#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RERE	473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	8422784	8422784	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:8422784T>C	ENST00000337907.3	-	17	2495	c.1861A>G	c.(1861-1863)Agc>Ggc	p.S621G	RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.S621G|RERE_ENST00000377464.1_Missense_Mutation_p.S353G|RERE_ENST00000476556.1_Missense_Mutation_p.S67G	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	621					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CTGTCATTGCTGGAGGTACTG	0.577																																					p.S621G		.											.	RERE-515	0			c.A1861G						.						137.0	114.0	122.0					1																	8422784		2203	4300	6503	SO:0001583	missense	473	exon17			CATTGCTGGAGGT	AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1861A>G	1.37:g.8422784T>C	ENSP00000338629:p.Ser621Gly	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	201	70	NM_012102	0	0	6	7	1	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	ENST00000337907.3	37	CCDS95.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.838657	0.91117	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908;ENST00000505225	T;T;T;T	0.64260	-0.09;3.35;1.89;-0.09	5.7	5.7	0.88788	.	.	.	.	.	T	0.77226	0.4099	M	0.67953	2.075	0.80722	D	1	D;D	0.63046	0.992;0.979	D;D	0.76071	0.987;0.982	T	0.78347	-0.2239	9	0.52906	T	0.07	-23.6318	15.138	0.72583	0.0:0.0:0.0:1.0	.	353;621	B1AKN3;Q9P2R6	.;RERE_HUMAN	G	621;353;67;621;41	ENSP00000338629:S621G;ENSP00000366684:S353G;ENSP00000422246:S67G;ENSP00000383700:S621G	ENSP00000338629:S621G	S	-	1	0	RERE	8345371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.644000	0.83416	2.158000	0.67659	0.460000	0.39030	AGC	.		0.577	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004916.1		
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	16260463	16260463	+	Silent	SNP	T	T	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:16260463T>G	ENST00000375759.3	+	11	7932	c.7728T>G	c.(7726-7728)gtT>gtG	p.V2576V		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2576	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCCCGCCAGTTGACTCTAAAA	0.527																																					p.V2576V		.											.	SPEN-298	0			c.T7728G						.						72.0	83.0	79.0					1																	16260463		2203	4300	6503	SO:0001819	synonymous_variant	23013	exon11			GCCAGTTGACTCT		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7728T>G	1.37:g.16260463T>G		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	25	10	NM_015001	0	0	2	2	0	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	37	CCDS164.1																																																																																			.		0.527	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
AKR7A3	22977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19611546	19611546	+	Silent	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:19611546A>G	ENST00000361640.4	-	4	1110	c.570T>C	c.(568-570)ttT>ttC	p.F190F		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	190					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTCAGTCCAAAGTGCCTGA	0.612																																					p.F190F		.											.	AKR7A3-90	0			c.T570C						.						94.0	96.0	95.0					1																	19611546		2199	4300	6499	SO:0001819	synonymous_variant	22977	exon4			CAGTCCAAAGTGC	AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.570T>C	1.37:g.19611546A>G		Somatic	338	0		WXS	Illumina HiSeq	Phase_I	296	116	NM_012067	0	0	64	119	55	Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Silent	SNP	ENST00000361640.4	37	CCDS193.1																																																																																			.		0.612	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067	
RAP1GAP	5909	bcgsc.ca	37	1	21952821	21952821	+	5'UTR	SNP	G	G	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:21952821G>T	ENST00000374765.4	-	0	158				RAP1GAP_ENST00000290101.4_Silent_p.S50S|RAP1GAP_ENST00000542643.2_5'UTR|RAP1GAP_ENST00000374757.3_5'UTR	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein						GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		AAGGAGTATAGGAGGGAACTA	0.577																																					p.S50S													.	RAP1GAP-245	0			c.C150A						.						131.0	128.0	129.0					1																	21952821		1568	3582	5150	SO:0001623	5_prime_UTR_variant	5909	exon3			AGTATAGGAGGGA	BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.-43C>A	1.37:g.21952821G>T		Somatic	68	0		WXS	Illumina HiSeq	Phase_1	47	4	NM_001145658	0	0	1	1	0	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Silent	SNP	ENST00000374765.4	37	CCDS218.1																																																																																			.		0.577	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019759.2	NM_002885	
ZMYM1	79830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	35569920	35569920	+	Silent	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:35569920G>C	ENST00000373330.1	+	6	618	c.444G>C	c.(442-444)gtG>gtC	p.V148V	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Silent_p.V148V			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	148						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CAAAGGATGTGATTAGTGTCC	0.308																																					p.V148V		.											.	ZMYM1-90	0			c.G444C						.						41.0	40.0	41.0					1																	35569920		1830	4087	5917	SO:0001819	synonymous_variant	79830	exon5			GGATGTGATTAGT	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.444G>C	1.37:g.35569920G>C		Somatic	96	0		WXS	Illumina HiSeq	Phase_I	78	31	NM_024772	0	0	1	3	2	D3DPR7|Q7Z3Q4	Silent	SNP	ENST00000373330.1	37	CCDS41302.1																																																																																			.		0.308	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772	
EPS15	2060	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	51946986	51946986	+	Splice_Site	SNP	A	A	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:51946986A>C	ENST00000371733.3	-	2	130	c.34T>G	c.(34-36)Tta>Gta	p.L12V	EPS15_ENST00000371730.2_Splice_Site_p.L12V	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	12	Interaction with DAB2. {ECO:0000250}.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)			endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						CCACTTGATAACTGAAATAAA	0.274			T	MLL	ALL																																p.L12V				Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	.	EPS15-1082	0			c.T34G						.						52.0	53.0	53.0					1																	51946986		2200	4296	6496	SO:0001630	splice_region_variant	2060	exon2			TTGATAACTGAAA	BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.34-1T>G	1.37:g.51946986A>C		Somatic	126	1		WXS	Illumina HiSeq	Phase_I	88	31	NM_001981	0	0	0	0	0	B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	ENST00000371733.3	37	CCDS557.1	.	.	.	.	.	.	.	.	.	.	A	11.39	1.624296	0.28889	.	.	ENSG00000085832	ENST00000371730;ENST00000371733;ENST00000371727	T;T	0.25749	1.87;1.78	5.0	3.81	0.43845	EPS15 homology (EH) (1);	0.000000	0.26478	N	0.024144	T	0.39655	0.1086	M	0.75264	2.295	0.80722	D	1	D;D	0.67145	0.993;0.996	D;D	0.75484	0.967;0.986	T	0.56080	-0.8038	10	0.02654	T	1	.	6.4196	0.21736	0.7757:0.0:0.2243:0.0	.	12;12	B1AUU8;P42566	.;EPS15_HUMAN	V	12	ENSP00000360795:L12V;ENSP00000360798:L12V	ENSP00000360792:L12V	L	-	1	2	EPS15	51719574	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	1.897000	0.39799	0.930000	0.37217	0.533000	0.62120	TTA	.		0.274	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022422.1	NM_001981	Missense_Mutation
FAM46C	54855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	118165851	118165851	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:118165851C>G	ENST00000369448.3	+	2	608	c.361C>G	c.(361-363)Cca>Gca	p.P121A		NM_017709.3	NP_060179.2	Q5VWP2	FA46C_HUMAN	family with sequence similarity 46, member C	121										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	15	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		GAACTTCCTGCCAGAGGGTGT	0.502			"""Mis, F, O"""		MM					Multiple Myeloma(3;1.13e-06)																											p.P121A		.		Rec	yes		1	1p12	54855	"""family with sequence similarity 46, member C"""		L	.	FAM46C-90	0			c.C361G						.						104.0	106.0	105.0					1																	118165851		2203	4300	6503	SO:0001583	missense	54855	exon2			TTCCTGCCAGAGG	BC036516	CCDS896.1	1p12	2008-02-05			ENSG00000183508	ENSG00000183508			24712	protein-coding gene	gene with protein product		613952				12477932	Standard	NM_017709		Approved	FLJ20202	uc001ehe.3	Q5VWP2	OTTHUMG00000013703	ENST00000369448.3:c.361C>G	1.37:g.118165851C>G	ENSP00000358458:p.Pro121Ala	Somatic	173	0		WXS	Illumina HiSeq	Phase_I	146	64	NM_017709	0	0	0	0	0	A3KMG2|Q8NE25|Q9NXK0	Missense_Mutation	SNP	ENST00000369448.3	37	CCDS896.1	.	.	.	.	.	.	.	.	.	.	C	19.71	3.877619	0.72294	.	.	ENSG00000183508	ENST00000369448	T	0.46819	0.86	5.75	5.75	0.90469	Domain of unknown function DUF1693 (1);	0.000000	0.64402	D	0.000002	T	0.70456	0.3226	M	0.87971	2.92	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.74850	-0.3524	10	0.72032	D	0.01	-31.2719	18.9258	0.92544	0.0:1.0:0.0:0.0	.	121	Q5VWP2	FA46C_HUMAN	A	121	ENSP00000358458:P121A	ENSP00000358458:P121A	P	+	1	0	FAM46C	117967374	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.818000	0.86416	2.711000	0.92665	0.655000	0.94253	CCA	.		0.502	FAM46C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038424.1	NM_017709	
ZC3H11A	9877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	203819761	203819761	+	Silent	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:203819761C>T	ENST00000545588.1	+	15	5885	c.2058C>T	c.(2056-2058)ctC>ctT	p.L686L	ZC3H11A_ENST00000367214.1_Silent_p.L686L|ZC3H11A_ENST00000367210.1_Silent_p.L686L|ZC3H11A_ENST00000367212.3_Silent_p.L686L|ZC3H11A_ENST00000332127.4_Silent_p.L686L	NM_001271675.1	NP_001258604.1	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A	686					poly(A)+ mRNA export from nucleus (GO:0016973)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TGAAGCCACTCAGCTCCAGCA	0.502																																					p.L686L		.											.	ZC3H11A-515	0			c.C2058T						.						80.0	80.0	80.0					1																	203819761		2203	4300	6503	SO:0001819	synonymous_variant	9877	exon18			GCCACTCAGCTCC		CCDS30978.1	1q32.1	2012-07-05	2005-06-02	2005-06-02	ENSG00000058673	ENSG00000058673		"""Zinc fingers, CCCH-type domain containing"""	29093	protein-coding gene	gene with protein product		613513	"""zinc finger CCCH-type domain containing 11A"""	ZC3HDC11A		9734811	Standard	NM_014827		Approved	KIAA0663	uc001hac.3	O75152	OTTHUMG00000035909	ENST00000545588.1:c.2058C>T	1.37:g.203819761C>T		Somatic	184	0		WXS	Illumina HiSeq	Phase_I	142	62	NM_014827	0	0	22	43	21	Q6AHY4|Q6AHY9|Q6AW79|Q6AWA1|Q6PJK4|Q86XZ7	Silent	SNP	ENST00000545588.1	37	CCDS30978.1																																																																																			.		0.502	ZC3H11A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087471.3	NM_014827	
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	208213052	208213052	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:208213052C>T	ENST00000367033.3	-	24	5171	c.4414G>A	c.(4414-4416)Ggc>Agc	p.G1472S		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1472					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TCAATGGGGCCCTTCTCCATC	0.622																																					p.G1472S		.											.	PLXNA2-92	0			c.G4414A						.						96.0	88.0	91.0					1																	208213052		2203	4300	6503	SO:0001583	missense	5362	exon24			TGGGGCCCTTCTC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.4414G>A	1.37:g.208213052C>T	ENSP00000356000:p.Gly1472Ser	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	111	31	NM_025179	0	0	2	2	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	C	36	5.938808	0.97122	.	.	ENSG00000076356	ENST00000367033	T	0.35789	1.29	5.51	5.51	0.81932	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.71745	0.3376	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79752	-0.1671	10	0.87932	D	0	.	19.4545	0.94882	0.0:1.0:0.0:0.0	.	1472	O75051	PLXA2_HUMAN	S	1472	ENSP00000356000:G1472S	ENSP00000356000:G1472S	G	-	1	0	PLXNA2	206279675	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.538000	0.82048	2.590000	0.87494	0.650000	0.86243	GGC	.		0.622	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
CAPN2	824	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	223900487	223900487	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:223900487C>A	ENST00000295006.5	+	1	454	c.145C>A	c.(145-147)Ccg>Acg	p.P49T	CAPN2_ENST00000433674.2_Intron	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	49	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		CTTCCAGGACCCGTCCTTCCC	0.672																																					p.P49T		.											.	CAPN2-523	0			c.C145A						.						24.0	24.0	24.0					1																	223900487		2201	4297	6498	SO:0001583	missense	824	exon1			CAGGACCCGTCCT	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.145C>A	1.37:g.223900487C>A	ENSP00000295006:p.Pro49Thr	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	71	30	NM_001748	0	0	5	9	4	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Missense_Mutation	SNP	ENST00000295006.5	37	CCDS31035.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.935915	0.52972	.	.	ENSG00000162909	ENST00000295006;ENST00000366869	T	0.49432	0.78	3.88	3.88	0.44766	Peptidase C2, calpain, catalytic domain (3);	0.526246	0.19489	U	0.113025	T	0.54046	0.1834	M	0.81112	2.525	0.24034	N	0.996105	B	0.34214	0.442	B	0.39094	0.29	T	0.54556	-0.8276	10	0.54805	T	0.06	.	12.5002	0.55952	0.0:0.6877:0.3123:0.0	.	49	P17655	CAN2_HUMAN	T	49;78	ENSP00000295006:P49T	ENSP00000295006:P49T	P	+	1	0	CAPN2	221967110	0.000000	0.05858	0.913000	0.36048	0.489000	0.33432	0.484000	0.22308	1.862000	0.54008	0.491000	0.48974	CCG	.		0.672	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
DNAJC1	64215	ucsc.edu	37	10	22208842	22208842	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr10:22208842C>G	ENST00000376980.3	-	5	844	c.554G>C	c.(553-555)aGa>aCa	p.R185T		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	185					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				TCTCTTTTTTCTACTTAGTAG	0.333																																					p.R185T													.	DNAJC1-226	0			c.G554C						.						82.0	87.0	85.0					10																	22208842		2201	4293	6494	SO:0001583	missense	64215	exon5			TTTTTTCTACTTA	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.554G>C	10.37:g.22208842C>G	ENSP00000366179:p.Arg185Thr	Somatic	24	0		WXS	Illumina HiSeq		5	1	NM_022365	0	0	3	11	8	B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	ENST00000376980.3	37	CCDS7136.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077825	0.36662	.	.	ENSG00000136770	ENST00000376980	T	0.45668	0.89	5.7	4.79	0.61399	.	0.126969	0.64402	D	0.000001	T	0.30603	0.0770	L	0.38531	1.155	0.80722	D	1	P	0.40144	0.704	B	0.38378	0.272	T	0.02813	-1.1107	10	0.17832	T	0.49	-7.7676	11.1524	0.48466	0.0:0.8588:0.0:0.1412	.	185	Q96KC8	DNJC1_HUMAN	T	185	ENSP00000366179:R185T	ENSP00000366179:R185T	R	-	2	0	DNAJC1	22248848	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.912000	0.28597	2.695000	0.91970	0.650000	0.86243	AGA	.		0.333	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365	
KIF5B	3799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	32320043	32320043	+	Silent	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr10:32320043A>G	ENST00000302418.4	-	14	1996	c.1539T>C	c.(1537-1539)acT>acC	p.T513T		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	513					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				CATATTCCTTAGTTTTGTCTT	0.313			T	"""RET, ALK"""	NSCLC																																p.T513T		.		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	.	KIF5B-399	0			c.T1539C						.						103.0	101.0	102.0					10																	32320043		2203	4300	6503	SO:0001819	synonymous_variant	3799	exon14			TTCCTTAGTTTTG	X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.1539T>C	10.37:g.32320043A>G		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	37	10	NM_004521	0	0	2	2	0	A0AVB2|Q5VZ85	Silent	SNP	ENST00000302418.4	37	CCDS7171.1																																																																																			.		0.313	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047467.1	NM_004521	
CYP26A1	1592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	94834101	94834101	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr10:94834101G>A	ENST00000224356.4	+	2	271	c.226G>A	c.(226-228)Ggc>Agc	p.G76S	CYP26A1_ENST00000394139.1_Missense_Mutation_p.G7S|CYP26A1_ENST00000371531.1_Missense_Mutation_p.G7S	NM_000783.3	NP_000774.2	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A, polypeptide 1	76					anterior/posterior pattern specification (GO:0009952)|cellular response to retinoic acid (GO:0071300)|central nervous system development (GO:0007417)|metabolic process (GO:0008152)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|retinoic acid catabolic process (GO:0034653)|retinoic acid receptor signaling pathway (GO:0048384)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			breast(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Colorectal(252;0.122)			Acitretin(DB00459)|Ketoconazole(DB01026)|Vitamin A(DB00162)	CAGGAAATACGGCTTCATCTA	0.657																																					p.G76S		.											.	CYP26A1-155	0			c.G226A						.						53.0	56.0	55.0					10																	94834101		2203	4300	6503	SO:0001583	missense	1592	exon2			AAATACGGCTTCA	AF005418	CCDS7426.1, CCDS7427.1	10q23-q24	2003-10-06	2003-01-14		ENSG00000095596	ENSG00000095596		"""Cytochrome P450s"""	2603	protein-coding gene	gene with protein product		602239	"""cytochrome P450, subfamily XXVIA, polypeptide 1"""			9228017, 9521883	Standard	NM_000783		Approved	P450RAI, CP26, CYP26, P450RAI1	uc001kil.2	O43174	OTTHUMG00000018765	ENST00000224356.4:c.226G>A	10.37:g.94834101G>A	ENSP00000224356:p.Gly76Ser	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	51	17	NM_000783	0	0	0	0	0	B3KNI4|Q5VXH9|Q5VXI0	Missense_Mutation	SNP	ENST00000224356.4	37	CCDS7426.1	.	.	.	.	.	.	.	.	.	.	G	34	5.324133	0.95708	.	.	ENSG00000095596	ENST00000371531;ENST00000224356;ENST00000394139	T;T;T	0.78003	-1.14;-1.14;-1.14	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.85504	0.5712	L	0.52759	1.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84672	0.0712	10	0.45353	T	0.12	-21.1018	18.8725	0.92320	0.0:0.0:1.0:0.0	.	76	O43174	CP26A_HUMAN	S	7;76;7	ENSP00000360586:G7S;ENSP00000224356:G76S;ENSP00000377695:G7S	ENSP00000224356:G76S	G	+	1	0	CYP26A1	94824091	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.187000	0.94912	2.711000	0.92665	0.561000	0.74099	GGC	.		0.657	CYP26A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049408.3		
LGI1	9211	hgsc.bcm.edu	37	10	95549895	95549895	+	Silent	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr10:95549895T>C	ENST00000371418.4	+	5	731	c.471T>C	c.(469-471)gaT>gaC	p.D157D	LGI1_ENST00000371413.3_Silent_p.D157D|LGI1_ENST00000542308.1_Silent_p.D109D	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	157					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				TCCCAAAAGATATTTTCAAAG	0.328																																					p.D157D		.											.	LGI1-517	0			c.T471C						.						54.0	57.0	56.0					10																	95549895		2203	4299	6502	SO:0001819	synonymous_variant	9211	exon5			AAAAGATATTTTC	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.471T>C	10.37:g.95549895T>C		Somatic	5	0		WXS	Illumina HiSeq	Phase_I	10	5	NM_005097	0	0	0	0	0	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Silent	SNP	ENST00000371418.4	37	CCDS7431.1																																																																																			.		0.328	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049445.1	NM_005097	
SEMA4G	57715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	102738660	102738660	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr10:102738660G>A	ENST00000370250.4	+	7	1071	c.698G>A	c.(697-699)gGt>gAt	p.G233D	SEMA4G_ENST00000519756.1_Intron|MRPL43_ENST00000318325.2_3'UTR|MRPL43_ENST00000370241.3_3'UTR|RP11-108L7.4_ENST00000447344.1_RNA|SEMA4G_ENST00000517724.1_Missense_Mutation_p.G233D|SEMA4G_ENST00000210633.3_Missense_Mutation_p.G233D	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G	233	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		AGTGCAGTGGGTGATGATGAC	0.587																																					p.G233D		.											.	SEMA4G-154	0			c.G698A						.						84.0	65.0	71.0					10																	102738660		2203	4300	6503	SO:0001583	missense	57715	exon7			CAGTGGGTGATGA	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.698G>A	10.37:g.102738660G>A	ENSP00000359270:p.Gly233Asp	Somatic	370	0		WXS	Illumina HiSeq	Phase_I	288	106	NM_001203244	0	0	0	0	0	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	Missense_Mutation	SNP	ENST00000370250.4	37		.	.	.	.	.	.	.	.	.	.	G	23.0	4.363918	0.82353	.	.	ENSG00000095539	ENST00000519649;ENST00000457585;ENST00000370250;ENST00000517724;ENST00000210633	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.74	4.84	0.62591	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.050938	0.85682	D	0.000000	T	0.52805	0.1757	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.984	D;D;P	0.97110	1.0;1.0;0.907	T	0.53049	-0.8493	10	0.45353	T	0.12	.	13.9543	0.64137	0.0731:0.0:0.9269:0.0	.	233;233;233	Q9NTN9;A1A5C6;Q9NTN9-2	SEM4G_HUMAN;.;.	D	233	ENSP00000428896:G233D;ENSP00000359270:G233D;ENSP00000430175:G233D;ENSP00000210633:G233D	ENSP00000210633:G233D	G	+	2	0	SEMA4G	102728650	1.000000	0.71417	0.959000	0.39883	0.876000	0.50452	7.636000	0.83301	1.433000	0.47394	0.484000	0.47621	GGT	.		0.587	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2		
PPRC1	23082	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103899235	103899235	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr10:103899235G>A	ENST00000278070.2	+	5	1009	c.970G>A	c.(970-972)Gca>Aca	p.A324T	PPRC1_ENST00000370012.1_5'Flank|PPRC1_ENST00000413464.2_Missense_Mutation_p.A324T	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CACCCACCTGGCATCACTTGA	0.602																																					p.A324T													.	PPRC1-227	0			c.G970A						.						90.0	77.0	81.0					10																	103899235		2203	4300	6503	SO:0001583	missense	23082	exon5			CACCTGGCATCAC	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.970G>A	10.37:g.103899235G>A	ENSP00000278070:p.Ala324Thr	Somatic	133	1		WXS	Illumina HiSeq	Phase_I	134	43	NM_015062	0	0	1	1	0	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	ENST00000278070.2	37	CCDS7529.1	.	.	.	.	.	.	.	.	.	.	G	7.563	0.665151	0.14710	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.53857	0.6;0.6	5.87	1.18	0.20946	.	0.908110	0.09536	N	0.788858	T	0.27205	0.0667	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.20773	-1.0265	10	0.20519	T	0.43	.	4.8401	0.13485	0.2462:0.0:0.584:0.1699	.	324;204;324	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	T	324	ENSP00000278070:A324T;ENSP00000399743:A324T	ENSP00000278070:A324T	A	+	1	0	PPRC1	103889225	0.825000	0.29262	0.862000	0.33874	0.407000	0.30961	1.093000	0.30939	0.240000	0.21263	-0.350000	0.07774	GCA	.		0.602	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
DMBT1	1755	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	124339398	124339398	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr10:124339398C>G	ENST00000338354.3	+	10	1090	c.984C>G	c.(982-984)gaC>gaG	p.D328E	DMBT1_ENST00000344338.3_Missense_Mutation_p.D328E|DMBT1_ENST00000368909.3_Missense_Mutation_p.D328E|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368955.3_Missense_Mutation_p.D328E|DMBT1_ENST00000330163.4_Missense_Mutation_p.D328E|DMBT1_ENST00000368956.2_Missense_Mutation_p.D328E			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	328	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATAGTGAAGACGCTGGTGTCA	0.532																																					p.D328E	Ovarian(182;93 2026 18125 22222 38972)												.	DMBT1-494	0			c.C984G						.						82.0	81.0	81.0					10																	124339398		1908	4138	6046	SO:0001583	missense	1755	exon10			TGAAGACGCTGGT		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.984C>G	10.37:g.124339398C>G	ENSP00000342210:p.Asp328Glu	Somatic	127	1		WXS	Illumina HiSeq	Phase_I	101	25	NM_007329	0	0	0	0	0	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	37		.	.	.	.	.	.	.	.	.	.	c	16.17	3.046172	0.55110	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66	3.94	-7.88	0.01178	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.74741	0.3756	H	0.95504	3.68	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;1.0	D;D;D;D;D	0.97110	1.0;0.996;0.98;0.997;0.999	D	0.85967	0.1474	9	0.66056	D	0.02	.	19.1418	0.93449	0.0:0.092:0.0:0.908	.	328;328;328;328;328	Q9UGM3-4;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	E	328	ENSP00000342210:D328E;ENSP00000343175:D328E;ENSP00000327747:D328E;ENSP00000357905:D328E;ENSP00000357951:D328E;ENSP00000357952:D328E	ENSP00000331522:D328E	D	+	3	2	DMBT1	124329388	0.017000	0.18338	0.000000	0.03702	0.118000	0.20060	-1.037000	0.03557	-3.153000	0.00230	-1.386000	0.01163	GAC	.		0.532	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
