#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
BAI2	576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	32205741	32205741	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr1:32205741T>G	ENST00000373658.3	-	13	2369	c.2028A>C	c.(2026-2028)gaA>gaC	p.E676D	BAI2_ENST00000398538.1_Missense_Mutation_p.E664D|BAI2_ENST00000398556.3_Missense_Mutation_p.E624D|BAI2_ENST00000257070.4_Missense_Mutation_p.E676D|BAI2_ENST00000398547.1_Missense_Mutation_p.E609D|BAI2_ENST00000527361.1_Missense_Mutation_p.E676D|BAI2_ENST00000440175.2_Missense_Mutation_p.E318D|BAI2_ENST00000398542.1_Missense_Mutation_p.E609D|BAI2_ENST00000373655.2_Missense_Mutation_p.E676D	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	676					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TCTCCTTGTTTTCCGCATCCA	0.612																																					p.E676D		.											.	BAI2-526	0			c.A2028C						.						125.0	110.0	115.0					1																	32205741		2203	4300	6503	SO:0001583	missense	576	exon13			CTTGTTTTCCGCA	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2028A>C	1.37:g.32205741T>G	ENSP00000362762:p.Glu676Asp	Somatic	214	0		WXS	Illumina HiSeq	Phase_I	148	50	NM_001703	0	0	2	2	0	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	T	18.09	3.546810	0.65198	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125	T;T;T;T;T;T;T;T;T;T	0.10288	2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89	4.62	1.63	0.23807	Domain of unknown function DUF3497 (1);	0.192067	0.26106	N	0.026319	T	0.16385	0.0394	L	0.54323	1.7	0.32584	N	0.528032	P;D;B;P;P;P	0.52996	0.804;0.957;0.307;0.815;0.804;0.815	P;P;P;P;P;P	0.53313	0.526;0.723;0.534;0.631;0.526;0.631	T	0.12268	-1.0554	10	0.46703	T	0.11	.	7.784	0.29080	0.0:0.6153:0.0:0.3847	.	676;664;318;609;676;676	O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	D	624;609;676;676;609;676;676;318;664;614	ENSP00000381564:E624D;ENSP00000381555:E609D;ENSP00000362762:E676D;ENSP00000362759:E676D;ENSP00000381550:E609D;ENSP00000257070:E676D;ENSP00000435397:E676D;ENSP00000391071:E318D;ENSP00000381548:E664D;ENSP00000410921:E614D	ENSP00000257070:E676D	E	-	3	2	BAI2	31978328	1.000000	0.71417	0.975000	0.42487	0.765000	0.43378	0.796000	0.26986	0.124000	0.18369	-0.474000	0.04947	GAA	.		0.612	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
BGLAP	632	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	156209392	156209392	+	5'Flank	SNP	A	A	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr1:156209392A>C	ENST00000368272.4	+	0	0				PMF1_ENST00000567140.1_Intron|PMF1-BGLAP_ENST00000368276.4_Intron|PMF1_ENST00000368279.3_3'UTR|PMF1_ENST00000565805.1_Intron|PMF1_ENST00000368273.4_Nonstop_Mutation_p.*208C|PMF1-BGLAP_ENST00000320139.5_Intron|PMF1_ENST00000368277.3_Nonstop_Mutation_p.*206C|PMF1-BGLAP_ENST00000490491.1_Intron	NM_199173.4	NP_954642.1	P02818	OSTCN_HUMAN	bone gamma-carboxyglutamate (gla) protein						bone development (GO:0060348)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cell aging (GO:0007569)|cellular response to growth factor stimulus (GO:0071363)|cellular response to vitamin D (GO:0071305)|odontogenesis (GO:0042476)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|regulation of bone mineralization (GO:0030500)|regulation of bone resorption (GO:0045124)|regulation of osteoclast differentiation (GO:0045670)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to hydroxyisoflavone (GO:0033594)|response to mechanical stimulus (GO:0009612)|response to testosterone (GO:0033574)|response to vitamin D (GO:0033280)|response to vitamin K (GO:0032571)|response to zinc ion (GO:0010043)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|perikaryon (GO:0043204)|rough endoplasmic reticulum (GO:0005791)	calcium ion binding (GO:0005509)|hydroxyapatite binding (GO:0046848)|structural constituent of bone (GO:0008147)|structural molecule activity (GO:0005198)			large_intestine(3)|lung(1)|urinary_tract(1)	5	Hepatocellular(266;0.158)				Gallium nitrate(DB05260)|Menadione(DB00170)|Phylloquinone(DB01022)	AGCCTGAGTGAGGAGACCGCC	0.572																																					p.X208C		.											.	PMF1-44	0			c.A624C						.						81.0	85.0	84.0					1																	156209392		2203	4300	6503	SO:0001631	upstream_gene_variant	11243	exon5			TGAGTGAGGAGAC	X04143	CCDS1134.1	1q22	2014-05-13	2008-08-01		ENSG00000242252	ENSG00000242252			1043	protein-coding gene	gene with protein product	"""osteocalcin"""	112260				2785029, 2394711	Standard	NM_199173		Approved	OCN	uc001fnt.3	P02818	OTTHUMG00000014819		1.37:g.156209392A>C	Exception_encountered	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	121	42	NM_001199654	0	0	35	80	45	Q5TCK6	Missense_Mutation	SNP	ENST00000368272.4	37	CCDS1134.1	.	.	.	.	.	.	.	.	.	.	a	16.96	3.267332	0.59540	.	.	ENSG00000160783	ENST00000368273;ENST00000368277	.	.	.	5.07	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4393	0.27174	0.9034:0.0:0.0966:0.0	.	.	.	.	C	208;206	.	.	X	+	3	0	PMF1	154476016	0.998000	0.40836	0.883000	0.34634	0.969000	0.65631	2.898000	0.48672	1.073000	0.40885	0.529000	0.55759	TGA	.		0.572	BGLAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040867.2	NM_199173	
OR2T3	343173	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	248637175	248637175	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr1:248637175A>C	ENST00000359594.2	+	1	549	c.524A>C	c.(523-525)cAg>cCg	p.Q175P		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCTTTTGCCAGTCTAGGAAA	0.527																																					p.Q175P		.											.	OR2T3-69	0			c.A524C						.						42.0	39.0	40.0					1																	248637175		2162	4256	6418	SO:0001583	missense	343173	exon1			TTTGCCAGTCTAG		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.524A>C	1.37:g.248637175A>C	ENSP00000352604:p.Gln175Pro	Somatic	467	1		WXS	Illumina HiSeq	Phase_I	430	119	NM_001005495	0	0	0	0	0	B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	37	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	a	10.12	1.262159	0.23051	.	.	ENSG00000196539	ENST00000359594	T	0.37235	1.21	2.37	-2.34	0.06704	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.27629	0.0679	N	0.20807	0.61	0.09310	N	1	B	0.29909	0.261	B	0.40602	0.334	T	0.45396	-0.9264	9	0.66056	D	0.02	.	8.3181	0.32113	0.2131:0.0:0.7869:0.0	.	175	Q8NH03	OR2T3_HUMAN	P	175	ENSP00000352604:Q175P	ENSP00000352604:Q175P	Q	+	2	0	OR2T3	246703798	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.077000	0.11394	-1.019000	0.03358	0.156000	0.16432	CAG	.		0.527	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495	
CCDC3	83643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	13043327	13043327	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr10:13043327G>T	ENST00000378825.3	-	1	370	c.244C>A	c.(244-246)Ctg>Atg	p.L82M	CCDC3_ENST00000378839.1_Intron	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	82						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			TGGTCGCACAGCATCTCGACC	0.706																																					p.L82M		.											.	CCDC3-91	0			c.C244A						.						14.0	16.0	15.0					10																	13043327		2194	4293	6487	SO:0001583	missense	83643	exon1			CGCACAGCATCTC	BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.244C>A	10.37:g.13043327G>T	ENSP00000368102:p.Leu82Met	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	70	27	NM_031455	0	0	1	1	0	Q5VYV8|Q5VYV9	Missense_Mutation	SNP	ENST00000378825.3	37	CCDS7093.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.029083	0.75504	.	.	ENSG00000151468	ENST00000378825	.	.	.	4.55	3.65	0.41850	.	0.000000	0.64402	D	0.000001	T	0.75788	0.3897	M	0.74258	2.255	0.50813	D	0.999899	D	0.76494	0.999	D	0.71656	0.974	T	0.76623	-0.2891	9	0.54805	T	0.06	-8.5593	11.5639	0.50794	0.0889:0.0:0.9111:0.0	.	82	Q9BQI4	CCDC3_HUMAN	M	82	.	ENSP00000368102:L82M	L	-	1	2	CCDC3	13083333	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.135000	0.71696	0.905000	0.36596	-0.224000	0.12420	CTG	.		0.706	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046829.1	NM_031455	
