#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM125	128218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	43739036	43739036	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:43739036A>G	ENST00000432792.2	+	4	1213	c.643A>G	c.(643-645)Att>Gtt	p.I215V	TMEM125_ENST00000439858.1_Missense_Mutation_p.I215V			Q96AQ2	TM125_HUMAN	transmembrane protein 125	215						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CACATCCAGCATTGCCAGCCT	0.627																																					p.I215V		.											.	TMEM125-153	0			c.A643G						.						35.0	29.0	31.0					1																	43739036		2203	4300	6503	SO:0001583	missense	128218	exon4			TCCAGCATTGCCA	BC016858	CCDS480.1	1p34.2	2006-02-16			ENSG00000179178	ENSG00000179178			28275	protein-coding gene	gene with protein product							Standard	NM_144626		Approved	MGC17299	uc021oml.1	Q96AQ2	OTTHUMG00000007288	ENST00000432792.2:c.643A>G	1.37:g.43739036A>G	ENSP00000429275:p.Ile215Val	Somatic	205	0		WXS	Illumina HiSeq	Phase_I	150	80	NM_144626	0	0	15	23	8	D3DPX1	Missense_Mutation	SNP	ENST00000432792.2	37	CCDS480.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.340390	0.41498	.	.	ENSG00000179178	ENST00000439858;ENST00000432792	T;T	0.44482	0.92;0.92	4.91	4.91	0.64330	.	0.123297	0.53938	D	0.000057	T	0.28599	0.0708	N	0.19112	0.55	0.29819	N	0.830963	P	0.34462	0.454	B	0.31337	0.128	T	0.19844	-1.0293	10	0.36615	T	0.2	.	14.5656	0.68173	1.0:0.0:0.0:0.0	.	215	Q96AQ2	TM125_HUMAN	V	215	ENSP00000429775:I215V;ENSP00000429275:I215V	ENSP00000429275:I215V	I	+	1	0	TMEM125	43511623	1.000000	0.71417	0.997000	0.53966	0.784000	0.44337	2.906000	0.48735	1.842000	0.53543	0.460000	0.39030	ATT	.		0.627	TMEM125-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019032.2	NM_144626	
C1orf185	284546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	51578193	51578193	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:51578193G>C	ENST00000371759.2	+	2	74	c.74G>C	c.(73-75)gGt>gCt	p.G25A	C1orf185_ENST00000467127.1_5'UTR|C1orf185_ENST00000474016.1_3'UTR	NM_001136508.1	NP_001129980.1	Q5T7R7	CA185_HUMAN	chromosome 1 open reading frame 185	25						integral component of membrane (GO:0016021)		p.0?(3)		endometrium(1)	1						TTGGGAATTGGTTTCTTTGCT	0.303																																					p.G25A		.											.	.	3	Whole gene deletion(3)	central_nervous_system(2)|thyroid(1)	c.G74C						.						228.0	187.0	199.0					1																	51578193		692	1591	2283	SO:0001583	missense	284546	exon2			GAATTGGTTTCTT	AK130995	CCDS44142.1	1p32.3	2012-07-27			ENSG00000204006	ENSG00000204006			28096	protein-coding gene	gene with protein product							Standard	NM_001136508		Approved	FLJ27485	uc001csh.3	Q5T7R7	OTTHUMG00000008084	ENST00000371759.2:c.74G>C	1.37:g.51578193G>C	ENSP00000360824:p.Gly25Ala	Somatic	26	0		WXS	Illumina HiSeq	Phase_I	32	16	NM_001136508	0	0	0	0	0	A6NHS3	Missense_Mutation	SNP	ENST00000371759.2	37	CCDS44142.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220781	0.58560	.	.	ENSG00000204006	ENST00000371759	.	.	.	4.65	2.52	0.30459	.	0.186132	0.26345	N	0.024907	T	0.42698	0.1214	N	0.24115	0.695	0.33357	D	0.571871	D	0.65815	0.995	P	0.55965	0.788	T	0.55988	-0.8053	9	0.87932	D	0	-11.586	6.7794	0.23638	0.0:0.1719:0.4748:0.3532	.	25	Q5T7R7	CA185_HUMAN	A	25	.	ENSP00000360824:G25A	G	+	2	0	C1orf185	51350781	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.006000	0.40874	1.221000	0.43506	0.563000	0.77884	GGT	.		0.303	C1orf185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022123.1	NM_001136508	
RPTN	126638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152127305	152127305	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:152127305C>T	ENST00000316073.3	-	3	2334	c.2270G>A	c.(2269-2271)cGa>cAa	p.R757Q		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	757	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TTGCCTGTCTCGTCTCTGATG	0.512																																					p.R757Q		.											.	RPTN-68	0			c.G2270A						.						835.0	660.0	713.0					1																	152127305		1568	3582	5150	SO:0001583	missense	126638	exon3			CTGTCTCGTCTCT	AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.2270G>A	1.37:g.152127305C>T	ENSP00000317895:p.Arg757Gln	Somatic	367	1		WXS	Illumina HiSeq	Phase_I	399	158	NM_001122965	0	0	0	0	0	B7ZBZ3	Missense_Mutation	SNP	ENST00000316073.3	37	CCDS41397.1	.	.	.	.	.	.	.	.	.	.	C	4.873	0.162231	0.09287	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.12569	2.67	5.46	-6.92	0.01644	.	1.609200	0.05690	N	0.591997	T	0.02688	0.0081	N	0.25286	0.73	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.25187	-1.0139	10	0.29301	T	0.29	0.289	14.9735	0.71251	0.0:0.6643:0.0:0.3357	.	757	Q6XPR3	RPTN_HUMAN	Q	757;412	ENSP00000317895:R757Q	ENSP00000317895:R757Q	R	-	2	0	RPTN	150393929	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-1.478000	0.02329	-2.128000	0.00818	-1.183000	0.01708	CGA	.		0.512	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333867.1	XM_371312	
NUP210L	91181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154108401	154108401	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:154108401T>C	ENST00000368559.3	-	7	969	c.898A>G	c.(898-900)Aga>Gga	p.R300G	NUP210L_ENST00000271854.3_Missense_Mutation_p.R300G	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	300					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			AGTGCAACTCTATGGTCTTGC	0.418																																					p.R300G		.											.	NUP210L-77	0			c.A898G						.						108.0	99.0	102.0					1																	154108401		1876	4103	5979	SO:0001583	missense	91181	exon7			CAACTCTATGGTC	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.898A>G	1.37:g.154108401T>C	ENSP00000357547:p.Arg300Gly	Somatic	90	0		WXS	Illumina HiSeq	Phase_I	94	29	NM_001159484	0	0	0	0	0	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	37	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	T	10.65	1.410097	0.25465	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.05447	3.44;3.44	5.0	2.53	0.30540	.	0.593551	0.16379	N	0.216995	T	0.01387	0.0045	L	0.44542	1.39	0.09310	N	1	B;B	0.31125	0.201;0.309	B;B	0.21917	0.037;0.037	T	0.48714	-0.9011	10	0.23302	T	0.38	-11.1939	4.5019	0.11869	0.0:0.1237:0.3878:0.4885	.	300;300	E7EP56;Q5VU65	.;P210L_HUMAN	G	300	ENSP00000357547:R300G;ENSP00000271854:R300G	ENSP00000271854:R300G	R	-	1	2	NUP210L	152375025	0.003000	0.15002	0.002000	0.10522	0.896000	0.52359	1.475000	0.35409	0.321000	0.23259	0.533000	0.62120	AGA	.		0.418	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
TMEM9	252839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	201123024	201123024	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:201123024C>T	ENST00000367330.1	-	1	544	c.28G>A	c.(28-30)Gtc>Atc	p.V10I	TMEM9_ENST00000485839.2_Missense_Mutation_p.V10I|TMEM9_ENST00000367332.1_Missense_Mutation_p.V10I|TMEM9_ENST00000367334.5_Missense_Mutation_p.V10I|TMEM9_ENST00000367333.2_Missense_Mutation_p.V10I			Q9P0T7	TMEM9_HUMAN	transmembrane protein 9	10					transport (GO:0006810)	integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)				liver(1)|lung(1)|stomach(1)	3		Breast(1374;0.000301)				AAACACCCGACCACAGCCACC	0.582																																					p.V10I		.											.	TMEM9-90	0			c.G28A						.						70.0	66.0	67.0					1																	201123024		2203	4300	6503	SO:0001583	missense	252839	exon2			ACCCGACCACAGC		CCDS1408.1, CCDS73001.1	1q41	2008-02-05			ENSG00000116857	ENSG00000116857			18823	protein-coding gene	gene with protein product							Standard	NM_001288565		Approved	TMEM9A	uc001gvy.3	Q9P0T7	OTTHUMG00000035831	ENST00000367330.1:c.28G>A	1.37:g.201123024C>T	ENSP00000356299:p.Val10Ile	Somatic	275	0		WXS	Illumina HiSeq	Phase_I	251	89	NM_016456	0	0	12	21	9	B1ALM6|Q96NQ9|Q9BQF5	Missense_Mutation	SNP	ENST00000367330.1	37	CCDS1408.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.198740	0.58126	.	.	ENSG00000116857	ENST00000367334;ENST00000367332;ENST00000367330;ENST00000367329;ENST00000367333;ENST00000455367;ENST00000435310;ENST00000414605	.	.	.	4.66	3.75	0.43078	.	0.790844	0.10935	N	0.617956	T	0.20210	0.0486	N	0.19112	0.55	0.19300	N	0.999979	B;B;B;B	0.31581	0.329;0.049;0.008;0.003	B;B;B;B	0.25987	0.065;0.039;0.003;0.004	T	0.11641	-1.0579	9	0.08599	T	0.76	-18.4909	9.8146	0.40844	0.0:0.9026:0.0:0.0974	.	10;10;10;10	B4DJZ4;B4E1H4;B1ALM5;Q9P0T7	.;.;.;TMEM9_HUMAN	I	10	.	ENSP00000356298:V10I	V	-	1	0	TMEM9	199389647	0.000000	0.05858	0.772000	0.31596	0.991000	0.79684	0.133000	0.15912	1.175000	0.42826	0.557000	0.71058	GTC	.		0.582	TMEM9-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087160.1	NM_016456	
IDI2	91734	broad.mit.edu	37	10	1066741	1066741	+	Missense_Mutation	SNP	C	C	T	rs368608756		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr10:1066741C>T	ENST00000277517.1	-	4	396	c.332G>A	c.(331-333)cGt>cAt	p.R111H	IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000434470.1_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000420381.1_RNA	NM_033261.2	NP_150286.1	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	111	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isopentenyl diphosphate metabolic process (GO:0046490)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		TGCTTGCAGACGCCTCTGGGC	0.572													C|||	1	0.000199681	0.0	0.0014	5008	,	,		16338	0.0		0.0	False		,,,				2504	0.0				p.R111H													.	IDI2-90	0			c.G332A						.						100.0	86.0	91.0					10																	1066741		2203	4300	6503	SO:0001583	missense	91734	exon4			TGCAGACGCCTCT	AF271725	CCDS7055.1	10p15.3	2003-11-19			ENSG00000148377	ENSG00000148377			23487	protein-coding gene	gene with protein product		615389				12477932	Standard	NM_033261		Approved	IPPI2	uc001ifv.1	Q9BXS1	OTTHUMG00000017537	ENST00000277517.1:c.332G>A	10.37:g.1066741C>T	ENSP00000277517:p.Arg111His	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	90	4	NM_033261	0	0	0	0	0		Missense_Mutation	SNP	ENST00000277517.1	37	CCDS7055.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673904	0.47781	.	.	ENSG00000148377	ENST00000277517	T	0.08193	3.12	4.09	-1.8	0.07907	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.116280	0.53938	U	0.000051	T	0.25568	0.0622	M	0.88979	2.995	0.20403	N	0.999907	D	0.71674	0.998	D	0.65573	0.936	T	0.05354	-1.0890	10	0.87932	D	0	-4.7047	8.2637	0.31801	0.0:0.6495:0.1046:0.246	.	111	Q9BXS1	IDI2_HUMAN	H	111	ENSP00000277517:R111H	ENSP00000277517:R111H	R	-	2	0	IDI2	1056741	0.103000	0.21917	0.000000	0.03702	0.001000	0.01503	2.002000	0.40835	-1.050000	0.03230	-2.005000	0.00442	CGT	.		0.572	IDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046411.1	NM_033261	
MYPN	84665	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	69959137	69959137	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr10:69959137C>T	ENST00000358913.5	+	17	3786	c.3298C>T	c.(3298-3300)Ccg>Tcg	p.P1100S	MYPN_ENST00000354393.2_Missense_Mutation_p.P825S|MYPN_ENST00000540630.1_Missense_Mutation_p.P1100S	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1100	Ig-like 4.|Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GAGTGGTTTACCGCCCCCGGA	0.507																																					p.P1100S		.											.	MYPN-95	0			c.C3298T						.						56.0	48.0	50.0					10																	69959137		2203	4300	6503	SO:0001583	missense	84665	exon17			GGTTTACCGCCCC	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3298C>T	10.37:g.69959137C>T	ENSP00000351790:p.Pro1100Ser	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	129	47	NM_032578	0	0	0	0	0	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	C	30	5.053409	0.93793	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.80393	-1.37;-1.37;-1.37	5.38	5.38	0.77491	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94072	0.8100	H	0.97806	4.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.95767	0.8805	9	.	.	.	.	19.3311	0.94288	0.0:1.0:0.0:0.0	.	1100;825;1100	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	S	825;825;1100;1100	ENSP00000346369:P825S;ENSP00000351790:P1100S;ENSP00000441668:P1100S	.	P	+	1	0	MYPN	69629143	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	7.595000	0.82710	2.813000	0.96785	0.655000	0.94253	CCG	.		0.507	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
TRIM8	81603	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104416093	104416093	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr10:104416093C>A	ENST00000302424.7	+	5	1121	c.999C>A	c.(997-999)ttC>ttA	p.F333L	TRIM8_ENST00000487927.1_3'UTR	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	333					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCAAGCTCTTCCTGAACGAAG	0.607																																					p.F333L		.											.	TRIM8-227	0			c.C999A						.						59.0	46.0	50.0					10																	104416093		2203	4300	6503	SO:0001583	missense	81603	exon5			GCTCTTCCTGAAC	AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.999C>A	10.37:g.104416093C>A	ENSP00000302120:p.Phe333Leu	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	200	86	NM_030912	0	0	24	55	31	A6NI31|Q9C028	Missense_Mutation	SNP	ENST00000302424.7	37	CCDS31274.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940287	0.52972	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	T	0.77489	-1.1	5.67	3.82	0.43975	.	0.000000	0.85682	D	0.000000	T	0.76205	0.3955	L	0.29908	0.895	0.58432	D	0.99999	P	0.52842	0.956	P	0.62184	0.899	T	0.69525	-0.5122	10	0.08837	T	0.75	.	12.1033	0.53796	0.0:0.8608:0.0:0.1392	.	333	Q9BZR9	TRIM8_HUMAN	L	333;332	ENSP00000302120:F333L	ENSP00000302120:F333L	F	+	3	2	TRIM8	104406083	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.588000	0.36633	0.753000	0.32945	0.555000	0.69702	TTC	.		0.607	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050084.3	NM_030912	
MUC2	4583	broad.mit.edu;bcgsc.ca	37	11	1093344	1093344	+	Silent	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr11:1093344G>T	ENST00000441003.2	+	30	5190	c.5163G>T	c.(5161-5163)ccG>ccT	p.P1721P	MUC2_ENST00000333592.6_Silent_p.P9P|MUC2_ENST00000359061.5_Silent_p.P1688P|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.P1688P(1)|p.P1721P(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccccaaccccgacacccatct	0.642																																					p.P1721P													.	MUC2-90	2	Substitution - coding silent(2)	lung(2)	c.G5163T						.						231.0	269.0	256.0					11																	1093344		1975	3757	5732	SO:0001819	synonymous_variant	4583	exon30			AACCCCGACACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5163G>T	11.37:g.1093344G>T		Somatic	159	1		WXS	Illumina HiSeq	Phase_I	182	11	NM_002457	0	0	0	0	0	Q14878	Silent	SNP	ENST00000441003.2	37																																																																																				.		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
GPR83	10888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	94113422	94113422	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr11:94113422T>A	ENST00000243673.2	-	4	1336	c.1165A>T	c.(1165-1167)Aat>Tat	p.N389Y	GPR83_ENST00000539203.2_Missense_Mutation_p.N347Y	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	389					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGGCCATCATTCTTCTCTGTC	0.562																																					p.N389Y		.											.	GPR83-92	0			c.A1165T						.						83.0	82.0	82.0					11																	94113422		2201	4298	6499	SO:0001583	missense	10888	exon4			CATCATTCTTCTC	AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.1165A>T	11.37:g.94113422T>A	ENSP00000243673:p.Asn389Tyr	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	175	76	NM_016540	0	0	0	0	0	B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	ENST00000243673.2	37	CCDS8297.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.689837	0.00100	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.61392	0.11;0.22	5.75	0.538	0.17150	.	0.659318	0.17607	N	0.168232	T	0.31544	0.0800	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17319	-1.0373	10	0.21014	T	0.42	.	9.6421	0.39846	0.0:0.4117:0.0:0.5883	.	389	Q9NYM4	GPR83_HUMAN	Y	389;347	ENSP00000243673:N389Y;ENSP00000441550:N347Y	ENSP00000243673:N389Y	N	-	1	0	GPR83	93753070	0.772000	0.28567	0.077000	0.20336	0.003000	0.03518	0.384000	0.20668	0.096000	0.17463	-0.250000	0.11733	AAT	.		0.562	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396232.1	NM_016540	
PIWIL4	143689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	94340737	94340737	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr11:94340737A>G	ENST00000299001.6	+	14	1982	c.1771A>G	c.(1771-1773)Atc>Gtc	p.I591V	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	591	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GATGATGAGTATCGCCACCAA	0.453																																					p.I591V		.											.	PIWIL4-91	0			c.A1771G						.						89.0	82.0	84.0					11																	94340737		2201	4298	6499	SO:0001583	missense	143689	exon14			ATGAGTATCGCCA	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1771A>G	11.37:g.94340737A>G	ENSP00000299001:p.Ile591Val	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	95	37	NM_152431	0	0	0	0	0	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Missense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	A	0.557	-0.846779	0.02671	.	.	ENSG00000134627	ENST00000299001	T	0.30448	1.53	4.75	-9.49	0.00587	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	1.548280	0.03817	N	0.266847	T	0.10337	0.0253	N	0.03881	-0.34	0.40307	D	0.978677	B	0.14438	0.01	B	0.21546	0.035	T	0.24621	-1.0155	10	0.06099	T	0.92	0.1986	8.5103	0.33213	0.4048:0.3269:0.2683:0.0	.	591	Q7Z3Z4	PIWL4_HUMAN	V	591	ENSP00000299001:I591V	ENSP00000299001:I591V	I	+	1	0	PIWIL4	93980385	0.000000	0.05858	0.000000	0.03702	0.135000	0.20990	-0.634000	0.05477	-2.120000	0.00826	-0.472000	0.04984	ATC	.		0.453	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
