#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	11270889	11270889	+	Silent	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:11270889G>A	ENST00000361445.4	-	24	3712	c.3636C>T	c.(3634-3636)ctC>ctT	p.L1212L		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1212					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTCTGCAGATGAGCACATCAT	0.403																																					p.L1212L													.	MTOR-1439	0			c.C3636T						.						105.0	94.0	98.0					1																	11270889		2203	4300	6503	SO:0001819	synonymous_variant	2475	exon24			GCAGATGAGCACA	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.3636C>T	1.37:g.11270889G>A		Somatic	70	0		WXS	Illumina HiSeq	Phase_I	64	8	NM_004958	0	0	3	8	5	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	37	CCDS127.1																																																																																			.		0.403	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
MTF1	4520	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38288352	38288352	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:38288352G>T	ENST00000373036.4	-	9	1348	c.1208C>A	c.(1207-1209)tCa>tAa	p.S403*		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	403					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ATCACTGACTGACTCTGCATC	0.438																																					p.S403X													.	MTF1-92	0			c.C1208A						.						59.0	66.0	64.0					1																	38288352		2203	4300	6503	SO:0001587	stop_gained	4520	exon9			CTGACTGACTCTG	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.1208C>A	1.37:g.38288352G>T	ENSP00000362127:p.Ser403*	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	42	8	NM_005955	0	0	1	1	0	B2RAK6|Q96CB1	Nonsense_Mutation	SNP	ENST00000373036.4	37	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	G	37	6.559377	0.97663	.	.	ENSG00000188786	ENST00000373036	.	.	.	6.11	6.11	0.99139	.	0.399758	0.26776	N	0.022551	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	18.9147	0.92501	0.0:0.0:1.0:0.0	.	.	.	.	X	403	.	ENSP00000362127:S403X	S	-	2	0	MTF1	38060939	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.613000	0.67688	2.906000	0.99361	0.655000	0.94253	TCA	.		0.438	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
RIMS3	9783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	41107442	41107442	+	Silent	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:41107442C>T	ENST00000372684.3	-	3	625	c.156G>A	c.(154-156)aaG>aaA	p.K52K	RIMS3_ENST00000372683.1_Silent_p.K52K	NM_014747.2	NP_055562.2	Q9UJD0	RIMS3_HUMAN	regulating synaptic membrane exocytosis 3	52					calcium ion-dependent exocytosis (GO:0017156)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.47e-17)			TGGCCACCATCTTGGCACCCA	0.662																																					p.K52K		.											.	RIMS3-90	0			c.G156A						.						50.0	46.0	47.0					1																	41107442		2203	4300	6503	SO:0001819	synonymous_variant	9783	exon3			CACCATCTTGGCA	BC003103	CCDS30687.1	1p34.2	2013-09-19			ENSG00000117016	ENSG00000117016			21292	protein-coding gene	gene with protein product		611600				12620390, 10748113	Standard	NM_014747		Approved	RIM3, NIM3	uc001cfu.1	Q9UJD0	OTTHUMG00000007453	ENST00000372684.3:c.156G>A	1.37:g.41107442C>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	88	18	NM_014747	0	0	0	1	1	D3DPV8|Q92511|X5D7U7	Silent	SNP	ENST00000372684.3	37	CCDS30687.1																																																																																			.		0.662	RIMS3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019585.1	NM_014747	
MCL1	4170	broad.mit.edu	37	1	150551617	150551617	+	Silent	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:150551617C>T	ENST00000369026.2	-	1	449	c.390G>A	c.(388-390)gaG>gaA	p.E130E	MCL1_ENST00000464132.1_5'Flank|MCL1_ENST00000307940.3_Silent_p.E130E	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	130	PEST-like.				apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GAGGCTCCGGCTCGTACCCGT	0.672																																					p.E130E													.	MCL1-227	0			c.G390A						.						20.0	24.0	23.0					1																	150551617		2167	4235	6402	SO:0001819	synonymous_variant	4170	exon1			CTCCGGCTCGTAC	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.390G>A	1.37:g.150551617C>T		Somatic	20	0		WXS	Illumina HiSeq	Phase_I	18	3	NM_021960	0	0	10	17	7	B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Silent	SNP	ENST00000369026.2	37	CCDS957.1																																																																																			.		0.672	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084402.1	NM_021960	
PSMB4	5692	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	151372469	151372469	+	Silent	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:151372469G>A	ENST00000290541.6	+	2	207	c.153G>A	c.(151-153)gtG>gtA	p.V51V		NM_002796.2	NP_002787.2	P28070	PSB4_HUMAN	proteasome (prosome, macropain) subunit, beta type, 4	51					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	lipopolysaccharide binding (GO:0001530)|threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|lung(9)|ovary(2)|prostate(1)|skin(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			ACCCCATGGTGACCGGGACCT	0.577																																					p.V51V													.	PSMB4-92	0			c.G153A						.						73.0	76.0	75.0					1																	151372469		2203	4300	6503	SO:0001819	synonymous_variant	5692	exon2			CATGGTGACCGGG	D26600	CCDS996.1	1q21	2008-02-05			ENSG00000159377	ENSG00000159377		"""Proteasome (prosome, macropain) subunits"""	9541	protein-coding gene	gene with protein product		602177				7918633	Standard	NM_002796		Approved	HN3, PROS26	uc001eyc.1	P28070	OTTHUMG00000012494	ENST00000290541.6:c.153G>A	1.37:g.151372469G>A		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	65	7	NM_002796	0	0	0	0	0	B2R9L3|P31148|Q5SZS5|Q6IBI4|Q969L6	Silent	SNP	ENST00000290541.6	37	CCDS996.1																																																																																			.		0.577	PSMB4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034885.1	NM_002796	
SLC25A44	9673	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	156169658	156169658	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:156169658T>C	ENST00000359511.4	+	2	192	c.20T>C	c.(19-21)aTc>aCc	p.I7T	SLC25A44_ENST00000423538.2_Missense_Mutation_p.I7T|SLC25A44_ENST00000469537.1_3'UTR	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	7					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					AAACGCAACATCCAGATCATC	0.507																																					p.I7T		.											.	SLC25A44-91	0			c.T20C						.						153.0	142.0	146.0					1																	156169658		2203	4300	6503	SO:0001583	missense	9673	exon2			GCAACATCCAGAT	AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.20T>C	1.37:g.156169658T>C	ENSP00000352497:p.Ile7Thr	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	123	16	NM_014655	0	0	6	11	5	O75034	Missense_Mutation	SNP	ENST00000359511.4	37	CCDS1133.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.365339	0.82463	.	.	ENSG00000160785	ENST00000359511;ENST00000423538;ENST00000412949	T;T	0.80824	-1.42;-1.34	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.85517	0.5715	M	0.79123	2.44	0.80722	D	1	D;D;D	0.63046	0.992;0.986;0.986	P;P;P	0.61477	0.858;0.889;0.889	D	0.87847	0.2655	10	0.72032	D	0.01	-27.8219	13.6089	0.62063	0.0:0.0:0.0:1.0	.	7;7;7	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	T	7	ENSP00000352497:I7T;ENSP00000407560:I7T	ENSP00000352497:I7T	I	+	2	0	SLC25A44	154436282	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.778000	0.85637	2.108000	0.64289	0.528000	0.53228	ATC	.		0.507	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040856.1	NM_014655	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	186024754	186024754	+	Silent	SNP	T	T	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:186024754T>A	ENST00000271588.4	+	45	7321	c.7092T>A	c.(7090-7092)gtT>gtA	p.V2364V	HMCN1_ENST00000367492.2_Silent_p.V2364V	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2364	Ig-like C2-type 21.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATGTGTGTGTTGCTGTGAATG	0.418																																					p.V2364V		.											.	HMCN1-113	0			c.T7092A						.						152.0	137.0	142.0					1																	186024754		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon45			GTGTGTTGCTGTG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7092T>A	1.37:g.186024754T>A		Somatic	331	0		WXS	Illumina HiSeq	Phase_I	258	43	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																			.		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	215820886	215820886	+	Silent	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:215820886G>T	ENST00000307340.3	-	67	15155	c.14769C>A	c.(14767-14769)atC>atA	p.I4923I	USH2A_ENST00000366943.2_Silent_p.I4923I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4923	Fibronectin type-III 34. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGTGAAACTGATCCACTCGG	0.532										HNSCC(13;0.011)																											p.I4923I		.											.	USH2A-115	0			c.C14769A						.						93.0	76.0	81.0					1																	215820886		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon67			GAAACTGATCCAC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.14769C>A	1.37:g.215820886G>T		Somatic	196	0		WXS	Illumina HiSeq	Phase_I	165	25	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.532	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228462497	228462497	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:228462497G>C	ENST00000422127.1	+	20	5952	c.5908G>C	c.(5908-5910)Gtg>Ctg	p.V1970L	RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.V2345L|RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366707.4_5'UTR|RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000284548.11_Missense_Mutation_p.V1970L|OBSCN_ENST00000359599.6_Missense_Mutation_p.V817L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1970	Ig-like 19.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCAGATCACCGTGGAGGCTGA	0.652																																					p.V2345L		.											.	OBSCN-403	0			c.G7033C						.						27.0	33.0	31.0					1																	228462497		2133	4237	6370	SO:0001583	missense	84033	exon24			ATCACCGTGGAGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5908G>C	1.37:g.228462497G>C	ENSP00000409493:p.Val1970Leu	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	104	18	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.331260	0.24167	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.76448	1.01;1.01;-1.02	5.49	3.61	0.41365	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.425981	0.22964	N	0.053513	T	0.73393	0.3581	L	0.51914	1.62	0.48571	D	0.999671	B;P	0.44816	0.002;0.844	B;B	0.44085	0.005;0.44	T	0.69339	-0.5171	10	0.36615	T	0.2	.	11.1091	0.48221	0.0696:0.129:0.8014:0.0	.	1970;1970	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	L	1970;1970;817	ENSP00000284548:V1970L;ENSP00000409493:V1970L;ENSP00000352613:V817L	ENSP00000284548:V1970L	V	+	1	0	OBSCN	226529120	0.981000	0.34729	0.000000	0.03702	0.005000	0.04900	6.186000	0.72026	0.679000	0.31345	0.555000	0.69702	GTG	.		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
FAM208B	54906	hgsc.bcm.edu;broad.mit.edu	37	10	5781661	5781661	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr10:5781661C>T	ENST00000328090.5	+	13	2153	c.1528C>T	c.(1528-1530)Caa>Taa	p.Q510*	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	510																	AAATAGTGTTCAACCAGAAAA	0.383																																					p.Q510X		.											.	.	0			c.C1528T						.						99.0	93.0	95.0					10																	5781661		1895	4126	6021	SO:0001587	stop_gained	54906	exon13			AGTGTTCAACCAG	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.1528C>T	10.37:g.5781661C>T	ENSP00000328426:p.Gln510*	Somatic	134	0		WXS	Illumina HiSeq	Phase_I	112	6	NM_017782	0	0	1	1	0	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Nonsense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.453755|6.453755	0.97581|0.97581	.|.	.|.	ENSG00000108021|ENSG00000108021	ENST00000328090|ENST00000380270	.|.	.|.	.|.	5.72|5.72	3.81|3.81	0.43845|0.43845	.|.	0.212671|.	0.33144|.	N|.	0.005222|.	.|T	.|0.63920	.|0.2552	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69379	.|-0.5161	.|3	0.25106|.	T|.	0.35|.	.|.	13.9222|13.9222	0.63940|0.63940	0.0:0.556:0.444:0.0|0.0:0.556:0.444:0.0	.|.	.|.	.|.	.|.	X|L	510|208	.|.	ENSP00000328426:Q510X|.	Q|S	+|+	1|2	0|0	C10orf18|C10orf18	5821667|5821667	0.722000|0.722000	0.28017|0.28017	0.029000|0.029000	0.17559|0.17559	0.010000|0.010000	0.07245|0.07245	1.851000|1.851000	0.39338|0.39338	0.699000|0.699000	0.31761|0.31761	-0.274000|-0.274000	0.10170|0.10170	CAA|TCA	.		0.383	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
EPC1	80314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	32573863	32573863	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr10:32573863T>A	ENST00000263062.8	-	10	1776	c.1507A>T	c.(1507-1509)Aca>Tca	p.T503S	EPC1_ENST00000319778.6_Missense_Mutation_p.T503S|EPC1_ENST00000375110.2_Missense_Mutation_p.T453S|RP11-166N17.3_ENST00000419441.1_RNA	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	503					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GAGGTATTTGTTTCTGAGGTA	0.423																																					p.T503S		.											.	EPC1-93	0			c.A1507T						.						145.0	139.0	141.0					10																	32573863		2203	4300	6503	SO:0001583	missense	80314	exon10			TATTTGTTTCTGA	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1507A>T	10.37:g.32573863T>A	ENSP00000263062:p.Thr503Ser	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	119	21	NM_025209	0	0	1	5	4	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	ENST00000263062.8	37	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.240893	0.58995	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.16743	2.32;2.32;2.32	6.07	4.93	0.64822	.	0.132659	0.64402	D	0.000002	T	0.19485	0.0468	L	0.56769	1.78	0.37213	D	0.904872	B;B;B	0.26512	0.019;0.003;0.151	B;B;B	0.27796	0.031;0.027;0.083	T	0.06391	-1.0829	10	0.25106	T	0.35	-3.2229	13.751	0.62908	0.0:0.0:0.1278:0.8721	.	453;503;503	Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;EPC1_HUMAN	S	453;503;503	ENSP00000364251:T453S;ENSP00000318559:T503S;ENSP00000263062:T503S	ENSP00000263062:T503S	T	-	1	0	EPC1	32613869	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.783000	0.68982	1.080000	0.41073	0.533000	0.62120	ACA	.		0.423	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		
MBL2	4153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	54527970	54527970	+	Missense_Mutation	SNP	A	A	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr10:54527970A>G	ENST00000373968.3	-	4	738	c.674T>C	c.(673-675)cTa>cCa	p.L225P		NM_000242.2	NP_000233.1	P11226	MBL2_HUMAN	mannose-binding lectin (protein C) 2, soluble	225	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|complement activation, lectin pathway (GO:0001867)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|killing by host of symbiont cells (GO:0051873)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of viral process (GO:0048525)|opsonization (GO:0008228)|positive regulation of phagocytosis (GO:0050766)|response to oxidative stress (GO:0006979)	cell surface (GO:0009986)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium-dependent protein binding (GO:0048306)|mannose binding (GO:0005537)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21						ATTTTTCAGTAGCAATACACA	0.502																																					p.L225P		.											.	MBL2-91	0			c.T674C						.						379.0	337.0	351.0					10																	54527970		2202	4300	6502	SO:0001583	missense	4153	exon4			TTCAGTAGCAATA	AF360991	CCDS7247.1	10q11.2	2014-09-17	2011-02-02		ENSG00000165471	ENSG00000165471		"""Collectins"""	6922	protein-coding gene	gene with protein product		154545	"""mannose-binding lectin (protein C) 2, soluble (opsonic defect)"""	MBL		1675710, 1672848	Standard	NM_000242		Approved	COLEC1	uc001jjt.3	P11226	OTTHUMG00000150270	ENST00000373968.3:c.674T>C	10.37:g.54527970A>G	ENSP00000363079:p.Leu225Pro	Somatic	263	0		WXS	Illumina HiSeq	Phase_I	219	39	NM_000242	0	0	0	0	0	Q4VB12|Q4VB13|Q4VB14|Q5SQS3|Q86SI4|Q96KE4|Q96TF7|Q96TF8|Q96TF9	Missense_Mutation	SNP	ENST00000373968.3	37	CCDS7247.1	.	.	.	.	.	.	.	.	.	.	A	17.66	3.444961	0.63178	.	.	ENSG00000165471	ENST00000373968	T	0.24350	1.86	5.13	5.13	0.70059	C-type lectin fold (1);C-type lectin, conserved site (1);C-type lectin-like (1);C-type lectin (3);	1.028080	0.07735	N	0.945891	T	0.66137	0.2759	H	0.95611	3.695	0.22811	N	0.99871	D	0.89917	1.0	D	0.85130	0.997	T	0.56805	-0.7918	10	0.87932	D	0	-1.5247	13.1902	0.59706	1.0:0.0:0.0:0.0	.	225	P11226	MBL2_HUMAN	P	225	ENSP00000363079:L225P	ENSP00000363079:L225P	L	-	2	0	MBL2	54197976	0.066000	0.20996	0.003000	0.11579	0.002000	0.02628	4.043000	0.57354	2.048000	0.60808	0.482000	0.46254	CTA	.		0.502	MBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048115.1	NM_000242	
MUC2	4583	broad.mit.edu	37	11	1092953	1092953	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr11:1092953C>T	ENST00000441003.2	+	30	4799	c.4772C>T	c.(4771-4773)aCg>aTg	p.T1591M	MUC2_ENST00000359061.5_Splice_Site_p.T1592M|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1592M(1)|p.T1591M(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccactacggtgacccca	0.627																																					p.T1591M													.	MUC2-90	2	Substitution - Missense(2)	endometrium(2)	c.C4772T						.						54.0	86.0	74.0					11																	1092953		1812	3313	5125	SO:0001583	missense	4583	exon30			CCACTACGGTGAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4772C>T	11.37:g.1092953C>T	ENSP00000415183:p.Thr1591Met	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	101	8	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	3.179	-0.168424	0.06461	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.16743	2.32;2.56	1.75	-0.619	0.11572	.	6.725620	0.00827	U	0.001636	T	0.08846	0.0219	.	.	.	0.09310	N	1	D	0.60575	0.988	B	0.34489	0.184	T	0.24548	-1.0157	9	0.32370	T	0.25	.	3.3423	0.07123	0.2481:0.5888:0.0:0.163	.	1591	E7EUV1	.	M	1591;1592	ENSP00000415183:T1591M;ENSP00000351956:T1592M	ENSP00000351956:T1592M	T	+	2	0	MUC2	1082953	0.064000	0.20934	0.000000	0.03702	0.189000	0.23516	1.615000	0.36922	-0.313000	0.08728	0.121000	0.15741	ACG	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