C10orf76	79591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	103789497	103789497	+	Silent	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr10:103789497C>T	ENST00000370033.4	-	5	431	c.312G>A	c.(310-312)ctG>ctA	p.L104L	C10orf76_ENST00000311122.5_Silent_p.L104L	NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	104						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		TGAGTGCGCACAGGGTCTGCA	0.473																																					p.L104L		.											.	C10orf76-90	0			c.G312A						.						112.0	104.0	107.0					10																	103789497		1928	4137	6065	SO:0001819	synonymous_variant	79591	exon5			TGCGCACAGGGTC	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.312G>A	10.37:g.103789497C>T		Somatic	48	0		WXS	Illumina HiSeq	Phase_I	46	10	NM_024541	0	0	0	0	0	Q2TB87|Q9H8Z9	Silent	SNP	ENST00000370033.4	37	CCDS41563.1																																																																																			.		0.473	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050007.1	NM_024541	
PSD	5662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	104173630	104173630	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr10:104173630C>A	ENST00000020673.5	-	5	1975	c.1449G>T	c.(1447-1449)gaG>gaT	p.E483D	PSD_ENST00000406432.1_Missense_Mutation_p.E483D|PSD_ENST00000492902.2_5'Flank	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	483	Poly-Glu.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		CCTCCTCCTCCTCCCCTCTCT	0.677																																					p.E483D		.											.	PSD-272	0			c.G1449T						.						30.0	34.0	33.0					10																	104173630		2203	4300	6503	SO:0001583	missense	5662	exon6			CTCCTCCTCCCCT	X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1449G>T	10.37:g.104173630C>A	ENSP00000020673:p.Glu483Asp	Somatic	209	0		WXS	Illumina HiSeq	Phase_I	147	50	NM_001270965	0	0	0	0	0	B1AKX7|D3DR87|Q15673|Q8IVG0	Missense_Mutation	SNP	ENST00000020673.5	37	CCDS31272.1	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379979	0.42207	.	.	ENSG00000059915	ENST00000020673;ENST00000541902;ENST00000406432	T;T	0.19806	2.12;2.12	4.65	0.0368	0.14193	.	0.480088	0.20167	N	0.097814	T	0.11067	0.0270	N	0.24115	0.695	0.20638	N	0.999877	B	0.16396	0.017	B	0.09377	0.004	T	0.35895	-0.9770	10	0.13853	T	0.58	.	9.4906	0.38958	0.0:0.5847:0.0:0.4153	.	483	A5PKW4	PSD1_HUMAN	D	483;386;483	ENSP00000020673:E483D;ENSP00000384830:E483D	ENSP00000020673:E483D	E	-	3	2	PSD	104163620	0.473000	0.25878	0.998000	0.56505	0.989000	0.77384	-0.538000	0.06120	0.064000	0.16427	0.456000	0.33151	GAG	.		0.677	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050041.2		
SLC25A22	79751	ucsc.edu	37	11	799396	799396	+	5'Flank	SNP	C	C	T	rs370316550		TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr11:799396C>T	ENST00000531214.1	-	0	0				PIDD_ENST00000411829.2_Missense_Mutation_p.D865N|PIDD_ENST00000347755.5_Missense_Mutation_p.D882N	NM_001191060.1	NP_001177989.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22						L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGGATGCTGTCCTGGTACTTG	0.701																																					p.D882N	Colon(93;848 1468 3270 23355 49636)												.	PIDD-205	0			c.G2644A						.						59.0	62.0	61.0					11																	799396		2203	4294	6497	SO:0001631	upstream_gene_variant	55367	exon16			TGCTGTCCTGGTA	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310		11.37:g.799396C>T	Exception_encountered	Somatic	64	0		WXS	Illumina HiSeq		47	4	NM_145886	0	0	13	13	0	A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000531214.1	37	CCDS7715.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809838	0.50421	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	D;D	0.93076	-3.16;-3.16	5.04	5.04	0.67666	DEATH-like (1);	0.275088	0.34411	N	0.003990	D	0.87370	0.6160	N	0.24115	0.695	0.34027	D	0.653334	P;B;P	0.38504	0.561;0.302;0.634	B;B;B	0.33620	0.109;0.167;0.167	D	0.92063	0.5658	10	0.66056	D	0.02	.	14.0391	0.64663	0.0:0.8486:0.1514:0.0	.	882;725;865	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	N	865;882	ENSP00000416801:D865N;ENSP00000337797:D882N	ENSP00000337797:D882N	D	-	1	0	PIDD	789396	0.995000	0.38212	0.925000	0.36789	0.081000	0.17604	4.915000	0.63355	2.338000	0.79540	0.448000	0.29417	GAC	.		0.701	SLC25A22-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384124.1		
MUC2	4583	bcgsc.ca	37	11	1092920	1092920	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr11:1092920C>A	ENST00000441003.2	+	30	4766	c.4739C>A	c.(4738-4740)aCc>aAc	p.T1580N	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.T1581N	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ggcacacagaccccaacatcg	0.632																																					p.T1580N													.	MUC2-90	0			c.C4739A						.						74.0	113.0	100.0					11																	1092920		1924	3573	5497	SO:0001583	missense	4583	exon30			CACAGACCCCAAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4739C>A	11.37:g.1092920C>A	ENSP00000415183:p.Thr1580Asn	Somatic	383	7		WXS	Illumina HiSeq	Phase_1	322	15	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.897	-0.228278	0.06022	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.15952	2.38;2.53	1.75	-3.51	0.04696	.	7739.210000	0.00597	U	0.000365	T	0.08492	0.0211	.	.	.	0.09310	N	1	B	0.28026	0.198	B	0.17098	0.017	T	0.10776	-1.0615	9	0.27082	T	0.32	.	2.0197	0.03506	0.1703:0.3607:0.3305:0.1386	.	1580	E7EUV1	.	N	1580;1581	ENSP00000415183:T1580N;ENSP00000351956:T1581N	ENSP00000351956:T1581N	T	+	2	0	MUC2	1082920	0.001000	0.12720	0.000000	0.03702	0.071000	0.16799	1.304000	0.33482	-1.223000	0.02584	0.121000	0.15741	ACC	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
PSMA1	5682	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	14536021	14536021	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr11:14536021C>A	ENST00000396394.2	-	5	667	c.271G>T	c.(271-273)Gag>Tag	p.E91*	PSMA1_ENST00000418988.2_Nonsense_Mutation_p.E97*|PSMA1_ENST00000396393.1_Nonsense_Mutation_p.E91*|PSMA1_ENST00000530457.1_Nonsense_Mutation_p.E66*|PSMA1_ENST00000419365.2_Nonsense_Mutation_p.E91*|PSMA1_ENST00000555531.1_Nonsense_Mutation_p.E91*	NM_002786.3	NP_002777.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1	91					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						TCCAAACACTCCTGACGCATA	0.308																																					p.E97X													.	PSMA1-92	0			c.G289T						.						43.0	41.0	42.0					11																	14536021		2200	4294	6494	SO:0001587	stop_gained	5682	exon6			AACACTCCTGACG	X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000396394.2:c.271G>T	11.37:g.14536021C>A	ENSP00000379676:p.Glu91*	Somatic	100	1		WXS	Illumina HiSeq	Phase_I	113	41	NM_148976	0	0	69	79	10	A8K400|Q53YE8|Q9BRV9	Nonsense_Mutation	SNP	ENST00000396394.2	37	CCDS7816.1	.	.	.	.	.	.	.	.	.	.	C	39	7.563044	0.98361	.	.	ENSG00000129084	ENST00000419365;ENST00000396394;ENST00000396393;ENST00000530457;ENST00000418988	.	.	.	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-21.0217	19.5544	0.95335	0.0:1.0:0.0:0.0	.	.	.	.	X	91;91;91;66;97	.	ENSP00000379675:E91X	E	-	1	0	PSMA1	14492597	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.018000	0.76406	2.623000	0.88846	0.591000	0.81541	GAG	.		0.308	PSMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386421.3	NM_002786	