NAALAD2	10003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	89896525	89896525	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr11:89896525G>A	ENST00000534061.1	+	10	1353	c.1123G>A	c.(1123-1125)Gct>Act	p.A375T	NAALAD2_ENST00000321955.4_Missense_Mutation_p.A342T|NAALAD2_ENST00000375944.3_Intron|NAALAD2_ENST00000525171.1_Missense_Mutation_p.A282T	NM_005467.3	NP_005458.1	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	375	NAALADase.				neurotransmitter catabolic process (GO:0042135)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|N-formylglutamate deformylase activity (GO:0050129)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(32)|pancreas(1)|prostate(3)|skin(5)|stomach(2)	59		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GGTATTTGGAGCTATTGACCC	0.403																																					p.A375T		.											.	NAALAD2-92	0			c.G1123A						.						122.0	129.0	126.0					11																	89896525		2201	4299	6500	SO:0001583	missense	10003	exon10			TTTGGAGCTATTG	AJ012370	CCDS8288.1, CCDS73364.1	11q14.3-q21	2011-08-16			ENSG00000077616	ENSG00000077616	3.4.17.21		14526	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase III"""	611636				10085079	Standard	NM_005467		Approved	NAALADASE2, NAADALASE2, GPCIII	uc001pdf.4	Q9Y3Q0	OTTHUMG00000166368	ENST00000534061.1:c.1123G>A	11.37:g.89896525G>A	ENSP00000432481:p.Ala375Thr	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	59	19	NM_005467	0	0	0	0	0	B3KQR4|Q4KKV4|Q4VAM9	Missense_Mutation	SNP	ENST00000534061.1	37	CCDS8288.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688939	0.68271	.	.	ENSG00000077616	ENST00000534061;ENST00000321955;ENST00000525171	T;T;T	0.65364	-0.15;-0.15;-0.15	5.51	4.61	0.57282	Peptidase M28 (1);	0.502085	0.19690	N	0.108285	T	0.69975	0.3171	M	0.83012	2.62	0.80722	D	1	P;B	0.45283	0.855;0.001	P;B	0.45753	0.492;0.004	T	0.73726	-0.3892	9	.	.	.	-1.5086	14.2116	0.65769	0.0725:0.0:0.9275:0.0	.	375;282	Q9Y3Q0;E9PKX5	NALD2_HUMAN;.	T	375;342;282	ENSP00000432481:A375T;ENSP00000320083:A342T;ENSP00000435249:A282T	.	A	+	1	0	NAALAD2	89536173	1.000000	0.71417	0.972000	0.41901	0.993000	0.82548	7.040000	0.76551	1.467000	0.48044	-0.218000	0.12543	GCT	.		0.403	NAALAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389424.2	NM_005467	
GPRC5D	55507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	13102558	13102558	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:13102558A>T	ENST00000228887.1	-	1	760	c.761T>A	c.(760-762)cTg>cAg	p.L254Q	RP11-392P7.6_ENST00000536029.1_RNA|RP11-392P7.6_ENST00000394742.3_RNA|RP11-392P7.6_ENST00000538231.1_RNA|RP11-392P7.6_ENST00000543515.2_RNA|RP11-392P7.6_ENST00000545914.1_RNA|GPRC5D_ENST00000396333.3_Missense_Mutation_p.L254Q|RP11-392P7.6_ENST00000540198.1_RNA|RP11-392P7.6_ENST00000542078.1_RNA	NM_018654.1	NP_061124.1	Q9NZD1	GPC5D_HUMAN	G protein-coupled receptor, class C, group 5, member D	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			kidney(2)|large_intestine(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		GTACAGCAGCAGGAAAACCCA	0.577																																					p.L254Q		.											.	GPRC5D-90	0			c.T761A						.						144.0	132.0	136.0					12																	13102558		2203	4300	6503	SO:0001583	missense	55507	exon1			AGCAGCAGGAAAA	AF209923	CCDS8658.1	12p13.3	2014-01-30	2014-01-30		ENSG00000111291	ENSG00000111291		"""GPCR / Class C : Orphans"""	13310	protein-coding gene	gene with protein product		607437	"""G protein-coupled receptor, family C, group 5, member D"""				Standard	XM_005253421		Approved		uc010shp.2	Q9NZD1	OTTHUMG00000168711	ENST00000228887.1:c.761T>A	12.37:g.13102558A>T	ENSP00000228887:p.Leu254Gln	Somatic	194	0		WXS	Illumina HiSeq	Phase_I	245	129	NM_018654	0	0	0	0	0	Q3KNV3|Q7Z5J9|Q8TDS6	Missense_Mutation	SNP	ENST00000228887.1	37	CCDS8658.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.684961	0.88639	.	.	ENSG00000111291	ENST00000228887;ENST00000396333	D;D	0.94793	-3.52;-3.52	6.03	6.03	0.97812	GPCR, family 3, C-terminal (1);	0.000000	0.56097	D	0.000037	D	0.97269	0.9107	M	0.80183	2.485	0.51767	D	0.999936	D	0.89917	1.0	D	0.97110	1.0	D	0.97842	1.0269	10	0.87932	D	0	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	254	Q9NZD1	GPC5D_HUMAN	Q	254	ENSP00000228887:L254Q;ENSP00000379624:L254Q	ENSP00000228887:L254Q	L	-	2	0	GPRC5D	12993825	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.300000	0.96151	2.302000	0.77476	0.533000	0.62120	CTG	.		0.577	GPRC5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400687.1		
SP7	121340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53722359	53722359	+	Silent	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:53722359C>T	ENST00000536324.2	-	3	1150	c.867G>A	c.(865-867)cgG>cgA	p.R289R	SP7_ENST00000303846.3_Silent_p.R289R|SP7_ENST00000537210.2_Silent_p.R271R	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	289					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						TGGGCTTCTTCCGCAGCCCAG	0.657																																					p.R289R		.											.	.	0			c.G867A						.						17.0	22.0	20.0					12																	53722359		2187	4292	6479	SO:0001819	synonymous_variant	121340	exon2			CTTCTTCCGCAGC	AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.867G>A	12.37:g.53722359C>T		Somatic	54	0		WXS	Illumina HiSeq	Phase_I	43	17	NM_152860	0	0	0	0	0	B3KY26|Q3MJ72|Q7Z718	Silent	SNP	ENST00000536324.2	37	CCDS44897.1																																																																																			.		0.657	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406917.1		
HNRNPA1	3178	bcgsc.ca	37	12	54677021	54677021	+	Intron	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:54677021A>G	ENST00000340913.6	+	8	960				RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000547276.1_Intron|HNRNPA1_ENST00000546500.1_Intron|HNRNPA1_ENST00000330752.8_Intron	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1						cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TGGTAGTGGTAGGTATCCAGT	0.522																																					.	Colon(83;502 1289 8436 16406 24870)												.	.	0			.						.						64.0	83.0	77.0					12																	54677021		2060	4192	6252	SO:0001627	intron_variant	664709	.			AGTGGTAGGTATC	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.907+3A>G	12.37:g.54677021A>G		Somatic	108	0		WXS	Illumina HiSeq	Phase_1	90	46	.	0	0	1	1	0	A8K4Z8|Q3MIB7|Q6PJZ7	RNA	SNP	ENST00000340913.6	37	CCDS44909.1																																																																																			.		0.522	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
DNAJC14	85406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56216194	56216194	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:56216194A>G	ENST00000357606.3	-	7	2150	c.1861T>C	c.(1861-1863)Ttt>Ctt	p.F621L	RP11-762I7.5_ENST00000552719.1_5'UTR|RP11-762I7.5_ENST00000546837.1_Missense_Mutation_p.I250T|DNAJC14_ENST00000317287.5_Missense_Mutation_p.F621L|DNAJC14_ENST00000317269.3_Missense_Mutation_p.F621L			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	621					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						CGAGAACCAAATGAGATGTGA	0.463											OREG0021910	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F621L		.											.	DNAJC14-229	0			c.T1861C						.						107.0	112.0	110.0					12																	56216194		2203	4300	6503	SO:0001583	missense	85406	exon6			AACCAAATGAGAT	AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.1861T>C	12.37:g.56216194A>G	ENSP00000350223:p.Phe621Leu	Somatic	104	0	1013	WXS	Illumina HiSeq	Phase_I	120	62	NM_032364	0	0	3	9	6	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Missense_Mutation	SNP	ENST00000357606.3	37	CCDS8894.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.5|23.5	4.424150|4.424150	0.83667|0.83667	.|.	.|.	ENSG00000135392|ENSG00000257390	ENST00000357606;ENST00000317269;ENST00000537962;ENST00000317287;ENST00000540330|ENST00000546837	T;T;T|.	0.33216|.	1.42;1.42;1.42|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.53481|0.53481	0.1799|0.1799	L|L	0.28014|0.28014	0.82|0.82	0.58432|0.58432	D|D	0.999997|0.999997	D;D|.	0.71674|.	0.998;0.998|.	D;D|.	0.72625|.	0.978;0.978|.	T|T	0.50285|0.50285	-0.8846|-0.8846	10|5	0.29301|.	T|.	0.29|.	-12.4258|-12.4258	14.2815|14.2815	0.66216|0.66216	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	621;621|.	Q6Y2X3;A8K5A7|.	DJC14_HUMAN;.|.	L|T	621;621;331;621;117|250	ENSP00000350223:F621L;ENSP00000316240:F621L;ENSP00000317500:F621L|.	ENSP00000316240:F621L|.	F|I	-|-	1|2	0|0	DNAJC14|RP11-762I7.5	54502461|54502461	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.512000|8.512000	0.90538|0.90538	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	TTT|ATT	.		0.463	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364	
DPY19L2	283417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	63991615	63991615	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:63991615G>A	ENST00000324472.4	-	14	1618	c.1435C>T	c.(1435-1437)Ccc>Tcc	p.P479S		NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	479					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCAAATTCGGGAGCACAGGTA	0.323																																					p.P479S		.											.	DPY19L2-515	0			c.C1435T						.						53.0	58.0	56.0					12																	63991615		2202	4287	6489	SO:0001583	missense	283417	exon14			ATTCGGGAGCACA		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.1435C>T	12.37:g.63991615G>A	ENSP00000315988:p.Pro479Ser	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	129	29	NM_173812	0	0	0	0	0	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	ENST00000324472.4	37	CCDS31851.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.769090	0.49680	.	.	ENSG00000177990	ENST00000324472	T	0.54071	0.59	3.15	2.22	0.28083	.	0.062767	0.64402	U	0.000008	T	0.51991	0.1707	M	0.71581	2.175	0.58432	D	0.999999	B	0.25272	0.122	B	0.36186	0.219	T	0.44050	-0.9353	9	.	.	.	.	8.3442	0.32263	0.0:0.2427:0.7573:0.0	.	479	Q6NUT2	D19L2_HUMAN	S	479	ENSP00000315988:P479S	.	P	-	1	0	DPY19L2	62277882	1.000000	0.71417	0.698000	0.30274	0.953000	0.61014	2.632000	0.46511	0.619000	0.30197	0.586000	0.80456	CCC	.		0.323	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812	
TMPO	7112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	98925573	98925573	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:98925573G>C	ENST00000556029.1	+	3	878	c.522G>C	c.(520-522)caG>caC	p.Q174H	TMPO_ENST00000343315.5_Missense_Mutation_p.Q174H|TMPO_ENST00000266732.4_Missense_Mutation_p.Q174H|TMPO_ENST00000393053.2_Missense_Mutation_p.Q174H|TMPO_ENST00000261210.5_Missense_Mutation_p.Q174H	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin	174	NAKAP95-binding N.|Nucleoplasmic. {ECO:0000255}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						ATACAAGGCAGAATGGAAGTA	0.323																																					p.Q174H		.											.	TMPO-93	0			c.G522C						.						70.0	70.0	70.0					12																	98925573		2203	4300	6503	SO:0001583	missense	7112	exon3			AAGGCAGAATGGA		CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.522G>C	12.37:g.98925573G>C	ENSP00000450627:p.Gln174His	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	160	36	NM_003276	0	0	4	4	0	A2T926|Q14861	Missense_Mutation	SNP	ENST00000556029.1	37	CCDS31879.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562332	0.65538	.	.	ENSG00000120802	ENST00000556029;ENST00000343315;ENST00000266732;ENST00000393053;ENST00000261210;ENST00000556678	T;T;T;T;T;T	0.74421	0.18;0.22;1.55;-0.23;-0.84;-0.8	5.4	2.51	0.30379	.	0.053524	0.85682	D	0.000000	T	0.78046	0.4222	L	0.46157	1.445	0.49687	D	0.999819	D;P;D;D	0.71674	0.997;0.604;0.998;0.997	D;B;D;D	0.79784	0.991;0.204;0.993;0.99	T	0.75611	-0.3258	10	0.59425	D	0.04	.	6.5002	0.22164	0.2145:0.1293:0.6561:0.0	.	207;174;174;174	Q59G12;P42167;A2T926;P42166	.;LAP2B_HUMAN;.;LAP2A_HUMAN	H	174;174;174;174;174;81	ENSP00000450627:Q174H;ENSP00000340251:Q174H;ENSP00000266732:Q174H;ENSP00000376773:Q174H;ENSP00000261210:Q174H;ENSP00000451552:Q81H	ENSP00000261210:Q174H	Q	+	3	2	TMPO	97449704	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.511000	0.45476	0.634000	0.30469	0.655000	0.94253	CAG	.		0.323	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276	
POLR3B	55703	broad.mit.edu	37	12	106890644	106890644	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:106890644C>T	ENST00000228347.4	+	25	3154	c.2932C>T	c.(2932-2934)Cgc>Tgc	p.R978C	RP11-144F15.1_ENST00000551505.1_Intron|POLR3B_ENST00000539066.1_Missense_Mutation_p.R920C	NM_018082.5	NP_060552.4	Q9NW08	RPC2_HUMAN	polymerase (RNA) III (DNA directed) polypeptide B	978				R -> C (in Ref. 2; BAA91527). {ECO:0000305}.	defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(22)|ovary(1)|prostate(3)|skin(3)|urinary_tract(2)	57						GGACCTCGTTCGCCATGGTTA	0.488																																					p.R978C													.	POLR3B-91	0			c.C2932T						.						215.0	170.0	185.0					12																	106890644		2203	4300	6503	SO:0001583	missense	55703	exon25			CTCGTTCGCCATG	AY092084	CCDS9105.1, CCDS53824.1	12q23.3	2014-08-12			ENSG00000013503	ENSG00000013503		"""RNA polymerase subunits"""	30348	protein-coding gene	gene with protein product		614366				12391170	Standard	NM_018082		Approved	RPC2, FLJ10388	uc001tlp.3	Q9NW08	OTTHUMG00000170077	ENST00000228347.4:c.2932C>T	12.37:g.106890644C>T	ENSP00000228347:p.Arg978Cys	Somatic	89	0		WXS	Illumina HiSeq	Phase_I	116	4	NM_018082	0	0	4	4	0	A8K6H0|B3KV73|F5H1E6|Q9NW59	Missense_Mutation	SNP	ENST00000228347.4	37	CCDS9105.1	.	.	.	.	.	.	.	.	.	.	C	35	5.566002	0.96540	.	.	ENSG00000013503	ENST00000228347;ENST00000539066	T;T	0.73047	-0.71;-0.71	5.56	5.56	0.83823	DNA-directed RNA polymerase, subunit 2, domain 6 (2);	0.046314	0.85682	D	0.000000	T	0.82226	0.4991	M	0.71036	2.16	0.80722	D	1	D	0.65815	0.995	P	0.58970	0.849	D	0.83970	0.0326	10	0.87932	D	0	-12.8497	19.5302	0.95226	0.0:1.0:0.0:0.0	.	978	Q9NW08	RPC2_HUMAN	C	978;920	ENSP00000228347:R978C;ENSP00000445721:R920C	ENSP00000228347:R978C	R	+	1	0	POLR3B	105414774	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.786000	0.85741	2.592000	0.87571	0.655000	0.94253	CGC	.		0.488	POLR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407166.1	NM_018082	
IPO4	79711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	24654679	24654679	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr14:24654679A>T	ENST00000354464.6	-	13	1440	c.1264T>A	c.(1264-1266)Tca>Aca	p.S422T	RP11-468E2.2_ENST00000561419.1_3'UTR	NM_024658.3	NP_078934.3	Q8TEX9	IPO4_HUMAN	importin 4	422					DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(1)|stomach(2)|urinary_tract(1)	33				GBM - Glioblastoma multiforme(265;0.0087)		AGGTTTTCTGAGAACTGGCCC	0.562																																					p.S422T		.											.	IPO4-226	0			c.T1264A						.						85.0	91.0	89.0					14																	24654679		2042	4182	6224	SO:0001583	missense	79711	exon13			TTTCTGAGAACTG	AF411122	CCDS9616.1	14q11.2	2003-03-10			ENSG00000196497	ENSG00000196497		"""Importins"""	19426	protein-coding gene	gene with protein product						11823430	Standard	NR_051979		Approved	Imp4, FLJ23338	uc001wmv.1	Q8TEX9	OTTHUMG00000028801	ENST00000354464.6:c.1264T>A	14.37:g.24654679A>T	ENSP00000346453:p.Ser422Thr	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	141	60	NM_024658	0	0	0	0	0	B2RN95|Q2NL96|Q86TZ9|Q8NCG8|Q96SJ3|Q9BTI4|Q9H5L0	Missense_Mutation	SNP	ENST00000354464.6	37	CCDS9616.1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.007813	0.93287	.	.	ENSG00000196497	ENST00000354464;ENST00000399536	T	0.05513	3.43	5.44	5.44	0.79542	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.21962	0.0529	M	0.69185	2.1	0.80722	D	1	D	0.65815	0.995	D	0.70016	0.967	T	0.00138	-1.2003	10	0.72032	D	0.01	-9.0334	13.1234	0.59340	1.0:0.0:0.0:0.0	.	422	Q8TEX9	IPO4_HUMAN	T	422;98	ENSP00000346453:S422T	ENSP00000346453:S422T	S	-	1	0	IPO4	23724519	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.283000	0.65621	2.288000	0.76882	0.533000	0.62120	TCA	.		0.562	IPO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071931.4	NM_024658	
NIN	51199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	51223359	51223359	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr14:51223359C>G	ENST00000382041.3	-	18	4579	c.4389G>C	c.(4387-4389)gaG>gaC	p.E1463D	NIN_ENST00000245441.5_Missense_Mutation_p.E1463D|NIN_ENST00000453196.1_Missense_Mutation_p.E1463D|NIN_ENST00000382043.4_Intron|NIN_ENST00000389868.3_Intron|NIN_ENST00000530997.2_Missense_Mutation_p.E1463D|NIN_ENST00000324330.9_Missense_Mutation_p.E1463D	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1463					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					tcctagtcagctcctgtaact	0.418			T	PDGFRB	MPD																																p.E1463D		.		Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	.	NIN-229	0			c.G4389C						.						113.0	88.0	96.0					14																	51223359		2194	4286	6480	SO:0001583	missense	51199	exon18			AGTCAGCTCCTGT	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4389G>C	14.37:g.51223359C>G	ENSP00000371472:p.Glu1463Asp	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	81	27	NM_020921	0	0	4	5	1	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	ENST00000382041.3	37	CCDS32079.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.37|16.37	3.103971|3.103971	0.56291|0.56291	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000530997;ENST00000389869;ENST00000530853|ENST00000245441;ENST00000311149;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196	.|T;T;T;T	.|0.10192	.|3.17;2.91;2.9;2.91	5.59|5.59	4.7|4.7	0.59300|0.59300	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.20170|0.20170	0.0485|0.0485	M|M	0.62723|0.62723	1.935|1.935	0.31457|0.31457	N|N	0.670061|0.670061	.|P;D;P;P	.|0.59767	.|0.873;0.986;0.852;0.8	.|B;P;B;B	.|0.53224	.|0.291;0.721;0.275;0.416	T|T	0.11842|0.11842	-1.0571|-1.0571	5|10	.|0.48119	.|T	.|0.1	-1.0688|-1.0688	10.3959|10.3959	0.44201|0.44201	0.0:0.9099:0.0:0.0901|0.0:0.9099:0.0:0.0901	.|.	.|1469;1463;1463;1463	.|Q8N4C6-5;C9J066;Q8N4C6;Q8N4C6-7	.|.;.;NIN_HUMAN;.	P|D	954|1463;1446;1469;1463;1463;1463	.|ENSP00000245441:E1463D;ENSP00000371472:E1463D;ENSP00000324210:E1463D;ENSP00000412391:E1463D	.|ENSP00000245441:E1463D	A|E	-|-	1|3	0|2	NIN|NIN	50293109|50293109	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	0.415000|0.415000	0.21181|0.21181	1.366000|1.366000	0.46076|0.46076	0.655000|0.655000	0.94253|0.94253	GCT|GAG	.		0.418	NIN-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395207.2	NM_182946	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493794	77493794	+	Silent	SNP	T	T	C	rs377151545|rs28718623|rs71125518	byFrequency	TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr14:77493794T>C	ENST00000238647.3	-	1	1240	c.342A>G	c.(340-342)caA>caG	p.Q114Q		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	114	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgttgctgctgct	0.697													T|||	1146	0.228834	0.1649	0.1758	5008	,	,		5976	0.2659		0.2614	False		,,,				2504	0.2812				p.Q114Q		.											.	IRF2BPL-90	0			c.A342G						.	-		160,2330		6,148,1091	2.0	2.0	2.0		342	0.6	0.0	14	dbSNP_125	2	324,4012		7,310,1851	no	coding-synonymous	IRF2BPL	NM_024496.2		13,458,2942	CC,CT,TT		7.4723,6.4257,7.0905		114/797	77493794	484,6342	1245	2168	3413	SO:0001819	synonymous_variant	64207	exon1			CTGCTGTTGCTGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.342A>G	14.37:g.77493794T>C		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	5	5	NM_024496	1	1	18	4841	4821	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			.		0.697	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
CHGA	1113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	93397675	93397675	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr14:93397675A>G	ENST00000216492.5	+	6	716	c.436A>G	c.(436-438)Aca>Gca	p.T146A	CHGA_ENST00000553866.1_3'UTR|CHGA_ENST00000334654.4_Intron	NM_001275.3	NP_001266.1	P10645	CMGA_HUMAN	chromogranin A (parathyroid secretory protein 1)	146					regulation of blood pressure (GO:0008217)	extracellular region (GO:0005576)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)				cervix(1)|large_intestine(1)|lung(3)|skin(3)	8		all_cancers(154;0.0843)		Epithelial(152;0.102)|COAD - Colon adenocarcinoma(157;0.208)|all cancers(159;0.224)		TGGTGAAGCCACAGACGGAGC	0.597																																					p.T146A	Colon(31;154 822 45066 49155)|NSCLC(28;804 1157 13734 25204)	.											.	CHGA-516	0			c.A436G						.						33.0	40.0	37.0					14																	93397675		2203	4300	6503	SO:0001583	missense	1113	exon6			GAAGCCACAGACG		CCDS9906.1	14q32	2012-10-02			ENSG00000100604	ENSG00000100604			1929	protein-coding gene	gene with protein product	"""vasostatin"", ""pancreastatin"", ""parastatin"""	118910				3403545	Standard	NM_001275		Approved		uc001ybc.4	P10645		ENST00000216492.5:c.436A>G	14.37:g.93397675A>G	ENSP00000216492:p.Thr146Ala	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	118	43	NM_001275	0	0	0	0	0	B2R9E9|Q53FA8|Q6NR84|Q96E84|Q96GL7|Q9BQB5	Missense_Mutation	SNP	ENST00000216492.5	37	CCDS9906.1	.	.	.	.	.	.	.	.	.	.	A	5.459	0.269804	0.10349	.	.	ENSG00000100604	ENST00000216492	T	0.01647	4.71	4.7	-9.4	0.00616	.	2.536240	0.01191	N	0.007328	T	0.01061	0.0035	N	0.16656	0.425	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45862	-0.9232	10	0.11182	T	0.66	6.9295	4.398	0.11372	0.216:0.2247:0.4493:0.11	.	146	P10645	CMGA_HUMAN	A	146	ENSP00000216492:T146A	ENSP00000216492:T146A	T	+	1	0	CHGA	92467428	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.711000	0.05019	-2.936000	0.00299	-0.441000	0.05720	ACA	.		0.597	CHGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412411.1	NM_001275	
GCNT3	9245	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	59911000	59911000	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr15:59911000T>C	ENST00000396065.1	+	3	1011	c.563T>C	c.(562-564)aTa>aCa	p.I188T	GCNT3_ENST00000560585.1_Missense_Mutation_p.I188T	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	188					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AATGTCTTCATAGCCAGTAAG	0.498																																					p.I188T		.											.	GCNT3-91	0			c.T563C						.						117.0	110.0	112.0					15																	59911000		2190	4290	6480	SO:0001583	missense	9245	exon3			TCTTCATAGCCAG	AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.563T>C	15.37:g.59911000T>C	ENSP00000379377:p.Ile188Thr	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	72	31	NM_004751	0	0	1	1	0		Missense_Mutation	SNP	ENST00000396065.1	37	CCDS10172.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311833	0.60414	.	.	ENSG00000140297	ENST00000396065	T	0.11712	2.75	6.13	6.13	0.99165	.	0.536118	0.20374	N	0.093586	T	0.20210	0.0486	M	0.80183	2.485	0.45035	D	0.998058	P	0.36354	0.549	B	0.35182	0.197	T	0.01249	-1.1406	10	0.87932	D	0	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	188	O95395	GCNT3_HUMAN	T	188	ENSP00000379377:I188T	ENSP00000379377:I188T	I	+	2	0	GCNT3	57698292	1.000000	0.71417	0.948000	0.38648	0.868000	0.49771	7.955000	0.87856	2.367000	0.80283	0.529000	0.55759	ATA	.		0.498	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256068.1	NM_004751	
UACA	55075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	70991969	70991969	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr15:70991969G>A	ENST00000322954.6	-	2	294	c.109C>T	c.(109-111)Cga>Tga	p.R37*	UACA_ENST00000379983.2_Nonsense_Mutation_p.R24*|UACA_ENST00000560441.1_Nonsense_Mutation_p.R24*|UACA_ENST00000539319.1_Nonsense_Mutation_p.R37*	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	37					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						TTCATCAATCGGTCATCATAT	0.363																																					p.R37X		.											.	UACA-94	0			c.C109T						.						145.0	125.0	132.0					15																	70991969		2199	4297	6496	SO:0001587	stop_gained	55075	exon2			TCAATCGGTCATC	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.109C>T	15.37:g.70991969G>A	ENSP00000314556:p.Arg37*	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	58	20	NM_018003	0	0	0	0	0	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Nonsense_Mutation	SNP	ENST00000322954.6	37	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	G	37	6.366924	0.97511	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000395362;ENST00000539319	.	.	.	5.28	3.23	0.37069	.	0.000000	0.48286	D	0.000192	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.7105	14.3737	0.66860	0.0:0.0:0.6557:0.3443	.	.	.	.	X	37;24;24;37	.	ENSP00000314556:R37X	R	-	1	2	UACA	68779023	1.000000	0.71417	0.999000	0.59377	0.956000	0.61745	4.021000	0.57196	1.312000	0.45043	0.491000	0.48974	CGA	.		0.363	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
ST8SIA2	8128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	92973323	92973323	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr15:92973323T>C	ENST00000268164.3	+	2	380	c.143T>C	c.(142-144)tTa>tCa	p.L48S	ST8SIA2_ENST00000539113.1_Intron	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	48					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			GTGAACAGCTTACATAGCAAA	0.393																																					p.L48S		.											.	ST8SIA2-90	0			c.T143C						.						143.0	133.0	136.0					15																	92973323		2198	4298	6496	SO:0001583	missense	8128	exon2			ACAGCTTACATAG	U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.143T>C	15.37:g.92973323T>C	ENSP00000268164:p.Leu48Ser	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	82	30	NM_006011	0	0	0	0	0	Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	ENST00000268164.3	37	CCDS10372.1	.	.	.	.	.	.	.	.	.	.	T	10.03	1.239532	0.22711	.	.	ENSG00000140557	ENST00000268164;ENST00000555434	T;T	0.27720	1.95;1.65	5.55	5.55	0.83447	.	0.179000	0.35436	N	0.003205	T	0.23054	0.0557	L	0.27053	0.805	0.80722	D	1	B	0.12630	0.006	B	0.09377	0.004	T	0.05053	-1.0909	10	0.20046	T	0.44	0.2846	15.71	0.77620	0.0:0.0:0.0:1.0	.	48	Q92186	SIA8B_HUMAN	S	48	ENSP00000268164:L48S;ENSP00000450851:L48S	ENSP00000268164:L48S	L	+	2	0	ST8SIA2	90774327	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.306000	0.65756	2.105000	0.64084	0.533000	0.62120	TTA	.		0.393	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313526.1	NM_006011	