ARHGAP32	9743	broad.mit.edu	37	11	128936739	128936739	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr11:128936739T>A	ENST00000310343.9	-	6	513	c.514A>T	c.(514-516)Agt>Tgt	p.S172C	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.S98C	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	172	PX; atypical.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TCTTCATAACTTCTTTTAACA	0.348																																					p.S172C													.	ARHGAP32-231	0			c.A514T						.						58.0	54.0	55.0					11																	128936739		1566	3578	5144	SO:0001583	missense	9743	exon6			CATAACTTCTTTT	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.514A>T	11.37:g.128936739T>A	ENSP00000310561:p.Ser172Cys	Somatic	24	1		WXS	Illumina HiSeq	Phase_I	25	13	NM_001142685	0	0	2	2	0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.529999	0.85706	.	.	ENSG00000134909	ENST00000310343;ENST00000524655;ENST00000457677;ENST00000525234	T;T;T	0.32515	1.45;1.45;1.45	5.04	5.04	0.67666	Phox homologous domain (3);	.	.	.	.	T	0.58452	0.2123	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.961	T	0.65195	-0.6227	9	0.87932	D	0	.	13.8913	0.63740	0.0:0.0:0.0:1.0	.	106;172	Q86T64;A7KAX9	.;RHG32_HUMAN	C	172;98;106;146	ENSP00000310561:S172C;ENSP00000432468:S98C;ENSP00000432303:S146C	ENSP00000310561:S172C	S	-	1	0	ARHGAP32	128441949	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.647000	0.67923	2.123000	0.65237	0.455000	0.32223	AGT	.		0.348	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
XPOT	11260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	64827226	64827226	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:64827226C>A	ENST00000332707.5	+	19	2824	c.2295C>A	c.(2293-2295)ttC>ttA	p.F765L		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	765	Necessary for tRNA-binding, cytoplasmic localization and nuclear export.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		AACAGATGTTCATGCCCCTGC	0.383																																					p.F765L		.											.	XPOT-652	0			c.C2295A						.						142.0	139.0	140.0					12																	64827226		2203	4300	6503	SO:0001583	missense	11260	exon19			GATGTTCATGCCC	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.2295C>A	12.37:g.64827226C>A	ENSP00000327821:p.Phe765Leu	Somatic	122	0		WXS	Illumina HiSeq	Phase_I	126	74	NM_007235	0	0	3	17	14	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	C	9.351	1.065624	0.20067	.	.	ENSG00000184575	ENST00000332707	T	0.35048	1.33	4.99	1.1	0.20463	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.25121	0.0610	L	0.43923	1.385	0.58432	D	0.999994	B	0.26483	0.15	B	0.19946	0.027	T	0.05632	-1.0873	9	.	.	.	.	8.7565	0.34648	0.0:0.4567:0.0:0.5433	.	765	O43592	XPOT_HUMAN	L	765	ENSP00000327821:F765L	.	F	+	3	2	XPOT	63113493	1.000000	0.71417	0.998000	0.56505	0.566000	0.35808	0.960000	0.29253	-0.000000	0.14550	0.650000	0.86243	TTC	.		0.383	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
UHRF1BP1L	23074	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	100453199	100453199	+	Missense_Mutation	SNP	C	C	G	rs374748413		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:100453199C>G	ENST00000279907.7	-	14	2068	c.1856G>C	c.(1855-1857)cGa>cCa	p.R619P	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.R269P	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	619								p.R619Q(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GTCAGAATGTCGACAGTTTGG	0.353																																					p.R619P		.											.	UHRF1BP1L-24	1	Substitution - Missense(1)	large_intestine(1)	c.G1856C						.						47.0	50.0	49.0					12																	100453199		2203	4300	6503	SO:0001583	missense	23074	exon14			GAATGTCGACAGT		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1856G>C	12.37:g.100453199C>G	ENSP00000279907:p.Arg619Pro	Somatic	83	0		WXS	Illumina HiSeq	Phase_I	103	22	NM_015054	0	0	0	2	2	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	37	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.110310	0.56398	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.10960	2.83;2.82	5.56	5.56	0.83823	.	0.071690	0.56097	D	0.000028	T	0.26159	0.0638	L	0.51422	1.61	0.80722	D	1	D	0.63046	0.992	P	0.59115	0.852	T	0.00102	-1.2063	10	0.48119	T	0.1	-7.7813	19.5255	0.95203	0.0:1.0:0.0:0.0	.	619	A0JNW5	UH1BL_HUMAN	P	619;269	ENSP00000279907:R619P;ENSP00000444824:R269P	ENSP00000279907:R619P	R	-	2	0	UHRF1BP1L	98977330	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	4.740000	0.62087	2.624000	0.88883	0.650000	0.86243	CGA	.		0.353	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
SCYL2	55681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	100707272	100707272	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:100707272A>T	ENST00000360820.2	+	7	1362	c.925A>T	c.(925-927)Aat>Tat	p.N309Y		NM_017988.4	NP_060458.3	Q6P3W7	SCYL2_HUMAN	SCY1-like 2 (S. cerevisiae)	309	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endosome to lysosome transport (GO:0008333)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of receptor internalization (GO:0002092)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(4)|lung(15)|ovary(2)|skin(1)	41						GCTACTGTTAAATGTAACTCC	0.363																																					p.N309Y		.											.	SCYL2-336	0			c.A925T						.						94.0	84.0	87.0					12																	100707272		2203	4300	6503	SO:0001583	missense	55681	exon7			CTGTTAAATGTAA	AB037781	CCDS9076.1	12q23.1	2005-01-20				ENSG00000136021			19286	protein-coding gene	gene with protein product						10718198	Standard	NM_017988		Approved	KIAA1360	uc001thn.3	Q6P3W7	OTTHUMG00000170319	ENST00000360820.2:c.925A>T	12.37:g.100707272A>T	ENSP00000354061:p.Asn309Tyr	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	102	27	NM_017988	0	0	8	11	3	A8KAB5|Q96EF4|Q96ST4|Q9H7V5|Q9NVH3|Q9P2I7	Missense_Mutation	SNP	ENST00000360820.2	37	CCDS9076.1	.	.	.	.	.	.	.	.	.	.	A	29.9	5.046858	0.93740	.	.	ENSG00000136021	ENST00000549687;ENST00000258506;ENST00000360820	T;T	0.66815	-0.23;-0.23	5.87	5.87	0.94306	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.039673	0.85682	D	0.000000	T	0.78349	0.4269	M	0.68952	2.095	0.80722	D	1	P	0.45240	0.854	P	0.57009	0.811	T	0.79680	-0.1702	10	0.62326	D	0.03	.	16.2736	0.82632	1.0:0.0:0.0:0.0	.	309	Q6P3W7	SCYL2_HUMAN	Y	309;136;309	ENSP00000448366:N309Y;ENSP00000354061:N309Y	ENSP00000258506:N136Y	N	+	1	0	SCYL2	99231403	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	8.769000	0.91742	2.247000	0.74100	0.477000	0.44152	AAT	.		0.363	SCYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408493.2	NM_017988	
IFT81	28981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	110565896	110565896	+	Nonsense_Mutation	SNP	C	C	T	rs372027811		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:110565896C>T	ENST00000242591.5	+	3	696	c.190C>T	c.(190-192)Cga>Tga	p.R64*	IFT81_ENST00000361948.4_Nonsense_Mutation_p.R64*|IFT81_ENST00000552912.1_Nonsense_Mutation_p.R64*	NM_014055.3	NP_054774.2	Q8WYA0	IFT81_HUMAN	intraflagellar transport 81	64	CH (calponin-homology)-like region.				cilium assembly (GO:0042384)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|spermatogenesis (GO:0007283)	centrosome (GO:0005813)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	tubulin binding (GO:0015631)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)	10						GACAGCCAAACGAATGTTGAG	0.343																																					p.R64X		.											.	IFT81-91	0			c.C190T						.	C	stop/ARG,stop/ARG,stop/ARG	2,4404	4.2+/-10.8	0,2,2201	125.0	120.0	122.0		190,190,190	2.9	1.0	12		122	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained,stop-gained	IFT81	NM_001143779.1,NM_014055.3,NM_031473.3	,,	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	,,	64/677,64/677,64/432	110565896	3,13003	2203	4300	6503	SO:0001587	stop_gained	28981	exon3			GCCAAACGAATGT	AF139540	CCDS9142.1, CCDS41831.1	12q24.13	2014-07-03	2014-07-03	2005-11-02		ENSG00000122970		"""Intraflagellar transport homologs"""	14313	protein-coding gene	gene with protein product		605489	"""carnitine deficiency-associated, expressed in ventricle 1"", ""intraflagellar transport 81 homolog (Chlamydomonas)"""	CDV1		11130971	Standard	NM_014055		Approved	CDV-1R, MGC4027	uc001tqi.3	Q8WYA0	OTTHUMG00000169326	ENST00000242591.5:c.190C>T	12.37:g.110565896C>T	ENSP00000242591:p.Arg64*	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	119	36	NM_014055	0	0	7	7	0	Q2YDY1|Q8NB51|Q9BSV2|Q9UNY8	Nonsense_Mutation	SNP	ENST00000242591.5	37	CCDS41831.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.830743	0.91036	4.54E-4	1.16E-4	ENSG00000122970	ENST00000361948;ENST00000552912;ENST00000242591;ENST00000546374	.	.	.	5.96	2.88	0.33553	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6056	16.1793	0.81889	0.5747:0.4253:0.0:0.0	.	.	.	.	X	64	.	ENSP00000242591:R64X	R	+	1	2	IFT81	109050279	0.998000	0.40836	0.997000	0.53966	0.972000	0.66771	1.423000	0.34837	0.248000	0.21435	0.655000	0.94253	CGA	.		0.343	IFT81-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403529.1	NM_014055	
OLFM4	10562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	53624827	53624827	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr13:53624827C>A	ENST00000219022.2	+	5	1532	c.1454C>A	c.(1453-1455)cCt>cAt	p.P485H		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	485	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		AACTATAACCCTTTTGACCAG	0.378																																					p.P485H		.											.	OLFM4-69	0			c.C1454A						.						99.0	100.0	100.0					13																	53624827		2203	4300	6503	SO:0001583	missense	10562	exon5			ATAACCCTTTTGA	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1454C>A	13.37:g.53624827C>A	ENSP00000219022:p.Pro485His	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	72	43	NM_006418	0	0	0	0	0	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	37	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.816222	0.90790	.	.	ENSG00000102837	ENST00000219022	T	0.19669	2.13	5.64	5.64	0.86602	Olfactomedin-like (3);	0.049423	0.85682	D	0.000000	T	0.58409	0.2120	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67465	-0.5664	10	0.87932	D	0	.	19.7082	0.96082	0.0:1.0:0.0:0.0	.	485	Q6UX06	OLFM4_HUMAN	H	485	ENSP00000219022:P485H	ENSP00000219022:P485H	P	+	2	0	OLFM4	52522828	1.000000	0.71417	0.882000	0.34594	0.914000	0.54420	6.095000	0.71439	2.651000	0.90000	0.585000	0.79938	CCT	.		0.378	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
C14orf105	55195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	57960296	57960296	+	Silent	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr14:57960296T>A	ENST00000216445.3	-	1	274	c.138A>T	c.(136-138)tcA>tcT	p.S46S	C14orf105_ENST00000422976.2_Silent_p.S46S|C14orf105_ENST00000526336.1_Silent_p.S46S|C14orf105_ENST00000534126.1_Silent_p.S46S	NM_001283057.1|NM_018168.2	NP_001269986.1|NP_060638.2	Q9NVL8	CN105_HUMAN	chromosome 14 open reading frame 105	46										breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)	11						GTCTTGCCAGTGAATATGAAG	0.438																																					p.S46S		.											.	C14orf105-90	0			c.A138T						.						126.0	127.0	127.0					14																	57960296		2203	4300	6503	SO:0001819	synonymous_variant	55195	exon1			TGCCAGTGAATAT	AK001512	CCDS9730.1, CCDS61458.1, CCDS61459.1	14q22.2	2012-09-25			ENSG00000100557	ENSG00000100557			20189	protein-coding gene	gene with protein product							Standard	XM_005267806		Approved	FLJ10650	uc001xcy.2	Q9NVL8	OTTHUMG00000140317	ENST00000216445.3:c.138A>T	14.37:g.57960296T>A		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	75	35	NM_018168	0	0	5	14	9	Q53G04	Silent	SNP	ENST00000216445.3	37	CCDS9730.1																																																																																			.		0.438	C14orf105-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276921.2	NM_018168	
PAPLN	89932	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	73712877	73712877	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr14:73712877T>G	ENST00000554301.1	+	4	491	c.328T>G	c.(328-330)Tac>Gac	p.Y110D	PAPLN_ENST00000381166.3_Missense_Mutation_p.Y110D|PAPLN_ENST00000427855.1_Missense_Mutation_p.Y110D|RNU6-419P_ENST00000517030.1_RNA|RP4-647C14.2_ENST00000554614.1_RNA|PAPLN_ENST00000340738.5_Missense_Mutation_p.Y110D|PAPLN_ENST00000555445.1_Missense_Mutation_p.Y110D			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	110						basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		GCTGCCCTACTACAGCGGTGA	0.642																																					p.Y110D		.											.	PAPLN-70	0			c.T328G						.						8.0	10.0	10.0					14																	73712877		2163	4255	6418	SO:0001583	missense	89932	exon5			CCCTACTACAGCG	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.328T>G	14.37:g.73712877T>G	ENSP00000451803:p.Tyr110Asp	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	60	20	NM_173462	0	0	0	0	0	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Missense_Mutation	SNP	ENST00000554301.1	37		.	.	.	.	.	.	.	.	.	.	T	23.3	4.398999	0.83120	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000394134;ENST00000554301;ENST00000555445	T;T;T;T;T	0.03441	3.93;3.93;3.93;3.93;3.93	4.26	4.26	0.50523	.	.	.	.	.	T	0.17662	0.0424	M	0.82132	2.575	0.47698	D	0.999491	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.72625	0.978;0.951;0.975	T	0.00593	-1.1654	9	0.62326	D	0.03	.	13.222	0.59894	0.0:0.0:0.0:1.0	.	110;110;110	O95428-5;O95428;O95428-6	.;PPN_HUMAN;.	D	110	ENSP00000345395:Y110D;ENSP00000403403:Y110D;ENSP00000370558:Y110D;ENSP00000451803:Y110D;ENSP00000451729:Y110D	ENSP00000216658:Y110D	Y	+	1	0	PAPLN	72782630	1.000000	0.71417	0.997000	0.53966	0.671000	0.39405	4.002000	0.57053	1.789000	0.52484	0.379000	0.24179	TAC	.		0.642	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462	
TDP1	55775	bcgsc.ca	37	14	90459808	90459808	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr14:90459808G>T	ENST00000335725.4	+	14	1772	c.1522G>T	c.(1522-1524)Gct>Tct	p.A508S	TDP1_ENST00000393452.3_Missense_Mutation_p.A508S|TDP1_ENST00000393454.2_Missense_Mutation_p.A508S|TDP1_ENST00000357382.3_Missense_Mutation_p.A269S|TDP1_ENST00000555880.1_Missense_Mutation_p.A508S	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	508					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		CAGTAAAATTGCTTGGTTCCT	0.403								Repair of DNA-protein crosslinks																													p.A508S													.	TDP1-92	0			c.G1522T						.						98.0	90.0	93.0					14																	90459808		2203	4300	6503	SO:0001583	missense	55775	exon14			AAAATTGCTTGGT	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.1522G>T	14.37:g.90459808G>T	ENSP00000337353:p.Ala508Ser	Somatic	82	0		WXS	Illumina HiSeq	Phase_1	106	6	NM_018319	0	0	5	5	0	Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Missense_Mutation	SNP	ENST00000335725.4	37	CCDS9888.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.002048|4.002048	0.74932|0.74932	.|.	.|.	ENSG00000042088|ENSG00000042088	ENST00000393452;ENST00000393454;ENST00000335725;ENST00000357382;ENST00000555880|ENST00000556063	T;T;T;T;T|.	0.42131|.	0.98;0.98;0.98;0.98;0.98|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74359|0.74359	0.3706|0.3706	M|M	0.65320|0.65320	2|2	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.76494|.	0.999;0.999;0.999;0.981;0.999|.	D;D;D;D;D|.	0.83275|.	0.986;0.992;0.996;0.949;0.996|.	T|T	0.71504|0.71504	-0.4573|-0.4573	10|5	0.25751|.	T|.	0.34|.	-9.0E-4|-9.0E-4	19.4362|19.4362	0.94796|0.94796	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	508;508;508;269;508|.	G3V2F4;E7EPD8;B2RDI0;Q86TV8;Q9NUW8|.	.;.;.;.;TYDP1_HUMAN|.	S|F	508;508;508;269;508|148	ENSP00000377098:A508S;ENSP00000377099:A508S;ENSP00000337353:A508S;ENSP00000349952:A269S;ENSP00000450628:A508S|.	ENSP00000337353:A508S|.	A|C	+|+	1|2	0|0	TDP1|TDP1	89529561|89529561	1.000000|1.000000	0.71417|0.71417	0.128000|0.128000	0.21923|0.21923	0.978000|0.978000	0.69477|0.69477	6.611000|6.611000	0.74183|0.74183	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	GCT|TGC	.		0.403	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319	
SERPINA6	866	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	94780584	94780584	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr14:94780584A>T	ENST00000341584.3	-	2	548	c.402T>A	c.(400-402)gaT>gaA	p.D134E		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	134					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	CCAGGCTGCCATCAAGAAACA	0.502																																					p.D134E													.	SERPINA6-653	0			c.T402A						.						92.0	87.0	89.0					14																	94780584		2203	4300	6503	SO:0001583	missense	866	exon2			GCTGCCATCAAGA	J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.402T>A	14.37:g.94780584A>T	ENSP00000342850:p.Asp134Glu	Somatic	106	1		WXS	Illumina HiSeq	Phase_I	89	34	NM_001756	0	0	3	4	1	A8K456|Q7Z2Q9	Missense_Mutation	SNP	ENST00000341584.3	37	CCDS9924.1	.	.	.	.	.	.	.	.	.	.	A	0.415	-0.911384	0.02434	.	.	ENSG00000170099	ENST00000341584;ENST00000557225	D;D	0.87966	-2.32;-1.66	4.85	1.84	0.25277	Serpin domain (3);	1.049680	0.07521	N	0.910514	T	0.76140	0.3946	L	0.28192	0.835	0.09310	N	1	B	0.20164	0.042	B	0.25759	0.063	T	0.59595	-0.7425	10	0.17369	T	0.5	.	2.1492	0.03795	0.2204:0.2403:0.4165:0.1227	.	134	P08185	CBG_HUMAN	E	134	ENSP00000342850:D134E;ENSP00000452018:D134E	ENSP00000342850:D134E	D	-	3	2	SERPINA6	93850337	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	0.022000	0.13511	0.581000	0.29539	-0.242000	0.12053	GAT	.		0.502	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413065.1	NM_001756	