INPPL1	3636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	71944164	71944164	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr11:71944164G>T	ENST00000298229.2	+	17	2201	c.1997G>T	c.(1996-1998)gGt>gTt	p.G666V	INPPL1_ENST00000541756.1_Missense_Mutation_p.G424V|INPPL1_ENST00000538751.1_Missense_Mutation_p.G424V	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	666					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TATGAGCGGGGTTCCCGGGAC	0.602																																					p.G666V		.											.	INPPL1-660	0			c.G1997T						.						49.0	48.0	48.0					11																	71944164		2200	4293	6493	SO:0001583	missense	3636	exon17			AGCGGGGTTCCCG	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.1997G>T	11.37:g.71944164G>T	ENSP00000298229:p.Gly666Val	Somatic	219	0		WXS	Illumina HiSeq	Phase_I	158	66	NM_001567	0	0	5	10	5	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.	.	.	.	.	.	.	.	.	.	g	18.33	3.599890	0.66332	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751	D;D;D	0.95656	-3.77;-3.77;-3.77	5.66	5.66	0.87406	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.230735	0.44688	D	0.000437	D	0.98457	0.9486	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.98338	1.0537	10	0.27082	T	0.32	.	17.588	0.87988	0.0:0.0:1.0:0.0	.	666	O15357	SHIP2_HUMAN	V	666;424;424	ENSP00000298229:G666V;ENSP00000446360:G424V;ENSP00000444619:G424V	ENSP00000298229:G666V	G	+	2	0	INPPL1	71621812	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.393000	0.97256	2.830000	0.97506	0.655000	0.94253	GGT	.		0.602	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
MMP27	64066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102563689	102563689	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr11:102563689T>G	ENST00000260229.4	-	9	1368	c.1277A>C	c.(1276-1278)gAt>gCt	p.D426A		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	426					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	GAAAGCAGCATCAACACGGAT	0.413																																					p.D426A		.											.	MMP27-229	0			c.A1277C						.						215.0	201.0	206.0					11																	102563689		2203	4299	6502	SO:0001583	missense	64066	exon9			GCAGCATCAACAC	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1277A>C	11.37:g.102563689T>G	ENSP00000260229:p.Asp426Ala	Somatic	178	0		WXS	Illumina HiSeq	Phase_I	157	48	NM_022122	0	0	0	0	0	Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	37	CCDS8319.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.756835	0.49362	.	.	ENSG00000137675	ENST00000260229	T	0.20598	2.06	5.67	4.55	0.56014	Hemopexin/matrixin (2);	0.204141	0.33813	N	0.004526	T	0.50497	0.1619	M	0.90483	3.12	0.53688	D	0.999973	D	0.76494	0.999	D	0.67900	0.954	T	0.58578	-0.7612	10	0.72032	D	0.01	.	11.5591	0.50766	0.0:0.0698:0.0:0.9302	.	426	Q9H306	MMP27_HUMAN	A	426	ENSP00000260229:D426A	ENSP00000260229:D426A	D	-	2	0	MMP27	102068899	0.445000	0.25657	0.431000	0.26735	0.430000	0.31655	2.306000	0.43673	0.996000	0.38943	0.529000	0.55759	GAT	.		0.413	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122	
PAFAH1B2	5049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	117038364	117038364	+	Missense_Mutation	SNP	C	C	G	rs569223304		TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr11:117038364C>G	ENST00000527958.1	+	6	798	c.639C>G	c.(637-639)atC>atG	p.I213M	PAFAH1B2_ENST00000419197.2_Intron|PAFAH1B2_ENST00000529887.2_Intron|PAFAH1B2_ENST00000530272.1_Intron|PAFAH1B2_ENST00000526888.1_Intron	NM_002572.3	NP_002563.1	P68402	PA1B2_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)	213					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|positive regulation of macroautophagy (GO:0016239)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)			kidney(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;1.68e-05)|Epithelial(105;0.000162)|all cancers(92;0.00111)		ATGAACTGATCATGCAGTTGT	0.488			T	IGH@	MLCLS																																p.I213M		.		Dom	yes		11	11q23	5049	"""platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa"""		L	.	PAFAH1B2-204	0			c.C639G						.						82.0	68.0	73.0					11																	117038364		2201	4296	6497	SO:0001583	missense	5049	exon6			ACTGATCATGCAG	D63390	CCDS8380.1, CCDS53713.1, CCDS53714.1, CCDS53715.1	11q23	2011-10-24	2010-02-10			ENSG00000168092			8575	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 2 subunit"""	602508	"""platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 2 (30kDa)"""			9144386, 9693049	Standard	NM_002572		Approved		uc001pqe.2	P68402		ENST00000527958.1:c.639C>G	11.37:g.117038364C>G	ENSP00000435289:p.Ile213Met	Somatic	340	0		WXS	Illumina HiSeq	Phase_I	330	137	NM_002572	0	0	23	27	4	A8DPS5|A8DPS6|A8DPS7|E9PEJ5|E9PLP3|O00687|Q29459|Q6IBR6	Missense_Mutation	SNP	ENST00000527958.1	37	CCDS8380.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458076	0.63401	.	.	ENSG00000168092	ENST00000527958;ENST00000304808	T;T	0.56776	0.62;0.44	5.49	5.49	0.81192	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.053461	0.85682	D	0.000000	T	0.64360	0.2591	L	0.54323	1.7	0.80722	D	1	P	0.40931	0.733	P	0.51193	0.662	T	0.65685	-0.6108	10	0.72032	D	0.01	-9.1136	19.3671	0.94468	0.0:1.0:0.0:0.0	.	213	P68402	PA1B2_HUMAN	M	213;159	ENSP00000435289:I213M;ENSP00000304006:I159M	ENSP00000304006:I159M	I	+	3	3	PAFAH1B2	116543574	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.100000	0.50275	2.593000	0.87608	0.563000	0.77884	ATC	.		0.488	PAFAH1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392826.1	NM_002572	
RECQL	5965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	21623145	21623145	+	Missense_Mutation	SNP	T	T	G			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr12:21623145T>G	ENST00000444129.2	-	15	2401	c.1933A>C	c.(1933-1935)Aaa>Caa	p.K645Q	RECQL_ENST00000421138.2_Missense_Mutation_p.K645Q|PYROXD1_ENST00000538582.1_3'UTR|PYROXD1_ENST00000240651.9_3'UTR	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	645					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TCATCGATTTTTCTTTTCTTA	0.313								Other identified genes with known or suspected DNA repair function																													p.K645Q		.											.	RECQL-228	0			c.A1933C						.						79.0	81.0	80.0					12																	21623145		2202	4297	6499	SO:0001583	missense	5965	exon16			CGATTTTTCTTTT	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1933A>C	12.37:g.21623145T>G	ENSP00000416739:p.Lys645Gln	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	427	263	NM_032941	0	0	11	54	43	A8K6G2	Missense_Mutation	SNP	ENST00000444129.2	37	CCDS31756.1	.	.	.	.	.	.	.	.	.	.	T	17.60	3.429403	0.62844	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.57907	0.37;0.37	4.56	4.56	0.56223	.	0.597468	0.16648	N	0.205325	T	0.48926	0.1527	L	0.32530	0.975	0.33037	D	0.530956	P	0.52316	0.952	P	0.49140	0.601	T	0.62553	-0.6830	10	0.66056	D	0.02	-7.7317	10.4656	0.44604	0.0:0.0:0.0:1.0	.	645	P46063	RECQ1_HUMAN	Q	645	ENSP00000416739:K645Q;ENSP00000395449:K645Q	ENSP00000395449:K645Q	K	-	1	0	RECQL	21514412	1.000000	0.71417	0.988000	0.46212	0.886000	0.51366	3.310000	0.51911	2.036000	0.60181	0.528000	0.53228	AAA	.		0.313	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