CCDC86	79080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	60609627	60609627	+	Silent	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr11:60609627G>T	ENST00000227520.5	+	1	84	c.30G>T	c.(28-30)cgG>cgT	p.R10R	RP11-804A23.4_ENST00000538705.1_RNA|RP11-804A23.2_ENST00000539897.1_RNA	NM_024098.3	NP_077003.1	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	10					viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|liver(2)|lung(2)|urinary_tract(3)	10						GCAGCCGACGGCTGGGAGGCC	0.642																																					p.R10R		.											.	CCDC86-90	0			c.G30T						.						15.0	16.0	15.0					11																	60609627		2187	4274	6461	SO:0001819	synonymous_variant	79080	exon1			CCGACGGCTGGGA	AK025974	CCDS7993.1	11q12.2	2006-03-16			ENSG00000110104	ENSG00000110104			28359	protein-coding gene	gene with protein product		611293					Standard	NM_024098		Approved	MGC2574	uc001nqa.2	Q9H6F5	OTTHUMG00000167706	ENST00000227520.5:c.30G>T	11.37:g.60609627G>T		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	98	18	NM_024098	0	0	13	28	15	B4DY99	Silent	SNP	ENST00000227520.5	37	CCDS7993.1																																																																																			.		0.642	CCDC86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395743.1	NM_024098	
FERMT3	83706	broad.mit.edu	37	11	63978789	63978789	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr11:63978789C>T	ENST00000279227.5	+	5	652	c.557C>T	c.(556-558)tCg>tTg	p.S186L	FERMT3_ENST00000345728.5_Missense_Mutation_p.S186L	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	186					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						GCTCACTTCTCGGACAGCGCC	0.701																																					p.S186L													.	FERMT3-23	0			c.C557T						.						32.0	28.0	29.0					11																	63978789		2199	4296	6495	SO:0001583	missense	83706	exon5			ACTTCTCGGACAG	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.557C>T	11.37:g.63978789C>T	ENSP00000279227:p.Ser186Leu	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	58	4	NM_031471	0	0	21	21	0	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.272987	0.23221	.	.	ENSG00000149781	ENST00000544997;ENST00000345728;ENST00000279227;ENST00000541252	T;T;T;T	0.48836	1.46;0.87;0.88;0.8	3.37	3.37	0.38596	Band 4.1 domain (1);	0.235735	0.34750	N	0.003715	T	0.25457	0.0619	N	0.11427	0.14	0.39553	D	0.969006	B;B	0.19706	0.012;0.038	B;B	0.10450	0.005;0.005	T	0.10042	-1.0647	10	0.39692	T	0.17	-11.0265	8.147	0.31117	0.0:0.8833:0.0:0.1167	.	186;186	Q86UX7-2;Q86UX7	.;URP2_HUMAN	L	186;186;186;6	ENSP00000445778:S186L;ENSP00000339950:S186L;ENSP00000279227:S186L;ENSP00000438885:S6L	ENSP00000279227:S186L	S	+	2	0	FERMT3	63735365	0.997000	0.39634	0.998000	0.56505	0.122000	0.20287	3.722000	0.54948	1.915000	0.55452	0.561000	0.74099	TCG	.		0.701	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396297.1	NM_031471	
PANX1	24145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	93911576	93911576	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr11:93911576C>G	ENST00000227638.3	+	3	748	c.363C>G	c.(361-363)taC>taG	p.Y121*	PANX1_ENST00000436171.2_Nonsense_Mutation_p.Y121*	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	121					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	TCCTCCTGTACCTGCCCCCGC	0.463																																					p.Y121X		.											.	PANX1-68	0			c.C363G						.						167.0	127.0	141.0					11																	93911576		2201	4298	6499	SO:0001587	stop_gained	24145	exon3			CCTGTACCTGCCC	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.363C>G	11.37:g.93911576C>G	ENSP00000227638:p.Tyr121*	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	184	41	NM_015368	0	0	2	3	1	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Nonsense_Mutation	SNP	ENST00000227638.3	37	CCDS8296.1	.	.	.	.	.	.	.	.	.	.	C	38	6.963806	0.97967	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.6852	13.9642	0.64199	0.0:0.9245:0.0:0.0755	.	.	.	.	X	121	.	ENSP00000227638:Y121X	Y	+	3	2	PANX1	93551224	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	0.922000	0.28734	2.402000	0.81655	0.563000	0.77884	TAC	.		0.463	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368	
LPCAT3	10162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7125633	7125633	+	Silent	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr12:7125633C>T	ENST00000261407.4	-	1	181	c.96G>A	c.(94-96)gcG>gcA	p.A32A	C1S_ENST00000406697.1_Intron	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	32					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						CCAGGGACGTCGCCAACTTGT	0.662																																					p.A32A		.											.	LPCAT3-91	0			c.G96A						.						49.0	48.0	49.0					12																	7125633		2202	4299	6501	SO:0001819	synonymous_variant	10162	exon1			GGACGTCGCCAAC	U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.96G>A	12.37:g.7125633C>T		Somatic	122	0		WXS	Illumina HiSeq	Phase_I	143	39	NM_005768	0	0	67	153	86	B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Silent	SNP	ENST00000261407.4	37	CCDS8572.1																																																																																			.		0.662	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401812.1	NM_005768	
SCN8A	6334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52188171	52188171	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr12:52188171T>A	ENST00000354534.6	+	26	4719	c.4541T>A	c.(4540-4542)aTc>aAc	p.I1514N	SCN8A_ENST00000545061.1_Missense_Mutation_p.I1473N	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1514					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	ATCCAAGGAATCGTCTTTGAT	0.428																																					p.I1514N		.											.	SCN8A-29	0			c.T4541A						.						132.0	127.0	129.0					12																	52188171		1982	4186	6168	SO:0001583	missense	6334	exon26			AAGGAATCGTCTT	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.4541T>A	12.37:g.52188171T>A	ENSP00000346534:p.Ile1514Asn	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	72	25	NM_014191	0	0	0	0	0	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	t	11.59	1.684148	0.29872	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133	D;D;D	0.96073	-3.9;-3.87;-3.75	4.96	4.96	0.65561	.	0.387189	0.31821	N	0.007009	D	0.92051	0.7481	L	0.60455	1.87	0.23050	N	0.998375	B	0.06786	0.001	B	0.01281	0.0	D	0.83764	0.0216	10	0.66056	D	0.02	.	3.8457	0.08934	0.0:0.1628:0.1988:0.6384	.	1514	Q9UQD0	SCN8A_HUMAN	N	1514;1473;1473	ENSP00000346534:I1514N;ENSP00000440360:I1473N;ENSP00000347255:I1473N	ENSP00000346534:I1514N	I	+	2	0	SCN8A	50474438	0.009000	0.17119	0.680000	0.29994	0.997000	0.91878	1.516000	0.35856	2.228000	0.72767	0.524000	0.50904	ATC	.		0.428	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
KRT84	3890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	52779218	52779218	+	Missense_Mutation	SNP	C	C	G	rs148258545		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr12:52779218C>G	ENST00000257951.3	-	1	218	c.152G>C	c.(151-153)gGt>gCt	p.G51A	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	51	Head.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		ACTCCGACTACCAAAGCTGCC	0.582																																					p.G51A		.											.	KRT84-91	0			c.G152C						.						75.0	80.0	78.0					12																	52779218		2203	4300	6503	SO:0001583	missense	3890	exon1			CGACTACCAAAGC	Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.152G>C	12.37:g.52779218C>G	ENSP00000257951:p.Gly51Ala	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	164	35	NM_033045	0	0	0	0	0	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	37	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.370922	0.42003	.	.	ENSG00000161849	ENST00000257951	D	0.84944	-1.92	5.06	4.15	0.48705	.	0.143814	0.32563	N	0.005926	D	0.87269	0.6135	M	0.86420	2.815	0.34114	D	0.663369	B	0.15141	0.012	B	0.12156	0.007	D	0.89533	0.3787	10	0.66056	D	0.02	.	15.849	0.78912	0.0:0.864:0.136:0.0	.	51	Q9NSB2	KRT84_HUMAN	A	51	ENSP00000257951:G51A	ENSP00000257951:G51A	G	-	2	0	KRT84	51065485	0.946000	0.32159	0.968000	0.41197	0.853000	0.48598	2.037000	0.41174	1.466000	0.48025	0.543000	0.68304	GGT	C|1.000;T|0.000		0.582	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
C12orf29	91298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	88442035	88442035	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr12:88442035T>A	ENST00000356891.3	+	7	1017	c.814T>A	c.(814-816)Tgc>Agc	p.C272S		NM_001009894.2	NP_001009894.2	Q8N999	CL029_HUMAN	chromosome 12 open reading frame 29	272					hematopoietic progenitor cell differentiation (GO:0002244)					large_intestine(3)|lung(1)|ovary(1)	5						TCTTGGCTTATGCTGGCCAAT	0.363																																					p.C272S		.											.	C12orf29-90	0			c.T814A						.						126.0	108.0	114.0					12																	88442035		2203	4300	6503	SO:0001583	missense	91298	exon7			GGCTTATGCTGGC	AL137488	CCDS31866.1	12q21.32	2012-05-30			ENSG00000133641	ENSG00000133641			25322	protein-coding gene	gene with protein product						14702039	Standard	NM_001009894		Approved	DKFZp434N2030	uc001tao.3	Q8N999	OTTHUMG00000169870	ENST00000356891.3:c.814T>A	12.37:g.88442035T>A	ENSP00000349358:p.Cys272Ser	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	141	41	NM_001009894	0	0	1	2	1	Q569K5|Q6AWA8|Q6PEK5|Q8IYQ5|Q9NT75	Missense_Mutation	SNP	ENST00000356891.3	37	CCDS31866.1	.	.	.	.	.	.	.	.	.	.	.	3.780	-0.045871	0.07452	.	.	ENSG00000133641	ENST00000356891	T	0.50001	0.76	5.41	1.98	0.26296	.	0.784752	0.12584	N	0.456148	T	0.27278	0.0669	L	0.34521	1.04	0.26278	N	0.978315	B	0.02656	0.0	B	0.04013	0.001	T	0.32851	-0.9891	10	0.02654	T	1	0.2767	4.1297	0.10143	0.1564:0.353:0.0:0.4906	.	272	Q8N999	CL029_HUMAN	S	272	ENSP00000349358:C272S	ENSP00000349358:C272S	C	+	1	0	C12orf29	86966166	0.225000	0.23685	0.998000	0.56505	0.994000	0.84299	0.223000	0.17719	0.109000	0.17891	0.533000	0.62120	TGC	.		0.363	C12orf29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406335.1	NM_001009894	
RPH3A	22895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	113333603	113333603	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr12:113333603C>A	ENST00000389385.4	+	21	2376	c.1879C>A	c.(1879-1881)Cac>Aac	p.H627N	RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000420983.2_Missense_Mutation_p.H627N|RPH3A_ENST00000551052.1_Missense_Mutation_p.H623N|RPH3A_ENST00000415485.3_Missense_Mutation_p.H627N|RPH3A_ENST00000548866.1_Missense_Mutation_p.H578N|RPH3A_ENST00000447659.2_Missense_Mutation_p.H578N|RPH3A_ENST00000543106.2_Missense_Mutation_p.H627N	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	627	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TGACATCAAACACAGTGACCT	0.473																																					p.H627N		.											.	RPH3A-519	0			c.C1879A						.						97.0	78.0	84.0					12																	113333603		2203	4300	6503	SO:0001583	missense	22895	exon21			ATCAAACACAGTG	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1879C>A	12.37:g.113333603C>A	ENSP00000374036:p.His627Asn	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	101	11	NM_001143854	0	0	0	0	0	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	37	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599097	0.87055	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983;ENST00000549913	T;T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	5.42	5.42	0.78866	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.64402	D	0.000007	T	0.70684	0.3252	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.997	D;D;D	0.77004	0.989;0.972;0.977	T	0.68637	-0.5356	10	0.27785	T	0.31	.	18.006	0.89209	0.0:1.0:0.0:0.0	.	578;627;623	F8VP47;Q9Y2J0;Q9Y2J0-2	.;RP3A_HUMAN;.	N	627;627;578;623;627;578;627;279	ENSP00000440384:H627N;ENSP00000374036:H627N;ENSP00000413254:H578N;ENSP00000448297:H623N;ENSP00000405357:H627N;ENSP00000450347:H578N;ENSP00000408889:H627N	ENSP00000374036:H627N	H	+	1	0	RPH3A	111817986	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.703000	0.68340	2.550000	0.86006	0.655000	0.94253	CAC	.		0.473	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	39262352	39262352	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr13:39262352G>C	ENST00000280481.7	+	1	1087	c.871G>C	c.(871-873)Gct>Cct	p.A291P		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	291					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTCACGAGGGGCTCCTGTGGG	0.617																																					p.A291P		.											.	FREM2-100	0			c.G871C						.						57.0	56.0	56.0					13																	39262352		2203	4300	6503	SO:0001583	missense	341640	exon1			CGAGGGGCTCCTG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.871G>C	13.37:g.39262352G>C	ENSP00000280481:p.Ala291Pro	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	107	22	NM_207361	0	0	0	1	1	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909632	0.33721	.	.	ENSG00000150893	ENST00000280481	T	0.19532	2.14	5.93	0.756	0.18421	.	0.690381	0.13204	N	0.405691	T	0.16685	0.0401	L	0.39898	1.24	0.22675	N	0.998866	B	0.10296	0.003	B	0.10450	0.005	T	0.21655	-1.0239	10	0.62326	D	0.03	.	8.0541	0.30596	0.138:0.0:0.6112:0.2508	.	291	Q5SZK8	FREM2_HUMAN	P	291	ENSP00000280481:A291P	ENSP00000280481:A291P	A	+	1	0	FREM2	38160352	0.752000	0.28338	0.027000	0.17364	0.945000	0.59286	1.457000	0.35212	-0.207000	0.10187	0.555000	0.69702	GCT	.		0.617	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
PLEKHH1	57475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	68038953	68038953	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr14:68038953C>A	ENST00000329153.5	+	11	1819	c.1687C>A	c.(1687-1689)Cgc>Agc	p.R563S		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	563						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		CAAACTGCAGCGCACCTCATC	0.662																																					p.R563S		.											.	PLEKHH1-22	0			c.C1687A						.						29.0	32.0	31.0					14																	68038953		2079	4209	6288	SO:0001583	missense	57475	exon11			CTGCAGCGCACCT	AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1687C>A	14.37:g.68038953C>A	ENSP00000330278:p.Arg563Ser	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	37	10	NM_020715	0	0	0	0	0	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	ENST00000329153.5	37	CCDS45128.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966478	0.74131	.	.	ENSG00000054690	ENST00000329153	T	0.73789	-0.78	4.61	3.68	0.42216	.	0.000000	0.85682	D	0.000000	T	0.79650	0.4482	M	0.64997	1.995	0.80722	D	1	P;D	0.61080	0.911;0.989	P;P	0.60012	0.486;0.867	T	0.76963	-0.2764	10	0.30854	T	0.27	.	11.6328	0.51185	0.2994:0.7006:0.0:0.0	.	78;563	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	S	563	ENSP00000330278:R563S	ENSP00000330278:R563S	R	+	1	0	PLEKHH1	67108706	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.483000	0.45233	2.387000	0.81309	0.555000	0.69702	CGC	.		0.662	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412730.3	XM_031054	
EML5	161436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	89105224	89105224	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr14:89105224T>G	ENST00000380664.5	-	30	4240	c.4241A>C	c.(4240-4242)aAt>aCt	p.N1414T	EML5_ENST00000554922.1_Missense_Mutation_p.N1422T|EML5_ENST00000352093.5_Missense_Mutation_p.N1376T			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1414						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AATATCATCATTATGTTCCTG	0.333																																					p.N1422T		.											.	EML5-93	0			c.A4265C						.						81.0	71.0	74.0					14																	89105224		1809	4079	5888	SO:0001583	missense	161436	exon31			TCATCATTATGTT	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4241A>C	14.37:g.89105224T>G	ENSP00000370039:p.Asn1414Thr	Somatic	50	0		WXS	Illumina HiSeq	Phase_I	72	12	NM_183387	0	0	0	0	0	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	37	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	T	2.398	-0.338242	0.05278	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.04234	3.67;3.67;3.67	5.38	3.04	0.35103	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.114168	0.64402	D	0.000016	T	0.01029	0.0034	N	0.00332	-1.63	0.31575	N	0.655785	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38112	-0.9676	10	0.02654	T	1	-24.3174	5.3744	0.16156	0.0:0.1523:0.1491:0.6985	.	1422;1414	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	T	1422;1376;1414	ENSP00000451998:N1422T;ENSP00000298315:N1376T;ENSP00000370039:N1414T	ENSP00000298315:N1376T	N	-	2	0	EML5	88174977	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.975000	0.40569	0.884000	0.36064	0.482000	0.46254	AAT	.		0.333	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
WDR20	91833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	102689211	102689211	+	Silent	SNP	T	T	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr14:102689211T>A	ENST00000335263.5	+	4	1817	c.1737T>A	c.(1735-1737)acT>acA	p.T579T	WDR20_ENST00000556807.1_Silent_p.T518T	NM_181291.2	NP_851808.1	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	0										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						CAGGTGGAACTGTAGTGTAGC	0.602																																					p.T579T		.											.	WDR20-90	0			c.T1737A						.						148.0	116.0	126.0					14																	102689211		2203	4300	6503	SO:0001819	synonymous_variant	91833	exon4			TGGAACTGTAGTG	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000335263.5:c.1737T>A	14.37:g.102689211T>A		Somatic	221	0		WXS	Illumina HiSeq	Phase_I	232	42	NM_181291	0	0	0	4	4	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Silent	SNP	ENST00000335263.5	37	CCDS9968.1																																																																																			.		0.602	WDR20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414960.1	NM_181291	
EIF2AK4	440275	ucsc.edu	37	15	40284411	40284411	+	Silent	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr15:40284411G>A	ENST00000263791.5	+	17	2710	c.2667G>A	c.(2665-2667)ttG>ttA	p.L889L	EIF2AK4_ENST00000382727.2_Silent_p.L861L	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	889	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CAGGAGACTTGATTAAGTCAG	0.353																																					p.L889L													.	EIF2AK4-757	0			c.G2667A						.						109.0	103.0	105.0					15																	40284411		1813	4073	5886	SO:0001819	synonymous_variant	440275	exon17			AGACTTGATTAAG	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2667G>A	15.37:g.40284411G>A		Somatic	48	0		WXS	Illumina HiSeq		46	4	NM_001013703	0	0	6	6	0	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Silent	SNP	ENST00000263791.5	37	CCDS42016.1																																																																																			.		0.353	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