NUSAP1	51203	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41669495	41669495	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr15:41669495C>T	ENST00000559596.1	+	10	1312	c.1225C>T	c.(1225-1227)Cag>Tag	p.Q409*	NUSAP1_ENST00000450318.1_Nonsense_Mutation_p.Q370*|NUSAP1_ENST00000558123.1_3'UTR|NUSAP1_ENST00000560177.1_Nonsense_Mutation_p.Q408*|NUSAP1_ENST00000414849.2_Nonsense_Mutation_p.Q408*|NUSAP1_ENST00000560747.1_Nonsense_Mutation_p.Q407*|NUSAP1_ENST00000260359.6_Nonsense_Mutation_p.Q394*|NUSAP1_ENST00000450592.2_Nonsense_Mutation_p.Q346*			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	409					establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		ACCCCATCTCCAGACAAAGTA	0.333																																					p.Q409X		.											.	.	0			c.C1225T						.						16.0	14.0	15.0					15																	41669495		1771	4000	5771	SO:0001587	stop_gained	51203	exon10			CATCTCCAGACAA	AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.1225C>T	15.37:g.41669495C>T	ENSP00000453403:p.Gln409*	Somatic	40	0		WXS	Illumina HiSeq	Phase_I	56	20	NM_016359	0	0	0	0	0	B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Nonsense_Mutation	SNP	ENST00000559596.1	37	CCDS45234.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.761477	0.49468	.	.	ENSG00000137804	ENST00000260359;ENST00000414849;ENST00000450318;ENST00000450592	.	.	.	5.65	4.71	0.59529	.	0.367085	0.31922	N	0.006860	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	12.8916	0.58073	0.1626:0.8374:0.0:0.0	.	.	.	.	X	409;408;370;346	.	ENSP00000260359:Q409X	Q	+	1	0	NUSAP1	39456787	1.000000	0.71417	0.756000	0.31282	0.567000	0.35839	2.988000	0.49386	1.561000	0.49584	0.655000	0.94253	CAG	.		0.333	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419427.1	NM_016359	
SHF	90525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	45491143	45491143	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr15:45491143G>T	ENST00000290894.8	-	2	624	c.130C>A	c.(130-132)Cat>Aat	p.H44N	SHF_ENST00000318390.6_Missense_Mutation_p.H101N|CTD-2651B20.6_ENST00000563103.1_RNA|CTD-2651B20.7_ENST00000568314.1_RNA|RP11-519G16.2_ENST00000560034.1_RNA	NM_138356.2	NP_612365			Src homology 2 domain containing F											endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(2)	12		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		ATCCAGGAATGGGGCTGGGCG	0.632											OREG0023105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H44N		.											.	SHF-69	0			c.C130A						.						50.0	54.0	53.0					15																	45491143		1969	4159	6128	SO:0001583	missense	90525	exon2			AGGAATGGGGCTG	BC007586	CCDS10120.2, CCDS73721.1	15q21.1	2013-02-14			ENSG00000138606	ENSG00000138606		"""SH2 domain containing"""	25116	protein-coding gene	gene with protein product						11095946	Standard	NM_138356		Approved		uc001zuy.3	Q7M4L6	OTTHUMG00000131353	ENST00000290894.8:c.130C>A	15.37:g.45491143G>T	ENSP00000290894:p.His44Asn	Somatic	123	0	932	WXS	Illumina HiSeq	Phase_I	137	68	NM_138356	0	0	0	0	0		Missense_Mutation	SNP	ENST00000290894.8	37	CCDS10120.2	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788761	0.31685	.	.	ENSG00000138606	ENST00000290894;ENST00000361989;ENST00000318390	T;T	0.38240	1.57;1.15	3.04	-6.08	0.02151	.	7739.210000	0.00166	N	0.000000	T	0.23886	0.0578	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15578	-1.0432	10	0.37606	T	0.19	3.8664	8.6801	0.34203	0.0:0.4794:0.1588:0.3618	.	44	Q7M4L6	SHF_HUMAN	N	44;44;101	ENSP00000290894:H44N;ENSP00000315978:H101N	ENSP00000290894:H44N	H	-	1	0	SHF	43278435	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.536000	0.02208	-1.992000	0.00975	0.655000	0.94253	CAT	.		0.632	SHF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254141.2	NM_138356	
C15orf39	56905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75499667	75499667	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr15:75499667C>T	ENST00000360639.2	+	2	1598	c.1278C>T	c.(1276-1278)tgC>tgT	p.C426C	C15orf39_ENST00000394987.4_Silent_p.C426C|C15orf39_ENST00000567617.1_Silent_p.C426C			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	426						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						GCCAGCCCTGCTCAGAGCCTG	0.642																																					p.C426C		.											.	C15orf39-90	0			c.C1278T						.						37.0	42.0	40.0					15																	75499667		2197	4295	6492	SO:0001819	synonymous_variant	56905	exon2			GCCCTGCTCAGAG	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.1278C>T	15.37:g.75499667C>T		Somatic	119	0		WXS	Illumina HiSeq	Phase_I	150	64	NM_015492	0	0	4	8	4	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Silent	SNP	ENST00000360639.2	37	CCDS10276.1																																																																																			.		0.642	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	3901001	3901001	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:3901001G>A	ENST00000262367.5	-	2	904	c.95C>T	c.(94-96)tCa>tTa	p.S32L	CREBBP_ENST00000382070.3_Missense_Mutation_p.S32L	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	32					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GTCAAACAATGATCCAAAATC	0.403			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.S32L		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP-1807	0			c.C95T						.						55.0	54.0	55.0					16																	3901001		2195	4291	6486	SO:0001583	missense	1387	exon2			AACAATGATCCAA	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.95C>T	16.37:g.3901001G>A	ENSP00000262367:p.Ser32Leu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	78	22	NM_001079846	0	0	0	0	0	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054063	0.75960	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.86562	-2.14;-2.12	5.92	5.92	0.95590	.	0.086452	0.49916	D	0.000127	D	0.92172	0.7518	M	0.72894	2.215	0.80722	D	1	P;D	0.58620	0.949;0.983	P;P	0.57101	0.719;0.813	D	0.92259	0.5815	10	0.87932	D	0	-4.3311	20.3206	0.98668	0.0:0.0:1.0:0.0	.	100;32	Q4LE28;Q92793	.;CBP_HUMAN	L	32;100;32	ENSP00000262367:S32L;ENSP00000371502:S32L	ENSP00000262367:S32L	S	-	2	0	CREBBP	3841002	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.390000	0.79816	2.809000	0.96659	0.655000	0.94253	TCA	.		0.403	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
UBN1	29855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	16	4908004	4908004	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:4908004C>T	ENST00000396658.4	+	2	966	c.263C>T	c.(262-264)tCa>tTa	p.S88L	UBN1_ENST00000590769.1_Missense_Mutation_p.S88L|UBN1_ENST00000545171.1_Missense_Mutation_p.S88L|UBN1_ENST00000262376.6_Missense_Mutation_p.S88L	NM_016936.3	NP_058632.2	Q9NPG3	UBN1_HUMAN	ubinuclein 1	88	Sufficient for interaction with HIRA.				chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of phosphatase activity (GO:0010923)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(6)|kidney(4)|large_intestine(10)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38						AAAGATCTGTCAGATCCTTTC	0.338																																					p.S88L		.											.	UBN1-92	0			c.C263T						.						70.0	77.0	75.0					16																	4908004		2197	4300	6497	SO:0001583	missense	29855	exon3			ATCTGTCAGATCC	AF108460	CCDS10525.1, CCDS73822.1	16p13.3	2010-11-09			ENSG00000118900	ENSG00000118900			12506	protein-coding gene	gene with protein product		609771				10725330	Standard	XM_005255277		Approved		uc002cyb.3	Q9NPG3	OTTHUMG00000129531	ENST00000396658.4:c.263C>T	16.37:g.4908004C>T	ENSP00000379894:p.Ser88Leu	Somatic	12	0		WXS	Illumina HiSeq	Phase_I	32	9	NM_001079514	0	0	1	1	0	B7Z6D3|D3DUE8|Q13079|Q9P1P7	Missense_Mutation	SNP	ENST00000396658.4	37	CCDS10525.1	.	.	.	.	.	.	.	.	.	.	C	10.11	1.260216	0.23051	.	.	ENSG00000118900	ENST00000262376;ENST00000545171;ENST00000396658	T;T;T	0.44083	1.51;0.93;1.51	5.37	-2.3	0.06785	.	1.211730	0.05673	N	0.589051	T	0.27313	0.0670	N	0.16266	0.395	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.26258	-1.0108	10	0.27785	T	0.31	1.4387	11.8692	0.52511	0.0:0.4651:0.0:0.5349	.	88;88	Q9NPG3-2;Q9NPG3	.;UBN1_HUMAN	L	88	ENSP00000262376:S88L;ENSP00000442379:S88L;ENSP00000379894:S88L	ENSP00000262376:S88L	S	+	2	0	UBN1	4848005	0.000000	0.05858	0.017000	0.16124	0.976000	0.68499	-1.157000	0.03157	-0.259000	0.09432	0.655000	0.94253	TCA	.		0.338	UBN1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251719.1	NM_016936	
DNAH3	55567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	21051260	21051260	+	Missense_Mutation	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:21051260C>A	ENST00000261383.3	-	33	4643	c.4644G>T	c.(4642-4644)ttG>ttT	p.L1548F	DNAH3_ENST00000415178.1_Missense_Mutation_p.L1548F	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1548	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTGTCCGGAACAAGGCCTGGA	0.488																																					p.L1548F		.											.	DNAH3-167	0			c.G4644T						.						114.0	103.0	107.0					16																	21051260		2201	4300	6501	SO:0001583	missense	55567	exon33			CCGGAACAAGGCC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.4644G>T	16.37:g.21051260C>A	ENSP00000261383:p.Leu1548Phe	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	236	59	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	c	19.21	3.783406	0.70222	.	.	ENSG00000158486	ENST00000261383;ENST00000415178	T;T	0.40756	1.02;1.02	5.48	-3.63	0.04529	ATPase, AAA+ type, core (1);	0.000000	0.64402	D	0.000008	T	0.71787	0.3381	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76408	-0.2970	10	0.87932	D	0	.	11.9329	0.52857	0.0:0.4256:0.0:0.5744	.	1548	Q8TD57	DYH3_HUMAN	F	1548	ENSP00000261383:L1548F;ENSP00000394245:L1548F	ENSP00000261383:L1548F	L	-	3	2	DNAH3	20958761	0.014000	0.17966	0.915000	0.36163	0.963000	0.63663	-0.900000	0.04097	-0.896000	0.03915	-0.753000	0.03488	TTG	.		0.488	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
MBTPS1	8720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	84094306	84094306	+	Silent	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:84094306G>C	ENST00000343411.3	-	20	3180	c.2685C>G	c.(2683-2685)gtC>gtG	p.V895V		NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	895					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						TCTCTGGAGTGACTGAGCCTG	0.592																																					p.V895V		.											.	MBTPS1-92	0			c.C2685G						.						65.0	53.0	57.0					16																	84094306		2200	4300	6500	SO:0001819	synonymous_variant	8720	exon20			TGGAGTGACTGAG	D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.2685C>G	16.37:g.84094306G>C		Somatic	110	0		WXS	Illumina HiSeq	Phase_I	126	55	NM_003791	0	0	17	42	25	A8K6V8|Q24JQ2|Q9UF67	Silent	SNP	ENST00000343411.3	37	CCDS10941.1																																																																																			.		0.592	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269080.2	NM_003791	
ZCCHC14	23174	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	87445209	87445209	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr16:87445209T>A	ENST00000268616.4	-	12	2924	c.2707A>T	c.(2707-2709)Agc>Tgc	p.S903C		NM_015144.2	NP_055959.1	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	903							nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	36				BRCA - Breast invasive adenocarcinoma(80;0.0285)		AGGTTCCCGCTCTTTTTGTGA	0.597																																					p.S903C		.											.	ZCCHC14-154	0			c.A2707T						.						85.0	74.0	78.0					16																	87445209		2198	4300	6498	SO:0001583	missense	23174	exon12			TCCCGCTCTTTTT	AB011151	CCDS10961.1	16q24.2	2013-01-10			ENSG00000140948	ENSG00000140948		"""Zinc fingers, CCHC domain containing"", ""Sterile alpha motif (SAM) domain containing"""	24134	protein-coding gene	gene with protein product						9628581	Standard	XM_005255858		Approved	BDG29, MGC14139	uc002fjz.1	Q8WYQ9	OTTHUMG00000137655	ENST00000268616.4:c.2707A>T	16.37:g.87445209T>A	ENSP00000268616:p.Ser903Cys	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	165	56	NM_015144	0	0	7	10	3	D3DUN1|O60324|Q3MJD8|Q9UFP0	Missense_Mutation	SNP	ENST00000268616.4	37	CCDS10961.1	.	.	.	.	.	.	.	.	.	.	T	14.84	2.654553	0.47467	.	.	ENSG00000140948	ENST00000268616	T	0.76968	-1.06	5.55	5.55	0.83447	.	0.169858	0.53938	D	0.000059	T	0.79375	0.4435	L	0.27053	0.805	0.33555	D	0.596683	D;D	0.67145	0.996;0.993	P;P	0.59288	0.855;0.72	D	0.85907	0.1438	10	0.87932	D	0	-19.183	15.975	0.80057	0.0:0.0:0.0:1.0	.	903;903	Q8WYQ9-2;Q8WYQ9	.;ZCH14_HUMAN	C	903	ENSP00000268616:S903C	ENSP00000268616:S903C	S	-	1	0	ZCCHC14	86002710	0.998000	0.40836	0.998000	0.56505	0.927000	0.56198	1.668000	0.37481	2.223000	0.72356	0.533000	0.62120	AGC	.		0.597	ZCCHC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269107.1	NM_015144	
FXR2	9513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7497319	7497319	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:7497319T>G	ENST00000250113.7	-	11	1358	c.1024A>C	c.(1024-1026)Atg>Ctg	p.M342L	FXR2_ENST00000573057.1_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	342						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		AAGGGAACCATTCCCTAGAGA	0.532																																					p.M342L		.											.	.	0			c.A1024C						.						60.0	59.0	59.0					17																	7497319		1905	4126	6031	SO:0001583	missense	9513	exon11			GAACCATTCCCTA	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1024A>C	17.37:g.7497319T>G	ENSP00000250113:p.Met342Leu	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	63	18	NM_004860	0	0	0	2	2	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	37	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	T	9.196	1.027335	0.19512	.	.	ENSG00000129245	ENST00000250113	T	0.27720	1.65	5.52	5.52	0.82312	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.122387	0.64402	D	0.000001	T	0.18299	0.0439	N	0.12746	0.255	0.42425	D	0.992651	B	0.06786	0.001	B	0.09377	0.004	T	0.08932	-1.0698	10	0.22706	T	0.39	1.2613	13.6401	0.62246	0.0:0.0:0.0:1.0	.	342	P51116	FXR2_HUMAN	L	342	ENSP00000250113:M342L	ENSP00000250113:M342L	M	-	1	0	FXR2	7438044	1.000000	0.71417	1.000000	0.80357	0.081000	0.17604	5.842000	0.69417	2.317000	0.78254	0.460000	0.39030	ATG	.		0.532	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441084.1		
MYH4	4622	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	10366950	10366950	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:10366950T>G	ENST00000255381.2	-	8	769	c.659A>C	c.(658-660)gAa>gCa	p.E220A	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	220	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GATTTGATCTTCAAGGGTCCC	0.448																																					p.E220A		.											.	MYH4-102	0			c.A659C						.						73.0	73.0	73.0					17																	10366950		2203	4300	6503	SO:0001583	missense	4622	exon8			TGATCTTCAAGGG		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.659A>C	17.37:g.10366950T>G	ENSP00000255381:p.Glu220Ala	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	72	55	NM_017533	0	0	0	0	0		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.567354	0.86439	.	.	ENSG00000141048	ENST00000255381	D	0.89050	-2.46	5.14	5.14	0.70334	Myosin head, motor domain (2);	0.000000	0.38005	U	0.001849	D	0.96503	0.8859	H	0.97707	4.06	0.80722	D	1	D	0.63880	0.993	D	0.77557	0.99	D	0.97990	1.0354	10	0.87932	D	0	.	15.2278	0.73364	0.0:0.0:0.0:1.0	.	220	Q9Y623	MYH4_HUMAN	A	220	ENSP00000255381:E220A	ENSP00000255381:E220A	E	-	2	0	MYH4	10307675	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.966000	0.87956	2.052000	0.61016	0.455000	0.32223	GAA	.		0.448	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
STAC2	342667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37373422	37373422	+	Silent	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:37373422G>A	ENST00000333461.5	-	3	771	c.402C>T	c.(400-402)aaC>aaT	p.N134N		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	134					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						CCTGTTTGGAGTTTCCTAGGA	0.562																																					p.N134N		.											.	STAC2-91	0			c.C402T						.						59.0	56.0	57.0					17																	37373422		2203	4300	6503	SO:0001819	synonymous_variant	342667	exon3			TTTGGAGTTTCCT	AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.402C>T	17.37:g.37373422G>A		Somatic	83	0		WXS	Illumina HiSeq	Phase_I	115	60	NM_198993	0	0	0	0	0	Q32MA3	Silent	SNP	ENST00000333461.5	37	CCDS11335.1																																																																																			.		0.562	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444533.2	NM_198993	