HOXC10	3226	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54382989	54382989	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr12:54382989T>C	ENST00000303460.4	+	2	862	c.788T>C	c.(787-789)cTg>cCg	p.L263P	MIR196A2_ENST00000385189.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron|HOXC10_ENST00000511575.1_3'UTR	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10	263					anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						GGAAATTGGCTGACAGCAAAG	0.428											OREG0021882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L263P													.	HOXC10-91	0			c.T788C						.						64.0	62.0	63.0					12																	54382989		2203	4300	6503	SO:0001583	missense	3226	exon2			ATTGGCTGACAGC		CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.788T>C	12.37:g.54382989T>C	ENSP00000307321:p.Leu263Pro	Somatic	148	1	999	WXS	Illumina HiSeq	Phase_I	226	47	NM_017409	0	0	48	71	23	O15219|O15220|Q9BVD5	Missense_Mutation	SNP	ENST00000303460.4	37	CCDS8868.1	.	.	.	.	.	.	.	.	.	.	T	16.15	3.041980	0.55003	.	.	ENSG00000180818	ENST00000303460	D	0.95724	-3.79	3.97	3.97	0.46021	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.64402	D	0.000004	D	0.95233	0.8454	M	0.70842	2.15	0.80722	D	1	P	0.43607	0.812	P	0.46585	0.521	D	0.95488	0.8566	10	0.87932	D	0	.	12.5235	0.56073	0.0:0.0:0.0:1.0	.	263	Q9NYD6	HXC10_HUMAN	P	263	ENSP00000307321:L263P	ENSP00000307321:L263P	L	+	2	0	HOXC10	52669256	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.993000	0.88291	1.743000	0.51761	0.374000	0.22700	CTG	.		0.428	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358952.2		
NCKAP1L	3071	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	54905823	54905823	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr12:54905823C>A	ENST00000293373.6	+	9	954	c.875C>A	c.(874-876)aCc>aAc	p.T292N	NCKAP1L_ENST00000552211.1_3'UTR|NCKAP1L_ENST00000545638.2_Missense_Mutation_p.T242N	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	292					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						CTCTACATCACCCTTATCCGT	0.522																																					p.T292N													.	NCKAP1L-93	0			c.C875A						.						144.0	125.0	132.0					12																	54905823		2203	4300	6503	SO:0001583	missense	3071	exon9			ACATCACCCTTAT	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.875C>A	12.37:g.54905823C>A	ENSP00000293373:p.Thr292Asn	Somatic	332	1		WXS	Illumina HiSeq	Phase_I	518	88	NM_005337	0	0	2	2	0	B4DUT5|Q52LW0	Missense_Mutation	SNP	ENST00000293373.6	37	CCDS31813.1	.	.	.	.	.	.	.	.	.	.	C	18.92	3.724890	0.68959	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.34072	1.38;1.38	5.61	5.61	0.85477	.	0.108403	0.64402	D	0.000011	T	0.50837	0.1639	M	0.65498	2.005	0.37617	D	0.921162	D	0.55385	0.971	P	0.52823	0.71	T	0.54728	-0.8250	10	0.42905	T	0.14	-19.2572	17.1917	0.86881	0.0:1.0:0.0:0.0	.	292	P55160	NCKPL_HUMAN	N	292;242	ENSP00000293373:T292N;ENSP00000445596:T242N	ENSP00000293373:T292N	T	+	2	0	NCKAP1L	53192090	0.976000	0.34144	1.000000	0.80357	0.786000	0.44442	2.377000	0.44300	2.665000	0.90641	0.558000	0.71614	ACC	.		0.522	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
LRIG3	121227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	59308047	59308047	+	Splice_Site	SNP	C	C	T	rs373824765		TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr12:59308047C>T	ENST00000320743.3	-	2	593	c.307G>A	c.(307-309)Gtg>Atg	p.V103M	LRIG3_ENST00000379141.4_Splice_Site_p.V43M	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	103					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			AAGACTCACACTTCTCGAAGG	0.323			T	ROS1	NSCLC																																p.V103M		.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3-229	0			c.G307A						.	C	MET/VAL,MET/VAL	0,4406		0,0,2203	97.0	104.0	101.0		127,307	4.0	1.0	12		101	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice,missense-near-splice	LRIG3	NM_001136051.1,NM_153377.3	21,21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	43/1060,103/1120	59308047	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	121227	exon2			CTCACACTTCTCG	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.308+1G>A	12.37:g.59308047C>T		Somatic	61	0		WXS	Illumina HiSeq	Phase_I	88	13	NM_153377	0	0	0	0	0	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	37	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	C	13.83	2.352857	0.41700	0.0	1.16E-4	ENSG00000139263	ENST00000379141;ENST00000320743;ENST00000552267	T;T;T	0.55052	1.74;1.53;0.54	5.86	3.99	0.46301	.	0.234157	0.21955	N	0.066677	T	0.44850	0.1313	M	0.63428	1.95	0.41104	D	0.985693	B;B	0.24823	0.112;0.02	B;B	0.24541	0.054;0.006	T	0.31696	-0.9934	9	.	.	.	.	5.4651	0.16637	0.0:0.5541:0.1389:0.307	.	43;103	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	M	43;103;10	ENSP00000368436:V43M;ENSP00000326759:V103M;ENSP00000449109:V10M	.	V	-	1	0	LRIG3	57594314	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	0.426000	0.21363	0.753000	0.32945	0.655000	0.94253	GTG	.		0.323	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	Missense_Mutation
UBC	7316	ucsc.edu;bcgsc.ca	37	12	125397655	125397655	+	Silent	SNP	C	C	A	rs544863778		TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr12:125397655C>A	ENST00000536769.1	-	1	2239	c.663G>T	c.(661-663)ctG>ctT	p.L221L	UBC_ENST00000339647.5_Silent_p.L221L|UBC_ENST00000536661.1_5'Flank|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Silent_p.L145L|UBC_ENST00000538617.1_Intron			P0CG48	UBC_HUMAN	ubiquitin C	221	Ubiquitin-like 3. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		GACGGAGTACCAGGTGCAAGG	0.512																																					p.L221L													.	UBC-46	0			c.G663T						.						221.0	196.0	204.0					12																	125397655		2203	4299	6502	SO:0001819	synonymous_variant	7316	exon2			GAGTACCAGGTGC		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.663G>T	12.37:g.125397655C>A		Somatic	627	2		WXS	Illumina HiSeq		894	224	NM_021009	1	0	1200	1614	413	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000536769.1	37	CCDS9260.1																																																																																			.		0.512	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009	
ATP5EP2	432369	ucsc.edu	37	13	28519461	28519461	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr13:28519461T>C	ENST00000381026.3	+	1	119	c.65T>C	c.(64-66)gTa>gCa	p.V22A				Q5VTU8	AT5EL_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit pseudogene 2	22					ATP synthesis coupled proton transport (GO:0015986)	mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			ovary(1)	1						TGTGCAAAAGTAGTGAGAGAT	0.478																																					.													.	ATP5EP2-1	0			.						.																																			SO:0001583	missense	432369	.			CAAAAGTAGTGAG	EC567419		13q12	2008-10-21			ENSG00000180389	ENSG00000180389			34026	pseudogene	pseudogene							Standard	NR_002162		Approved		uc001uru.3	Q5VTU8	OTTHUMG00000016642	ENST00000381026.3:c.65T>C	13.37:g.28519461T>C	ENSP00000370414:p.Val22Ala	Somatic	189	0		WXS	Illumina HiSeq		161	1	.	3	0	1	1263	1259		RNA	SNP	ENST00000381026.3	37		.	.	.	.	.	.	.	.	.	.	T	0.760	-0.769591	0.02974	.	.	ENSG00000180389	ENST00000381026	T	0.73363	-0.74	3.32	1.53	0.23141	.	0.142509	0.44285	N	0.000463	T	0.43299	0.1241	.	.	.	0.24288	N	0.995177	.	.	.	.	.	.	T	0.33445	-0.9868	7	0.05620	T	0.96	-15.6185	5.8926	0.18921	0.0:0.7412:0.0:0.2588	.	.	.	.	A	22	ENSP00000370414:V22A	ENSP00000370414:V22A	V	+	2	0	ATP5EP2	27417461	1.000000	0.71417	0.993000	0.49108	0.972000	0.66771	0.331000	0.19733	0.250000	0.21479	-0.275000	0.10095	GTA	.		0.478	ATP5EP2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000044314.1	NR_002162	