ASB7	140460	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	101152488	101152488	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr15:101152488G>A	ENST00000332783.7	+	4	852	c.67G>A	c.(67-69)Gct>Act	p.A23T	ASB7_ENST00000343276.4_Missense_Mutation_p.A23T|ASB7_ENST00000558747.1_Missense_Mutation_p.A23T	NM_198243.2	NP_937886.1	Q9H672	ASB7_HUMAN	ankyrin repeat and SOCS box containing 7	23					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)	16	Lung NSC(78;0.00121)|all_lung(78;0.00152)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.00168)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)			GGCCGCGGTGGCTGCTGGGGA	0.512																																					p.A23T													.	ASB7-227	0			c.G67A						.						106.0	95.0	99.0					15																	101152488		2203	4300	6503	SO:0001583	missense	140460	exon4			GCGGTGGCTGCTG		CCDS10387.1, CCDS10388.1	15q26.3	2013-01-10	2011-01-25		ENSG00000183475	ENSG00000183475		"""Ankyrin repeat domain containing"""	17182	protein-coding gene	gene with protein product		615052	"""ankyrin repeat and SOCS box-containing 7"""				Standard	NM_024708		Approved		uc002bwk.3	Q9H672	OTTHUMG00000149868	ENST00000332783.7:c.67G>A	15.37:g.101152488G>A	ENSP00000328327:p.Ala23Thr	Somatic	157	1		WXS	Illumina HiSeq	Phase_I	153	58	NM_024708	0	0	1	1	0	A8K1E5|Q6GSJ6|Q7Z4S3	Missense_Mutation	SNP	ENST00000332783.7	37	CCDS10387.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.969229	0.74246	.	.	ENSG00000183475	ENST00000332783;ENST00000343276	T;T	0.65364	-0.15;-0.11	5.9	5.9	0.94986	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.76828	0.4042	L	0.56280	1.765	0.80722	D	1	D;P	0.62365	0.991;0.867	D;B	0.77004	0.989;0.445	T	0.72679	-0.4220	10	0.38643	T	0.18	-7.1712	20.2822	0.98520	0.0:0.0:1.0:0.0	.	23;23	Q9H672;Q9H672-2	ASB7_HUMAN;.	T	23	ENSP00000328327:A23T;ENSP00000339819:A23T	ENSP00000328327:A23T	A	+	1	0	ASB7	98970011	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.296000	0.96104	2.806000	0.96561	0.655000	0.94253	GCT	.		0.512	ASB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313617.1	NM_024708	
PCSK6	5046	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	101865152	101865152	+	Silent	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr15:101865152A>G	ENST00000348070.1	-	18	2276	c.2277T>C	c.(2275-2277)gcT>gcC	p.A759A	PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000358417.3_Silent_p.A746A	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	760	CRM (Cys-rich motif).				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACTGCGTCGCAGCTCTGCTGG	0.587																																					.													.	PCSK6-46	0			.						.						45.0	50.0	48.0					15																	101865152		2042	4184	6226	SO:0001819	synonymous_variant	5046	.			CGTCGCAGCTCTG		CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.2277T>C	15.37:g.101865152A>G		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	54	12	.	0	0	0	0	0	Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Silent	SNP	ENST00000348070.1	37																																																																																				.		0.587	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_002570	
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30733555	30733555	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr16:30733555G>C	ENST00000262518.4	+	22	4039	c.3654G>C	c.(3652-3654)ttG>ttC	p.L1218F	SRCAP_ENST00000395059.2_Missense_Mutation_p.L1218F|SRCAP_ENST00000344771.4_Missense_Mutation_p.L1122F	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1218	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AGCTGACTTTGACTGGTGCCC	0.587																																					p.L1218F		.											.	SRCAP-94	0			c.G3654C						.						113.0	96.0	102.0					16																	30733555		2197	4300	6497	SO:0001583	missense	10847	exon22			GACTTTGACTGGT	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3654G>C	16.37:g.30733555G>C	ENSP00000262518:p.Leu1218Phe	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	267	72	NM_006662	0	0	8	8	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673750	0.47781	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.96913	-4.07;-4.17;-3.98	4.68	4.68	0.58851	.	0.000000	0.40064	N	0.001186	D	0.96522	0.8865	L	0.29908	0.895	0.27411	N	0.954569	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.997	D	0.92402	0.5930	10	0.72032	D	0.01	-5.1815	16.5291	0.84353	0.0:0.0:1.0:0.0	.	1122;1218;1218	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	F	1218;1218;1122	ENSP00000262518:L1218F;ENSP00000378499:L1218F;ENSP00000343042:L1122F	ENSP00000262518:L1218F	L	+	3	2	SRCAP	30641056	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	2.423000	0.44705	2.414000	0.81942	0.462000	0.41574	TTG	.		0.587	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	31371302	31371302	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr16:31371302G>A	ENST00000268296.4	+	7	744	c.623G>A	c.(622-624)cGc>cAc	p.R208H	ITGAX_ENST00000562522.1_Missense_Mutation_p.R208H	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	208	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						GAATTCAGGCGCAGCTCAAAC	0.517																																					p.R208H		.											.	ITGAX-229	0			c.G623A						.						101.0	103.0	102.0					16																	31371302		2197	4300	6497	SO:0001583	missense	3687	exon7			TCAGGCGCAGCTC	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.623G>A	16.37:g.31371302G>A	ENSP00000268296:p.Arg208His	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	71	43	NM_000887	0	0	1	1	0	Q8IVA6	Missense_Mutation	SNP	ENST00000268296.4	37	CCDS10711.1	.	.	.	.	.	.	.	.	.	.	G	11.36	1.616950	0.28801	.	.	ENSG00000140678	ENST00000268296	T	0.78246	-1.16	4.88	-5.48	0.02592	von Willebrand factor, type A (3);	.	.	.	.	T	0.64800	0.2631	L	0.41492	1.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.54002	-0.8358	9	0.56958	D	0.05	.	8.8842	0.35394	0.176:0.46:0.364:0.0	.	208	P20702	ITAX_HUMAN	H	208	ENSP00000268296:R208H	ENSP00000268296:R208H	R	+	2	0	ITGAX	31278803	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.940000	0.01543	-0.882000	0.03987	-0.670000	0.03821	CGC	.		0.517	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
ZNF319	57567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	58031774	58031774	+	Silent	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr16:58031774G>A	ENST00000299237.2	-	2	1018	c.396C>T	c.(394-396)ttC>ttT	p.F132F	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	132					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						CCCCACAGACGAAGGGCTTCT	0.572																																					p.F132F		.											.	ZNF319-90	0			c.C396T						.						59.0	57.0	57.0					16																	58031774		2198	4300	6498	SO:0001819	synonymous_variant	57567	exon2			ACAGACGAAGGGC	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.396C>T	16.37:g.58031774G>A		Somatic	69	0		WXS	Illumina HiSeq	Phase_I	98	46	NM_020807	0	0	0	0	0	Q52LH8	Silent	SNP	ENST00000299237.2	37	CCDS32462.1																																																																																			.		0.572	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
AP1G1	164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	71772895	71772895	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr16:71772895T>A	ENST00000299980.4	-	21	2659	c.2218A>T	c.(2218-2220)Agc>Tgc	p.S740C	AP1G1_ENST00000564155.1_Missense_Mutation_p.S165C|AP1G1_ENST00000433195.2_Missense_Mutation_p.S763C|AP1G1_ENST00000423132.2_Missense_Mutation_p.S743C|AP1G1_ENST00000569748.1_Missense_Mutation_p.S740C|AP1G1_ENST00000393512.3_Missense_Mutation_p.S743C	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	740	GAE. {ECO:0000255|PROSITE- ProRule:PRU00093}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				AGCTCTGTGCTGTTGGAGGCC	0.418																																					p.S743C		.											.	AP1G1-92	0			c.A2227T						.						208.0	183.0	191.0					16																	71772895		2198	4300	6498	SO:0001583	missense	164	exon22			CTGTGCTGTTGGA	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.2218A>T	16.37:g.71772895T>A	ENSP00000299980:p.Ser740Cys	Somatic	252	0		WXS	Illumina HiSeq	Phase_I	348	94	NM_001030007	0	0	9	13	4	O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	ENST00000299980.4	37	CCDS32480.1	.	.	.	.	.	.	.	.	.	.	T	13.67	2.307011	0.40795	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.29	5.29	0.74685	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, gamma-adaptin, appendage (2);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);	0.135369	0.64402	D	0.000002	T	0.38878	0.1057	L	0.52905	1.665	0.49687	D	0.999819	B;B;B	0.12013	0.005;0.002;0.002	B;B;B	0.19666	0.026;0.017;0.023	T	0.26608	-1.0098	10	0.48119	T	0.1	-8.7323	10.4684	0.44622	0.1451:0.0:0.0:0.8549	.	740;763;743	O43747;B3KXW5;O43747-2	AP1G1_HUMAN;.;.	C	740;743;743;763	ENSP00000299980:S740C;ENSP00000377148:S743C;ENSP00000409153:S743C;ENSP00000403259:S763C	ENSP00000299980:S740C	S	-	1	0	AP1G1	70330396	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	3.020000	0.49643	1.996000	0.58369	0.528000	0.53228	AGC	.		0.418	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
ACACA	31	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	35615281	35615281	+	Silent	SNP	A	A	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr17:35615281A>T	ENST00000394406.2	-	13	1594	c.1404T>A	c.(1402-1404)atT>atA	p.I468I	ACACA_ENST00000353139.5_Silent_p.I505I|ACACA_ENST00000335166.5_Silent_p.I390I|ACACA_ENST00000360679.3_Silent_p.I410I	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	468	Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TATATAGAGGAATCCCCATGG	0.368																																					p.I505I	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	.											.	ACACA-154	0			c.T1515A						.						67.0	66.0	66.0					17																	35615281		2203	4300	6503	SO:0001819	synonymous_variant	31	exon13			TAGAGGAATCCCC	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.1404T>A	17.37:g.35615281A>T		Somatic	104	0		WXS	Illumina HiSeq	Phase_I	108	61	NM_198834	0	0	0	1	1	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Silent	SNP	ENST00000394406.2	37	CCDS11317.1																																																																																			.		0.368	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
KRT23	25984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39092459	39092459	+	Splice_Site	SNP	C	C	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr17:39092459C>G	ENST00000209718.3	-	2	821		c.e2+1		KRT23_ENST00000582283.1_5'Flank|AC004231.2_ENST00000418393.1_RNA|KRT23_ENST00000436344.3_Intron	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)							intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				CAGCATCTTACCTGCTCCTGC	0.517																																					.		.											.	KRT23-91	0			c.396+1G>C						.						55.0	57.0	56.0					17																	39092459		2203	4300	6503	SO:0001630	splice_region_variant	25984	exon3			ATCTTACCTGCTC	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.396+1G>C	17.37:g.39092459C>G		Somatic	45	0		WXS	Illumina HiSeq	Phase_I	63	32	NM_015515	0	0	0	0	0	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Splice_Site	SNP	ENST00000209718.3	37	CCDS11380.1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205300	0.39003	.	.	ENSG00000108244	ENST00000209718	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8915	0.96931	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT23	36345985	1.000000	0.71417	1.000000	0.80357	0.197000	0.23852	7.797000	0.85911	2.707000	0.92482	0.557000	0.71058	.	.		0.517	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257223.1		Intron
PSMD12	5718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	65362549	65362549	+	Silent	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr17:65362549G>C	ENST00000356126.3	-	1	194	c.87C>G	c.(85-87)ccC>ccG	p.P29P	PSMD12_ENST00000581618.1_5'UTR|PSMD12_ENST00000357146.4_Silent_p.P29P	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	29					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					TCGCACACTCGGGTAGGCGCT	0.706																																					p.P29P		.											.	PSMD12-90	0			c.C87G						.						40.0	31.0	34.0					17																	65362549		2203	4299	6502	SO:0001819	synonymous_variant	5718	exon1			ACACTCGGGTAGG	AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.87C>G	17.37:g.65362549G>C		Somatic	31	0		WXS	Illumina HiSeq	Phase_I	34	14	NM_174871	0	0	0	0	0	A6NP15|Q53HA2|Q6P053	Silent	SNP	ENST00000356126.3	37	CCDS11669.1																																																																																			.		0.706	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277103.1	NM_002816, NM_174871	
TRIM47	91107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73872839	73872839	+	Missense_Mutation	SNP	G	G	A	rs377764139		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr17:73872839G>A	ENST00000254816.2	-	2	757	c.731C>T	c.(730-732)gCt>gTt	p.A244V	TRIM47_ENST00000587339.1_Missense_Mutation_p.A6V|RP11-552F3.9_ENST00000586076.1_RNA	NM_033452.2	NP_258411.2	Q96LD4	TRI47_HUMAN	tripartite motif containing 47	244						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22			Epithelial(20;4.23e-06)|all cancers(21;5.24e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGCAATGCCAGCACCCAGCTC	0.587																																					p.A244V		.											.	TRIM47-659	0			c.C731T						.						170.0	119.0	136.0					17																	73872839		2203	4300	6503	SO:0001583	missense	91107	exon2			ATGCCAGCACCCA	AY026763	CCDS32737.1	17q25	2013-01-09	2011-01-25			ENSG00000132481		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19020	protein-coding gene	gene with protein product		611041	"""tripartite motif-containing 47"""				Standard	NM_033452		Approved	GOA, RNF100	uc002jpw.3	Q96LD4		ENST00000254816.2:c.731C>T	17.37:g.73872839G>A	ENSP00000254816:p.Ala244Val	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	167	106	NM_033452	0	0	5	18	13	Q96AD0|Q96GU5|Q9BRN7	Missense_Mutation	SNP	ENST00000254816.2	37	CCDS32737.1	.	.	.	.	.	.	.	.	.	.	G	14.00	2.404309	0.42613	.	.	ENSG00000132481	ENST00000254816	T	0.45276	0.9	4.91	4.91	0.64330	.	0.105328	0.42682	D	0.000664	T	0.27524	0.0676	N	0.24115	0.695	0.37335	D	0.910149	B	0.02656	0.0	B	0.06405	0.002	T	0.14783	-1.0460	10	0.39692	T	0.17	.	9.121	0.36786	0.097:0.0:0.903:0.0	.	244	Q96LD4	TRI47_HUMAN	V	244	ENSP00000254816:A244V	ENSP00000254816:A244V	A	-	2	0	TRIM47	71384434	0.747000	0.28283	0.927000	0.36925	0.785000	0.44390	3.752000	0.55172	2.560000	0.86352	0.511000	0.50034	GCT	.		0.587	TRIM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448934.1		
OSBPL1A	114876	ucsc.edu;bcgsc.ca	37	18	21914248	21914248	+	Silent	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr18:21914248T>C	ENST00000319481.3	-	6	647	c.441A>G	c.(439-441)gcA>gcG	p.A147A		NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	147	Interaction with RAB7A.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CTCTTGCTGCTGCTAAAAGTA	0.363																																					p.A147A													.	OSBPL1A-94	0			c.A441G						.						138.0	125.0	129.0					18																	21914248		2203	4297	6500	SO:0001819	synonymous_variant	114876	exon6			TGCTGCTGCTAAA	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.441A>G	18.37:g.21914248T>C		Somatic	44	1		WXS	Illumina HiSeq		19	6	NM_080597	0	0	0	0	0	B7Z7D3|Q9BZF5|Q9NW87	Silent	SNP	ENST00000319481.3	37	CCDS11884.1																																																																																			.		0.363	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
B4GALT6	9331	bcgsc.ca	37	18	29218694	29218694	+	Silent	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr18:29218694G>A	ENST00000306851.5	-	5	797	c.501C>T	c.(499-501)cgC>cgT	p.R167R	B4GALT6_ENST00000237019.7_Silent_p.R128R|B4GALT6_ENST00000383131.3_Intron	NM_004775.3	NP_004766.2	Q9UBX8	B4GT6_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6	167	UDP-alpha-D-galactose binding. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(6)|pancreas(1)	20			OV - Ovarian serous cystadenocarcinoma(10;0.00791)			GATGTTCATGGCGATTACGGA	0.353																																					p.R167R													.	B4GALT6-90	0			c.C501T						.						85.0	84.0	84.0					18																	29218694		2203	4300	6503	SO:0001819	synonymous_variant	9331	exon5			TTCATGGCGATTA	AF038664	CCDS11900.1	18q11	2013-02-19			ENSG00000118276	ENSG00000118276		"""Beta 4-glycosyltransferases"""	929	protein-coding gene	gene with protein product	"""UDP-Gal:glucosylceramide beta-1,4-galactosyltransferase"""	604017				9597550, 12180132	Standard	NM_004775		Approved	beta4GalT-VI	uc002kwz.4	Q9UBX8	OTTHUMG00000131980	ENST00000306851.5:c.501C>T	18.37:g.29218694G>A		Somatic	53	0		WXS	Illumina HiSeq	Phase_1	69	4	NM_004775	0	0	0	0	0	O60514|Q6NT09	Silent	SNP	ENST00000306851.5	37	CCDS11900.1																																																																																			.		0.353	B4GALT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254942.2	NM_004775	
PLIN4	729359	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	4511773	4511773	+	Silent	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:4511773G>A	ENST00000301286.3	-	3	2156	c.2157C>T	c.(2155-2157)gtC>gtT	p.V719V		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	719	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						CCCCACTGCAGACGGTGTCCT	0.572																																					p.V719V		.											.	PLIN4-68	0			c.C2157T						.						210.0	212.0	211.0					19																	4511773		2098	4206	6304	SO:0001819	synonymous_variant	729359	exon3			ACTGCAGACGGTG	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2157C>T	19.37:g.4511773G>A		Somatic	293	0		WXS	Illumina HiSeq	Phase_I	234	37	NM_001080400	0	0	0	0	0	A6NEI2	Silent	SNP	ENST00000301286.3	37	CCDS45927.1																																																																																			.		0.572	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
PLIN3	10226	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	4839279	4839279	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:4839279C>G	ENST00000221957.4	-	8	1406	c.1230G>C	c.(1228-1230)caG>caC	p.Q410H	PLIN3_ENST00000585479.1_Missense_Mutation_p.Q409H|PLIN3_ENST00000592528.1_Missense_Mutation_p.Q398H|CTC-518P12.6_ENST00000591657.1_RNA	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	410					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	CAGGTGTGTTCTGGGCCACAT	0.632																																					p.Q410H		.											.	PLIN3-90	0			c.G1230C						.						66.0	70.0	69.0					19																	4839279		2203	4300	6503	SO:0001583	missense	10226	exon8			TGTGTTCTGGGCC	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.1230G>C	19.37:g.4839279C>G	ENSP00000221957:p.Gln410His	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	80	7	NM_005817	0	0	9	9	0	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	C	7.106	0.575129	0.13623	.	.	ENSG00000105355	ENST00000221957	T	0.18960	2.18	4.97	2.65	0.31530	.	0.938934	0.08920	N	0.874576	T	0.19287	0.0463	L	0.28192	0.835	0.34333	D	0.68787	B;B;B	0.23249	0.027;0.082;0.033	B;B;B	0.25140	0.022;0.058;0.038	T	0.21690	-1.0238	10	0.37606	T	0.19	-13.9129	16.1339	0.81465	0.0:0.4858:0.5141:0.0	.	409;227;410	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	H	410	ENSP00000221957:Q410H	ENSP00000221957:Q410H	Q	-	3	2	PLIN3	4790279	1.000000	0.71417	0.992000	0.48379	0.108000	0.19459	0.655000	0.24933	1.042000	0.40150	0.561000	0.74099	CAG	.		0.632	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817	
PLIN3	10226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	4839466	4839466	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:4839466A>C	ENST00000221957.4	-	8	1219	c.1043T>G	c.(1042-1044)aTt>aGt	p.I348S	PLIN3_ENST00000585479.1_Missense_Mutation_p.I347S|PLIN3_ENST00000592528.1_Missense_Mutation_p.I336S|CTC-518P12.6_ENST00000591657.1_RNA	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	348					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	GAGGCCCTGAATGCTGGACCC	0.647																																					p.I348S		.											.	PLIN3-90	0			c.T1043G						.						37.0	31.0	33.0					19																	4839466		2203	4300	6503	SO:0001583	missense	10226	exon8			CCCTGAATGCTGG	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.1043T>G	19.37:g.4839466A>C	ENSP00000221957:p.Ile348Ser	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	89	27	NM_005817	0	0	10	18	8	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	A	14.10	2.433232	0.43224	.	.	ENSG00000105355	ENST00000221957	T	0.20332	2.08	4.85	4.85	0.62838	.	422.645000	0.01670	U	0.025543	T	0.50120	0.1597	M	0.78637	2.42	0.27909	N	0.93868	D;P;D	0.56746	0.971;0.937;0.977	P;P;D	0.64506	0.879;0.698;0.926	T	0.06881	-1.0802	10	0.87932	D	0	-13.3555	9.052	0.36383	0.9163:0.0:0.0837:0.0	.	347;165;348	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	S	348	ENSP00000221957:I348S	ENSP00000221957:I348S	I	-	2	0	PLIN3	4790466	0.801000	0.28930	0.975000	0.42487	0.034000	0.12701	3.474000	0.53129	1.817000	0.53016	0.454000	0.30748	ATT	.		0.647	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817	
DCAF15	90379	hgsc.bcm.edu;broad.mit.edu	37	19	14070072	14070072	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:14070072G>A	ENST00000254337.6	+	7	1021	c.1000G>A	c.(1000-1002)Gcc>Acc	p.A334T		NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	334					protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						GGCCAAAGAGGCCAAGGGCGG	0.682																																					p.A334T		.											.	DCAF15-90	0			c.G1000A						.						27.0	35.0	32.0					19																	14070072		2203	4300	6503	SO:0001583	missense	90379	exon7			AAAGAGGCCAAGG	BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.1000G>A	19.37:g.14070072G>A	ENSP00000254337:p.Ala334Thr	Somatic	14	0		WXS	Illumina HiSeq	Phase_I	12	6	NM_138353	0	0	5	9	4	B3KS86|Q96DW0|Q9BU31	Missense_Mutation	SNP	ENST00000254337.6	37	CCDS32926.1	.	.	.	.	.	.	.	.	.	.	g	32	5.112699	0.94339	.	.	ENSG00000132017	ENST00000254337	.	.	.	4.46	4.46	0.54185	.	0.085620	0.44097	D	0.000488	T	0.60470	0.2271	L	0.29908	0.895	0.41151	D	0.986027	D	0.54207	0.965	P	0.55871	0.786	T	0.65998	-0.6032	9	0.62326	D	0.03	-24.0048	15.8605	0.79017	0.0:0.0:1.0:0.0	.	334	Q66K64	DCA15_HUMAN	T	334	.	ENSP00000254337:A334T	A	+	1	0	DCAF15	13931072	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.504000	0.66968	2.043000	0.60533	0.491000	0.48974	GCC	.		0.682	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353	
NAPA	8775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47996229	47996229	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:47996229T>C	ENST00000263354.3	-	7	849	c.550A>G	c.(550-552)Atc>Gtc	p.I184V	NAPA_ENST00000595227.1_Missense_Mutation_p.I145V|NAPA-AS1_ENST00000593284.1_RNA|NAPA-AS1_ENST00000594367.1_RNA|NAPA_ENST00000593785.1_5'Flank	NM_003827.3	NP_003818.2	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, alpha	184					apical protein localization (GO:0045176)|brain development (GO:0007420)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron differentiation (GO:0030182)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)	11		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		TGTTCGTAGATGTCAATGGCC	0.607																																					p.I184V	Ovarian(185;1135 2042 27703 31345 42493)	.											.	NAPA-90	0			c.A550G						.						113.0	101.0	105.0					19																	47996229		2203	4300	6503	SO:0001583	missense	8775	exon7			CGTAGATGTCAAT	U39412	CCDS12702.1	19q13.33	2012-08-16			ENSG00000105402	ENSG00000105402			7641	protein-coding gene	gene with protein product	"""alpha SNAP"""	603215				9269766	Standard	NM_003827		Approved		uc002pha.2	P54920		ENST00000263354.3:c.550A>G	19.37:g.47996229T>C	ENSP00000263354:p.Ile184Val	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	186	74	NM_003827	0	0	23	31	8	A8K879|Q96IK3|Q9BVJ3	Missense_Mutation	SNP	ENST00000263354.3	37	CCDS12702.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.323538	0.41096	.	.	ENSG00000105402	ENST00000263354	T	0.76448	-1.02	5.16	5.16	0.70880	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.77605	0.4155	M	0.76170	2.325	0.80722	D	1	B	0.16603	0.018	B	0.20577	0.03	T	0.75190	-0.3405	10	0.45353	T	0.12	-33.228	14.1002	0.65049	0.0:0.0:0.0:1.0	.	184	P54920	SNAA_HUMAN	V	184	ENSP00000263354:I184V	ENSP00000263354:I184V	I	-	1	0	NAPA	52688041	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	7.585000	0.82584	2.168000	0.68352	0.496000	0.49642	ATC	.		0.607	NAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466048.2	NM_003827	
