55197	exon6			CATACACGCATCC	AF419845	CCDS11917.1	18q12.2	2012-02-09	2008-08-15		ENSG00000141425	ENSG00000141425			25560	protein-coding gene	gene with protein product	"""cyclin-dependent kinase 2B-inhibitor-related protein"", ""Cyclin-dependent kinase inhibitor 2B-related protein (p15INK4B-related protein)"""	610347				12470661, 22231121	Standard	NM_018170		Approved	P15RS, FLJ10656, HsT3101	uc002kzg.3	Q96P16	OTTHUMG00000132591	ENST00000399022.4:c.657G>A	18.37:g.33606995C>T		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	73	45	NM_018170	0	0	3	11	8	A8KA42|B2RBA3|Q7Z5G8|Q96FY9|Q9NVL4	Silent	SNP	ENST00000399022.4	37	CCDS11917.1																																																																																			C|0.999;T|0.001		0.373	RPRD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255802.1	NM_018170	
MED16	10025	hgsc.bcm.edu	37	19	879943	879943	+	Missense_Mutation	SNP	G	G	C	rs201392672|rs76403059	byFrequency	TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr19:879943G>C	ENST00000589119.1	-	7	1346	c.1347C>G	c.(1345-1347)caC>caG	p.H449Q	MED16_ENST00000269814.4_Missense_Mutation_p.H449Q|MED16_ENST00000325464.1_Missense_Mutation_p.H449Q|MED16_ENST00000395808.3_Missense_Mutation_p.H449Q|MED16_ENST00000312090.6_Missense_Mutation_p.H449Q|MED16_ENST00000606828.1_Intron			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	449					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACCTTCCCGTGGCTGTCAA	0.672																																					p.H449Q		.											.	MED16-186	0			c.C1347G						.						13.0	11.0	12.0					19																	879943		2152	4247	6399	SO:0001583	missense	10025	exon8			CTTCCCGTGGCTG	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1347C>G	19.37:g.879943G>C	ENSP00000464810:p.His449Gln	Somatic	34	1		WXS	Illumina HiSeq	Phase_I	18	3	NM_005481	0	0	0	0	0	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	ENST00000589119.1	37	CCDS12047.1	.	.	.	.	.	.	.	.	.	.	C	3.376	-0.127462	0.06753	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000540679;ENST00000538572;ENST00000424039	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.21	-7.89	0.01174	WD40 repeat-like-containing domain (1);	0.323237	0.32357	N	0.006220	T	0.21307	0.0513	L	0.37850	1.14	0.37741	D	0.925623	B;B;B;B;B	0.13145	0.006;0.007;0.002;0.001;0.001	B;B;B;B;B	0.14023	0.006;0.006;0.003;0.006;0.01	T	0.20009	-1.0288	10	0.15066	T	0.55	-14.2411	8.1092	0.30905	0.4704:0.1904:0.3392:0.0	.	449;449;449;449;449	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	Q	449;449;449;449;449;305;210;208;449	ENSP00000325612:H449Q;ENSP00000308528:H449Q;ENSP00000379153:H449Q;ENSP00000269814:H449Q	ENSP00000269814:H449Q	H	-	3	2	MED16	830943	0.000000	0.05858	0.886000	0.34754	0.057000	0.15508	-3.404000	0.00482	-1.779000	0.01280	-2.326000	0.00250	CAC	.		0.672	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	40408648	40408648	+	Silent	SNP	G	G	C			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr19:40408648G>C	ENST00000221347.6	-	8	4198	c.4191C>G	c.(4189-4191)ccC>ccG	p.P1397P		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1397	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGTCATCCTTGGGGTCGCCGT	0.607																																					p.P1397P		.											.	FCGBP-98	0			c.C4191G						.						121.0	108.0	112.0					19																	40408648		2203	4300	6503	SO:0001819	synonymous_variant	8857	exon8			ATCCTTGGGGTCG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4191C>G	19.37:g.40408648G>C		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	116	34	NM_003890	0	1	26	27	0	O95784	Silent	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.607	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
LTBP1	4052	hgsc.bcm.edu	37	2	33172879	33172879	+	Missense_Mutation	SNP	T	T	C	rs62135680	byFrequency	TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr2:33172879T>C	ENST00000404816.2	+	1	841	c.488T>C	c.(487-489)cTg>cCg	p.L163P	Y_RNA_ENST00000384224.1_RNA|LTBP1_ENST00000354476.3_Missense_Mutation_p.L163P			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	163					extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AAGCAGCAGCTGCAGGGGTAA	0.716													T|||	22	0.00439297	0.0	0.0	5008	,	,		8051	0.0		0.0189	False		,,,				2504	0.0031				p.L163P		.											.	LTBP1-230	0			c.T488C						.	T	PRO/LEU	5,3041		0,5,1518	6.0	6.0	6.0		488	3.5	1.0	2	dbSNP_129	6	61,5721		0,61,2830	yes	missense	LTBP1	NM_206943.2	98	0,66,4348	CC,CT,TT		1.055,0.1641,0.7476	possibly-damaging	163/1722	33172879	66,8762	1523	2891	4414	SO:0001583	missense	4052	exon1			AGCAGCTGCAGGG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.488T>C	2.37:g.33172879T>C	ENSP00000386043:p.Leu163Pro	Somatic	7	2		WXS	Illumina HiSeq	Phase_I	18	9	NM_206943	0	0	0	0	0	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	ENST00000404816.2	37	CCDS33177.2	17	0.007783882783882784	0	0.0	0	0.0	0	0.0	17	0.022427440633245383	T	20.4	3.981933	0.74474	0.001641	0.01055	ENSG00000049323	ENST00000404816;ENST00000354476	D;D	0.83992	-1.79;-1.78	4.67	3.52	0.40303	.	