SLIRP	81892	ucsc.edu	37	14	78174462	78174462	+	Missense_Mutation	SNP	C	C	A	rs552083394		TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr14:78174462C>A	ENST00000557342.1	+	1	49	c.8C>A	c.(7-9)gCc>gAc	p.A3D	SLIRP_ENST00000557431.1_Missense_Mutation_p.A3D|SLIRP_ENST00000238688.5_Missense_Mutation_p.A3D|SLIRP_ENST00000557623.1_Missense_Mutation_p.A3D|ALKBH1_ENST00000216489.3_5'Flank	NM_001267864.1|NM_031210.5	NP_001254793.1|NP_112487.1	Q9GZT3	SLIRP_HUMAN	SRA stem-loop interacting RNA binding protein	3					mitochondrion morphogenesis (GO:0070584)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	acrosomal vesicle (GO:0001669)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)|sperm flagellum (GO:0036126)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			kidney(1)|prostate(1)	2						AAGATGGCGGCCTCAGCAGCG	0.567																																					p.A3D													.	SLIRP-90	0			c.C8A						.						58.0	59.0	59.0					14																	78174462		2203	4300	6503	SO:0001583	missense	81892	exon1			TGGCGGCCTCAGC	AF253980	CCDS9866.1, CCDS58331.1, CCDS73668.1	14q24.3	2013-02-12	2011-06-17	2011-06-17	ENSG00000119705	ENSG00000119705		"""RNA binding motif (RRM) containing"""	20495	protein-coding gene	gene with protein product		610211	"""chromosome 14 open reading frame 156"""	C14orf156		16762838	Standard	NM_031210		Approved	DC50	uc001xue.5	Q9GZT3		ENST00000557342.1:c.8C>A	14.37:g.78174462C>A	ENSP00000450909:p.Ala3Asp	Somatic	61	1		WXS	Illumina HiSeq		44	2	NM_001267864	0	0	6	6	0	J3KMY7	Missense_Mutation	SNP	ENST00000557342.1	37	CCDS9866.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.20|16.20	3.055129|3.055129	0.55325|0.55325	.|.	.|.	ENSG00000119705|ENSG00000119705	ENST00000557342;ENST00000238688;ENST00000557623;ENST00000557431|ENST00000556831	T;T;T;T|.	0.59638|.	0.72;0.68;1.02;0.25|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.74419|0.74419	0.3714|0.3714	M|M	0.70595|0.70595	2.14|2.14	0.37545|0.37545	D|D	0.918469|0.918469	D|.	0.89917|.	1.0|.	D|.	0.83275|.	0.996|.	T|T	0.76356|0.76356	-0.2989|-0.2989	10|5	0.32370|.	T|.	0.25|.	-0.5502|-0.5502	16.6407|16.6407	0.85098|0.85098	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3|.	Q9GZT3|.	SLIRP_HUMAN|.	D|T	3|1	ENSP00000450909:A3D;ENSP00000238688:A3D;ENSP00000452057:A3D;ENSP00000450849:A3D|.	ENSP00000238688:A3D|.	A|P	+|+	2|1	0|0	SLIRP|SLIRP	77244215|77244215	0.984000|0.984000	0.35163|0.35163	0.959000|0.959000	0.39883|0.39883	0.159000|0.159000	0.22180|0.22180	3.389000|3.389000	0.52516|0.52516	2.732000|2.732000	0.93576|0.93576	0.650000|0.650000	0.86243|0.86243	GCC|CCT	.		0.567	SLIRP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413901.1	NM_031210	
CLMN	79789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	95670380	95670380	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr14:95670380G>A	ENST00000298912.4	-	9	1419	c.1306C>T	c.(1306-1308)Cct>Tct	p.P436S		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	436					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		CTGCAGAAAGGATCCTTGTAG	0.478																																					p.P436S		.											.	CLMN-90	0			c.C1306T						.						115.0	110.0	112.0					14																	95670380		2203	4300	6503	SO:0001583	missense	79789	exon9			AGAAAGGATCCTT	AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1306C>T	14.37:g.95670380G>A	ENSP00000298912:p.Pro436Ser	Somatic	221	0		WXS	Illumina HiSeq	Phase_I	113	68	NM_024734	0	0	0	0	0	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	ENST00000298912.4	37	CCDS9933.1	.	.	.	.	.	.	.	.	.	.	G	5.446	0.267351	0.10294	.	.	ENSG00000165959	ENST00000298912	D	0.91894	-2.93	5.91	3.07	0.35406	.	0.178386	0.27311	N	0.019959	T	0.81555	0.4847	N	0.08118	0	0.09310	N	0.999997	B	0.16802	0.019	B	0.14023	0.01	T	0.71755	-0.4497	10	0.62326	D	0.03	.	8.3135	0.32086	0.0:0.6159:0.3036:0.0805	.	436	Q96JQ2	CLMN_HUMAN	S	436	ENSP00000298912:P436S	ENSP00000298912:P436S	P	-	1	0	CLMN	94740133	0.051000	0.20477	0.007000	0.13788	0.002000	0.02628	0.554000	0.23407	0.388000	0.25054	-0.839000	0.03059	CCT	.		0.478	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414518.2		
RMDN3	55177	bcgsc.ca	37	15	41043764	41043764	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr15:41043764G>T	ENST00000260385.6	-	3	1451	c.384C>A	c.(382-384)tgC>tgA	p.C128*	RMDN3_ENST00000338376.3_Nonsense_Mutation_p.C128*|RMDN3_ENST00000558560.1_5'UTR			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3	128					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											CTTCCATGTGGCATCTGGAAA	0.562																																					p.C128X													.	.	0			c.C384A						.						80.0	77.0	78.0					15																	41043764		2203	4300	6503	SO:0001587	stop_gained	55177	exon4			CATGTGGCATCTG	AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.384C>A	15.37:g.41043764G>T	ENSP00000260385:p.Cys128*	Somatic	66	0		WXS	Illumina HiSeq	Phase_1	47	4	NM_018145	0	0	0	0	0	A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Nonsense_Mutation	SNP	ENST00000260385.6	37	CCDS10063.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318354	0.81469	.	.	ENSG00000137824	ENST00000260385;ENST00000338376;ENST00000426872	.	.	.	4.93	-6.67	0.01783	.	0.173950	0.48286	D	0.000187	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-4.3853	0.9165	0.01305	0.3395:0.1799:0.2985:0.1821	.	.	.	.	X	128;128;65	.	ENSP00000260385:C128X	C	-	3	2	FAM82A2	38831056	0.443000	0.25641	0.715000	0.30552	0.868000	0.49771	-0.645000	0.05409	-1.259000	0.02468	0.484000	0.47621	TGC	.		0.562	RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252357.1	NM_018145	
CSPG4	1464	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	75968209	75968209	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr15:75968209G>C	ENST00000308508.5	-	10	6743	c.6651C>G	c.(6649-6651)ttC>ttG	p.F2217L	CTD-2026K11.1_ENST00000569467.1_RNA|AC105020.1_ENST00000435356.1_5'Flank	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2217	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGGCCTCAAGGAAGCTCAGGA	0.622																																					p.F2217L		.											.	CSPG4-229	0			c.C6651G						.						80.0	78.0	79.0					15																	75968209		2197	4294	6491	SO:0001583	missense	1464	exon10			CTCAAGGAAGCTC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6651C>G	15.37:g.75968209G>C	ENSP00000312506:p.Phe2217Leu	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	56	21	NM_001897	0	0	6	6	0	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	37	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931673	0.34096	.	.	ENSG00000173546	ENST00000308508;ENST00000537176	T	0.18657	2.2	5.33	2.43	0.29744	.	0.080794	0.52532	N	0.000076	T	0.15609	0.0376	L	0.50333	1.59	0.24930	N	0.991921	B	0.10296	0.003	B	0.08055	0.003	T	0.36261	-0.9755	10	0.09843	T	0.71	.	8.3535	0.32316	0.3053:0.0:0.6947:0.0	.	2217	Q6UVK1	CSPG4_HUMAN	L	2217;249	ENSP00000312506:F2217L	ENSP00000312506:F2217L	F	-	3	2	CSPG4	73755264	1.000000	0.71417	0.865000	0.33974	0.938000	0.57974	0.970000	0.29383	0.251000	0.21505	0.561000	0.74099	TTC	.		0.622	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