LLGL2	3993	broad.mit.edu	37	17	73565071	73565071	+	Silent	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:73565071C>A	ENST00000392550.3	+	13	1452	c.1335C>A	c.(1333-1335)ggC>ggA	p.G445G	LLGL2_ENST00000577200.1_Silent_p.G445G|LLGL2_ENST00000167462.5_Silent_p.G445G	NM_001031803.1	NP_001026973.1	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 (Drosophila)	445					cell cycle (GO:0007049)|cell division (GO:0051301)|exocytosis (GO:0006887)|regulation of establishment or maintenance of cell polarity (GO:0032878)	cytoplasm (GO:0005737)	PDZ domain binding (GO:0030165)			NS(1)|breast(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			ACGAGGACGGCACGGTGCGGT	0.667																																					p.G445G													.	LLGL2-251	0			c.C1335A						.						41.0	42.0	41.0					17																	73565071		2203	4300	6503	SO:0001819	synonymous_variant	3993	exon13			GGACGGCACGGTG	X87342	CCDS11725.1, CCDS32733.1, CCDS45776.1	17q25.1	2013-01-10	2001-11-28			ENSG00000073350		"""WD repeat domain containing"""	6629	protein-coding gene	gene with protein product			"""lethal giant larvae (Drosophila) homolog 2"""				Standard	XR_243659		Approved	HGL	uc002joh.3	Q6P1M3		ENST00000392550.3:c.1335C>A	17.37:g.73565071C>A		Somatic	13	0		WXS	Illumina HiSeq	Phase_I	36	5	NM_004524	0	0	0	0	0	Q14521|Q9BR62	Silent	SNP	ENST00000392550.3	37	CCDS32733.1																																																																																			.		0.667	LLGL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447633.1	NM_004524	
NEDD4L	23327	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	56033337	56033337	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr18:56033337G>C	ENST00000400345.3	+	21	2223	c.1940G>C	c.(1939-1941)aGa>aCa	p.R647T	NEDD4L_ENST00000456986.1_Missense_Mutation_p.R526T|NEDD4L_ENST00000456173.2_Missense_Mutation_p.R506T|NEDD4L_ENST00000586263.1_Missense_Mutation_p.R619T|NEDD4L_ENST00000356462.6_Missense_Mutation_p.R583T|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000357895.5_Missense_Mutation_p.R639T|NEDD4L_ENST00000256830.9_Missense_Mutation_p.R543T|NEDD4L_ENST00000435432.2_Missense_Mutation_p.R506T|NEDD4L_ENST00000431212.2_Missense_Mutation_p.R526T|NEDD4L_ENST00000382850.4_Missense_Mutation_p.R627T|NEDD4L_ENST00000256832.7_Missense_Mutation_p.R507T	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	647	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						CTAAAAGCTAGACTGTGGATT	0.408																																					p.R647T		.											.	NEDD4L-658	0			c.G1940C						.						122.0	114.0	117.0					18																	56033337		1867	4102	5969	SO:0001583	missense	23327	exon21			AAGCTAGACTGTG	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1940G>C	18.37:g.56033337G>C	ENSP00000383199:p.Arg647Thr	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	132	9	NM_001144967	0	0	9	9	0	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	ENST00000400345.3	37	CCDS45872.1	.	.	.	.	.	.	.	.	.	.	G	30	5.052900	0.93793	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000256832;ENST00000456986;ENST00000357895;ENST00000435432;ENST00000456173;ENST00000431212	T;T;T;T;T;T;T;T;T;T	0.75938	0.97;0.97;0.97;0.97;-0.98;-0.98;0.97;-0.98;-0.98;-0.98	5.54	5.54	0.83059	HECT (3);	0.000000	0.85682	D	0.000000	D	0.86727	0.6002	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.966;0.985;0.999;0.999	D;D;P;D;D;D	0.77004	0.989;0.985;0.574;0.955;0.977;0.985	D	0.87407	0.2373	10	0.87932	D	0	.	19.8487	0.96730	0.0:0.0:1.0:0.0	.	619;639;506;583;647;627	Q96PU5-6;Q96PU5-7;Q3LSM7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;.;NED4L_HUMAN;.	T	647;627;583;543;507;526;639;506;506;526	ENSP00000383199:R647T;ENSP00000372301:R627T;ENSP00000348847:R583T;ENSP00000256830:R543T;ENSP00000256832:R507T;ENSP00000411947:R526T;ENSP00000350569:R639T;ENSP00000393395:R506T;ENSP00000405440:R506T;ENSP00000389406:R526T	ENSP00000256830:R543T	R	+	2	0	NEDD4L	54184317	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.813000	0.99286	2.748000	0.94277	0.650000	0.86243	AGA	.		0.408	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
LPPR3	79948	hgsc.bcm.edu	37	19	815207	815207	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:815207G>A	ENST00000520876.3	-	4	460	c.382C>T	c.(382-384)Cgg>Tgg	p.R128W	LPPR3_ENST00000359894.2_Missense_Mutation_p.R128W|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		128						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										ACCGTACGCCGCAGGAAGGAG	0.716																																					p.R128W		.											.	.	0			c.C382T						.						23.0	28.0	26.0					19																	815207		2181	4286	6467	SO:0001583	missense	0	exon4			TACGCCGCAGGAA																												ENST00000520876.3:c.382C>T	19.37:g.815207G>A	ENSP00000430297:p.Arg128Trp	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	4	4	NM_001270366	0	0	0	0	0	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	37	CCDS58636.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790052	0.70337	.	.	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876;ENST00000521445	T;T	0.52526	0.66;0.66	4.33	3.27	0.37495	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.68339	0.2990	M	0.82517	2.595	0.52501	D	0.999955	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.71712	-0.4510	10	0.87932	D	0	-9.9087	11.2342	0.48931	0.0:0.0:0.8149:0.1851	.	128;128;128	Q6T4P5-2;Q6T4P5;Q6T4P5-3	.;LPPR3_HUMAN;.	W	128	ENSP00000352962:R128W;ENSP00000430297:R128W	ENSP00000300947:R128W	R	-	1	2	AC006273.1	766207	0.599000	0.26891	0.997000	0.53966	0.459000	0.32528	0.345000	0.19979	0.788000	0.33755	0.462000	0.41574	CGG	.		0.716	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
STK11	6794	ucsc.edu	37	19	1220643	1220643	+	Missense_Mutation	SNP	C	C	T	rs587782546		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:1220643C>T	ENST00000326873.7	+	5	1834	c.661C>T	c.(661-663)Ccg>Tcg	p.P221S		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	221	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(2)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCTTTCCAGCCGCCCGAGAT	0.711		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																											p.P221S			yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	.	STK11-5227	22	Whole gene deletion(20)|Unknown(2)	cervix(14)|lung(4)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	c.C661T						.						13.0	19.0	17.0					19																	1220643		1945	4124	6069	SO:0001583	missense	6794	exon5	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	TTCCAGCCGCCCG	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.661C>T	19.37:g.1220643C>T	ENSP00000324856:p.Pro221Ser	Somatic	18	0		WXS	Illumina HiSeq		24	4	NM_000455	0	0	32	32	0	B2RBX7|E7EW76	Missense_Mutation	SNP	ENST00000326873.7	37	CCDS45896.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963262	0.92791	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	T	0.81163	-1.46	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.76335	0.3973	N	0.04335	-0.225	0.80722	D	1	D	0.62365	0.991	P	0.58660	0.843	T	0.79298	-0.1861	10	0.34782	T	0.22	-28.8932	18.5988	0.91240	0.0:1.0:0.0:0.0	.	221	Q15831	STK11_HUMAN	S	221	ENSP00000324856:P221S	ENSP00000324856:P221S	P	+	1	0	STK11	1171643	1.000000	0.71417	0.999000	0.59377	0.684000	0.39900	7.712000	0.84684	2.644000	0.89710	0.561000	0.74099	CCG	.		0.711	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449839.3	NM_000455	
ZNF57	126295	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2915555	2915555	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:2915555C>T	ENST00000306908.5	+	2	187	c.39C>T	c.(37-39)ttC>ttT	p.F13F	AC006277.2_ENST00000520090.2_RNA|ZNF57_ENST00000523428.1_5'UTR	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	13	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGTGGACTTCACCCTGGAGG	0.542																																					p.F13F	NSCLC(150;910 1964 4303 10464 26498)	.											.	ZNF57-71	0			c.C39T						.						160.0	141.0	147.0					19																	2915555		2203	4300	6503	SO:0001819	synonymous_variant	126295	exon2			GGACTTCACCCTG	M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.39C>T	19.37:g.2915555C>T		Somatic	174	0		WXS	Illumina HiSeq	Phase_I	170	76	NM_173480	0	0	0	0	0	Q8N6R9	Silent	SNP	ENST00000306908.5	37	CCDS12098.1																																																																																			.		0.542	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378969.1	NM_173480	
C19orf71	100128569	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3543941	3543941	+	Missense_Mutation	SNP	T	T	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:3543941T>C	ENST00000329493.5	+	4	587	c.563T>C	c.(562-564)gTc>gCc	p.V188A	AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000389395.3_Intron|MFSD12_ENST00000398558.4_Intron	NM_001135580.1	NP_001129052.1	A6NCJ1	CS071_HUMAN	chromosome 19 open reading frame 71	188										endometrium(2)	2						CGGGAGTGGGTCCTGGAACCA	0.667																																					p.V188A													.	.	0			c.T563C						.						82.0	93.0	90.0					19																	3543941		692	1591	2283	SO:0001583	missense	100128569	exon4			AGTGGGTCCTGGA		CCDS45918.1	19p13.3	2012-10-26			ENSG00000183397	ENSG00000183397			34496	protein-coding gene	gene with protein product							Standard	NM_001135580		Approved	LOC100128569	uc010xhm.2	A6NCJ1		ENST00000329493.5:c.563T>C	19.37:g.3543941T>C	ENSP00000327950:p.Val188Ala	Somatic	245	2		WXS	Illumina HiSeq	Phase_I	344	120	NM_001135580	0	0	5	5	0		Missense_Mutation	SNP	ENST00000329493.5	37	CCDS45918.1	.	.	.	.	.	.	.	.	.	.	T	5.404	0.259715	0.10239	.	.	ENSG00000183397	ENST00000329493	T	0.27890	1.64	4.55	-9.11	0.00711	.	2.161880	0.02090	N	0.053021	T	0.12817	0.0311	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15407	-1.0438	10	0.37606	T	0.19	.	4.4865	0.11792	0.1461:0.4148:0.3334:0.1057	.	188	A6NCJ1	CS071_HUMAN	A	188	ENSP00000327950:V188A	ENSP00000327950:V188A	V	+	2	0	C19orf71	3494941	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.061000	0.03472	-2.812000	0.00347	-0.743000	0.03520	GTC	.		0.667	C19orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452943.1	NM_001135580	
C19orf71	100128569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3543943	3543943	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:3543943C>T	ENST00000329493.5	+	4	589	c.565C>T	c.(565-567)Ctg>Ttg	p.L189L	AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000389395.3_Intron|MFSD12_ENST00000398558.4_Intron	NM_001135580.1	NP_001129052.1	A6NCJ1	CS071_HUMAN	chromosome 19 open reading frame 71	189										endometrium(2)	2						GGAGTGGGTCCTGGAACCATA	0.662																																					p.L189L		.											.	.	0			c.C565T						.						83.0	93.0	90.0					19																	3543943		692	1591	2283	SO:0001819	synonymous_variant	100128569	exon4			TGGGTCCTGGAAC		CCDS45918.1	19p13.3	2012-10-26			ENSG00000183397	ENSG00000183397			34496	protein-coding gene	gene with protein product							Standard	NM_001135580		Approved	LOC100128569	uc010xhm.2	A6NCJ1		ENST00000329493.5:c.565C>T	19.37:g.3543943C>T		Somatic	253	0		WXS	Illumina HiSeq	Phase_I	348	126	NM_001135580	0	0	5	5	0		Silent	SNP	ENST00000329493.5	37	CCDS45918.1																																																																																			.		0.662	C19orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452943.1	NM_001135580	
ZFR2	23217	hgsc.bcm.edu;broad.mit.edu	37	19	3808936	3808936	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:3808936G>A	ENST00000262961.4	-	17	2489	c.2479C>T	c.(2479-2481)Ccc>Tcc	p.P827S		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	827	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GGGCCCAGGGGCCCAGCCGCA	0.697																																					p.P827S		.											.	ZFR2-70	0			c.C2479T						.						10.0	15.0	14.0					19																	3808936		2017	4182	6199	SO:0001583	missense	23217	exon17			CCAGGGGCCCAGC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.2479C>T	19.37:g.3808936G>A	ENSP00000262961:p.Pro827Ser	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	33	15	NM_015174	0	0	0	0	0		Missense_Mutation	SNP	ENST00000262961.4	37	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588474	0.46110	.	.	ENSG00000105278	ENST00000262961	T	0.42131	0.98	3.97	3.97	0.46021	DZF (2);	0.084158	0.48767	U	0.000179	T	0.62962	0.2471	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.65668	-0.6112	10	0.48119	T	0.1	-16.1842	11.3964	0.49845	0.0:0.0:1.0:0.0	.	827	Q9UPR6	ZFR2_HUMAN	S	827	ENSP00000262961:P827S	ENSP00000262961:P827S	P	-	1	0	ZFR2	3759936	1.000000	0.71417	0.677000	0.29947	0.009000	0.06853	5.975000	0.70475	2.053000	0.61076	0.484000	0.47621	CCC	.		0.697	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
C19orf80	55908	broad.mit.edu;bcgsc.ca	37	19	11350388	11350388	+	Silent	SNP	C	C	T	rs376063419		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:11350388C>T	ENST00000252453.8	+	1	94	c.75C>T	c.(73-75)ggC>ggT	p.G25G	C19orf80_ENST00000591200.1_Intron|DOCK6_ENST00000294618.7_Intron|DOCK6_ENST00000319867.7_5'Flank	NM_018687.6	NP_061157.3	Q6UXH0	BETAT_HUMAN	chromosome 19 open reading frame 80	25					cellular lipid metabolic process (GO:0044255)|glucose metabolic process (GO:0006006)|positive regulation of protein processing (GO:0010954)|regulation of lipoprotein metabolic process (GO:0050746)|triglyceride homeostasis (GO:0070328)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(1)|breast(1)|endometrium(2)	4						CCCCCATGGGCGGCCCAGAAC	0.652																																					p.G25G													.	.	0			c.C75T						.	C	,	0,3918		0,0,1959	24.0	26.0	25.0		75,	-8.4	0.0	19		25	2,8282		0,2,4140	no	coding-synonymous,intron	C19orf80,DOCK6	NM_018687.6,NM_020812.2	,	0,2,6099	TT,TC,CC		0.0241,0.0,0.0164	,	25/199,	11350388	2,12200	1959	4142	6101	SO:0001819	synonymous_variant	55908	exon1			CATGGGCGGCCCA		CCDS54220.1	19p13.2	2014-02-13			ENSG00000130173	ENSG00000130173			24933	protein-coding gene	gene with protein product	"""lipasin"", ""betatrophin"""					22809513, 23150577, 24262987	Standard	NM_018687		Approved	TD26, RIFL, ANGPTL8	uc021upg.1	Q6UXH0		ENST00000252453.8:c.75C>T	19.37:g.11350388C>T		Somatic	48	1		WXS	Illumina HiSeq	Phase_I	104	46	NM_018687	0	0	0	0	0	Q9NQZ1	Silent	SNP	ENST00000252453.8	37	CCDS54220.1																																																																																			.		0.652	C19orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453175.1	NM_018687	
IL27RA	9466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	14150421	14150421	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:14150421G>A	ENST00000263379.2	+	3	445	c.320G>A	c.(319-321)gGc>gAc	p.G107D		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	107					cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						CTTGTCTGGGGCACTAAGGCA	0.612																																					p.G107D	Colon(164;1849 1896 4443 37792 47834)	.											.	IL27RA-90	0			c.G320A						.						66.0	61.0	63.0					19																	14150421		2203	4300	6503	SO:0001583	missense	9466	exon3			TCTGGGGCACTAA	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.320G>A	19.37:g.14150421G>A	ENSP00000263379:p.Gly107Asp	Somatic	170	0		WXS	Illumina HiSeq	Phase_I	190	61	NM_004843	0	0	4	6	2	A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	37	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	G	13.70	2.314782	0.40996	.	.	ENSG00000104998	ENST00000263379	T	0.61627	0.09	4.54	-2.12	0.07165	.	0.705821	0.12338	N	0.477779	T	0.46073	0.1374	L	0.32530	0.975	0.09310	N	0.999991	P	0.52316	0.952	P	0.49140	0.601	T	0.43718	-0.9374	10	0.23891	T	0.37	-20.1299	7.3547	0.26713	0.0:0.2745:0.2642:0.4613	.	107	Q6UWB1	I27RA_HUMAN	D	107	ENSP00000263379:G107D	ENSP00000263379:G107D	G	+	2	0	IL27RA	14011421	0.006000	0.16342	0.097000	0.21041	0.288000	0.27193	-0.354000	0.07681	-0.030000	0.13804	0.555000	0.69702	GGC	.		0.612	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	
MYO9B	4650	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	17322846	17322846	+	Silent	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:17322846G>A	ENST00000594824.1	+	40	6348	c.6201G>A	c.(6199-6201)acG>acA	p.T2067T	MYO9B_ENST00000595618.1_3'UTR|MYO9B_ENST00000397274.2_3'UTR			Q13459	MYO9B_HUMAN	myosin IXB	2067	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						TCATGCCCACGGCCAACATCA	0.736																																					p.T2067T		.											.	MYO9B-67	0			c.G6201A						.						9.0	11.0	10.0					19																	17322846		1808	4035	5843	SO:0001819	synonymous_variant	4650	exon40			GCCCACGGCCAAC		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.6201G>A	19.37:g.17322846G>A		Somatic	32	0		WXS	Illumina HiSeq	Phase_I	59	36	NM_004145	0	0	2	3	1	O75314|Q9NUJ2|Q9UHN0	Silent	SNP	ENST00000594824.1	37																																																																																				.		0.736	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
MAP3K10	4294	hgsc.bcm.edu	37	19	40698281	40698281	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:40698281G>T	ENST00000253055.3	+	1	631	c.343G>T	c.(343-345)Gcc>Tcc	p.A115S	MAP3K10_ENST00000593906.1_3'UTR	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	115	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GGTCTATCGGGCCCTGTGGCG	0.687																																					p.A115S		.											.	MAP3K10-981	0			c.G343T						.						33.0	38.0	36.0					19																	40698281		2202	4298	6500	SO:0001583	missense	4294	exon1			TATCGGGCCCTGT	X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.343G>T	19.37:g.40698281G>T	ENSP00000253055:p.Ala115Ser	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	28	4	NM_002446	0	0	6	6	0	Q12761|Q14871	Missense_Mutation	SNP	ENST00000253055.3	37	CCDS12549.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976122	0.92982	.	.	ENSG00000130758	ENST00000253055	D	0.84944	-1.92	4.3	4.3	0.51218	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.207947	0.38897	N	0.001532	D	0.89223	0.6654	M	0.63428	1.95	0.39678	D	0.970865	P	0.51933	0.949	P	0.58660	0.843	D	0.91138	0.4943	10	0.87932	D	0	.	14.3128	0.66426	0.0:0.0:1.0:0.0	.	115	Q02779	M3K10_HUMAN	S	115	ENSP00000253055:A115S	ENSP00000253055:A115S	A	+	1	0	MAP3K10	45390121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.646000	0.98474	2.232000	0.73038	0.655000	0.94253	GCC	.		0.687	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462552.1	NM_002446	