.	.	.	.	T	0.56124	0.1964	N	0.24115	0.695	0.80722	D	1	B	0.15930	0.015	B	0.14578	0.011	T	0.60905	-0.7170	9	0.87932	D	0	.	7.8282	0.29328	0.0:0.0979:0.0:0.9021	rs62135680	163	Q14766-4	.	P	163	ENSP00000386043:L163P;ENSP00000346467:L163P	ENSP00000346467:L163P	L	+	2	0	LTBP1	33026383	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.717000	0.54911	0.649000	0.30751	0.459000	0.35465	CTG	T|0.992;C|0.008		0.716	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
CCDC142	84865	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74702509	74702509	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr2:74702509C>T	ENST00000393965.3	-	7	2035	c.1639G>A	c.(1639-1641)Gag>Aag	p.E547K	MRPL53_ENST00000409710.1_5'Flank|MRPL53_ENST00000258105.7_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.E540K	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	547										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						CCAGCATACTCACTAGGAGCA	0.532																																					p.E540K													.	CCDC142-68	0			c.G1618A						.						61.0	63.0	62.0					2																	74702509		2203	4300	6503	SO:0001583	missense	84865	exon7			CATACTCACTAGG	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.1639G>A	2.37:g.74702509C>T	ENSP00000377537:p.Glu547Lys	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	65	13	NM_032779	0	0	8	9	1	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	37		.	.	.	.	.	.	.	.	.	.	C	12.40	1.925984	0.34002	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.44881	0.91;0.91	4.9	3.08	0.35506	.	0.243987	0.32161	N	0.006491	T	0.50309	0.1608	M	0.68317	2.08	0.32597	N	0.526396	D;D;D	0.58268	0.982;0.982;0.982	P;P;P	0.58013	0.831;0.831;0.831	T	0.57923	-0.7727	10	0.32370	T	0.25	-6.6459	6.4852	0.22085	0.0:0.7188:0.1836:0.0976	.	547;540;547	Q17RM4;Q17RM4-2;Q17RM4-3	CC142_HUMAN;.;.	K	547;540	ENSP00000377537:E547K;ENSP00000290418:E540K	ENSP00000290418:E540K	E	-	1	0	CCDC142	74556017	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	3.184000	0.50926	0.661000	0.30985	-0.218000	0.12543	GAG	.		0.532	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779	
ALPPL2	251	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233272617	233272617	+	Missense_Mutation	SNP	G	G	A	rs145892470		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr2:233272617G>A	ENST00000295453.3	+	5	590	c.538G>A	c.(538-540)Gcc>Acc	p.A180T		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	180					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CGGCGCCTACGCCCACACGGT	0.627																																					p.A180T		.											.	ALPPL2-91	0			c.G538A						.	G	THR/ALA	0,4406		0,0,2203	67.0	69.0	68.0		538	2.7	0.1	2	dbSNP_134	68	1,8597	1.2+/-3.3	0,1,4298	no	missense	ALPPL2	NM_031313.2	58	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	180/533	233272617	1,13003	2203	4299	6502	SO:0001583	missense	251	exon5			GCCTACGCCCACA	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.538G>A	2.37:g.233272617G>A	ENSP00000295453:p.Ala180Thr	Somatic	137	0		WXS	Illumina HiSeq	Phase_I	170	26	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	.	.	.	.	.	.	.	.	.	.	g	14.70	2.615024	0.46631	0.0	1.16E-4	ENSG00000163286	ENST00000295453	D	0.98400	-4.91	2.71	2.71	0.32032	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.057529	0.64402	D	0.000002	D	0.99118	0.9696	H	0.94306	3.52	0.45005	D	0.998024	D	0.89917	1.0	D	0.77004	0.989	D	0.99047	1.0826	10	0.87932	D	0	.	13.8099	0.63256	0.0:0.0:1.0:0.0	.	180	P10696	PPBN_HUMAN	T	180	ENSP00000295453:A180T	ENSP00000295453:A180T	A	+	1	0	ALPPL2	232980861	1.000000	0.71417	0.066000	0.19879	0.144000	0.21451	5.834000	0.69361	1.499000	0.48617	0.205000	0.17691	GCC	G|1.000;A|0.000		0.627	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