BRSK1	84446	broad.mit.edu	37	19	55805597	55805597	+	Silent	SNP	G	G	T	rs374051558		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:55805597G>T	ENST00000309383.1	+	6	868	c.591G>T	c.(589-591)gcG>gcT	p.A197A	BRSK1_ENST00000585418.1_Silent_p.A197A|BRSK1_ENST00000590333.1_Silent_p.A213A	NM_032430.1	NP_115806.1	Q8TDC3	BRSK1_HUMAN	BR serine/threonine kinase 1	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axonogenesis (GO:0007409)|cellular response to DNA damage stimulus (GO:0006974)|centrosome duplication (GO:0051298)|establishment of cell polarity (GO:0030010)|G2 DNA damage checkpoint (GO:0031572)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|protein phosphorylation (GO:0006468)|response to UV (GO:0009411)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)	p.A197A(2)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(15)|ovary(2)|prostate(2)|skin(6)|stomach(1)	48		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0474)		CCCATTATGCGTGTCCAGAGG	0.617																																					p.A197A													.	BRSK1-759	2	Substitution - coding silent(2)	large_intestine(2)	c.G591T						.						82.0	84.0	83.0					19																	55805597		2203	4300	6503	SO:0001819	synonymous_variant	84446	exon6			TTATGCGTGTCCA	AB058714	CCDS12921.1	19q13.4	2008-02-05				ENSG00000160469			18994	protein-coding gene	gene with protein product		609235				14976552	Standard	NM_032430		Approved	KIAA1811	uc002qkg.3	Q8TDC3		ENST00000309383.1:c.591G>T	19.37:g.55805597G>T		Somatic	155	0		WXS	Illumina HiSeq	Phase_I	133	4	NM_032430	0	0	7	7	0	F1DG44|Q5J5B5|Q8NDD0|Q8NDR4|Q8TDC2|Q96AV4|Q96JL4	Silent	SNP	ENST00000309383.1	37	CCDS12921.1																																																																																			.		0.617	BRSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452787.1	NM_032430	
ZNF274	10782	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	58724017	58724017	+	Silent	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:58724017G>C	ENST00000326804.4	+	9	1926	c.1467G>C	c.(1465-1467)cgG>cgC	p.R489R	ZNF274_ENST00000345813.3_Silent_p.R457R|ZNF274_ENST00000424679.2_Silent_p.R384R|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		CCTTCAGTCGGAGTACTAAAC	0.388																																					.													.	ZNF274-91	0			.						.						91.0	91.0	91.0					19																	58724017		1893	4106	5999	SO:0001819	synonymous_variant	10782	.			CAGTCGGAGTACT	AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.1467G>C	19.37:g.58724017G>C		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	41	23	.	0	0	6	11	5	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Silent	SNP	ENST00000326804.4	37																																																																																				.		0.388	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_133502	
MZF1	7593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	59082640	59082640	+	Silent	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:59082640G>A	ENST00000215057.2	-	2	677	c.117C>T	c.(115-117)ggC>ggT	p.G39G	MZF1_ENST00000594108.1_Silent_p.G39G|AC016629.8_ENST00000600534.1_RNA|MZF1_ENST00000599369.1_Silent_p.G39G|AC016629.8_ENST00000593642.1_RNA|AC016629.8_ENST00000600726.1_RNA|MZF1_ENST00000594234.1_Silent_p.G39G	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	39					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		CAGCTTCAGGGCCTGGGTCCC	0.657																																					p.G39G		.											.	MZF1-91	0			c.C117T						.						26.0	29.0	28.0					19																	59082640		2203	4300	6503	SO:0001819	synonymous_variant	7593	exon2			TTCAGGGCCTGGG	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.117C>T	19.37:g.59082640G>A		Somatic	91	0		WXS	Illumina HiSeq	Phase_I	50	16	NM_198055	0	0	2	6	4	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Silent	SNP	ENST00000215057.2	37	CCDS12988.1																																																																																			.		0.657	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
ASXL2	55252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	25972919	25972919	+	Silent	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:25972919C>T	ENST00000435504.4	-	12	1799	c.1506G>A	c.(1504-1506)gaG>gaA	p.E502E	ASXL2_ENST00000272341.4_Silent_p.E242E|ASXL2_ENST00000404843.1_Silent_p.E242E|ASXL2_ENST00000336112.4_Silent_p.E474E			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	502					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATGGTTCTTCTCAGATTCCT	0.443																																					p.E502E		.											.	ASXL2-23	0			c.G1506A						.						148.0	136.0	140.0					2																	25972919		1903	4132	6035	SO:0001819	synonymous_variant	55252	exon11			GTTCTTCTCAGAT			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1506G>A	2.37:g.25972919C>T		Somatic	44	0		WXS	Illumina HiSeq	Phase_I	57	29	NM_018263	0	0	0	0	0	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Silent	SNP	ENST00000435504.4	37																																																																																				.		0.443	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
HADHA	3030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	26427053	26427053	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:26427053A>C	ENST00000380649.3	-	12	1227	c.1098T>G	c.(1096-1098)atT>atG	p.I366M		NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	366					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCACCAAGAATAGCCAGAT	0.468																																					p.I366M		.											.	HADHA-91	0			c.T1098G						.						223.0	216.0	219.0					2																	26427053		2203	4300	6503	SO:0001583	missense	3030	exon12			ACCAAGAATAGCC	D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.1098T>G	2.37:g.26427053A>C	ENSP00000370023:p.Ile366Met	Somatic	125	0		WXS	Illumina HiSeq	Phase_I	131	36	NM_000182	0	0	0	0	0	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000380649.3	37	CCDS1721.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.521115	0.64747	.	.	ENSG00000084754	ENST00000380649	T	0.81163	-1.46	5.0	3.85	0.44370	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.398782	0.28834	N	0.013995	D	0.83454	0.5258	M	0.65677	2.01	0.80722	D	1	P;P	0.40731	0.728;0.728	P;P	0.57057	0.812;0.812	T	0.81743	-0.0793	10	0.66056	D	0.02	-14.6089	1.9477	0.03360	0.5809:0.166:0.0927:0.1603	.	366;366	E9KL44;P40939	.;ECHA_HUMAN	M	366	ENSP00000370023:I366M	ENSP00000370023:I366M	I	-	3	3	HADHA	26280557	0.998000	0.40836	0.972000	0.41901	0.988000	0.76386	0.641000	0.24720	0.867000	0.35654	0.533000	0.62120	ATT	.		0.468	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214051.1	NM_000182	
TET3	200424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74320721	74320721	+	Silent	SNP	G	G	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:74320721G>T	ENST00000409262.3	+	7	2790	c.2790G>T	c.(2788-2790)ggG>ggT	p.G930G		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	930					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTTCGCGGGGGTCACGGCCT	0.597																																					p.G930G		.											.	.	0			c.G2790T						.						71.0	76.0	74.0					2																	74320721		2052	4226	6278	SO:0001819	synonymous_variant	200424	exon7			CGCGGGGGTCACG		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2790G>T	2.37:g.74320721G>T		Somatic	159	0		WXS	Illumina HiSeq	Phase_I	152	46	NM_144993	0	0	2	2	0	A6NEI3|Q86Z24|Q8TBM9	Silent	SNP	ENST00000409262.3	37	CCDS46339.1																																																																																			.		0.597	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328141.4		
MAP4K4	9448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	102493592	102493592	+	Silent	SNP	C	C	G	rs575144210		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:102493592C>G	ENST00000347699.4	+	24	2934	c.2934C>G	c.(2932-2934)gtC>gtG	p.V978V	MAP4K4_ENST00000324219.4_Silent_p.V1059V|MAP4K4_ENST00000350198.4_Silent_p.V897V|MAP4K4_ENST00000302217.5_Silent_p.V781V|MAP4K4_ENST00000413150.2_Silent_p.V893V|MAP4K4_ENST00000456652.1_Silent_p.V777V|MAP4K4_ENST00000350878.4_Silent_p.V1018V|MAP4K4_ENST00000425019.1_Silent_p.V1011V	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	978	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.|Mediates interaction with RAP2A.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GCTTGAATGTCTTGGTGACAA	0.418													C|||	1	0.000199681	0.0	0.0	5008	,	,		22716	0.001		0.0	False		,,,				2504	0.0				p.V1012V		.											.	MAP4K4-547	0			c.C3036G						.						180.0	173.0	175.0					2																	102493592		1970	4164	6134	SO:0001819	synonymous_variant	9448	exon25			GAATGTCTTGGTG	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.2934C>G	2.37:g.102493592C>G		Somatic	311	0		WXS	Illumina HiSeq	Phase_I	420	124	NM_145686	0	0	7	7	0	O75172|Q9NST7	Silent	SNP	ENST00000347699.4	37	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	C	8.328	0.825853	0.16749	.	.	ENSG00000071054	ENST00000421882	.	.	.	5.48	1.44	0.22558	.	.	.	.	.	T	0.53965	0.1829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43972	-0.9358	4	.	.	.	.	6.5872	0.22626	0.1267:0.6675:0.0:0.2057	.	.	.	.	V	795	.	.	L	+	1	0	MAP4K4	101860024	1.000000	0.71417	0.986000	0.45419	0.981000	0.71138	1.591000	0.36665	0.368000	0.24481	-0.136000	0.14681	CTT	.		0.418	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	NM_004834	
NPHP1	4867	broad.mit.edu	37	2	110936067	110936067	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:110936067G>A	ENST00000393272.3	-	4	359	c.262C>T	c.(262-264)Ctt>Ttt	p.L88F	NPHP1_ENST00000316534.4_Missense_Mutation_p.L88F|NPHP1_ENST00000418527.1_Missense_Mutation_p.L88F|NPHP1_ENST00000445609.2_Missense_Mutation_p.L88F|NPHP1_ENST00000355301.4_Intron|NPHP1_ENST00000417665.1_Missense_Mutation_p.L88F	NM_000272.3|NM_207181.2	NP_000263.2|NP_997064.2	O15259	NPHP1_HUMAN	nephronophthisis 1 (juvenile)	88					actin cytoskeleton organization (GO:0030036)|cell projection organization (GO:0030030)|cellular protein localization (GO:0034613)|excretion (GO:0007588)|photoreceptor cell outer segment organization (GO:0035845)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|spermatid differentiation (GO:0048515)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(2)	24						TTGTCCAAAAGAGTATGCTCC	0.358																																					p.L88F													.	NPHP1-92	0			c.C262T						.						165.0	149.0	154.0					2																	110936067		2203	4300	6503	SO:0001583	missense	4867	exon4			CCAAAAGAGTATG	AF023674	CCDS2086.1, CCDS46384.1, CCDS46385.1, CCDS46386.1	2q13	2014-01-28			ENSG00000144061	ENSG00000144061			7905	protein-coding gene	gene with protein product	"""nephrocystin-1"""	607100		NPH1			Standard	NM_000272		Approved	JBTS4, SLSN1	uc002tfm.4	O15259	OTTHUMG00000131195	ENST00000393272.3:c.262C>T	2.37:g.110936067G>A	ENSP00000376953:p.Leu88Phe	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	79	4	NM_207181	0	0	5	5	0	O14837	Missense_Mutation	SNP	ENST00000393272.3	37	CCDS46385.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916016	0.52546	.	.	ENSG00000144061	ENST00000316534;ENST00000445609;ENST00000393272;ENST00000417665;ENST00000418527	T;T;T;T	0.62639	0.01;0.04;0.01;0.04	5.57	2.59	0.31030	.	0.325851	0.28488	N	0.015164	T	0.69815	0.3153	L	0.56769	1.78	0.19575	N	0.999963	P;P;D;P;P;D	0.71674	0.868;0.947;0.998;0.868;0.919;0.977	B;P;D;B;B;P	0.69142	0.23;0.642;0.962;0.383;0.406;0.847	T	0.57860	-0.7738	10	0.39692	T	0.17	-10.1049	8.3457	0.32272	0.0775:0.0:0.6507:0.2718	.	88;88;88;88;88;88	B4DQY0;C9JNM7;C9J082;O15259;O15259-2;O15259-4	.;.;.;NPHP1_HUMAN;.;.	F	88	ENSP00000313169:L88F;ENSP00000389879:L88F;ENSP00000376953:L88F;ENSP00000402176:L88F	ENSP00000313169:L88F	L	-	1	0	NPHP1	110293356	0.499000	0.26083	0.400000	0.26346	0.901000	0.52897	1.117000	0.31234	0.800000	0.34041	0.655000	0.94253	CTT	.		0.358	NPHP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253919.3	NM_000272	
ZC3H6	376940	broad.mit.edu;bcgsc.ca	37	2	113067649	113067649	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:113067649G>A	ENST00000409871.1	+	4	925	c.524G>A	c.(523-525)aGg>aAg	p.R175K	ZC3H6_ENST00000343936.4_Missense_Mutation_p.R175K	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	175							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						AAACAATACAGGCAAGCTAAA	0.378																																					p.R175K													.	ZC3H6-93	0			c.G524A						.						81.0	75.0	77.0					2																	113067649		1854	4104	5958	SO:0001583	missense	376940	exon4			AATACAGGCAAGC	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.524G>A	2.37:g.113067649G>A	ENSP00000386764:p.Arg175Lys	Somatic	270	1		WXS	Illumina HiSeq	Phase_I	321	31	NM_198581	0	0	0	0	0	A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	37	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	G	19.32	3.805777	0.70682	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.15603	2.41;2.41	5.86	5.86	0.93980	.	0.213150	0.44285	D	0.000480	T	0.39172	0.1068	M	0.62016	1.91	0.37302	D	0.908746	D	0.61697	0.99	P	0.61070	0.883	T	0.10636	-1.0621	10	0.46703	T	0.11	-26.5479	20.1828	0.98210	0.0:0.0:1.0:0.0	.	175	P61129	ZC3H6_HUMAN	K	175;175;152	ENSP00000386764:R175K;ENSP00000340298:R175K	ENSP00000340298:R175K	R	+	2	0	ZC3H6	112784120	1.000000	0.71417	0.998000	0.56505	0.939000	0.58152	4.052000	0.57420	2.767000	0.95098	0.561000	0.74099	AGG	.		0.378	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
CCDC74B	91409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	130899739	130899739	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:130899739T>G	ENST00000310463.6	-	3	648	c.511A>C	c.(511-513)Agc>Cgc	p.S171R	CCDC74B_ENST00000409128.1_Missense_Mutation_p.S147R|CCDC74B_ENST00000409943.3_Missense_Mutation_p.S105R|MED15P9_ENST00000427638.1_RNA|CCDC74B_ENST00000392984.3_Missense_Mutation_p.S273R	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B	171										endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					GACTGGAAGCTTGACGTGGAG	0.647																																					p.S171R		.											.	CCDC74B-90	0			c.A511C						.						98.0	73.0	81.0					2																	130899739		2201	4298	6499	SO:0001583	missense	91409	exon3			GGAAGCTTGACGT		CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.511A>C	2.37:g.130899739T>G	ENSP00000308873:p.Ser171Arg	Somatic	383	1		WXS	Illumina HiSeq	Phase_I	433	205	NM_207310	0	0	0	2	2	Q6NW18	Missense_Mutation	SNP	ENST00000310463.6	37	CCDS2155.1	.	.	.	.	.	.	.	.	.	.	.	13.91	2.377052	0.42105	.	.	ENSG00000152076	ENST00000409943;ENST00000310463;ENST00000392984;ENST00000409488;ENST00000409128	T;T;T;T	0.57273	1.77;1.86;1.79;0.41	2.21	2.21	0.28008	.	0.538074	0.15538	U	0.257135	T	0.62134	0.2403	M	0.69823	2.125	0.09310	N	1	D;D;D	0.71674	0.995;0.998;0.991	P;P;P	0.61070	0.763;0.862;0.883	T	0.48822	-0.9001	10	0.42905	T	0.14	-14.6217	6.277	0.20987	0.0:0.0:0.0:1.0	.	273;105;171	E7ESC5;Q96LY2-2;Q96LY2	.;.;CC74B_HUMAN	R	105;171;273;105;147	ENSP00000386294:S105R;ENSP00000308873:S171R;ENSP00000376710:S273R;ENSP00000386644:S147R	ENSP00000308873:S171R	S	-	1	0	CCDC74B	130616209	0.427000	0.25514	0.007000	0.13788	0.018000	0.09664	2.792000	0.47837	1.010000	0.39314	0.248000	0.18094	AGC	.		0.647	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254522.3	NM_207310	
SF3B1	23451	broad.mit.edu;bcgsc.ca	37	2	198285209	198285209	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:198285209T>G	ENST00000335508.6	-	4	449	c.358A>C	c.(358-360)Aaa>Caa	p.K120Q	SF3B1_ENST00000487698.1_Missense_Mutation_p.K120Q|SF3B1_ENST00000409915.4_Missense_Mutation_p.K120Q|SF3B1_ENST00000414963.2_Missense_Mutation_p.K120Q	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	120					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CTATGCTTTTTGTATTCATCT	0.368			Mis		myelodysplastic syndrome																																p.K120Q				Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.A358C						.						178.0	174.0	175.0					2																	198285209		2203	4300	6503	SO:0001583	missense	23451	exon4			GCTTTTTGTATTC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.358A>C	2.37:g.198285209T>G	ENSP00000335321:p.Lys120Gln	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	242	9	NM_012433	0	0	30	30	0	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.153467	0.38021	.	.	ENSG00000115524	ENST00000335508;ENST00000409915;ENST00000414963;ENST00000487698	.	.	.	6.06	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.26955	0.0660	N	0.02539	-0.55	0.58432	D	0.999998	D;D;B	0.54964	0.969;0.969;0.001	P;P;B	0.50314	0.556;0.637;0.002	T	0.25467	-1.0131	9	0.02654	T	1	.	12.5268	0.56091	0.1251:0.0:0.0:0.8749	.	120;120;120	B4DGZ4;E9PCH3;O75533	.;.;SF3B1_HUMAN	Q	120	.	ENSP00000335321:K120Q	K	-	1	0	SF3B1	197993454	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.111000	0.71541	1.076000	0.40961	0.523000	0.50628	AAA	.		0.368	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
C2orf69	205327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	200790075	200790075	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:200790075T>A	ENST00000319974.5	+	2	807	c.624T>A	c.(622-624)aaT>aaA	p.N208K	C2orf69_ENST00000491721.1_Intron	NM_153689.5	NP_710156.3	Q8N8R5	CB069_HUMAN	chromosome 2 open reading frame 69	208						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)|stomach(1)|urinary_tract(1)	11						AAAGTTTGAATGTTTGGAATA	0.348																																					p.N208K		.											.	C2orf69-23	0			c.T624A						.						52.0	52.0	52.0					2																	200790075		1819	4078	5897	SO:0001583	missense	205327	exon2			TTTGAATGTTTGG		CCDS46482.1	2q33.1	2008-08-08			ENSG00000178074	ENSG00000178074			26799	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38973"""					12477932	Standard	NM_153689		Approved	FLJ38973	uc010zhb.2	Q8N8R5	OTTHUMG00000154480	ENST00000319974.5:c.624T>A	2.37:g.200790075T>A	ENSP00000312770:p.Asn208Lys	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	46	12	NM_153689	0	0	0	0	0	Q8NE30	Missense_Mutation	SNP	ENST00000319974.5	37	CCDS46482.1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.923247	0.00498	.	.	ENSG00000178074	ENST00000319974	.	.	.	5.5	-1.14	0.09741	.	0.634163	0.16276	N	0.221571	T	0.06050	0.0157	N	0.01048	-1.04	0.09310	N	0.999996	B	0.06786	0.001	B	0.08055	0.003	T	0.29518	-1.0009	9	0.05620	T	0.96	-2.3723	1.9048	0.03275	0.1333:0.2218:0.111:0.5339	.	208	Q8N8R5	CB069_HUMAN	K	208	.	ENSP00000312770:N208K	N	+	3	2	C2orf69	200498320	0.999000	0.42202	0.155000	0.22561	0.064000	0.16182	0.773000	0.26661	-0.325000	0.08577	-0.250000	0.11733	AAT	.		0.348	C2orf69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335446.1	NM_153689	
ORC2	4999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	201778083	201778083	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:201778083T>A	ENST00000234296.2	-	17	1831	c.1582A>T	c.(1582-1584)Agt>Tgt	p.S528C		NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	528					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						GTCAGATCACTATTGACGAGG	0.428																																					p.S528C		.											.	ORC2-209	0			c.A1582T						.						101.0	95.0	97.0					2																	201778083		2203	4300	6503	SO:0001583	missense	4999	exon17			GATCACTATTGAC		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1582A>T	2.37:g.201778083T>A	ENSP00000234296:p.Ser528Cys	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	76	42	NM_006190	0	0	3	12	9	Q13204|Q53TX5	Missense_Mutation	SNP	ENST00000234296.2	37	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.506382	0.85282	.	.	ENSG00000115942	ENST00000234296	T	0.52057	0.68	5.6	5.6	0.85130	.	0.091390	0.85682	D	0.000000	T	0.76190	0.3953	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82835	-0.0261	10	0.87932	D	0	-13.9094	15.7889	0.78338	0.0:0.0:0.0:1.0	.	528	Q13416	ORC2_HUMAN	C	528	ENSP00000234296:S528C	ENSP00000234296:S528C	S	-	1	0	ORC2	201486328	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	6.057000	0.71119	2.116000	0.64780	0.482000	0.46254	AGT	.		0.428	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	
FN1	2335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	216271073	216271073	+	Silent	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:216271073C>T	ENST00000359671.1	-	19	3139	c.2874G>A	c.(2872-2874)agG>agA	p.R958R	FN1_ENST00000443816.1_Silent_p.R958R|FN1_ENST00000446046.1_Silent_p.R958R|FN1_ENST00000357009.2_Silent_p.R958R|FN1_ENST00000356005.4_Silent_p.R958R|FN1_ENST00000357867.4_Silent_p.R958R|FN1_ENST00000336916.4_Silent_p.R958R|FN1_ENST00000346544.3_Silent_p.R958R|FN1_ENST00000421182.1_Silent_p.R958R|FN1_ENST00000345488.5_Silent_p.R958R|FN1_ENST00000354785.4_Silent_p.R958R|FN1_ENST00000323926.6_Silent_p.R958R|FN1_ENST00000432072.2_Silent_p.R958R			P02751	FINC_HUMAN	fibronectin 1	958	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CAAAGGTGTTCCTGCTGATGG	0.597																																					p.R958R		.											.	FN1-584	0			c.G2874A						.						63.0	62.0	63.0					2																	216271073		2203	4300	6503	SO:0001819	synonymous_variant	2335	exon19			GGTGTTCCTGCTG		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2874G>A	2.37:g.216271073C>T		Somatic	137	0		WXS	Illumina HiSeq	Phase_I	144	24	NM_212476	0	0	7	7	0	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	ENST00000359671.1	37																																																																																				.		0.597	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
PLCB1	23236	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	8608961	8608961	+	Silent	SNP	T	T	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr20:8608961T>G	ENST00000338037.6	+	4	294	c.267T>G	c.(265-267)ctT>ctG	p.L89L	PLCB1_ENST00000378641.3_Silent_p.L89L|PLCB1_ENST00000378637.2_Silent_p.L89L	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	89					activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TACGTGAACTTTTGGATGTGG	0.443																																					p.N89K		.											.	PLCB1-297	0			c.C267G						.						78.0	78.0	78.0					20																	8608961		2203	4300	6503	SO:0001819	synonymous_variant	23236	exon4			TGAACTTTTGGAT	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.267T>G	20.37:g.8608961T>G		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	116	34	NM_015192	0	0	0	0	0	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1																																																																																			.		0.443	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
ASIP	434	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	32856797	32856797	+	Splice_Site	SNP	A	A	G	rs538816237		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr20:32856797A>G	ENST00000568305.1	+	4	425	c.223A>G	c.(223-225)Aag>Gag	p.K75E	RP4-785G19.5_ENST00000512005.1_RNA|ASIP_ENST00000374954.3_Splice_Site_p.K75E			P42127	ASIP_HUMAN	agouti signaling protein	75	Arg/Lys-rich (basic).				adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|generation of precursor metabolites and energy (GO:0006091)|genetic imprinting (GO:0071514)|hormone-mediated signaling pathway (GO:0009755)|melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|regulation of molecular function, epigenetic (GO:0040030)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(2)	3						TCCCACGCAGAAGGAGGCTTC	0.697													A|||	1	0.000199681	0.0	0.0	5008	,	,		12806	0.001		0.0	False		,,,				2504	0.0				p.K75E		.											.	ASIP-90	0			c.A223G						.						8.0	11.0	10.0					20																	32856797		2188	4282	6470	SO:0001630	splice_region_variant	434	exon3			ACGCAGAAGGAGG		CCDS13232.1	20q11.2-q12	2010-06-24	2010-06-24		ENSG00000101440	ENSG00000101440			745	protein-coding gene	gene with protein product	"""nonagouti homolog (mouse)"""	600201	"""agouti (mouse)-signaling protein"", ""agouti signaling protein, nonagouti homolog (mouse)"""	AGTIL		7937887, 7757071	Standard	NM_001672		Approved	ASP	uc002xah.1	P42127	OTTHUMG00000032289	ENST00000568305.1:c.223-1A>G	20.37:g.32856797A>G		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	67	33	NM_001672	0	0	0	0	0	Q3SXL2	Missense_Mutation	SNP	ENST00000568305.1	37	CCDS13232.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744523	0.49151	.	.	ENSG00000101440	ENST00000374954	T	0.31769	1.48	4.61	4.61	0.57282	.	0.063957	0.64402	D	0.000013	T	0.48660	0.1512	M	0.82323	2.585	0.40299	D	0.978584	P	0.51240	0.943	P	0.54346	0.749	T	0.54970	-0.8213	9	.	.	.	.	10.3603	0.43989	1.0:0.0:0.0:0.0	.	75	P42127	ASIP_HUMAN	E	75	ENSP00000364092:K75E	.	K	+	1	0	ASIP	32320458	1.000000	0.71417	1.000000	0.80357	0.127000	0.20565	3.560000	0.53763	1.942000	0.56320	0.397000	0.26171	AAG	.		0.697	ASIP-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430541.1		Missense_Mutation
CNBD2	140894	ucsc.edu;bcgsc.ca	37	20	34618475	34618475	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr20:34618475C>A	ENST00000373973.3	+	12	1809	c.1636C>A	c.(1636-1638)Cct>Act	p.P546T	CNBD2_ENST00000538900.1_3'UTR|CNBD2_ENST00000349339.1_Missense_Mutation_p.P542T			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	546																	ACCTCGTTATCCTATTTTTAT	0.468																																					p.P542T													.	.	0			c.C1624A						.						232.0	221.0	225.0					20																	34618475		2203	4300	6503	SO:0001583	missense	140894	exon12			CGTTATCCTATTT	AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.1636C>A	20.37:g.34618475C>A	ENSP00000363084:p.Pro546Thr	Somatic	260	4		WXS	Illumina HiSeq		279	68	NM_080834	0	0	0	0	0	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Missense_Mutation	SNP	ENST00000373973.3	37		.	.	.	.	.	.	.	.	.	.	C	13.10	2.134926	0.37728	.	.	ENSG00000149646	ENST00000373973;ENST00000349339	T;T	0.25250	1.81;1.81	5.26	4.31	0.51392	.	0.000000	0.56097	D	0.000033	T	0.39963	0.1098	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.13308	-1.0514	10	0.72032	D	0.01	-16.0468	9.1274	0.36824	0.0:0.9017:0.0:0.0983	.	542	Q96M20-2	.	T	546;542	ENSP00000363084:P546T;ENSP00000340954:P542T	ENSP00000340954:P542T	P	+	1	0	C20orf152	34081889	0.002000	0.14202	0.900000	0.35374	0.020000	0.10135	0.206000	0.17375	2.634000	0.89283	0.561000	0.74099	CCT	.		0.468	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000078960.2	NM_080834	