CYP2A6	1548	ucsc.edu;bcgsc.ca	37	19	41349763	41349763	+	Missense_Mutation	SNP	G	G	T	rs561053481	byFrequency	TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:41349763G>T	ENST00000301141.5	-	9	1443	c.1423C>A	c.(1423-1425)Ccc>Acc	p.P475T	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	475					coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	ACGTGTTTGGGGGACACGTCA	0.602																																					p.P475T													.	CYP2A6-92	0			c.C1423A						.						213.0	159.0	177.0					19																	41349763		2202	4300	6502	SO:0001583	missense	1548	exon9			GTTTGGGGGACAC	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.1423C>A	19.37:g.41349763G>T	ENSP00000301141:p.Pro475Thr	Somatic	1557	5		WXS	Illumina HiSeq		1723	501	NM_000762	0	0	0	0	0	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	ENST00000301141.5	37	CCDS12568.1	.	.	.	.	.	.	.	.	.	.	-	22.8	4.342732	0.82022	.	.	ENSG00000255974	ENST00000301141	T	0.68624	-0.34	3.02	1.92	0.25849	.	0.064020	0.64402	U	0.000006	T	0.75140	0.3809	L	0.56340	1.77	0.33079	D	0.536371	D	0.89917	1.0	D	0.97110	1.0	T	0.79995	-0.1568	10	0.87932	D	0	.	10.8431	0.46728	0.0:0.1951:0.8049:0.0	.	475	P11509	CP2A6_HUMAN	T	475	ENSP00000301141:P475T	ENSP00000301141:P475T	P	-	1	0	CYP2A6	46041603	0.999000	0.42202	0.036000	0.18154	0.855000	0.48748	2.893000	0.48633	0.364000	0.24374	0.386000	0.25728	CCC	.		0.602	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463259.1	NM_000762	
ZNF221	7638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	44471195	44471195	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:44471195G>C	ENST00000251269.5	+	6	1869	c.1541G>C	c.(1540-1542)aGa>aCa	p.R514T	ZNF221_ENST00000587682.1_Missense_Mutation_p.R514T|ZNF221_ENST00000592350.1_Missense_Mutation_p.R514T	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TGTGGAAAGAGATTTACTCAG	0.428																																					p.R514T		.											.	ZNF221-91	0			c.G1541C						.						94.0	89.0	91.0					19																	44471195		2203	4300	6503	SO:0001583	missense	7638	exon6			GAAAGAGATTTAC	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.1541G>C	19.37:g.44471195G>C	ENSP00000251269:p.Arg514Thr	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	51	15	NM_013359	0	0	0	0	0	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	ENST00000251269.5	37	CCDS12633.1	.	.	.	.	.	.	.	.	.	.	g	12.16	1.853235	0.32699	.	.	ENSG00000159905	ENST00000251269	T	0.16597	2.33	2.63	-1.52	0.08637	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10895	0.0266	N	0.11870	0.19	0.09310	N	1	P	0.51240	0.943	P	0.48873	0.593	T	0.25152	-1.0140	9	0.38643	T	0.18	.	5.5077	0.16864	0.1145:0.0:0.5338:0.3517	.	514	Q9UK13	ZN221_HUMAN	T	514	ENSP00000251269:R514T	ENSP00000251269:R514T	R	+	2	0	ZNF221	49163035	0.000000	0.05858	0.000000	0.03702	0.888000	0.51559	0.114000	0.15520	-0.005000	0.14395	0.313000	0.20887	AGA	.		0.428	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
GPN1	11321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27858007	27858007	+	Splice_Site	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:27858007G>A	ENST00000610189.1	+	7	437	c.430G>A	c.(430-432)Gca>Aca	p.A144T	GPN1_ENST00000458167.2_Splice_Site_p.A49T|RP11-158I13.2_ENST00000505973.1_RNA|GPN1_ENST00000503738.1_Splice_Site_p.A49T|GPN1_ENST00000424214.1_Splice_Site_p.A65T|GPN1_ENST00000461249.1_3'UTR|GPN1_ENST00000264718.3_Splice_Site_p.A158T|GPN1_ENST00000407583.3_Splice_Site_p.A132T|ZNF512_ENST00000556601.1_3'UTR|GPN1_ENST00000515877.1_Splice_Site_p.A65T	NM_007266.3	NP_009197.2			GPN-loop GTPase 1											endometrium(1)|large_intestine(1)|lung(12)	14						GTGGCTTTAGGCATCCTCATT	0.443																																					p.A158T		.											.	GPN1-159	0			c.G472A						.						209.0	190.0	196.0					2																	27858007		2203	4300	6503	SO:0001630	splice_region_variant	11321	exon7			CTTTAGGCATCCT	AB044661	CCDS1760.2, CCDS46248.1, CCDS46249.1, CCDS46250.1	2p23.3	2011-11-04	2008-04-30	2008-04-30	ENSG00000198522	ENSG00000198522		"""GPN-loop GTPases"""	17030	protein-coding gene	gene with protein product	"""RNA polymerase II associated protein 4"""	611479	"""XPA binding protein 1"", ""XPA binding protein 1, GTPase"""	XAB1		11058119, 11124703	Standard	NM_007266		Approved	NTPBP, MBDIN, ATPBD1A, RPAP4	uc010ymc.2	Q9HCN4	OTTHUMG00000097784	ENST00000610189.1:c.430-1G>A	2.37:g.27858007G>A		Somatic	209	0		WXS	Illumina HiSeq	Phase_I	189	73	NM_007266	0	0	0	1	1		Missense_Mutation	SNP	ENST00000610189.1	37		.	.	.	.	.	.	.	.	.	.	G	36	5.660616	0.96734	.	.	ENSG00000198522	ENST00000515877;ENST00000503738;ENST00000458167;ENST00000424214;ENST00000407583;ENST00000264718	T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9	5.96	5.96	0.96718	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.53449	0.1797	M	0.77616	2.38	0.80722	D	1	P;D;D;D	0.89917	0.792;1.0;0.98;0.992	P;D;P;D	0.81914	0.9;0.995;0.876;0.92	T	0.50039	-0.8874	9	.	.	.	-8.5718	17.1122	0.86679	0.0:0.0:1.0:0.0	.	144;158;49;132	Q9HCN4;B4DQM4;B4DXU4;B5MBZ5	GPN1_HUMAN;.;.;.	T	65;49;49;65;132;158	ENSP00000424678:A65T;ENSP00000427269:A49T;ENSP00000412170:A49T;ENSP00000398115:A65T;ENSP00000384255:A132T;ENSP00000264718:A158T	.	A	+	1	0	GPN1	27711511	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	8.896000	0.92521	2.820000	0.97059	0.655000	0.94253	GCA	.		0.443	GPN1-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000473126.1	NM_007266	Missense_Mutation
RTN4	57142	bcgsc.ca	37	2	55254453	55254453	+	Missense_Mutation	SNP	G	G	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:55254453G>T	ENST00000337526.6	-	3	1025	c.782C>A	c.(781-783)aCt>aAt	p.T261N	RTN4_ENST00000357376.3_Missense_Mutation_p.T55N|RTN4_ENST00000354474.6_Intron|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000394611.2_Missense_Mutation_p.T55N|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000405240.1_Missense_Mutation_p.T55N|RTN4_ENST00000404909.1_Missense_Mutation_p.T55N	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	261					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TGTTCCTTCAGTGGGTAATAC	0.398																																					p.T261N													.	RTN4-155	0			c.C782A						.						76.0	78.0	77.0					2																	55254453		2203	4300	6503	SO:0001583	missense	57142	exon3			CCTTCAGTGGGTA	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.782C>A	2.37:g.55254453G>T	ENSP00000337838:p.Thr261Asn	Somatic	49	0		WXS	Illumina HiSeq	Phase_1	62	4	NM_020532	0	0	0	0	0	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	G	9.097	1.003103	0.19121	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000427710	T;T;T;T;T	0.20463	2.07;2.07;2.3;2.07;2.07	6.02	3.28	0.37604	.	0.837760	0.10740	N	0.639616	T	0.21718	0.0523	L	0.56769	1.78	0.53688	D	0.99997	P	0.34462	0.454	B	0.30251	0.113	T	0.01951	-1.1241	10	0.72032	D	0.01	-0.0569	9.4715	0.38844	0.1281:0.1192:0.7527:0.0	.	261	Q9NQC3	RTN4_HUMAN	N	55;55;261;55;55;55	ENSP00000384471:T55N;ENSP00000349944:T55N;ENSP00000337838:T261N;ENSP00000378109:T55N;ENSP00000385650:T55N	ENSP00000337838:T261N	T	-	2	0	RTN4	55107957	0.920000	0.31207	0.045000	0.18777	0.578000	0.36192	2.530000	0.45641	0.438000	0.26450	-0.156000	0.13503	ACT	.		0.398	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
ALMS1	7840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	73836707	73836707	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:73836707C>T	ENST00000264448.6	+	23	12583	c.12472C>T	c.(12472-12474)Caa>Taa	p.Q4158*	ALMS1_ENST00000409009.1_Nonsense_Mutation_p.Q4116*	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	4158	ALMS motif.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGTGACCAATCAACTTCTGGG	0.433																																					p.Q4158X		.											.	ALMS1-142	0			c.C12472T						.						117.0	116.0	116.0					2																	73836707		1850	4083	5933	SO:0001587	stop_gained	7840	exon23			ACCAATCAACTTC	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.12472C>T	2.37:g.73836707C>T	ENSP00000264448:p.Gln4158*	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	53	15	NM_015120	0	0	0	0	0	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Nonsense_Mutation	SNP	ENST00000264448.6	37	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	C	53	21.012144	0.99936	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	.	.	.	5.34	5.34	0.76211	.	0.658065	0.14442	N	0.319301	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	14.4071	0.67090	0.0:1.0:0.0:0.0	.	.	.	.	X	4116;4158	.	ENSP00000264448:Q4158X	Q	+	1	0	ALMS1	73690215	0.984000	0.35163	0.996000	0.52242	0.780000	0.44128	2.387000	0.44389	2.779000	0.95612	0.591000	0.81541	CAA	.		0.433	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
ACVR2A	92	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	148676153	148676153	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:148676153A>G	ENST00000241416.7	+	7	1590	c.954A>G	c.(952-954)atA>atG	p.I318M	ACVR2A_ENST00000404590.1_Missense_Mutation_p.I318M|ACVR2A_ENST00000535787.1_Missense_Mutation_p.I210M	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	318	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		AACCTGCCATATCTCACAGGT	0.348																																					p.I318M		.											.	ACVR2A-831	0			c.A954G						.						42.0	44.0	43.0					2																	148676153		2202	4300	6502	SO:0001583	missense	92	exon7			TGCCATATCTCAC		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.954A>G	2.37:g.148676153A>G	ENSP00000241416:p.Ile318Met	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	56	22	NM_001616	0	0	0	0	0	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	37	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	A	17.99	3.524183	0.64747	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	T;T;T	0.73789	-0.78;-0.78;-0.78	5.63	0.102	0.14522	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.050216	0.85682	D	0.000000	D	0.84465	0.5478	M	0.86178	2.8	0.54753	D	0.999987	P	0.42827	0.791	P	0.56514	0.8	D	0.85693	0.1308	10	0.59425	D	0.04	.	15.9363	0.79712	0.3896:0.6104:0.0:0.0	.	318	P27037	AVR2A_HUMAN	M	318;210;318	ENSP00000241416:I318M;ENSP00000439988:I210M;ENSP00000384338:I318M	ENSP00000241416:I318M	I	+	3	3	ACVR2A	148392623	0.981000	0.34729	0.995000	0.50966	0.986000	0.74619	0.307000	0.19296	-0.207000	0.10187	0.460000	0.39030	ATA	.		0.348	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
SH3BP4	23677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	235949726	235949726	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr2:235949726C>G	ENST00000409212.1	+	4	820	c.313C>G	c.(313-315)Ccc>Gcc	p.P105A	SH3BP4_ENST00000392011.2_Missense_Mutation_p.P105A|SH3BP4_ENST00000344528.4_Missense_Mutation_p.P105A			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	105	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GGGCTACATCCCCTCCTCCTA	0.537																																					p.P105A		.											.	SH3BP4-94	0			c.C313G						.						171.0	144.0	153.0					2																	235949726		2203	4300	6503	SO:0001583	missense	23677	exon4			TACATCCCCTCCT	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.313C>G	2.37:g.235949726C>G	ENSP00000386862:p.Pro105Ala	Somatic	321	0		WXS	Illumina HiSeq	Phase_I	320	127	NM_014521	0	0	2	5	3	O95082|Q309A3|Q53QD0|Q53TD1	Missense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.895268	0.91962	.	.	ENSG00000130147	ENST00000392011;ENST00000420127;ENST00000416021;ENST00000409212;ENST00000344528;ENST00000446904	D;D;D;D;D	0.99454	-5.92;-5.92;-5.92;-5.92;-5.92	5.24	5.24	0.73138	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	D	0.99635	0.9866	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97817	1.0254	10	0.72032	D	0.01	-9.9278	17.3901	0.87427	0.0:1.0:0.0:0.0	.	105;105	A8K594;Q9P0V3	.;SH3B4_HUMAN	A	105	ENSP00000375867:P105A;ENSP00000403251:P105A;ENSP00000386862:P105A;ENSP00000340237:P105A;ENSP00000415391:P105A	ENSP00000340237:P105A	P	+	1	0	SH3BP4	235614465	1.000000	0.71417	0.996000	0.52242	0.940000	0.58332	7.571000	0.82399	2.442000	0.82660	0.655000	0.94253	CCC	.		0.537	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
SEPT5	5413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	19709430	19709430	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr22:19709430C>T	ENST00000455784.2	+	10	1025	c.900C>T	c.(898-900)tgC>tgT	p.C300C	SEPT5_ENST00000406395.1_Nonsense_Mutation_p.R297*|SEPT5_ENST00000383045.3_Silent_p.C309C|SEPT5_ENST00000438754.2_Nonsense_Mutation_p.R306*|GP1BB_ENST00000366425.3_5'Flank	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	300	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					ACGTGACGTGCGACGTGCACT	0.662																																					p.R306X		.											.	SEPT5-636	0			c.C916T						.						58.0	52.0	54.0					22																	19709430		2203	4299	6502	SO:0001819	synonymous_variant	5413	exon9			GACGTGCGACGTG	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.900C>T	22.37:g.19709430C>T		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	119	43	NM_001009939	0	0	6	12	6	O15251|Q96MY5	Nonsense_Mutation	SNP	ENST00000455784.2	37	CCDS13764.1	.	.	.	.	.	.	.	.	.	.	C	35	5.483869	0.96307	.	.	ENSG00000184702	ENST00000406395;ENST00000438754	.	.	.	3.66	-2.26	0.06867	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999992	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	5.9818	0.19411	0.0:0.3259:0.1386:0.5355	.	.	.	.	X	297;306	.	ENSP00000384535:R297X	R	+	1	2	SEPT5	18089430	0.020000	0.18652	0.802000	0.32245	0.983000	0.72400	-0.876000	0.04201	-0.201000	0.10284	0.297000	0.19635	CGA	.		0.662	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
MTMR3	8897	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	30416249	30416249	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr22:30416249C>T	ENST00000401950.2	+	17	2943	c.2601C>T	c.(2599-2601)tgC>tgT	p.C867C	CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000333027.3_Silent_p.C867C|MTMR3_ENST00000351488.3_Silent_p.C867C|MTMR3_ENST00000406629.1_Silent_p.C867C|MTMR3_ENST00000323630.5_Silent_p.C731C|CTA-85E5.10_ENST00000429350.1_RNA	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	867					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ATAGATCTTGCCTTGTAAATA	0.512																																					p.C867C		.											.	MTMR3-292	0			c.C2601T						.						69.0	65.0	66.0					22																	30416249		2203	4300	6503	SO:0001819	synonymous_variant	8897	exon17			ATCTTGCCTTGTA	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2601C>T	22.37:g.30416249C>T		Somatic	139	0		WXS	Illumina HiSeq	Phase_I	145	60	NM_153050	0	0	10	11	1	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	ENST00000401950.2	37	CCDS13870.1																																																																																			.		0.512	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322066.1	NM_021090	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	4859771	4859771	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:4859771G>A	ENST00000443694.2	+	57	7828	c.7828G>A	c.(7828-7830)Gaa>Aaa	p.E2610K	AC018816.3_ENST00000441894.1_Intron|ITPR1_ENST00000423119.2_Missense_Mutation_p.E2577K|AC018816.3_ENST00000489771.1_Intron|ITPR1_ENST00000544951.1_Missense_Mutation_p.E588K|ITPR1_ENST00000354582.6_Missense_Mutation_p.E2610K|ITPR1_ENST00000302640.8_Missense_Mutation_p.E2610K|ITPR1_ENST00000357086.4_Missense_Mutation_p.E2577K|ITPR1_ENST00000456211.2_Missense_Mutation_p.E2562K|ITPR1_ENST00000463980.1_3'UTR|AC018816.3_ENST00000449914.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	2625					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TTTAGGCTTGGAAAGAGACAA	0.448																																					p.E2610K		.											.	ITPR1-710	0			c.G7828A						.						52.0	48.0	49.0					3																	4859771		1897	4121	6018	SO:0001583	missense	3708	exon59			GGCTTGGAAAGAG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.7828G>A	3.37:g.4859771G>A	ENSP00000401671:p.Glu2610Lys	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	126	45	NM_001168272	0	0	2	2	0	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	g	32	5.120856	0.94385	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000544951;ENST00000443694	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.58581	0.2132	L	0.57536	1.79	0.80722	D	1	D;B;B	0.62365	0.991;0.102;0.226	P;B;B	0.61201	0.885;0.07;0.425	T	0.56147	-0.8027	10	0.35671	T	0.21	.	18.3362	0.90288	0.0:0.0:1.0:0.0	.	588;2625;2577	B7ZMI3;Q14643;G5E9P1	.;ITPR1_HUMAN;.	K	2625;2610;2610;2577;1071;2577;2562;588;2610	ENSP00000306253:E2610K;ENSP00000346595:E2610K;ENSP00000405934:E2577K;ENSP00000349597:E2577K;ENSP00000397885:E2562K;ENSP00000440564:E588K;ENSP00000401671:E2610K	ENSP00000306253:E2610K	E	+	1	0	ITPR1	4834771	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.709000	0.98729	2.311000	0.77944	0.461000	0.40582	GAA	.		0.448	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