FAM65C	140876	bcgsc.ca	37	20	49219029	49219029	+	Missense_Mutation	SNP	C	C	A			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr20:49219029C>A	ENST00000327979.2	-	13	1638	c.1227G>T	c.(1225-1227)gaG>gaT	p.E409D	FAM65C_ENST00000045083.2_Missense_Mutation_p.E409D|FAM65C_ENST00000535356.1_Missense_Mutation_p.E413D			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	409										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTCGGGGGTCCTCAGAGCTGA	0.627																																					p.E409D													.	FAM65C-92	0			c.G1227T						.						41.0	39.0	40.0					20																	49219029		2091	4148	6239	SO:0001583	missense	140876	exon13			GGGGTCCTCAGAG	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1227G>T	20.37:g.49219029C>A	ENSP00000332663:p.Glu409Asp	Somatic	87	0		WXS	Illumina HiSeq	Phase_1	132	8	NM_080829	0	0	1	1	0	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	37	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	C	12.14	1.848134	0.32699	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.15139	2.46;2.46;2.45	4.77	2.53	0.30540	.	0.497453	0.23202	N	0.050769	T	0.15003	0.0362	L	0.50333	1.59	0.36489	D	0.868329	B;B	0.21606	0.058;0.058	B;B	0.20184	0.028;0.028	T	0.09862	-1.0655	10	0.26408	T	0.33	-28.4224	10.6816	0.45817	0.128:0.6762:0.1958:0.0	.	413;409	F5H0X2;Q96MK2	.;FA65C_HUMAN	D	409;409;413	ENSP00000332663:E409D;ENSP00000045083:E409D;ENSP00000439802:E413D	ENSP00000045083:E409D	E	-	3	2	FAM65C	48652436	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	1.193000	0.32162	2.206000	0.71126	0.561000	0.74099	GAG	.		0.627	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52422876	52422876	+	Silent	SNP	C	C	T			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr3:52422876C>T	ENST00000420323.2	+	59	9679	c.9418C>T	c.(9418-9420)Ctg>Ttg	p.L3140L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3205					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGTGGAGAACCTGCAGTACAT	0.637																																					p.L3140L		.											.	DNAH1-67	0			c.C9418T						.						59.0	71.0	67.0					3																	52422876		2151	4243	6394	SO:0001819	synonymous_variant	25981	exon59			GAGAACCTGCAGT	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.9418C>T	3.37:g.52422876C>T		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	60	39	NM_015512	0	0	0	0	0	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	ENST00000420323.2	37	CCDS46842.1																																																																																			.		0.637	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
BEND4	389206	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	42146005	42146005	+	Missense_Mutation	SNP	C	C	T	rs200387125		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr4:42146005C>T	ENST00000502486.1	-	3	1073	c.494G>A	c.(493-495)cGa>cAa	p.R165Q	BEND4_ENST00000504360.1_Missense_Mutation_p.R161Q	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	165										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						CAAGATCATTCGACTCTCTGA	0.413																																					p.R165Q													.	BEND4-90	0			c.G494A						.	C	GLN/ARG,GLN/ARG	0,3866		0,0,1933	30.0	28.0	28.0		494,494	5.9	0.9	4		28	1,8269		0,1,4134	yes	missense,missense	BEND4	NM_001159547.1,NM_207406.3	43,43	0,1,6067	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging,probably-damaging	165/442,165/535	42146005	1,12135	1933	4135	6068	SO:0001583	missense	389206	exon3			ATCATTCGACTCT	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.494G>A	4.37:g.42146005C>T	ENSP00000421169:p.Arg165Gln	Somatic	25	0		WXS	Illumina HiSeq	Phase_I	26	13	NM_001159547	0	0	0	0	0	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	37	CCDS47048.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033242	0.93575	0.0	1.21E-4	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.73369	0.3578	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.992;0.996	T	0.74589	-0.3615	9	0.87932	D	0	-14.1289	20.3539	0.98825	0.0:1.0:0.0:0.0	.	87;165;165	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	Q	36;165;161	.	ENSP00000412495:R36Q	R	-	2	0	BEND4	41840762	1.000000	0.71417	0.920000	0.36463	0.697000	0.40408	7.487000	0.81328	2.826000	0.97356	0.655000	0.94253	CGA	.		0.413	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406	
TMEM161B	153396	broad.mit.edu	37	5	87498782	87498782	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr5:87498782G>C	ENST00000296595.6	-	9	1035	c.911C>G	c.(910-912)cCt>cGt	p.P304R	TMEM161B_ENST00000511218.1_Missense_Mutation_p.P122R|TMEM161B_ENST00000509387.1_Missense_Mutation_p.P177R|TMEM161B_ENST00000512429.1_Missense_Mutation_p.P293R|TMEM161B_ENST00000514135.1_Missense_Mutation_p.P304R|TMEM161B_ENST00000506536.1_Missense_Mutation_p.P122R	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	304						integral component of membrane (GO:0016021)				endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		TACTTACAAAGGGATACTTTC	0.368																																					p.P304R													.	TMEM161B-92	0			c.C911G						.						175.0	166.0	169.0					5																	87498782		2203	4300	6503	SO:0001583	missense	153396	exon9			TACAAAGGGATAC	BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.911C>G	5.37:g.87498782G>C	ENSP00000296595:p.Pro304Arg	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	165	3	NM_153354	0	0	1	1	0	Q5CZH7|Q6UWQ6	Missense_Mutation	SNP	ENST00000296595.6	37	CCDS4065.