BAHD1	22893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	40751142	40751142	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr15:40751142C>A	ENST00000416165.1	+	2	550	c.479C>A	c.(478-480)gCt>gAt	p.A160D	BAHD1_ENST00000561234.1_Missense_Mutation_p.A160D|BAHD1_ENST00000560846.1_Missense_Mutation_p.A160D	NM_014952.3	NP_055767.3	Q8TBE0	BAHD1_HUMAN	bromo adjacent homology domain containing 1	160					heterochromatin assembly (GO:0031507)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|chromosome (GO:0005694)	chromatin binding (GO:0003682)			NS(1)|endometrium(6)|kidney(3)|large_intestine(3)|lung(10)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	28		all_cancers(109;8.28e-19)|all_epithelial(112;2.64e-15)|Lung NSC(122;5.14e-11)|all_lung(180;1.27e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.46e-06)|BRCA - Breast invasive adenocarcinoma(123;0.08)		CGTGATCGTGCTACTGGGGGC	0.672																																					p.A160D		.											.	BAHD1-90	0			c.C479A						.						22.0	29.0	26.0					15																	40751142		2197	4296	6493	SO:0001583	missense	22893	exon2			ATCGTGCTACTGG	AL833923	CCDS10058.1, CCDS73705.1	15q14	2005-11-10			ENSG00000140320	ENSG00000140320			29153	protein-coding gene	gene with protein product		613880				10231032	Standard	XM_005254229		Approved	KIAA0945	uc001zlu.2	Q8TBE0	OTTHUMG00000129982	ENST00000416165.1:c.479C>A	15.37:g.40751142C>A	ENSP00000396976:p.Ala160Asp	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	44	10	NM_014952	0	0	10	13	3	Q8NDF7|Q9Y2F4	Missense_Mutation	SNP	ENST00000416165.1	37	CCDS10058.1	.	.	.	.	.	.	.	.	.	.	C	9.014	0.983230	0.18889	.	.	ENSG00000140320	ENST00000416165	T	0.18338	2.22	5.11	0.82	0.18793	.	0.394096	0.23881	N	0.043645	T	0.09291	0.0229	N	0.08118	0	0.09310	N	1	P;B;P	0.36909	0.573;0.437;0.573	B;B;B	0.41894	0.369;0.203;0.369	T	0.26121	-1.0112	10	0.36615	T	0.2	-3.895	7.9432	0.29971	0.0:0.6539:0.1214:0.2247	.	160;160;160	Q8TBE0-3;Q8TBE0;Q8TBE0-2	.;BAHD1_HUMAN;.	D	160	ENSP00000396976:A160D	ENSP00000396976:A160D	A	+	2	0	BAHD1	38538434	0.840000	0.29493	0.037000	0.18230	0.004000	0.04260	1.548000	0.36201	0.311000	0.23014	-0.182000	0.12963	GCT	.		0.672	BAHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252248.1	NM_014952	
UBR1	197131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43378432	43378432	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr15:43378432C>T	ENST00000290650.4	-	2	166	c.88G>A	c.(88-90)Gat>Aat	p.D30N	UBR1_ENST00000382177.2_Missense_Mutation_p.D30N	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	30					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ACTTGCTGATCCCACCACTAA	0.358																																					p.D30N		.											.	UBR1-91	0			c.G88A						.						47.0	50.0	49.0					15																	43378432		2203	4299	6502	SO:0001583	missense	197131	exon2			GCTGATCCCACCA		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.88G>A	15.37:g.43378432C>T	ENSP00000290650:p.Asp30Asn	Somatic	37	0		WXS	Illumina HiSeq	Phase_I	30	6	NM_174916	0	0	0	0	0	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442186	0.25987	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.70045	0.39;-0.45	5.41	3.39	0.38822	.	0.425163	0.24730	N	0.036070	T	0.42539	0.1207	N	0.08118	0	0.32678	N	0.515941	B;P	0.35433	0.147;0.501	B;B	0.25140	0.045;0.058	T	0.48958	-0.8988	10	0.17832	T	0.49	-13.2485	17.5354	0.87829	0.0:0.7515:0.2485:0.0	.	30;30	B4DYL2;Q8IWV7	.;UBR1_HUMAN	N	30	ENSP00000290650:D30N;ENSP00000371612:D30N	ENSP00000290650:D30N	D	-	1	0	UBR1	41165724	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.711000	0.37930	1.277000	0.44412	0.561000	0.74099	GAT	.		0.358	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
REC114	283677	broad.mit.edu	37	15	73735652	73735652	+	Silent	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr15:73735652G>T	ENST00000331090.6	+	1	154	c.126G>T	c.(124-126)ctG>ctT	p.L42L	C15orf60_ENST00000560581.1_Silent_p.L42L	NM_001042367.1	NP_001035826.1	Q7Z4M0	RE114_HUMAN		42					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)					endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|pancreas(1)|prostate(2)	17						GGCCATGCCTGGAAGCTGGGA	0.652																																					p.L42L													.	C15orf60-46	0			c.G126T						.						17.0	23.0	21.0					15																	73735652		1995	4151	6146	SO:0001819	synonymous_variant	283677	exon1			ATGCCTGGAAGCT																												ENST00000331090.6:c.126G>T	15.37:g.73735652G>T		Somatic	39	2		WXS	Illumina HiSeq	Phase_I	43	6	NM_001042367	0	0	0	0	0		Silent	SNP	ENST00000331090.6	37	CCDS45296.1																																																																																			.		0.652	C15orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419069.1		
MMP25	64386	hgsc.bcm.edu	37	16	3100091	3100091	+	Missense_Mutation	SNP	G	G	A	rs146181243		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr16:3100091G>A	ENST00000336577.4	+	3	551	c.314G>A	c.(313-315)cGt>cAt	p.R105H	MMP25_ENST00000570755.1_3'UTR|RP11-473M20.7_ENST00000576250.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	120					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	GTCAGGCGGCGTCGCCGGTAC	0.701																																					p.R105H	NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)	.											.	MMP25-226	0			c.G314A						.	G	HIS/ARG	1,4393	2.1+/-5.4	0,1,2196	54.0	59.0	57.0		314	5.1	0.1	16	dbSNP_134	57	0,8596		0,0,4298	no	missense	MMP25	NM_022468.4	29	0,1,6494	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging	105/563	3100091	1,12989	2197	4298	6495	SO:0001583	missense	64386	exon3			GGCGGCGTCGCCG	AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.314G>A	16.37:g.3100091G>A	ENSP00000337816:p.Arg105His	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	22	9	NM_022468	0	0	0	0	0	Q96F04|Q96TE2	Missense_Mutation	SNP	ENST00000336577.4	37	CCDS10492.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085309	0.36758	2.28E-4	0.0	ENSG00000008516	ENST00000336577;ENST00000325800	T	0.19105	2.17	5.06	5.06	0.68205	Metallopeptidase, catalytic domain (1);	0.000000	0.34802	U	0.003670	T	0.19725	0.0474	M	0.62088	1.915	0.09310	N	0.999994	P;D	0.57571	0.796;0.98	B;B	0.37833	0.124;0.259	T	0.39820	-0.9595	10	0.72032	D	0.01	.	9.5362	0.39224	0.0975:0.0:0.9025:0.0	.	29;105	O43923;Q9NPA2	.;MMP25_HUMAN	H	105;32	ENSP00000337816:R105H	ENSP00000324953:R32H	R	+	2	0	MMP25	3040092	0.997000	0.39634	0.093000	0.20910	0.166000	0.22503	5.754000	0.68743	2.356000	0.79943	0.655000	0.94253	CGT	G|1.000;A|0.000		0.701	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437116.1	NM_022468	
COG8	84342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	69368509	69368509	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr16:69368509A>T	ENST00000306875.4	-	3	1442	c.1328T>A	c.(1327-1329)cTg>cAg	p.L443Q	RP11-343C2.12_ENST00000562949.1_Missense_Mutation_p.L89Q|COG8_ENST00000562081.1_Missense_Mutation_p.L443Q	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	443					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						GAAGGCAACCAGAATATTGTT	0.597																																					p.L443Q		.											.	COG8-91	0			c.T1328A						.						68.0	65.0	66.0					16																	69368509		2198	4300	6498	SO:0001583	missense	84342	exon3			GCAACCAGAATAT	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1328T>A	16.37:g.69368509A>T	ENSP00000305459:p.Leu443Gln	Somatic	167	0		WXS	Illumina HiSeq	Phase_I	153	27	NM_032382	0	0	16	24	8	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	ENST00000306875.4	37	CCDS10876.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.556094	0.86231	.	.	ENSG00000213380	ENST00000306875	T	0.61859	0.07	5.86	5.86	0.93980	.	0.085303	0.56097	D	0.000029	T	0.73860	0.3641	M	0.74881	2.28	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.61328	0.887;0.887	T	0.76305	-0.3008	10	0.56958	D	0.05	-1.8093	16.2605	0.82541	1.0:0.0:0.0:0.0	.	470;443	B4DYU2;Q96MW5	.;COG8_HUMAN	Q	443	ENSP00000305459:L443Q	ENSP00000305459:L443Q	L	-	2	0	COG8	67926010	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.903000	0.92573	2.237000	0.73441	0.460000	0.39030	CTG	.		0.597	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
ZNF469	84627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	88497561	88497561	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr16:88497561C>T	ENST00000437464.1	+	2	3599	c.3599C>T	c.(3598-3600)cCt>cTt	p.P1200L	ZNF469_ENST00000565624.1_Missense_Mutation_p.P1228L	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GCCAAGGAGCCTGAAACTGCC	0.637																																					p.P1200L		.											.	.	0			c.C3599T						.						22.0	34.0	30.0					16																	88497561		692	1590	2282	SO:0001583	missense	84627	exon2			AGGAGCCTGAAAC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3599C>T	16.37:g.88497561C>T	ENSP00000402343:p.Pro1200Leu	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	108	28	NM_001127464	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.193775	0.38707	.	.	ENSG00000225614	ENST00000437464	T	0.05447	3.44	4.18	2.04	0.26737	.	.	.	.	.	T	0.02848	0.0085	N	0.19112	0.55	0.09310	N	1	B	0.30584	0.286	B	0.23018	0.043	T	0.41502	-0.9505	9	0.08837	T	0.75	.	2.549	0.04744	0.2331:0.4937:0.0:0.2732	.	1200	Q96JG9	ZN469_HUMAN	L	1200	ENSP00000402343:P1200L	ENSP00000402343:P1200L	P	+	2	0	ZNF469	87025062	0.000000	0.05858	0.006000	0.13384	0.098000	0.18820	-0.045000	0.12003	1.869000	0.54173	0.491000	0.48974	CCT	.		0.637	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
SLC52A1	55065	ucsc.edu;bcgsc.ca	37	17	4937403	4937403	+	Silent	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:4937403G>T	ENST00000424747.1	-	3	1093	c.381C>A	c.(379-381)acC>acA	p.T127T	SLC52A1_ENST00000512825.2_Silent_p.T127T|SLC52A1_ENST00000254853.5_Silent_p.T127T	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	127					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)										TGACATTAGAGGTACAACAGG	0.597																																					p.T127T													.	.	0			c.C381A						.						145.0	143.0	144.0					17																	4937403		2203	4300	6503	SO:0001819	synonymous_variant	55065	exon3			ATTAGAGGTACAA	AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.381C>A	17.37:g.4937403G>T		Somatic	111	2		WXS	Illumina HiSeq		158	46	NM_017986	0	0	2	3	1	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	Silent	SNP	ENST00000424747.1	37	CCDS11066.1																																																																																			.		0.597	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1	NM_017986	
CHRNB1	1140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7350850	7350850	+	Missense_Mutation	SNP	A	A	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:7350850A>T	ENST00000306071.2	+	6	558	c.491A>T	c.(490-492)aAt>aTt	p.N164I	CHRNB1_ENST00000536404.2_Missense_Mutation_p.N92I|RP11-104H15.10_ENST00000575331.1_RNA|CHRNB1_ENST00000576360.1_Missense_Mutation_p.N92I	NM_000747.2	NP_000738.2	P11230	ACHB_HUMAN	cholinergic receptor, nicotinic, beta 1 (muscle)	164					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|neurological system process (GO:0050877)|neuromuscular synaptic transmission (GO:0007274)|postsynaptic membrane organization (GO:0001941)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|ligand-gated ion channel activity (GO:0015276)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(3)	23		Prostate(122;0.157)			Galantamine(DB00674)	GACTGGCAGAATTGCACTATG	0.567																																					p.N164I		.											.	CHRNB1-92	0			c.A491T						.						126.0	112.0	117.0					17																	7350850		2203	4300	6503	SO:0001583	missense	1140	exon6			GGCAGAATTGCAC	X14830	CCDS11106.1	17p13.1	2012-02-11	2006-02-01		ENSG00000170175	ENSG00000170175		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1961	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 1 (muscle)"""	100710	"""cholinergic receptor, nicotinic, beta polypeptide 1 (muscle)"""	CHRNB			Standard	NM_000747		Approved		uc002ghb.3	P11230	OTTHUMG00000108139	ENST00000306071.2:c.491A>T	17.37:g.7350850A>T	ENSP00000304290:p.Asn164Ile	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	166	21	NM_000747	0	0	2	6	4	B7Z5H1|Q8IZ46|Q96FB8	Missense_Mutation	SNP	ENST00000306071.2	37	CCDS11106.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.331856	0.81801	.	.	ENSG00000170175	ENST00000306071;ENST00000536404	T;T	0.80480	-1.38;-1.38	4.96	4.96	0.65561	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.86335	0.5908	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86860	0.2029	10	0.87932	D	0	.	7.3997	0.26956	0.9015:0.0:0.0985:0.0	.	164	P11230	ACHB_HUMAN	I	164;92	ENSP00000304290:N164I;ENSP00000439209:N92I	ENSP00000304290:N164I	N	+	2	0	CHRNB1	7291574	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.939000	0.92951	1.863000	0.54032	0.459000	0.35465	AAT	.		0.567	CHRNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226942.3		
SLC35G6	643664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7386013	7386013	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:7386013G>C	ENST00000412468.2	+	2	825	c.710G>C	c.(709-711)gGc>gCc	p.G237A	POLR2A_ENST00000572844.1_5'Flank|POLR2A_ENST00000322644.6_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	237						integral component of membrane (GO:0016021)											TCTGTGCCAGGCCTCTTTGTG	0.612																																					p.G237A		.											.	.	0			c.G710C						.						52.0	52.0	52.0					17																	7386013		2203	4297	6500	SO:0001583	missense	643664	exon2			TGCCAGGCCTCTT		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.710G>C	17.37:g.7386013G>C	ENSP00000396523:p.Gly237Ala	Somatic	158	0		WXS	Illumina HiSeq	Phase_I	183	25	NM_001102614	0	0	0	0	0		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	G	3.103	-0.184272	0.06340	.	.	ENSG00000181222	ENST00000412468	T	0.49720	0.77	4.06	3.07	0.35406	.	.	.	.	.	T	0.21631	0.0521	N	0.08118	0	0.25938	N	0.982908	B	0.09022	0.002	B	0.14578	0.011	T	0.27468	-1.0073	9	0.02654	T	1	-1.8186	7.3041	0.26436	0.0:0.1871:0.6199:0.193	.	237	P0C7Q6	S35G6_HUMAN	A	237	ENSP00000396523:G237A	ENSP00000396523:G237A	G	+	2	0	SLC35G6	7326737	0.975000	0.34042	0.271000	0.24616	0.720000	0.41350	2.298000	0.43602	0.827000	0.34685	0.467000	0.42956	GGC	.		0.612	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	Somatic	349	16		WXS	Illumina HiSeq		420	30	NM_145301	0	0	4	32	28	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
UTP6	55813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	30219812	30219812	+	Splice_Site	SNP	T	T	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:30219812T>C	ENST00000261708.4	-	5	451	c.314A>G	c.(313-315)gAc>gGc	p.D105G	UTP6_ENST00000490218.2_5'UTR	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	105					rRNA processing (GO:0006364)	nucleolus (GO:0005730)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				TTGAACATCGTCCTGCAAGAA	0.378																																					p.D105G		.											.	UTP6-91	0			c.A314G						.						116.0	93.0	101.0					17																	30219812		2203	4300	6503	SO:0001630	splice_region_variant	55813	exon5			ACATCGTCCTGCA	AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.313-1A>G	17.37:g.30219812T>C		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	76	10	NM_018428	0	0	0	0	0	Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	37	CCDS11269.1	.	.	.	.	.	.	.	.	.	.	T	13.02	2.111575	0.37242	.	.	ENSG00000108651	ENST00000261708	T	0.36699	1.24	5.44	5.44	0.79542	.	0.233979	0.51477	D	0.000100	T	0.24084	0.0583	N	0.21617	0.685	0.54753	D	0.999983	B;B	0.29766	0.129;0.256	B;B	0.24155	0.021;0.051	T	0.06698	-1.0812	10	0.15952	T	0.53	-22.7625	15.1464	0.72657	0.0:0.0:0.0:1.0	.	105;105	B4DSL9;Q9NYH9	.;UTP6_HUMAN	G	105	ENSP00000261708:D105G	ENSP00000261708:D105G	D	-	2	0	UTP6	27243925	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	3.602000	0.54066	2.057000	0.61298	0.454000	0.30748	GAC	.		0.378	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428	Missense_Mutation
SLC25A19	60386	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73273550	73273550	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:73273550G>C	ENST00000402418.3	-	5	1567	c.658C>G	c.(658-660)Ctg>Gtg	p.L220V	SLC25A19_ENST00000375261.4_Missense_Mutation_p.L163V|SLC25A19_ENST00000416858.2_Missense_Mutation_p.L220V|SLC25A19_ENST00000442286.2_Missense_Mutation_p.L220V|SLC25A19_ENST00000580994.1_Missense_Mutation_p.L220V|SLC25A19_ENST00000320362.3_Missense_Mutation_p.L220V			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19	220					deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			CCACAAAGCAGGTTTTGGAGG	0.512																																					p.L220V		.											.	SLC25A19-91	0			c.C658G						.						83.0	75.0	78.0					17																	73273550		2203	4300	6503	SO:0001583	missense	60386	exon6			AAAGCAGGTTTTG		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.658C>G	17.37:g.73273550G>C	ENSP00000385312:p.Leu220Val	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	105	27	NM_001126122	0	0	16	22	6	E9PF74|Q6V9R7	Missense_Mutation	SNP	ENST00000402418.3	37	CCDS11720.1	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031943	0.54790	.	.	ENSG00000125454	ENST00000416858;ENST00000442286;ENST00000320362;ENST00000402418;ENST00000375261	D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5	5.35	2.3	0.28687	Mitochondrial carrier domain (2);	0.067029	0.64402	D	0.000011	D	0.82435	0.5036	L	0.45581	1.43	0.45930	D	0.998765	D;P	0.61697	0.99;0.935	P;P	0.62014	0.897;0.513	T	0.81187	-0.1047	10	0.62326	D	0.03	-13.3282	9.0336	0.36273	0.3003:0.0:0.6997:0.0	.	163;220	E9PF74;Q9HC21	.;TPC_HUMAN	V	220;220;220;220;163	ENSP00000397818:L220V;ENSP00000402202:L220V;ENSP00000319574:L220V;ENSP00000385312:L220V;ENSP00000364410:L163V	ENSP00000319574:L220V	L	-	1	2	SLC25A19	70785145	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.657000	0.61490	0.648000	0.30732	-0.157000	0.13467	CTG	.		0.512	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447282.1	NM_021734	