ARVCF	421	hgsc.bcm.edu	37	22	19967432	19967432	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr22:19967432G>T	ENST00000263207.3	-	6	1521	c.1230C>A	c.(1228-1230)gaC>gaA	p.D410E	ARVCF_ENST00000344269.3_Missense_Mutation_p.D347E|ARVCF_ENST00000406522.1_Missense_Mutation_p.D347E|ARVCF_ENST00000401994.1_Missense_Mutation_p.D347E|ARVCF_ENST00000487793.1_5'Flank|ARVCF_ENST00000406259.1_Missense_Mutation_p.D410E	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	410					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CCCGCGGGTGGTCCAGCAGTG	0.682																																					p.D410E		.											.	ARVCF-91	0			c.C1230A						.						19.0	19.0	19.0					22																	19967432		2178	4274	6452	SO:0001583	missense	421	exon6			CGGGTGGTCCAGC		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1230C>A	22.37:g.19967432G>T	ENSP00000263207:p.Asp410Glu	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	8	4	NM_001670	0	0	3	6	3	B7WNV2	Missense_Mutation	SNP	ENST00000263207.3	37	CCDS13771.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167282	0.57476	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81	4.51	-0.0128	0.13987	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.42040	0.1185	L	0.28115	0.83	0.50171	D	0.999858	P	0.39601	0.68	P	0.51742	0.678	T	0.11966	-1.0566	9	.	.	.	-21.2014	9.1754	0.37109	0.4923:0.0:0.5077:0.0	.	410	O00192	ARVC_HUMAN	E	410;347;347;347;410	ENSP00000263207:D410E;ENSP00000342042:D347E;ENSP00000384341:D347E;ENSP00000384732:D347E;ENSP00000385444:D410E	.	D	-	3	2	ARVCF	18347432	0.997000	0.39634	0.997000	0.53966	0.684000	0.39900	0.345000	0.19979	0.012000	0.14892	-0.131000	0.14894	GAC	.		0.682	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
YPEL1	29799	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	22064932	22064932	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr22:22064932G>C	ENST00000339468.3	-	2	485	c.102C>G	c.(100-102)gaC>gaG	p.D34E	YPEL1_ENST00000403503.1_Missense_Mutation_p.D34E	NM_013313.3	NP_037445.1	O60688	YPEL1_HUMAN	yippee-like 1 (Drosophila)	34						nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(1)	3	Colorectal(54;0.105)					AGATGAGCTCGTCATGATTGG	0.438																																					p.D34E													.	YPEL1-90	0			c.C102G						.						317.0	269.0	285.0					22																	22064932		2203	4300	6503	SO:0001583	missense	29799	exon2			GAGCTCGTCATGA	AF060862	CCDS13794.1	22q11.2	2008-02-04	2001-11-28		ENSG00000100027	ENSG00000100027			12845	protein-coding gene	gene with protein product		608082	"""yippee (Drosophila) homolog-like 1"""			11473580	Standard	NM_013313		Approved		uc002zvl.3	O60688	OTTHUMG00000150830	ENST00000339468.3:c.102C>G	22.37:g.22064932G>C	ENSP00000342832:p.Asp34Glu	Somatic	309	2		WXS	Illumina HiSeq	Phase_I	263	81	NM_013313	0	0	3	3	0	Q65ZA1|Q6GLI6	Missense_Mutation	SNP	ENST00000339468.3	37	CCDS13794.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432950	0.43224	.	.	ENSG00000100027	ENST00000339468;ENST00000403503	.	.	.	4.86	-7.17	0.01511	.	0.000000	0.85682	D	0.000000	T	0.45175	0.1329	L	0.31065	0.9	0.53688	D	0.999971	B	0.15930	0.015	B	0.19666	0.026	T	0.02721	-1.1119	9	0.36615	T	0.2	.	16.9342	0.86199	0.6194:0.0:0.3806:0.0	.	34	O60688	YPEL1_HUMAN	E	34	.	ENSP00000342832:D34E	D	-	3	2	YPEL1	20394932	0.300000	0.24435	0.368000	0.25939	0.764000	0.43329	-0.146000	0.10250	-2.011000	0.00952	-2.069000	0.00389	GAC	.		0.438	YPEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320245.1	NM_013313	
LARGE	9215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	33679190	33679190	+	Silent	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr22:33679190G>A	ENST00000354992.2	-	14	2446	c.1875C>T	c.(1873-1875)ttC>ttT	p.F625F	LARGE_ENST00000402320.1_Silent_p.F573F|LARGE_ENST00000452586.2_Silent_p.F424F|LARGE_ENST00000437602.2_Intron|LARGE_ENST00000397394.2_Silent_p.F625F|LARGE_ENST00000337431.2_Silent_p.F573F	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	625					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				CCACTCACCTGAATGTGAAGA	0.552																																					p.F625F	Colon(70;397 1175 4573 19089 45288)	.											.	LARGE-92	0			c.C1875T						.						140.0	124.0	129.0					22																	33679190		2203	4300	6503	SO:0001819	synonymous_variant	9215	exon14			TCACCTGAATGTG	AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1875C>T	22.37:g.33679190G>A		Somatic	224	0		WXS	Illumina HiSeq	Phase_I	187	61	NM_004737	0	0	0	0	0	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Silent	SNP	ENST00000354992.2	37	CCDS13912.1																																																																																			.		0.552	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320515.2	NM_133642	
FBLN2	2199	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	13671374	13671374	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:13671374A>G	ENST00000295760.7	+	13	2825	c.2756A>G	c.(2755-2757)aAc>aGc	p.N919S	FBLN2_ENST00000492059.1_Missense_Mutation_p.N966S|FBLN2_ENST00000404922.3_Missense_Mutation_p.N966S|FBLN2_ENST00000535798.1_Missense_Mutation_p.N945S	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	919	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			ACGTGTGAGAACACACTCGGC	0.642																																					p.N966S													.	FBLN2-91	0			c.A2897G						.						22.0	26.0	24.0					3																	13671374		2135	4244	6379	SO:0001583	missense	2199	exon14			GTGAGAACACACT	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2756A>G	3.37:g.13671374A>G	ENSP00000295760:p.Asn919Ser	Somatic	347	1		WXS	Illumina HiSeq	Phase_I	226	44	NM_001004019	0	0	4	4	0	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	A	19.87	3.908264	0.72868	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000492059	D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39	5.1	5.1	0.69264	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.96371	0.8816	H	0.96943	3.91	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.996;0.997;0.997	D	0.97757	1.0218	10	0.87932	D	0	.	14.8854	0.70564	1.0:0.0:0.0:0.0	.	919;966;945	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	S	945;966;919;966	ENSP00000445705:N945S;ENSP00000384169:N966S;ENSP00000295760:N919S;ENSP00000420042:N966S	ENSP00000295760:N919S	N	+	2	0	FBLN2	13646375	1.000000	0.71417	0.998000	0.56505	0.400000	0.30750	7.469000	0.80959	1.920000	0.55613	0.383000	0.25322	AAC	.		0.642	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
TGFBR2	7048	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	30713426	30713426	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:30713426G>A	ENST00000295754.5	+	4	1133	c.751G>A	c.(751-753)Ggg>Agg	p.G251R	TGFBR2_ENST00000359013.4_Missense_Mutation_p.G276R	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CACCCTGGTGGGGAAAGGTCG	0.517																																					p.G276R													.	TGFBR2-1698	0			c.G826A						.						119.0	101.0	107.0					3																	30713426		2203	4300	6503	SO:0001583	missense	7048	exon5			CTGGTGGGGAAAG		CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.751G>A	3.37:g.30713426G>A	ENSP00000295754:p.Gly251Arg	Somatic	274	1		WXS	Illumina HiSeq	Phase_I	405	106	NM_001024847	0	0	4	4	0	B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	ENST00000295754.5	37	CCDS2648.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957609	0.92726	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.82984	-1.67;-1.67	5.44	5.44	0.79542	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93759	0.8005	M	0.94063	3.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95033	0.8171	10	0.87932	D	0	.	19.2452	0.93899	0.0:0.0:1.0:0.0	.	251;276	P37173;D2JYI1	TGFR2_HUMAN;.	R	251;276;117	ENSP00000295754:G251R;ENSP00000351905:G276R	ENSP00000295754:G251R	G	+	1	0	TGFBR2	30688430	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.864000	0.99589	2.536000	0.85505	0.591000	0.81541	GGG	.		0.517	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252994.2		
OSBPL10	114884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	31705657	31705657	+	Missense_Mutation	SNP	G	G	A	rs375455808		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:31705657G>A	ENST00000396556.2	-	11	2286	c.2164C>T	c.(2164-2166)Cgg>Tgg	p.R722W	OSBPL10_ENST00000438237.2_Missense_Mutation_p.R658W	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	722					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		TCCAGGTGCCGCTTCTGCTCG	0.607																																					p.R722W		.											.	OSBPL10-69	0			c.C2164T						.	G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	110.0	100.0	103.0		1972,2164	5.2	1.0	3		103	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	OSBPL10	NM_001174060.1,NM_017784.4	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	658/701,722/765	31705657	1,13005	2203	4300	6503	SO:0001583	missense	114884	exon11			GGTGCCGCTTCTG	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.2164C>T	3.37:g.31705657G>A	ENSP00000379804:p.Arg722Trp	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	183	58	NM_017784	0	0	4	4	0	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	37	CCDS2651.1	.	.	.	.	.	.	.	.	.	.	G	34	5.329303	0.95733	0.0	1.16E-4	ENSG00000144645	ENST00000396556;ENST00000438237	T;T	0.31247	1.5;1.5	5.25	5.25	0.73442	.	0.051590	0.85682	D	0.000000	T	0.57989	0.2091	M	0.77103	2.36	0.48696	D	0.999691	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.70935	0.971;0.93;0.969	T	0.57412	-0.7816	10	0.42905	T	0.14	-24.6464	19.2246	0.93814	0.0:0.0:1.0:0.0	.	658;722;490	B4E212;Q9BXB5;Q59ED9	.;OSB10_HUMAN;.	W	722;658	ENSP00000379804:R722W;ENSP00000406124:R658W	ENSP00000379804:R722W	R	-	1	2	OSBPL10	31680661	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.694000	0.74587	2.635000	0.89317	0.655000	0.94253	CGG	.		0.607	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
TRIM71	131405	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	32915387	32915387	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:32915387C>A	ENST00000383763.5	+	2	993	c.930C>A	c.(928-930)agC>agA	p.S310R		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	310					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GGGGCCACAGCTTCATCTACC	0.607																																					p.S310R													.	TRIM71-92	0			c.C930A						.						166.0	176.0	173.0					3																	32915387		2112	4227	6339	SO:0001583	missense	131405	exon2			CCACAGCTTCATC		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.930C>A	3.37:g.32915387C>A	ENSP00000373272:p.Ser310Arg	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	173	35	NM_001039111	0	0	0	0	0		Missense_Mutation	SNP	ENST00000383763.5	37	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	C	11.51	1.659417	0.29515	.	.	ENSG00000206557	ENST00000383763	T	0.40756	1.02	5.83	3.08	0.35506	Zinc finger, B-box (3);	0.090053	0.85682	D	0.000000	T	0.32436	0.0829	N	0.24115	0.695	0.58432	D	0.999999	P	0.51147	0.942	P	0.49999	0.628	T	0.03374	-1.1043	10	0.13470	T	0.59	-46.6103	9.4738	0.38858	0.0:0.7713:0.0:0.2287	.	310	Q2Q1W2	LIN41_HUMAN	R	310	ENSP00000373272:S310R	ENSP00000373272:S310R	S	+	3	2	TRIM71	32890391	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.122000	0.41987	0.817000	0.34445	0.655000	0.94253	AGC	.		0.607	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	
PRKCD	5580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	53220041	53220041	+	Nonsense_Mutation	SNP	A	A	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:53220041A>T	ENST00000394729.2	+	11	1412	c.1084A>T	c.(1084-1086)Aag>Tag	p.K362*	PRKCD_ENST00000330452.3_Nonsense_Mutation_p.K362*	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta	362	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	CAGCTTCGGGAAGGTGAGGGC	0.602																																					p.K362X		.											.	PRKCD-1378	0			c.A1084T						.						72.0	66.0	68.0					3																	53220041		2203	4300	6503	SO:0001587	stop_gained	5580	exon11			TTCGGGAAGGTGA		CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.1084A>T	3.37:g.53220041A>T	ENSP00000378217:p.Lys362*	Somatic	371	0		WXS	Illumina HiSeq	Phase_I	450	235	NM_212539	0	0	0	0	0	B0KZ81|B2R834|Q15144|Q86XJ6	Nonsense_Mutation	SNP	ENST00000394729.2	37	CCDS2870.1	.	.	.	.	.	.	.	.	.	.	A	41	8.637830	0.98895	.	.	ENSG00000163932	ENST00000394729;ENST00000330452	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9599	0.64172	1.0:0.0:0.0:0.0	.	.	.	.	X	362	.	ENSP00000331602:K362X	K	+	1	0	PRKCD	53195081	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.283000	0.95860	1.990000	0.58119	0.482000	0.46254	AAG	.		0.602	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257818.1		
FAM208A	23272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	56667344	56667344	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:56667344C>G	ENST00000493960.2	-	18	3485	c.3475G>C	c.(3475-3477)Gta>Cta	p.V1159L	FAM208A_ENST00000355628.5_Missense_Mutation_p.V1098L|FAM208A_ENST00000431842.2_Missense_Mutation_p.V722L	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1159							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TTCATTTCTACTTCAGTTAAA	0.423																																					p.V1159L		.											.	.	0			c.G3475C						.						161.0	153.0	156.0					3																	56667344		2203	4300	6503	SO:0001583	missense	23272	exon18			TTTCTACTTCAGT	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3475G>C	3.37:g.56667344C>G	ENSP00000417509:p.Val1159Leu	Somatic	255	1		WXS	Illumina HiSeq	Phase_I	282	153	NM_001112736	0	0	0	5	5	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	C	10.01	1.233960	0.22626	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.11930	2.73;2.92;2.92	5.71	2.97	0.34412	.	0.560812	0.17265	N	0.180629	T	0.14141	0.0342	L	0.59436	1.845	0.33043	D	0.531757	B;B;B;B	0.29481	0.052;0.082;0.046;0.245	B;B;B;B	0.26202	0.067;0.053;0.045;0.049	T	0.07731	-1.0757	10	0.49607	T	0.09	0.2694	9.0639	0.36451	0.0:0.7733:0.0:0.2267	.	1159;1098;722;1159	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	L	722;1159;1098	ENSP00000399410:V722L;ENSP00000417509:V1159L;ENSP00000347845:V1098L	ENSP00000347845:V1098L	V	-	1	0	C3orf63	56642384	0.810000	0.29049	0.970000	0.41538	0.807000	0.45602	0.627000	0.24506	0.444000	0.26612	-0.145000	0.13849	GTA	.		0.423	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
FRMD4B	23150	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	69247894	69247894	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:69247894T>C	ENST00000398540.3	-	12	991	c.908A>G	c.(907-909)tAt>tGt	p.Y303C	FRMD4B_ENST00000478263.1_De_novo_Start_OutOfFrame|FRMD4B_ENST00000542259.1_Missense_Mutation_p.Y249C	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	303	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CTCACGGAAATATAAGTTCTC	0.333																																					p.Y303C													.	FRMD4B-72	0			c.A908G						.						49.0	44.0	45.0					3																	69247894		1798	4063	5861	SO:0001583	missense	23150	exon12			CGGAAATATAAGT	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.908A>G	3.37:g.69247894T>C	ENSP00000381549:p.Tyr303Cys	Somatic	80	1		WXS	Illumina HiSeq	Phase_I	98	57	NM_015123	0	0	0	0	0	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.628228	0.87560	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000462512	D;D;D	0.87334	-2.24;-2.24;-2.24	5.73	5.73	0.89815	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.93360	0.7883	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;0.973	D;D	0.97110	1.0;0.934	D	0.94028	0.7298	10	0.72032	D	0.01	-14.0669	16.026	0.80545	0.0:0.0:0.0:1.0	.	147;303	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	C	303;249;14	ENSP00000381549:Y303C;ENSP00000437658:Y249C;ENSP00000419869:Y14C	ENSP00000381549:Y303C	Y	-	2	0	FRMD4B	69330584	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	8.040000	0.89188	2.191000	0.70037	0.533000	0.62120	TAT	.		0.333	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
CEP97	79598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	101450739	101450739	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:101450739T>C	ENST00000341893.3	+	5	1255	c.503T>C	c.(502-504)cTa>cCa	p.L168P	CEP97_ENST00000494050.1_Missense_Mutation_p.L168P|CEP97_ENST00000327230.4_Missense_Mutation_p.L168P			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	168					cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						CCTGCTTACCTACCCAGAAGT	0.358																																					p.L168P		.											.	CEP97-70	0			c.T503C						.						175.0	171.0	172.0					3																	101450739		2203	4300	6503	SO:0001583	missense	79598	exon5			CTTACCTACCCAG	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.503T>C	3.37:g.101450739T>C	ENSP00000342510:p.Leu168Pro	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	72	15	NM_024548	0	0	0	0	0	B5MDY8|Q8NA71|Q9H5T9	Missense_Mutation	SNP	ENST00000341893.3	37	CCDS2944.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.711642	0.89112	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	T;T;T	0.54866	0.55;0.55;0.55	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.78220	0.4249	M	0.90542	3.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.83115	-0.0121	10	0.87932	D	0	-9.0356	16.2507	0.82485	0.0:0.0:0.0:1.0	.	168;168;168	E9PG22;Q8IW35-2;Q8IW35	.;.;CEP97_HUMAN	P	168	ENSP00000342510:L168P;ENSP00000325881:L168P;ENSP00000418185:L168P	ENSP00000325881:L168P	L	+	2	0	CEP97	102933429	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.867000	0.87062	2.237000	0.73441	0.528000	0.53228	CTA	.		0.358	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548	
ITGB5	3693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	124536482	124536482	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:124536482T>A	ENST00000296181.4	-	8	1410	c.1114A>T	c.(1114-1116)Att>Ttt	p.I372F		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	372	VWFA.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TATGCATTAATAATCAGTTGA	0.463																																					p.I372F		.											.	ITGB5-227	0			c.A1114T						.						90.0	93.0	92.0					3																	124536482		2203	4300	6503	SO:0001583	missense	3693	exon8			CATTAATAATCAG	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.1114A>T	3.37:g.124536482T>A	ENSP00000296181:p.Ile372Phe	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	60	33	NM_002213	0	0	0	0	0	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	37	CCDS3030.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.39|10.39	1.336008|1.336008	0.24253|0.24253	.|.	.|.	ENSG00000082781|ENSG00000082781	ENST00000296181|ENST00000481591	D|.	0.97731|.	-4.51|.	5.91|5.91	3.56|3.56	0.40772|0.40772	Integrin beta subunit, N-terminal (2);von Willebrand factor, type A (1);|.	0.258920|.	0.37761|.	N|.	0.001959|.	T|T	0.58177|0.58177	0.2104|0.2104	M|M	0.62723|0.62723	1.935|1.935	0.48087|0.48087	D|D	0.99958|0.99958	D|.	0.53745|.	0.962|.	P|.	0.54401|.	0.751|.	T|T	0.55829|0.55829	-0.8079|-0.8079	10|5	0.87932|.	D|.	0|.	.|.	4.6147|4.6147	0.12420|0.12420	0.0:0.4306:0.0:0.5694|0.0:0.4306:0.0:0.5694	.|.	372|.	P18084|.	ITB5_HUMAN|.	F|F	372|106	ENSP00000296181:I372F|.	ENSP00000296181:I372F|.	I|L	-|-	1|3	0|2	ITGB5|ITGB5	126019172|126019172	0.989000|0.989000	0.36119|0.36119	0.981000|0.981000	0.43875|0.43875	0.079000|0.079000	0.17450|0.17450	2.520000|2.520000	0.45554|0.45554	1.062000|1.062000	0.40625|0.40625	-0.290000|-0.290000	0.09829|0.09829	ATT|TTA	.		0.463	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
IFT122	55764	hgsc.bcm.edu;bcgsc.ca	37	3	129200472	129200472	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:129200472G>C	ENST00000348417.2	+	14	1665	c.1588G>C	c.(1588-1590)Gcc>Ccc	p.A530P	IFT122_ENST00000440957.2_Missense_Mutation_p.A321P|IFT122_ENST00000296266.3_Missense_Mutation_p.A581P|IFT122_ENST00000347300.2_Missense_Mutation_p.A471P|IFT122_ENST00000431818.2_Missense_Mutation_p.A380P|IFT122_ENST00000349441.2_Missense_Mutation_p.A419P|IFT122_ENST00000507564.1_Missense_Mutation_p.A522P|IFT122_ENST00000504021.1_Missense_Mutation_p.A424P	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	530					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						TAAGAAGCTGGCCGTGGTAGA	0.537																																					p.A581P		.											.	IFT122-92	0			c.G1741C						.						36.0	37.0	36.0					3																	129200472		2202	4280	6482	SO:0001583	missense	55764	exon15			AAGCTGGCCGTGG	AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.1588G>C	3.37:g.129200472G>C	ENSP00000324005:p.Ala530Pro	Somatic	829	2		WXS	Illumina HiSeq	Phase_I	1002	371	NM_052985	0	0	2	5	3	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Missense_Mutation	SNP	ENST00000348417.2	37	CCDS3061.1	.	.	.	.	.	.	.	.	.	.	G	31	5.058399	0.93846	.	.	ENSG00000163913	ENST00000347300;ENST00000296266;ENST00000507564;ENST00000454840;ENST00000431818;ENST00000504021;ENST00000349441;ENST00000348417;ENST00000446384;ENST00000440957;ENST00000509522	T;T;T;D;T;T;T;D;T	0.91237	2.88;0.84;0.84;-2.81;1.18;1.18;0.84;-2.81;0.28	5.5	5.5	0.81552	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.052903	0.85682	D	0.000000	D	0.96676	0.8915	M	0.92507	3.315	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;0.991;1.0;1.0;0.999;1.0;0.996;0.998	D	0.97335	0.9953	10	0.87932	D	0	-22.9133	19.3987	0.94619	0.0:0.0:1.0:0.0	.	321;522;424;370;419;471;530;581	E9PDG2;E7EQF4;B4DEY9;B4DPW7;Q9BTY4;Q9HBG6-3;Q9HBG6;G3XAB1	.;.;.;.;.;.;IF122_HUMAN;.	P	471;581;522;471;380;424;419;530;370;321;45	ENSP00000323973:A471P;ENSP00000296266:A581P;ENSP00000425536:A522P;ENSP00000410946:A380P;ENSP00000422179:A424P;ENSP00000324165:A419P;ENSP00000324005:A530P;ENSP00000401569:A321P;ENSP00000424727:A45P	ENSP00000296266:A581P	A	+	1	0	IFT122	130683162	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.113000	0.94321	2.553000	0.86117	0.585000	0.79938	GCC	.		0.537	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355852.1	NM_018262	
DZIP1L	199221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	137790541	137790541	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:137790541G>A	ENST00000327532.2	-	12	1921	c.1559C>T	c.(1558-1560)gCg>gTg	p.A520V	DZIP1L_ENST00000488595.1_Intron|DZIP1L_ENST00000469243.1_Missense_Mutation_p.A520V	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	520					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						TCTCTCCTTCGCTCTGCTGGT	0.582																																					p.A520V		.											.	DZIP1L-92	0			c.C1559T						.						90.0	92.0	91.0					3																	137790541		2203	4300	6503	SO:0001583	missense	199221	exon13			TCCTTCGCTCTGC	AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.1559C>T	3.37:g.137790541G>A	ENSP00000332148:p.Ala520Val	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	112	65	NM_001170538	0	0	1	5	4	C9JUG5|Q96M38	Missense_Mutation	SNP	ENST00000327532.2	37	CCDS3096.1	.	.	.	.	.	.	.	.	.	.	G	4.821	0.152566	0.09185	.	.	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.38240	1.15;1.55	4.86	-3.99	0.04069	.	0.809238	0.10642	N	0.650958	T	0.12263	0.0298	N	0.03324	-0.35	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.001	T	0.38351	-0.9665	10	0.02654	T	1	-4.7251	11.046	0.47859	0.5108:0.0:0.4892:0.0	.	520;520	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	V	520	ENSP00000332148:A520V;ENSP00000419486:A520V	ENSP00000332148:A520V	A	-	2	0	DZIP1L	139273231	0.009000	0.17119	0.025000	0.17156	0.009000	0.06853	0.410000	0.21098	-0.777000	0.04572	-1.004000	0.02495	GCG	.		0.582	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357548.1	NM_173543	
KNG1	3827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	186445075	186445075	+	Missense_Mutation	SNP	A	A	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:186445075A>C	ENST00000265023.4	+	5	826	c.614A>C	c.(613-615)aAt>aCt	p.N205T	KNG1_ENST00000287611.2_Missense_Mutation_p.N205T|KNG1_ENST00000447445.1_Intron|RP11-573D15.8_ENST00000599314.1_RNA	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	205	Cystatin kininogen-type 2. {ECO:0000255|PROSITE-ProRule:PRU00979}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		GTGCAAACGAATTGTTCCAAA	0.348																																					p.N205T		.											.	KNG1-92	0			c.A614C						.						105.0	109.0	108.0					3																	186445075		2203	4300	6503	SO:0001583	missense	3827	exon5			AAACGAATTGTTC		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.614A>C	3.37:g.186445075A>C	ENSP00000265023:p.Asn205Thr	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	77	27	NM_000893	0	0	0	0	0	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	37	CCDS43183.1	.	.	.	.	.	.	.	.	.	.	A	17.29	3.353296	0.61293	.	.	ENSG00000113889	ENST00000287611;ENST00000265023;ENST00000432028	T;T	0.26067	1.76;1.76	4.98	3.82	0.43975	Proteinase inhibitor I25, cystatin (2);	0.085672	0.49916	D	0.000134	T	0.40473	0.1118	L	0.52011	1.625	0.80722	D	1	D;D	0.89917	0.974;1.0	D;D	0.85130	0.961;0.997	T	0.15263	-1.0443	10	0.54805	T	0.06	-28.4834	7.9142	0.29808	0.9039:0.0:0.0961:0.0	.	205;205	P01042;P01042-2	KNG1_HUMAN;.	T	205;205;193	ENSP00000287611:N205T;ENSP00000265023:N205T	ENSP00000265023:N205T	N	+	2	0	KNG1	187927769	0.996000	0.38824	0.989000	0.46669	0.901000	0.52897	4.757000	0.62213	0.998000	0.38996	0.528000	0.53228	AAT	.		0.348	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	