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.363061	0.82353	.	.	ENSG00000164180	ENST00000514135;ENST00000296595;ENST00000506536;ENST00000511218;ENST00000512429;ENST00000509387	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.79690	0.4489	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78516	-0.2174	9	0.48119	T	0.1	.	19.8949	0.96954	0.0:0.0:1.0:0.0	.	122;304	B7Z6A5;Q8NDZ6	.;T161B_HUMAN	R	304;304;122;122;293;177	.	ENSP00000296595:P304R	P	-	2	0	TMEM161B	87534538	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.832000	0.86757	2.704000	0.92352	0.650000	0.86243	CCT	.		0.368	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254094.1	NM_153354	
ANKS1A	23294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	35051232	35051232	+	Silent	SNP	C	C	A	rs371531749		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr6:35051232C>A	ENST00000360359.3	+	20	3084	c.2946C>A	c.(2944-2946)atC>atA	p.I982I	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	982	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCACCATCATCCTGTCCATCA	0.547																																					p.I982I		.											.	ANKS1A-94	0			c.C2946A						.						232.0	185.0	201.0					6																	35051232		2203	4300	6503	SO:0001819	synonymous_variant	23294	exon20			CATCATCCTGTCC	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2946C>A	6.37:g.35051232C>A		Somatic	116	0		WXS	Illumina HiSeq	Phase_I	108	72	NM_015245	0	0	2	12	10	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Silent	SNP	ENST00000360359.3	37	CCDS4798.1																																																																																			.		0.547	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040262.1	XM_166478	
AHI1	54806	hgsc.bcm.edu	37	6	135759585	135759585	+	Missense_Mutation	SNP	T	T	C			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr6:135759585T>C	ENST00000367800.4	-	13	2180	c.1964A>G	c.(1963-1965)aAt>aGt	p.N655S	AHI1_ENST00000327035.6_Missense_Mutation_p.N655S|AHI1_ENST00000457866.2_Missense_Mutation_p.N655S|AHI1_ENST00000417892.2_Missense_Mutation_p.N9S	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	655					cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		ATAAATGATATTGAGGTGGCC	0.363																																					p.N655S		.											.	AHI1-227	0			c.A1964G						.						46.0	41.0	43.0					6																	135759585		1861	4090	5951	SO:0001583	missense	54806	exon14			ATGATATTGAGGT	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.1964A>G	6.37:g.135759585T>C	ENSP00000356774:p.Asn655Ser	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	5	3	NM_001134832	0	0	0	2	2	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	37	CCDS47483.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.42|17.42	3.384268|3.384268	0.61845|0.61845	.|.	.|.	ENSG00000135541|ENSG00000135541	ENST00000367799|ENST00000367800;ENST00000457866;ENST00000417892;ENST00000265602;ENST00000327035;ENST00000367801	.|T;T;T;T;T	.|0.57595	.|0.39;0.39;0.39;0.39;0.39	5.79|5.79	5.79|5.79	0.91817|0.91817	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.050290	.|0.85682	.|D	.|0.000000	T|T	0.47783|0.47783	0.1464|0.1464	N|N	0.21545|0.21545	0.675|0.675	0.80722|0.80722	D|D	1|1	.|D;D;B	.|0.71674	.|0.997;0.998;0.145	.|D;D;B	.|0.70227	.|0.921;0.968;0.219	T|T	0.46373|0.46373	-0.9196|-0.9196	5|10	.|0.25751	.|T	.|0.34	-31.7502|-31.7502	16.1222|16.1222	0.81365|0.81365	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|655;655;655	.|Q8N157-2;Q8N157;Q4FD35	.|.;AHI1_HUMAN;.	V|S	155|655;655;9;655;655;655	.|ENSP00000356774:N655S;ENSP00000388650:N655S;ENSP00000416867:N9S;ENSP00000265602:N655S;ENSP00000322478:N655S	.|ENSP00000265602:N655S	I|N	-|-	1|2	0|0	AHI1|AHI1	135801278|135801278	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	4.305000|4.305000	0.59110|0.59110	2.215000|2.215000	0.71742|0.71742	0.528000|0.528000	0.53228|0.53228	ATA|AAT	.		0.363	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
FZD1	8321	broad.mit.edu	37	7	90894984	90894984	+	Silent	SNP	G	G	T			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr7:90894984G>T	ENST00000287934.2	+	1	1202	c.789G>T	c.(787-789)ccG>ccT	p.P263P		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	263					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			GCGGCTTCCCGGGGGGCGCCG	0.697																																					p.P263P													.	FZD1-658	0			c.G789T						.						5.0	6.0	5.0					7																	90894984		2094	4109	6203	SO:0001819	synonymous_variant	8321	exon1			CTTCCCGGGGGGC	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.789G>T	7.37:g.90894984G>T		Somatic	14	0		WXS	Illumina HiSeq	Phase_I	24	11	NM_003505	0	0	8	17	9	A4D1E8|O94815|Q549T8	Silent	SNP	ENST00000287934.2	37	CCDS5620.1																																																																																			.		0.697	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