PIGN	23556	bcgsc.ca	37	18	59807700	59807700	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr18:59807700G>A	ENST00000357637.5	-	12	1391	c.976C>T	c.(976-978)Cca>Tca	p.P326S	PIGN_ENST00000400334.3_Missense_Mutation_p.P326S	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	326					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				GTCATCAATGGTGCAATATCA	0.303																																					p.P326S													.	PIGN-227	0			c.C976T						.						57.0	51.0	53.0					18																	59807700		1828	4080	5908	SO:0001583	missense	23556	exon12			TCAATGGTGCAAT	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.976C>T	18.37:g.59807700G>A	ENSP00000350263:p.Pro326Ser	Somatic	97	0		WXS	Illumina HiSeq	Phase_1	99	6	NM_176787	0	0	0	0	0	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	37	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569012	0.86439	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.46063	0.88;0.88	5.72	5.72	0.89469	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.054258	0.85682	D	0.000000	T	0.62060	0.2397	L	0.58583	1.82	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.69479	0.946;0.964	T	0.56141	-0.8028	9	.	.	.	-11.9738	19.8454	0.96706	0.0:0.0:1.0:0.0	.	326;326	B2RCI8;O95427	.;PIGN_HUMAN	S	326	ENSP00000350263:P326S;ENSP00000383188:P326S	.	P	-	1	0	PIGN	57958680	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.060000	0.64312	2.850000	0.98022	0.650000	0.86243	CCA	.		0.303	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
CC2D1A	54862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14028999	14028999	+	Missense_Mutation	SNP	G	G	T	rs368763604		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:14028999G>T	ENST00000318003.7	+	7	1106	c.865G>T	c.(865-867)Gtg>Ttg	p.V289L	CC2D1A_ENST00000589606.1_Missense_Mutation_p.V289L	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	289	Pro-rich.				positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			ACACTTCCGCGTGGCTAAGGT	0.632																																					p.V289L		.											.	CC2D1A-90	0			c.G865T						.						9.0	11.0	10.0					19																	14028999		2035	4174	6209	SO:0001583	missense	54862	exon7			TTCCGCGTGGCTA	AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.865G>T	19.37:g.14028999G>T	ENSP00000313601:p.Val289Leu	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	156	32	NM_017721	0	0	0	0	0	Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	ENST00000318003.7	37	CCDS42512.1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.760509	0.31137	.	.	ENSG00000132024	ENST00000318003;ENST00000397486	T	0.23147	1.92	5.38	4.32	0.51571	Domain of unknown function DM14 (1);	0.244121	0.35291	N	0.003314	T	0.20007	0.0481	L	0.47716	1.5	0.34644	D	0.72099	P;B;P	0.43909	0.543;0.33;0.821	B;B;B	0.36719	0.198;0.126;0.231	T	0.30679	-0.9970	10	0.30854	T	0.27	-20.8199	10.4966	0.44780	0.0918:0.0:0.9082:0.0	.	289;289;43	Q6P1N0-2;Q6P1N0;C9J1T8	.;C2D1A_HUMAN;.	L	289;43	ENSP00000313601:V289L	ENSP00000313601:V289L	V	+	1	0	CC2D1A	13889999	0.936000	0.31750	0.936000	0.37596	0.192000	0.23643	1.812000	0.38952	1.235000	0.43724	0.655000	0.94253	GTG	.		0.632	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457954.1	NM_017721	
GRAMD1A	57655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	35505160	35505160	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:35505160C>G	ENST00000317991.5	+	10	1130	c.938C>G	c.(937-939)cCg>cGg	p.P313R	CTD-2527I21.14_ENST00000605640.1_RNA|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.P306R|GRAMD1A_ENST00000504615.2_Missense_Mutation_p.P79R|GRAMD1A_ENST00000599564.1_Missense_Mutation_p.P400R	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	313						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			ACAGTGACCCCGGTGGCTGAA	0.652																																					p.P313R		.											.	GRAMD1A-90	0			c.C938G						.						48.0	61.0	57.0					19																	35505160		2097	4240	6337	SO:0001583	missense	57655	exon10			TGACCCCGGTGGC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.938C>G	19.37:g.35505160C>G	ENSP00000441032:p.Pro313Arg	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	168	21	NM_020895	0	0	61	85	24	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	37	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536733	0.65085	.	.	ENSG00000089351	ENST00000453966;ENST00000504615;ENST00000317991;ENST00000411896	T;T;T	0.47177	0.85;1.89;1.9	4.44	4.44	0.53790	.	0.367080	0.24580	N	0.037308	T	0.54647	0.1871	L	0.34521	1.04	0.50039	D	0.999843	P;D;D;D;D	0.76494	0.484;0.997;0.999;0.964;0.997	B;P;D;P;D	0.75484	0.215;0.901;0.986;0.694;0.963	T	0.44174	-0.9345	10	0.18276	T	0.48	.	14.5907	0.68362	0.0:1.0:0.0:0.0	.	313;313;79;306;400	Q96CP6-3;Q96CP6;B3KQF7;Q96CP6-2;F5GZ02	.;GRM1A_HUMAN;.;.;.	R	400;79;313;306	ENSP00000423728:P79R;ENSP00000441032:P313R;ENSP00000439267:P306R	ENSP00000441032:P313R	P	+	2	0	GRAMD1A	40197000	0.272000	0.24172	0.963000	0.40424	0.951000	0.60555	1.956000	0.40382	2.309000	0.77851	0.491000	0.48974	CCG	.		0.652	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
FCGBP	8857	bcgsc.ca	37	19	40374023	40374023	+	Missense_Mutation	SNP	C	C	T	rs561293450	byFrequency	TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:40374023C>T	ENST00000221347.6	-	26	12062	c.12055G>A	c.(12055-12057)Gtg>Atg	p.V4019M	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4019	Cys-rich.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGGCACACCACGACTTTACCC	0.642													C|||	36	0.0071885	0.0121	0.0029	5008	,	,		23567	0.004		0.0119	False		,,,				2504	0.002				p.V4019M													.	FCGBP-98	0			c.G12055A						.						13.0	14.0	13.0					19																	40374023		2141	4205	6346	SO:0001583	missense	8857	exon26			ACACCACGACTTT	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12055G>A	19.37:g.40374023C>T	ENSP00000221347:p.Val4019Met	Somatic	826	6		WXS	Illumina HiSeq	Phase_1	1115	22	NM_003890	0	0	1	1	0	O95784	Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1	.	.	.	.	.	.	.	.	.	.	C	6.436	0.448534	0.12223	.	.	ENSG00000090920	ENST00000221347	T	0.06608	3.28	2.99	-5.98	0.02220	von Willebrand factor, type C (1);	.	.	.	.	T	0.03520	0.0101	L	0.31476	0.935	0.09310	N	1	B	0.29766	0.256	B	0.14578	0.011	T	0.30060	-0.9991	9	0.34782	T	0.22	.	6.2908	0.21059	0.0:0.3427:0.2739:0.3834	.	4019	Q9Y6R7	FCGBP_HUMAN	M	4019	ENSP00000221347:V4019M	ENSP00000221347:V4019M	V	-	1	0	FCGBP	45065863	0.000000	0.05858	0.010000	0.14722	0.077000	0.17291	-1.245000	0.02899	-1.918000	0.01072	-0.680000	0.03767	GTG	CGA|0.500;TGC|0.500		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
CYP2A6	1548	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41350548	41350548	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:41350548G>T	ENST00000301141.5	-	8	1311	c.1291C>A	c.(1291-1293)Ccc>Acc	p.P431T	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	431					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ATGGAAAAGGGCACAAAAGCA	0.567																																					p.P431T													.	CYP2A6-92	0			c.C1291A						.						160.0	150.0	153.0					19																	41350548		2203	4300	6503	SO:0001583	missense	1548	exon8			AAAAGGGCACAAA	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.1291C>A	19.37:g.41350548G>T	ENSP00000301141:p.Pro431Thr	Somatic	385	2		WXS	Illumina HiSeq	Phase_I	360	49	NM_000762	0	0	0	0	0	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	.	.	.	.	.	.	.	.	.	.	-	13.72	2.322377	0.41096	.	.	ENSG00000255974	ENST00000301141	D	0.83591	-1.74	3.16	1.88	0.25563	.	0.000000	0.85682	U	0.000000	D	0.88343	0.6411	M	0.70595	2.14	0.26111	N	0.980682	D	0.89917	1.0	D	0.81914	0.995	T	0.79165	-0.1916	10	0.72032	D	0.01	.	10.5837	0.45269	0.0:0.3621:0.6378:0.0	.	431	P11509	CP2A6_HUMAN	T	431	ENSP00000301141:P431T	ENSP00000301141:P431T	P	-	1	0	CYP2A6	46042388	1.000000	0.71417	0.646000	0.29493	0.731000	0.41821	3.222000	0.51223	1.487000	0.48415	0.379000	0.24179	CCC	.		0.567	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
ZNF235	9310	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44792844	44792844	+	Silent	SNP	T	T	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:44792844T>C	ENST00000291182.4	-	5	846	c.744A>G	c.(742-744)gtA>gtG	p.V248V	ZNF235_ENST00000589799.1_Intron|ZNF235_ENST00000589248.1_Intron	NM_004234.4	NP_004225.3	Q14590	ZN235_HUMAN	zinc finger protein 235	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29		Prostate(69;0.0352)|all_neural(266;0.116)				TAAGAGGTGATACCTTTAGGG	0.378																																					p.V248V													.	ZNF235-137	0			c.A744G						.						107.0	107.0	107.0					19																	44792844		2203	4300	6503	SO:0001819	synonymous_variant	9310	exon5			AGGTGATACCTTT	X78929	CCDS33048.1	19q13.2	2013-01-08	2002-11-04	2002-11-08	ENSG00000159917	ENSG00000159917		"""Zinc fingers, C2H2-type"", ""-"""	12866	protein-coding gene	gene with protein product		604749	"""zinc finger protein homologous to Zfp93 in mouse"""	ZNF270, ZFP93		7865130, 9570955	Standard	NM_004234		Approved	HZF6, ANF270	uc002oza.4	Q14590		ENST00000291182.4:c.744A>G	19.37:g.44792844T>C		Somatic	133	1		WXS	Illumina HiSeq	Phase_I	167	41	NM_004234	0	0	0	0	0	B4DTQ7|O14898|O14899|Q17RR8	Silent	SNP	ENST00000291182.4	37	CCDS33048.1																																																																																			.		0.378	ZNF235-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460732.1		
ZNF154	7710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58213806	58213806	+	Missense_Mutation	SNP	T	T	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:58213806T>C	ENST00000512439.2	-	3	707	c.511A>G	c.(511-513)Agc>Ggc	p.S171G	ZNF154_ENST00000426889.1_Missense_Mutation_p.S171G|ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron			Q13106	ZN154_HUMAN	zinc finger protein 154	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(7)|lung(3)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TAGCTTTTGCTAAAGGATTTC	0.433																																					p.S171G		.											.	ZNF154-90	0			c.A511G						.						215.0	215.0	215.0					19																	58213806		2165	4285	6450	SO:0001583	missense	7710	exon3			TTTTGCTAAAGGA	U20648	CCDS42639.1	19q13.4	2013-01-08	2006-08-22		ENSG00000179909	ENSG00000179909		"""Zinc fingers, C2H2-type"", ""-"""	12939	protein-coding gene	gene with protein product		604085	"""zinc finger protein 154 (pHZ-92)"""			7557990	Standard	XR_243957		Approved	pHZ-92	uc010euf.3	Q13106	OTTHUMG00000140375	ENST00000512439.2:c.511A>G	19.37:g.58213806T>C	ENSP00000421258:p.Ser171Gly	Somatic	335	0		WXS	Illumina HiSeq	Phase_I	296	41	NM_001085384	0	0	0	0	0	A7MCY3|Q8IVG7|Q8NAR0	Missense_Mutation	SNP	ENST00000512439.2	37	CCDS42639.1	.	.	.	.	.	.	.	.	.	.	T	15.85	2.953447	0.53293	.	.	ENSG00000179909	ENST00000512439;ENST00000426889;ENST00000396157	T;T	0.07688	3.17;3.17	3.03	2.0	0.26442	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08044	0.0201	L	0.55834	1.745	0.09310	N	1	B	0.15141	0.012	B	0.04013	0.001	T	0.34825	-0.9813	9	0.52906	T	0.07	.	2.5259	0.04691	0.2336:0.1338:0.0:0.6326	.	171	Q13106	ZN154_HUMAN	G	171;171;42	ENSP00000421258:S171G;ENSP00000442370:S171G	ENSP00000440907:S42G	S	-	1	0	ZNF154	62905618	0.001000	0.12720	0.015000	0.15790	0.941000	0.58515	0.218000	0.17622	0.559000	0.29153	0.459000	0.35465	AGC	.		0.433	ZNF154-002	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277102.2		
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		.											.	.	0			c.G965A						.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	106	14	NM_001144989	0	0	2	2	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	hgsc.bcm.edu	37	19	58385799	58385799	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr19:58385799C>T	ENST00000435989.2	-	3	1193	c.959G>A	c.(958-960)gGg>gAg	p.G320E	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	320					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G320E(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AGGTCTTTTCCCAGTGTGAAC	0.358																																					p.G320E		.											.	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.G959A						.						14.0	11.0	12.0					19																	58385799		687	1560	2247	SO:0001583	missense	730051	exon3			CTTTTCCCAGTGT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.959G>A	19.37:g.58385799C>T	ENSP00000410545:p.Gly320Glu	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	96	14	NM_001144989	0	0	2	2	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	7.488	0.650166	0.14516	.	.	ENSG00000204514	ENST00000435989	T	0.25749	1.78	2.37	-4.23	0.03789	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29389	0.0732	L	0.41824	1.3	0.09310	N	0.999992	D	0.76494	0.999	D	0.65573	0.936	T	0.23261	-1.0193	9	0.66056	D	0.02	.	2.112	0.03705	0.1507:0.4859:0.1487:0.2147	.	320	B7Z6K7	ZN814_HUMAN	E	320	ENSP00000410545:G320E	ENSP00000410545:G320E	G	-	2	0	ZNF814	63077611	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.267000	0.08619	-0.341000	0.08376	-3.844000	0.00018	GGG	.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
MFSD9	84804	broad.mit.edu	37	2	103343361	103343361	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr2:103343361G>A	ENST00000258436.5	-	4	413	c.370C>T	c.(370-372)Ctc>Ttc	p.L124F		NM_032718.3	NP_116107.3	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing 9	124					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(3)|large_intestine(7)|liver(1)|lung(6)|ovary(2)|skin(1)	20						CCGAGAAGGAGATAGCCCAGA	0.488																																					p.L124F													.	MFSD9-155	0			c.C370T						.						81.0	79.0	80.0					2																	103343361		2203	4300	6503	SO:0001583	missense	84804	exon4			GAAGGAGATAGCC		CCDS2063.1	2q12.1	2007-01-12			ENSG00000135953	ENSG00000135953			28158	protein-coding gene	gene with protein product							Standard	NM_032718		Approved	MGC11332	uc002tcb.2	Q8NBP5	OTTHUMG00000130781	ENST00000258436.5:c.370C>T	2.37:g.103343361G>A	ENSP00000258436:p.Leu124Phe	Somatic	251	4		WXS	Illumina HiSeq	Phase_I	257	7	NM_032718	0	0	1	1	0	Q4ZG89|Q53TU0|Q96GQ4|Q9BRI8	Missense_Mutation	SNP	ENST00000258436.5	37	CCDS2063.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035350	0.54896	.	.	ENSG00000135953	ENST00000258436	T	0.61627	0.09	5.34	4.45	0.53987	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.326073	0.30704	N	0.009046	T	0.48732	0.1516	M	0.69248	2.105	0.27141	N	0.96166	B	0.16802	0.019	B	0.19391	0.025	T	0.27773	-1.0064	10	0.22706	T	0.39	-21.7696	4.4903	0.11810	0.1674:0.2193:0.6133:0.0	.	124	Q8NBP5	MFSD9_HUMAN	F	124	ENSP00000258436:L124F	ENSP00000258436:L124F	L	-	1	0	MFSD9	102709793	1.000000	0.71417	0.495000	0.27527	0.664000	0.39144	4.031000	0.57267	2.663000	0.90544	0.655000	0.94253	CTC	.		0.488	MFSD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253295.2	NM_032718	
ZEB2	9839	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	145157390	145157390	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr2:145157390C>T	ENST00000558170.2	-	8	2548	c.1364G>A	c.(1363-1365)aGt>aAt	p.S455N	ZEB2_ENST00000409487.3_Missense_Mutation_p.S455N|ZEB2_ENST00000303660.4_Missense_Mutation_p.S455N|ZEB2_ENST00000539609.3_Missense_Mutation_p.S431N	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	455	SMAD-MH2 binding domain. {ECO:0000250}.				cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		ACTTAAATTACTATTCATGGT	0.438																																					p.S455N	Melanoma(33;1235 1264 5755 16332)												.	ZEB2-297	0			c.G1364A						.						75.0	78.0	77.0					2																	145157390		2203	4300	6503	SO:0001583	missense	9839	exon8			AAATTACTATTCA	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1364G>A	2.37:g.145157390C>T	ENSP00000454157:p.Ser455Asn	Somatic	137	1		WXS	Illumina HiSeq	Phase_I	99	13	NM_014795	0	0	0	1	1	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	C	0.218	-1.030702	0.02045	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487;ENST00000427902	T;T;T;T	0.11495	2.79;2.77;2.77;2.88	5.53	5.53	0.82687	.	0.037192	0.85682	D	0.000000	T	0.06962	0.0177	N	0.11927	0.2	0.48135	D	0.999594	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.10450	0.005;0.001;0.001;0.005	T	0.14254	-1.0479	10	0.02654	T	1	-8.897	19.4645	0.94932	0.0:1.0:0.0:0.0	.	431;320;454;455	F5H814;Q53TD9;A0JP08;O60315	.;.;.;ZEB2_HUMAN	N	431;455;455;455	ENSP00000443792:S431N;ENSP00000302501:S455N;ENSP00000386854:S455N;ENSP00000395496:S455N	ENSP00000302501:S455N	S	-	2	0	ZEB2	144873860	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.709000	0.61867	2.587000	0.87381	0.655000	0.94253	AGT	.		0.438	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
IKZF2	22807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	213872808	213872808	+	Splice_Site	SNP	C	C	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr2:213872808C>A	ENST00000434687.1	-	9	1166	c.857G>T	c.(856-858)gGg>gTg	p.G286V	IKZF2_ENST00000421754.2_Splice_Site_p.G212V|IKZF2_ENST00000457361.1_Splice_Site_p.G286V|IKZF2_ENST00000342002.2_Splice_Site_p.G292V|IKZF2_ENST00000374327.4_Splice_Site_p.G141V|IKZF2_ENST00000451136.2_Splice_Site_p.G214V|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000374319.4_Splice_Site_p.G260V|IKZF2_ENST00000413091.3_3'UTR			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	286					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GAGCTTTTCCCCTGGAAGGGA	0.373																																					p.G286V		.											.	IKZF2-226	0			c.G857T						.						35.0	35.0	35.0					2																	213872808		2203	4300	6503	SO:0001630	splice_region_variant	22807	exon8			TTTTCCCCTGGAA	AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.857-1G>T	2.37:g.213872808C>A		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	71	12	NM_016260	0	0	0	0	0	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	ENST00000434687.1	37	CCDS2395.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154388	0.57259	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327	T;T;T;T;T;T;T	0.24350	2.74;2.71;2.74;2.88;2.86;3.06;1.86	5.83	5.83	0.93111	.	0.072285	0.64402	D	0.000018	T	0.60090	0.2242	M	0.88979	2.995	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;0.999;0.999	T	0.66248	-0.5971	10	0.87932	D	0	.	18.2957	0.90145	0.0:1.0:0.0:0.0	.	214;212;141;260;286;64	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	V	286;292;286;260;214;212;141	ENSP00000410447:G286V;ENSP00000342876:G292V;ENSP00000412869:G286V;ENSP00000363439:G260V;ENSP00000395203:G214V;ENSP00000399574:G212V;ENSP00000363447:G141V	ENSP00000342876:G292V	G	-	2	0	IKZF2	213581053	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	5.731000	0.68554	2.750000	0.94351	0.655000	0.94253	GGG	.		0.373	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256593.3	NM_016260	Missense_Mutation
PER2	8864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	239162231	239162231	+	Silent	SNP	G	G	A	rs566281173	byFrequency	TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr2:239162231G>A	ENST00000254657.3	-	19	2712	c.2433C>T	c.(2431-2433)acC>acT	p.T811T	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	811					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CCCCAGATCCGGTGCTCTCAG	0.572													g|||	2	0.000399361	0.0	0.0	5008	,	,		14310	0.0		0.0	False		,,,				2504	0.002				p.T811T		.											.	PER2-154	0			c.C2433T						.						12.0	15.0	14.0					2																	239162231		2199	4298	6497	SO:0001819	synonymous_variant	8864	exon19			AGATCCGGTGCTC	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.2433C>T	2.37:g.239162231G>A		Somatic	35	0		WXS	Illumina HiSeq	Phase_I	53	12	NM_022817	0	0	1	2	1	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Silent	SNP	ENST00000254657.3	37	CCDS2528.1																																																																																			.		0.572	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
