#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DDI2	84301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15956850	15956850	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr1:15956850C>A	ENST00000480945.1	+	3	470	c.299C>A	c.(298-300)gCt>gAt	p.A100D		NM_032341.4	NP_115717.3	Q5TDH0	DDI2_HUMAN	DNA-damage inducible 1 homolog 2 (S. cerevisiae)	100							aspartic-type endopeptidase activity (GO:0004190)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|stomach(1)	17		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGTAGTATAGCTGTGCCTGGC	0.473																																					p.A100D		.											.	DDI2-44	0			c.C299A						.						86.0	88.0	87.0					1																	15956850		2203	4300	6503	SO:0001583	missense	84301	exon3			GTATAGCTGTGCC		CCDS30607.1	1p36.13	2010-05-04	2010-05-04		ENSG00000197312	ENSG00000197312			24578	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae)"""				Standard	NM_032341		Approved	MGC14844	uc001awx.2	Q5TDH0	OTTHUMG00000002381	ENST00000480945.1:c.299C>A	1.37:g.15956850C>A	ENSP00000417748:p.Ala100Asp	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	112	24	NM_032341	0	0	5	6	1	A8KAE1|Q7RTZ0|Q9BRT1	Missense_Mutation	SNP	ENST00000480945.1	37	CCDS30607.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182624	0.78677	.	.	ENSG00000197312	ENST00000480945	T	0.23552	1.9	5.9	5.9	0.94986	.	0.130770	0.51477	U	0.000091	T	0.34774	0.0909	M	0.71036	2.16	0.80722	D	1	P	0.44946	0.846	B	0.40101	0.319	T	0.19321	-1.0309	10	0.56958	D	0.05	-28.9484	19.873	0.96856	0.0:1.0:0.0:0.0	.	100	Q5TDH0	DDI2_HUMAN	D	100	ENSP00000417748:A100D	ENSP00000417748:A100D	A	+	2	0	DDI2	15829437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.971000	0.76105	2.802000	0.96397	0.650000	0.86243	GCT	.		0.473	DDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006826.1	NM_032341	
SLC16A12	387700	bcgsc.ca	37	10	91203549	91203549	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr10:91203549T>C	ENST00000341233.4	-	4	568	c.178A>G	c.(178-180)Atc>Gtc	p.I60V	SLC16A12_ENST00000371790.4_Missense_Mutation_p.I90V	NM_213606.3	NP_998771.3	Q6ZSM3	MOT12_HUMAN	solute carrier family 16, member 12	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|skin(1)|stomach(1)	14						ATGGAATGGATCCATGCCGTT	0.378																																					p.I90V													.	SLC16A12-69	0			c.A268G						.						124.0	108.0	114.0					10																	91203549		2203	4300	6503	SO:0001583	missense	387700	exon4			AATGGATCCATGC		CCDS7404.1, CCDS7404.2	10q23.32	2013-07-18	2013-07-18		ENSG00000152779	ENSG00000152779		"""Solute carriers"""	23094	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 12"""	611910	"""solute carrier family 16 (monocarboxylic acid transporters), member 12"", ""solute carrier family 16, member 12 (monocarboxylic acid transporter 12)"""				Standard	NM_213606		Approved	MCT12	uc001kgm.3	Q6ZSM3	OTTHUMG00000018714	ENST00000341233.4:c.178A>G	10.37:g.91203549T>C	ENSP00000343022:p.Ile60Val	Somatic	56	0		WXS	Illumina HiSeq	Phase_1	60	4	NM_213606	0	0	22	22	0	Q5M9M9|Q5T7J2|Q6ZV76	Missense_Mutation	SNP	ENST00000341233.4	37		.	.	.	.	.	.	.	.	.	.	T	18.13	3.554819	0.65425	.	.	ENSG00000152779	ENST00000341233;ENST00000371790	T;T	0.55413	0.52;0.52	5.47	5.47	0.80525	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.098147	0.64402	D	0.000002	T	0.46658	0.1404	L	0.37850	1.14	0.80722	D	1	P	0.37612	0.602	B	0.42214	0.38	T	0.33163	-0.9879	10	0.14252	T	0.57	.	14.7418	0.69461	0.0:0.0:0.0:1.0	.	60	Q6ZSM3	MOT12_HUMAN	V	60;90	ENSP00000343022:I60V;ENSP00000360855:I90V	ENSP00000343022:I60V	I	-	1	0	SLC16A12	91193529	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.223000	0.72257	2.087000	0.62958	0.482000	0.46254	ATC	.		0.378	SLC16A12-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_213606	
NDUFS3	4722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	47604000	47604000	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr11:47604000C>T	ENST00000263774.4	+	6	689	c.607C>T	c.(607-609)Cct>Tct	p.P203S	NDUFS3_ENST00000533507.1_3'UTR	NM_004551.2	NP_004542.1	O75489	NDUS3_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NADH-coenzyme Q reductase)	203					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)	9					Doxorubicin(DB00997)	GAAAGACTTTCCTCTATCTGG	0.512																																					p.P203S	Pancreas(15;551 601 22438 23457 52512)	.											.	NDUFS3-90	0			c.C607T						.						261.0	270.0	267.0					11																	47604000		2201	4298	6499	SO:0001583	missense	4722	exon6			GACTTTCCTCTAT	AF067139	CCDS7941.1	11p11.11	2011-08-03	2002-08-29		ENSG00000213619	ENSG00000213619	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7710	protein-coding gene	gene with protein product	"""complex I 30kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial"""	603846	"""NADH dehydrogenase (ubiquinone) Fe-S protein 3 (30kD) (NADH-coenzyme Q reductase)"""			9763677	Standard	NM_004551		Approved	CI-30	uc001nga.2	O75489	OTTHUMG00000166893	ENST00000263774.4:c.607C>T	11.37:g.47604000C>T	ENSP00000263774:p.Pro203Ser	Somatic	512	1		WXS	Illumina HiSeq	Phase_I	378	86	NM_004551	0	0	60	79	19	B2R9J1|B4DFM8|Q9UNQ8	Missense_Mutation	SNP	ENST00000263774.4	37	CCDS7941.1	.	.	.	.	.	.	.	.	.	.	C	33	5.261674	0.95368	.	.	ENSG00000213619	ENST00000263774	D	0.88124	-2.34	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.95544	0.8552	M	0.93507	3.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.972;0.979	D	0.95909	0.8921	10	0.87932	D	0	-17.4651	20.206	0.98277	0.0:1.0:0.0:0.0	.	203;129	O75489;Q9UF24	NDUS3_HUMAN;.	S	203	ENSP00000263774:P203S	ENSP00000263774:P203S	P	+	1	0	NDUFS3	47560576	1.000000	0.71417	0.999000	0.59377	0.932000	0.56968	7.474000	0.81024	2.785000	0.95823	0.655000	0.94253	CCT	.		0.512	NDUFS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391749.1	NM_004551	
ARHGEF17	9828	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	73020521	73020521	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr11:73020521G>T	ENST00000263674.3	+	1	1188	c.838G>T	c.(838-840)Gac>Tac	p.D280Y	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	280					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CAGTGACGACGACCGAGACGG	0.697																																					p.D280Y		.											.	ARHGEF17-227	0			c.G838T						.						16.0	21.0	20.0					11																	73020521		2151	4242	6393	SO:0001583	missense	9828	exon1			GACGACGACCGAG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.838G>T	11.37:g.73020521G>T	ENSP00000263674:p.Asp280Tyr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	50	13	NM_014786	0	0	9	12	3	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	37	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677629	0.47886	.	.	ENSG00000110237	ENST00000263674	T	0.68181	-0.31	4.72	4.72	0.59763	.	0.000000	0.40554	N	0.001072	T	0.60495	0.2273	L	0.27053	0.805	0.09310	N	0.999994	P	0.49447	0.924	P	0.46419	0.516	T	0.60239	-0.7302	10	0.87932	D	0	-17.9023	15.1972	0.73100	0.0:0.0:1.0:0.0	.	280	Q96PE2	ARHGH_HUMAN	Y	280	ENSP00000263674:D280Y	ENSP00000263674:D280Y	D	+	1	0	ARHGEF17	72698169	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	4.087000	0.57671	2.179000	0.69175	0.313000	0.20887	GAC	.		0.697	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	49446075	49446075	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:49446075G>A	ENST00000301067.7	-	10	1390	c.1391C>T	c.(1390-1392)gCa>gTa	p.A464V		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	464	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CAGGCGTGATGCCTCAGGTGG	0.657																																					p.A464V		.											.	MLL2-612	0			c.C1391T						.						88.0	98.0	94.0					12																	49446075		2162	4235	6397	SO:0001583	missense	8085	exon10			CGTGATGCCTCAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1391C>T	12.37:g.49446075G>A	ENSP00000301067:p.Ala464Val	Somatic	166	0		WXS	Illumina HiSeq	Phase_I	180	48	NM_003482	0	0	7	10	3	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	7.479	0.648310	0.14516	.	.	ENSG00000167548	ENST00000301067	T	0.80393	-1.37	3.73	2.82	0.32997	.	.	.	.	.	T	0.58807	0.2148	N	0.08118	0	0.21841	N	0.999512	P	0.38395	0.629	B	0.29440	0.102	T	0.53844	-0.8381	9	0.87932	D	0	.	8.8235	0.35041	0.0:0.0:0.5915:0.4085	.	464	O14686	MLL2_HUMAN	V	464	ENSP00000301067:A464V	ENSP00000301067:A464V	A	-	2	0	MLL2	47732342	0.989000	0.36119	0.999000	0.59377	0.673000	0.39480	0.945000	0.29056	1.130000	0.42092	0.313000	0.20887	GCA	.		0.657	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
UTP20	27340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	101684601	101684601	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:101684601A>G	ENST00000261637.4	+	8	1000	c.826A>G	c.(826-828)Atg>Gtg	p.M276V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	276					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						ACTCAAAAACATGGTCAAATC	0.373																																					p.M276V		.											.	UTP20-155	0			c.A826G						.						165.0	146.0	153.0					12																	101684601		2203	4300	6503	SO:0001583	missense	27340	exon8			AAAAACATGGTCA	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.826A>G	12.37:g.101684601A>G	ENSP00000261637:p.Met276Val	Somatic	65	1		WXS	Illumina HiSeq	Phase_I	95	28	NM_014503	0	0	2	4	2	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	37	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	a	11.01	1.513057	0.27123	.	.	ENSG00000120800	ENST00000261637	T	0.63096	-0.02	5.36	5.36	0.76844	Armadillo-type fold (1);	0.044796	0.85682	D	0.000000	T	0.53449	0.1797	M	0.65975	2.015	0.41134	D	0.9859	B	0.13145	0.007	B	0.08055	0.003	T	0.49523	-0.8931	10	0.02654	T	1	-27.2237	10.5826	0.45265	0.8563:0.0:0.0:0.1437	.	276	O75691	UTP20_HUMAN	V	276	ENSP00000261637:M276V	ENSP00000261637:M276V	M	+	1	0	UTP20	100208732	1.000000	0.71417	0.999000	0.59377	0.862000	0.49288	5.005000	0.63972	2.031000	0.59945	0.528000	0.53228	ATG	.		0.373	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
PTPN11	5781	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112892482	112892482	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:112892482C>A	ENST00000351677.2	+	5	838	c.640C>A	c.(640-642)Cag>Aag	p.Q214K	PTPN11_ENST00000392597.1_Missense_Mutation_p.Q214K	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	214	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						ACAACTCAAGCAGGTGAGCAG	0.378			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																												p.Q214K				Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	.	PTPN11-7239	0			c.C640A						.						72.0	67.0	69.0					12																	112892482		2203	4300	6503	SO:0001583	missense	5781	exon5	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CTCAAGCAGGTGA	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.640C>A	12.37:g.112892482C>A	ENSP00000340944:p.Gln214Lys	Somatic	39	0		WXS	Illumina HiSeq	Phase_I	50	7	NM_080601	0	0	0	0	0	A8K1D9|Q96HD7	Missense_Mutation	SNP	ENST00000351677.2	37	CCDS9163.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.04|17.04	3.287636|3.287636	0.59976|0.59976	.|.	.|.	ENSG00000179295|ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596|ENST00000530818	T;T|.	0.75938|.	-0.98;-0.98|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68531|0.68531	0.3011|0.3011	L|L	0.42744|0.42744	1.35|1.35	0.80722|0.80722	D|D	1|1	B;B|.	0.19583|.	0.016;0.037|.	B;B|.	0.23150|.	0.036;0.044|.	T|T	0.63296|0.63296	-0.6669|-0.6669	10|5	0.40728|.	T|.	0.16|.	.|.	19.717|19.717	0.96124|0.96124	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	214;214|.	Q06124-2;Q06124-3|.	.;.|.	K|R	214|58	ENSP00000376376:Q214K;ENSP00000340944:Q214K|.	ENSP00000340944:Q214K|.	Q|S	+|+	1|3	0|2	PTPN11|PTPN11	111376865|111376865	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.431000|0.431000	0.31685|0.31685	7.468000|7.468000	0.80943|0.80943	2.654000|2.654000	0.90174|0.90174	0.484000|0.484000	0.47621|0.47621	CAG|AGC	.		0.378	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259496.2		