SLC26A3	1811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	107415276	107415276	+	Missense_Mutation	SNP	T	T	G			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr7:107415276T>G	ENST00000340010.5	-	16	1903	c.1719A>C	c.(1717-1719)aaA>aaC	p.K573N	SLC26A3_ENST00000422236.2_Missense_Mutation_p.K538N	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	573	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						TCCTCAAAGCTTTGTTGCGCT	0.393																																					p.K573N		.											.	SLC26A3-94	0			c.A1719C						.						166.0	145.0	152.0					7																	107415276		2203	4300	6503	SO:0001583	missense	1811	exon16			CAAAGCTTTGTTG	L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1719A>C	7.37:g.107415276T>G	ENSP00000345873:p.Lys573Asn	Somatic	124	1		WXS	Illumina HiSeq	Phase_I	165	73	NM_000111	0	0	0	0	0		Missense_Mutation	SNP	ENST00000340010.5	37	CCDS5748.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232480	0.79688	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.94793	-2.3;-3.52	6.11	3.74	0.42951	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.040256	0.85682	D	0.000000	D	0.96654	0.8908	M	0.82923	2.615	0.51233	D	0.999917	D;D	0.89917	0.997;1.0	D;D	0.80764	0.951;0.994	D	0.95529	0.8601	10	0.66056	D	0.02	.	8.8658	0.35284	0.0:0.2007:0.0:0.7993	.	538;573	G5E9U3;P40879	.;S26A3_HUMAN	N	538;573	ENSP00000415817:K538N;ENSP00000345873:K573N	ENSP00000345873:K573N	K	-	3	2	SLC26A3	107202512	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.954000	0.29175	0.544000	0.28883	0.533000	0.62120	AAA	.		0.393	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337190.1	NM_000111	
GSTK1	373156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142965268	142965268	+	Missense_Mutation	SNP	C	C	T			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr7:142965268C>T	ENST00000358406.5	+	7	693	c.622C>T	c.(622-624)Cac>Tac	p.H208Y	GSTK1_ENST00000479303.1_Missense_Mutation_p.H264Y|GSTK1_ENST00000409500.3_Missense_Mutation_p.H196Y|AC073342.12_ENST00000427392.1_RNA|GSTK1_ENST00000443571.2_Missense_Mutation_p.H165Y	NM_015917.2	NP_057001.1	Q9Y2Q3	GSTK1_HUMAN	glutathione S-transferase kappa 1	208					epithelial cell differentiation (GO:0030855)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|peroxisome (GO:0005777)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|protein disulfide oxidoreductase activity (GO:0015035)|receptor binding (GO:0005102)			lung(4)	4	Melanoma(164;0.059)				Glutathione(DB00143)	GCTGCTGGCGCACCTGCTGGG	0.567																																					p.H264Y		.											.	GSTK1-90	0			c.C790T						.						181.0	182.0	182.0					7																	142965268		2203	4300	6503	SO:0001583	missense	373156	exon6			CTGGCGCACCTGC		CCDS5877.1, CCDS47730.1, CCDS47731.1, CCDS47732.1	7q34	2012-06-21			ENSG00000197448	ENSG00000197448	2.5.1.18	"""Glutathione S-transferases / Mitochondrial (kappa)"""	16906	protein-coding gene	gene with protein product		602321				12720545, 14742434	Standard	NM_015917		Approved	GST13	uc003wcj.3	Q9Y2Q3	OTTHUMG00000152637	ENST00000358406.5:c.622C>T	7.37:g.142965268C>T	ENSP00000351181:p.His208Tyr	Somatic	415	0		WXS	Illumina HiSeq	Phase_I	495	101	NM_001143679	0	0	0	0	0	B4DIH1|B4DSY2|Q6P4H0|Q7Z520|Q9P1S4	Missense_Mutation	SNP	ENST00000358406.5	37	CCDS5877.1	.	.	.	.	.	.	.	.	.	.	C	4.988	0.183556	0.09495	.	.	ENSG00000197448	ENST00000409500;ENST00000443571;ENST00000358406;ENST00000479303	.	.	.	5.78	-3.58	0.04597	DSBA-like thioredoxin domain (1);Thioredoxin-like fold (1);	1.302130	0.04873	N	0.446319	T	0.28167	0.0695	N	0.25380	0.74	0.09310	N	1	B;B;B;B	0.11235	0.0;0.0;0.004;0.002	B;B;B;B	0.14578	0.003;0.005;0.011;0.004	T	0.34825	-0.9813	9	0.08837	T	0.75	-3.554	12.5207	0.56058	0.0:0.6216:0.0:0.3784	.	196;165;264;208	Q9Y2Q3-3;Q9Y2Q3-4;Q9Y2Q3-2;Q9Y2Q3	.;.;.;GSTK1_HUMAN	Y	196;165;208;264	.	ENSP00000351181:H208Y	H	+	1	0	GSTK1	142675390	0.000000	0.05858	0.003000	0.11579	0.606000	0.37113	-1.201000	0.03026	-1.038000	0.03279	-0.259000	0.10710	CAC	.		0.567	GSTK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327091.1	NM_015917	