TIGD4	201798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	153690653	153690653	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr4:153690653G>C	ENST00000304337.2	-	2	2324	c.1504C>G	c.(1504-1506)Ctt>Gtt	p.L502V		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	502						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					AAATTTTCAAGGTCTGCTAAA	0.284																																					p.L502V		.											.	TIGD4-91	0			c.C1504G						.						34.0	39.0	38.0					4																	153690653		2202	4299	6501	SO:0001583	missense	201798	exon2			TTTCAAGGTCTGC	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.1504C>G	4.37:g.153690653G>C	ENSP00000355162:p.Leu502Val	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	51	13	NM_145720	0	0	0	0	0	Q96LP5	Missense_Mutation	SNP	ENST00000304337.2	37	CCDS34079.1	.	.	.	.	.	.	.	.	.	.	G	4.593	0.110214	0.08780	.	.	ENSG00000169989	ENST00000304337	T	0.17854	2.25	6.08	2.33	0.28932	Centromere protein Cenp-B, dimerisation domain (1);	0.493860	0.17134	N	0.185704	T	0.10981	0.0268	L	0.29908	0.895	0.26016	N	0.981923	B	0.06786	0.001	B	0.06405	0.002	T	0.24048	-1.0171	10	0.56958	D	0.05	-8.793	4.401	0.11386	0.0666:0.2372:0.3299:0.3663	.	502	Q8IY51	TIGD4_HUMAN	V	502	ENSP00000355162:L502V	ENSP00000355162:L502V	L	-	1	0	TIGD4	153910103	0.997000	0.39634	0.991000	0.47740	0.706000	0.40770	0.275000	0.18698	0.118000	0.18165	-0.293000	0.09583	CTT	.		0.284	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365028.1	NM_145720	
SEMA5A	9037	broad.mit.edu	37	5	9063125	9063125	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr5:9063125G>C	ENST00000382496.5	-	18	3057	c.2392C>G	c.(2392-2394)Cgt>Ggt	p.R798G		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	798	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CTGCAGTCACGGCTGCACTGT	0.597																																					p.R798G													.	SEMA5A-91	0			c.C2392G						.						82.0	65.0	71.0					5																	9063125		2203	4300	6503	SO:0001583	missense	9037	exon18			AGTCACGGCTGCA	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2392C>G	5.37:g.9063125G>C	ENSP00000371936:p.Arg798Gly	Somatic	335	1		WXS	Illumina HiSeq	Phase_I	265	4	NM_003966	0	0	1	1	0	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959722	0.74016	.	.	ENSG00000112902	ENST00000382496	T	0.52754	0.65	5.65	3.75	0.43078	.	0.000000	0.85682	D	0.000000	T	0.68997	0.3062	M	0.85197	2.74	0.53005	D	0.999964	D	0.65815	0.995	D	0.69307	0.963	T	0.74399	-0.3678	10	0.62326	D	0.03	.	12.7069	0.57065	0.0:0.0:0.6934:0.3066	.	798	Q13591	SEM5A_HUMAN	G	798	ENSP00000371936:R798G	ENSP00000371936:R798G	R	-	1	0	SEMA5A	9116125	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	4.915000	0.63355	1.323000	0.45263	0.655000	0.94253	CGT	.		0.597	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206989.2		
CARD6	84674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	40852818	40852818	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr5:40852818T>C	ENST00000254691.5	+	3	1583	c.1384T>C	c.(1384-1386)Tac>Cac	p.Y462H	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	462					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						GCGTCTAGGATACTGTAGCTT	0.433																																					p.Y462H		.											.	CARD6-230	0			c.T1384C						.						87.0	91.0	89.0					5																	40852818		2203	4300	6503	SO:0001583	missense	84674	exon3			CTAGGATACTGTA	AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.1384T>C	5.37:g.40852818T>C	ENSP00000254691:p.Tyr462His	Somatic	115	0		WXS	Illumina HiSeq	Phase_I	145	64	NM_032587	0	0	0	0	0	Q52LR2	Missense_Mutation	SNP	ENST00000254691.5	37	CCDS3935.1	.	.	.	.	.	.	.	.	.	.	T	4.601	0.111736	0.08831	.	.	ENSG00000132357	ENST00000254691	T	0.11169	2.8	5.48	-5.23	0.02798	.	1.493650	0.03820	N	0.267293	T	0.04724	0.0128	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.34950	-0.9808	10	0.35671	T	0.21	3.1866	3.3078	0.07006	0.209:0.5204:0.1052:0.1655	.	462	Q9BX69	CARD6_HUMAN	H	462	ENSP00000254691:Y462H	ENSP00000254691:Y462H	Y	+	1	0	CARD6	40888575	0.000000	0.05858	0.002000	0.10522	0.968000	0.65278	-0.582000	0.05814	-1.244000	0.02516	-0.248000	0.11899	TAC	.		0.433	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
MSH3	4437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	80037368	80037368	+	Splice_Site	SNP	G	G	C	rs550626088		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr5:80037368G>C	ENST00000265081.6	+	11	1733		c.e11+1		MSH3_ENST00000512258.1_Splice_Site	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ACAGAATCAGGTCAGGCAAAT	0.333								Mismatch excision repair (MMR)																													.	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.1653+1G>C						.						53.0	58.0	57.0					5																	80037368		2203	4297	6500	SO:0001630	splice_region_variant	4437	exon11			AATCAGGTCAGGC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.1653+1G>C	5.37:g.80037368G>C		Somatic	166	0		WXS	Illumina HiSeq	Phase_I	103	34	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Splice_Site	SNP	ENST00000265081.6	37	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	G	19.14	3.770243	0.69992	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9659	0.86285	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MSH3	80073124	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	6.767000	0.74975	2.369000	0.80426	0.650000	0.86243	.	.		0.333	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	Intron
PAM	5066	hgsc.bcm.edu;bcgsc.ca	37	5	102203044	102203044	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr5:102203044G>A	ENST00000438793.3	+	2	627	c.157G>A	c.(157-159)Gat>Aat	p.D53N	PAM_ENST00000348126.2_Missense_Mutation_p.D53N|PAM_ENST00000274392.9_5'UTR|PAM_ENST00000513648.1_3'UTR|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000304400.7_Missense_Mutation_p.D53N|PAM_ENST00000455264.2_Missense_Mutation_p.D53N|PAM_ENST00000346918.2_Missense_Mutation_p.D53N	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	53	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	AGTTCCTATTGATTCATCAGA	0.373																																					p.D53N		.											.	PAM-68	0			c.G157A						.						166.0	147.0	153.0					5																	102203044		2203	4300	6503	SO:0001583	missense	5066	exon2			CCTATTGATTCAT	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.157G>A	5.37:g.102203044G>A	ENSP00000396493:p.Asp53Asn	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	80	22	NM_138822	0	0	3	3	0	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347969	0.41599	.	.	ENSG00000145730	ENST00000511839;ENST00000509832;ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000455264	T;T;T;T;T;T;T	0.64085	0.66;-0.08;1.36;1.36;1.36;1.36;1.36	5.68	5.68	0.88126	Copper type II, ascorbate-dependent monooxygenase, N-terminal (1);PHM/PNGase F domain (1);	0.264128	0.41396	D	0.000899	T	0.54481	0.1861	L	0.29908	0.895	0.80722	D	1	B;B;B;B;B	0.12630	0.004;0.006;0.006;0.006;0.006	B;B;B;B;B	0.12156	0.003;0.006;0.006;0.006;0.007	T	0.45760	-0.9239	10	0.39692	T	0.17	.	19.791	0.96456	0.0:0.0:1.0:0.0	.	53;53;53;53;53	P19021;P19021-4;P19021-3;P19021-5;P19021-2	AMD_HUMAN;.;.;.;.	N	53	ENSP00000426448:D53N;ENSP00000423763:D53N;ENSP00000396493:D53N;ENSP00000282992:D53N;ENSP00000314638:D53N;ENSP00000306100:D53N;ENSP00000403461:D53N	ENSP00000306100:D53N	D	+	1	0	PAM	102230943	1.000000	0.71417	0.985000	0.45067	0.013000	0.08279	5.413000	0.66399	2.677000	0.91161	0.491000	0.48974	GAT	.		0.373	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
ARHGAP26	23092	broad.mit.edu	37	5	142281511	142281511	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr5:142281511C>A	ENST00000274498.4	+	7	987	c.609C>A	c.(607-609)ttC>ttA	p.F203L	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.F203L	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	203					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGCTGGCCTTCCTGCAAGGAC	0.458																																					p.F203L													.	ARHGAP26-660	0			c.C609A						.						149.0	125.0	133.0					5																	142281511		2203	4300	6503	SO:0001583	missense	23092	exon7			GGCCTTCCTGCAA	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.609C>A	5.37:g.142281511C>A	ENSP00000274498:p.Phe203Leu	Somatic	211	0		WXS	Illumina HiSeq	Phase_I	163	6	NM_015071	0	0	0	0	0	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063007	0.76187	.	.	ENSG00000145819	ENST00000274498;ENST00000378004	T;T	0.04551	3.6;3.6	5.79	3.03	0.35002	IRSp53/MIM homology domain (IMD) (2);	0.000000	0.85682	D	0.000000	T	0.15955	0.0384	M	0.85462	2.755	0.58432	D	0.999998	P;P	0.49307	0.655;0.922	P;P	0.55667	0.557;0.781	T	0.00363	-1.1788	10	0.54805	T	0.06	.	8.3362	0.32217	0.0:0.6617:0.0:0.3383	.	203;203	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	L	203	ENSP00000274498:F203L;ENSP00000367243:F203L	ENSP00000274498:F203L	F	+	3	2	ARHGAP26	142261695	0.926000	0.31397	1.000000	0.80357	0.990000	0.78478	0.065000	0.14466	0.784000	0.33661	0.563000	0.77884	TTC	.		0.458	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
SYCP2L	221711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	10931696	10931696	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:10931696A>G	ENST00000283141.6	+	20	1953	c.1657A>G	c.(1657-1659)Agt>Ggt	p.S553G		NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	553						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			CCCTCCCAGTAGTGGCAGTGG	0.398																																					p.S553G		.											.	SYCP2L-24	0			c.A1657G						.						162.0	153.0	156.0					6																	10931696		1894	4121	6015	SO:0001583	missense	221711	exon20			CCCAGTAGTGGCA	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1657A>G	6.37:g.10931696A>G	ENSP00000283141:p.Ser553Gly	Somatic	99	0		WXS	Illumina HiSeq	Phase_I	104	37	NM_001040274	0	0	0	0	0	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	ENST00000283141.6	37	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	A	12.52	1.964123	0.34659	.	.	ENSG00000153157	ENST00000283141	T	0.31247	1.5	4.54	3.37	0.38596	.	0.357110	0.31648	N	0.007296	T	0.19327	0.0464	L	0.52011	1.625	0.24843	N	0.992458	D	0.60160	0.987	P	0.50270	0.636	T	0.03325	-1.1048	10	0.59425	D	0.04	.	8.5559	0.33480	0.7752:0.2248:0.0:0.0	.	553	Q5T4T6	SYC2L_HUMAN	G	553	ENSP00000283141:S553G	ENSP00000283141:S553G	S	+	1	0	SYCP2L	11039682	0.004000	0.15560	0.006000	0.13384	0.043000	0.13939	0.576000	0.23744	0.822000	0.34565	0.460000	0.39030	AGT	.		0.398	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
GPLD1	2822	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	24450018	24450018	+	Splice_Site	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:24450018T>C	ENST00000230036.1	-	15	1555	c.1445A>G	c.(1444-1446)aAa>aGa	p.K482R		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	482					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						CAGCCTTACTTTGTAGGTGAG	0.632																																					p.K482R		.											.	GPLD1-228	0			c.A1445G						.						67.0	71.0	69.0					6																	24450018		2203	4300	6503	SO:0001630	splice_region_variant	2822	exon15			CTTACTTTGTAGG	L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.1446+1A>G	6.37:g.24450018T>C		Somatic	90	0		WXS	Illumina HiSeq	Phase_I	69	32	NM_001503	0	0	0	0	0	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	ENST00000230036.1	37	CCDS4553.1	.	.	.	.	.	.	.	.	.	.	T	9.926	1.213638	0.22289	.	.	ENSG00000112293	ENST00000230036	T	0.66995	-0.24	5.5	-3.95	0.04118	.	0.800408	0.11589	N	0.548920	T	0.20455	0.0492	N	0.12527	0.23	0.53005	D	0.999964	B	0.09022	0.002	B	0.14578	0.011	T	0.12142	-1.0559	10	0.12766	T	0.61	-0.5038	9.3674	0.38232	0.0:0.1973:0.5455:0.2572	.	482	P80108	PHLD_HUMAN	R	482	ENSP00000230036:K482R	ENSP00000230036:K482R	K	-	2	0	GPLD1	24557997	0.006000	0.16342	0.147000	0.22382	0.634000	0.38068	-0.438000	0.06905	-0.534000	0.06315	0.482000	0.46254	AAA	.		0.632	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503	Missense_Mutation
NOTCH4	4855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	32169043	32169043	+	Silent	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:32169043C>T	ENST00000375023.3	-	22	4128	c.3990G>A	c.(3988-3990)agG>agA	p.R1330R		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1330					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CACGATCCTTCCTTACCCAGA	0.622																																					p.R1330R		.											.	NOTCH4-1321	0			c.G3990A						.						59.0	65.0	63.0					6																	32169043		1511	2709	4220	SO:0001819	synonymous_variant	4855	exon22			ATCCTTCCTTACC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3990G>A	6.37:g.32169043C>T		Somatic	229	0		WXS	Illumina HiSeq	Phase_I	142	53	NM_004557	0	0	0	0	0	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	37	CCDS34420.1																																																																																			.		0.622	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
C6orf106	64771	hgsc.bcm.edu;broad.mit.edu	37	6	34664262	34664262	+	Missense_Mutation	SNP	T	T	C	rs369638409		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:34664262T>C	ENST00000374023.3	-	1	362	c.119A>G	c.(118-120)aAt>aGt	p.N40S	RP11-140K17.3_ENST00000606971.1_RNA|C6orf106_ENST00000374026.3_Missense_Mutation_p.N40S|RP11-140K17.3_ENST00000606496.1_RNA	NM_024294.2	NP_077270.1	Q9H6K1	CF106_HUMAN	chromosome 6 open reading frame 106	40										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10						ACCGGCAGGATTGAGCTGGAA	0.662																																					p.N40S		.											.	C6orf106-93	0			c.A119G						.	T	SER/ASN,SER/ASN	0,4406		0,0,2203	62.0	43.0	49.0		119,119	1.8	1.0	6		49	1,8599		0,1,4299	no	missense,missense	C6orf106	NM_022758.4,NM_024294.2	46,46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	40/233,40/299	34664262	1,13005	2203	4300	6503	SO:0001583	missense	64771	exon1			GCAGGATTGAGCT	AF052106	CCDS4795.1, CCDS4796.1	6p21.31	2012-01-27			ENSG00000196821	ENSG00000196821			21215	protein-coding gene	gene with protein product		612217					Standard	XM_005249298		Approved	FLJ22195, dJ391O22.4	uc003ojr.2	Q9H6K1	OTTHUMG00000014553	ENST00000374023.3:c.119A>G	6.37:g.34664262T>C	ENSP00000363135:p.Asn40Ser	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	50	7	NM_024294	0	0	3	4	1	B2R8K7|Q5VV77|Q96MG5|Q9BUR9	Missense_Mutation	SNP	ENST00000374023.3	37	CCDS4796.1	.	.	.	.	.	.	.	.	.	.	T	10.61	1.399579	0.25291	0.0	1.16E-4	ENSG00000196821	ENST00000374023;ENST00000374026	.	.	.	2.99	1.78	0.24846	UBA-like (1);	0.185370	0.46442	D	0.000288	T	0.21186	0.0510	L	0.46670	1.46	0.80722	D	1	B;P	0.46142	0.207;0.873	B;B	0.44163	0.219;0.443	T	0.04178	-1.0971	9	0.33940	T	0.23	-7.2216	2.9531	0.05868	0.2121:0.1602:0.0:0.6277	.	40;40	Q9H6K1-2;Q9H6K1	.;CF106_HUMAN	S	40	.	ENSP00000363135:N40S	N	-	2	0	C6orf106	34772240	1.000000	0.71417	1.000000	0.80357	0.515000	0.34225	3.873000	0.56093	0.535000	0.28714	-0.669000	0.03829	AAT	.		0.662	C6orf106-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040251.1	NM_022758	
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	56501422	56501422	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:56501422C>T	ENST00000361203.3	-	19	2367	c.2360G>A	c.(2359-2361)tGg>tAg	p.W787*	DST_ENST00000370788.2_Nonsense_Mutation_p.W787*|DST_ENST00000370769.4_Nonsense_Mutation_p.W787*|DST_ENST00000312431.6_Nonsense_Mutation_p.W787*|DST_ENST00000244364.6_Nonsense_Mutation_p.W461*|DST_ENST00000421834.2_Nonsense_Mutation_p.W787*|DST_ENST00000446842.2_Nonsense_Mutation_p.W461*|DST_ENST00000370754.5_Nonsense_Mutation_p.W965*|DST_ENST00000518935.1_Nonsense_Mutation_p.W461*|DST_ENST00000370765.6_Nonsense_Mutation_p.W461*			Q03001	DYST_HUMAN	dystonin	787					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GATCCAGCTCCACTGCGTCTG	0.453																																					p.W461X		.											.	DST-523	0			c.G1382A						.						171.0	142.0	152.0					6																	56501422		2203	4300	6503	SO:0001587	stop_gained	667	exon9			CAGCTCCACTGCG	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.2360G>A	6.37:g.56501422C>T	ENSP00000354508:p.Trp787*	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	40	23	NM_001723	0	0	0	0	0	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	C	38	6.731382	0.97796	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	.	.	.	5.25	5.25	0.73442	.	0.000000	0.46145	D	0.000304	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.029	0.92948	0.0:1.0:0.0:0.0	.	.	.	.	X	461;965;787;787;461;787;787;787;461;827;461;461	.	ENSP00000244364:W461X	W	-	2	0	DST	56609381	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.644000	0.83416	2.726000	0.93360	0.579000	0.79373	TGG	.		0.453	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
CEP162	22832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	84872967	84872967	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:84872967T>G	ENST00000403245.3	-	19	2522	c.2408A>C	c.(2407-2409)gAa>gCa	p.E803A	KIAA1009_ENST00000461137.1_5'UTR|KIAA1009_ENST00000257766.4_Missense_Mutation_p.E727A	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TTTGATGTCTTCCAATAAACT	0.318																																					p.E803A		.											.	KIAA1009-91	0			c.A2408C						.						180.0	165.0	170.0					6																	84872967		2203	4300	6503	SO:0001583	missense	22832	exon19			ATGTCTTCCAATA																												ENST00000403245.3:c.2408A>C	6.37:g.84872967T>G	ENSP00000385215:p.Glu803Ala	Somatic	57	0		WXS	Illumina HiSeq	Phase_I	31	11	NM_014895	0	0	0	4	4		Missense_Mutation	SNP	ENST00000403245.3	37	CCDS34494.2	.	.	.	.	.	.	.	.	.	.	T	18.77	3.694256	0.68386	.	.	ENSG00000135315	ENST00000257766;ENST00000403245	T;T	0.33216	1.42;1.42	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000005	T	0.43523	0.1251	M	0.66506	2.035	0.46437	D	0.999046	D	0.71674	0.998	D	0.81914	0.995	T	0.37686	-0.9695	10	0.44086	T	0.13	-22.1089	14.6743	0.68967	0.0:0.0:0.0:1.0	.	803	Q5TB80	QN1_HUMAN	A	727;803	ENSP00000257766:E727A;ENSP00000385215:E803A	ENSP00000257766:E727A	E	-	2	0	KIAA1009	84929686	1.000000	0.71417	0.998000	0.56505	0.910000	0.53928	6.642000	0.74329	1.912000	0.55364	0.460000	0.39030	GAA	.		0.318	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317315.1		
ZNF292	23036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	87943085	87943085	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:87943085T>A	ENST00000369577.3	+	5	624	c.581T>A	c.(580-582)aTg>aAg	p.M194K	ZNF292_ENST00000339907.4_Missense_Mutation_p.M189K	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	194						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TTGTTGGATATGAGAATTAAA	0.313																																					p.M194K		.											.	ZNF292-72	0			c.T581A						.						81.0	77.0	78.0					6																	87943085		1825	4076	5901	SO:0001583	missense	23036	exon5			TGGATATGAGAAT	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.581T>A	6.37:g.87943085T>A	ENSP00000358590:p.Met194Lys	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	85	24	NM_015021	0	0	0	0	0	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	ENST00000369577.3	37	CCDS47457.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.376146	0.82682	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.10860	2.83;2.85	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.24198	0.0586	M	0.72894	2.215	0.58432	D	0.999993	D	0.76494	0.999	D	0.79784	0.993	T	0.01524	-1.1333	10	0.87932	D	0	.	15.658	0.77158	0.0:0.0:0.0:1.0	.	194	O60281	ZN292_HUMAN	K	194;189	ENSP00000358590:M194K;ENSP00000342847:M189K	ENSP00000342847:M189K	M	+	2	0	ZNF292	87999804	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.183000	0.77697	2.158000	0.67659	0.460000	0.39030	ATG	.		0.313	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376192.2	NM_015021	
PNRC1	10957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	89793801	89793801	+	Silent	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:89793801T>C	ENST00000336032.3	+	2	987	c.870T>C	c.(868-870)ccT>ccC	p.P290P	PNRC1_ENST00000354922.3_Silent_p.P105P|PNRC1_ENST00000369472.1_Silent_p.P105P	NM_006813.2	NP_006804.1	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		CACCTTCTCCTAGTGTTCTTC	0.413										Multiple Myeloma(7;0.094)																											p.P290P		.											.	PNRC1-186	0			c.T870C						.						81.0	83.0	83.0					6																	89793801		2203	4300	6503	SO:0001819	synonymous_variant	10957	exon2			TTCTCCTAGTGTT	U03105	CCDS5018.1	6q16.1	2008-02-05	2003-09-25	2003-09-26	ENSG00000146278	ENSG00000146278			17278	protein-coding gene	gene with protein product		606714	"""proline rich 2"""	PROL2		7578250	Standard	NM_006813		Approved	B4-2, PRR2	uc003pmv.3	Q12796	OTTHUMG00000015191	ENST00000336032.3:c.870T>C	6.37:g.89793801T>C		Somatic	124	0		WXS	Illumina HiSeq	Phase_I	105	43	NM_006813	0	0	48	82	34	B2R6Q0|E1P515|Q5T7J6|Q7Z5N0	Silent	SNP	ENST00000336032.3	37	CCDS5018.1																																																																																			.		0.413	PNRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041471.1	NM_006813	
MCM9	254394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	119245294	119245294	+	Splice_Site	SNP	T	T	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:119245294T>C	ENST00000316316.6	-	3	591		c.e3-2		MCM9_ENST00000316068.3_Splice_Site	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9						cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		CAGGCAAACCTGATGGAGAAA	0.393																																					.		.											.	MCM9-515	0			c.305-2A>G						.						118.0	126.0	124.0					6																	119245294		2201	4300	6501	SO:0001630	splice_region_variant	254394	exon3			CAAACCTGATGGA	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.305-2A>G	6.37:g.119245294T>C		Somatic	49	0		WXS	Illumina HiSeq	Phase_I	54	21	NM_017696	0	0	0	0	0	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Splice_Site	SNP	ENST00000316316.6	37	CCDS56447.1	.	.	.	.	.	.	.	.	.	.	T	16.26	3.073982	0.55646	.	.	ENSG00000111877	ENST00000316316;ENST00000316068;ENST00000425154	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5716	0.76341	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MCM9	119286993	1.000000	0.71417	0.963000	0.40424	0.735000	0.41995	7.499000	0.81566	2.072000	0.62099	0.460000	0.39030	.	.		0.393	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042005.4	NM_153255	Intron
FGFR1OP	11116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	167435950	167435950	+	Silent	SNP	C	C	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr6:167435950C>A	ENST00000366847.4	+	8	864	c.633C>A	c.(631-633)ccC>ccA	p.P211P	FGFR1OP_ENST00000349556.4_Silent_p.P191P|RP11-517H2.6_ENST00000609590.1_RNA	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	211					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)			large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		TGTCAGAACCCAAGAGCAAAA	0.428			T	FGFR1	"""MPD, NHL"""																																p.P211P		.		Dom	yes		6	6q27	11116	FGFR1 oncogene partner (FOP)		L	.	FGFR1OP-683	0			c.C633A						.						96.0	92.0	93.0					6																	167435950		2203	4300	6503	SO:0001819	synonymous_variant	11116	exon8			AGAACCCAAGAGC	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.633C>A	6.37:g.167435950C>A		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	38	11	NM_007045	0	0	5	9	4	A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Silent	SNP	ENST00000366847.4	37	CCDS5296.1																																																																																			.		0.428	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043099.2	NM_007045	
ZNF727	442319	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	63537955	63537955	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr7:63537955A>T	ENST00000550760.3	+	4	707	c.528A>T	c.(526-528)gaA>gaT	p.E176D	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	176					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						ACAAATGTGAAGAATGTGGCA	0.353																																					p.E176D		.											.	.	0			c.A528T						.						29.0	23.0	25.0					7																	63537955		692	1591	2283	SO:0001583	missense	442319	exon4			ATGTGAAGAATGT			7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.528A>T	7.37:g.63537955A>T	ENSP00000447987:p.Glu176Asp	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	122	67	NM_001159522	0	0	0	3	3		Missense_Mutation	SNP	ENST00000550760.3	37	CCDS55113.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360407	0.41801	.	.	ENSG00000257482	ENST00000550760	T	0.14893	2.47	0.401	0.401	0.16338	.	.	.	.	.	T	0.16727	0.0402	L	0.41356	1.27	0.19775	N	0.999959	D	0.61080	0.989	P	0.49829	0.623	T	0.15235	-1.0444	8	.	.	.	.	5.0894	0.14700	0.9999:0.0:1.0E-4:0.0	.	176	A8MUV8	ZN727_HUMAN	D	176	ENSP00000447987:E176D	.	E	+	3	2	ZNF727	63175390	0.000000	0.05858	0.286000	0.24833	0.269000	0.26545	-1.645000	0.02000	0.369000	0.24510	0.358000	0.22013	GAA	.		0.353	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001159522	
WBSCR27	155368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	73249148	73249148	+	Silent	SNP	A	A	C			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr7:73249148A>C	ENST00000297873.4	-	6	712	c.663T>G	c.(661-663)tcT>tcG	p.S221S		NM_152559.2	NP_689772.2	Q8N6F8	WBS27_HUMAN	Williams Beuren syndrome chromosome region 27	221										NS(1)|central_nervous_system(1)|lung(2)|prostate(1)	5		Lung NSC(55;0.159)				TCCTTGGCAGAGATGCCGGAT	0.637																																					p.S221S		.											.	WBSCR27-90	0			c.T663G						.						68.0	61.0	63.0					7																	73249148		2203	4300	6503	SO:0001819	synonymous_variant	155368	exon6			TGGCAGAGATGCC	AF534110	CCDS5561.1	7q11.23	2004-07-05			ENSG00000165171	ENSG00000165171			19068	protein-coding gene	gene with protein product		612546					Standard	NM_152559		Approved		uc003tzj.2	Q8N6F8	OTTHUMG00000130033	ENST00000297873.4:c.663T>G	7.37:g.73249148A>C		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	117	42	NM_152559	0	0	26	43	17		Silent	SNP	ENST00000297873.4	37	CCDS5561.1																																																																																			.		0.637	WBSCR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252312.1	NM_152559	