ABCB9	23457	broad.mit.edu	37	12	123444428	123444428	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:123444428G>T	ENST00000542678.1	-	2	3193	c.355C>A	c.(355-357)Ctg>Atg	p.L119M	ABCB9_ENST00000344275.7_Missense_Mutation_p.L119M|ABCB9_ENST00000392439.3_Missense_Mutation_p.L119M|ABCB9_ENST00000280560.8_Missense_Mutation_p.L119M|ABCB9_ENST00000540285.1_Missense_Mutation_p.L119M|ABCB9_ENST00000442028.2_Missense_Mutation_p.L119M|ABCB9_ENST00000442833.2_Missense_Mutation_p.L119M|ABCB9_ENST00000346530.5_Missense_Mutation_p.L119M			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	119					peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		CACACGAACAGGGCCCAAAAC	0.647																																					p.L119M	Ovarian(49;786 1333 9175 38236)												.	ABCB9-90	0			c.C355A						.						35.0	38.0	37.0					12																	123444428		2203	4300	6503	SO:0001583	missense	23457	exon2			CGAACAGGGCCCA	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.355C>A	12.37:g.123444428G>T	ENSP00000440288:p.Leu119Met	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	35	6	NM_019625	0	0	6	11	5	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	ENST00000542678.1	37	CCDS9241.1	.	.	.	.	.	.	.	.	.	.	G	15.02	2.707845	0.48412	.	.	ENSG00000150967	ENST00000280560;ENST00000540285;ENST00000346530;ENST00000392439;ENST00000542678;ENST00000442028;ENST00000539502	D;D;D;D;D;D	0.90732	-2.41;-2.72;-2.6;-2.41;-2.41;-2.39	5.53	3.63	0.41609	.	0.159060	0.42053	D	0.000776	D	0.92570	0.7640	L	0.55481	1.735	0.45777	D	0.998666	P;D;D;D;D	0.89917	0.822;1.0;1.0;0.961;1.0	P;D;D;P;D	0.91635	0.54;0.999;0.991;0.774;0.987	D	0.90410	0.4409	10	0.44086	T	0.13	-30.2529	8.7879	0.34832	0.07:0.0:0.6597:0.2704	.	119;119;119;119;119	B4E2J0;F5GX63;Q9NP78-3;Q9NP78-2;Q9NP78	.;.;.;.;ABCB9_HUMAN	M	119	ENSP00000280560:L119M;ENSP00000441734:L119M;ENSP00000280559:L119M;ENSP00000376234:L119M;ENSP00000440288:L119M;ENSP00000394898:L119M	ENSP00000280560:L119M	L	-	1	2	ABCB9	122010381	0.994000	0.37717	0.991000	0.47740	0.938000	0.57974	1.935000	0.40173	0.642000	0.30620	0.561000	0.74099	CTG	.		0.647	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624	
OGFOD2	79676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	123463804	123463804	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr12:123463804C>G	ENST00000228922.7	+	7	996	c.964C>G	c.(964-966)Cgt>Ggt	p.R322G	ARL6IP4_ENST00000315580.5_5'Flank|ARL6IP4_ENST00000439686.2_5'Flank|RP11-197N18.2_ENST00000540866.2_RNA|ARL6IP4_ENST00000357866.4_5'Flank|ARL6IP4_ENST00000426960.2_5'Flank|ARL6IP4_ENST00000453766.2_5'Flank|OGFOD2_ENST00000454694.2_Missense_Mutation_p.R158G|ABCB9_ENST00000542678.1_5'UTR|ARL6IP4_ENST00000392435.2_5'Flank|OGFOD2_ENST00000545612.1_Missense_Mutation_p.R158G|OGFOD2_ENST00000397389.2_Missense_Mutation_p.R262G|OGFOD2_ENST00000538755.1_Missense_Mutation_p.R158G|OGFOD2_ENST00000536150.1_Missense_Mutation_p.R158G|ARL6IP4_ENST00000543566.1_5'Flank|ARL6IP4_ENST00000412505.2_5'Flank|OGFOD2_ENST00000538628.1_Missense_Mutation_p.R158G|ARL6IP4_ENST00000454885.2_5'Flank|OGFOD2_ENST00000545317.1_Missense_Mutation_p.R158G			Q6N063	OGFD2_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 2	322							iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			breast(1)|endometrium(2)|lung(4)|pancreas(1)	8	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.11e-05)|Epithelial(86;0.000127)|BRCA - Breast invasive adenocarcinoma(302;0.107)	Vitamin C(DB00126)	CATGTGCTGCCGTGAGCCCGA	0.647																																					p.R262G		.											.	OGFOD2-69	0			c.C784G						.						42.0	49.0	47.0					12																	123463804		2166	4249	6415	SO:0001583	missense	79676	exon8			TGCTGCCGTGAGC	AK094820	CCDS41855.1	12q24.31	2010-11-23			ENSG00000111325	ENSG00000111325			25823	protein-coding gene	gene with protein product						12477932	Standard	NM_024623		Approved	FLJ13491, FLJ37501	uc001udz.1	Q6N063		ENST00000228922.7:c.964C>G	12.37:g.123463804C>G	ENSP00000228922:p.Arg322Gly	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	70	13	NM_024623	0	0	13	29	16	B3KT24|Q4KN13|Q6N023|Q9H8K6	Missense_Mutation	SNP	ENST00000228922.7	37		.	.	.	.	.	.	.	.	.	.	C	2.311	-0.357912	0.05138	.	.	ENSG00000111325	ENST00000397389;ENST00000538755;ENST00000536150;ENST00000545056;ENST00000545612;ENST00000538628;ENST00000545317;ENST00000454694;ENST00000228922;ENST00000536439	D;D	0.86432	-2.12;-2.12	5.07	2.15	0.27550	.	0.765042	0.12924	N	0.427954	D	0.83691	0.5309	M	0.62723	1.935	0.09310	N	1	B;B	0.13594	0.008;0.003	B;B	0.10450	0.005;0.005	T	0.74976	-0.3480	10	0.62326	D	0.03	-12.262	8.1428	0.31093	0.2533:0.6406:0.0:0.1061	.	322;262	Q6N063;Q6N063-2	OGFD2_HUMAN;.	G	262;158;158;158;158;158;158;158;322;158	ENSP00000380544:R262G;ENSP00000228922:R322G	ENSP00000228922:R322G	R	+	1	0	OGFOD2	122029757	0.007000	0.16637	0.378000	0.26068	0.008000	0.06430	0.512000	0.22755	0.560000	0.29169	-0.954000	0.02651	CGT	.		0.647	OGFOD2-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000400984.1	NM_024623	
FARP1	10160	ucsc.edu	37	13	98865556	98865556	+	Silent	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr13:98865556G>A	ENST00000319562.6	+	2	325	c.60G>A	c.(58-60)tcG>tcA	p.S20S	FARP1_ENST00000376586.2_Silent_p.S20S|FARP1_ENST00000376581.5_Silent_p.S20S|FARP1_ENST00000595437.1_Silent_p.S20S	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	20					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S20S(6)		breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CGGAAAATTCGGGGATCAGTA	0.542																																					p.S20S													.	FARP1-290	6	Substitution - coding silent(6)	lung(3)|endometrium(3)	c.G60A						.						109.0	126.0	120.0					13																	98865556		2203	4300	6503	SO:0001819	synonymous_variant	10160	exon2			AAATTCGGGGATC	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.60G>A	13.37:g.98865556G>A		Somatic	249	0		WXS	Illumina HiSeq		153	5	NM_001001715	0	0	81	89	8	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	37	CCDS9487.1																																																																																			.		0.542	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
BTBD7	55727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	93730186	93730186	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr14:93730186A>C	ENST00000334746.5	-	4	1623	c.1316T>G	c.(1315-1317)tTt>tGt	p.F439C	BTBD7_ENST00000393170.2_Intron|BTBD7_ENST00000554565.1_Missense_Mutation_p.F88C	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	439	BACK.				multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GAGTTCATAAAAAACATCCGA	0.428																																					p.F439C		.											.	BTBD7-91	0			c.T1316G						.						121.0	113.0	116.0					14																	93730186		2203	4300	6503	SO:0001583	missense	55727	exon4			TCATAAAAAACAT	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1316T>G	14.37:g.93730186A>C	ENSP00000335615:p.Phe439Cys	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	75	16	NM_001002860	0	0	7	13	6	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	ENST00000334746.5	37	CCDS32146.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.453818	0.84209	.	.	ENSG00000011114	ENST00000334746;ENST00000554565	D;D	0.82526	-1.62;-1.62	4.99	4.99	0.66335	BTB/Kelch-associated (2);	0.049285	0.85682	D	0.000000	D	0.90758	0.7099	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.999;0.992	D;P	0.65443	0.935;0.819	D	0.92297	0.5846	10	0.87932	D	0	.	14.7279	0.69357	1.0:0.0:0.0:0.0	.	88;439	Q9P203-5;Q9P203	.;BTBD7_HUMAN	C	439;88	ENSP00000335615:F439C;ENSP00000451010:F88C	ENSP00000335615:F439C	F	-	2	0	BTBD7	92799939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.904000	0.55121	0.456000	0.33151	TTT	.		0.428	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
SLC27A2	11001	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	50528292	50528292	+	Silent	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr15:50528292G>A	ENST00000267842.5	+	10	2094	c.1862G>A	c.(1861-1863)tGa>tAa	p.*621*	SLC27A2_ENST00000380902.4_Silent_p.*568*|SLC27A2_ENST00000544960.1_Silent_p.*386*	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	0					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		CTGAAACTCTGAATATTCCCA	0.363																																					p.X621X													.	SLC27A2-92	0			c.G1862A						.						104.0	100.0	102.0					15																	50528292		2196	4295	6491	SO:0001819	synonymous_variant	11001	exon10			AACTCTGAATATT	D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.1862G>A	15.37:g.50528292G>A		Somatic	99	0		WXS	Illumina HiSeq	Phase_I	75	15	NM_003645	1	0	3	11	7	A8K2J7|Q53FY6|Q6PF09	Silent	SNP	ENST00000267842.5	37	CCDS10133.1																																																																																			.		0.363	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254539.2	NM_003645	
CDH16	1014	ucsc.edu	37	16	66949283	66949283	+	Splice_Site	SNP	T	T	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr16:66949283T>A	ENST00000299752.4	-	6	618		c.e6-2		CDH16_ENST00000394055.3_Splice_Site|CDH16_ENST00000570262.1_Splice_Site|CDH16_ENST00000565796.1_Splice_Site|CDH16_ENST00000568632.1_Intron	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin						calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		AGGGGATGCCTGGTTCACGGT	0.562																																					.													.	CDH16-93	0			c.425-2A>T						.						54.0	55.0	55.0					16																	66949283		2200	4300	6500	SO:0001630	splice_region_variant	1014	exon7			GATGCCTGGTTCA	AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.425-2A>T	16.37:g.66949283T>A		Somatic	60	0		WXS	Illumina HiSeq		65	1	NM_004062	0	0	4	4	0	B4DPA8|H3BPD3|Q6UW93	Splice_Site	SNP	ENST00000299752.4	37	CCDS10823.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094037	0.76870	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0694	0.47995	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDH16	65506784	1.000000	0.71417	0.850000	0.33497	0.589000	0.36550	5.069000	0.64370	1.930000	0.55929	0.460000	0.39030	.	.		0.562	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268839.2	NM_004062	Intron
PIK3R6	146850	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	8731475	8731475	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr17:8731475G>A	ENST00000311434.9	-	12	1585	c.1346C>T	c.(1345-1347)cCc>cTc	p.P449L	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	449					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										GCTGAGTCTGGGAGTGAGGCA	0.642																																					.													.	.	0			.						.						94.0	98.0	96.0					17																	8731475		1991	4163	6154	SO:0001583	missense	146850	.			AGTCTGGGAGTGA	AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.1346C>T	17.37:g.8731475G>A	ENSP00000475670:p.Pro449Leu	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	80	9	.	0	0	13	13	0	Q658R3	Missense_Mutation	SNP	ENST00000311434.9	37																																																																																				.		0.642	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001010855	
ASXL3	80816	hgsc.bcm.edu	37	18	31318454	31318454	+	Silent	SNP	G	G	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr18:31318454G>C	ENST00000269197.5	+	11	1086	c.1086G>C	c.(1084-1086)ctG>ctC	p.L362L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	362					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TGTACAGGCTGGGCATGTCAA	0.408																																					p.L362L		.											.	ASXL3-49	0			c.G1086C						.						50.0	48.0	49.0					18																	31318454		1880	4118	5998	SO:0001819	synonymous_variant	80816	exon11			CAGGCTGGGCATG	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1086G>C	18.37:g.31318454G>C		Somatic	27	0		WXS	Illumina HiSeq	Phase_I	36	2	NM_030632	0	0	0	0	0	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	37	CCDS45847.1																																																																																			.		0.408	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
EPG5	57724	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	43440155	43440155	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr18:43440155A>G	ENST00000282041.5	-	40	6957	c.6923T>C	c.(6922-6924)cTt>cCt	p.L2308P	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2308					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						TGCTGTTAAAAGGGGCAGCAC	0.537																																					p.L2308P		.											.	EPG5-580	0			c.T6923C						.						76.0	79.0	78.0					18																	43440155		1977	4156	6133	SO:0001583	missense	57724	exon40			GTTAAAAGGGGCA	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.6923T>C	18.37:g.43440155A>G	ENSP00000282041:p.Leu2308Pro	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	90	18	NM_020964	0	0	10	12	2	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	37	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237609	0.58886	.	.	ENSG00000152223	ENST00000282041;ENST00000540322;ENST00000308403	T	0.12672	2.66	5.59	5.59	0.84812	.	.	.	.	.	T	0.36082	0.0954	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.08106	-1.0738	9	0.87932	D	0	-10.9784	15.7665	0.78131	1.0:0.0:0.0:0.0	.	2308	Q9HCE0	EPG5_HUMAN	P	2308;236;1183	ENSP00000282041:L2308P	ENSP00000282041:L2308P	L	-	2	0	EPG5	41694153	1.000000	0.71417	0.897000	0.35233	0.053000	0.15095	9.225000	0.95219	2.108000	0.64289	0.533000	0.62120	CTT	.		0.537	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