IDH3B	3420	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	2639399	2639399	+	Nonstop_Mutation	SNP	A	A	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr20:2639399A>C	ENST00000380843.4	-	12	1186	c.1156T>G	c.(1156-1158)Tag>Gag	p.*386E	SNORD86_ENST00000391196.1_RNA|IDH3B_ENST00000380851.5_Intron|SNORD56_ENST00000413522.1_RNA|IDH3B_ENST00000488299.1_5'UTR|SNORD57_ENST00000448188.1_RNA	NM_006899.3	NP_008830.2	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3 (NAD+) beta	0					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|NADH metabolic process (GO:0006734)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(1)|endometrium(3)|kidney(2)|lung(7)|prostate(1)	14						AAAGGGCTCTAGCTCCCTTTA	0.552																																					p.X386E		.											.	IDH3B-226	0			c.T1156G						.						177.0	154.0	162.0					20																	2639399		2203	4300	6503	SO:0001578	stop_lost	3420	exon12			GGCTCTAGCTCCC		CCDS13031.1, CCDS13032.1, CCDS74696.1	20p13	2013-02-14			ENSG00000101365	ENSG00000101365	1.1.1.41		5385	protein-coding gene	gene with protein product		604526				10575215	Standard	NM_006899		Approved	RP46	uc002wgp.4	O43837	OTTHUMG00000031699	ENST00000380843.4:c.1156T>G	20.37:g.2639399A>C	ENSP00000370223:p.*386Glnext*29	Somatic	276	0		WXS	Illumina HiSeq	Phase_I	212	18	NM_006899	0	0	79	80	1	B2RDR1|D3DVX2|D3DVX3|O95106|Q5JXS8|Q9NQ06|Q9NQ07|Q9NUZ0|Q9UEX0|Q9UG99	Missense_Mutation	SNP	ENST00000380843.4	37	CCDS13032.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.913714	0.52439	.	.	ENSG00000101365	ENST00000380843;ENST00000435594	.	.	.	5.69	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5939	0.33703	0.9128:0.0:0.0872:0.0	.	.	.	.	E	386;234	.	.	X	-	1	0	IDH3B	2587399	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	4.484000	0.60271	0.979000	0.38497	0.477000	0.44152	TAG	.		0.552	IDH3B-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077613.1		
FRG1B	284802	bcgsc.ca	37	20	29623215	29623215	+	Silent	SNP	G	G	A	rs77485836	byFrequency	TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr20:29623215G>A	ENST00000278882.3	+	3	407	c.27G>A	c.(25-27)tcG>tcA	p.S9S	FRG1B_ENST00000439954.2_Missense_Mutation_p.D11N|FRG1B_ENST00000358464.4_Silent_p.S9S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	9										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						ACATGCACTCGACAATGGTCT	0.393													.|||	138	0.0275559	0.0106	0.0576	5008	,	,		49196	0.0238		0.0268	False		,,,				2504	0.0337				.													.	FRG1B-22	0			.						.																																			SO:0001819	synonymous_variant	284802	.			GCACTCGACAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.27G>A	20.37:g.29623215G>A		Somatic	809	29		WXS	Illumina HiSeq	Phase_1	731	43	.	0	0	46	48	2	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	10.79	1.450717	0.26074	.	.	ENSG00000149531	ENST00000439954	T	0.63913	-0.07	1.93	1.93	0.25924	.	.	.	.	.	T	0.67135	0.2861	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68945	-0.5275	6	0.54805	T	0.06	.	9.8943	0.41309	0.0:0.0:1.0:0.0	.	.	.	.	N	11	ENSP00000408863:D11N	ENSP00000408863:D11N	D	+	1	0	FRG1B	28236876	1.000000	0.71417	0.999000	0.59377	0.081000	0.17604	8.270000	0.89880	1.399000	0.46721	0.423000	0.28283	GAC	G|0.500;A|0.500		0.393	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SOGA1	140710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	35443624	35443624	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr20:35443624C>T	ENST00000357779.3	-	5	1833	c.1507G>A	c.(1507-1509)Gaa>Aaa	p.E503K	SOGA1_ENST00000237536.4_Missense_Mutation_p.E741K|SOGA1_ENST00000456801.2_Missense_Mutation_p.E344K|SOGA1_ENST00000279034.6_Missense_Mutation_p.E503K			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	503					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						TCCTGCTGTTCCTTGACAGAG	0.577																																					p.E741K		.											.	.	0			c.G2221A						.						84.0	95.0	91.0					20																	35443624		2173	4275	6448	SO:0001583	missense	140710	exon5			GCTGTTCCTTGAC	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1507G>A	20.37:g.35443624C>T	ENSP00000350424:p.Glu503Lys	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	85	17	NM_080627	0	0	0	0	0	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	C	18.14	3.556991	0.65425	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.22743	1.99;1.94;1.98;1.98	5.72	5.72	0.89469	.	0.594212	0.17064	N	0.188438	T	0.45677	0.1354	M	0.63843	1.955	0.52501	D	0.999954	D	0.89917	1.0	D	0.87578	0.998	T	0.04991	-1.0913	10	0.27082	T	0.32	-37.714	18.6578	0.91460	0.0:1.0:0.0:0.0	.	503	O94964-4	.	K	741;503;344;503	ENSP00000237536:E741K;ENSP00000279034:E503K;ENSP00000413886:E344K;ENSP00000350424:E503K	ENSP00000237536:E741K	E	-	1	0	KIAA0889	34877038	1.000000	0.71417	0.999000	0.59377	0.042000	0.13812	3.774000	0.55341	2.706000	0.92434	0.561000	0.74099	GAA	.		0.577	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
DNAH1	25981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	52429465	52429465	+	Missense_Mutation	SNP	T	T	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:52429465T>A	ENST00000420323.2	+	69	11371	c.11110T>A	c.(11110-11112)Tcc>Acc	p.S3704T		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	3769					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTCTGCCATCTCCCTGGGCCA	0.627																																					p.S3704T		.											.	DNAH1-67	0			c.T11110A						.						36.0	38.0	37.0					3																	52429465		1924	4124	6048	SO:0001583	missense	25981	exon69			GCCATCTCCCTGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.11110T>A	3.37:g.52429465T>A	ENSP00000401514:p.Ser3704Thr	Somatic	207	0		WXS	Illumina HiSeq	Phase_I	199	36	NM_015512	0	0	1	1	0	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	37	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.840907	0.71488	.	.	ENSG00000114841	ENST00000420323;ENST00000273600	T	0.14022	2.54	4.38	4.38	0.52667	.	0.000000	0.64402	D	0.000005	T	0.57110	0.2031	H	0.99435	4.565	0.45366	D	0.998355	D;D	0.89917	1.0;0.99	D;D	0.85130	0.997;0.979	T	0.76963	-0.2764	10	0.87932	D	0	.	13.7712	0.63026	0.0:0.0:0.0:1.0	.	3704;3769	C9JXH6;Q9P2D7-2	.;.	T	3704;457	ENSP00000401514:S3704T	ENSP00000273600:S457T	S	+	1	0	DNAH1	52404505	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.531000	0.81973	1.837000	0.53436	0.533000	0.62120	TCC	.		0.627	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
LRIG1	26018	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	66436541	66436541	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:66436541C>G	ENST00000273261.3	-	13	2177	c.1653G>C	c.(1651-1653)caG>caC	p.Q551H	SLC25A26_ENST00000536651.1_Intron|LRIG1_ENST00000383703.3_Missense_Mutation_p.Q575H|LRIG1_ENST00000496559.2_5'UTR	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	551	Ig-like C2-type 1.				innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CTTCCCCGTCCTGCGCGTGGA	0.567																																					p.Q551H													.	LRIG1-230	0			c.G1653C						.						230.0	196.0	207.0					3																	66436541		2203	4300	6503	SO:0001583	missense	26018	exon13			CCCGTCCTGCGCG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.1653G>C	3.37:g.66436541C>G	ENSP00000273261:p.Gln551His	Somatic	407	1		WXS	Illumina HiSeq	Phase_I	339	52	NM_015541	0	0	5	8	3	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	.	.	.	.	.	.	.	.	.	.	C	11.80	1.748197	0.30955	.	.	ENSG00000144749	ENST00000273261;ENST00000383703;ENST00000383702	T;T	0.39229	1.09;1.09	6.17	6.17	0.99709	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.293434	0.33075	N	0.005306	T	0.32675	0.0837	L	0.39898	1.24	0.45995	D	0.998806	B;P;B	0.38148	0.095;0.62;0.116	B;B;B	0.33568	0.045;0.166;0.044	T	0.15178	-1.0446	10	0.62326	D	0.03	.	10.391	0.44168	0.0:0.7956:0.1354:0.0689	.	575;551;551	Q96JA1-2;Q5XWD3;Q96JA1	.;.;LRIG1_HUMAN	H	551;575;454	ENSP00000273261:Q551H;ENSP00000373208:Q575H	ENSP00000273261:Q551H	Q	-	3	2	LRIG1	66519231	0.970000	0.33590	1.000000	0.80357	0.068000	0.16541	0.512000	0.22755	2.941000	0.99782	0.655000	0.94253	CAG	.		0.567	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
EPHA3	2042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	89478285	89478285	+	Missense_Mutation	SNP	A	A	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:89478285A>C	ENST00000336596.2	+	12	2329	c.2104A>C	c.(2104-2106)Atg>Ctg	p.M702L	EPHA3_ENST00000494014.1_Missense_Mutation_p.M702L	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	702	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CACAGAATACATGGAGAATGG	0.299										TSP Lung(6;0.00050)																											p.M702L		.											.	EPHA3-1500	0			c.A2104C						.						111.0	116.0	114.0					3																	89478285		2203	4299	6502	SO:0001583	missense	2042	exon12			GAATACATGGAGA	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2104A>C	3.37:g.89478285A>C	ENSP00000337451:p.Met702Leu	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	77	11	NM_005233	0	0	0	0	0	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.781520	0.90282	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.62639	0.01;0.01	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70228	0.3200	L	0.39020	1.185	0.80722	D	1	P	0.50710	0.938	D	0.65773	0.938	T	0.67964	-0.5534	9	.	.	.	.	16.2237	0.82280	1.0:0.0:0.0:0.0	.	702	P29320	EPHA3_HUMAN	L	702	ENSP00000337451:M702L;ENSP00000419190:M702L	.	M	+	1	0	EPHA3	89560975	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.287000	0.95975	2.289000	0.77006	0.482000	0.46254	ATG	.		0.299	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
ATR	545	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	142279142	142279142	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:142279142G>T	ENST00000350721.4	-	6	1625	c.1504C>A	c.(1504-1506)Ctg>Atg	p.L502M	ATR_ENST00000383101.3_Intron	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	502					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ACAGTACACAGAGCAGTCAGT	0.378								Other conserved DNA damage response genes																													p.L502M													.	ATR-1139	0			c.C1504A						.						141.0	138.0	139.0					3																	142279142		2203	4300	6503	SO:0001583	missense	545	exon6			TACACAGAGCAGT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1504C>A	3.37:g.142279142G>T	ENSP00000343741:p.Leu502Met	Somatic	244	2		WXS	Illumina HiSeq	Phase_I	224	29	NM_001184	0	0	0	1	1	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	37	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.493824	0.64186	.	.	ENSG00000175054	ENST00000350721	T	0.03982	3.74	5.71	2.98	0.34508	Armadillo-type fold (1);	0.445732	0.20701	N	0.087280	T	0.10680	0.0261	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.65233	0.933	T	0.02625	-1.1132	10	0.59425	D	0.04	-8.5525	10.5221	0.44924	0.2672:0.0:0.7328:0.0	.	502	Q13535	ATR_HUMAN	M	502	ENSP00000343741:L502M	ENSP00000343741:L502M	L	-	1	2	ATR	143761832	0.999000	0.42202	0.998000	0.56505	0.979000	0.70002	0.525000	0.22956	0.358000	0.24211	0.585000	0.79938	CTG	.		0.378	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
CP	1356	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	148924070	148924070	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:148924070T>G	ENST00000264613.6	-	6	1355	c.1093A>C	c.(1093-1095)Aat>Cat	p.N365H		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	365					cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CCACGGATATTATCCTTTGAT	0.408																																					p.N365H		.											.	CP-515	0			c.A1093C						.						140.0	137.0	138.0					3																	148924070		2203	4300	6503	SO:0001583	missense	1356	exon6			GGATATTATCCTT	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1093A>C	3.37:g.148924070T>G	ENSP00000264613:p.Asn365His	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	112	10	NM_000096	0	0	3	3	0	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	37	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	T	11.00	1.511691	0.27036	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.99239	-5.04;-5.61	5.81	-5.54	0.02544	.	1.443030	0.03609	N	0.234542	D	0.97785	0.9273	L	0.53249	1.67	0.09310	N	1	B;B;B;B	0.28128	0.0;0.201;0.0;0.0	B;B;B;B	0.24848	0.0;0.056;0.0;0.0	D	0.94485	0.7696	10	0.39692	T	0.17	0.0553	13.1324	0.59391	0.0:0.1357:0.1004:0.7639	.	365;365;365;365	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	H	365;148	ENSP00000264613:N365H;ENSP00000420545:N148H	ENSP00000264613:N365H	N	-	1	0	CP	150406760	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.776000	0.04674	-1.021000	0.03350	-0.242000	0.12053	AAT	.		0.408	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
ABCC5	10057	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183732125	183732125	+	Missense_Mutation	SNP	C	C	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:183732125C>G	ENST00000334444.6	-	2	296	c.56G>C	c.(55-57)aGt>aCt	p.S19T	ABCC5_ENST00000446941.2_Missense_Mutation_p.S19T|ABCC5_ENST00000427120.2_Missense_Mutation_p.S19T|ABCC5_ENST00000392579.2_Missense_Mutation_p.S19T|ABCC5_ENST00000382494.2_Missense_Mutation_p.S19T|ABCC5_ENST00000265586.6_Missense_Mutation_p.S19T|ABCC5-AS1_ENST00000422946.1_RNA	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	19					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	CTCCCTCACACTTCTATACCC	0.483																																					p.S19T													.	ABCC5-137	0			c.G56C						.						141.0	126.0	131.0					3																	183732125		2203	4300	6503	SO:0001583	missense	10057	exon2			CTCACACTTCTAT	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.56G>C	3.37:g.183732125C>G	ENSP00000333926:p.Ser19Thr	Somatic	164	2		WXS	Illumina HiSeq	Phase_I	174	37	NM_005688	0	0	4	6	2	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	C	6.516	0.463419	0.12402	.	.	ENSG00000114770	ENST00000334444;ENST00000265586;ENST00000427120;ENST00000392579;ENST00000382494;ENST00000437341;ENST00000446941	D;D;T;T;T	0.91577	-2.66;-2.87;1.37;1.38;1.41	5.28	2.0	0.26442	.	0.201917	0.34133	N	0.004231	T	0.81422	0.4819	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.31817	0.341;0.287;0.002;0.021;0.016	B;B;B;B;B	0.28011	0.059;0.085;0.008;0.033;0.011	T	0.66376	-0.5939	10	0.21014	T	0.42	-4.7806	6.1229	0.20164	0.0:0.3249:0.0:0.6751	.	19;19;19;19;19	A5PKY6;Q29ZA9;Q86UX3;Q86W30;O15440	.;.;.;.;MRP5_HUMAN	T	19	ENSP00000333926:S19T;ENSP00000265586:S19T;ENSP00000404809:S19T;ENSP00000376358:S19T;ENSP00000371934:S19T	ENSP00000265586:S19T	S	-	2	0	ABCC5	185214819	0.254000	0.23992	0.002000	0.10522	0.091000	0.18340	0.507000	0.22675	0.190000	0.20209	-0.136000	0.14681	AGT	.		0.483	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
MUC4	4585	broad.mit.edu	37	3	195506331	195506331	+	Silent	SNP	T	T	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:195506331T>A	ENST00000463781.3	-	2	12579	c.12120A>T	c.(12118-12120)tcA>tcT	p.S4040S	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.S4040S|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGTGGATGCTGAGGAAGTGC	0.577																																					p.S4040S													.	MUC4-90	0			c.A12120T						.						26.0	14.0	17.0					3																	195506331		624	1399	2023	SO:0001819	synonymous_variant	4585	exon2			GGATGCTGAGGAA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12120A>T	3.37:g.195506331T>A		Somatic	57	1		WXS	Illumina HiSeq	Phase_I	50	2	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195510130	195510130	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:195510130G>T	ENST00000463781.3	-	2	8780	c.8321C>A	c.(8320-8322)aCt>aAt	p.T2774N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T2774N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTTGGTGAC	0.582																																					p.T2774N													.	MUC4-90	0			c.C8321A						.						41.0	25.0	30.0					3																	195510130		687	1545	2232	SO:0001583	missense	4585	exon2			GAGGAAGTGTTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8321C>A	3.37:g.195510130G>T	ENSP00000417498:p.Thr2774Asn	Somatic	729	2		WXS	Illumina HiSeq	Phase_1	581	40	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.012	0.370599	0.11409	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32023	1.47;1.51	1.02	-1.52	0.08637	.	.	.	.	.	T	0.12008	0.0292	N	0.08118	0	0.09310	N	1	D	0.59357	0.985	B	0.40659	0.336	T	0.16897	-1.0387	8	.	.	.	.	4.2355	0.10623	0.2868:0.0:0.7132:0.0	.	2646	E7ESK3	.	N	2774	ENSP00000417498:T2774N;ENSP00000420243:T2774N	.	T	-	2	0	MUC4	196994909	0.004000	0.15560	0.001000	0.08648	0.009000	0.06853	1.274000	0.33132	-1.669000	0.01470	-1.973000	0.00462	ACT	.		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CPZ	8532	hgsc.bcm.edu	37	4	8621250	8621250	+	Missense_Mutation	SNP	G	G	A	rs144042196		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr4:8621250G>A	ENST00000360986.4	+	11	2039	c.1865G>A	c.(1864-1866)cGc>cAc	p.R622H	CPZ_ENST00000315782.6_Missense_Mutation_p.R611H|CPZ_ENST00000382480.2_Missense_Mutation_p.R485H|CPZ_ENST00000429646.2_Missense_Mutation_p.R230H	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	622					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CTCCGGGCGCGCAGGCAGCCC	0.672																																					p.R622H		.											.	CPZ-93	0			c.G1865A						.	G	HIS/ARG,HIS/ARG,HIS/ARG	0,4402		0,0,2201	28.0	31.0	30.0		1865,1454,1832	2.1	0.1	4	dbSNP_134	30	1,8595	1.2+/-3.3	0,1,4297	yes	missense,missense,missense	CPZ	NM_001014447.2,NM_001014448.2,NM_003652.3	29,29,29	0,1,6498	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	622/653,485/516,611/642	8621250	1,12997	2201	4298	6499	SO:0001583	missense	8532	exon11			GGGCGCGCAGGCA	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1865G>A	4.37:g.8621250G>A	ENSP00000354255:p.Arg622His	Somatic	3	0		WXS	Illumina HiSeq	Phase_I	8	5	NM_001014447	0	0	2	2	0	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677115	0.47886	0.0	1.16E-4	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782;ENST00000429646	T;T;T;T	0.58940	0.62;1.98;0.3;1.86	4.82	2.09	0.27110	.	0.624251	0.13588	U	0.376803	T	0.51873	0.1700	M	0.62723	1.935	0.09310	N	0.999999	B;B	0.18013	0.025;0.006	B;B	0.10450	0.005;0.001	T	0.46610	-0.9179	10	0.46703	T	0.11	-25.7306	8.9438	0.35747	0.2406:0.0:0.7594:0.0	.	611;622	Q66K79-2;Q66K79	.;CBPZ_HUMAN	H	622;485;611;230	ENSP00000354255:R622H;ENSP00000371920:R485H;ENSP00000315074:R611H;ENSP00000403981:R230H	ENSP00000315074:R611H	R	+	2	0	CPZ	8672150	0.003000	0.15002	0.094000	0.20943	0.121000	0.20230	0.793000	0.26944	0.448000	0.26722	0.462000	0.41574	CGC	G|1.000;A|0.000		0.672	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