RHCG	51458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	90030138	90030138	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr15:90030138G>A	ENST00000268122.4	-	2	331	c.263C>T	c.(262-264)gCc>gTc	p.A88V	RHCG_ENST00000544600.1_Missense_Mutation_p.A88V	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	88					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					GAAGCCCACGGCGCTGAAGCC	0.622																																					p.A88V		.											.	RHCG-226	0			c.C263T						.						65.0	56.0	59.0					15																	90030138		2200	4299	6499	SO:0001583	missense	51458	exon2			CCCACGGCGCTGA	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.263C>T	15.37:g.90030138G>A	ENSP00000268122:p.Ala88Val	Somatic	379	0		WXS	Illumina HiSeq	Phase_I	357	159	NM_016321	0	0	0	0	0	A8K4D4|Q6X3Y4	Missense_Mutation	SNP	ENST00000268122.4	37	CCDS10351.1	.	.	.	.	.	.	.	.	.	.	g	17.75	3.466191	0.63625	.	.	ENSG00000140519	ENST00000544600;ENST00000268122;ENST00000536247	T;T	0.23552	1.9;1.9	4.76	2.79	0.32731	Ammonium transporter AmtB-like (3);	0.658388	0.16053	N	0.231841	T	0.49592	0.1566	M	0.88310	2.945	0.21386	N	0.99971	P	0.49358	0.923	P	0.53760	0.734	T	0.50021	-0.8876	9	.	.	.	-2.9237	14.3657	0.66805	0.0:0.4295:0.5705:0.0	.	88	Q9UBD6	RHCG_HUMAN	V	88;88;79	ENSP00000438123:A88V;ENSP00000268122:A88V	.	A	-	2	0	RHCG	87831142	0.691000	0.27709	0.099000	0.21106	0.817000	0.46193	2.392000	0.44433	0.397000	0.25310	0.479000	0.44913	GCC	.		0.622	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
JMJD8	339123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	732019	732019	+	3'UTR	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr16:732019G>T	ENST00000293882.4	-	0	1779				STUB1_ENST00000566181.2_Splice_Site|STUB1_ENST00000219548.4_Splice_Site|JMJD8_ENST00000454700.1_3'UTR|JMJD8_ENST00000609261.1_3'UTR|LA16c-313D11.9_ENST00000571933.1_RNA|LA16c-313D11.9_ENST00000567091.1_RNA|STUB1_ENST00000565677.1_Splice_Site|STUB1_ENST00000564370.1_Splice_Site|JMJD8_ENST00000412368.2_3'UTR			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						ACTCTTCACAGGACAAGTACA	0.592																																					.		.											.	STUB1-226	0			c.613-1G>T						.						196.0	177.0	184.0					16																	732019		2201	4300	6501	SO:0001624	3_prime_UTR_variant	10273	exon5			TTCACAGGACAAG		CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.*775C>A	16.37:g.732019G>T		Somatic	220	0		WXS	Illumina HiSeq	Phase_I	276	156	NM_005861	0	1	100	324	223	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Splice_Site	SNP	ENST00000293882.4	37		.	.	.	.	.	.	.	.	.	.	G	13.81	2.348521	0.41599	.	.	ENSG00000103266	ENST00000219548	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8172	0.85737	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STUB1	672020	1.000000	0.71417	0.999000	0.59377	0.292000	0.27327	8.863000	0.92288	2.366000	0.80165	0.555000	0.69702	.	.		0.592	JMJD8-201	KNOWN	basic	protein_coding	protein_coding		NM_001005920	
GLG1	2734	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	74505165	74505165	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr16:74505165A>C	ENST00000422840.2	-	15	2134	c.2135T>G	c.(2134-2136)aTa>aGa	p.I712R	GLG1_ENST00000205061.5_Missense_Mutation_p.I712R|GLG1_ENST00000447066.2_Missense_Mutation_p.I701R	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	712					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CCCAGAGTCTATCTGGTTATC	0.458																																					p.I712R		.											.	GLG1-136	0			c.T2135G						.						251.0	213.0	226.0					16																	74505165		2198	4300	6498	SO:0001583	missense	2734	exon15			GAGTCTATCTGGT		CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2135T>G	16.37:g.74505165A>C	ENSP00000405984:p.Ile712Arg	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	227	60	NM_001145667	0	0	9	11	2	B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	ENST00000422840.2	37	CCDS45527.1	.	.	.	.	.	.	.	.	.	.	A	13.05	2.122299	0.37436	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.68559	0.3014	L	0.49350	1.555	0.80722	D	1	D;D;D	0.65815	0.984;0.995;0.97	D;P;P	0.65684	0.937;0.901;0.905	T	0.62595	-0.6821	9	0.16896	T	0.51	-0.9347	16.8222	0.85835	1.0:0.0:0.0:0.0	.	712;712;701	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	R	712;701;712	.	ENSP00000205061:I712R	I	-	2	0	GLG1	73062666	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.923000	0.70045	2.371000	0.80710	0.533000	0.62120	ATA	.		0.458	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000435750.1	NM_012201	
C16orf46	123775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81094972	81094972	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr16:81094972G>A	ENST00000299578.5	-	4	1217	c.982C>T	c.(982-984)Cag>Tag	p.Q328*	C16orf46_ENST00000378611.4_Nonsense_Mutation_p.Q328*|RP11-303E16.8_ENST00000564536.1_RNA|C16orf46_ENST00000444657.3_5'Flank	NM_152337.2	NP_689550.2	Q6P387	CP046_HUMAN	chromosome 16 open reading frame 46	328						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|large_intestine(3)|lung(9)|prostate(1)|stomach(1)|urinary_tract(1)	18						CCCCGTTTCTGCAGAAGCTGC	0.552																																					p.Q328X		.											.	C16orf46-90	0			c.C982T						.						103.0	101.0	102.0					16																	81094972		2202	4300	6502	SO:0001587	stop_gained	123775	exon3			GTTTCTGCAGAAG	BC064143	CCDS10932.1, CCDS42201.1	16q23.2	2012-10-09			ENSG00000166455	ENSG00000166455			26525	protein-coding gene	gene with protein product							Standard	NM_152337		Approved	FLJ32702	uc002fgc.4	Q6P387	OTTHUMG00000137629	ENST00000299578.5:c.982C>T	16.37:g.81094972G>A	ENSP00000299578:p.Gln328*	Somatic	250	0		WXS	Illumina HiSeq	Phase_I	316	83	NM_001100873	0	0	2	2	0	Q96MA7	Nonsense_Mutation	SNP	ENST00000299578.5	37	CCDS10932.1	.	.	.	.	.	.	.	.	.	.	G	14.52	2.561321	0.45590	.	.	ENSG00000166455	ENST00000378611;ENST00000444657;ENST00000299578	.	.	.	5.23	1.87	0.25490	.	0.466272	0.20153	N	0.098118	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	14.4868	0.67622	0.0:0.414:0.5859:0.0	.	.	.	.	X	328;55;328	.	ENSP00000299578:Q328X	Q	-	1	0	C16orf46	79652473	1.000000	0.71417	0.998000	0.56505	0.073000	0.16967	1.093000	0.30939	0.653000	0.30826	0.563000	0.77884	CAG	.		0.552	C16orf46-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269054.2	NM_152337	
TRPV1	7442	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	3480482	3480482	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr17:3480482A>G	ENST00000571088.1	-	12	1931	c.1718T>C	c.(1717-1719)aTc>aCc	p.I573T	TRPV1_ENST00000425167.2_Missense_Mutation_p.I584T|TRPV1_ENST00000174621.6_Missense_Mutation_p.I571T|SHPK_ENST00000572705.1_Missense_Mutation_p.I573T|RP11-235E17.3_ENST00000573568.1_RNA|TRPV1_ENST00000576351.1_Missense_Mutation_p.I563T|TRPV1_ENST00000399756.4_Missense_Mutation_p.I573T|TRPV1_ENST00000310522.5_Missense_Mutation_p.I513T|TRPV1_ENST00000399759.3_Missense_Mutation_p.I573T	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	573					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	GTCTCTCAGGATCATCTGCAG	0.602																																					p.I573T	Melanoma(38;962 1762 15789)	.											.	TRPV1-23	0			c.T1718C						.						34.0	34.0	34.0					17																	3480482		2044	4170	6214	SO:0001583	missense	7442	exon12			CTCAGGATCATCT	AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.1718T>C	17.37:g.3480482A>G	ENSP00000461007:p.Ile573Thr	Somatic	213	0		WXS	Illumina HiSeq	Phase_I	257	125	NM_018727	0	0	0	0	0	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Missense_Mutation	SNP	ENST00000571088.1	37	CCDS45576.1	.	.	.	.	.	.	.	.	.	.	A	19.04	3.749434	0.69533	.	.	ENSG00000196689	ENST00000399759;ENST00000399756;ENST00000174621;ENST00000425167;ENST00000310522	D;D;D;D;D	0.90504	-2.68;-2.68;-2.68;-2.68;-2.68	5.15	5.15	0.70609	Ion transport (1);	0.045746	0.85682	D	0.000000	D	0.95007	0.8384	M	0.88842	2.985	0.58432	D	0.999999	P;D;D;P	0.63046	0.764;0.975;0.992;0.77	B;P;P;B	0.58660	0.394;0.717;0.843;0.282	D	0.95830	0.8857	10	0.87932	D	0	-0.9535	14.4569	0.67423	1.0:0.0:0.0:0.0	.	573;571;513;584	Q8NER1;E7EQ80;E7ESJ2;E7EQ78	TRPV1_HUMAN;.;.;.	T	573;573;571;584;513	ENSP00000382661:I573T;ENSP00000382659:I573T;ENSP00000174621:I571T;ENSP00000409627:I584T;ENSP00000311692:I513T	ENSP00000174621:I571T	I	-	2	0	TRPV1	3427231	1.000000	0.71417	1.000000	0.80357	0.693000	0.40251	6.734000	0.74801	2.072000	0.62099	0.460000	0.39030	ATC	.		0.602	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438254.1	NM_018727	