CDKN2A	1029	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	21971120	21971120	+	Nonsense_Mutation	SNP	G	G	A	rs121913388		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr9:21971120G>A	ENST00000304494.5	-	2	508	c.238C>T	c.(238-240)Cga>Tga	p.R80*	CDKN2A_ENST00000479692.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000361570.3_Missense_Mutation_p.P135L|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.R80*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.R80*|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000578845.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000530628.2_Missense_Mutation_p.P94L|CDKN2A_ENST00000497750.1_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000498628.2_Nonsense_Mutation_p.R29*|CDKN2A_ENST00000579755.1_Missense_Mutation_p.P94L|CDKN2A_ENST00000494262.1_Nonsense_Mutation_p.R29*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	80			R -> L (in a head and neck tumor).|R -> P (in CMM2; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.R80*(100)|p.?(44)|p.P135L(7)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		TGCACGGGTCGGGTGAGAGTG	0.726	R80*(HSC4_UPPER_AERODIGESTIVE_TRACT)|R80*(MEWO_SKIN)	17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.R80X		.											.	CDKN2A-23992	1474	Whole gene deletion(1316)|Substitution - Nonsense(100)|Unknown(44)|Substitution - Missense(7)|Deletion - Frameshift(6)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(298)|skin(206)|central_nervous_system(168)|lung(150)|urinary_tract(91)|bone(76)|oesophagus(72)|upper_aerodigestive_tract(63)|soft_tissue(60)|pleura(51)|pancreas(37)|ovary(36)|kidney(32)|breast(32)|biliary_tract(16)|thyroid(15)|NS(14)|stomach(14)|large_intestine(7)|autonomic_ganglia(7)|meninges(7)|liver(6)|salivary_gland(4)|thymus(4)|vulva(3)|endometrium(3)|prostate(2)	c.C238T	GRCh37	CM014695	CDKN2A	M	rs121913388	.						11.0	14.0	13.0					9																	21971120		2172	4246	6418	SO:0001587	stop_gained	1029	exon2			CGGGTCGGGTGAG	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.238C>T	9.37:g.21971120G>A	ENSP00000307101:p.Arg80*	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	38	26	NM_000077	0	0	0	11	11	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	ENST00000304494.5	37	CCDS6510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	39|39	7.328457|7.328457	0.98214|0.98214	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000361570;ENST00000530628|ENST00000304494;ENST00000446177	D;D|.	0.86497|.	-2.13;-2.02|.	5.93|5.93	5.01|5.01	0.66863|0.66863	.|.	0.000000|.	0.37136|.	N|.	0.002233|.	T|.	0.44561|.	0.1299|.	L|L	0.36672|0.36672	1.1|1.1	0.47511|0.47511	D|D	0.999443|0.999443	D|.	0.59357|.	0.985|.	B|.	0.40602|.	0.334|.	T|.	0.34825|.	-0.9813|.	10|.	0.13108|0.02654	T|T	0.6|1	-2.989|-2.989	8.7197|8.7197	0.34434|0.34434	0.0759:0.0:0.7715:0.1526|0.0759:0.0:0.7715:0.1526	.|.	135|.	Q8N726|.	CD2A2_HUMAN|.	L|X	135;94|80	ENSP00000355153:P135L;ENSP00000432664:P94L|.	ENSP00000355153:P135L|ENSP00000307101:R80X	P|R	-|-	2|1	0|2	CDKN2A|CDKN2A	21961120|21961120	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	2.363000|2.363000	0.44178|0.44178	1.464000|1.464000	0.47987|0.47987	0.650000|0.650000	0.86243|0.86243	CCG|CGA	.		0.726	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
PRRC2B	84726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	134350415	134350415	+	Missense_Mutation	SNP	G	G	C			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr9:134350415G>C	ENST00000357304.4	+	15	2954	c.2899G>C	c.(2899-2901)Ggg>Cgg	p.G967R	PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	967							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCAGGAGCTAGGGGAGGAGAG	0.582																																					p.G967R		.											.	PRRC2B-24	0			c.G2899C						.						37.0	42.0	40.0					9																	134350415		2050	4189	6239	SO:0001583	missense	84726	exon15			GAGCTAGGGGAGG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.2899G>C	9.37:g.134350415G>C	ENSP00000349856:p.Gly967Arg	Somatic	19	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_013318	0	1	4	23	18	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	G	11.07	1.531552	0.27387	.	.	ENSG00000130723	ENST00000357304;ENST00000418650	T	0.01918	4.56	5.87	4.98	0.66077	.	.	.	.	.	T	0.01627	0.0052	N	0.12182	0.205	0.80722	D	1	B;B	0.18166	0.026;0.004	B;B	0.18561	0.022;0.005	T	0.57985	-0.7716	8	.	.	.	.	9.9519	0.41645	0.152:0.0:0.848:0.0	.	263;967	Q5H9R5;Q5JSZ5	.;PRC2B_HUMAN	R	967;263	ENSP00000349856:G967R	.	G	+	1	0	PRRC2B	133340236	1.000000	0.71417	0.147000	0.22382	0.913000	0.54294	6.182000	0.71995	1.487000	0.48415	0.655000	0.94253	GGG	.		0.582	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