GBA3	57733	broad.mit.edu	37	4	22737642	22737642	+	RNA	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr4:22737642G>T	ENST00000503442.1	+	0	188				GBA3_ENST00000508166.1_RNA|GBA3_ENST00000511446.2_RNA	NM_001128432.2	NP_001121904.1	Q9H227	GBA3_HUMAN	glucosidase, beta, acid 3 (gene/pseudogene)						carbohydrate metabolic process (GO:0005975)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	beta-galactosidase activity (GO:0004565)|beta-glucosidase activity (GO:0008422)|glycosylceramidase activity (GO:0017042)			breast(1)|kidney(2)|large_intestine(4)|lung(20)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TTGTGTCTGGGACACATTTAC	0.448																																					.													.	GBA3-1	0			.						.						112.0	115.0	114.0					4																	22737642		1931	4143	6074			57733	.			GTCTGGGACACAT	AB017913		4p15.2	2013-05-09	2013-05-09		ENSG00000249948	ENSG00000249948	3.2.1.21		19069	protein-coding gene	gene with protein product	"""klotho-related protein"""	606619	"""glucosidase, beta, acid 3 (cytosolic)"""			11389701	Standard	NM_020973		Approved	GLUC, KLrP	uc031sdv.1	Q9H227	OTTHUMG00000160448		4.37:g.22737642G>T		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	106	4	.	0	0	14	14	0	Q32LY7|Q3MIH4|Q53GG8|Q6NSF4|Q8NHT8|Q9H3T4|Q9H4C6	Missense_Mutation	SNP	ENST00000503442.1	37																																																																																				.		0.448	GBA3-003	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000360620.2		
SEC31A	22872	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	83769958	83769958	+	Splice_Site	SNP	T	T	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr4:83769958T>G	ENST00000395310.2	-	20	2683	c.2501A>C	c.(2500-2502)cAt>cCt	p.H834P	SEC31A_ENST00000500777.2_Splice_Site_p.H795P|SEC31A_ENST00000508479.1_Splice_Site_p.H834P|SEC31A_ENST00000505984.1_Splice_Site_p.H795P|SEC31A_ENST00000509142.1_Splice_Site_p.H834P|SEC31A_ENST00000508502.1_Splice_Site_p.H834P|SEC31A_ENST00000311785.7_Splice_Site_p.H834P|SEC31A_ENST00000513858.1_Splice_Site_p.H795P|SEC31A_ENST00000505472.1_Splice_Site_p.H834P|SEC31A_ENST00000355196.2_Splice_Site_p.H834P|SEC31A_ENST00000348405.4_Splice_Site_p.H795P|SEC31A_ENST00000326950.5_Splice_Site_p.H795P|SEC31A_ENST00000443462.2_Splice_Site_p.H829P|SEC31A_ENST00000432794.1_Splice_Site_p.H834P|SEC31A_ENST00000448323.1_Splice_Site_p.H834P|SEC31A_ENST00000264405.5_Splice_Site_p.H567P	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	834	Interaction with PDCD6.|Pro-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				ATCACTCACATGGGGATAATA	0.448																																					p.H834P													.	SEC31A-268	0			c.A2501C						.						84.0	81.0	82.0					4																	83769958		2203	4300	6503	SO:0001630	splice_region_variant	22872	exon20			CTCACATGGGGAT	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.2502+1A>C	4.37:g.83769958T>G		Somatic	155	1		WXS	Illumina HiSeq	Phase_I	154	25	NM_001077206	0	0	0	0	0	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	ENST00000395310.2	37	CCDS3596.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.985948	0.53934	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.36520	1.43;1.25;2.49;2.45;1.3;2.39;2.49;1.43;1.3;1.27;1.25;2.46;2.49;3.37;2.42;2.36	5.72	5.72	0.89469	.	0.270404	0.40640	N	0.001049	T	0.31482	0.0798	N	0.12182	0.205	0.45118	D	0.998132	B;B;B;B;B;B;P;B;P	0.37038	0.357;0.167;0.357;0.0;0.0;0.0;0.49;0.238;0.579	B;B;B;B;B;B;B;B;P	0.46975	0.232;0.123;0.232;0.001;0.002;0.001;0.409;0.125;0.533	T	0.17806	-1.0357	10	0.30078	T	0.28	-7.7203	14.2292	0.65879	0.0:0.0:0.0:1.0	.	829;795;834;795;795;834;834;834;567	B4DIW6;B7ZL00;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7	.;.;.;.;.;.;.;SC31A_HUMAN;.	P	795;795;834;829;834;834;834;795;834;834;795;834;834;567;795;834	ENSP00000337602:H795P;ENSP00000426886:H795P;ENSP00000378721:H834P;ENSP00000408027:H829P;ENSP00000426569:H834P;ENSP00000407944:H834P;ENSP00000400926:H834P;ENSP00000325087:H795P;ENSP00000309070:H834P;ENSP00000421633:H834P;ENSP00000421464:H795P;ENSP00000424635:H834P;ENSP00000347329:H834P;ENSP00000264405:H567P;ENSP00000424451:H795P;ENSP00000425999:H834P	ENSP00000264405:H567P	H	-	2	0	SEC31A	83988982	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	5.132000	0.64758	2.184000	0.69523	0.383000	0.25322	CAT	.		0.448	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	Missense_Mutation
GRID2	2895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	94690404	94690404	+	Missense_Mutation	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr4:94690404C>T	ENST00000282020.4	+	15	2662	c.2404C>T	c.(2404-2406)Cac>Tac	p.H802Y	GRID2_ENST00000510992.1_Missense_Mutation_p.H707Y	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	802					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		CATCCTGAAGCACAAATGGTG	0.483																																					p.H802Y		.											.	GRID2-159	0			c.C2404T						.						124.0	117.0	119.0					4																	94690404		2203	4300	6503	SO:0001583	missense	2895	exon15			CTGAAGCACAAAT	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.2404C>T	4.37:g.94690404C>T	ENSP00000282020:p.His802Tyr	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	156	21	NM_001510	0	0	0	0	0	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	ENST00000282020.4	37	CCDS3637.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829280	0.71258	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	T;T	0.26957	1.7;1.7	5.17	5.17	0.71159	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.054536	0.64402	D	0.000001	T	0.16514	0.0397	N	0.08118	0	0.58432	D	0.999992	B;B	0.30584	0.286;0.286	B;B	0.26693	0.072;0.072	T	0.11324	-1.0592	10	0.87932	D	0	.	18.7052	0.91635	0.0:1.0:0.0:0.0	.	707;802	E9PH24;O43424	.;GRID2_HUMAN	Y	802;707	ENSP00000282020:H802Y;ENSP00000421257:H707Y	ENSP00000282020:H802Y	H	+	1	0	GRID2	94909427	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.713000	0.54882	2.415000	0.81967	0.650000	0.86243	CAC	.		0.483	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
ZCCHC10	54819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	132342536	132342536	+	Silent	SNP	T	T	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr5:132342536T>G	ENST00000509437.1	-	3	191	c.184A>C	c.(184-186)Aga>Cga	p.R62R	ZCCHC10_ENST00000508080.1_5'UTR|ZCCHC10_ENST00000509008.1_Silent_p.R40R|ZCCHC10_ENST00000513848.1_Silent_p.R40R|ZCCHC10_ENST00000355372.2_Silent_p.R62R|ZCCHC10_ENST00000513541.1_Silent_p.R62R|ZCCHC10_ENST00000324170.3_Silent_p.R40R			Q8TBK6	ZCH10_HUMAN	zinc finger, CCHC domain containing 10	62							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AGGTATTTTCTTTTTCCTGTG	0.338																																					p.R40R		.											.	ZCCHC10-90	0			c.A118C						.						91.0	83.0	85.0					5																	132342536		2201	4298	6499	SO:0001819	synonymous_variant	54819	exon2			ATTTTCTTTTTCC	BC005211	CCDS4165.1, CCDS75300.1, CCDS75301.1, CCDS75302.1	5q31.1	2008-05-02			ENSG00000155329	ENSG00000155329		"""Zinc fingers, CCHC domain containing"""	25954	protein-coding gene	gene with protein product						12477932	Standard	XM_005272024		Approved	FLJ20094	uc003kyg.3	Q8TBK6	OTTHUMG00000129013	ENST00000509437.1:c.184A>C	5.37:g.132342536T>G		Somatic	108	0		WXS	Illumina HiSeq	Phase_I	153	16	NM_017665	0	0	4	10	6	Q9NXR4	Silent	SNP	ENST00000509437.1	37																																																																																				.		0.338	ZCCHC10-004	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000370163.1	NM_017665	
DDX41	51428	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176943931	176943931	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr5:176943931G>T	ENST00000507955.1	-	1	539	c.16C>A	c.(16-18)Ccc>Acc	p.P6T	DDX41_ENST00000506965.1_5'UTR	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	6					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TTCCGTTCGGGTTCCGACTCC	0.657																																					p.P6T													.	DDX41-226	0			c.C16A						.						73.0	61.0	65.0					5																	176943931		2202	4300	6502	SO:0001583	missense	51428	exon1			GTTCGGGTTCCGA	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.16C>A	5.37:g.176943931G>T	ENSP00000422753:p.Pro6Thr	Somatic	174	1		WXS	Illumina HiSeq	Phase_I	227	52	NM_016222	0	0	0	0	0	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	ENST00000507955.1	37	CCDS4427.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547551	0.45383	.	.	ENSG00000183258	ENST00000507955	T	0.26518	1.73	4.65	3.71	0.42584	.	1.216860	0.06063	N	0.658641	T	0.20333	0.0489	N	0.22421	0.69	0.34597	D	0.716069	B	0.25904	0.137	B	0.23018	0.043	T	0.05289	-1.0894	10	0.30854	T	0.27	-19.3593	12.3624	0.55211	0.0:0.1709:0.8291:0.0	.	6	Q9UJV9	DDX41_HUMAN	T	6	ENSP00000422753:P6T	ENSP00000422753:P6T	P	-	1	0	DDX41	176876537	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.870000	0.39529	2.571000	0.86741	0.591000	0.81541	CCC	.		0.657	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253432.2	NM_016222	
COL12A1	1303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	75860944	75860944	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr6:75860944G>T	ENST00000322507.8	-	21	4369	c.4060C>A	c.(4060-4062)Cat>Aat	p.H1354N	COL12A1_ENST00000483888.2_Missense_Mutation_p.H1354N|COL12A1_ENST00000416123.2_Missense_Mutation_p.H1354N|COL12A1_ENST00000345356.6_Missense_Mutation_p.H190N	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1354	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TTGTATGCATGGGTATCATCA	0.368																																					p.H1354N		.											.	COL12A1-142	0			c.C4060A						.						171.0	170.0	170.0					6																	75860944		1901	4128	6029	SO:0001583	missense	1303	exon21			ATGCATGGGTATC	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4060C>A	6.37:g.75860944G>T	ENSP00000325146:p.His1354Asn	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	100	16	NM_004370	0	0	0	0	0	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.98|18.98	3.738638|3.738638	0.69304|0.69304	.|.	.|.	ENSG00000111799|ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888|ENST00000419671	D;D;D;D|.	0.84516|.	-1.86;-1.86;-1.86;-1.86|.	5.6|5.6	5.6|5.6	0.85130|0.85130	von Willebrand factor, type A (3);|.	0.072196|.	0.64402|.	D|.	0.000020|.	T|T	0.57548|0.57548	0.2061|0.2061	M|M	0.63169|0.63169	1.94|1.94	0.49915|0.49915	D|D	0.999831|0.999831	B;D|.	0.60575|.	0.345;0.988|.	B;D|.	0.64237|.	0.199;0.923|.	T|T	0.57289|0.57289	-0.7837|-0.7837	10|5	0.66056|.	D|.	0.02|.	.|.	12.886|12.886	0.58045|0.58045	0.0744:0.0:0.9256:0.0|0.0744:0.0:0.9256:0.0	.|.	190;1354|.	Q99715-2;Q99715|.	.;COCA1_HUMAN|.	N|Q	1354;1354;190;1354;1354|95	ENSP00000325146:H1354N;ENSP00000305147:H190N;ENSP00000412864:H1354N;ENSP00000421216:H1354N|.	ENSP00000325146:H1354N|.	H|P	-|-	1|2	0|0	COL12A1|COL12A1	75917664|75917664	1.000000|1.000000	0.71417|0.71417	0.509000|0.509000	0.27700|0.27700	0.925000|0.925000	0.55904|0.55904	7.690000|7.690000	0.84178|0.84178	2.631000|2.631000	0.89168|0.89168	0.655000|0.655000	0.94253|0.94253	CAT|CCA	.		0.368	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
MYO6	4646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	76602272	76602272	+	Missense_Mutation	SNP	G	G	C	rs529167250		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr6:76602272G>C	ENST00000369977.3	+	28	3111	c.2972G>C	c.(2971-2973)cGa>cCa	p.R991P	MYO6_ENST00000369975.1_Missense_Mutation_p.R991P|MYO6_ENST00000369981.3_Missense_Mutation_p.R991P|MYO6_ENST00000369985.4_Missense_Mutation_p.R991P	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	991	Glu-rich.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CAGCTGGCCCGACAGAAGGAG	0.532																																					p.R991P		.											.	MYO6-92	0			c.G2972C						.						100.0	109.0	106.0					6																	76602272		2203	4300	6503	SO:0001583	missense	4646	exon28			TGGCCCGACAGAA	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2972G>C	6.37:g.76602272G>C	ENSP00000358994:p.Arg991Pro	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	97	15	NM_004999	0	0	6	14	8	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	37	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	G	9.868	1.198055	0.22037	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975;ENST00000430435	T;T;T;T;T	0.58060	2.07;2.59;2.59;2.07;0.36	5.75	3.97	0.46021	.	0.350255	0.33477	N	0.004873	T	0.55210	0.1906	L	0.61218	1.895	0.09310	N	1	B;D	0.62365	0.086;0.991	B;D	0.67548	0.049;0.952	T	0.50939	-0.8768	10	0.72032	D	0.01	.	11.8787	0.52562	0.1401:0.0:0.8599:0.0	.	991;991	Q9UM54-2;Q9UM54-1	.;.	P	991;991;991;991;991;54	ENSP00000358998:R991P;ENSP00000359002:R991P;ENSP00000358994:R991P;ENSP00000358992:R991P;ENSP00000399406:R54P	ENSP00000358992:R991P	R	+	2	0	MYO6	76658992	0.031000	0.19500	0.018000	0.16275	0.286000	0.27126	0.655000	0.24933	1.448000	0.47680	0.491000	0.48974	CGA	.		0.532	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
MMS22L	253714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	97629854	97629854	+	Silent	SNP	A	A	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr6:97629854A>T	ENST00000275053.4	-	16	2575	c.2310T>A	c.(2308-2310)atT>atA	p.I770I	MMS22L_ENST00000369251.2_Silent_p.I730I	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	770					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CAAAAAGTTGAATAATTGATA	0.373																																					p.I770I		.											.	MMS22L-92	0			c.T2310A						.						174.0	169.0	171.0					6																	97629854		2203	4300	6503	SO:0001819	synonymous_variant	253714	exon16			AAGTTGAATAATT		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2310T>A	6.37:g.97629854A>T		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	67	10	NM_198468	0	0	1	1	0	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Silent	SNP	ENST00000275053.4	37	CCDS5039.1																																																																																			.		0.373	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	
SERINC1	57515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	122777747	122777747	+	Silent	SNP	A	A	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr6:122777747A>G	ENST00000339697.4	-	3	334	c.250T>C	c.(250-252)Ttg>Ctg	p.L84L		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	84					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		TAGCCAACCAAAATGTTACAA	0.333																																					p.L84L		.											.	SERINC1-91	0			c.T250C						.						125.0	110.0	115.0					6																	122777747		2203	4300	6503	SO:0001819	synonymous_variant	57515	exon3			CAACCAAAATGTT	AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.250T>C	6.37:g.122777747A>G		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	74	13	NM_020755	0	0	26	49	23	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Silent	SNP	ENST00000339697.4	37	CCDS5125.1																																																																																			.		0.333	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	NM_020755	
SP4	6671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	21469335	21469335	+	Silent	SNP	T	T	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr7:21469335T>C	ENST00000222584.3	+	3	770	c.552T>C	c.(550-552)acT>acC	p.T184T		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	184					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TCAATCCAACTAGTAGTTCAT	0.398																																					p.T184T		.											.	SP4-95	0			c.T552C						.						77.0	74.0	75.0					7																	21469335		2203	4300	6503	SO:0001819	synonymous_variant	6671	exon3			TCCAACTAGTAGT		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.552T>C	7.37:g.21469335T>C		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	71	15	NM_003112	0	0	0	0	0	O60402|Q32M52	Silent	SNP	ENST00000222584.3	37	CCDS5373.1																																																																																			.		0.398	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
MYO1G	64005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	7	45010552	45010552	+	Missense_Mutation	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr7:45010552G>T	ENST00000258787.7	-	8	1089	c.953C>A	c.(952-954)cCc>cAc	p.P318H		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	318	Myosin motor.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						GAGGTCCCGGGGTGTGGCCGT	0.657																																					p.P318H		.											.	MYO1G-137	0			c.C953A						.						57.0	47.0	50.0					7																	45010552		2202	4300	6502	SO:0001583	missense	64005	exon8			TCCCGGGGTGTGG	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.953C>A	7.37:g.45010552G>T	ENSP00000258787:p.Pro318His	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	87	12	NM_033054	0	0	6	6	0	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Missense_Mutation	SNP	ENST00000258787.7	37	CCDS34629.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075212	0.55646	.	.	ENSG00000136286	ENST00000258787	D	0.87029	-2.2	5.3	4.36	0.52297	Myosin head, motor domain (2);	0.183757	0.26598	N	0.023498	D	0.86871	0.6037	L	0.42744	1.35	0.09310	N	1	P;P	0.50528	0.936;0.848	P;P	0.53401	0.725;0.722	T	0.79472	-0.1789	10	0.46703	T	0.11	.	11.939	0.52890	0.0:0.2921:0.7079:0.0	.	318;318	B0I1T2-4;B0I1T2	.;MYO1G_HUMAN	H	318	ENSP00000258787:P318H	ENSP00000258787:P318H	P	-	2	0	MYO1G	44977077	0.000000	0.05858	0.428000	0.26697	0.808000	0.45660	0.514000	0.22786	2.649000	0.89929	0.655000	0.94253	CCC	.		0.657	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341832.2		