ZNF532	55205	ucsc.edu	37	18	56586955	56586955	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr18:56586955C>T	ENST00000336078.4	+	4	2212	c.1436C>T	c.(1435-1437)aCg>aTg	p.T479M	ZNF532_ENST00000589288.1_Missense_Mutation_p.T479M|ZNF532_ENST00000591808.1_Missense_Mutation_p.T479M|ZNF532_ENST00000591230.1_Missense_Mutation_p.T479M|ZNF532_ENST00000591083.1_Missense_Mutation_p.T479M	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						GTGAAAGCCACGGTCATATCT	0.552																																					p.T479M													.	ZNF532-154	0			c.C1436T						.						33.0	29.0	30.0					18																	56586955		2203	4300	6503	SO:0001583	missense	55205	exon4			AAGCCACGGTCAT	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.1436C>T	18.37:g.56586955C>T	ENSP00000338217:p.Thr479Met	Somatic	50	0		WXS	Illumina HiSeq		32	3	NM_018181	0	0	5	5	0	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	37	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	c	15.70	2.909737	0.52439	.	.	ENSG00000074657	ENST00000336078	T	0.01787	4.64	5.6	5.6	0.85130	.	0.104215	0.64402	D	0.000004	T	0.08670	0.0215	L	0.58101	1.795	0.48395	D	0.999646	D	0.89917	1.0	D	0.63957	0.92	T	0.01114	-1.1447	10	0.72032	D	0.01	-4.1959	19.3114	0.94188	0.0:1.0:0.0:0.0	.	479	Q9HCE3	ZN532_HUMAN	M	479	ENSP00000338217:T479M	ENSP00000338217:T479M	T	+	2	0	ZNF532	54737935	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.840000	0.62817	2.663000	0.90544	0.544000	0.68410	ACG	.		0.552	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
LPHN1	22859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14263148	14263148	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:14263148A>G	ENST00000340736.6	-	22	3934	c.3637T>C	c.(3637-3639)Tcc>Ccc	p.S1213P	CTB-55O6.12_ENST00000592086.1_RNA|CTB-55O6.12_ENST00000588658.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.S1208P	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1213					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGGGGCGAGGAGGGATTGAAG	0.617																																					p.S1213P		.											.	LPHN1-523	0			c.T3637C						.						96.0	103.0	101.0					19																	14263148		2203	4300	6503	SO:0001583	missense	22859	exon22			GCGAGGAGGGATT	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3637T>C	19.37:g.14263148A>G	ENSP00000340688:p.Ser1213Pro	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	69	7	NM_001008701	0	0	2	5	3	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	A	5.267	0.234643	0.09969	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.66099	-0.19;-0.19	4.99	4.99	0.66335	GPCR, family 2, latrophilin, C-terminal (1);	0.061997	0.64402	D	0.000003	T	0.28797	0.0714	N	0.01235	-0.94	0.45747	D	0.998642	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.36672	-0.9738	10	0.02654	T	1	.	12.6626	0.56822	1.0:0.0:0.0:0.0	.	1208;1213	O94910-2;O94910	.;LPHN1_HUMAN	P	1213;1208	ENSP00000340688:S1213P;ENSP00000355328:S1208P	ENSP00000340688:S1213P	S	-	1	0	LPHN1	14124148	0.998000	0.40836	1.000000	0.80357	0.928000	0.56348	0.694000	0.25512	1.881000	0.54492	0.459000	0.35465	TCC	.		0.617	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
EMR2	30817	ucsc.edu	37	19	14884819	14884819	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:14884819C>T	ENST00000315576.3	-	4	581	c.130G>A	c.(130-132)Gcc>Acc	p.A44T	EMR2_ENST00000353876.1_Missense_Mutation_p.A44T|EMR2_ENST00000594294.1_Missense_Mutation_p.A44T|EMR2_ENST00000346057.1_Missense_Mutation_p.A44T|EMR2_ENST00000392964.3_5'Flank|EMR2_ENST00000353005.1_Missense_Mutation_p.A44T|EMR2_ENST00000392967.2_Missense_Mutation_p.A44T|EMR2_ENST00000595839.1_Missense_Mutation_p.A44T|EMR2_ENST00000596991.2_Missense_Mutation_p.A44T|EMR2_ENST00000601345.1_Missense_Mutation_p.A44T|EMR2_ENST00000599423.1_5'UTR|EMR2_ENST00000392965.3_Missense_Mutation_p.A44T|EMR2_ENST00000594076.1_Missense_Mutation_p.A44T	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	44	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						CAGCGACAGGCGGTGGCATTG	0.582																																					p.A44T													.	EMR2-524	0			c.G130A						.						128.0	117.0	120.0					19																	14884819		2203	4300	6503	SO:0001583	missense	30817	exon3			GACAGGCGGTGGC	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.130G>A	19.37:g.14884819C>T	ENSP00000319883:p.Ala44Thr	Somatic	210	0		WXS	Illumina HiSeq		142	1	NM_001271052	0	0	47	74	27	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	ENST00000315576.3	37	CCDS32935.1	.	.	.	.	.	.	.	.	.	.	C	12.07	1.827492	0.32329	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000360222;ENST00000392965;ENST00000392962	T;T;T;T;T;T;D	0.86694	-0.93;-1.05;-0.43;0.39;1.13;-1.22;-2.16	3.87	-7.75	0.01236	.	.	.	.	.	T	0.70456	0.3226	L	0.43554	1.36	0.09310	N	1	P;B;P;B;B;B;P	0.43477	0.808;0.278;0.466;0.001;0.037;0.341;0.668	B;B;B;B;B;B;B	0.32022	0.139;0.032;0.016;0.0;0.021;0.035;0.112	T	0.63633	-0.6593	9	0.17369	T	0.5	.	4.0651	0.09856	0.439:0.1847:0.0:0.3763	.	44;44;44;44;44;44;44	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;Q9UHX3;Q9UHX3-2	.;.;.;.;.;EMR2_HUMAN;.	T	44	ENSP00000319883:A44T;ENSP00000376694:A44T;ENSP00000263380:A44T;ENSP00000319454:A44T;ENSP00000319838:A44T;ENSP00000376692:A44T;ENSP00000376689:A44T	ENSP00000319883:A44T	A	-	1	0	EMR2	14745819	0.000000	0.05858	0.004000	0.12327	0.275000	0.26752	-3.623000	0.00411	-1.229000	0.02564	-0.507000	0.04495	GCC	.		0.582	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2		
LPAR2	9170	broad.mit.edu	37	19	19735163	19735163	+	Missense_Mutation	SNP	G	G	A	rs144007983		TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:19735163G>A	ENST00000542587.1	-	6	1860	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C	LPAR2_ENST00000586703.1_Missense_Mutation_p.R320C|LPAR2_ENST00000407877.3_Missense_Mutation_p.R320C			Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	320					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of Rho protein signal transduction (GO:0035025)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	10						ACAGACTCGCGGGTGGACTGG	0.617																																					p.R320C													.	LPAR2-501	0			c.C958T						.	G	CYS/ARG	0,4406		0,0,2203	102.0	93.0	96.0		958	3.9	0.0	19	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	no	missense	LPAR2	NM_004720.5	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	320/352	19735163	1,13005	2203	4300	6503	SO:0001583	missense	9170	exon3			ACTCGCGGGTGGA	AF011466	CCDS12407.1	19p12	2012-08-08	2008-04-11	2008-04-11		ENSG00000064547		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3168	protein-coding gene	gene with protein product		605110	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4"""	EDG4		9525886, 9804623	Standard	NM_004720		Approved	EDG-4, LPA2	uc002nnb.4	Q9HBW0		ENST00000542587.1:c.958C>T	19.37:g.19735163G>A	ENSP00000443256:p.Arg320Cys	Somatic	109	0		WXS	Illumina HiSeq	Phase_I	75	6	NM_004720	0	0	3	3	0	O00543|O43431	Missense_Mutation	SNP	ENST00000542587.1	37	CCDS12407.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896393	0.33442	0.0	1.16E-4	ENSG00000064547	ENST00000407877;ENST00000542587	T;T	0.38887	1.11;1.11	3.92	3.92	0.45320	.	1.007880	0.07969	N	0.983676	T	0.25644	0.0624	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.04976	-1.0914	10	0.59425	D	0.04	.	9.1791	0.37129	0.0:0.0:0.7833:0.2167	.	320	Q9HBW0	LPAR2_HUMAN	C	320	ENSP00000384665:R320C;ENSP00000443256:R320C	ENSP00000384665:R320C	R	-	1	0	LPAR2	19596163	0.032000	0.19561	0.013000	0.15412	0.023000	0.10783	1.904000	0.39868	2.480000	0.83734	0.561000	0.74099	CGC	G|1.000;A|0.000		0.617	LPAR2-003	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460544.1	NM_004720	
SIGLEC11	114132	hgsc.bcm.edu	37	19	50462728	50462728	+	Missense_Mutation	SNP	T	T	G	rs550818529	byFrequency	TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:50462728T>G	ENST00000447370.2	-	5	1036	c.946A>C	c.(946-948)Acc>Ccc	p.T316P	CTC-326K19.6_ENST00000451973.1_5'Flank|SIGLEC11_ENST00000426971.2_Missense_Mutation_p.T316P	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	316	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		AGCCCCAGGGTTCTGGGGCCC	0.692													T|||	2	0.000399361	0.0015	0.0	5008	,	,		12019	0.0		0.0	False		,,,				2504	0.0				p.T316P		.											.	SIGLEC11-94	0			c.A946C						.						6.0	10.0	9.0					19																	50462728		1815	4163	5978	SO:0001583	missense	114132	exon5			CCAGGGTTCTGGG	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.946A>C	19.37:g.50462728T>G	ENSP00000412361:p.Thr316Pro	Somatic	57	1		WXS	Illumina HiSeq	Phase_I	35	3	NM_052884	0	0	5	5	0		Missense_Mutation	SNP	ENST00000447370.2	37	CCDS12790.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.500|0.500	-0.871393|-0.871393	0.02570|0.02570	.|.	.|.	ENSG00000161640|ENSG00000161640	ENST00000426971|ENST00000447370;ENST00000458019	.|T	.|0.67523	.|-0.27	1.61|1.61	-1.27|-1.27	0.09347|0.09347	.|Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|1.785050	.|0.02815	.|N	.|0.124869	T|T	0.72211|0.72211	0.3432|0.3432	M|M	0.91972|0.91972	3.26|3.26	0.09310|0.09310	N|N	1|1	.|B;B	.|0.20368	.|0.044;0.02	.|B;B	.|0.25405	.|0.045;0.06	T|T	0.47535|0.47535	-0.9110|-0.9110	5|10	.|0.34782	.|T	.|0.22	.|.	5.7793|5.7793	0.18297|0.18297	0.0:0.0:0.5751:0.4249|0.0:0.0:0.5751:0.4249	.|.	.|316;316	.|Q96RL6-2;Q96RL6	.|.;SIG11_HUMAN	D|P	305|316	.|ENSP00000412361:T316P	.|ENSP00000412361:T316P	E|T	-|-	3|1	2|0	SIGLEC11|SIGLEC11	55154540|55154540	0.001000|0.001000	0.12720|0.12720	0.036000|0.036000	0.18154|0.18154	0.195000|0.195000	0.23768|0.23768	-0.655000|-0.655000	0.05348|0.05348	-0.403000|-0.403000	0.07622|0.07622	0.529000|0.529000	0.55759|0.55759	GAA|ACC	.		0.692	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884	
SYT3	84258	hgsc.bcm.edu	37	19	51135725	51135725	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:51135725C>G	ENST00000338916.4	-	2	1125	c.492G>C	c.(490-492)atG>atC	p.M164I	SYT3_ENST00000593901.1_Missense_Mutation_p.M164I|SYT3_ENST00000544769.1_Missense_Mutation_p.M164I|SYT3_ENST00000600079.1_Missense_Mutation_p.M164I	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	164					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GATACGAGTCCATGTCCAAGT	0.647																																					p.M164I		.											.	SYT3-155	0			c.G492C						.						26.0	26.0	26.0					19																	51135725		2202	4299	6501	SO:0001583	missense	84258	exon2			CGAGTCCATGTCC	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.492G>C	19.37:g.51135725C>G	ENSP00000340914:p.Met164Ile	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	37	2	NM_032298	0	0	0	0	0	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350361	0.41599	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.59502	0.26;0.26	4.59	4.59	0.56863	.	0.067275	0.53938	U	0.000047	T	0.58104	0.2099	L	0.27053	0.805	0.80722	D	1	P	0.45126	0.851	P	0.55391	0.775	T	0.50065	-0.8871	10	0.17832	T	0.49	.	16.6764	0.85280	0.0:1.0:0.0:0.0	.	164	Q9BQG1	SYT3_HUMAN	I	164	ENSP00000340914:M164I;ENSP00000438883:M164I	ENSP00000340914:M164I	M	-	3	0	SYT3	55827537	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.982000	0.63825	2.536000	0.85505	0.563000	0.77884	ATG	.		0.647	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