NCOR1	9611	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	15968952	15968952	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr17:15968952G>T	ENST00000268712.3	-	33	5055	c.4798C>A	c.(4798-4800)Cag>Aag	p.Q1600K	NCOR1_ENST00000395857.3_Missense_Mutation_p.Q184K|NCOR1_ENST00000395851.1_Missense_Mutation_p.Q1616K	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1600	Interaction with C1D. {ECO:0000250}.|Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		AGCTGATACTGACTTGGGTAA	0.453																																					p.Q1616K		.											.	NCOR1-229	0			c.C4846A						.						154.0	137.0	143.0					17																	15968952		2203	4300	6503	SO:0001583	missense	9611	exon32			GATACTGACTTGG	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.4798C>A	17.37:g.15968952G>T	ENSP00000268712:p.Gln1600Lys	Somatic	222	0		WXS	Illumina HiSeq	Phase_I	279	72	NM_001190440	0	0	5	6	1	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	37	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087095	0.76642	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.47528	0.84;0.84;0.84	5.58	5.58	0.84498	.	0.104733	0.64402	D	0.000003	T	0.65964	0.2742	L	0.57536	1.79	0.40995	D	0.984889	D;D;P;P;P	0.59767	0.986;0.962;0.9;0.94;0.856	D;P;B;P;P	0.72338	0.977;0.53;0.366;0.57;0.501	T	0.63611	-0.6598	10	0.39692	T	0.17	-9.3223	18.5647	0.91113	0.0:0.0:1.0:0.0	.	410;1504;1600;1616;120	B4DZ48;E7EVK1;O75376;O75376-2;Q86YY1	.;.;NCOR1_HUMAN;.;.	K	1600;1616;1504;184	ENSP00000268712:Q1600K;ENSP00000379192:Q1616K;ENSP00000379198:Q184K	ENSP00000268712:Q1600K	Q	-	1	0	NCOR1	15909677	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.984000	0.76186	2.625000	0.88918	0.557000	0.71058	CAG	.		0.453	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
KCNJ12	3768	broad.mit.edu;bcgsc.ca	37	17	21318895	21318895	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr17:21318895C>T	ENST00000583088.1	+	3	1136	c.241C>T	c.(241-243)Cgg>Tgg	p.R81W	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R81W	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	81					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)	p.R81G(1)		NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CATCCGCTGGCGGTACATGCT	0.577										Prostate(3;0.18)																											p.R81W													.	.	1	Substitution - Missense(1)	lung(1)	c.C241T						.						205.0	126.0	153.0					17																	21318895		2203	4300	6503	SO:0001583	missense	100134444	exon3			CGCTGGCGGTACA	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.241C>T	17.37:g.21318895C>T	ENSP00000463778:p.Arg81Trp	Somatic	300	2		WXS	Illumina HiSeq	Phase_I	373	48	NM_001194958	0	0	0	0	0	O43401|Q15756|Q8NG63	Missense_Mutation	SNP	ENST00000583088.1	37	CCDS11219.1	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843005	0.71488	.	.	ENSG00000184185	ENST00000331718	D	0.96011	-3.88	5.33	4.31	0.51392	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.98128	0.9382	H	0.95043	3.615	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98223	1.0479	10	0.87932	D	0	.	10.7711	0.46323	0.4271:0.5729:0.0:0.0	.	81	Q14500	IRK12_HUMAN	W	81	ENSP00000328150:R81W	ENSP00000328150:R81W	R	+	1	2	KCNJ12	21259488	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.669000	0.46825	2.506000	0.84524	0.591000	0.81541	CGG	.		0.577	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255060.2	NM_021012	
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	76449535	76449535	+	Silent	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr17:76449535G>T	ENST00000585328.1	-	65	10528	c.10404C>A	c.(10402-10404)gtC>gtA	p.V3468V	DNAH17_ENST00000389840.5_Silent_p.V3459V|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3459	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CCTGCTCGATGACATCCAGGT	0.617																																					p.V3473V		.											.	DNAH17-142	0			c.C10419A						.						112.0	76.0	88.0					17																	76449535		2203	4300	6503	SO:0001819	synonymous_variant	8632	exon65			CTCGATGACATCC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10404C>A	17.37:g.76449535G>T		Somatic	203	0		WXS	Illumina HiSeq	Phase_I	238	118	NM_173628	0	0	0	0	0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	37																																																																																				.		0.617	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
PTPRM	5797	hgsc.bcm.edu;bcgsc.ca	37	18	8314790	8314790	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr18:8314790C>T	ENST00000332175.8	+	19	3852	c.2815C>T	c.(2815-2817)Cga>Tga	p.R939*	PTPRM_ENST00000580170.1_Nonsense_Mutation_p.R952*|PTPRM_ENST00000400053.4_Nonsense_Mutation_p.R877*|PTPRM_ENST00000444013.1_Nonsense_Mutation_p.R726*|PTPRM_ENST00000400060.4_Nonsense_Mutation_p.R953*	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	939	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CGATCATTCCCGAGTGAGGCT	0.353																																					p.R952X		.											.	PTPRM-228	0			c.C2854T						.						149.0	142.0	145.0					18																	8314790		2203	4300	6503	SO:0001587	stop_gained	5797	exon21			CATTCCCGAGTGA	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2815C>T	18.37:g.8314790C>T	ENSP00000331418:p.Arg939*	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	72	4	NM_001105244	0	0	0	0	0	A7MBN1|D3DUH8|J3QL11	Nonsense_Mutation	SNP	ENST00000332175.8	37	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	50	17.034461	0.99877	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	.	.	.	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.1802	0.98196	0.0:1.0:0.0:0.0	.	.	.	.	X	939;953;877;726	.	ENSP00000331418:R939X	R	+	1	2	PTPRM	8304790	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.775000	0.55349	2.777000	0.95525	0.655000	0.94253	CGA	.		0.353	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
PRKCSH	5589	bcgsc.ca	37	19	11546941	11546941	+	Start_Codon_SNP	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr19:11546941G>T	ENST00000589838.1	+	1	3	c.3G>T	c.(1-3)atG>atT	p.M1I	PRKCSH_ENST00000592741.1_Start_Codon_SNP_p.M1I|CCDC151_ENST00000356392.4_5'Flank|PRKCSH_ENST00000252455.2_Start_Codon_SNP_p.M1I|PRKCSH_ENST00000587327.1_Start_Codon_SNP_p.M1I|CCDC151_ENST00000545100.1_5'Flank|CCDC151_ENST00000586836.1_5'Flank|CCDC151_ENST00000591179.1_5'Flank|PRKCSH_ENST00000591462.1_Start_Codon_SNP_p.M1I|PRKCSH_ENST00000412601.1_Start_Codon_SNP_p.M1I			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	1					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						CTGGTGAGAtgctgttgccgc	0.637											OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M1I													.	PRKCSH-90	0			c.G3T						.						27.0	24.0	25.0					19																	11546941		2202	4293	6495	SO:0001582	initiator_codon_variant	5589	exon2			TGAGATGCTGTTG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.3G>T	19.37:g.11546941G>T	ENSP00000465461:p.Met1Ile	Somatic	75	1	673	WXS	Illumina HiSeq	Phase_1	54	4	NM_001001329	0	0	109	110	1	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	ENST00000589838.1	37	CCDS32911.1	.	.	.	.	.	.	.	.	.	.	G	10.46	1.355232	0.24512	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.71103	-0.54;-0.54	5.37	4.26	0.50523	.	0.321663	0.28006	U	0.016970	T	0.59528	0.2200	.	.	.	0.43919	D	0.996566	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.09377	0.004;0.004;0.004	T	0.55661	-0.8106	9	0.32370	T	0.25	-3.4273	14.4376	0.67293	0.0:0.1487:0.8513:0.0	.	1;1;1	E7EQZ9;A8K318;P14314	.;.;GLU2B_HUMAN	I	1	ENSP00000252455:M1I;ENSP00000395616:M1I	ENSP00000252455:M1I	M	+	3	0	PRKCSH	11407941	0.997000	0.39634	0.197000	0.23402	0.025000	0.11179	2.803000	0.47924	2.516000	0.84829	0.491000	0.48974	ATG	.		0.637	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		Missense_Mutation