NUP205	23165	broad.mit.edu	37	7	135269748	135269748	+	Missense_Mutation	SNP	C	C	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr7:135269748C>A	ENST00000285968.6	+	8	1237	c.1211C>A	c.(1210-1212)cCa>cAa	p.P404Q	NUP205_ENST00000440390.2_Missense_Mutation_p.P198Q	NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	404					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						GCACTTATGCCAATGAAGGTA	0.299																																					p.P404Q													.	NUP205-207	0			c.C1211A						.						42.0	41.0	41.0					7																	135269748		2203	4300	6503	SO:0001583	missense	23165	exon8			TTATGCCAATGAA	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.1211C>A	7.37:g.135269748C>A	ENSP00000285968:p.Pro404Gln	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	30	4	NM_015135	0	0	0	0	0	A6H8X3|Q86YC1	Missense_Mutation	SNP	ENST00000285968.6	37	CCDS34759.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700331	0.88924	.	.	ENSG00000155561	ENST00000285968;ENST00000440390	T;T	0.33438	1.41;1.41	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.56920	0.2018	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57441	-0.7811	10	0.62326	D	0.03	-2.9094	19.44	0.94815	0.0:1.0:0.0:0.0	.	404	Q92621	NU205_HUMAN	Q	404;198	ENSP00000285968:P404Q;ENSP00000401983:P198Q	ENSP00000285968:P404Q	P	+	2	0	NUP205	134920288	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.586000	0.87340	0.591000	0.81541	CCA	.		0.299	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
ARMC1	55156	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	66534565	66534565	+	Missense_Mutation	SNP	G	G	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr8:66534565G>C	ENST00000276569.3	-	3	452	c.208C>G	c.(208-210)Cgt>Ggt	p.R70G	ARMC1_ENST00000523384.1_Intron|ARMC1_ENST00000458464.2_Missense_Mutation_p.P31R	NM_018120.4	NP_060590.1	Q9NVT9	ARMC1_HUMAN	armadillo repeat containing 1	70					metal ion transport (GO:0030001)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|large_intestine(1)|lung(8)|skin(1)	14			Epithelial(68;0.103)|OV - Ovarian serous cystadenocarcinoma(28;0.235)			CTGTTTGCACGGCATTCTGCC	0.348																																					p.R70G													.	ARMC1-91	0			c.C208G						.						151.0	144.0	146.0					8																	66534565		2203	4300	6503	SO:0001583	missense	55156	exon3			TTGCACGGCATTC	BC011607	CCDS6181.1, CCDS69490.1	8q12.3	2013-02-14			ENSG00000104442	ENSG00000104442		"""Armadillo repeat containing"""	17684	protein-coding gene	gene with protein product							Standard	XM_005251264		Approved	FLJ10511, Arcp	uc003xvl.3	Q9NVT9	OTTHUMG00000164374	ENST00000276569.3:c.208C>G	8.37:g.66534565G>C	ENSP00000276569:p.Arg70Gly	Somatic	79	1		WXS	Illumina HiSeq	Phase_I	84	14	NM_018120	0	0	6	6	0	B4E2W7|Q9H018|Q9H820	Missense_Mutation	SNP	ENST00000276569.3	37	CCDS6181.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.91|16.91	3.252602|3.252602	0.59212|0.59212	.|.	.|.	ENSG00000104442|ENSG00000104442	ENST00000458464|ENST00000276569;ENST00000518908;ENST00000519352	.|T;T;T	.|0.50277	.|0.75;0.75;0.75	4.97|4.97	4.97|4.97	0.65823|0.65823	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.054393	.|0.85682	.|D	.|0.000000	T|T	0.45875|0.45875	0.1364|0.1364	L|L	0.57536|0.57536	1.79|1.79	0.37913|0.37913	D|D	0.931434|0.931434	D|B	0.55385|0.02656	0.971|0.0	P|B	0.54629|0.04013	0.757|0.001	T|T	0.46190|0.46190	-0.9209|-0.9209	8|10	0.54805|0.17369	T|T	0.06|0.5	-15.0047|-15.0047	18.5949|18.5949	0.91226|0.91226	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	31|70	B4E2W7|Q9NVT9	.|ARMC1_HUMAN	R|G	31|70	.|ENSP00000276569:R70G;ENSP00000429191:R70G;ENSP00000429715:R70G	ENSP00000388572:P31R|ENSP00000276569:R70G	P|R	-|-	2|1	0|0	ARMC1|ARMC1	66697119|66697119	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.383000|9.383000	0.97214|0.97214	2.478000|2.478000	0.83669|0.83669	0.467000|0.467000	0.42956|0.42956	CCG|CGT	.		0.348	ARMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378480.1	NM_018120	
TMC1	117531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	75355127	75355127	+	Splice_Site	SNP	T	T	C			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr9:75355127T>C	ENST00000297784.5	+	9	993		c.e9+2		TMC1_ENST00000340019.3_Splice_Site|TMC1_ENST00000396237.3_Splice_Site	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						ATGGCCAAGGTAGGTATTTTT	0.358																																					.	Pancreas(75;173 1345 14232 34245 43413)	.											.	TMC1-91	0			c.453+2T>C						.						105.0	108.0	107.0					9																	75355127		2203	4300	6503	SO:0001630	splice_region_variant	117531	exon9			CCAAGGTAGGTAT	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.453+2T>C	9.37:g.75355127T>C		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	73	16	NM_138691	0	0	0	0	0	A8MVZ2|B1AM91	Splice_Site	SNP	ENST00000297784.5	37	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.251532	0.39797	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2221	0.54439	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMC1	74544947	1.000000	0.71417	0.998000	0.56505	0.532000	0.34746	3.240000	0.51368	2.133000	0.65898	0.533000	0.62120	.	.		0.358	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		Intron
NOTCH1	4851	broad.mit.edu	37	9	139391937	139391937	+	Missense_Mutation	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr9:139391937G>A	ENST00000277541.6	-	34	6329	c.6254C>T	c.(6253-6255)gCc>gTc	p.A2085V		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2085					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTCCCGGTTGGCAAAGTGGTC	0.652			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.A2085V				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.C6254T						.						30.0	32.0	32.0					9																	139391937		2185	4275	6460	SO:0001583	missense	4851	exon34			CGGTTGGCAAAGT	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.6254C>T	9.37:g.139391937G>A	ENSP00000277541:p.Ala2085Val	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	82	4	NM_017617	0	0	4	4	0	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824283	0.90955	.	.	ENSG00000148400	ENST00000277541	T	0.61510	0.1	5.42	5.42	0.78866	Ankyrin repeat-containing domain (4);	0.115232	0.64402	D	0.000017	T	0.78329	0.4266	M	0.83692	2.655	0.80722	D	1	D	0.89917	1.0	D	0.68483	0.958	T	0.81241	-0.1022	10	0.87932	D	0	.	18.5525	0.91071	0.0:0.0:1.0:0.0	.	2085	P46531	NOTC1_HUMAN	V	2085	ENSP00000277541:A2085V	ENSP00000277541:A2085V	A	-	2	0	NOTCH1	138511758	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	9.598000	0.98277	2.703000	0.92315	0.561000	0.74099	GCC	.		0.652	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
NELFB	25920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	140158762	140158762	+	Silent	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr9:140158762G>A	ENST00000343053.4	+	6	1186	c.849G>A	c.(847-849)ctG>ctA	p.L283L		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	283					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CGCGGGAGCTGCAGGGGTTTC	0.672																																					p.L283L		.											.	.	0			c.G849A						.						63.0	61.0	62.0					9																	140158762		2201	4299	6500	SO:0001819	synonymous_variant	25920	exon6			GGAGCTGCAGGGG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.849G>A	9.37:g.140158762G>A		Somatic	25	0		WXS	Illumina HiSeq	Phase_I	37	8	NM_015456	0	0	25	41	16	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Silent	SNP	ENST00000343053.4	37	CCDS7040.1																																																																																			.		0.672	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
RPS6KA3	6197	broad.mit.edu	37	X	20222171	20222171	+	Silent	SNP	G	G	A			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chrX:20222171G>A	ENST00000379565.3	-	4	501	c.294C>T	c.(292-294)gcC>gcT	p.A98A	RPS6KA3_ENST00000540702.1_Silent_p.A70A|RPS6KA3_ENST00000544447.1_Silent_p.A70A|RPS6KA3_ENST00000379548.4_Silent_p.A69A	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	98	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	ATACCTTCATGGCATAAAGCT	0.338																																					p.A98A													.	RPS6KA3-1504	0			c.C294T						.						139.0	126.0	130.0					X																	20222171		2203	4300	6503	SO:0001819	synonymous_variant	6197	exon4			CTTCATGGCATAA	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.294C>T	X.37:g.20222171G>A		Somatic	105	1		WXS	Illumina HiSeq	Phase_I	102	4	NM_004586	0	0	8	8	0	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Silent	SNP	ENST00000379565.3	37	CCDS14197.1																																																																																			.		0.338	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
FOXO4	4303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	70316474	70316474	+	Silent	SNP	C	C	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chrX:70316474C>T	ENST00000374259.3	+	1	428	c.96C>T	c.(94-96)acC>acT	p.T32T	FOXO4_ENST00000466874.1_3'UTR|FOXO4_ENST00000341558.3_Silent_p.T32T	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	32				QSRPRSCTWP -> RAVPLLHLA (in Ref. 1; CAA72156). {ECO:0000305}.	cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					GCTCCTGCACCTGGCCCCTTC	0.637																																					p.T32T		.											.	FOXO4-986	0			c.C96T						.						24.0	27.0	26.0					X																	70316474		1951	4125	6076	SO:0001819	synonymous_variant	4303	exon1			CTGCACCTGGCCC		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.96C>T	X.37:g.70316474C>T		Somatic	84	0		WXS	Illumina HiSeq	Phase_I	96	23	NM_005938	0	0	3	3	0	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Silent	SNP	ENST00000374259.3	37	CCDS43969.1																																																																																			.		0.637	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938	
ALG13	79868	ucsc.edu	37	X	110987897	110987897	+	Splice_Site	SNP	G	G	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chrX:110987897G>T	ENST00000394780.3	+	24	2709	c.2697G>T	c.(2695-2697)gtG>gtT	p.V899V	ALG13_ENST00000251943.4_Intron|ALG13_ENST00000470971.1_3'UTR	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	899	Pro-rich.				cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						CTTTGTTAGTGATTGCCTCAC	0.458																																					p.V899V													.	ALG13-130	0			c.G2697T						.						89.0	61.0	70.0					X																	110987897		1567	3574	5141	SO:0001630	splice_region_variant	79868	exon24			GTTAGTGATTGCC	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.2696-1G>T	X.37:g.110987897G>T		Somatic	37	0		WXS	Illumina HiSeq		39	4	NM_001099922	0	0	0	0	0	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Silent	SNP	ENST00000394780.3	37	CCDS55477.1																																																																																			.		0.458	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	NM_018466	Silent
OCRL	4952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	128678970	128678970	+	Missense_Mutation	SNP	T	T	G			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chrX:128678970T>G	ENST00000371113.4	+	3	320	c.155T>G	c.(154-156)gTt>gGt	p.V52G	OCRL_ENST00000486673.1_3'UTR|OCRL_ENST00000357121.5_Missense_Mutation_p.V52G	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	52	PH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						GAACAGCATGTTCAAGATATC	0.348																																					p.V52G		.											.	OCRL-206	0			c.T155G						.						178.0	153.0	162.0					X																	128678970		2203	4300	6503	SO:0001583	missense	4952	exon3			AGCATGTTCAAGA	U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.155T>G	X.37:g.128678970T>G	ENSP00000360154:p.Val52Gly	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	37	14	NM_000276	0	0	1	5	4	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	ENST00000371113.4	37	CCDS35393.1	.	.	.	.	.	.	.	.	.	.	T	12.47	1.946658	0.34377	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	D;D	0.94376	-3.41;-3.41	5.36	3.03	0.35002	.	0.751295	0.12380	N	0.473987	D	0.84938	0.5583	N	0.14661	0.345	0.47341	D	0.999398	B;B	0.19200	0.034;0.02	B;B	0.19946	0.027;0.019	T	0.80174	-0.1492	10	0.42905	T	0.14	.	5.7638	0.18215	0.0:0.1888:0.0:0.8112	.	52;52	Q01968-2;Q01968	.;OCRL_HUMAN	G	52	ENSP00000360154:V52G;ENSP00000349635:V52G	ENSP00000349635:V52G	V	+	2	0	OCRL	128506651	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.736000	0.26130	1.780000	0.52325	0.417000	0.27973	GTT	.		0.348	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058917.1	NM_000276	
LRRC42	115353	broad.mit.edu;bcgsc.ca	37	1	54417869	54417876	+	Frame_Shift_Del	DEL	AAGAGAAG	AAGAGAAG	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	AAGAGAAG	AAGAGAAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:54417869_54417876delAAGAGAAG	ENST00000371370.3	+	3	718_725	c.197_204delAAGAGAAG	c.(196-204)aaagagaagfs	p.KEK66fs	LRRC42_ENST00000319223.4_Frame_Shift_Del_p.KEK66fs	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	66										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						ACTGCACGGAAAGAGAAGACTGATCATT	0.514																																					p.66_68del													.	LRRC42-90	0			c.197_204del						.																																			SO:0001589	frameshift_variant	115353	exon2			CACGGAAAGAGAA	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.197_204delAAGAGAAG	1.37:g.54417869_54417876delAAGAGAAG	ENSP00000360421:p.Lys66fs	Somatic	157	0		WXS	Illumina HiSeq	Phase_I	111	13	NM_052940	0	0	0	0	0	D3DQ46|Q8N2Q8	Frame_Shift_Del	DEL	ENST00000371370.3	37	CCDS585.1																																																																																			.		0.514	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023250.1	NM_052940	
OR6K6	128371	broad.mit.edu;bcgsc.ca	37	1	158724869	158724869	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:158724869delT	ENST00000368144.2	+	1	360	c.264delT	c.(262-264)tatfs	p.Y88fs		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	88						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					CCCCTTTGTATTTCTTTATCA	0.463																																					p.Y88fs													.	OR6K6-69	0			c.264delT						.						156.0	157.0	157.0					1																	158724869		2203	4300	6503	SO:0001589	frameshift_variant	128371	exon1			TTTGTATTTCTTT	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.264delT	1.37:g.158724869delT	ENSP00000357126:p.Tyr88fs	Somatic	150	0		WXS	Illumina HiSeq	Phase_I	153	16	NM_001005184	0	0	0	0	0	B9EIM8|Q5VUU9|Q6IFR4	Frame_Shift_Del	DEL	ENST00000368144.2	37	CCDS30904.1																																																																																			.		0.463	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
PPP1R15B	84919	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	204379087	204379089	+	In_Frame_Del	DEL	CTA	CTA	-	rs200631983		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	CTA	CTA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr1:204379087_204379089delCTA	ENST00000367188.4	-	1	1830_1832	c.1451_1453delTAG	c.(1450-1455)gtagat>gat	p.V484del	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	484					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			TTATAAGGATCTACACTGCAGAA	0.448																																					p.484_485del		.											.	PPP1R15B-652	0			c.1451_1453del						.																																			SO:0001651	inframe_deletion	84919	exon1			.	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1451_1453delTAG	1.37:g.204379087_204379089delCTA	ENSP00000356156:p.Val484del	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	67	12	NM_032833	0	0	0	0	0	Q53GQ4|Q658M2|Q6P156|Q96SN1	In_Frame_Del	DEL	ENST00000367188.4	37	CCDS1445.1																																																																																			.		0.448	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
HHEX	3087	broad.mit.edu	37	10	94450034	94450038	+	Frame_Shift_Del	DEL	GGGCC	GGGCC	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	GGGCC	GGGCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr10:94450034_94450038delGGGCC	ENST00000282728.5	+	1	2090_2094	c.291_295delGGGCC	c.(289-297)gggggccctfs	p.GP98fs	HHEX_ENST00000472590.2_5'Flank|HHEX_ENST00000492654.2_5'Flank	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	98	Pro-rich.				anterior/posterior pattern specification (GO:0009952)|B cell differentiation (GO:0030183)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|DNA conformation change (GO:0071103)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|forebrain morphogenesis (GO:0048853)|gall bladder development (GO:0061010)|hepatic duct development (GO:0061011)|hepatoblast differentiation (GO:0061017)|hepatocyte differentiation (GO:0070365)|in utero embryonic development (GO:0001701)|interkinetic nuclear migration (GO:0022027)|mRNA export from nucleus (GO:0006406)|multicellular organism growth (GO:0035264)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|pancreas development (GO:0031016)|poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|primary lung bud formation (GO:0060431)|primitive streak formation (GO:0090009)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|eukaryotic initiation factor 4E binding (GO:0008190)|protein homodimerization activity (GO:0042803)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10						GCGGCTTCGGGGGCCCTCTGTACCC	0.737																																					p.97_99del													.	HHEX-227	0			c.291_295del						.																																			SO:0001589	frameshift_variant	3087	exon1			CTTCGGGGGCCCT	Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804		"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX		8096636, 8103988	Standard	NM_002729		Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000282728.5:c.291_295delGGGCC	10.37:g.94450034_94450038delGGGCC	ENSP00000282728:p.Gly98fs	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	10	3	NM_002729	0	0	0	0	0	B1AQ17|Q96CE9	Frame_Shift_Del	DEL	ENST00000282728.5	37	CCDS7423.1																																																																																			.		0.737	HHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049402.2		
RNASEH2C	84153	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	65487867	65487867	+	Frame_Shift_Del	DEL	C	C	-	rs554234154		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr11:65487867delC	ENST00000308418.4	-	2	382	c.194delG	c.(193-195)ggcfs	p.G65fs	RNASEH2C_ENST00000528220.1_5'UTR|RNASEH2C_ENST00000527610.1_Frame_Shift_Del_p.G65fs	NM_032193.3	NP_115569.2	Q8TDP1	RNH2C_HUMAN	ribonuclease H2, subunit C	65					RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)				cervix(1)	1						TAGACAGCGGCCCCGAAACGA	0.677																																					p.G65fs		.											.	RNASEH2C-90	0			c.194delG						.						41.0	48.0	46.0					11																	65487867		2201	4296	6497	SO:0001589	frameshift_variant	84153	exon2			.	AF312034	CCDS8111.1	11q13.1	2014-09-17							24116	protein-coding gene	gene with protein product	"""Aicardi-Goutieres syndrome 3"""	610330				8244390, 16845400	Standard	NM_032193		Approved	AYP1, AGS3	uc001ofn.3	Q8TDP1		ENST00000308418.4:c.194delG	11.37:g.65487867delC	ENSP00000308193:p.Gly65fs	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	76	16	NM_032193	0	0	0	0	0	Q9H7F5	Frame_Shift_Del	DEL	ENST00000308418.4	37	CCDS8111.1																																																																																			.		0.677	RNASEH2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390693.2	NM_032193	