NRXN1	9378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	50149203	50149203	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:50149203C>G	ENST00000406316.2	-	22	5789	c.4313G>C	c.(4312-4314)aGt>aCt	p.S1438T	NRXN1_ENST00000406859.3_Missense_Mutation_p.S1438T|NRXN1_ENST00000401710.1_Missense_Mutation_p.S456T|NRXN1_ENST00000405472.3_Missense_Mutation_p.S1460T|NRXN1_ENST00000401669.2_Missense_Mutation_p.S1468T|NRXN1_ENST00000402717.3_Missense_Mutation_p.S1460T|NRXN1_ENST00000342183.5_Missense_Mutation_p.S403T|NRXN1_ENST00000404971.1_Missense_Mutation_p.S1508T	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1438					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GTAGTTTCGACTCTCGTCCAC	0.478																																					p.S1508T		.											.	NRXN1-92	0			c.G4523C						.						230.0	185.0	200.0					2																	50149203		2203	4300	6503	SO:0001583	missense	9378	exon24			TTTCGACTCTCGT	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4313G>C	2.37:g.50149203C>G	ENSP00000384311:p.Ser1438Thr	Somatic	130	1		WXS	Illumina HiSeq	Phase_I	111	16	NM_001135659	0	0	0	0	0	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	12.73|12.73|12.73	2.026044|2.026044|2.026044	0.35701|0.35701|0.35701	.|.|.	.|.|.	ENSG00000179915|ENSG00000179915|ENSG00000179915	ENST00000378262|ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859|ENST00000412315	T|T;T;T;T;T;T;T;T|.	0.70869|0.72615|.	-0.52|0.82;2.08;0.04;0.05;-0.67;-0.56;-0.27;-0.09|.	5.44|5.44|5.44	5.44|5.44|5.44	0.79542|0.79542|0.79542	.|Neurexin/syndecan/glycophorin C (1);|.	.|0.000000|.	.|0.64402|.	.|U|.	.|0.000011|.	T|T|T	0.60457|0.60457|0.60457	0.2270|0.2270|0.2270	L|L|L	0.33245|0.33245|0.33245	0.995|0.995|0.995	0.51012|0.51012|0.51012	D|D|D	0.999905|0.999905|0.999905	.|P;B;B;D;P;B|.	.|0.61697|.	.|0.877;0.296;0.172;0.99;0.946;0.452|.	.|D;B;B;D;P;P|.	.|0.72982|.	.|0.916;0.101;0.145;0.979;0.77;0.762|.	T|T|T	0.52779|0.52779|0.52779	-0.8530|-0.8530|-0.8530	7|10|5	0.72032|0.29301|.	D|T|.	0.01|0.29|.	.|.|.	19.4587|19.4587|19.4587	0.94906|0.94906|0.94906	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	.|103;1508;403;1438;1457;100|.	.|B4DIT5;Q9ULB1-3;P58400;F8WB18;A7E294;Q5HYI0|.	.|.;.;NRX1B_HUMAN;.;.;.|.	D|T|L	104|403;357;456;1508;1438;1460;1468;1509;1460;1438|171	ENSP00000367510:E104D|ENSP00000341184:S403T;ENSP00000385580:S456T;ENSP00000385142:S1508T;ENSP00000384311:S1438T;ENSP00000434015:S1460T;ENSP00000385017:S1468T;ENSP00000385434:S1460T;ENSP00000385681:S1438T|.	ENSP00000367510:E104D|ENSP00000341184:S403T|.	E|S|V	-|-|-	3|2|1	2|0|0	NRXN1|NRXN1|NRXN1	50002707|50002707|50002707	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.999000|0.999000|0.999000	0.98932|0.98932|0.98932	7.651000|7.651000|7.651000	0.83577|0.83577|0.83577	2.828000|2.828000|2.828000	0.97474|0.97474|0.97474	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAG|AGT|GTC	.		0.478	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
CCDC88A	55704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	55523606	55523606	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:55523606T>C	ENST00000436346.1	-	30	5720	c.4879A>G	c.(4879-4881)Agc>Ggc	p.S1627G	CCDC88A_ENST00000422883.2_Missense_Mutation_p.S128G|CCDC88A_ENST00000263630.8_Missense_Mutation_p.S1599G|CCDC88A_ENST00000413716.2_Missense_Mutation_p.S1626G|CCDC88A_ENST00000336838.6_Missense_Mutation_p.S1626G	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1627					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TGAAGCAGGCTAAATTCTCCA	0.453																																					p.S1626G		.											.	CCDC88A-94	0			c.A4876G						.						119.0	105.0	110.0					2																	55523606		2203	4300	6503	SO:0001583	missense	55704	exon30			GCAGGCTAAATTC	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.4879A>G	2.37:g.55523606T>C	ENSP00000410608:p.Ser1627Gly	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	68	19	NM_001254943	0	0	24	25	1	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.68|14.68	2.606920|2.606920	0.46527|0.46527	.|.	.|.	ENSG00000115355|ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000422883;ENST00000412148;ENST00000413716;ENST00000426576|ENST00000456975	T;T;T;T;T;T|.	0.52295|.	2.4;2.38;2.62;0.67;2.4;1.32|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.000000|.	0.56097|.	U|.	0.000024|.	T|.	0.69024|.	0.3065|.	L|L	0.54323|0.54323	1.7|1.7	0.58432|0.58432	D|D	0.999998|0.999998	B;D;D;D;B;D;D|.	0.63046|.	0.005;0.99;0.982;0.982;0.05;0.992;0.99|.	B;D;D;D;B;D;D|.	0.74674|.	0.012;0.979;0.952;0.961;0.019;0.984;0.979|.	T|.	0.67436|.	-0.5671|.	10|.	0.27082|.	T|.	0.32|.	-9.3716|-9.3716	15.4218|15.4218	0.75018|0.75018	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1626;1599;1544;128;1627;1626;1598|.	B7ZM78;Q3V6T2-2;D6W5D1;B3KW94;Q3V6T2;Q3V6T2-3;Q3V6T2-4|.	.;.;.;.;GRDN_HUMAN;.;.|.	G|W	1626;1599;1627;128;644;1626;802|579	ENSP00000338728:S1626G;ENSP00000263630:S1599G;ENSP00000410608:S1627G;ENSP00000390012:S644G;ENSP00000404431:S1626G;ENSP00000405080:S802G|.	ENSP00000263630:S1599G|.	S|X	-|-	1|2	0|0	CCDC88A|CCDC88A	55377110|55377110	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.274000|7.274000	0.78538|0.78538	2.051000|2.051000	0.60960|0.60960	0.383000|0.383000	0.25322|0.25322	AGC|TAG	.		0.453	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
FAM161A	84140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	62067675	62067675	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:62067675A>T	ENST00000405894.3	-	3	565	c.464T>A	c.(463-465)aTg>aAg	p.M155K	FAM161A_ENST00000404929.1_Missense_Mutation_p.M155K	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	155					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AAATGATGTCATTAATGAGAC	0.363																																					p.M155K		.											.	FAM161A-136	0			c.T464A						.						104.0	91.0	95.0					2																	62067675		1846	4096	5942	SO:0001583	missense	84140	exon3			GATGTCATTAATG		CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.464T>A	2.37:g.62067675A>T	ENSP00000385893:p.Met155Lys	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	67	8	NM_032180	0	0	1	2	1	B4DJV7|Q9H8R2	Missense_Mutation	SNP	ENST00000405894.3	37	CCDS42687.2	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002006	0.35320	.	.	ENSG00000170264	ENST00000404929;ENST00000405894	T;T	0.20598	2.87;2.06	5.3	-0.661	0.11417	.	1.199220	0.05573	N	0.571416	T	0.17323	0.0416	L	0.51422	1.61	0.09310	N	1	B;B	0.28233	0.204;0.018	B;B	0.21708	0.036;0.013	T	0.29119	-1.0022	9	.	.	.	-6.764	4.6748	0.12706	0.4925:0.0:0.1664:0.3411	.	155;155	Q3B820;Q3B820-3	F161A_HUMAN;.	K	155	ENSP00000385158:M155K;ENSP00000385893:M155K	.	M	-	2	0	FAM161A	61921179	0.001000	0.12720	0.000000	0.03702	0.743000	0.42351	0.901000	0.28445	-0.003000	0.14444	-0.490000	0.04691	ATG	.		0.363	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325537.2	NM_032180	
WDR92	116143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	68368907	68368907	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:68368907G>T	ENST00000295121.6	-	4	552	c.436C>A	c.(436-438)Cca>Aca	p.P146T	WDR92_ENST00000492039.2_5'UTR|WDR92_ENST00000406245.2_Missense_Mutation_p.P45T|RP11-474G23.1_ENST00000406334.3_3'UTR|WDR92_ENST00000409164.1_Missense_Mutation_p.P146T	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	146					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)			endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						TTTTGCCTTGGGTCCCACACC	0.373																																					p.P146T		.											.	WDR92-68	0			c.C436A						.						196.0	186.0	189.0					2																	68368907		2203	4300	6503	SO:0001583	missense	116143	exon4			GCCTTGGGTCCCA	AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.436C>A	2.37:g.68368907G>T	ENSP00000295121:p.Pro146Thr	Somatic	248	2		WXS	Illumina HiSeq	Phase_I	201	31	NM_001256476	0	0	3	4	1	Q96CR6	Missense_Mutation	SNP	ENST00000295121.6	37	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.216136	0.39201	.	.	ENSG00000243667	ENST00000295121;ENST00000406245;ENST00000409164	T;T;T	0.64991	1.64;1.64;-0.13	5.71	5.71	0.89125	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000002	T	0.55114	0.1900	L	0.38953	1.18	0.80722	D	1	B	0.12013	0.005	B	0.08055	0.003	T	0.45991	-0.9223	10	0.22706	T	0.39	.	20.2245	0.98337	0.0:0.0:1.0:0.0	.	146	Q96MX6	WDR92_HUMAN	T	146;45;146	ENSP00000295121:P146T;ENSP00000384518:P45T;ENSP00000386746:P146T	ENSP00000295121:P146T	P	-	1	0	WDR92	68222411	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.656000	0.74396	2.861000	0.98227	0.650000	0.86243	CCA	.		0.373	WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	
MAT2A	4144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	85770091	85770091	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:85770091A>T	ENST00000306434.3	+	8	1142	c.1019A>T	c.(1018-1020)aAg>aTg	p.K340M	MAT2A_ENST00000409017.1_Missense_Mutation_p.K277M	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	340					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	ACCTCTCAGAAGAGTGAGAGA	0.398																																					p.K340M		.											.	MAT2A-90	0			c.A1019T						.						153.0	156.0	155.0					2																	85770091		2203	4300	6503	SO:0001583	missense	4144	exon8			CTCAGAAGAGTGA		CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.1019A>T	2.37:g.85770091A>T	ENSP00000303147:p.Lys340Met	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	143	28	NM_005911	0	0	38	50	12	A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	ENST00000306434.3	37	CCDS1977.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.358960	0.41801	.	.	ENSG00000168906	ENST00000306434;ENST00000424323;ENST00000409017	D;D	0.97688	-4.49;-4.49	5.8	5.8	0.92144	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.95230	0.8453	L	0.39692	1.235	0.58432	D	0.999993	B;B	0.16802	0.019;0.019	B;B	0.18263	0.021;0.021	D	0.92657	0.6138	10	0.31617	T	0.26	-9.6104	14.0949	0.65013	1.0:0.0:0.0:0.0	.	340;340	B4DEX8;P31153	.;METK2_HUMAN	M	340;121;277	ENSP00000303147:K340M;ENSP00000386353:K277M	ENSP00000303147:K340M	K	+	2	0	MAT2A	85623602	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.899000	0.69846	2.209000	0.71365	0.460000	0.39030	AAG	.		0.398	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252491.2	NM_005911	
PHOSPHO2	493911	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	170557930	170557930	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:170557930A>G	ENST00000359744.3	+	4	837	c.449A>G	c.(448-450)aAt>aGt	p.N150S	KLHL23_ENST00000602521.1_Intron|KLHL23_ENST00000272797.4_Intron	NM_001008489.3|NM_001199285.1|NM_001199286.1|NM_001199288.1	NP_001008489.1|NP_001186214.1|NP_001186215.1|NP_001186217.1	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	150							metal ion binding (GO:0046872)|pyridoxal phosphatase activity (GO:0033883)			breast(1)|large_intestine(1)|lung(6)|skin(2)	10						TGCCCAAAGAATCTTTGCAAA	0.308																																					p.N150S		.											.	PHOSPHO2-91	0			c.A449G						.						64.0	65.0	64.0					2																	170557930		2203	4299	6502	SO:0001583	missense	493911	exon4			CAAAGAATCTTTG	BC022324	CCDS33319.1	2q31.1	2008-02-05			ENSG00000144362	ENSG00000144362			28316	protein-coding gene	gene with protein product						16054448	Standard	NM_001199285		Approved	MGC22679	uc021vsh.1	Q8TCD6	OTTHUMG00000153981	ENST00000359744.3:c.449A>G	2.37:g.170557930A>G	ENSP00000352782:p.Asn150Ser	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	75	13	NM_001199286	0	0	1	1	0	B2RC30|D3DPC7	Missense_Mutation	SNP	ENST00000359744.3	37	CCDS33319.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.082674	0.76528	.	.	ENSG00000144362	ENST00000359744	T	0.61980	0.06	5.96	5.96	0.96718	HAD-like domain (2);	0.000000	0.85682	U	0.000000	D	0.82508	0.5052	M	0.89353	3.025	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.84925	0.0856	10	0.52906	T	0.07	.	16.4219	0.83766	1.0:0.0:0.0:0.0	.	150	Q8TCD6	PHOP2_HUMAN	S	150	ENSP00000352782:N150S	ENSP00000352782:N150S	N	+	2	0	PHOSPHO2	170266176	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.155000	0.89643	2.282000	0.76494	0.533000	0.62120	AAT	.		0.308	PHOSPHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333304.1	NM_001008489	
OR6B2	389090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	240969643	240969643	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:240969643G>C	ENST00000402971.2	-	1	263	c.204C>G	c.(202-204)ttC>ttG	p.F68L		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		AGATCTCCAGGAAAGACATGG	0.557																																					p.F68L		.											.	.	0			c.C204G						.						117.0	127.0	124.0					2																	240969643		2117	4242	6359	SO:0001583	missense	389090	exon1			CTCCAGGAAAGAC		CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.204C>G	2.37:g.240969643G>C	ENSP00000384563:p.Phe68Leu	Somatic	242	0		WXS	Illumina HiSeq	Phase_I	168	20	NM_001005853	0	0	0	0	0	B2RPR3|Q8NGW0	Missense_Mutation	SNP	ENST00000402971.2	37	CCDS46559.1	.	.	.	.	.	.	.	.	.	.	N	4.356	0.065626	0.08388	.	.	ENSG00000182083	ENST00000402971	T	0.00966	5.49	4.35	0.501	0.16925	GPCR, rhodopsin-like superfamily (1);	0.813827	0.10478	N	0.669897	T	0.00967	0.0032	L	0.29908	0.895	0.09310	N	1	B	0.19583	0.037	B	0.22601	0.04	T	0.45818	-0.9235	10	0.38643	T	0.18	.	8.2409	0.31660	0.3395:0.0:0.6605:0.0	.	68	Q6IFH4	OR6B2_HUMAN	L	68	ENSP00000384563:F68L	ENSP00000384563:F68L	F	-	3	2	OR6B2	240618316	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.228000	0.09114	-0.029000	0.13827	-0.237000	0.12165	TTC	.		0.557	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326079.1	NM_001005853	