HTR5A	3361	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	154862732	154862732	+	Silent	SNP	G	G	T	rs372855479		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr7:154862732G>T	ENST00000287907.2	+	1	699	c.123G>T	c.(121-123)gtG>gtT	p.V41V	HTR5A-AS1_ENST00000543018.1_Intron|HTR5A-AS1_ENST00000493904.1_Intron|HTR5A-AS1_ENST00000395731.2_Intron	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	41					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	TCTTCGGAGTGCTTATTCTCA	0.642																																					p.V41V													.	HTR5A-155	0			c.G123T						.						103.0	89.0	94.0					7																	154862732		2203	4300	6503	SO:0001819	synonymous_variant	3361	exon1			CGGAGTGCTTATT		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.123G>T	7.37:g.154862732G>T		Somatic	109	1		WXS	Illumina HiSeq	Phase_I	125	49	NM_024012	0	0	0	0	0	Q2M2D2	Silent	SNP	ENST00000287907.2	37	CCDS5936.1																																																																																			.		0.642	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
TRIM35	23087	bcgsc.ca	37	8	27145422	27145422	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr8:27145422C>T	ENST00000305364.4	-	6	1210	c.1127G>A	c.(1126-1128)cGc>cAc	p.R376H	TRIM35_ENST00000521253.1_3'UTR	NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	376	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		CGAGTCCTGGCGCACACGTAC	0.697																																					p.R376H													.	TRIM35-226	0			c.G1127A						.						35.0	31.0	32.0					8																	27145422		2201	4297	6498	SO:0001583	missense	23087	exon6			TCCTGGCGCACAC	AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.1127G>A	8.37:g.27145422C>T	ENSP00000301924:p.Arg376His	Somatic	22	0		WXS	Illumina HiSeq	Phase_1	11	3	NM_171982	0	0	3	3	0	Q86XQ0|Q8WVA4	Missense_Mutation	SNP	ENST00000305364.4	37	CCDS6056.2	.	.	.	.	.	.	.	.	.	.	C	13.92	2.380304	0.42207	.	.	ENSG00000104228	ENST00000305364;ENST00000380544	T	0.61040	0.14	5.42	2.27	0.28462	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.406842	0.21274	N	0.077274	T	0.31979	0.0814	N	0.14661	0.345	0.09310	N	1	P	0.38167	0.621	B	0.36534	0.227	T	0.08932	-1.0698	10	0.33141	T	0.24	.	2.7059	0.05162	0.2211:0.5064:0.0:0.2725	.	376	Q9UPQ4	TRI35_HUMAN	H	376	ENSP00000301924:R376H	ENSP00000301924:R376H	R	-	2	0	TRIM35	27201339	0.024000	0.19004	0.005000	0.12908	0.427000	0.31564	0.264000	0.18497	0.556000	0.29098	0.313000	0.20887	CGC	.		0.697	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219848.2	NM_171982	
SQLE	6713	ucsc.edu;bcgsc.ca	37	8	126033029	126033029	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr8:126033029C>T	ENST00000265896.5	+	10	2346	c.1448C>T	c.(1447-1449)tCc>tTc	p.S483F	SQLE_ENST00000523430.1_Missense_Mutation_p.S388F	NM_003129.3	NP_003120.2	Q14534	ERG1_HUMAN	squalene epoxidase	483					cellular aromatic compound metabolic process (GO:0006725)|cholesterol biosynthetic process (GO:0006695)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|squalene monooxygenase activity (GO:0004506)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		Butenafine(DB01091)|Naftifine(DB00735)|Terbinafine(DB00857)	ATTTTAGATTCCCTGCATCAA	0.348																																					p.S483F													.	SQLE-523	0			c.C1448T						.						75.0	73.0	74.0					8																	126033029		1841	4086	5927	SO:0001583	missense	6713	exon10			TAGATTCCCTGCA	D78130	CCDS47918.1	8q24.1	2014-06-23			ENSG00000104549	ENSG00000104549	1.14.13.132		11279	protein-coding gene	gene with protein product	"""squalene monooxygenase"""	602019				9286711	Standard	NM_003129		Approved		uc011liq.2	Q14534	OTTHUMG00000164990	ENST00000265896.5:c.1448C>T	8.37:g.126033029C>T	ENSP00000265896:p.Ser483Phe	Somatic	54	0		WXS	Illumina HiSeq		40	4	NM_003129	0	0	1	1	0	Q9UEK6	Missense_Mutation	SNP	ENST00000265896.5	37	CCDS47918.1	.	.	.	.	.	.	.	.	.	.	C	17.60	3.429507	0.62844	.	.	ENSG00000104549	ENST00000523430;ENST00000265896;ENST00000541193;ENST00000518931	T;T;T	0.40476	1.03;1.03;1.03	5.87	3.0	0.34707	Squalene epoxidase (1);	0.096455	0.85682	D	0.000000	T	0.61602	0.2360	M	0.83012	2.62	0.58432	D	0.99999	D	0.53462	0.96	P	0.61003	0.882	T	0.63413	-0.6643	10	0.51188	T	0.08	-7.9375	12.0916	0.53730	0.2455:0.6365:0.118:0.0	.	483	Q14534	ERG1_HUMAN	F	388;483;288;135	ENSP00000430331:S388F;ENSP00000265896:S483F;ENSP00000429916:S135F	ENSP00000265896:S483F	S	+	2	0	SQLE	126102211	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	3.631000	0.54280	0.425000	0.26087	0.655000	0.94253	TCC	.		0.348	SQLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381362.1	NM_003129	
ACER2	340485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	19435060	19435060	+	Silent	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr9:19435060C>T	ENST00000340967.2	+	4	507	c.481C>T	c.(481-483)Ctg>Ttg	p.L161L	ACER2_ENST00000380376.1_Silent_p.L112L	NM_001010887.2	NP_001010887.2	Q5QJU3	ACER2_HUMAN	alkaline ceramidase 2	161					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to drug (GO:0035690)|ceramide metabolic process (GO:0006672)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of protein glycosylation in Golgi (GO:0090285)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	ceramidase activity (GO:0017040)|dihydroceramidase activity (GO:0071633)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	13						TTGCACTGCACTGCTCATCGC	0.557																																					p.L161L		.											.	ACER2-516	0			c.C481T						.						219.0	164.0	182.0					9																	19435060		2203	4300	6503	SO:0001819	synonymous_variant	340485	exon4			ACTGCACTGCTCA	AK123581	CCDS34992.1	9p21.3	2013-01-25	2008-12-19	2008-12-19	ENSG00000177076	ENSG00000177076	3.5.1.23	"""Alkaline ceramidase"""	23675	protein-coding gene	gene with protein product		613492	"""N-acylsphingosine amidohydrolase 3-like"""	ASAH3L		18945876	Standard	XM_005251447		Approved	FLJ41587	uc003zny.1	Q5QJU3	OTTHUMG00000019644	ENST00000340967.2:c.481C>T	9.37:g.19435060C>T		Somatic	243	0		WXS	Illumina HiSeq	Phase_I	212	50	NM_001010887	0	0	0	0	0	A2A3R8|Q569G5|Q5VZR7|Q71RD2	Silent	SNP	ENST00000340967.2	37	CCDS34992.1																																																																																			.		0.557	ACER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051864.1	XM_294540	
NUTM2F	54754	bcgsc.ca	37	9	97081337	97081337	+	Nonsense_Mutation	SNP	C	C	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr9:97081337C>A	ENST00000253262.4	-	7	1701	c.1681G>T	c.(1681-1683)Gga>Tga	p.G561*	NUTM2F_ENST00000335456.7_Intron|NUTM2F_ENST00000341207.4_Nonsense_Mutation_p.G546*	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	561																	CTGCCCTGTCCCTGAGGGTCC	0.632																																					p.G561X													.	FAM22F-68	0			c.G1681T						.						9.0	15.0	13.0					9																	97081337		1825	4044	5869	SO:0001587	stop_gained	54754	exon7			CCTGTCCCTGAGG		CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1681G>T	9.37:g.97081337C>A	ENSP00000253262:p.Gly561*	Somatic	144	2		WXS	Illumina HiSeq	Phase_1	127	56	NM_017561	0	0	0	0	0	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Nonsense_Mutation	SNP	ENST00000253262.4	37	CCDS47994.1	.	.	.	.	.	.	.	.	.	.	C	14.40	2.524387	0.44969	.	.	ENSG00000130950	ENST00000253262;ENST00000341207;ENST00000375347	.	.	.	1.45	-0.439	0.12264	.	0.767987	0.11801	N	0.528127	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	3.6141	0.08071	0.0:0.3681:0.0:0.6319	.	.	.	.	X	561;546;395	.	ENSP00000253262:G561X	G	-	1	0	FAM22F	96121158	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.318000	0.08050	-0.110000	0.12022	0.400000	0.26472	GGA	.		0.632	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2	NM_017561	
NUTM2G	441457	bcgsc.ca	37	9	99700841	99700841	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr9:99700841G>T	ENST00000372322.3	+	7	1657	c.1636G>T	c.(1636-1638)Gga>Tga	p.G546*	NUTM2G_ENST00000354649.3_Intron|HIATL2_ENST00000506067.1_Intron	NM_001170741.1	NP_001164212.1	Q5VZR2	NTM2G_HUMAN	NUT family member 2G	546																	GGACCCTCAGGGACAGGGCAG	0.642																																					p.G546X													.	FAM22G-69	0			c.G1636T						.						62.0	71.0	68.0					9																	99700841		692	1591	2283	SO:0001587	stop_gained	441457	exon7			CCTCAGGGACAGG		CCDS43854.1, CCDS55329.1	9q22.33	2013-05-02	2013-03-14	2013-05-02	ENSG00000188152	ENSG00000188152			23449	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member G"""	FAM22G			Standard	NM_001045477		Approved			Q5VZR2	OTTHUMG00000020305	ENST00000372322.3:c.1636G>T	9.37:g.99700841G>T	ENSP00000361397:p.Gly546*	Somatic	659	3		WXS	Illumina HiSeq	Phase_1	444	73	NM_001170741	0	0	0	0	0	A6NNI5|Q5VZR3	Nonsense_Mutation	SNP	ENST00000372322.3	37	CCDS55329.1	.	.	.	.	.	.	.	.	.	.	.	14.35	2.510637	0.44660	.	.	ENSG00000188152	ENST00000372322;ENST00000417159;ENST00000375230	.	.	.	1.01	-1.15	0.09709	.	0.767987	0.11801	N	0.528127	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	3.5235	0.07751	0.5622:0.0:0.4378:0.0	.	.	.	.	X	546;395;427	.	ENSP00000361397:G546X	G	+	1	0	FAM22G	98740662	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.006000	0.13152	-0.335000	0.08451	0.473000	0.43528	GGA	.		0.642	NUTM2G-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053291.2	NM_001170741	
PTGR1	22949	bcgsc.ca	37	9	114332440	114332440	+	Silent	SNP	A	A	G			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr9:114332440A>G	ENST00000407693.2	-	9	1072	c.810T>C	c.(808-810)ttT>ttC	p.F270F	PTGR1_ENST00000538962.1_Silent_p.F270F|PTGR1_ENST00000238248.3_Silent_p.F147F|ZNF483_ENST00000358151.4_Intron|PTGR1_ENST00000309195.5_Silent_p.F270F	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	270					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						GGTAGACGACAAAAGCTTCCA	0.547																																					p.F270F	Ovarian(200;132 2151 7551 19220 46064)												.	PTGR1-90	0			c.T810C						.						53.0	52.0	52.0					9																	114332440		2203	4300	6503	SO:0001819	synonymous_variant	22949	exon9			GACGACAAAAGCT	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.810T>C	9.37:g.114332440A>G		Somatic	97	0		WXS	Illumina HiSeq	Phase_1	64	7	NM_001146108	0	0	31	31	0	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Silent	SNP	ENST00000407693.2	37	CCDS6779.1																																																																																			.		0.547	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
GPR21	2844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	125797664	125797664	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr9:125797664G>T	ENST00000373642.1	+	1	859	c.819G>T	c.(817-819)ttG>ttT	p.L273F	RABGAP1_ENST00000373647.4_Intron|RABGAP1_ENST00000493854.1_Intron|RABGAP1_ENST00000373643.5_Intron	NM_005294.1	NP_005285.1	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	273					G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|negative regulation of insulin receptor signaling pathway (GO:0046627)|positive regulation of multicellular organism growth (GO:0040018)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	15						TCTACTTCTTGTTGGAAAGCT	0.458																																					p.L273F		.											.	GPR21-91	0			c.G819T						.						148.0	128.0	135.0					9																	125797664		2203	4300	6503	SO:0001583	missense	2844	exon2			CTTCTTGTTGGAA	BC066885	CCDS6849.1	9q33	2012-08-21			ENSG00000188394	ENSG00000188394		"""GPCR / Class A : Orphans"""	4476	protein-coding gene	gene with protein product		601909					Standard	NM_005294		Approved		uc011lzk.3	Q99679	OTTHUMG00000020631	ENST00000373642.1:c.819G>T	9.37:g.125797664G>T	ENSP00000362746:p.Leu273Phe	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	129	49	NM_005294	0	0	0	0	0	B2R8W9|Q6NXU2	Missense_Mutation	SNP	ENST00000373642.1	37	CCDS6849.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365299	0.24684	.	.	ENSG00000188394	ENST00000373642	T	0.41758	0.99	5.93	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	0.281802	0.23228	U	0.050493	T	0.33352	0.0860	M	0.64630	1.985	0.80722	D	1	P	0.41232	0.743	B	0.36244	0.22	T	0.05099	-1.0906	10	0.44086	T	0.13	-6.8862	5.7514	0.18148	0.2774:0.2257:0.4969:0.0	.	273	Q99679	GPR21_HUMAN	F	273	ENSP00000362746:L273F	ENSP00000362746:L273F	L	+	3	2	GPR21	124837485	0.993000	0.37304	0.989000	0.46669	0.976000	0.68499	0.535000	0.23114	0.080000	0.16959	-0.218000	0.12543	TTG	.		0.458	GPR21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053965.1	NM_005294	
SPTAN1	6709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	131386741	131386741	+	Silent	SNP	G	G	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr9:131386741G>A	ENST00000372731.4	+	45	6062	c.5952G>A	c.(5950-5952)aaG>aaA	p.K1984K	SPTAN1_ENST00000372739.3_Silent_p.K1989K|SPTAN1_ENST00000358161.5_Silent_p.K1989K	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1984					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TCAACTGGAAGGCGGACGTGG	0.562																																					p.K1989K	NSCLC(120;833 1744 2558 35612 37579)	.											.	SPTAN1-158	0			c.G5967A						.						64.0	53.0	57.0					9																	131386741		2203	4300	6503	SO:0001819	synonymous_variant	6709	exon46			CTGGAAGGCGGAC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.5952G>A	9.37:g.131386741G>A		Somatic	165	0		WXS	Illumina HiSeq	Phase_I	159	68	NM_001130438	0	0	19	32	13	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Silent	SNP	ENST00000372731.4	37	CCDS6905.1																																																																																			.		0.562	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054472.1	NM_003127	
BCOR	54880	hgsc.bcm.edu;bcgsc.ca	37	X	39923132	39923132	+	Silent	SNP	G	G	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chrX:39923132G>T	ENST00000378444.4	-	8	3804	c.3576C>A	c.(3574-3576)acC>acA	p.T1192T	BCOR_ENST00000397354.3_Intron|BCOR_ENST00000378455.4_Intron|BCOR_ENST00000342274.4_Intron|BCOR_ENST00000378463.1_Intron	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1192					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CCTTCAGGTTGGTCAGCTCAC	0.453			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.T1192T		.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR-229	0			c.C3576A						.						57.0	55.0	55.0					X																	39923132		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon8			CAGGTTGGTCAGC	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.3576C>A	X.37:g.39923132G>T		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	56	4	NM_001123385	0	0	0	0	0	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	37	CCDS48093.1																																																																																			.		0.453	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
DCX	1641	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	110654011	110654011	+	Silent	SNP	C	C	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chrX:110654011C>T	ENST00000338081.3	-	1	363	c.192G>A	c.(190-192)ccG>ccA	p.P64P	DCX_ENST00000496551.1_Intron|DCX_ENST00000488120.1_Intron|DCX_ENST00000371993.2_Intron|DCX_ENST00000356915.2_Intron|DCX_ENST00000356220.3_Intron	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	64					axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						ATTGGAACTTCGGGCTAAATA	0.433																																					p.P64P													.	DCX-554	0			c.G192A						.						167.0	158.0	161.0					X																	110654011		2203	4300	6503	SO:0001819	synonymous_variant	1641	exon1			GAACTTCGGGCTA	AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.192G>A	X.37:g.110654011C>T		Somatic	129	2		WXS	Illumina HiSeq	Phase_I	97	74	NM_000555	0	0	0	0	0	A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Silent	SNP	ENST00000338081.3	37	CCDS14556.1	.	.	.	.	.	.	.	.	.	.	c	4.746	0.138661	0.09083	.	.	ENSG00000077279	ENST00000358070	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	T	0.60287	0.2257	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57688	-0.7768	4	.	.	.	.	9.6932	0.40141	0.0:0.7737:0.2263:0.0	.	.	.	.	Q	56	.	.	R	-	2	0	DCX	110540667	0.959000	0.32827	1.000000	0.80357	0.995000	0.86356	1.431000	0.34925	2.442000	0.82660	0.509000	0.49947	CGA	.		0.433	DCX-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357058.1	NM_178153	
MFN2	9927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	12052666	12052667	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:12052666_12052667delAC	ENST00000235329.5	+	4	552_553	c.230_231delAC	c.(229-231)gacfs	p.D77fs	MFN2_ENST00000497302.1_3'UTR|MFN2_ENST00000444836.1_Frame_Shift_Del_p.D77fs	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	77					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		CAGGTTCTGGACGTCAAAGGTT	0.525																																					p.77_77del		.											.	MFN2-91	0			c.230_231del						.																																			SO:0001589	frameshift_variant	9927	exon4			.	AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.230_231delAC	1.37:g.12052666_12052667delAC	ENSP00000235329:p.Asp77fs	Somatic	472	0		WXS	Illumina HiSeq	Phase_I	347	129	NM_014874	0	0	0	0	0	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Frame_Shift_Del	DEL	ENST00000235329.5	37	CCDS30587.1																																																																																			.		0.525	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006859.2	NM_014874	
NUAK2	81788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	205272646	205272646	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:205272646delG	ENST00000367157.3	-	7	1945	c.1819delC	c.(1819-1821)ctgfs	p.L607fs		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CAGTCTGTCAGGGAAAAGCAG	0.642																																					p.L607X		.											.	NUAK2-391	0			c.1819delC						.						55.0	53.0	54.0					1																	205272646		2203	4300	6503	SO:0001589	frameshift_variant	81788	exon7			.	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.1819delC	1.37:g.205272646delG	ENSP00000356125:p.Leu607fs	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	85	32	NM_030952	0	0	0	0	0		Nonsense_Mutation	DEL	ENST00000367157.3	37	CCDS1453.1																																																																																			.		0.642	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
C2CD3	26005	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	73748552	73748561	+	Frame_Shift_Del	DEL	AGGTTACTGG	AGGTTACTGG	-	rs146977583		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	AGGTTACTGG	AGGTTACTGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr11:73748552_73748561delAGGTTACTGG	ENST00000334126.7	-	30	6069_6078	c.5843_5852delCCAGTAACCT	c.(5842-5853)tccagtaacctgfs	p.SSNL1948fs	C2CD3_ENST00000313663.7_Frame_Shift_Del_p.SSNL1948fs			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1948					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TTGCAACACCAGGTTACTGGATTTCTCCAG	0.49																																					p.1948_1951del		.											.	C2CD3-75	0			c.5843_5852del						.																																			SO:0001589	frameshift_variant	26005	exon30			.	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5843_5852delCCAGTAACCT	11.37:g.73748552_73748561delAGGTTACTGG	ENSP00000334379:p.Ser1948fs	Somatic	145	0		WXS	Illumina HiSeq	Phase_I	97	31	NM_015531	0	0	0	0	0	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Frame_Shift_Del	DEL	ENST00000334126.7	37																																																																																				.		0.490	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
PDZRN4	29951	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	41966603	41966603	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:41966603delA	ENST00000402685.2	+	10	2030	c.2022delA	c.(2020-2022)agafs	p.R674fs	PDZRN4_ENST00000539469.2_Frame_Shift_Del_p.R416fs|PDZRN4_ENST00000298919.7_Frame_Shift_Del_p.R414fs	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	674							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AAGAACTGAGAAACATTGAGC	0.458																																					p.R674fs		.											.	PDZRN4-296	0			c.2022delA						.						112.0	100.0	104.0					12																	41966603		2203	4300	6503	SO:0001589	frameshift_variant	29951	exon10			.	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2022delA	12.37:g.41966603delA	ENSP00000384197:p.Arg674fs	Somatic	155	0		WXS	Illumina HiSeq	Phase_I	212	64	NM_001164595	0	0	0	0	0	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Frame_Shift_Del	DEL	ENST00000402685.2	37	CCDS53777.1																																																																																			.		0.458	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
GALNT6	11226	broad.mit.edu;bcgsc.ca	37	12	51751976	51751982	+	Frame_Shift_Del	DEL	ACCAGGA	ACCAGGA	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	ACCAGGA	ACCAGGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:51751976_51751982delACCAGGA	ENST00000543196.2	-	8	1637_1643	c.1432_1438delTCCTGGT	c.(1432-1440)tcctggtacfs	p.SWY478fs	GALNT6_ENST00000356317.3_Frame_Shift_Del_p.SWY478fs			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	478					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TTGTGCAGGTACCAGGAAAAGTTGTGA	0.517																																					p.478_480del													.	GALNT6-92	0			c.1432_1438del						.																																			SO:0001589	frameshift_variant	11226	exon9			GCAGGTACCAGGA	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.1432_1438delTCCTGGT	12.37:g.51751976_51751982delACCAGGA	ENSP00000444171:p.Ser478fs	Somatic	195	0		WXS	Illumina HiSeq	Phase_I	245	33	NM_007210	0	0	0	0	0	Q8IYH4|Q9H6G2|Q9UIV5	Frame_Shift_Del	DEL	ENST00000543196.2	37	CCDS8813.1																																																																																			.		0.517	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
RNF34	80196	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	121855373	121855374	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr12:121855373_121855374delAG	ENST00000392464.2	+	3	361_362	c.292_293delAG	c.(292-294)agafs	p.R98fs	RNF34_ENST00000361234.5_Frame_Shift_Del_p.R98fs|RNF34_ENST00000555076.1_Intron|RNF34_ENST00000392465.3_Frame_Shift_Del_p.R99fs					ring finger protein 34, E3 ubiquitin protein ligase											breast(1)|large_intestine(1)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000432)|Epithelial(86;0.00233)		AAATCTCCGTAGATGTTCTACT	0.416																																					p.99_99del		.											.	RNF34-226	0			c.295_296del						.																																			SO:0001589	frameshift_variant	80196	exon4			.	AF306709, AB084914	CCDS9221.1, CCDS31915.1, CCDS73538.1	12q24.31	2012-02-23	2012-02-23			ENSG00000170633		"""RING-type (C3HC4) zinc fingers"""	17297	protein-coding gene	gene with protein product		608299	"""ring finger protein 34"""			12118383	Standard	NM_025126		Approved	RIFF, FLJ21786, RIF	uc001ual.2	Q969K3		ENST00000392464.2:c.292_293delAG	12.37:g.121855373_121855374delAG	ENSP00000376257:p.Arg98fs	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	82	44	NM_194271	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000392464.2	37																																																																																				.		0.416	RNF34-005	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000413892.1	NM_194271	
BRMS1L	84312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	36300676	36300676	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr14:36300676delT	ENST00000216807.7	+	2	402	c.203delT	c.(202-204)cttfs	p.L68fs	BRMS1L_ENST00000543183.1_Frame_Shift_Del_p.L20fs	NM_032352.3	NP_115728.2	Q5PSV4	BRM1L_HUMAN	breast cancer metastasis-suppressor 1-like	68					regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	Breast(36;0.137)|Hepatocellular(127;0.158)		Lung(8;1.7e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.00467)|all cancers(34;0.0157)|BRCA - Breast invasive adenocarcinoma(188;0.158)	GBM - Glioblastoma multiforme(112;0.0333)		ATGTCCAATCTTGAAAAACAG	0.333																																					p.L68fs		.											.	BRMS1L-226	0			c.203delT						.						116.0	117.0	116.0					14																	36300676		2203	4300	6503	SO:0001589	frameshift_variant	84312	exon2			.	AK096496	CCDS32066.1	14q13.1	2005-09-22	2003-12-02	2003-12-03		ENSG00000100916			20512	protein-coding gene	gene with protein product			"""breast cancer metastasis-suppressor 1"""	BRMS1			Standard	XM_005268128		Approved	MGC11296, FLJ39177	uc001wtl.3	Q5PSV4		ENST00000216807.7:c.203delT	14.37:g.36300676delT	ENSP00000216807:p.Leu68fs	Somatic	242	0		WXS	Illumina HiSeq	Phase_I	203	80	NM_032352	0	0	0	0	0	A6NFW5|A6NH45|B2RD65|Q9BRI4	Frame_Shift_Del	DEL	ENST00000216807.7	37	CCDS32066.1																																																																																			.		0.333	BRMS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409601.2	NM_032352	