RAB15	376267	broad.mit.edu;bcgsc.ca	37	14	65418357	65418362	+	In_Frame_Del	DEL	GTATCT	GTATCT	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	GTATCT	GTATCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr14:65418357_65418362delGTATCT	ENST00000533601.2	-	3	542_547	c.205_210delAGATAC	c.(205-210)agatacdel	p.RY69del	FNTB_ENST00000542227.1_Intron|RAB15_ENST00000426039.3_In_Frame_Del_p.RY23del|CHURC1-FNTB_ENST00000549987.1_Intron|RAB15_ENST00000436278.2_In_Frame_Del_p.RY23del|FNTB_ENST00000447296.2_Intron|RAB15_ENST00000267512.5_In_Frame_Del_p.RY69del			P59190	RAB15_HUMAN	RAB15, member RAS oncogene family	69					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	8				all cancers(60;0.00136)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.0102)		TGATGGTCTGGTATCTCTCCTGCCCT	0.592																																					p.69_70del													.	RAB15-228	0			c.205_210del						.																																			SO:0001651	inframe_deletion	376267	exon3			GGTCTGGTATCTC	BC014511	CCDS9768.1	14q23.2	2012-02-28	2012-02-28		ENSG00000139998	ENSG00000139998		"""RAB, member RAS oncogene"""	20150	protein-coding gene	gene with protein product						11697911	Standard	NM_198686		Approved		uc001xhz.2	P59190	OTTHUMG00000142810	ENST00000533601.2:c.205_210delAGATAC	14.37:g.65418357_65418362delGTATCT	ENSP00000434103:p.Arg69_Tyr70del	Somatic	189	0		WXS	Illumina HiSeq	Phase_I	154	19	NM_198686	0	0	0	0	0	G5EMR7|Q86TX7|Q8IW89	In_Frame_Del	DEL	ENST00000533601.2	37																																																																																				.		0.592	RAB15-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000390443.2	NM_198686	
SLC24A5	283652	broad.mit.edu	37	15	48431306	48431306	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr15:48431306delT	ENST00000341459.3	+	7	1085	c.1012delT	c.(1012-1014)tttfs	p.F339fs	SLC24A5_ENST00000449382.2_Frame_Shift_Del_p.F279fs	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	339					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		TGTGATAACCTTTTTCATGTC	0.308																																					p.F338fs													.	SLC24A5-90	0			c.1012delT						.						101.0	99.0	100.0					15																	48431306		2198	4287	6485	SO:0001589	frameshift_variant	283652	exon7			ATAACCTTTTTCA	AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.1012delT	15.37:g.48431306delT	ENSP00000341550:p.Phe339fs	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	78	7	NM_205850	0	0	0	0	0	A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Frame_Shift_Del	DEL	ENST00000341459.3	37	CCDS10128.1																																																																																			.		0.308	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254340.2	NM_205850	
POLG	5428	broad.mit.edu;bcgsc.ca	37	15	89872222	89872222	+	Frame_Shift_Del	DEL	G	G	-	rs551973680		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr15:89872222delG	ENST00000268124.5	-	4	1308	c.975delC	c.(973-975)cccfs	p.P325fs	POLG_ENST00000442287.2_Frame_Shift_Del_p.P325fs	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	325					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CTTGCTTTGTGGGGGGCTGGA	0.602								DNA polymerases (catalytic subunits)																													p.P325fs	Colon(73;648 1203 11348 18386 27782)												.	POLG-228	0			c.975delC						.						91.0	80.0	83.0					15																	89872222		2200	4299	6499	SO:0001589	frameshift_variant	5428	exon4			CTTTGTGGGGGGC	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.975delC	15.37:g.89872222delG	ENSP00000268124:p.Pro325fs	Somatic	164	0		WXS	Illumina HiSeq	Phase_I	150	19	NM_002693	0	0	0	0	0	Q8NFM2|Q92515	Frame_Shift_Del	DEL	ENST00000268124.5	37	CCDS10350.1																																																																																			.		0.602	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
ANKS4B	257629	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	21245180	21245180	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr16:21245180delA	ENST00000311620.5	+	1	195	c.122delA	c.(121-123)tacfs	p.Y41fs		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	41					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TTGGCAGCCTACCATGGGAAC	0.463																																					p.Y41fs		.											.	ANKS4B-92	0			c.122delA						.						128.0	125.0	126.0					16																	21245180		1902	4118	6020	SO:0001589	frameshift_variant	257629	exon1			.	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.122delA	16.37:g.21245180delA	ENSP00000308772:p.Tyr41fs	Somatic	141	0		WXS	Illumina HiSeq	Phase_I	144	47	NM_145865	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000311620.5	37	CCDS42130.1																																																																																			.		0.463	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436535.1	NM_145865	
CLTC	1213	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	57760151	57760152	+	Frame_Shift_Del	DEL	AG	AG	-	rs111452880		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:57760151_57760152delAG	ENST00000269122.3	+	23	4036_4037	c.3762_3763delAG	c.(3760-3765)aaagagfs	p.E1255fs	CLTC_ENST00000579456.1_Frame_Shift_Del_p.E192fs|CLTC_ENST00000393043.1_Frame_Shift_Del_p.E1255fs	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1255	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GAACATGGAAAGAGGTAATCTA	0.386			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.1254_1255del		.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC-835	0			c.3762_3763del						.																																			SO:0001589	frameshift_variant	1213	exon23			.	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.3762_3763delAG	17.37:g.57760153_57760154delAG	ENSP00000269122:p.Glu1255fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	90	21	NM_004859	0	0	0	0	0	D3DU00|Q6N0A0|Q86TF2	Frame_Shift_Del	DEL	ENST00000269122.3	37	CCDS32696.1																																																																																			.		0.386	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	78321624	78321624	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr17:78321624delC	ENST00000582970.1	+	29	9632	c.9489delC	c.(9487-9489)atcfs	p.I3163fs	RNF213_ENST00000336301.6_Frame_Shift_Del_p.I1236fs|RNF213_ENST00000508628.2_Frame_Shift_Del_p.I3212fs	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3163					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACTTTCCCATCCCCCTCATTA	0.542																																					p.I3163fs		.											.	RNF213-577	0			c.9489delC						.						67.0	62.0	63.0					17																	78321624		2203	4300	6503	SO:0001589	frameshift_variant	57674	exon29			.	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.9489delC	17.37:g.78321624delC	ENSP00000464087:p.Ile3163fs	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	180	48	NM_001256071	0	0	0	0	0	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Frame_Shift_Del	DEL	ENST00000582970.1	37	CCDS58606.1																																																																																			.		0.542	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
PKDCC	91461	broad.mit.edu;bcgsc.ca	37	2	42281437	42281445	+	In_Frame_Del	DEL	AATGCCTAC	AATGCCTAC	-	rs55733961|rs371967754	byFrequency	TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	AATGCCTAC	AATGCCTAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr2:42281437_42281445delAATGCCTAC	ENST00000294964.5	+	3	1204_1212	c.1024_1032delAATGCCTAC	c.(1024-1032)aatgcctacdel	p.NAY342del		NM_138370.2	NP_612379.2			protein kinase domain containing, cytoplasmic											breast(2)|kidney(1)|lung(5)	8						GAACCTCTATAATGCCTACAGGTGACCTC	0.617																																					p.342_344del													.	PKDCC-67	0			c.1024_1032del						.																																			SO:0001651	inframe_deletion	91461	exon3			CTCTATAATGCCT		CCDS33186.2	2p21	2014-01-28	2012-12-07		ENSG00000162878	ENSG00000162878			25123	protein-coding gene	gene with protein product	"""vertebrate lonesome kinase"""	614150	"""protein kinase domain containing, cytoplasmic homolog (mouse)"""			19097194, 19465597	Standard	NM_138370		Approved	SgK493, Vlk	uc002rsg.3	Q504Y2	OTTHUMG00000152303	ENST00000294964.5:c.1024_1032delAATGCCTAC	2.37:g.42281437_42281445delAATGCCTAC	ENSP00000294964:p.Asn342_Tyr344del	Somatic	211	0		WXS	Illumina HiSeq	Phase_I	201	16	NM_138370	0	0	0	0	0		In_Frame_Del	DEL	ENST00000294964.5	37	CCDS33186.2																																																																																			.		0.617	PKDCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325745.3		
UNC80	285175	broad.mit.edu	37	2	210841021	210841021	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr2:210841021delG	ENST00000439458.1	+	56	8648	c.8568delG	c.(8566-8568)cagfs	p.Q2856fs	UNC80_ENST00000539183.1_Frame_Shift_Del_p.Q302fs|UNC80_ENST00000272845.6_Frame_Shift_Del_p.Q2851fs	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2856					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CTTTCATCCAGTGCAAGGTGT	0.542																																					p.Q2856fs													.	UNC80-90	0			c.8568delG						.						130.0	113.0	118.0					2																	210841021		692	1591	2283	SO:0001589	frameshift_variant	285175	exon56			CATCCAGTGCAAG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.8568delG	2.37:g.210841021delG	ENSP00000391088:p.Gln2856fs	Somatic	168	0		WXS	Illumina HiSeq	Phase_I	129	8	NM_032504	0	0	0	0	0	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Frame_Shift_Del	DEL	ENST00000439458.1	37	CCDS46504.1																																																																																			.		0.542	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
ZSWIM3	140831	bcgsc.ca	37	20	44486494	44486501	+	Frame_Shift_Del	DEL	TGAGGACT	TGAGGACT	-	rs199725190		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	TGAGGACT	TGAGGACT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr20:44486494_44486501delTGAGGACT	ENST00000255152.2	+	1	239_246	c.30_37delTGAGGACT	c.(28-39)tatgaggacttcfs	p.EDF11fs	ACOT8_ENST00000217455.4_5'Flank|ZSWIM3_ENST00000454862.2_5'UTR	NM_080752.3	NP_542790.2	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM-type containing 3	11							zinc ion binding (GO:0008270)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	35		Myeloproliferative disorder(115;0.0122)				TCAAGACCTATGAGGACTTCAAGGAGTG	0.601																																					p.10_13del													.	ZSWIM3-92	0			c.30_37del						.																																			SO:0001589	frameshift_variant	140831	exon1			GACCTATGAGGAC	AL008726	CCDS13381.1	20q13.12	2014-06-13	2003-12-17	2003-12-19	ENSG00000132801	ENSG00000132801		"""Zinc fingers, SWIM-type"""	16157	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 174"""		"""chromosome 20 open reading frame 164"""	C20orf164			Standard	NM_080752		Approved	dJ337O18.7, PPP1R174	uc002xqd.3	Q96MP5	OTTHUMG00000032627	ENST00000255152.2:c.30_37delTGAGGACT	20.37:g.44486494_44486501delTGAGGACT	ENSP00000255152:p.Glu11fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_1	101	6	NM_080752	0	0	0	0	0	Q9BR13	Frame_Shift_Del	DEL	ENST00000255152.2	37	CCDS13381.1																																																																																			.		0.601	ZSWIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079540.1	NM_080752	
STAG2	10735	broad.mit.edu	37	X	123190070	123190070	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chrX:123190070delA	ENST00000371160.1	+	14	1579	c.1289delA	c.(1288-1290)gaafs	p.E430fs	STAG2_ENST00000371157.3_Frame_Shift_Del_p.E430fs|STAG2_ENST00000371144.3_Frame_Shift_Del_p.E430fs|STAG2_ENST00000371145.3_Frame_Shift_Del_p.E430fs|STAG2_ENST00000354548.5_Frame_Shift_Del_p.E361fs|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Frame_Shift_Del_p.E430fs	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	430					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GCAGCTGGAGAATTTCTCTAC	0.333																																					p.E430fs													.	STAG2-134	0			c.1289delA						.						71.0	69.0	70.0					X																	123190070		2203	4300	6503	SO:0001589	frameshift_variant	10735	exon14			CTGGAGAATTTCT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1289delA	X.37:g.123190070delA	ENSP00000360202:p.Glu430fs	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	25	9	NM_001042749	0	0	0	0	0	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Frame_Shift_Del	DEL	ENST00000371160.1	37	CCDS14607.1																																																																																			.		0.333	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
MUC6	4588	broad.mit.edu	37	11	1019461	1019462	+	Frame_Shift_Ins	INS	-	-	T			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr11:1019461_1019462insT	ENST00000421673.2	-	30	3893_3894	c.3843_3844insA	c.(3841-3846)caagccfs	p.A1282fs		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1282	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTGATGTGGCTTGTGGGGTGA	0.639																																					p.A1282fs													.	MUC6-23	0			c.3844_3845insA						.																																			SO:0001589	frameshift_variant	4588	exon30			ATGTGGCTTGTGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.3844dupA	11.37:g.1019463_1019463dupT	ENSP00000406861:p.Ala1282fs	Somatic	304	0		WXS	Illumina HiSeq	Phase_I	439	7	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Frame_Shift_Ins	INS	ENST00000421673.2	37	CCDS44513.1																																																																																			.		0.639	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MSH6	2956	broad.mit.edu;bcgsc.ca	37	2	48025884	48025885	+	Frame_Shift_Ins	INS	-	-	G	rs267608072		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr2:48025884_48025885insG	ENST00000234420.5	+	4	914_915	c.762_763insG	c.(763-765)gagfs	p.E255fs	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000538136.1_5'UTR|MSH6_ENST00000540021.1_Frame_Shift_Ins_p.E125fs	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	255					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TATCAGATTCTGAGAGTGACAT	0.436			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.S254fs			yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6-3014	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.762_763insG						.																																			SO:0001589	frameshift_variant	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	AGATTCTGAGAGT	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.763dupG	2.37:g.48025885_48025885dupG	ENSP00000234420:p.Glu255fs	Somatic	95	0		WXS	Illumina HiSeq	Phase_I	57	8	NM_000179	0	0	0	0	0	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Frame_Shift_Ins	INS	ENST00000234420.5	37	CCDS1836.1																																																																																			.		0.436	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
NDUFB5	4711	broad.mit.edu	37	3	179322628	179322629	+	Frame_Shift_Ins	INS	-	-	G	rs144873631|rs11539673		TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr3:179322628_179322629insG	ENST00000259037.3	+	1	139_140	c.25_26insG	c.(25-27)cggfs	p.R9fs	MRPL47_ENST00000476781.1_5'Flank|NDUFB5_ENST00000472629.1_Frame_Shift_Ins_p.R9fs|MRPL47_ENST00000259038.2_5'Flank|NDUFB5_ENST00000493866.1_Frame_Shift_Ins_p.R9fs|MRPL47_ENST00000392659.2_5'Flank	NM_002492.3	NP_002483.1	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa	9					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.R9P(1)		endometrium(1)|lung(6)|skin(1)	8	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			TTTGTTGCGGCGGGTTTCGGTT	0.609																																					p.R9fs													.	NDUFB5-91	1	Substitution - Missense(1)	lung(1)	c.25_26insG						.																																			SO:0001589	frameshift_variant	4711	exon1			TTGCGGCGGGTTT	AF047181	CCDS3234.1, CCDS56297.1, CCDS75054.1	3q27.1	2011-07-04	2002-08-29		ENSG00000136521	ENSG00000136521		"""Mitochondrial respiratory chain complex / Complex I"""	7700	protein-coding gene	gene with protein product	"""complex I SGDH subunit"""	603841	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 (16kD, SGDH)"""			9425316	Standard	NM_002492		Approved	SGDH, CI-SGDH, MGC12314	uc003fkc.3	O43674	OTTHUMG00000157480	ENST00000259037.3:c.28dupG	3.37:g.179322631_179322631dupG	ENSP00000259037:p.Arg9fs	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	100	16	NM_002492	0	0	0	0	0	Q561V6	Frame_Shift_Ins	INS	ENST00000259037.3	37	CCDS3234.1																																																																																			.		0.609	NDUFB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348937.2	NM_002492	
IDH3B	3420	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	2639397	2639398	+	Nonstop_Mutation	DNP	CT	CT	TA			TCGA-GL-A4EM-01A-11D-A25F-10	TCGA-GL-A4EM-10A-01D-A25F-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7815397b-aa39-4b79-bcaa-6859a3f115f8	4bc53b4e-8334-46ff-aaab-4e5a0f30177b	g.chr20:2639397_2639398CT>TA	ENST00000380843.4	-	12	1187_1188	c.1157_1158AG>TA	c.(1156-1158)tAG>tTA	p.*386L	SNORD86_ENST00000391196.1_RNA|IDH3B_ENST00000380851.5_Intron|SNORD56_ENST00000413522.1_RNA|IDH3B_ENST00000488299.1_5'UTR|SNORD57_ENST00000448188.1_RNA	NM_006899.3	NP_008830.2	O43837	IDH3B_HUMAN	isocitrate dehydrogenase 3 (NAD+) beta	0					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|NADH metabolic process (GO:0006734)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(1)|endometrium(3)|kidney(2)|lung(7)|prostate(1)	14						ATAAAGGGCTCTAGCTCCCTTT	0.55																																					.		.											.	IDH3B-226	0			c.A1157T						.																																			SO:0001578	stop_lost	3420	exon12			GGGCTCTAGCTCC		CCDS13031.1, CCDS13032.1, CCDS74696.1	20p13	2013-02-14			ENSG00000101365	ENSG00000101365	1.1.1.41		5385	protein-coding gene	gene with protein product		604526				10575215	Standard	NM_006899		Approved	RP46	uc002wgp.4	O43837	OTTHUMG00000031699	ENST00000380843.4:c.1156_1156delinsTA	20.37:g.2639397_2639398delinsTA	Exception_encountered	Somatic	278.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	20.0	NM_006899	0	0	0	0	0	B2RDR1|D3DVX2|D3DVX3|O95106|Q5JXS8|Q9NQ06|Q9NQ07|Q9NUZ0|Q9UEX0|Q9UG99	Missense_Mutation	DNP	ENST00000380843.4	37	CCDS13032.1																																																																																			.		0.550	IDH3B-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077613.1		