SNX5	27131	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	17950811	17950811	+	5'Flank	SNP	C	C	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr20:17950811C>A	ENST00000377768.3	-	0	0				SNX5_ENST00000486039.1_5'Flank|SNX5_ENST00000377759.4_5'Flank|SNX5_ENST00000606602.1_5'Flank|SNX5_ENST00000481323.1_5'Flank|SNX5_ENST00000606557.1_5'Flank|MGME1_ENST00000377704.4_Silent_p.I103I|MGME1_ENST00000377709.1_Intron|MGME1_ENST00000467391.1_3'UTR|MGME1_ENST00000377710.5_Silent_p.I103I	NM_152227.1	NP_689413.1	Q9Y5X3	SNX5_HUMAN	sorting nexin 5						intracellular protein transport (GO:0006886)|pinocytosis (GO:0006907)	cytoplasmic vesicle (GO:0031410)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|extrinsic component of endosome membrane (GO:0031313)|macropinocytic cup (GO:0070685)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	11						GGTTTCCTATCTTCAATCCAG	0.478																																					p.I103I													.	.	0			c.C309A						.						68.0	71.0	70.0					20																	17950811		2203	4300	6503	SO:0001631	upstream_gene_variant	92667	exon2			TCCTATCTTCAAT	AF121855	CCDS13130.1	20p11	2008-05-22			ENSG00000089006	ENSG00000089006		"""Sorting nexins"""	14969	protein-coding gene	gene with protein product		605937				10600472, 17148574	Standard	NM_152227		Approved		uc002wqc.3	Q9Y5X3	OTTHUMG00000031953		20.37:g.17950811C>A	Exception_encountered	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	96	14	NM_052865	0	1	20	24	3	B7ZKN3|D3DW26|Q52LC4|Q7KZN0|Q9BWP0	Silent	SNP	ENST00000377768.3	37	CCDS13130.1																																																																																			.		0.478	SNX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078137.4		
KCNQ2	3785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	62070959	62070959	+	Silent	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr20:62070959G>A	ENST00000359125.2	-	6	1093	c.919C>T	c.(919-921)Ctg>Ttg	p.L307L	KCNQ2_ENST00000344425.5_Silent_p.L307L|KCNQ2_ENST00000344462.4_Silent_p.L307L|KCNQ2_ENST00000370224.1_Silent_p.L307L|KCNQ2_ENST00000354587.3_Silent_p.L307L|KCNQ2_ENST00000359689.1_Silent_p.L307L|KCNQ2_ENST00000357249.2_Silent_p.L307L|KCNQ2_ENST00000360480.3_Silent_p.L307L	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	307					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	ACTGCAGGCAGCGCGAAGAAG	0.637																																					p.L307L		.											.	KCNQ2-92	0			c.C919T						.						152.0	116.0	128.0					20																	62070959		2203	4300	6503	SO:0001819	synonymous_variant	3785	exon6			CAGGCAGCGCGAA	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.919C>T	20.37:g.62070959G>A		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	75	28	NM_172106	0	0	0	0	0	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	37	CCDS13520.1																																																																																			.		0.637	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
L3MBTL2	83746	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	41621916	41621916	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr22:41621916A>G	ENST00000216237.5	+	12	1633	c.1475A>G	c.(1474-1476)aAg>aGg	p.K492R		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	492					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TTCTGTCAGAAGAATGACATT	0.592																																					p.K492R		.											.	L3MBTL2-92	0			c.A1475G						.						94.0	69.0	78.0					22																	41621916		2203	4300	6503	SO:0001583	missense	83746	exon12			GTCAGAAGAATGA	AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1475A>G	22.37:g.41621916A>G	ENSP00000216237:p.Lys492Arg	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	70	6	NM_031488	0	0	25	26	1	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	ENST00000216237.5	37	CCDS14011.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.711335	0.30322	.	.	ENSG00000100395	ENST00000216237	T	0.31769	1.48	5.23	4.17	0.49024	.	0.233465	0.50627	D	0.000106	T	0.27663	0.0680	L	0.54965	1.715	0.35928	D	0.832306	B;B	0.14438	0.004;0.01	B;B	0.21151	0.003;0.033	T	0.19484	-1.0304	10	0.46703	T	0.11	.	7.1971	0.25860	0.7961:0.0:0.0731:0.1308	.	492;492	Q969R5-3;Q969R5	.;LMBL2_HUMAN	R	492	ENSP00000216237:K492R	ENSP00000216237:K492R	K	+	2	0	L3MBTL2	39951862	1.000000	0.71417	0.987000	0.45799	0.906000	0.53458	2.599000	0.46231	0.792000	0.33850	0.459000	0.35465	AAG	.		0.592	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320613.1	NM_031488	
RPL14	9045	hgsc.bcm.edu	37	3	40503557	40503557	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr3:40503557T>C	ENST00000396203.2	+	6	614	c.482T>C	c.(481-483)gTt>gCt	p.V161A	RPL14_ENST00000338970.6_Missense_Mutation_p.V161A|RPL14_ENST00000416518.1_3'UTR	NM_001034996.2	NP_001030168.1	P50914	RL14_HUMAN	ribosomal protein L14	161					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)								KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		gctgctAAAGTTCCAGCAAAA	0.532																																					p.V161A		.											.	RPL14-90	0			c.T482C						.						12.0	12.0	12.0					3																	40503557		2196	4288	6484	SO:0001583	missense	9045	exon6			CTAAAGTTCCAGC	D87735	CCDS33739.1, CCDS43070.1	3p22-p21.2	2008-07-18			ENSG00000188846	ENSG00000188846		"""L ribosomal proteins"""	10305	protein-coding gene	gene with protein product	"""CAG-ISL 7"", ""60S ribosomal protein L14"""					9480843	Standard	NM_003973		Approved	L14, hRL14, RL14, CTG-B33	uc003ckg.4	P50914	OTTHUMG00000156046	ENST00000396203.2:c.482T>C	3.37:g.40503557T>C	ENSP00000379506:p.Val161Ala	Somatic	49	2		WXS	Illumina HiSeq	Phase_I	37	2	NM_003973	0	3	729	733	1	Q45RF0|Q53G20|Q8TBD5|Q8WUT0|Q92579|Q96GR0|Q9BSB8|Q9BW65|Q9BYF6	Missense_Mutation	SNP	ENST00000396203.2	37	CCDS43070.1	.	.	.	.	.	.	.	.	.	.	T	7.353	0.623248	0.14193	.	.	ENSG00000188846	ENST00000338970;ENST00000396203	T;T	0.42513	0.97;0.97	4.43	0.773	0.18516	.	1.064700	0.07443	N	0.897726	T	0.23806	0.0576	N	0.17082	0.46	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16541	-1.0399	10	0.16896	T	0.51	.	5.9465	0.19221	0.0:0.3206:0.0:0.6794	.	161	P50914	RL14_HUMAN	A	161	ENSP00000345156:V161A;ENSP00000379506:V161A	ENSP00000345156:V161A	V	+	2	0	RPL14	40478561	0.562000	0.26586	0.855000	0.33649	0.302000	0.27658	0.600000	0.24104	0.211000	0.20683	0.519000	0.50382	GTT	.		0.532	RPL14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342889.2	NM_003973	
THAP9	79725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	83839493	83839493	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr4:83839493G>A	ENST00000302236.5	+	5	2179	c.2128G>A	c.(2128-2130)Gat>Aat	p.D710N	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	710					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				AGACCTGTCAGATCATAGGCG	0.423																																					p.D710N		.											.	THAP9-156	0			c.G2128A						.						117.0	101.0	106.0					4																	83839493		2203	4300	6503	SO:0001583	missense	79725	exon5			CTGTCAGATCATA	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.2128G>A	4.37:g.83839493G>A	ENSP00000305533:p.Asp710Asn	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	107	26	NM_024672	0	0	2	2	0	B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	37	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	G	3.185	-0.167102	0.06461	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	D	0.90069	-2.61	3.87	3.02	0.34903	.	0.462748	0.18401	N	0.142355	T	0.77805	0.4185	N	0.22421	0.69	0.09310	N	0.999994	B	0.23058	0.079	B	0.21546	0.035	T	0.62124	-0.6920	10	0.22706	T	0.39	-12.7397	5.7567	0.18176	0.1093:0.218:0.6727:0.0	.	710	Q9H5L6	THAP9_HUMAN	N	710	ENSP00000305533:D710N	ENSP00000305533:D710N	D	+	1	0	THAP9	84058517	0.016000	0.18221	0.085000	0.20634	0.025000	0.11179	1.445000	0.35079	1.203000	0.43233	0.655000	0.94253	GAT	.		0.423	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
NR3C2	4306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	149075914	149075914	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr4:149075914G>C	ENST00000358102.3	-	5	2515	c.2153C>G	c.(2152-2154)tCg>tGg	p.S718W	NR3C2_ENST00000355292.3_Missense_Mutation_p.S722W|NR3C2_ENST00000511528.1_Missense_Mutation_p.S722W|NR3C2_ENST00000344721.4_Missense_Mutation_p.S718W|NR3C2_ENST00000503313.1_5'UTR|RP11-76G10.1_ENST00000514843.1_RNA|NR3C2_ENST00000512865.1_Intron	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	718	Hinge.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.S718L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TGTGTTGACCGAGGGTTCTTT	0.567																																					p.S718W	Melanoma(27;428 957 40335 51025 51111)	.											.	NR3C2-154	1	Substitution - Missense(1)	large_intestine(1)	c.C2153G						.						192.0	172.0	179.0					4																	149075914		2203	4300	6503	SO:0001583	missense	4306	exon5			TTGACCGAGGGTT	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.2153C>G	4.37:g.149075914G>C	ENSP00000350815:p.Ser718Trp	Somatic	289	0		WXS	Illumina HiSeq	Phase_I	177	30	NM_000901	0	0	2	3	1	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	ENST00000358102.3	37	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928892	0.52759	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000511528	D;D;D;D	0.90676	-2.71;-2.71;-2.71;-2.71	5.57	5.57	0.84162	.	0.406531	0.27932	N	0.017264	D	0.94318	0.8174	M	0.77313	2.365	0.52501	D	0.99995	D	0.63880	0.993	P	0.56514	0.8	D	0.93801	0.7101	9	.	.	.	.	19.5581	0.95361	0.0:0.0:1.0:0.0	.	718	B0ZBF6	.	W	718;722;718;722	ENSP00000341390:S718W;ENSP00000347441:S722W;ENSP00000350815:S718W;ENSP00000421481:S722W	.	S	-	2	0	NR3C2	149295364	0.985000	0.35326	0.611000	0.29010	0.430000	0.31655	3.814000	0.55643	2.614000	0.88457	0.655000	0.94253	TCG	.		0.567	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
SREK1	140890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	65466769	65466769	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr5:65466769C>T	ENST00000380918.3	+	10	1790	c.1130C>T	c.(1129-1131)tCc>tTc	p.S377F	SREK1_ENST00000334121.6_Missense_Mutation_p.S493F|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	377	Arg/Glu/Lys/Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TCTCGTAGTTCCAGCAGGTTT	0.368																																					p.S493F	GBM(10;31 347 27684 38976 41583)	.											.	SREK1-91	0			c.C1478T						.						60.0	66.0	64.0					5																	65466769		2200	4297	6497	SO:0001583	missense	140890	exon9			GTAGTTCCAGCAG	AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.1130C>T	5.37:g.65466769C>T	ENSP00000370305:p.Ser377Phe	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	69	17	NM_001077199	0	0	0	1	1	A4FTW3|Q2M1J0|Q86X37	Missense_Mutation	SNP	ENST00000380918.3	37	CCDS3991.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.67|16.67	3.186680|3.186680	0.57909|0.57909	.|.	.|.	ENSG00000153914|ENSG00000153914	ENST00000537482|ENST00000334121;ENST00000380918	.|T;T	.|0.11821	.|2.74;2.74	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	.|0.330683	.|0.31167	.|N	.|0.008136	T|T	0.11580|0.11580	0.0282|0.0282	N|N	0.19112|0.19112	0.55|0.55	0.31022|0.31022	N|N	0.718059|0.718059	.|P;P	.|0.40794	.|0.61;0.729	.|B;B	.|0.38056	.|0.135;0.264	T|T	0.02269|0.02269	-1.1185|-1.1185	6|10	0.44086|0.56958	T|D	0.13|0.05	.|.	18.2481|18.2481	0.89993|0.89993	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|377;493	.|Q8WXA9;Q8WXA9-2	.|SREK1_HUMAN;.	S|F	493|493;377	.|ENSP00000334538:S493F;ENSP00000370305:S377F	ENSP00000445557:P493S|ENSP00000334538:S493F	P|S	+|+	1|2	0|0	SREK1|SREK1	65502525|65502525	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.322000|4.322000	0.59215|0.59215	2.409000|2.409000	0.81822|0.81822	0.650000|0.650000	0.86243|0.86243	CCA|TCC	.		0.368	SREK1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381118.1	NM_001077199	
PTK7	5754	broad.mit.edu	37	6	43112987	43112987	+	Silent	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr6:43112987G>A	ENST00000230419.4	+	16	2678	c.2457G>A	c.(2455-2457)gaG>gaA	p.E819E	PTK7_ENST00000349241.2_Silent_p.E689E|PTK7_ENST00000352931.2_Silent_p.E763E|PTK7_ENST00000345201.2_Silent_p.E779E|PTK7_ENST00000481273.1_Silent_p.E827E	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	819	Interaction with CTNNB1.|Protein kinase; inactive. {ECO:0000255|PROSITE-ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGGGCTTGGAGGAGGGAGTGG	0.597																																					p.E827E													.	PTK7-1493	0			c.G2481A						.						87.0	85.0	86.0					6																	43112987		2203	4300	6503	SO:0001819	synonymous_variant	5754	exon16			CTTGGAGGAGGGA	AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.2457G>A	6.37:g.43112987G>A		Somatic	115	0		WXS	Illumina HiSeq	Phase_I	103	4	NM_001270398	0	0	31	31	0	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Silent	SNP	ENST00000230419.4	37	CCDS4884.1	.	.	.	.	.	.	.	.	.	.	G	8.784	0.929057	0.18131	.	.	ENSG00000112655	ENST00000489707	.	.	.	5.71	2.47	0.30058	.	.	.	.	.	T	0.39489	0.1080	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28267	-1.0049	4	.	.	.	.	5.8526	0.18701	0.3389:0.0:0.5272:0.1338	.	.	.	.	K	114	.	.	R	+	2	0	PTK7	43220965	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	0.999000	0.29757	0.737000	0.32582	0.655000	0.94253	AGG	.		0.597	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040580.2		