THUMPD3	25917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9406849	9406849	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:9406849G>A	ENST00000345094.3	+	2	431	c.97G>A	c.(97-99)Gaa>Aaa	p.E33K	SETD5-AS1_ENST00000468186.1_RNA|RP11-380O24.1_ENST00000517846.1_RNA|RP11-380O24.1_ENST00000518331.1_RNA|THUMPD3_ENST00000515662.2_Missense_Mutation_p.E33K|RP11-380O24.1_ENST00000517687.1_RNA|THUMPD3_ENST00000452837.2_Missense_Mutation_p.E33K|RP11-380O24.1_ENST00000466431.2_RNA|RP11-380O24.1_ENST00000491930.2_RNA	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	33						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		CCTCGGAAGTGAATCTGAGCT	0.443																																					p.E33K		.											.	THUMPD3-227	0			c.G97A						.						94.0	95.0	94.0					3																	9406849		2203	4300	6503	SO:0001583	missense	25917	exon2			GGAAGTGAATCTG	AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.97G>A	3.37:g.9406849G>A	ENSP00000339532:p.Glu33Lys	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	128	51	NM_001114092	0	0	0	0	0	Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	ENST00000345094.3	37	CCDS2573.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044109	0.75732	.	.	ENSG00000134077	ENST00000452837;ENST00000417036;ENST00000419437;ENST00000345094;ENST00000515662	T;T;T	0.44083	0.93;0.93;0.93	5.57	4.47	0.54385	.	0.949351	0.08920	N	0.874534	T	0.35595	0.0937	L	0.51422	1.61	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.11494	-1.0585	10	0.40728	T	0.16	.	5.2477	0.15506	0.1312:0.2026:0.6662:0.0	.	33	Q9BV44	THUM3_HUMAN	K	33	ENSP00000395893:E33K;ENSP00000339532:E33K;ENSP00000424064:E33K	ENSP00000339532:E33K	E	+	1	0	THUMPD3	9381849	0.049000	0.20398	0.085000	0.20634	0.888000	0.51559	2.198000	0.42705	2.785000	0.95823	0.655000	0.94253	GAA	.		0.443	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214127.1	NM_015453	
IGSF10	285313	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	151155196	151155196	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:151155196T>G	ENST00000282466.3	-	6	7152	c.7153A>C	c.(7153-7155)Agt>Cgt	p.S2385R	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2385	Ig-like C2-type 10.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TACTGATAACTTTGTGGTCCA	0.408																																					p.S2385R		.											.	IGSF10-102	0			c.A7153C						.						125.0	125.0	125.0					3																	151155196		2203	4300	6503	SO:0001583	missense	285313	exon6			GATAACTTTGTGG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.7153A>C	3.37:g.151155196T>G	ENSP00000282466:p.Ser2385Arg	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	77	41	NM_178822	0	0	0	0	0	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	37	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	T	4.176	0.031261	0.08101	.	.	ENSG00000152580	ENST00000282466	T	0.63580	-0.05	5.59	0.331	0.15933	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.945401	0.08716	N	0.904233	T	0.42607	0.1210	L	0.28115	0.83	0.09310	N	1	P;B	0.41080	0.737;0.141	B;B	0.36845	0.234;0.066	T	0.18681	-1.0329	10	0.22706	T	0.39	.	6.415	0.21712	0.0:0.1304:0.2469:0.6227	.	2385;412	Q6WRI0;Q6WRI0-2	IGS10_HUMAN;.	R	2385	ENSP00000282466:S2385R	ENSP00000282466:S2385R	S	-	1	0	IGSF10	152637886	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	1.061000	0.30542	-0.160000	0.11002	-0.316000	0.08728	AGT	.		0.408	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
UGT2B28	54490	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	70146322	70146322	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr4:70146322A>T	ENST00000335568.5	+	1	106	c.104A>T	c.(103-105)cAt>cTt	p.H35L	UGT2B28_ENST00000511240.1_Missense_Mutation_p.H35L	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	35					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						GAATACAGCCATTGGATGAAT	0.458																																					p.H35L													.	UGT2B28-91	0			c.A104T						.						160.0	185.0	177.0					4																	70146322		2067	4246	6313	SO:0001583	missense	54490	exon1			ACAGCCATTGGAT	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.104A>T	4.37:g.70146322A>T	ENSP00000334276:p.His35Leu	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	170	74	NM_053039	0	0	0	0	0	B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	-	7.966	0.747929	0.15710	.	.	ENSG00000135226	ENST00000335568;ENST00000511240	T;T	0.75704	-0.96;-0.96	2.18	2.18	0.27775	.	0.076639	0.51477	U	0.000092	T	0.80560	0.4646	M	0.90595	3.13	0.31529	N	0.661439	B;B	0.25007	0.004;0.116	B;B	0.39935	0.015;0.314	T	0.81614	-0.0853	10	0.66056	D	0.02	.	7.9497	0.30008	1.0:0.0:0.0:0.0	.	35;35	Q9BY64-2;Q9BY64	.;UDB28_HUMAN	L	35	ENSP00000334276:H35L;ENSP00000427399:H35L	ENSP00000334276:H35L	H	+	2	0	UGT2B28	70180911	0.998000	0.40836	0.173000	0.22940	0.039000	0.13416	5.193000	0.65120	1.012000	0.39366	0.155000	0.16302	CAT	.		0.458	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2	NM_053039	
NPFFR2	10886	bcgsc.ca	37	4	73012838	73012838	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr4:73012838G>A	ENST00000308744.6	+	4	976	c.878G>A	c.(877-879)cGa>cAa	p.R293Q	NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000395999.1_Missense_Mutation_p.R194Q|NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000358749.3_Missense_Mutation_p.R191Q	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	293					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AAATATTACCGAGTGAGACTC	0.433																																					p.R293Q													.	NPFFR2-92	0			c.G878A						.						140.0	138.0	138.0					4																	73012838		2203	4300	6503	SO:0001583	missense	10886	exon4			ATTACCGAGTGAG	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.878G>A	4.37:g.73012838G>A	ENSP00000307822:p.Arg293Gln	Somatic	83	0		WXS	Illumina HiSeq	Phase_1	89	5	NM_004885	0	0	0	0	0	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	G	8.617	0.890562	0.17613	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.71817	-0.6;-0.6;-0.6	5.67	0.868	0.19090	GPCR, rhodopsin-like superfamily (1);	0.487974	0.17420	N	0.174879	T	0.57519	0.2059	L	0.48174	1.505	0.47659	D	0.99948	B;B	0.31655	0.108;0.334	B;B	0.29524	0.024;0.103	T	0.40515	-0.9559	10	0.17832	T	0.49	.	9.92	0.41459	0.3518:0.0:0.6482:0.0	.	194;293	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	Q	293;194;191	ENSP00000307822:R293Q;ENSP00000379321:R194Q;ENSP00000351599:R191Q	ENSP00000307822:R293Q	R	+	2	0	NPFFR2	73231702	0.252000	0.23972	0.933000	0.37362	0.106000	0.19336	0.370000	0.20433	-0.165000	0.10908	-0.136000	0.14681	CGA	.		0.433	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
ENPEP	2028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	111397929	111397929	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr4:111397929G>A	ENST00000265162.5	+	1	701	c.359G>A	c.(358-360)aGc>aAc	p.S120N		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	120					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		GGCACCGTGAGCATCTCCATC	0.627																																					p.S120N		.											.	ENPEP-157	0			c.G359A						.						96.0	100.0	99.0					4																	111397929		2203	4300	6503	SO:0001583	missense	2028	exon1			CCGTGAGCATCTC	L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.359G>A	4.37:g.111397929G>A	ENSP00000265162:p.Ser120Asn	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	143	38	NM_001977	0	0	0	2	2	Q504U2	Missense_Mutation	SNP	ENST00000265162.5	37	CCDS3691.1	.	.	.	.	.	.	.	.	.	.	G	4.521	0.096620	0.08681	.	.	ENSG00000138792	ENST00000265162	T	0.02709	4.19	5.83	-6.19	0.02078	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.193580	0.05705	N	0.594848	T	0.02342	0.0072	N	0.12443	0.215	0.20489	N	0.999897	B	0.09022	0.002	B	0.14023	0.01	T	0.41270	-0.9518	10	0.17832	T	0.49	.	18.7095	0.91651	0.2671:0.1216:0.6113:0.0	.	120	Q07075	AMPE_HUMAN	N	120	ENSP00000265162:S120N	ENSP00000265162:S120N	S	+	2	0	ENPEP	111617378	0.004000	0.15560	0.072000	0.20136	0.026000	0.11368	-0.722000	0.04958	-1.974000	0.00998	-0.305000	0.09177	AGC	.		0.627	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255747.2		
CCT5	22948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	10263419	10263419	+	Silent	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:10263419G>A	ENST00000280326.4	+	10	1911	c.1491G>A	c.(1489-1491)ggG>ggA	p.G497G	CCT5_ENST00000515676.1_Silent_p.G459G|CCT5_ENST00000503026.1_Silent_p.G476G|CTD-2256P15.4_ENST00000606194.1_RNA|CCT5_ENST00000506600.1_Silent_p.G404G|CCT5_ENST00000515390.1_Silent_p.G442G	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	497					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						TGCACAAGGGGACAAATGGTG	0.512																																					p.G497G		.											.	CCT5-92	0			c.G1491A						.						59.0	55.0	56.0					5																	10263419		2203	4300	6503	SO:0001819	synonymous_variant	22948	exon10			CAAGGGGACAAAT	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.1491G>A	5.37:g.10263419G>A		Somatic	97	0		WXS	Illumina HiSeq	Phase_I	111	50	NM_012073	0	0	1	2	1	A8JZY8|A8K2X8|B4DYD8	Silent	SNP	ENST00000280326.4	37	CCDS3877.1																																																																																			.		0.512	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2		
ZNF366	167465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	71739709	71739709	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:71739709C>T	ENST00000318442.5	-	5	2599	c.2109G>A	c.(2107-2109)agG>agA	p.R703R	RP11-389C8.2_ENST00000564956.1_RNA	NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	703	Interaction with CTBP1.|Interaction with NRIP1.				negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		TCTGAAAAGCCCTGAGACTGA	0.517																																					p.R703R		.											.	ZNF366-91	0			c.G2109A						.						102.0	107.0	105.0					5																	71739709		2203	4300	6503	SO:0001819	synonymous_variant	167465	exon5			AAAAGCCCTGAGA	AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.2109G>A	5.37:g.71739709C>T		Somatic	36	0		WXS	Illumina HiSeq	Phase_I	42	13	NM_152625	0	0	0	0	0	Q5HYI9|Q7RTV4	Silent	SNP	ENST00000318442.5	37	CCDS4015.1																																																																																			.		0.517	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218574.3		
SLC12A2	6558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	127477532	127477532	+	Silent	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:127477532T>A	ENST00000262461.2	+	10	1821	c.1632T>A	c.(1630-1632)gtT>gtA	p.V544V	SLC12A2_ENST00000343225.4_Silent_p.V544V	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	544					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	GTTCTTGTGTTGTTCGAGATG	0.308																																					p.V544V		.											.	SLC12A2-94	0			c.T1632A						.						171.0	162.0	165.0					5																	127477532		2203	4300	6503	SO:0001819	synonymous_variant	6558	exon10			TTGTGTTGTTCGA		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1632T>A	5.37:g.127477532T>A		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	74	25	NM_001046	0	0	0	0	0	Q8N713|Q8WWH7	Silent	SNP	ENST00000262461.2	37	CCDS4144.1																																																																																			.		0.308	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
SLC26A2	1836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149361289	149361289	+	Silent	SNP	T	T	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr5:149361289T>C	ENST00000286298.4	+	3	2401	c.2133T>C	c.(2131-2133)agT>agC	p.S711S		NM_000112.3	NP_000103.2	P50443	S26A2_HUMAN	solute carrier family 26 (anion exchanger), member 2	711	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|ossification (GO:0001503)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(1)|prostate(2)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCTTCTATAGTGTGTATGAAG	0.413																																					p.S711S		.											.	SLC26A2-90	0			c.T2133C						.						57.0	63.0	61.0					5																	149361289		2203	4299	6502	SO:0001819	synonymous_variant	1836	exon3			CTATAGTGTGTAT	U14528	CCDS4300.1	5q31-q34	2014-09-17	2013-07-18		ENSG00000155850	ENSG00000155850		"""Solute carriers"""	10994	protein-coding gene	gene with protein product		606718	"""solute carrier family 26 (sulfate transporter), member 2"""	DTD		7923357	Standard	NM_000112		Approved	DTDST	uc003lrh.3	P50443	OTTHUMG00000130054	ENST00000286298.4:c.2133T>C	5.37:g.149361289T>C		Somatic	42	0		WXS	Illumina HiSeq	Phase_I	41	17	NM_000112	0	0	2	2	0	A8K2U3|B2R6J1|Q6N051	Silent	SNP	ENST00000286298.4	37	CCDS4300.1																																																																																			.		0.413	SLC26A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252333.2	NM_000112	
CUL9	23113	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	43193768	43193768	+	IGR	SNP	C	C	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr6:43193768C>A	ENST00000252050.4	+	0	7780				RP3-330M21.5_ENST00000500590.1_RNA|DNPH1_ENST00000230431.6_Intron|DNPH1_ENST00000393987.2_Nonsense_Mutation_p.E127*	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9						microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						TTGGGGTGCTCACCGCGGCCA	0.647																																					p.E127X		.											.	.	0			c.G379T						.						27.0	26.0	26.0					6																	43193768		2203	4298	6501	SO:0001628	intergenic_variant	10591	exon3			GGTGCTCACCGCG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723		6.37:g.43193768C>A		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	72	25	NM_199184	0	0	2	9	7	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Nonsense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539836	0.27563	.	.	ENSG00000112667	ENST00000393987	.	.	.	4.24	2.38	0.29361	.	.	.	.	.	.	.	.	.	.	.	0.53688	D	0.999974	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	6.7563	0.23516	0.0:0.7731:0.0:0.2269	.	.	.	.	X	127	.	ENSP00000377556:E127X	E	-	1	0	C6orf108	43301746	0.036000	0.19791	0.992000	0.48379	0.353000	0.29299	0.002000	0.13061	0.989000	0.38761	0.462000	0.41574	GAG	.		0.647	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040582.2	NM_015089	
HCRTR2	3062	ucsc.edu;bcgsc.ca	37	6	55113587	55113587	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr6:55113587C>G	ENST00000370862.3	+	2	710	c.374C>G	c.(373-375)tCc>tGc	p.S125C		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	125					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)	p.S125C(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTTGGACAGTCCCTTTGCAAA	0.423																																					p.S125C													.	HCRTR2-525	1	Substitution - Missense(1)	lung(1)	c.C374G						.						251.0	234.0	240.0					6																	55113587		2203	4299	6502	SO:0001583	missense	3062	exon2			GACAGTCCCTTTG	AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.374C>G	6.37:g.55113587C>G	ENSP00000359899:p.Ser125Cys	Somatic	176	2		WXS	Illumina HiSeq		181	73	NM_001526	0	0	0	0	0	Q5VTM0	Missense_Mutation	SNP	ENST00000370862.3	37	CCDS4956.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177419	0.57692	.	.	ENSG00000137252	ENST00000370862	T	0.72167	-0.63	4.65	4.65	0.58169	GPCR, rhodopsin-like superfamily (1);	0.230889	0.43416	D	0.000566	T	0.64821	0.2633	L	0.41492	1.28	0.32294	N	0.565959	P;P	0.40931	0.733;0.733	P;P	0.56343	0.796;0.796	T	0.64774	-0.6328	10	0.39692	T	0.17	.	11.1333	0.48360	0.1407:0.723:0.1364:0.0	.	125;125	Q548Y0;O43614	.;OX2R_HUMAN	C	125	ENSP00000359899:S125C	ENSP00000359899:S125C	S	+	2	0	HCRTR2	55221546	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.695000	0.54749	2.282000	0.76494	0.555000	0.69702	TCC	.		0.423	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043392.1		
IGF2R	3482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	160467594	160467594	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr6:160467594G>C	ENST00000356956.1	+	15	2116	c.1968G>C	c.(1966-1968)aaG>aaC	p.K656N		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	656					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AGACAAAGAAGTATGACTTTT	0.413																																					p.K656N		.											.	IGF2R-118	0			c.G1968C						.						81.0	88.0	86.0					6																	160467594		2203	4300	6503	SO:0001583	missense	3482	exon15			AAAGAAGTATGAC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1968G>C	6.37:g.160467594G>C	ENSP00000349437:p.Lys656Asn	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	32	9	NM_000876	0	0	3	7	4	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	10.21	1.287371	0.23478	.	.	ENSG00000197081	ENST00000356956	T	0.11277	2.79	5.07	3.25	0.37280	Mannose-6-phosphate receptor, binding (1);	0.269818	0.41500	D	0.000876	T	0.04770	0.0129	L	0.58354	1.805	0.45995	D	0.998804	P	0.45396	0.857	P	0.45377	0.478	T	0.37798	-0.9690	10	0.19147	T	0.46	-5.8683	3.1762	0.06569	0.2087:0.1255:0.5372:0.1286	.	656	P11717	MPRI_HUMAN	N	656	ENSP00000349437:K656N	ENSP00000349437:K656N	K	+	3	2	IGF2R	160387584	0.158000	0.22850	0.965000	0.40720	0.840000	0.47671	-0.185000	0.09684	1.262000	0.44165	0.655000	0.94253	AAG	.		0.413	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