KATNBL1	79768	broad.mit.edu;bcgsc.ca	37	15	34445066	34445072	+	Frame_Shift_Del	DEL	ATATGTT	ATATGTT	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	ATATGTT	ATATGTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr15:34445066_34445072delATATGTT	ENST00000256544.3	-	4	499_505	c.357_363delAACATAT	c.(355-363)cgaacatatfs	p.RTY119fs		NM_024713.2	NP_078989.1	Q9H079	KTBL1_HUMAN	katanin p80 subunit B-like 1	119						nucleolus (GO:0005730)											AGTTAACCAAATATGTTCGACTATCAT	0.411																																					p.119_121del													.	.	0			c.357_363del						.																																			SO:0001589	frameshift_variant	79768	exon4			AACCAAATATGTT	AL136908	CCDS10034.1	15q13.2	2012-09-27	2012-09-27	2012-09-27	ENSG00000134152	ENSG00000134152			26199	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 29"""	C15orf29		11230166	Standard	NM_024713		Approved	FLJ22557	uc001zhp.3	Q9H079	OTTHUMG00000129368	ENST00000256544.3:c.357_363delAACATAT	15.37:g.34445066_34445072delATATGTT	ENSP00000256544:p.Arg119fs	Somatic	59	0		WXS	Illumina HiSeq	Phase_I	45	9	NM_024713	0	0	0	0	0	A8KAF6|Q2TAC0|Q9H670	Frame_Shift_Del	DEL	ENST00000256544.3	37	CCDS10034.1																																																																																			.		0.411	KATNBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251520.1	NM_024713	
TECR	9524	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	14674655	14674657	+	In_Frame_Del	DEL	CGT	CGT	-	rs367952165|rs201634024		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	CGT	CGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:14674655_14674657delCGT	ENST00000215567.5	+	5	344_346	c.207_209delCGT	c.(205-210)cccgtg>ccg	p.V70del	TECR_ENST00000600083.1_5'UTR|TECR_ENST00000596073.1_5'UTR|TECR_ENST00000436007.2_In_Frame_Del_p.V85del|TECR_ENST00000596164.1_3'UTR	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	70					cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						AGAAGCTGCCCGTGGGCACCACG	0.66																																					p.69_70del		.											.	TECR-90	0			c.207_209del						.																																			SO:0001651	inframe_deletion	9524	exon5			.	AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.207_209delCGT	19.37:g.14674655_14674657delCGT	ENSP00000215567:p.Val70del	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	87	35	NM_138501	0	0	0	0	0	B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	In_Frame_Del	DEL	ENST00000215567.5	37	CCDS12313.1																																																																																			.		0.660	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466000.1	NM_138501	
ZNF836	162962	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	52658860	52658860	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:52658860delT	ENST00000322146.8	-	5	2597	c.2076delA	c.(2074-2076)aaafs	p.K692fs	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Frame_Shift_Del_p.K692fs	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	692					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						AATTGTAAGGTTTCTCTCCAG	0.393																																					p.K692fs		.											.	ZNF836-46	0			c.2076delA						.						71.0	76.0	74.0					19																	52658860		2071	4245	6316	SO:0001589	frameshift_variant	162962	exon5			.	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.2076delA	19.37:g.52658860delT	ENSP00000325038:p.Lys692fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	36	20	NM_001102657	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000322146.8	37	CCDS46162.1																																																																																			.		0.393	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
ZNF274	10782	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	58723654	58723658	+	Frame_Shift_Del	DEL	TACCT	TACCT	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	TACCT	TACCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:58723654_58723658delTACCT	ENST00000326804.4	+	9	1563_1567	c.1104_1108delTACCT	c.(1102-1110)gataccttgfs	p.TL369fs	ZNF274_ENST00000345813.3_Frame_Shift_Del_p.TL337fs|ZNF274_ENST00000424679.2_Frame_Shift_Del_p.TL264fs|ZNF274_ENST00000597818.1_3'UTR	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	370					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		CATTAGAAGATACCTTGCAGGGTGG	0.483																																					.		.											.	ZNF274-91	0			.						.																																			SO:0001589	frameshift_variant	10782	.			.	AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.1104_1108delTACCT	19.37:g.58723654_58723658delTACCT	ENSP00000321209:p.Thr369fs	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	50	12	.	0	0	0	0	0	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Targeted_Region	DEL	ENST00000326804.4	37																																																																																				.		0.483	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_133502	
CLK1	1195	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	201721517	201721517	+	Frame_Shift_Del	DEL	G	G	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr2:201721517delG	ENST00000321356.4	-	9	1080	c.945delC	c.(943-945)accfs	p.T315fs	CLK1_ENST00000409769.2_Frame_Shift_Del_p.T138fs|CLK1_ENST00000434813.2_Frame_Shift_Del_p.T357fs	NM_004071.3	NP_004062.2	P49759	CLK1_HUMAN	CDC-like kinase 1	315	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(12)|ovary(1)|pancreas(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GATTTATTAAGGTGCGTTCAT	0.328																																					p.T357fs		.											.	CLK1-784	0			c.1071delC						.						163.0	159.0	161.0					2																	201721517		2202	4300	6502	SO:0001589	frameshift_variant	1195	exon9			.	L29219	CCDS2331.1, CCDS54427.1	2q33	2008-05-02			ENSG00000013441	ENSG00000013441		"""CDC-like kinases"""	2068	protein-coding gene	gene with protein product		601951				9856501	Standard	NM_004071		Approved		uc002uwe.2	P49759	OTTHUMG00000132784	ENST00000321356.4:c.945delC	2.37:g.201721517delG	ENSP00000326830:p.Thr315fs	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	164	98	NM_001162407	0	0	0	0	0	B4DFW7|Q0P694|Q8N5V8	Frame_Shift_Del	DEL	ENST00000321356.4	37	CCDS2331.1																																																																																			.		0.328	CLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256192.2		
SALL4	57167	hgsc.bcm.edu;bcgsc.ca	37	20	50401006	50401006	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr20:50401006delA	ENST00000217086.4	-	4	3071	c.2960delT	c.(2959-2961)atcfs	p.I987fs	SALL4_ENST00000371539.3_Frame_Shift_Del_p.I210fs|SALL4_ENST00000395997.3_Frame_Shift_Del_p.I550fs	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	987					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GATCACAGAGATCTCATTGGT	0.572																																					p.I987fs		.											.	SALL4-92	0			c.2960delT						.						85.0	78.0	80.0					20																	50401006		2203	4300	6503	SO:0001589	frameshift_variant	57167	exon4			.	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2960delT	20.37:g.50401006delA	ENSP00000217086:p.Ile987fs	Somatic	193	0		WXS	Illumina HiSeq	Phase_I	211	66	NM_020436	0	0	0	0	0	A2A2D8|Q540H3|Q6Y8G6	Frame_Shift_Del	DEL	ENST00000217086.4	37	CCDS13438.1																																																																																			.		0.572	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
TRNT1	51095	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	3182301	3182309	+	In_Frame_Del	DEL	CAGAGATCT	CAGAGATCT	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	CAGAGATCT	CAGAGATCT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:3182301_3182309delCAGAGATCT	ENST00000251607.6	+	4	552_560	c.450_458delCAGAGATCT	c.(448-459)cgcagagatctc>cgc	p.RDL151del	TRNT1_ENST00000280591.6_In_Frame_Del_p.RDL151del	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	151					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		ATGCGGAACGCAGAGATCTCACTATAAAT	0.354																																					p.150_153del		.											.	TRNT1-90	0			c.450_458del						.																																			SO:0001651	inframe_deletion	51095	exon4			.	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.450_458delCAGAGATCT	3.37:g.3182301_3182309delCAGAGATCT	ENSP00000251607:p.Arg151_Leu153del	Somatic	151	0		WXS	Illumina HiSeq	Phase_I	104	24	NM_182916	0	0	0	0	0	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	In_Frame_Del	DEL	ENST00000251607.6	37	CCDS2561.2																																																																																			.		0.354	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
PAM	5066	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	102203042	102203042	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr5:102203042delT	ENST00000438793.3	+	2	625	c.155delT	c.(154-156)attfs	p.I52fs	PAM_ENST00000348126.2_Frame_Shift_Del_p.I52fs|PAM_ENST00000274392.9_De_novo_Start_OutOfFrame|PAM_ENST00000513648.1_3'UTR|PAM_ENST00000379787.4_De_novo_Start_InFrame|PAM_ENST00000304400.7_Frame_Shift_Del_p.I52fs|PAM_ENST00000455264.2_Frame_Shift_Del_p.I52fs|PAM_ENST00000346918.2_Frame_Shift_Del_p.I52fs	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	52	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	GTAGTTCCTATTGATTCATCA	0.373																																					p.I52fs		.											.	PAM-68	0			c.155delT						.						168.0	148.0	155.0					5																	102203042		2203	4300	6503	SO:0001589	frameshift_variant	5066	exon2			.	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.155delT	5.37:g.102203042delT	ENSP00000396493:p.Ile52fs	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	79	21	NM_138822	0	0	0	0	0	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Frame_Shift_Del	DEL	ENST00000438793.3	37	CCDS54885.1																																																																																			.		0.373	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
PAM	5066	hgsc.bcm.edu	37	5	102203043	102203044	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr5:102203043_102203044delTG	ENST00000438793.3	+	2	626_627	c.156_157delTG	c.(154-159)attgatfs	p.D53fs	PAM_ENST00000348126.2_Frame_Shift_Del_p.D53fs|PAM_ENST00000274392.9_5'UTR|PAM_ENST00000513648.1_3'UTR|PAM_ENST00000379787.4_5'UTR|PAM_ENST00000304400.7_Frame_Shift_Del_p.D53fs|PAM_ENST00000455264.2_Frame_Shift_Del_p.D53fs|PAM_ENST00000346918.2_Frame_Shift_Del_p.D53fs	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	53	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TAGTTCCTATTGATTCATCAGA	0.376																																					p.52_53del		.											.	PAM-68	0			c.156_157del						.																																			SO:0001589	frameshift_variant	5066	exon2			.	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.156_157delTG	5.37:g.102203043_102203044delTG	ENSP00000396493:p.Asp53fs	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	80	17	NM_138822	0	0	0	0	0	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Frame_Shift_Del	DEL	ENST00000438793.3	37	CCDS54885.1																																																																																			.		0.376	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
GDAP1	54332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	75274164	75274164	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr8:75274164delA	ENST00000220822.7	+	4	610	c.530delA	c.(529-531)gaafs	p.E177fs	GDAP1_ENST00000521096.1_3'UTR|GDAP1_ENST00000434412.2_Frame_Shift_Del_p.E109fs	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	177	GST C-terminal.				cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			CTTGCTGAAGAAAACCCAGAT	0.373																																					p.E177fs		.											.	GDAP1-90	0			c.530delA						.						118.0	110.0	113.0					8																	75274164		2203	4300	6503	SO:0001589	frameshift_variant	54332	exon4			.		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.530delA	8.37:g.75274164delA	ENSP00000220822:p.Glu177fs	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	31	16	NM_018972	0	0	0	0	0	A8K957|E7FJF3|E7FJF4	Frame_Shift_Del	DEL	ENST00000220822.7	37	CCDS34911.1																																																																																			.		0.373	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379061.1	NM_018972	
PTGR1	22949	broad.mit.edu;bcgsc.ca	37	9	114332439	114332439	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr9:114332439delC	ENST00000407693.2	-	9	1073	c.811delG	c.(811-813)gtcfs	p.V272fs	PTGR1_ENST00000538962.1_Frame_Shift_Del_p.V272fs|PTGR1_ENST00000238248.3_Frame_Shift_Del_p.V149fs|ZNF483_ENST00000358151.4_Intron|PTGR1_ENST00000309195.5_Frame_Shift_Del_p.V272fs	NM_001146108.1	NP_001139580.1	Q14914	PTGR1_HUMAN	prostaglandin reductase 1	272					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)|2-alkenal reductase [NAD(P)] activity (GO:0032440)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)	11						CGGTAGACGACAAAAGCTTCC	0.547																																					p.V271fs	Ovarian(200;132 2151 7551 19220 46064)												.	PTGR1-90	0			c.811delG						.						53.0	52.0	52.0					9																	114332439		2203	4300	6503	SO:0001589	frameshift_variant	22949	exon9			AGACGACAAAAGC	D49387	CCDS6779.1, CCDS55331.1	9q32	2008-06-04	2008-06-02	2008-06-02	ENSG00000106853	ENSG00000106853	1.3.1.74, 1.3.1.48		18429	protein-coding gene	gene with protein product	"""zinc binding alcohol dehydrogenase domain containing 3"""	601274	"""leukotriene B4 12-hydroxydehydrogenase"""	LTB4DH		8576264, 17449869	Standard	NM_001146109		Approved	ZADH3	uc004bfh.2	Q14914	OTTHUMG00000020493	ENST00000407693.2:c.811delG	9.37:g.114332439delC	ENSP00000385763:p.Val272fs	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	61	7	NM_001146108	0	0	0	0	0	A8K0N2|B4DPK3|F5GY50|Q8IYQ0|Q9H1X6	Frame_Shift_Del	DEL	ENST00000407693.2	37	CCDS6779.1																																																																																			.		0.547	PTGR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053647.2		
GATA1	2623	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	48650855	48650855	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chrX:48650855delA	ENST00000376670.3	+	4	835	c.724delA	c.(724-726)atcfs	p.I242fs	GATA1_ENST00000376665.3_Frame_Shift_Del_p.I242fs	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	242					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						CAGGCCCCTCATCCGGCCCAA	0.562			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																p.I242fs	Pancreas(9;429 505 11287 29617)	.		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	GATA1-1315	0			c.724delA						.						62.0	58.0	59.0					X																	48650855		2203	4300	6503	SO:0001589	frameshift_variant	2623	exon4			.	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.724delA	X.37:g.48650855delA	ENSP00000365858:p.Ile242fs	Somatic	148	0		WXS	Illumina HiSeq	Phase_I	132	99	NM_002049	0	0	0	0	0	Q96GB8	Frame_Shift_Del	DEL	ENST00000376670.3	37	CCDS14305.1																																																																																			.		0.562	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056517.1	NM_002049	
PRRG3	79057	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	150869380	150869380	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chrX:150869380delC	ENST00000370353.3	+	4	961	c.571delC	c.(571-573)cccfs	p.P192fs	PRRG3_ENST00000538575.1_Frame_Shift_Del_p.P192fs			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	192						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					CACCACCCCTCCCCCCTCCTA	0.647																																					p.P191fs		.											.	PRRG3-134	0			c.571delC						.						55.0	44.0	48.0					X																	150869380		2203	4300	6503	SO:0001589	frameshift_variant	79057	exon4			.	AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.571delC	X.37:g.150869380delC	ENSP00000359378:p.Pro192fs	Somatic	149	0		WXS	Illumina HiSeq	Phase_I	154	102	NM_024082	0	0	0	0	0	A1A523|A1A575|Q8N2N6	Frame_Shift_Del	DEL	ENST00000370353.3	37	CCDS14699.1																																																																																			.		0.647	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060880.1	NM_024082	
ATG4C	84938	broad.mit.edu;bcgsc.ca	37	1	63284805	63284806	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr1:63284805_63284806insA	ENST00000317868.4	+	5	731_732	c.524_525insA	c.(523-528)acaattfs	p.I176fs	ATG4C_ENST00000371120.3_Frame_Shift_Ins_p.I176fs	NM_032852.3	NP_116241.2	Q96DT6	ATG4C_HUMAN	autophagy related 4C, cysteine peptidase	176					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|protein targeting to membrane (GO:0006612)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)		ATG4C/FBXO38(2)	NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(3)|ovary(1)|prostate(2)	19						AAAACCCCAACAATTTCTCTGA	0.366																																					p.T175fs													.	ATG4C-91	0			c.524_525insA						.																																			SO:0001589	frameshift_variant	84938	exon5			CCCCAACAATTTC	AK027773	CCDS623.1	1p31.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000125703	ENSG00000125703			16040	protein-coding gene	gene with protein product		611339	"""AUT (S. cerevisiae)-like 1, cysteine endopeptidase; AUT-like 1, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog C (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog C (S. cerevisiae)"""	AUTL1, APG4C		12446702	Standard	NM_032852		Approved	FLJ14867, AUTL3	uc001dau.3	Q96DT6	OTTHUMG00000009142	ENST00000317868.4:c.526dupA	1.37:g.63284807_63284807dupA	ENSP00000322159:p.Ile176fs	Somatic	47	0		WXS	Illumina HiSeq	Phase_I	34	9	NM_178221	0	0	0	0	0	A6NLR8|D3DQ58|Q96K04	Frame_Shift_Ins	INS	ENST00000317868.4	37	CCDS623.1																																																																																			.		0.366	ATG4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025332.2	NM_032852	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	23906370	23906371	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr13:23906370_23906371insA	ENST00000382292.3	-	9	11917_11918	c.11644_11645insT	c.(11644-11646)tctfs	p.S3882fs	SACS_ENST00000382298.3_Frame_Shift_Ins_p.S3882fs|SACS_ENST00000402364.1_Frame_Shift_Ins_p.S3132fs			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3882					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GAACAGACCAGAAACTACTCTC	0.416																																					p.S3882fs		.											.	SACS-298	0			c.11645_11646insT						.																																			SO:0001589	frameshift_variant	26278	exon10			.	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11645dupT	13.37:g.23906373_23906373dupA	ENSP00000371729:p.Ser3882fs	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	46	14	NM_014363	0	0	0	0	0	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Frame_Shift_Ins	INS	ENST00000382292.3	37	CCDS9300.2																																																																																			.		0.416	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
DENND4A	10260	hgsc.bcm.edu;bcgsc.ca	37	15	65956990	65956991	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr15:65956990_65956991insT	ENST00000431932.2	-	30	5505_5506	c.5297_5298insA	c.(5296-5298)agtfs	p.S1766fs	DENND4A_ENST00000443035.3_Frame_Shift_Ins_p.S1809fs	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1766					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TTTTTACCATACTTTTCAACAG	0.337																																					p.S1809fs		.											.	DENND4A-229	0			c.5427_5428insA						.																																			SO:0001589	frameshift_variant	10260	exon31			.	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.5297_5298insA	15.37:g.65956990_65956991insT	ENSP00000396830:p.Ser1766fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	53	15	NM_001144823	0	0	0	0	0	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Frame_Shift_Ins	INS	ENST00000431932.2	37	CCDS45285.1																																																																																			.		0.337	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
PRPF8	10594	broad.mit.edu	37	17	1585300	1585301	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr17:1585300_1585301insT	ENST00000572621.1	-	4	731_732	c.466_467insA	c.(466-468)agafs	p.R156fs	PRPF8_ENST00000304992.6_Frame_Shift_Ins_p.R156fs			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	156					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CCTCCTATCTCTTTTTTCTCGG	0.51																																					p.R156fs													.	PRPF8-525	0			c.467_468insA						.																																			SO:0001589	frameshift_variant	10594	exon5			CTATCTCTTTTTT	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.467dupA	17.37:g.1585306_1585306dupT	ENSP00000460348:p.Arg156fs	Somatic	110	0		WXS	Illumina HiSeq	Phase_I	123	10	NM_006445	0	0	0	0	0	O14547|O75965	Frame_Shift_Ins	INS	ENST00000572621.1	37	CCDS11010.1																																																																																			.		0.510	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
RNF168	165918	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	196214285	196214286	+	Frame_Shift_Ins	INS	-	-	T	rs375146769		TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr3:196214285_196214286insT	ENST00000318037.3	-	3	1136_1137	c.542_543insA	c.(541-543)aagfs	p.K181fs		NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	181					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		CAATGCTTAGCTTTCTTGCCAG	0.47																																					p.K181fs		.											.	RNF168-90	0			c.543_544insA						.																																			SO:0001589	frameshift_variant	165918	exon3			.	AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.543dupA	3.37:g.196214288_196214288dupT	ENSP00000320898:p.Lys181fs	Somatic	155	0		WXS	Illumina HiSeq	Phase_I	180	89	NM_152617	0	0	0	0	0	Q8NA67|Q96NS4	Frame_Shift_Ins	INS	ENST00000318037.3	37	CCDS3317.1																																																																																			.		0.470	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340778.1	NM_152617	
MFAP3L	9848	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	170913188	170913189	+	Frame_Shift_Ins	INS	-	-	A			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr4:170913188_170913189insA	ENST00000361618.3	-	3	877_878	c.570_571insT	c.(568-573)tttaggfs	p.R191fs	RP11-6E9.4_ENST00000508955.1_RNA|MFAP3L_ENST00000393704.3_Frame_Shift_Ins_p.R88fs	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		CCTTCGGTCCTAAAGAACTCAT	0.525																																					p.R191_T192delinsX		.											.	MFAP3L-91	0			c.571_572insT						.																																			SO:0001589	frameshift_variant	9848	exon3			.	AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.571dupT	4.37:g.170913191_170913191dupA	ENSP00000354583:p.Arg191fs	Somatic	186	0		WXS	Illumina HiSeq	Phase_I	162	52	NM_021647	0	0	0	0	0	A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Nonsense_Mutation	INS	ENST00000361618.3	37	CCDS34103.1																																																																																			.		0.525	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363043.2	NM_021647	
MADCAM1	8174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	504882	504883	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	CC	CC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chr19:504882_504883CC>AT	ENST00000215637.3	+	5	1112_1113	c.1066_1067CC>AT	c.(1066-1068)CCa>ATa	p.P356I	MADCAM1_ENST00000382683.4_Missense_Mutation_p.P174I|TPGS1_ENST00000359315.5_5'Flank|MADCAM1_ENST00000346144.4_Missense_Mutation_p.P269I|AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000587541.1_Missense_Mutation_p.P137I	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	356					aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCCACCCACCAGCTTCTCTG	0.673																																					p.P380I		.											.	MADCAM1-90	0			c.C806T						.																																			SO:0001583	missense	8174	exon4			ACCCACCAGCTTC	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	Exception_encountered	19.37:g.504882_504883delinsAT	ENSP00000215637:p.Pro356Ile	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	22.0	NM_130762	0	0	0	0	0	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	DNP	ENST00000215637.3	37	CCDS12028.1																																																																																			.		0.673	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
AKAP17A	8227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	1714402	1714403	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-HE-A5NI-01A-11D-A26P-10	TCGA-HE-A5NI-10A-01D-A26P-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	40a609bb-2c8f-4146-83c4-e7b0d1b23619	a08286b5-7084-40d6-bbfe-9601634344bc	g.chrX:1714402_1714403GG>AA	ENST00000313871.3	+	3	1084_1085	c.888_889GG>AA	c.(886-891)gaGGag>gaAAag	p.E297K	AKAP17A_ENST00000381261.3_Missense_Mutation_p.E297K	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	297					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						AGGAAGCGGAGGAGAGGCAGCG	0.604																																					p.E297K		.											.	AKAP17A-40	0			c.G889A						.																																			SO:0001583	missense	8227	exon3			GCGGAGGAGAGGC	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	Exception_encountered	X.37:g.1714402_1714403delinsAA	ENSP00000324827:p.Glu297Lys	Somatic	152.0	1.0		WXS	Illumina HiSeq	Phase_I	89.0	73.0	NM_005088	0	0	0	0	0	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	DNP	ENST00000313871.3	37	CCDS14116.1																																																																																			.		0.604	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