SLC22A7	10864	ucsc.edu	37	6	43270500	43270500	+	Splice_Site	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr6:43270500A>G	ENST00000372585.5	+	9	1479	c.1384A>G	c.(1384-1386)Aga>Gga	p.R462G	SLC22A7_ENST00000372589.3_Splice_Site_p.R460G|SLC22A7_ENST00000372574.3_Splice_Site_p.R460G	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	462					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	TACGGTGCTCAGGTGAGGAAG	0.527																																					p.R462G													.	SLC22A7-90	0			c.A1384G						.						57.0	47.0	50.0					6																	43270500		2203	4300	6503	SO:0001630	splice_region_variant	10864	exon8			GTGCTCAGGTGAG	AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1385+1A>G	6.37:g.43270500A>G		Somatic	21	0		WXS	Illumina HiSeq		13	2	NM_153320	0	0	0	6	6	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	ENST00000372585.5	37	CCDS4893.2	.	.	.	.	.	.	.	.	.	.	A	15.13	2.741588	0.49151	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;D	0.87650	-0.09;-0.09;-0.09;-2.28	5.17	5.17	0.71159	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.95172	0.8435	H	0.97659	4.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96489	0.9362	10	0.87932	D	0	.	12.8168	0.57669	1.0:0.0:0.0:0.0	.	462;460;460	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	G	460;462;460;155	ENSP00000361670:R460G;ENSP00000361666:R462G;ENSP00000361655:R460G;ENSP00000393836:R155G	ENSP00000361655:R460G	R	+	1	2	SLC22A7	43378478	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	3.882000	0.56160	2.089000	0.63090	0.379000	0.24179	AGA	.		0.527	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040588.1		Missense_Mutation
NT5DC1	221294	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	116429548	116429548	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr6:116429548T>A	ENST00000319550.4	+	3	289	c.207T>A	c.(205-207)gaT>gaA	p.D69E		NM_152729.2	NP_689942.2	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase domain containing 1	69							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|stomach(1)	8		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		TGGCATTGGATCTAGAAGATG	0.323																																					p.D69E	Colon(128;1440 1664 38087 41475 42869)												.	NT5DC1-226	0			c.T207A						.						104.0	104.0	104.0					6																	116429548		2203	4299	6502	SO:0001583	missense	221294	exon3			ATTGGATCTAGAA	BC015138	CCDS5104.1	6q22.31	2008-02-05	2006-01-27	2006-01-27	ENSG00000178425	ENSG00000178425			21556	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic II-like 1"""	NT5C2L1			Standard	NM_152729		Approved	dJ486I3.1, MGC24302	uc003pwj.3	Q5TFE4	OTTHUMG00000015428	ENST00000319550.4:c.207T>A	6.37:g.116429548T>A	ENSP00000326858:p.Asp69Glu	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	71	10	NM_152729	0	0	30	36	6	B2RND9|B3KR35|Q6XYD5	Missense_Mutation	SNP	ENST00000319550.4	37	CCDS5104.1	.	.	.	.	.	.	.	.	.	.	T	18.64	3.666737	0.67814	.	.	ENSG00000178425	ENST00000368618;ENST00000319550;ENST00000419791	T;T	0.53206	0.63;0.63	5.15	2.74	0.32292	HAD-like domain (1);	0.097795	0.64402	D	0.000002	T	0.58552	0.2130	M	0.85041	2.73	0.46131	D	0.998888	D;D	0.89917	0.998;1.0	D;D	0.97110	0.994;1.0	T	0.62964	-0.6742	10	0.66056	D	0.02	-14.0759	8.9428	0.35740	0.0:0.1569:0.0:0.8431	.	69;69	A8K2Z3;Q5TFE4	.;NT5D1_HUMAN	E	69	ENSP00000326858:D69E;ENSP00000393578:D69E	ENSP00000326858:D69E	D	+	3	2	NT5DC1	116536241	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	0.994000	0.29693	0.383000	0.24910	-0.256000	0.11100	GAT	.		0.323	NT5DC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041931.3	NM_152729	
SGK1	6446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	134495704	134495704	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr6:134495704T>C	ENST00000237305.7	-	2	185	c.97A>G	c.(97-99)Atg>Gtg	p.M33V	SGK1_ENST00000475719.2_Missense_Mutation_p.M33V|SGK1_ENST00000413996.3_Missense_Mutation_p.M47V|SGK1_ENST00000367858.5_Missense_Mutation_p.M128V|SGK1_ENST00000528577.1_Missense_Mutation_p.M61V|SGK1_ENST00000367857.5_Missense_Mutation_p.M23V|SGK1_ENST00000489458.2_5'Flank	NM_005627.3	NP_005618.2	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1	33	Necessary for localization to the mitochondria.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|ion transmembrane transport (GO:0034220)|long-term memory (GO:0007616)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of catalytic activity (GO:0050790)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of gastric acid secretion (GO:0060453)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|renal sodium ion absorption (GO:0070294)|response to stress (GO:0006950)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(21)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(4)|stomach(1)	46	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		TTCAGACCCATCCTCCTCTGC	0.423											OREG0017675	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M128V		.											.	SGK1-981	0			c.A382G						.						81.0	81.0	81.0					6																	134495704		2203	4300	6503	SO:0001583	missense	6446	exon4			GACCCATCCTCCT	AJ000512	CCDS5170.1, CCDS47476.1, CCDS47477.1, CCDS47478.1	6q23	2008-02-05	2007-12-05	2007-12-05	ENSG00000118515	ENSG00000118515			10810	protein-coding gene	gene with protein product		602958	"""serum/glucocorticoid regulated kinase"""	SGK		9114008, 9722955	Standard	NM_005627		Approved		uc003qeo.4	O00141	OTTHUMG00000015613	ENST00000237305.7:c.97A>G	6.37:g.134495704T>C	ENSP00000237305:p.Met33Val	Somatic	70	0	1611	WXS	Illumina HiSeq	Phase_I	51	7	NM_001143676	0	0	253	303	50	B7UUP7|B7UUP8|B7UUP9|B7Z5B2|E1P583|Q5TCN2|Q5TCN3|Q5TCN4|Q5VY65|Q9UN56	Missense_Mutation	SNP	ENST00000237305.7	37	CCDS5170.1	.	.	.	.	.	.	.	.	.	.	T	16.43	3.121060	0.56613	.	.	ENSG00000118515	ENST00000367858;ENST00000413996;ENST00000237305;ENST00000367857;ENST00000528577;ENST00000475719;ENST00000461976	T;T;T;T;T;T;T	0.38401	1.66;1.66;1.66;1.66;1.66;1.66;1.14	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.47488	0.1448	M	0.62723	1.935	0.80722	D	1	B;P;B;B;B;B	0.48911	0.01;0.917;0.004;0.001;0.019;0.002	B;D;B;B;B;B	0.63488	0.018;0.915;0.008;0.01;0.032;0.008	T	0.38628	-0.9652	10	0.41790	T	0.15	.	16.3127	0.82898	0.0:0.0:0.0:1.0	.	61;47;33;23;128;33	O00141-5;O00141-3;E9PR89;O00141-4;O00141-2;O00141	.;.;.;.;.;SGK1_HUMAN	V	128;47;33;23;61;33;97	ENSP00000356832:M128V;ENSP00000396242:M47V;ENSP00000237305:M33V;ENSP00000356831:M23V;ENSP00000434450:M61V;ENSP00000434302:M33V;ENSP00000435577:M97V	ENSP00000237305:M33V	M	-	1	0	SGK1	134537397	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.246000	0.74042	0.533000	0.62120	ATG	.		0.423	SGK1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042312.2		
SLC35D3	340146	hgsc.bcm.edu	37	6	137245094	137245094	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr6:137245094T>C	ENST00000331858.4	+	2	676	c.511T>C	c.(511-513)Tac>Cac	p.Y171H		NM_001008783.1	NP_001008783.1	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	171					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	13	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		GCACGCTGCCTACCTGGTGCT	0.706																																					p.Y171H		.											.	SLC35D3-91	0			c.T511C						.						17.0	15.0	15.0					6																	137245094		2183	4273	6456	SO:0001583	missense	340146	exon2			GCTGCCTACCTGG		CCDS34544.1	6q23.2	2013-05-22			ENSG00000182747	ENSG00000182747		"""Solute carriers"""	15621	protein-coding gene	gene with protein product		612519		FRCL1			Standard	NM_001008783		Approved		uc003qhe.3	Q5M8T2	OTTHUMG00000015651	ENST00000331858.4:c.511T>C	6.37:g.137245094T>C	ENSP00000333591:p.Tyr171His	Somatic	4	1		WXS	Illumina HiSeq	Phase_I	10	6	NM_001008783	0	0	0	0	0	B4DI58|Q5QNZ6|Q6NX71	Missense_Mutation	SNP	ENST00000331858.4	37	CCDS34544.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.644042	0.87859	.	.	ENSG00000182747	ENST00000331858	T	0.63096	-0.02	5.67	5.67	0.87782	Domain of unknown function DUF250 (1);	0.000000	0.85682	D	0.000000	T	0.71584	0.3357	L	0.61218	1.895	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	T	0.74791	-0.3545	10	0.59425	D	0.04	-16.1043	15.9193	0.79547	0.0:0.0:0.0:1.0	.	171	Q5M8T2	S35D3_HUMAN	H	171	ENSP00000333591:Y171H	ENSP00000333591:Y171H	Y	+	1	0	SLC35D3	137286787	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.900000	0.87376	2.176000	0.68965	0.454000	0.30748	TAC	.		0.706	SLC35D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042389.2	XM_294017	
RP9	6100	broad.mit.edu	37	7	33139017	33139017	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr7:33139017G>C	ENST00000297157.3	-	3	232	c.215C>G	c.(214-216)cCa>cGa	p.P72R		NM_203288.1	NP_976033.1	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9 (autosomal dominant)	72	PIM1-binding. {ECO:0000250}.				cognition (GO:0050890)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|signal recognition particle receptor complex (GO:0005785)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.P72R(2)		large_intestine(3)|lung(3)|urinary_tract(1)	7			GBM - Glioblastoma multiforme(11;0.0403)			TGGTACATCTGGTATGCAATC	0.483																																					p.P72R													.	RP9-90	2	Substitution - Missense(2)	urinary_tract(1)|lung(1)	c.C215G						.						157.0	142.0	147.0					7																	33139017		2203	4300	6503	SO:0001583	missense	6100	exon3			ACATCTGGTATGC	AX016710	CCDS5440.1	7p14.3	2014-01-28			ENSG00000164610	ENSG00000164610			10288	protein-coding gene	gene with protein product	"""Pim-1 kinase associated protein"""	607331				8513323	Standard	NM_203288		Approved	PAP-1	uc003tdm.3	Q8TA86	OTTHUMG00000152988	ENST00000297157.3:c.215C>G	7.37:g.33139017G>C	ENSP00000297157:p.Pro72Arg	Somatic	135	1		WXS	Illumina HiSeq	Phase_I	123	5	NM_203288	0	0	13	13	0		Missense_Mutation	SNP	ENST00000297157.3	37	CCDS5440.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243312	0.79912	.	.	ENSG00000164610	ENST00000297157;ENST00000448915	T;D	0.85484	-1.2;-1.99	3.43	3.43	0.39272	.	0.000000	0.85682	U	0.000000	D	0.90027	0.6886	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91308	0.5072	10	0.66056	D	0.02	-35.7261	15.7391	0.77870	0.0:0.0:1.0:0.0	.	72	Q8TA86	RP9_HUMAN	R	72;38	ENSP00000297157:P72R;ENSP00000411577:P38R	ENSP00000297157:P72R	P	-	2	0	RP9	33105542	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.918000	0.92759	1.862000	0.54008	0.563000	0.77884	CCA	.		0.483	RP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328914.1	NM_203288	
KMT2E	55904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	104748161	104748161	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr7:104748161A>T	ENST00000311117.3	+	22	3802	c.3257A>T	c.(3256-3258)gAc>gTc	p.D1086V	CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000334914.7_Missense_Mutation_p.D141V|SRPK2_ENST00000493638.1_5'Flank|KMT2E_ENST00000334877.4_Missense_Mutation_p.D1086V|KMT2E_ENST00000257745.4_Missense_Mutation_p.D1086V	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1086					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										AACTTGAGGGACCTGACACCC	0.498																																					p.D1086V		.											.	MLL5-93	0			c.A3257T						.						83.0	82.0	82.0					7																	104748161		2203	4300	6503	SO:0001583	missense	55904	exon21			TGAGGGACCTGAC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3257A>T	7.37:g.104748161A>T	ENSP00000312379:p.Asp1086Val	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	65	22	NM_018682	0	0	8	17	9	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.704341	0.88924	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.96136	-3.92;-3.2;-3.92;-0.21	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.96222	0.8768	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97101	0.9797	10	0.87932	D	0	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	1086	Q8IZD2	MLL5_HUMAN	V	1086;1086;1086;1006;1086;141	ENSP00000312379:D1086V;ENSP00000335599:D1086V;ENSP00000257745:D1086V;ENSP00000333986:D141V	ENSP00000257745:D1086V	D	+	2	0	MLL5	104535397	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	8.690000	0.91272	2.302000	0.77476	0.533000	0.62120	GAC	.		0.498	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