ISPD	729920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	16255771	16255771	+	Missense_Mutation	SNP	G	G	C			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:16255771G>C	ENST00000407010.2	-	9	1170	c.1171C>G	c.(1171-1173)Cta>Gta	p.L391V	ISPD-AS1_ENST00000582683.1_RNA|ISPD-AS1_ENST00000438573.1_RNA|ISPD_ENST00000399310.3_Missense_Mutation_p.L341V|ISPD-AS1_ENST00000579293.1_RNA|ISPD-AS1_ENST00000457112.1_RNA	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	391					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						ATCTGCATTAGGTTTTCCATT	0.303										Multiple Myeloma(15;0.18)																											p.L391V		.											.	ISPD-23	0			c.C1171G						.						64.0	60.0	61.0					7																	16255771		1786	4057	5843	SO:0001583	missense	729920	exon9			GCATTAGGTTTTC	AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.1171C>G	7.37:g.16255771G>C	ENSP00000385478:p.Leu391Val	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	50	28	NM_001101426	0	0	0	1	1	A8MU35|H9KVB2	Missense_Mutation	SNP	ENST00000407010.2	37		.	.	.	.	.	.	.	.	.	.	G	5.747	0.322274	0.10900	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.87729	-2.23;-2.29	5.22	3.4	0.38934	.	.	.	.	.	T	0.77711	0.4171	N	0.24115	0.695	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.65857	-0.6066	9	0.48119	T	0.1	-18.4993	7.3675	0.26781	0.0916:0.1697:0.7388:0.0	.	391	A4D126	ISPD_HUMAN	V	391;341	ENSP00000385478:L391V;ENSP00000382249:L341V	ENSP00000382249:L341V	L	-	1	2	ISPD	16222296	0.250000	0.23951	0.038000	0.18304	0.431000	0.31685	0.794000	0.26958	0.685000	0.31468	0.591000	0.81541	CTA	.		0.303	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000326252.4	NM_001101426	
HIP1	3092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	75183809	75183809	+	Silent	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:75183809C>T	ENST00000336926.6	-	20	2006	c.1980G>A	c.(1978-1980)acG>acA	p.T660T	HIP1_ENST00000434438.2_Silent_p.T660T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	660					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGGATGTGACCGTGGAGAGGA	0.527			T	PDGFRB	CMML																																p.T660T		.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1-1085	0			c.G1980A						.						98.0	90.0	92.0					7																	75183809		2203	4300	6503	SO:0001819	synonymous_variant	3092	exon20			TGTGACCGTGGAG	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1980G>A	7.37:g.75183809C>T		Somatic	105	0		WXS	Illumina HiSeq	Phase_I	105	63	NM_005338	0	0	2	7	5	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	ENST00000336926.6	37	CCDS34669.1																																																																																			.		0.527	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
CD36	948	broad.mit.edu;bcgsc.ca	37	7	80302113	80302113	+	Nonsense_Mutation	SNP	A	A	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:80302113A>T	ENST00000435819.1	+	15	1837	c.1153A>T	c.(1153-1155)Aaa>Taa	p.K385*	CD36_ENST00000447544.2_Nonsense_Mutation_p.K385*|CD36_ENST00000394788.3_Nonsense_Mutation_p.K385*|CD36_ENST00000432207.1_Nonsense_Mutation_p.K385*|CD36_ENST00000433696.2_Nonsense_Mutation_p.K346*|CD36_ENST00000538969.1_Nonsense_Mutation_p.K325*|CD36_ENST00000309881.7_Nonsense_Mutation_p.K385*|CD36_ENST00000534394.1_Nonsense_Mutation_p.K309*|CD36_ENST00000544133.1_3'UTR			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	385					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						ACAATTTGCAAAACGGCTGCA	0.289																																					p.K385X													.	CD36-69	0			c.A1153T						.						63.0	64.0	64.0					7																	80302113		2200	4298	6498	SO:0001587	stop_gained	948	exon10			TTTGCAAAACGGC	Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.1153A>T	7.37:g.80302113A>T	ENSP00000399421:p.Lys385*	Somatic	81	2		WXS	Illumina HiSeq	Phase_I	166	108	NM_001127444	0	0	1	1	0	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Nonsense_Mutation	SNP	ENST00000435819.1	37	CCDS34673.1	.	.	.	.	.	.	.	.	.	.	A	38	6.792769	0.97841	.	.	ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000534394;ENST00000394788;ENST00000447544;ENST00000432207;ENST00000419819;ENST00000538969;ENST00000433696	.	.	.	5.06	5.06	0.68205	.	0.043359	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-27.73	14.7706	0.69675	1.0:0.0:0.0:0.0	.	.	.	.	X	385;385;309;385;385;385;385;325;346	.	.	K	+	1	0	CD36	80140049	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	4.318000	0.59190	2.016000	0.59253	0.482000	0.46254	AAA	.		0.289	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339767.6	NM_001001547	
HIPK2	28996	ucsc.edu;bcgsc.ca	37	7	139305166	139305166	+	Missense_Mutation	SNP	A	A	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:139305166A>T	ENST00000406875.3	-	7	1857	c.1763T>A	c.(1762-1764)cTg>cAg	p.L588Q	HIPK2_ENST00000428878.2_Missense_Mutation_p.L588Q|HIPK2_ENST00000342645.6_Missense_Mutation_p.L588Q	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	588	Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					GACAGTGGTCAGCTGGTTGTT	0.527																																					p.L588Q													.	HIPK2-785	0			c.T1763A						.						204.0	197.0	199.0					7																	139305166		2096	4234	6330	SO:0001583	missense	28996	exon7			GTGGTCAGCTGGT	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.1763T>A	7.37:g.139305166A>T	ENSP00000385571:p.Leu588Gln	Somatic	348	3		WXS	Illumina HiSeq		663	290	NM_022740	0	0	5	8	3	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	A	21.8	4.199947	0.79015	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.56776	0.46;0.44;0.51	4.79	4.79	0.61399	.	.	.	.	.	T	0.72179	0.3428	.	.	.	0.58432	D	0.999999	D;D	0.71674	0.998;0.997	D;D	0.80764	0.991;0.994	T	0.76490	-0.2940	8	0.66056	D	0.02	.	14.3492	0.66688	1.0:0.0:0.0:0.0	.	588;588	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	Q	588	ENSP00000385571:L588Q;ENSP00000413724:L588Q;ENSP00000343108:L588Q	ENSP00000343108:L588Q	L	-	2	0	HIPK2	138955706	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.907000	0.92634	1.780000	0.52325	0.533000	0.62120	CTG	.		0.527	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000349430.3	NM_022740	
PAXIP1	22976	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	154767474	154767474	+	Missense_Mutation	SNP	G	G	A	rs540417697		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr7:154767474G>A	ENST00000404141.1	-	6	1160	c.1006C>T	c.(1006-1008)Cgg>Tgg	p.R336W	PAXIP1_ENST00000397192.1_Missense_Mutation_p.R336W|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	336					adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CTCAGTGTCCGTACAGCTGGA	0.433																																					p.R336W		.											.	PAXIP1-228	0			c.C1006T						.						45.0	44.0	44.0					7																	154767474		1947	4167	6114	SO:0001583	missense	22976	exon6			GTGTCCGTACAGC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1006C>T	7.37:g.154767474G>A	ENSP00000384048:p.Arg336Trp	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	202	86	NM_007349	0	0	0	2	2	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	37	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486598	0.63962	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.48836	0.8;0.8	5.04	4.16	0.48862	.	0.000000	0.50627	U	0.000119	T	0.63141	0.2486	M	0.68952	2.095	0.40826	D	0.983548	B;D;B;D	0.89917	0.225;1.0;0.333;1.0	B;D;B;D	0.91635	0.028;0.999;0.061;0.998	T	0.66040	-0.6022	10	0.72032	D	0.01	-63.4587	8.8578	0.35238	0.0761:0.0:0.7761:0.1478	.	289;245;302;336	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	W	336;336;284;289	ENSP00000384048:R336W;ENSP00000380376:R336W	ENSP00000319149:R289W	R	-	1	2	PAXIP1	154398407	1.000000	0.71417	0.985000	0.45067	0.878000	0.50629	3.274000	0.51631	1.250000	0.43966	0.305000	0.20034	CGG	.		0.433	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
SGK223	157285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	8235300	8235300	+	Missense_Mutation	SNP	A	A	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:8235300A>G	ENST00000520004.1	-	3	883	c.619T>C	c.(619-621)Ttc>Ctc	p.F207L	SGK223_ENST00000330777.4_Missense_Mutation_p.F207L			Q86YV5	SG223_HUMAN		207							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TTCTGGCGGAAGCTCTCCTGG	0.602																																					p.F207L	GBM(34;731 755 10259 33573 33867)	.											.	.	0			c.T619C						.						88.0	97.0	94.0					8																	8235300		1951	4139	6090	SO:0001583	missense	0	exon2			GGCGGAAGCTCTC																												ENST00000520004.1:c.619T>C	8.37:g.8235300A>G	ENSP00000428054:p.Phe207Leu	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	94	43	NM_001080826	0	0	3	4	1	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	A	10.85	1.466943	0.26335	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.56103	0.48;0.48	5.2	5.2	0.72013	.	0.099877	0.41605	D	0.000844	T	0.38188	0.1031	L	0.32530	0.975	0.30179	N	0.800576	B	0.27351	0.176	B	0.25884	0.064	T	0.37150	-0.9718	10	0.37606	T	0.19	.	7.5573	0.27831	0.8992:0.0:0.1008:0.0	.	207	Q86YV5	SG223_HUMAN	L	207	ENSP00000330930:F207L;ENSP00000428054:F207L	ENSP00000330930:F207L	F	-	1	0	AC068353.1	8272710	0.988000	0.35896	1.000000	0.80357	0.426000	0.31534	1.270000	0.33086	2.089000	0.63090	0.533000	0.62120	TTC	.		0.602	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
PXDNL	137902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	52359698	52359698	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:52359698T>A	ENST00000356297.4	-	12	1491	c.1391A>T	c.(1390-1392)cAg>cTg	p.Q464L	PXDNL_ENST00000543296.1_Missense_Mutation_p.Q464L	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	464	Ig-like C2-type 3.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AACTGTATGCTGGCCTTCCAC	0.512																																					p.Q464L		.											.	PXDNL-70	0			c.A1391T						.						109.0	107.0	108.0					8																	52359698		2028	4190	6218	SO:0001583	missense	137902	exon12			GTATGCTGGCCTT		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1391A>T	8.37:g.52359698T>A	ENSP00000348645:p.Gln464Leu	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	108	44	NM_144651	0	0	0	0	0	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	T	5.421	0.262910	0.10294	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	D;D	0.81659	-1.52;-1.52	4.02	-7.16	0.01516	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65450	0.2692	L	0.43701	1.375	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.49523	-0.8931	9	0.36615	T	0.2	.	4.0424	0.09758	0.3721:0.1572:0.0:0.4707	.	464	A1KZ92	PXDNL_HUMAN	L	464	ENSP00000348645:Q464L;ENSP00000444865:Q464L	ENSP00000348645:Q464L	Q	-	2	0	PXDNL	52522251	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.100000	0.15231	-1.355000	0.02186	-0.375000	0.07067	CAG	.		0.512	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
RB1CC1	9821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	53555097	53555097	+	Missense_Mutation	SNP	T	T	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:53555097T>G	ENST00000025008.5	-	18	4674	c.4151A>C	c.(4150-4152)aAg>aCg	p.K1384T	RB1CC1_ENST00000539297.1_Missense_Mutation_p.K1384T|RB1CC1_ENST00000435644.2_Missense_Mutation_p.K1384T|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1384					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TTCTTCAAGCTTTTTCTTTTC	0.383																																					p.K1384T	GBM(180;1701 2102 13475 42023 52570)	.											.	RB1CC1-170	0			c.A4151C						.						96.0	91.0	93.0					8																	53555097		2203	4300	6503	SO:0001583	missense	9821	exon18			TCAAGCTTTTTCT	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4151A>C	8.37:g.53555097T>G	ENSP00000025008:p.Lys1384Thr	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	93	39	NM_001083617	0	0	2	6	4	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.040807	0.55003	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.18338	2.22;2.22;2.22	5.61	4.46	0.54185	.	0.235291	0.44097	D	0.000482	T	0.12561	0.0305	L	0.27053	0.805	0.34041	D	0.654965	B;B	0.30361	0.277;0.181	B;B	0.33042	0.157;0.075	T	0.22941	-1.0202	10	0.26408	T	0.33	-15.3958	10.1369	0.42712	0.0:0.0806:0.0:0.9194	.	1384;1384	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	T	1384	ENSP00000025008:K1384T;ENSP00000396067:K1384T;ENSP00000445960:K1384T	ENSP00000025008:K1384T	K	-	2	0	RB1CC1	53717650	0.999000	0.42202	0.825000	0.32803	0.998000	0.95712	3.259000	0.51515	0.950000	0.37743	0.533000	0.62120	AAG	.		0.383	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
UTP23	84294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	117782585	117782585	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:117782585C>T	ENST00000309822.2	+	2	444	c.343C>T	c.(343-345)Cat>Tat	p.H115Y	UTP23_ENST00000517820.1_Intron|UTP23_ENST00000520733.1_Missense_Mutation_p.H9Y|UTP23_ENST00000357148.3_Missense_Mutation_p.H115Y	NM_032334.2	NP_115710.2	Q9BRU9	UTP23_HUMAN	UTP23, small subunit (SSU) processome component, homolog (yeast)	115					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	12						AAATCCTCATCATTATTTTGT	0.353																																					p.H115Y		.											.	UTP23-226	0			c.C343T						.						112.0	105.0	107.0					8																	117782585		2203	4300	6503	SO:0001583	missense	84294	exon2			CCTCATCATTATT		CCDS6320.1	8q24.11	2008-06-12	2008-06-12	2008-06-12		ENSG00000147679			28224	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 53"""	C8orf53		16769905	Standard	NM_032334		Approved	MGC14595	uc003yoc.3	Q9BRU9		ENST00000309822.2:c.343C>T	8.37:g.117782585C>T	ENSP00000308332:p.His115Tyr	Somatic	58	0		WXS	Illumina HiSeq	Phase_I	87	30	NM_032334	0	0	4	8	4	B2RE25|Q96NJ8	Missense_Mutation	SNP	ENST00000309822.2	37	CCDS6320.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351801	0.82132	.	.	ENSG00000147679	ENST00000309822;ENST00000357148;ENST00000517814;ENST00000520733	T	0.24151	1.87	5.9	5.9	0.94986	.	0.093959	0.64402	D	0.000001	T	0.54935	0.1889	M	0.79011	2.435	0.58432	D	0.999998	D	0.71674	0.998	D	0.69142	0.962	T	0.54662	-0.8260	10	0.62326	D	0.03	-17.3326	20.2789	0.98501	0.0:1.0:0.0:0.0	.	115	Q9BRU9	UTP23_HUMAN	Y	115;115;115;9	ENSP00000308332:H115Y	ENSP00000308332:H115Y	H	+	1	0	UTP23	117851766	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.525000	0.67110	2.788000	0.95919	0.650000	0.86243	CAT	.		0.353	UTP23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381173.1	NM_032334	
TONSL	4796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145668588	145668588	+	Missense_Mutation	SNP	C	C	G			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr8:145668588C>G	ENST00000409379.3	-	4	410	c.381G>C	c.(379-381)agG>agC	p.R127S		NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	127					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GCAAAGCATCCCTCGACTGGC	0.622																																					p.R127S		.											.	TONSL-92	0			c.G381C						.						78.0	80.0	79.0					8																	145668588		692	1591	2283	SO:0001583	missense	4796	exon4			AGCATCCCTCGAC		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.381G>C	8.37:g.145668588C>G	ENSP00000386239:p.Arg127Ser	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	160	50	NM_013432	0	0	0	1	1	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	37	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	C	3.081	-0.189045	0.06299	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.75367	-0.93	4.66	2.56	0.30785	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.56630	0.1998	L	0.36672	1.1	0.09310	N	0.999996	B	0.29716	0.255	B	0.19148	0.024	T	0.36040	-0.9764	9	0.10111	T	0.7	.	7.8666	0.29541	0.1718:0.7237:0.0:0.1045	.	127	Q96HA7	TONSL_HUMAN	S	127	ENSP00000386239:R127S	ENSP00000386239:R127S	R	-	3	2	TONSL	145639396	0.079000	0.21365	0.105000	0.21289	0.613000	0.37349	0.816000	0.27267	0.930000	0.37217	0.462000	0.41574	AGG	.		0.622	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
NUTM2F	54754	bcgsc.ca	37	9	97082579	97082579	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr9:97082579G>A	ENST00000253262.4	-	5	1299	c.1279C>T	c.(1279-1281)Cag>Tag	p.Q427*	NUTM2F_ENST00000341207.4_Nonsense_Mutation_p.Q412*|NUTM2F_ENST00000335456.7_Nonsense_Mutation_p.Q412*	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	427																	TCCTGCGGCTGCTCCACTTTG	0.592																																					p.Q427X													.	FAM22F-68	0			c.C1279T						.						82.0	96.0	92.0					9																	97082579		1957	4131	6088	SO:0001587	stop_gained	54754	exon5			GCGGCTGCTCCAC		CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1279C>T	9.37:g.97082579G>A	ENSP00000253262:p.Gln427*	Somatic	295	2		WXS	Illumina HiSeq	Phase_1	314	105	NM_017561	0	0	0	0	0	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Nonsense_Mutation	SNP	ENST00000253262.4	37	CCDS47994.1	.	.	.	.	.	.	.	.	.	.	.	12.92	2.081550	0.36758	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207;ENST00000375347	.	.	.	1.2	1.2	0.21068	.	2.955810	0.00957	N	0.003056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.8356	0.18605	0.0:0.0:1.0:0.0	.	.	.	.	X	412;427;412;261	.	ENSP00000253262:Q427X	Q	-	1	0	FAM22F	96122400	0.024000	0.19004	0.001000	0.08648	0.006000	0.05464	1.009000	0.29886	0.992000	0.38840	0.456000	0.33151	CAG	.		0.592	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2	NM_017561	
CCDC180	100499483	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	100128909	100128909	+	Silent	SNP	C	C	T	rs575555258		TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr9:100128909C>T	ENST00000357054.1	+	43	5018	c.4083C>T	c.(4081-4083)tgC>tgT	p.C1361C	CCDC180_ENST00000375202.2_Silent_p.C1416C|RP11-23J9.4_ENST00000534123.1_RNA|MIR1302-8_ENST00000408342.1_RNA|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000529487.1_Silent_p.C1416C			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1361						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.C1361C(1)									TTGACCAGTGCGCCGAGAACA	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20527	0.0		0.0	False		,,,				2504	0.001				p.C1416C													.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C4248T						.						108.0	90.0	96.0					9																	100128909		2203	4300	6503	SO:0001819	synonymous_variant	0	exon31			CCAGTGCGCCGAG	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.4083C>T	9.37:g.100128909C>T		Somatic	300	2		WXS	Illumina HiSeq	Phase_I	336	119	NM_020893	0	0	5	6	1	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	ENST00000357054.1	37																																																																																				.		0.532	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