OBP2B	29989	hgsc.bcm.edu	37	9	136083879	136083879	+	Missense_Mutation	SNP	C	C	G	rs28584111		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr9:136083879C>G	ENST00000372034.3	-	2	224	c.183G>C	c.(181-183)aaG>aaC	p.K61N	OBP2B_ENST00000461961.1_Intron|OBP2B_ENST00000372032.2_Intron	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	61					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)	p.K61N(1)		central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		TGGCTTCCAACTTCCCACCGC	0.622																																					p.K61N		.											.	OBP2B-68	1	Substitution - Missense(1)	large_intestine(1)	c.G183C						.						124.0	110.0	115.0					9																	136083879		2203	4300	6503	SO:0001583	missense	29989	exon2			TTCCAACTTCCCA	AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.183G>C	9.37:g.136083879C>G	ENSP00000361104:p.Lys61Asn	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	40	3	NM_014581	0	0	0	0	0	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	ENST00000372034.3	37	CCDS6961.1	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812613	0.02798	.	.	ENSG00000171102	ENST00000372034	T	0.08458	3.09	2.31	-0.281	0.12882	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.089000	0.07156	N	0.849966	T	0.02230	0.0069	N	0.01122	-1.005	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.45116	-0.9283	10	0.07813	T	0.8	-15.6209	4.9518	0.14019	0.0:0.4459:0.3286:0.2255	rs28584111	61	Q9NPH6	OBP2B_HUMAN	N	61	ENSP00000361104:K61N	ENSP00000361104:K61N	K	-	3	2	OBP2B	135073700	0.003000	0.15002	0.017000	0.16124	0.019000	0.09904	0.281000	0.18810	-0.129000	0.11620	-0.335000	0.08231	AAG	.		0.622	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054851.1	NM_014581	
SLC6A14	11254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	115573956	115573956	+	Missense_Mutation	SNP	G	G	A			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chrX:115573956G>A	ENST00000371900.4	+	4	536	c.448G>A	c.(448-450)Gaa>Aaa	p.E150K		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	150					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TTTTCAAAGTGAACTACCATG	0.323																																					p.E150K		.											.	SLC6A14-133	0			c.G448A						.						126.0	118.0	121.0					X																	115573956		2203	4297	6500	SO:0001583	missense	11254	exon4			CAAAGTGAACTAC	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.448G>A	X.37:g.115573956G>A	ENSP00000360967:p.Glu150Lys	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	140	83	NM_007231	0	0	0	0	0	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	G	5.346	0.249106	0.10130	.	.	ENSG00000087916	ENST00000371900	T	0.74526	-0.85	5.61	2.77	0.32553	.	0.454788	0.25045	N	0.033578	T	0.56171	0.1967	L	0.33339	1.005	0.22435	N	0.999103	B	0.02656	0.0	B	0.09377	0.004	T	0.35773	-0.9775	10	0.06625	T	0.88	.	8.3675	0.32395	0.0857:0.4534:0.4609:0.0	.	150	Q9UN76	S6A14_HUMAN	K	150	ENSP00000360967:E150K	ENSP00000360967:E150K	E	+	1	0	SLC6A14	115487984	0.371000	0.25056	0.448000	0.26945	0.981000	0.71138	1.623000	0.37008	0.143000	0.18926	-0.218000	0.12543	GAA	.		0.323	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
CROCC	9696	broad.mit.edu	37	1	17294710	17294710	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:17294710delA	ENST00000375541.5	+	31	4942	c.4873delA	c.(4873-4875)aagfs	p.K1625fs		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GAAGATCAGCAAGATGAAGGC	0.652																																					p.K1625fs													.	CROCC-137	0			c.4873delA						.						20.0	18.0	19.0					1																	17294710		2180	4276	6456	SO:0001589	frameshift_variant	9696	exon31			ATCAGCAAGATGA	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.4873delA	1.37:g.17294710delA	ENSP00000364691:p.Lys1625fs	Somatic	6	0		WXS	Illumina HiSeq	Phase_I	6	2	NM_014675	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000375541.5	37	CCDS30616.1																																																																																			.		0.652	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
PTPRC	5788	broad.mit.edu;bcgsc.ca	37	1	198678927	198678927	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr1:198678927delG	ENST00000367376.2	+	11	1310	c.1139delG	c.(1138-1140)agtfs	p.S380fs	PTPRC_ENST00000442510.2_Frame_Shift_Del_p.S382fs|PTPRC_ENST00000352140.3_Frame_Shift_Del_p.S332fs|PTPRC_ENST00000348564.6_Frame_Shift_Del_p.S221fs|PTPRC_ENST00000594404.1_Frame_Shift_Del_p.S219fs	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	380					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						ACTAACGCAAGTAAAATTATT	0.274																																					p.S382fs													.	PTPRC-295	0			c.1145delG						.						75.0	91.0	85.0					1																	198678927		2198	4265	6463	SO:0001589	frameshift_variant	5788	exon11			ACGCAAGTAAAAT	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1139delG	1.37:g.198678927delG	ENSP00000356346:p.Ser380fs	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	214	23	NM_002838	0	0	0	0	0	A8K7W6|Q16614|Q9H0Y6	Frame_Shift_Del	DEL	ENST00000367376.2	37																																																																																				.		0.274	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