TTC26	79989	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	138822639	138822639	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr7:138822639T>C	ENST00000464848.1	+	3	268	c.188T>C	c.(187-189)aTt>aCt	p.I63T	TTC26_ENST00000474035.2_Missense_Mutation_p.I63T|TTC26_ENST00000478836.2_Missense_Mutation_p.I63T|TTC26_ENST00000481482.1_3'UTR|TTC26_ENST00000495038.1_Missense_Mutation_p.I63T|TTC26_ENST00000343187.4_Intron|TTC26_ENST00000430935.1_Missense_Mutation_p.I63T			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	63					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)				breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						AATTTGTGGATTGGATATTGT	0.323																																					p.I63T		.											.	TTC26-91	0			c.T188C						.						154.0	153.0	153.0					7																	138822639		2203	4300	6503	SO:0001583	missense	79989	exon3			TGTGGATTGGATA	AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.188T>C	7.37:g.138822639T>C	ENSP00000419279:p.Ile63Thr	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	110	7	NM_001144920	0	0	11	12	1	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Missense_Mutation	SNP	ENST00000464848.1	37	CCDS5852.1	.	.	.	.	.	.	.	.	.	.	T	15.05	2.717383	0.48622	.	.	ENSG00000105948	ENST00000430935;ENST00000495038;ENST00000474035;ENST00000478836;ENST00000464848	T;T;T;T;T	0.77229	-1.08;1.52;-1.08;1.15;-1.08	6.05	6.05	0.98169	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.287285	0.37761	N	0.001947	T	0.76550	0.4003	L	0.39245	1.2	0.58432	D	0.999996	P;B;P;B;B	0.41188	0.605;0.012;0.741;0.004;0.137	P;B;P;B;B	0.45660	0.489;0.018;0.489;0.012;0.062	T	0.77720	-0.2482	10	0.52906	T	0.07	.	15.5826	0.76455	0.0:0.0:0.0:1.0	.	63;63;63;63;63	B7Z2T3;C9J2N7;B7Z6R6;A0AVF1;Q96CU4	.;.;.;TTC26_HUMAN;.	T	63	ENSP00000410655:I63T;ENSP00000418788:I63T;ENSP00000443253:I63T;ENSP00000419178:I63T;ENSP00000419279:I63T	ENSP00000410655:I63T	I	+	2	0	TTC26	138473179	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.353000	0.59411	2.323000	0.78572	0.533000	0.62120	ATT	.		0.323	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348919.2	NM_024926	
AGPAT6	137964	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	41467379	41467379	+	Silent	SNP	C	C	T			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr8:41467379C>T	ENST00000396987.3	+	4	1368	c.441C>T	c.(439-441)agC>agT	p.S147S	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	147					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			ACCTGCTGAGCAGAACCAATT	0.493																																					p.S147S		.											.	AGPAT6-90	0			c.C441T						.						98.0	96.0	97.0					8																	41467379		2203	4300	6503	SO:0001819	synonymous_variant	137964	exon4			GCTGAGCAGAACC	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.441C>T	8.37:g.41467379C>T		Somatic	150	0		WXS	Illumina HiSeq	Phase_I	124	30	NM_178819	1	0	34	45	10	Q86V89	Silent	SNP	ENST00000396987.3	37	CCDS6117.1																																																																																			.		0.493	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
CDC37L1	55664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	4706079	4706079	+	Silent	SNP	A	A	G	rs200977934		TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr9:4706079A>G	ENST00000381854.3	+	7	1183	c.981A>G	c.(979-981)gaA>gaG	p.E327E		NM_017913.2	NP_060383.2	Q7L3B6	CD37L_HUMAN	cell division cycle 37-like 1	327	Interaction with Hsp70.|Required for interaction with STIP1.					cytoplasm (GO:0005737)				breast(1)|kidney(1)|lung(2)	4	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0318)		TACATAAAGAAGATGATGAAC	0.393																																					p.E327E		.											.	CDC37L1-90	0			c.A981G						.						130.0	112.0	118.0					9																	4706079		2203	4300	6503	SO:0001819	synonymous_variant	55664	exon7			TAAAGAAGATGAT	AK000497	CCDS6454.1	9p24.1	2013-01-17	2013-01-17		ENSG00000106993	ENSG00000106993			17179	protein-coding gene	gene with protein product		610346	"""CDC37 cell division cycle 37 homolog (S. cerevisiae)-like 1"", ""cell division cycle 37 homolog (S. cerevisiae)-like 1"""				Standard	NM_017913		Approved	HARC, FLJ20639, CDC37B	uc003zio.3	Q7L3B6	OTTHUMG00000019465	ENST00000381854.3:c.981A>G	9.37:g.4706079A>G		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	46	6	NM_017913	0	0	11	14	3	B1AL70|Q9NWS3|Q9NX16	Silent	SNP	ENST00000381854.3	37	CCDS6454.1																																																																																			.		0.393	CDC37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051564.1	NM_017913	
TOR2A	27433	ucsc.edu	37	9	130494938	130494938	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr9:130494938G>A	ENST00000373284.5	-	4	672	c.626C>T	c.(625-627)gCa>gTa	p.A209V	TOR2A_ENST00000336067.6_Intron|TOR2A_ENST00000458505.3_3'UTR|TOR2A_ENST00000373281.5_3'UTR|TOR2A_ENST00000472723.1_5'UTR	NM_001085347.2	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A	209					chaperone mediated protein folding requiring cofactor (GO:0051085)|protein homooligomerization (GO:0051260)	endoplasmic reticulum lumen (GO:0005788)	ATP binding (GO:0005524)			NS(1)|endometrium(2)	3						CGCCTCCAATGCCACCTGGTT	0.657																																					p.A209V													.	TOR2A-90	0			c.C626T						.						14.0	19.0	17.0					9																	130494938		2115	4225	6340	SO:0001583	missense	27433	exon4			TCCAATGCCACCT	AA873275	CCDS6876.1, CCDS43879.1, CCDS48024.1	9q34.11	2010-08-20			ENSG00000160404	ENSG00000160404			11996	protein-coding gene	gene with protein product		608052				10644435	Standard	NM_001085347		Approved	FLJ14771, TORP1	uc004brs.4	Q5JU69	OTTHUMG00000020706	ENST00000373284.5:c.626C>T	9.37:g.130494938G>A	ENSP00000362381:p.Ala209Val	Somatic	12	0		WXS	Illumina HiSeq		4	1	NM_001085347	0	0	16	19	3	A4FU12|A4FU13|Q3ZCN9|Q3ZCP0|Q5JU68|Q66K87|Q6UXW6|Q8NAN5|Q96SL7	Missense_Mutation	SNP	ENST00000373284.5	37	CCDS43879.1	.	.	.	.	.	.	.	.	.	.	G	14.61	2.585931	0.46110	.	.	ENSG00000160404	ENST00000373284	T	0.29397	1.57	5.72	-3.4	0.04853	ATPase, AAA+ type, core (1);	0.302598	0.39687	N	0.001290	T	0.16428	0.0395	L	0.27053	0.805	0.54753	D	0.999988	B	0.12630	0.006	B	0.12156	0.007	T	0.28459	-1.0043	10	0.10111	T	0.7	-1.6228	13.502	0.61462	0.236:0.0:0.764:0.0	.	209	Q5JU69	TOR2A_HUMAN	V	209	ENSP00000362381:A209V	ENSP00000362381:A209V	A	-	2	0	TOR2A	129534759	0.011000	0.17503	0.012000	0.15200	0.862000	0.49288	0.317000	0.19487	-0.535000	0.06307	-1.036000	0.02392	GCA	.		0.657	TOR2A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054205.1	NM_130459	
CACFD1	11094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	136333115	136333115	+	Silent	SNP	G	G	A	rs150411088		TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr9:136333115G>A	ENST00000316948.4	+	4	473	c.393G>A	c.(391-393)acG>acA	p.T131T	CACFD1_ENST00000542192.1_Silent_p.T89T|CACFD1_ENST00000291722.7_Silent_p.T89T|CACFD1_ENST00000540581.1_Silent_p.T131T	NM_017586.3	NP_060056.1	Q9UGQ2	FLOWR_HUMAN	calcium channel flower domain containing 1	131					synaptic vesicle endocytosis (GO:0048488)	integral component of synaptic vesicle membrane (GO:0030285)	calcium channel activity (GO:0005262)										CCTTTGCTACGGGGGTGCTGT	0.657																																					p.T131T		.											.	.	0			c.G393A						.	G	,,,	1,4405	2.1+/-5.4	0,1,2202	76.0	68.0	70.0		267,393,267,393	-10.8	0.2	9	dbSNP_134	70	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	C9orf7	NM_001135775.2,NM_001242369.1,NM_001242370.1,NM_017586.3	,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,	89/131,131/234,89/192,131/173	136333115	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	11094	exon4			TGCTACGGGGGTG		CCDS6974.1, CCDS48051.1, CCDS56591.1, CCDS56592.1	9q34	2012-03-06	2012-03-06	2012-03-06	ENSG00000160325	ENSG00000160325			1365	protein-coding gene	gene with protein product		613104	"""chromosome 9 open reading frame 7"""	C9orf7		19737521	Standard	NM_001242370		Approved	D9S2135, flower	uc011mdh.1	Q9UGQ2	OTTHUMG00000020875	ENST00000316948.4:c.393G>A	9.37:g.136333115G>A		Somatic	68	0		WXS	Illumina HiSeq	Phase_I	59	16	NM_017586	0	0	8	19	11	B7Z3T8|B7Z5E1|F5GXX4|Q5SXD4|Q8NBM6	Silent	SNP	ENST00000316948.4	37	CCDS6974.1																																																																																			G|1.000;A|0.000		0.657	CACFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054915.1	NM_017586	
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	31152282	31152282	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chrX:31152282C>G	ENST00000357033.4	-	77	11157	c.10951G>C	c.(10951-10953)Gac>Cac	p.D3651H	DMD_ENST00000378723.3_Missense_Mutation_p.D583H|DMD_ENST00000343523.2_Missense_Mutation_p.D1081H|DMD_ENST00000541735.1_Missense_Mutation_p.D1081H|DMD_ENST00000361471.4_Missense_Mutation_p.D570H|DMD_ENST00000474231.1_Missense_Mutation_p.D1191H|DMD_ENST00000359836.1_Missense_Mutation_p.D1178H|DMD_ENST00000378702.4_Missense_Mutation_p.D583H|DMD_ENST00000378677.2_Missense_Mutation_p.D3647H|DMD_ENST00000378707.3_Missense_Mutation_p.D1191H|DMD_ENST00000378680.2_Missense_Mutation_p.D473H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3651					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTGCTTGTGTCCTGGGGAGGA	0.408																																					p.D3651H		.											.	DMD-265	0			c.G10951C						.						189.0	119.0	143.0					X																	31152282		2202	4300	6502	SO:0001583	missense	1756	exon77			TTGTGTCCTGGGG	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.10951G>C	X.37:g.31152282C>G	ENSP00000354923:p.Asp3651His	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	39	13	NM_004006	0	0	4	7	3	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.136863|4.136863	0.77662|0.77662	.|.	.|.	ENSG00000198947|ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378723;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000378702;ENST00000474231;ENST00000361471;ENST00000378680|ENST00000465285	T;T;T;T;T;T;T;T;T;T;T;T|.	0.65178|.	2.06;3.8;-0.14;-0.14;3.72;3.74;3.68;3.48;2.04;3.74;2.08;2.1|.	5.04|5.04	5.04|5.04	0.67666|0.67666	.|.	0.000000|.	0.36740|.	U|.	0.002431|.	T|T	0.73992|0.73992	0.3658|0.3658	M|M	0.68317|0.68317	2.08|2.08	0.45621|0.45621	D|D	0.998554|0.998554	D;D;D;D;D;D;B;B;B;D;D;P;P;B;B;B|.	0.89917|.	0.996;0.996;0.999;0.999;0.999;0.996;0.098;0.059;0.059;0.999;1.0;0.86;0.729;0.003;0.001;0.38|.	D;D;D;D;D;D;B;B;B;D;D;P;P;B;B;B|.	0.83275|.	0.926;0.955;0.974;0.995;0.945;0.926;0.077;0.035;0.052;0.99;0.996;0.661;0.526;0.003;0.005;0.326|.	T|T	0.73379|0.73379	-0.4001|-0.4001	10|5	0.52906|.	T|.	0.07|.	.|.	17.7643|17.7643	0.88473|0.88473	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	473;3643;3651;3647;2310;2307;1178;1191;1191;1081;1081;3528;570;583;570;583|.	B4DSV7;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3;P11532-5;Q8N754;Q6NSJ9;E9PDN1|.	.;.;DMD_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.|.	H|A	3643;2310;2307;583;1334;3647;3651;1178;1081;3651;3528;1191;1081;583;1191;570;473|1379	ENSP00000367997:D583H;ENSP00000350765:D1334H;ENSP00000367948:D3647H;ENSP00000354923:D3651H;ENSP00000352894:D1178H;ENSP00000340057:D1081H;ENSP00000367979:D1191H;ENSP00000444119:D1081H;ENSP00000367974:D583H;ENSP00000417123:D1191H;ENSP00000354464:D570H;ENSP00000367951:D473H|.	ENSP00000340057:D1081H|.	D|G	-|-	1|2	0|0	DMD|DMD	31062203|31062203	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	6.271000|6.271000	0.72569|0.72569	2.470000|2.470000	0.83445|0.83445	0.600000|0.600000	0.82982|0.82982	GAC|GGA	.		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