POLA1	5422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	24750526	24750526	+	Missense_Mutation	SNP	T	T	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chrX:24750526T>A	ENST00000379059.3	+	16	1723	c.1708T>A	c.(1708-1710)Ttg>Atg	p.L570M	POLA1_ENST00000379068.3_Missense_Mutation_p.L576M|POLA1_ENST00000493342.1_3'UTR	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	570					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	CAGTTTTGCATTGGATAAAGC	0.398																																					p.L570M		.											.	POLA1-229	0			c.T1708A						.						189.0	158.0	168.0					X																	24750526		2203	4300	6503	SO:0001583	missense	5422	exon16			TTTGCATTGGATA		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.1708T>A	X.37:g.24750526T>A	ENSP00000368349:p.Leu570Met	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	26	23	NM_016937	0	0	0	3	3	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	37	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.534808	0.45073	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.45276	0.9;0.9	5.42	0.376	0.16193	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.268948	0.37483	N	0.002076	T	0.45357	0.1338	M	0.82323	2.585	0.33032	D	0.530339	B	0.32283	0.362	B	0.36244	0.22	T	0.54675	-0.8258	10	0.54805	T	0.06	-6.8741	9.4781	0.38884	0.0:0.4038:0.0:0.5962	.	570	P09884	DPOLA_HUMAN	M	576;570	ENSP00000368358:L576M;ENSP00000368349:L570M	ENSP00000368349:L570M	L	+	1	2	POLA1	24660447	0.321000	0.24625	0.054000	0.19295	0.938000	0.57974	0.682000	0.25335	-0.193000	0.10415	0.417000	0.27973	TTG	.		0.398	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
GATA1	2623	hgsc.bcm.edu	37	X	48652221	48652221	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chrX:48652221C>T	ENST00000376670.3	+	6	1003	c.892C>T	c.(892-894)Cgg>Tgg	p.R298W	GATA1_ENST00000376665.3_Intron	NM_002049.3	NP_002040.1	P15976	GATA1_HUMAN	GATA binding protein 1 (globin transcription factor 1)	298					basophil differentiation (GO:0030221)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cellular response to thyroid hormone stimulus (GO:0097067)|dendritic cell differentiation (GO:0097028)|embryonic hemopoiesis (GO:0035162)|eosinophil differentiation (GO:0030222)|eosinophil fate commitment (GO:0035854)|erythrocyte development (GO:0048821)|erythrocyte differentiation (GO:0030218)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|megakaryocyte differentiation (GO:0030219)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of definitive erythrocyte differentiation (GO:0010724)|regulation of glycoprotein biosynthetic process (GO:0010559)|transcription from RNA polymerase II promoter (GO:0006366)|transcriptional activation by promoter-enhancer looping (GO:0071733)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	C2H2 zinc finger domain binding (GO:0070742)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(259)|large_intestine(8)|lung(9)|prostate(1)	283						ACTGACCATGCGGAAGGATGG	0.582			"""Mis, F"""		megakaryoblastic leukemia of Downs Syndrome																																p.R298W	Pancreas(9;429 505 11287 29617)	.		Dom	yes		X	Xp11.23	2623	GATA binding protein 1 (globin transcription factor 1)		L	.	GATA1-1315	0			c.C892T						.						21.0	20.0	21.0					X																	48652221		2203	4299	6502	SO:0001583	missense	2623	exon6			ACCATGCGGAAGG	X17254	CCDS14305.1	Xp11.23	2014-09-17	2001-11-28		ENSG00000102145	ENSG00000102145		"""GATA zinc finger domain containing"""	4170	protein-coding gene	gene with protein product	"""nuclear factor, erythroid 1"""	305371	"""GATA-binding protein 1 (globin transcription factor 1)"""	GF1		1999341	Standard	NM_002049		Approved	ERYF1, NFE1, GATA-1, NF-E1	uc004dkq.4	P15976	OTTHUMG00000021504	ENST00000376670.3:c.892C>T	X.37:g.48652221C>T	ENSP00000365858:p.Arg298Trp	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	75	4	NM_002049	0	0	0	0	0	Q96GB8	Missense_Mutation	SNP	ENST00000376670.3	37	CCDS14305.1	.	.	.	.	.	.	.	.	.	.	c	18.07	3.540683	0.65085	.	.	ENSG00000102145	ENST00000376670	D	0.99667	-6.34	4.21	-2.43	0.06522	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (2);	0.068357	0.56097	U	0.000034	D	0.99007	0.9661	L	0.28694	0.88	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96825	0.9607	10	0.87932	D	0	-11.8489	14.9001	0.70672	0.8239:0.1761:0.0:0.0	.	298	P15976	GATA1_HUMAN	W	298	ENSP00000365858:R298W	ENSP00000365858:R298W	R	+	1	2	GATA1	48537165	0.693000	0.27728	0.976000	0.42696	0.976000	0.68499	-0.187000	0.09656	-1.041000	0.03266	0.365000	0.22127	CGG	.		0.582	GATA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056517.1	NM_002049	
FAM155B	27112	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	68748896	68748896	+	Missense_Mutation	SNP	C	C	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chrX:68748896C>T	ENST00000252338.4	+	2	964	c.922C>T	c.(922-924)Cgc>Tgc	p.R308C		NM_015686.2	NP_056501.2	O75949	F155B_HUMAN	family with sequence similarity 155, member B	308						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)	16						GGAATGCCAGCGCTGGGTGCC	0.597																																					p.R308C													.	FAM155B-131	0			c.C922T						.						57.0	44.0	48.0					X																	68748896		2203	4300	6503	SO:0001583	missense	27112	exon2			TGCCAGCGCTGGG	AF087142	CCDS35317.1	Xq13.1	2008-04-15	2008-04-15	2008-04-15	ENSG00000130054	ENSG00000130054			30701	protein-coding gene	gene with protein product			"""transmembrane protein 28"", ""chromosome X open reading frame 63"""	TMEM28, CXorf63			Standard	NM_015686		Approved	TED	uc004dxk.3	O75949	OTTHUMG00000021756	ENST00000252338.4:c.922C>T	X.37:g.68748896C>T	ENSP00000252338:p.Arg308Cys	Somatic	103	1		WXS	Illumina HiSeq	Phase_I	96	84	NM_015686	0	0	0	0	0	B1ALV6|B9EGK1|D3DVU1	Missense_Mutation	SNP	ENST00000252338.4	37	CCDS35317.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482094	0.63849	.	.	ENSG00000130054	ENST00000252338	T	0.12569	2.67	5.31	4.44	0.53790	.	0.417992	0.21811	N	0.068766	T	0.12220	0.0297	N	0.19112	0.55	0.38759	D	0.954299	D	0.57571	0.98	P	0.46049	0.502	T	0.06661	-1.0814	10	0.72032	D	0.01	-4.1926	12.3103	0.54925	0.1695:0.8305:0.0:0.0	.	308	O75949-2	.	C	308	ENSP00000252338:R308C	ENSP00000252338:R308C	R	+	1	0	FAM155B	68665621	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.899000	0.48679	0.993000	0.38866	0.523000	0.50628	CGC	.		0.597	FAM155B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057037.1	NM_015686	
TBC1D8B	54885	broad.mit.edu	37	X	106109170	106109170	+	Missense_Mutation	SNP	G	G	A			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chrX:106109170G>A	ENST00000357242.5	+	16	2743	c.2569G>A	c.(2569-2571)Gca>Aca	p.A857T	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.A851T	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	857							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GGCTCATTCTGCAAATAAAGA	0.408																																					p.A857T													.	TBC1D8B-133	0			c.G2569A						.						136.0	119.0	125.0					X																	106109170		2203	4300	6503	SO:0001583	missense	54885	exon16			CATTCTGCAAATA	AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.2569G>A	X.37:g.106109170G>A	ENSP00000349781:p.Ala857Thr	Somatic	53	0		WXS	Illumina HiSeq	Phase_I	45	3	NM_017752	0	0	0	0	0	B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	ENST00000357242.5	37	CCDS14522.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.04|10.04	1.241609|1.241609	0.22711|0.22711	.|.	.|.	ENSG00000133138|ENSG00000133138	ENST00000357242;ENST00000276175;ENST00000394972|ENST00000431860	T;T|.	0.30182|.	1.54;1.54|.	5.71|5.71	4.83|4.83	0.62350|0.62350	EF-hand-like domain (1);|.	0.116831|.	0.64402|.	D|.	0.000017|.	T|T	0.59595|0.59595	0.2205|0.2205	L|L	0.43598|0.43598	1.365|1.365	0.44282|0.44282	D|D	0.997149|0.997149	B|.	0.18461|.	0.028|.	B|.	0.15870|.	0.014|.	T|T	0.55496|0.55496	-0.8132|-0.8132	10|5	0.07175|.	T|.	0.84|.	-8.178|-8.178	14.2281|14.2281	0.65873|0.65873	0.0:0.1465:0.8535:0.0|0.0:0.1465:0.8535:0.0	.|.	857|.	Q0IIM8|.	TBC8B_HUMAN|.	T|Y	857;851;119|119	ENSP00000349781:A857T;ENSP00000276175:A851T|.	ENSP00000276175:A851T|.	A|C	+|+	1|2	0|0	TBC1D8B|TBC1D8B	105995826|105995826	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.899000|0.899000	0.52679|0.52679	3.852000|3.852000	0.55934|0.55934	1.125000|1.125000	0.41998|0.41998	0.594000|0.594000	0.82650|0.82650	GCA|TGC	.		0.408	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057807.2	NM_017752	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27106015	27106015	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr1:27106015delC	ENST00000324856.7	+	20	5997	c.5626delC	c.(5626-5628)ccafs	p.P1876fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.P1659fs|ARID1A_ENST00000540690.1_Frame_Shift_Del_p.P204fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.P1493fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1876					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		ACCCTGCCCACCAGCCCCTCG	0.622			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.P1876fs		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A-584	0			c.5626delC						.						64.0	70.0	68.0					1																	27106015		2203	4300	6503	SO:0001589	frameshift_variant	8289	exon20			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5626delC	1.37:g.27106015delC	ENSP00000320485:p.Pro1876fs	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	122	49	NM_006015	0	0	0	0	0	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.622	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
FAM21C	253725	broad.mit.edu	37	10	46282636	46282644	+	In_Frame_Del	DEL	GAGGCCGGT	GAGGCCGGT	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	GAGGCCGGT	GAGGCCGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr10:46282636_46282644delGAGGCCGGT	ENST00000336378.4	+	27	3077_3085	c.2959_2967delGAGGCCGGT	c.(2959-2967)gaggccggtdel	p.EAG987del	FAM21C_ENST00000540872.1_In_Frame_Del_p.EAG948del|FAM21C_ENST00000374362.2_In_Frame_Del_p.EAG989del|FAM21C_ENST00000537517.1_In_Frame_Del_p.EAG914del|FAM21C_ENST00000359860.4_In_Frame_Del_p.EAG931del	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	987					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CGGGAGTGGGGAGGCCGGTGTGAGTTTTG	0.488																																					p.989_991del													.	FAM21C-91	0			c.2965_2973del						.																																			SO:0001651	inframe_deletion	253725	exon27			AGTGGGGAGGCCG		CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.2959_2967delGAGGCCGGT	10.37:g.46282636_46282644delGAGGCCGGT	ENSP00000337541:p.Glu987_Gly989del	Somatic	620	0		WXS	Illumina HiSeq	Phase_I	516	27	NM_015262	0	0	0	0	0	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	In_Frame_Del	DEL	ENST00000336378.4	37																																																																																				.		0.488	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
WNK1	65125	broad.mit.edu	37	12	970297	970297	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr12:970297delA	ENST00000315939.6	+	7	2382	c.1739delA	c.(1738-1740)gaafs	p.E580fs	WNK1_ENST00000535572.1_Frame_Shift_Del_p.E580fs|WNK1_ENST00000537687.1_Frame_Shift_Del_p.E580fs|WNK1_ENST00000530271.2_Frame_Shift_Del_p.E580fs|WNK1_ENST00000340908.4_Frame_Shift_Del_p.E173fs|WNK1_ENST00000540360.1_3'UTR	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	580					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GAGGAGCAAGAAAAAAAAAAG	0.468																																					p.E580fs	Colon(19;451 567 6672 12618 28860)												.	WNK1-916	1	Unknown(1)	skin(1)	c.1739delA						.						98.0	96.0	97.0					12																	970297		2203	4300	6503	SO:0001589	frameshift_variant	65125	exon7			AGCAAGAAAAAAA	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1739delA	12.37:g.970297delA	ENSP00000313059:p.Glu580fs	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	96	9	NM_001184985	0	0	0	0	0	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Frame_Shift_Del	DEL	ENST00000315939.6	37	CCDS8506.1																																																																																			.		0.468	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
COL7A1	1294	hgsc.bcm.edu;bcgsc.ca	37	3	48610131	48610131	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:48610131delT	ENST00000328333.8	-	87	6980	c.6873delA	c.(6871-6873)gaafs	p.E2291fs	COL7A1_ENST00000454817.1_Frame_Shift_Del_p.E2259fs	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2291	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGGGCCAGGTTCTCCTTTAG	0.632																																					p.E2291fs		.											.	COL7A1-160	0			c.6873delA						.						24.0	30.0	28.0					3																	48610131		2200	4297	6497	SO:0001589	frameshift_variant	1294	exon87			.	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.6873delA	3.37:g.48610131delT	ENSP00000332371:p.Glu2291fs	Somatic	136	0		WXS	Illumina HiSeq	Phase_I	114	31	NM_000094	0	0	0	0	0	Q14054|Q16507	Frame_Shift_Del	DEL	ENST00000328333.8	37	CCDS2773.1																																																																																			.		0.632	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
IL17RD	54756	hgsc.bcm.edu;bcgsc.ca	37	3	57144293	57144293	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr3:57144293delC	ENST00000296318.7	-	4	445	c.357delG	c.(355-357)aagfs	p.K119fs	IL17RD_ENST00000427856.2_Frame_Shift_Del_p.K95fs|IL17RD_ENST00000463523.1_5'UTR|IL17RD_ENST00000320057.5_5'UTR	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	119					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		TTCCCTCCGACTTCAGCTCCT	0.438																																					p.K119fs		.											.	IL17RD-500	0			c.357delG						.						121.0	109.0	113.0					3																	57144293		1911	4137	6048	SO:0001589	frameshift_variant	54756	exon4			.	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.357delG	3.37:g.57144293delC	ENSP00000296318:p.Lys119fs	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	90	27	NM_017563	0	0	0	0	0	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Frame_Shift_Del	DEL	ENST00000296318.7	37	CCDS2880.2																																																																																			.		0.438	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
WDR16	146845	broad.mit.edu	37	17	9503401	9503402	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr17:9503401_9503402insT	ENST00000352665.5	+	6	723_724	c.654_655insT	c.(655-657)tttfs	p.F219fs	WDR16_ENST00000396219.3_Frame_Shift_Ins_p.F151fs|WDR16_ENST00000299764.5_Frame_Shift_Ins_p.F229fs	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						ATGATGATAGCTTTTTCTACCT	0.485																																					p.S218fs													.	WDR16-71	0			c.654_655insT						.																																			SO:0001589	frameshift_variant	146845	exon6			TGATAGCTTTTTC	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.659dupT	17.37:g.9503406_9503406dupT	ENSP00000339449:p.Phe219fs	Somatic	147	0		WXS	Illumina HiSeq	Phase_I	168	7	NM_145054	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000352665.5	37	CCDS11149.2																																																																																			.		0.485	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
USF2	7392	bcgsc.ca	37	19	35761401	35761402	+	In_Frame_Ins	INS	-	-	TCAGCGGGGAGGCACGATTTGCCT			TCGA-HE-A5NJ-01A-11D-A26P-10	TCGA-HE-A5NJ-10A-01D-A26P-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a9dbd55c-5dcc-48db-8785-6baef3fdd7db	de0653ad-a848-4f4b-b675-6cb625cb5167	g.chr19:35761401_35761402insTCAGCGGGGAGGCACGATTTGCCT	ENST00000222305.3	+	5	518_519	c.481_482insTCAGCGGGGAGGCACGATTTGCCT	c.(481-483)gtc>gTCAGCGGGGAGGCACGATTTGCCTtc	p.161_162insSGEARFAF	USF2_ENST00000594064.1_In_Frame_Ins_p.159_160insSGEARFAF|USF2_ENST00000343550.5_In_Frame_Ins_p.94_95insSGEARFAF|USF2_ENST00000379134.3_Intron|USF2_ENST00000595068.1_In_Frame_Ins_p.161_162insSGEARFAF	NM_003367.2	NP_003358.1	Q15853	USF2_HUMAN	upstream transcription factor 2, c-fos interacting	161					lactation (GO:0007595)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|urinary_tract(1)	13	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGCCGAGGCTGTCAGCGGGGAG	0.589																																					p.V161delinsVSGEARFAF	NSCLC(103;173 2832 8890)												.	USF2-514	0			c.481_482insTCAGCGGGGAGGCACGATTTGCCT						.																																			SO:0001652	inframe_insertion	7392	exon5			GAGGCTGTCAGCG	AY007087	CCDS12452.1, CCDS12453.1	19q13	2013-05-21				ENSG00000105698		"""Basic helix-loop-helix proteins"""	12594	protein-coding gene	gene with protein product		600390				8954795	Standard	NM_003367		Approved	FIP, bHLHb12	uc002nyq.1	Q15853		ENST00000222305.3:c.482_505dupTCAGCGGGGAGGCACGATTTGCCT	19.37:g.35761401_35761402insTCAGCGGGGAGGCACGATTTGCCT	ENSP00000222305:p.Val161_Ser162insSerGlyGluAlaArgPheAlaPhe	Somatic	288	0		WXS	Illumina HiSeq	Phase_1	209	10	NM_003367	0	0	0	0	0	O00671|O00709|Q05750|Q07952|Q15851|Q15852|Q6FI33|Q6YI47	In_Frame_Ins	INS	ENST00000222305.3	37	CCDS12452.1																																																																																			.		0.589	USF2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466056.1	NM_003367	