POLR1B	84172	broad.mit.edu;bcgsc.ca	37	2	113308552	113308559	+	Frame_Shift_Del	DEL	CTTTCTTC	CTTTCTTC	-			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	CTTTCTTC	CTTTCTTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr2:113308552_113308559delCTTTCTTC	ENST00000263331.5	+	5	1315_1322	c.735_742delCTTTCTTC	c.(733-744)ttctttcttcctfs	p.FLP246fs	POLR1B_ENST00000537335.1_Frame_Shift_Del_p.FLP35fs|POLR1B_ENST00000417433.2_Frame_Shift_Del_p.FLP190fs|POLR1B_ENST00000541869.1_Frame_Shift_Del_p.FLP284fs|POLR1B_ENST00000409894.3_Frame_Shift_Del_p.FLP246fs	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	246					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						AAGAACTGTTCTTTCTTCCTTTGGGATT	0.394																																					p.245_248del	Ovarian(16;256 576 9537 23969 41147)												.	POLR1B-91	0			c.735_742del						.																																			SO:0001589	frameshift_variant	84172	exon5			ACTGTTCTTTCTT	AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.735_742delCTTTCTTC	2.37:g.113308552_113308559delCTTTCTTC	ENSP00000263331:p.Phe246fs	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	165	25	NM_019014	0	0	0	0	0	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Frame_Shift_Del	DEL	ENST00000263331.5	37	CCDS2097.1																																																																																			.		0.394	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254083.1	NM_019014	
SLC51A	200931	broad.mit.edu	37	3	195955100	195955102	+	In_Frame_Del	DEL	CTG	CTG	-	rs142849558		TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr3:195955100_195955102delCTG	ENST00000296327.5	+	5	686_688	c.477_479delCTG	c.(475-480)ccctgc>ccc	p.C164del		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	164	Poly-Cys.				bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	ACACAGGCCCctgctgctgctgc	0.665																																					p.159_160del													.	.	0			c.477_479del						.			166,4098		0,166,1966						5.5	1.0		dbSNP_134	89	364,7890		0,364,3763	no	coding	OSTalpha	NM_152672.5		0,530,5729	A1A1,A1R,RR		4.41,3.8931,4.2339				530,11988				SO:0001651	inframe_deletion	200931	exon5			AGGCCCCTGCTGC		CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.477_479delCTG	3.37:g.195955109_195955111delCTG	ENSP00000296327:p.Cys164del	Somatic	139	0		WXS	Illumina HiSeq	Phase_I	116	7	NM_152672	0	0	0	0	0	Q6ZMC7	In_Frame_Del	DEL	ENST00000296327.5	37	CCDS3314.1																																																																																			.		0.665	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341253.1	NM_152672	
SAV1	60485	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	51132011	51132012	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G7-6789-01A-11D-1961-08	TCGA-G7-6789-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	73b0f7f3-54f1-4030-b2a9-89bb6b4e6d3e	e2d58fed-dc32-460b-aae1-c39d371dfca5	g.chr14:51132011_51132012insA	ENST00000324679.4	-	2	783_784	c.420_421insT	c.(418-423)tttgatfs	p.D141fs	RP11-248J18.2_ENST00000602954.1_RNA	NM_021818.3	NP_068590.1	Q9H4B6	SAV1_HUMAN	salvador family WW domain containing protein 1	141					hair follicle development (GO:0001942)|hippo signaling (GO:0035329)|intestinal epithelial cell differentiation (GO:0060575)|keratinocyte differentiation (GO:0030216)|lung epithelial cell differentiation (GO:0060487)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of apoptotic process (GO:0043065)|regulation of stem cell maintenance (GO:2000036)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|kidney(2)|lung(2)|prostate(1)	6	all_epithelial(31;0.000611)|Breast(41;0.0333)					CTCTGACCATCAAAAAAATTGT	0.396																																					p.D141_G142delinsX		.											.	SAV1-658	0			c.421_422insT						.																																			SO:0001589	frameshift_variant	60485	exon2			.	AK023071	CCDS9701.1	14q13-q23	2014-04-14	2014-04-14		ENSG00000151748	ENSG00000151748			17795	protein-coding gene	gene with protein product	"""WW domain-containing adaptor 45"""	607203	"""salvador homolog 1 (Drosophila)"""			12202036, 11027580	Standard	NM_021818		Approved	WW45, WWP4, salvador	uc001wyh.2	Q9H4B6	OTTHUMG00000140293	ENST00000324679.4:c.421dupT	14.37:g.51132018_51132018dupA	ENSP00000324729:p.Asp141fs	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	63	35	NM_021818	0	0	0	0	0	A8K4B8|D3DSB6|Q6IA58|Q9H949|Q9HAK9	Nonsense_Mutation	INS	ENST00000324679.4	37	CCDS9701.1																																																																																			.		0.396	SAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276879.1		