GLUD2	2747	ucsc.edu	37	X	120182436	120182436	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chrX:120182436A>G	ENST00000328078.1	+	1	975	c.898A>G	c.(898-900)Aga>Gga	p.R300G		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	300					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						ACCAGGGTTTAGAGATAAAAC	0.413																																					p.R300G													.	GLUD2-131	0			c.A898G						.						189.0	170.0	177.0					X																	120182436		2203	4300	6503	SO:0001583	missense	2747	exon1			GGGTTTAGAGATA	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.898A>G	X.37:g.120182436A>G	ENSP00000327589:p.Arg300Gly	Somatic	109	0		WXS	Illumina HiSeq		92	1	NM_012084	0	0	1	150	149	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.462215	0.01062	.	.	ENSG00000182890	ENST00000328078	D	0.95272	-3.66	2.3	-1.33	0.09172	Glutamate/phenylalanine/leucine/valine dehydrogenase, C-terminal (2);NAD(P)-binding domain (1);	0.376526	0.30093	N	0.010424	T	0.76983	0.4064	N	0.02247	-0.625	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.70048	-0.4979	10	0.02654	T	1	-8.2867	4.1877	0.10405	0.2739:0.2268:0.4994:0.0	.	300	P49448	DHE4_HUMAN	G	300	ENSP00000327589:R300G	ENSP00000327589:R300G	R	+	1	2	GLUD2	120010117	1.000000	0.71417	0.578000	0.28575	0.925000	0.55904	2.644000	0.46613	-0.680000	0.05211	-0.386000	0.06593	AGA	.		0.413	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058133.1	NM_012084	
OR51A7	119687	broad.mit.edu;bcgsc.ca	37	11	4928976	4928976	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr11:4928976delT	ENST00000359350.4	+	1	377	c.377delT	c.(376-378)attfs	p.I126fs	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTTCTTGCCATTCACAATCCC	0.393																																					p.I126fs													.	OR51A7-70	0			c.377delT						.						102.0	98.0	99.0					11																	4928976		2201	4298	6499	SO:0001589	frameshift_variant	119687	exon1			TTGCCATTCACAA	AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.377delT	11.37:g.4928976delT	ENSP00000352305:p.Ile126fs	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	112	15	NM_001004749	0	0	0	0	0	Q6IFH8	Frame_Shift_Del	DEL	ENST00000359350.4	37	CCDS31364.1																																																																																			.		0.393	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142175.1	NM_001004749	
NOL11	25926	broad.mit.edu	37	17	65732103	65732103	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr17:65732103delG	ENST00000253247.4	+	9	1133	c.1018delG	c.(1018-1020)ggtfs	p.G340fs	NOL11_ENST00000535137.1_Frame_Shift_Del_p.G158fs	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	340					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			ATCATTAGCAGGTGCTCTTGG	0.338																																					p.G340fs													.	NOL11-90	0			c.1018delG						.						115.0	105.0	108.0					17																	65732103		2203	4300	6503	SO:0001589	frameshift_variant	25926	exon9			TTAGCAGGTGCTC	AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1018delG	17.37:g.65732103delG	ENSP00000253247:p.Gly340fs	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	81	8	NM_015462	0	0	0	0	0	B7Z5V9|Q7L5S1|Q9UG18	Frame_Shift_Del	DEL	ENST00000253247.4	37	CCDS11671.1																																																																																			.		0.338	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448074.1	NM_015462	
MIDN	90007	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	1257046	1257048	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	GCT	GCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:1257046_1257048delGCT	ENST00000591446.2	+	7	1591_1593	c.1182_1184delGCT	c.(1180-1185)cggctg>cgg	p.L395del	CIRBP_ENST00000588030.1_5'Flank|MIDN_ENST00000300952.2_In_Frame_Del_p.L395del			Q504T8	MIDN_HUMAN	midnolin	395						cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTGGAACGGCTGCAGCTGCTT	0.67																																					p.394_395del		.											.	MIDN-90	0			c.1182_1184del						.																																			SO:0001651	inframe_deletion	90007	exon8			.	AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.1182_1184delGCT	19.37:g.1257046_1257048delGCT	ENSP00000467679:p.Leu395del	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	40	10	NM_177401	0	0	0	0	0	Q96BW8	In_Frame_Del	DEL	ENST00000591446.2	37	CCDS32864.1																																																																																			.		0.670	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449965.2		
PSMD1	5707	broad.mit.edu;bcgsc.ca	37	2	231943417	231943417	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr2:231943417delA	ENST00000308696.6	+	10	1278	c.1116delA	c.(1114-1116)gcafs	p.A372fs	PSMD1_ENST00000373635.4_Frame_Shift_Del_p.A372fs|PSMD1_ENST00000409643.1_Frame_Shift_Del_p.A372fs	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	372					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CCGTTATAGCAAACTCTTTTA	0.343																																					p.A372fs													.	PSMD1-92	0			c.1116delA						.						126.0	120.0	122.0					2																	231943417		2203	4300	6503	SO:0001589	frameshift_variant	5707	exon10			TATAGCAAACTCT	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.1116delA	2.37:g.231943417delA	ENSP00000309474:p.Ala372fs	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	78	12	NM_002807	0	0	0	0	0	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Frame_Shift_Del	DEL	ENST00000308696.6	37	CCDS2482.1																																																																																			.		0.343	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
MROH8	140699	bcgsc.ca	37	20	35769661	35769661	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr20:35769661delA	ENST00000400441.3	-	12	1391	c.1392delT	c.(1390-1392)tttfs	p.F464fs	MROH8_ENST00000441008.2_Frame_Shift_Del_p.F450fs|MROH8_ENST00000217333.8_Intron			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	349																	TCAGGGTATCAAATGTAGTCA	0.378																																					.													.	.	0			.						.						91.0	79.0	83.0					20																	35769661		1849	4093	5942	SO:0001589	frameshift_variant	140699	.			GGTATCAAATGTA	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1392delT	20.37:g.35769661delA	ENSP00000383291:p.Phe464fs	Somatic	34	0		WXS	Illumina HiSeq	Phase_1	19	5	.	0	0	0	0	0	Q5JYQ6	Frame_Shift_Del	DEL	ENST00000400441.3	37																																																																																				.		0.378	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503	
DZIP3	9666	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	108324275	108324275	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr3:108324275delT	ENST00000361582.3	+	2	252	c.22delT	c.(22-24)tttfs	p.F9fs	DZIP3_ENST00000463306.1_Frame_Shift_Del_p.F9fs	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	9					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ACCAGATGAATTTTTTGTGAG	0.443																																					p.F8fs		.											.	DZIP3-91	0			c.22delT						.						111.0	116.0	114.0					3																	108324275		2203	4300	6503	SO:0001589	frameshift_variant	9666	exon2			.	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.22delT	3.37:g.108324275delT	ENSP00000355028:p.Phe9fs	Somatic	94	0		WXS	Illumina HiSeq	Phase_I	96	20	NM_014648	0	0	0	0	0	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Frame_Shift_Del	DEL	ENST00000361582.3	37	CCDS2952.1																																																																																			.		0.443	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
LIPH	200879	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	185241864	185241865	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	AA	AA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr3:185241864_185241865delAA	ENST00000296252.4	-	5	853_854	c.712_713delTT	c.(712-714)ttgfs	p.L238fs	LIPH_ENST00000424591.2_Frame_Shift_Del_p.L204fs	NM_139248.2	NP_640341.1	Q8WWY8	LIPH_HUMAN	lipase, member H	238					lipid catabolic process (GO:0016042)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(2)	20	all_cancers(143;8.87e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			CTTACCTCCCAATATTGTTTTG	0.436																																					p.238_238del		.											.	LIPH-92	0			c.712_713del						.																																			SO:0001589	frameshift_variant	200879	exon5			.	AY093498	CCDS3272.1	3q27	2012-07-31			ENSG00000163898	ENSG00000163898			18483	protein-coding gene	gene with protein product		607365				12213196, 12063250	Standard	XM_006713529		Approved	mPA-PLA1, PLA1B, mPA-PLA1alpha, LPDLR	uc003fpm.3	Q8WWY8	OTTHUMG00000156657	ENST00000296252.4:c.712_713delTT	3.37:g.185241864_185241865delAA	ENSP00000296252:p.Leu238fs	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	63	24	NM_139248	0	0	0	0	0	A2IBA7|Q8TEC7	Frame_Shift_Del	DEL	ENST00000296252.4	37	CCDS3272.1																																																																																			.		0.436	LIPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345153.1		
OGN	4969	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	95148550	95148550	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr9:95148550delA	ENST00000262551.4	-	6	1079	c.659delT	c.(658-660)ttgfs	p.L220fs	CENPP_ENST00000375587.3_Intron|OGN_ENST00000375561.5_Frame_Shift_Del_p.L220fs	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	220					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						ATTATGGTCCAAGTAGAGGAA	0.368																																					p.L220fs		.											.	OGN-492	0			c.659delT						.						195.0	188.0	190.0					9																	95148550		2203	4300	6503	SO:0001589	frameshift_variant	4969	exon6			.	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.659delT	9.37:g.95148550delA	ENSP00000262551:p.Leu220fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	50	16	NM_033014	0	0	0	0	0	Q6FIB0|Q9UF90|Q9UNK5	Frame_Shift_Del	DEL	ENST00000262551.4	37	CCDS6695.1																																																																																			.		0.368	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416	
CYP4F2	8529	broad.mit.edu;bcgsc.ca	37	19	16003152	16003153	+	Frame_Shift_Ins	INS	-	-	ATAT			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:16003152_16003153insATAT	ENST00000221700.6	-	5	586_587	c.491_492insATAT	c.(490-492)atgfs	p.M164fs	CYP4F2_ENST00000011989.7_Frame_Shift_Ins_p.M15fs	NM_001082.3	NP_001073.3			cytochrome P450, family 4, subfamily F, polypeptide 2											NS(2)|breast(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGAAAATCTTCATATAGGGCTT	0.52																																					p.M164fs													.	CYP4F2-92	0			c.492_493insATAT						.																																			SO:0001589	frameshift_variant	8529	exon5			AATCTTCATATAG	U02388	CCDS12336.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186115	ENSG00000186115		"""Cytochrome P450s"""	2645	protein-coding gene	gene with protein product		604426	"""cytochrome P450, subfamily IVF, polypeptide 2"""			8424651, 8026587	Standard	NM_001082		Approved		uc002nbs.1	P78329	OTTHUMG00000185995	ENST00000221700.6:c.488_491dupATAT	19.37:g.16003153_16003156dupATAT	ENSP00000221700:p.Met164fs	Somatic	258	0		WXS	Illumina HiSeq	Phase_I	186	22	NM_001082	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000221700.6	37	CCDS12336.1																																																																																			.		0.520	CYP4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460372.3	NM_001082	
MIA	8190	ucsc.edu	37	19	41282923	41282924	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-HE-7128-01A-11D-1961-08	TCGA-HE-7128-10A-01D-1962-08	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a290bf48-c383-4a28-aed8-3d24910c3576	b9aafe9d-7537-47f4-9296-4e2581cfa7c3	g.chr19:41282923_41282924CC>AA	ENST00000263369.3	+	3	477_478	c.311_312CC>AA	c.(310-312)cCC>cAA	p.P104Q	MIA-RAB4B_ENST00000600729.1_Missense_Mutation_p.P104Q|MIA_ENST00000597784.1_Missense_Mutation_p.P104Q|RAB4B_ENST00000594800.1_5'Flank|MIA_ENST00000594436.1_Missense_Mutation_p.P104Q|RAB4B-EGLN2_ENST00000594136.1_5'Flank|RAB4B_ENST00000357052.2_5'Flank	NM_006533.3	NP_006524.1	Q16674	MIA_HUMAN	melanoma inhibitory activity	104	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell proliferation (GO:0008283)	extracellular space (GO:0005615)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)	GBM - Glioblastoma multiforme(1328;0.0199)		GGCTATTTCCCCAGTAGCATTG	0.545																																					p.P104Q													.	MIA-651	0			c.C312A						.																																			SO:0001583	missense	8190	exon4			TTTCCCCAGTAGC	X75450	CCDS12566.1	19q13.2	2012-10-15			ENSG00000261857	ENSG00000261857			7076	protein-coding gene	gene with protein product		601340				7923218, 8661134	Standard	NM_006533		Approved	CD-RAP	uc021uuu.1	Q16674		Exception_encountered	19.37:g.41282923_41282924delinsAA	ENSP00000263369:p.Pro104Gln	Somatic	65	2		WXS	Illumina HiSeq		37	4	NM_001202553	0	0	0	0	0	Q6FHV3	Missense_Mutation	DNP	ENST00000263369.3	37	CCDS12566.1																																																																																			.		0.545	MIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463162.1		