KLK14	43847	broad.mit.edu	37	19	51584905	51584905	+	Silent	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr19:51584905G>T	ENST00000156499.2	-	4	362	c.144C>A	c.(142-144)acC>acA	p.T48T	KLK14_ENST00000391802.1_Silent_p.T48T			Q9P0G3	KLK14_HUMAN	kallikrein-related peptidase 14	48	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis morphogenesis (GO:0048730)|fertilization (GO:0009566)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|proteolysis (GO:0006508)|seminal clot liquefaction (GO:0070684)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			kidney(4)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	11		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		GGGAGCTCCGGGTGCACGTAT	0.617																																					p.T48T	GBM(117;2161 2172 2448 22911)												.	KLK14-226	0			c.C144A						.						28.0	30.0	29.0					19																	51584905		1959	4087	6046	SO:0001819	synonymous_variant	43847	exon4			GCTCCGGGTGCAC	AF283670	CCDS12823.2	19q13.3-q13.4	2008-02-05	2006-10-27		ENSG00000129437	ENSG00000129437		"""Kallikreins"""	6362	protein-coding gene	gene with protein product		606135	"""kallikrein 14"""			16800724, 16800723	Standard	XM_006723224		Approved	KLK-L6	uc002pvs.1	Q9P0G3	OTTHUMG00000143721	ENST00000156499.2:c.144C>A	19.37:g.51584905G>T		Somatic	71	0		WXS	Illumina HiSeq	Phase_I	94	4	NM_022046	0	0	0	0	0	A7UNK5|Q1RMZ2|Q6B089	Silent	SNP	ENST00000156499.2	37	CCDS12823.2																																																																																			.		0.617	KLK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289774.2	NM_022046	
MZF1	7593	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	59082699	59082699	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr19:59082699C>T	ENST00000215057.2	-	2	618	c.58G>A	c.(58-60)Gtc>Atc	p.V20I	AC016629.8_ENST00000593642.1_RNA|MZF1_ENST00000594234.1_Missense_Mutation_p.V20I|MZF1_ENST00000599369.1_Missense_Mutation_p.V20I|MZF1_ENST00000594108.1_Missense_Mutation_p.V20I|AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA	NM_001267033.1|NM_198055.1	NP_001253962.1|NP_932172.1	P28698	MZF1_HUMAN	myeloid zinc finger 1	20					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0443)|all cancers(4;7.92e-14)|Epithelial(4;5.57e-11)|OV - Ovarian serous cystadenocarcinoma(4;1.13e-09)|GBM - Glioblastoma multiforme(193;0.0108)|Lung(386;0.182)		TTCACCATGACAGGCCCCTCA	0.627																																					p.V20I		.											.	MZF1-91	0			c.G58A						.						32.0	37.0	35.0					19																	59082699		2200	4300	6500	SO:0001583	missense	7593	exon2			CCATGACAGGCCC	M58297	CCDS12988.1, CCDS59427.1	19q13.43	2014-08-22	2006-06-15	2006-06-15	ENSG00000099326	ENSG00000099326		"""-"", ""Zinc fingers, C2H2-type"""	13108	protein-coding gene	gene with protein product		194550	"""zinc finger protein 42 (myeloid-specific retinoic acid-responsive)"""	ZNF42		1860835	Standard	NM_198055		Approved	ZSCAN6, MZF1B, MZF-1, Zfp98	uc002qtn.3	P28698	OTTHUMG00000183550	ENST00000215057.2:c.58G>A	19.37:g.59082699C>T	ENSP00000215057:p.Val20Ile	Somatic	127	0		WXS	Illumina HiSeq	Phase_I	117	39	NM_198055	0	0	3	3	0	M0QXU0|Q7Z729|Q96I71|Q9NRY0|Q9UBW2	Missense_Mutation	SNP	ENST00000215057.2	37	CCDS12988.1	.	.	.	.	.	.	.	.	.	.	.	9.755	1.168475	0.21621	.	.	ENSG00000099326	ENST00000215057	T	0.06768	3.26	4.06	-3.61	0.04556	.	0.426572	0.17300	N	0.179278	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.42032	-0.9475	9	.	.	.	-14.6825	5.3908	0.16244	0.0:0.4053:0.1456:0.4491	.	20;20	Q7Z729;P28698	.;MZF1_HUMAN	I	20	ENSP00000215057:V20I	.	V	-	1	0	MZF1	63774511	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.161000	0.10026	-0.559000	0.06110	-0.878000	0.02970	GTC	.		0.627	MZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467112.1	NM_198055	
MPHOSPH10	10199	broad.mit.edu	37	2	71376396	71376396	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr2:71376396C>T	ENST00000244230.2	+	10	2061	c.1709C>T	c.(1708-1710)aCa>aTa	p.T570I		NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	570					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						GCTGAAAAAACAGCTACAGAC	0.333																																					p.T570I													.	MPHOSPH10-93	0			c.C1709T						.						38.0	35.0	36.0					2																	71376396		2201	4299	6500	SO:0001583	missense	10199	exon10			AAAAAACAGCTAC	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.1709C>T	2.37:g.71376396C>T	ENSP00000244230:p.Thr570Ile	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	77	7	NM_005791	0	0	64	66	2	A0AVJ8	Missense_Mutation	SNP	ENST00000244230.2	37	CCDS1916.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831810	0.91036	.	.	ENSG00000124383	ENST00000244230;ENST00000425650	T;T	0.12879	2.64;2.64	5.64	5.64	0.86602	.	0.097879	0.64402	D	0.000001	T	0.47078	0.1426	M	0.90870	3.155	0.58432	D	0.999998	D	0.69078	0.997	D	0.70716	0.97	T	0.54437	-0.8294	10	0.62326	D	0.03	.	17.585	0.87979	0.0:1.0:0.0:0.0	.	570	O00566	MPP10_HUMAN	I	570;430	ENSP00000244230:T570I;ENSP00000393034:T430I	ENSP00000244230:T570I	T	+	2	0	MPHOSPH10	71229904	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.007000	0.63984	2.837000	0.97791	0.655000	0.94253	ACA	.		0.333	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
WDR54	84058	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74651108	74651108	+	Splice_Site	SNP	A	A	G			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr2:74651108A>G	ENST00000348227.4	+	6	621	c.533A>G	c.(532-534)cAg>cGg	p.Q178R	WDR54_ENST00000409791.1_Splice_Site_p.Q126R|WDR54_ENST00000461531.1_3'UTR	NM_032118.2	NP_115494.1	Q9H977	WDR54_HUMAN	WD repeat domain 54	178										breast(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9						GCCCAGGGACAGGTGAGTGGA	0.597																																					p.Q178R													.	WDR54-90	0			c.A533G						.						72.0	67.0	69.0					2																	74651108		2203	4300	6503	SO:0001630	splice_region_variant	84058	exon6			AGGGACAGGTGAG	AK023015	CCDS1940.1	2p13.1	2013-01-09			ENSG00000005448	ENSG00000005448		"""WD repeat domain containing"""	25770	protein-coding gene	gene with protein product						12477932	Standard	NM_032118		Approved	FLJ12953	uc002slb.3	Q9H977	OTTHUMG00000129951	ENST00000348227.4:c.534+1A>G	2.37:g.74651108A>G		Somatic	118	3		WXS	Illumina HiSeq	Phase_I	141	26	NM_032118	0	0	1	1	0	D6W5I3|Q53H85|Q86V45	Missense_Mutation	SNP	ENST00000348227.4	37	CCDS1940.1	.	.	.	.	.	.	.	.	.	.	A	8.262	0.811387	0.16537	.	.	ENSG00000005448	ENST00000409791;ENST00000426787;ENST00000348227	T;T	0.50277	0.75;0.75	5.23	4.05	0.47172	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.490280	0.21308	N	0.076697	T	0.28928	0.0718	N	0.22421	0.69	0.37494	D	0.916488	B	0.20671	0.047	B	0.17098	0.017	T	0.12293	-1.0553	10	0.23891	T	0.37	.	5.7368	0.18071	0.7423:0.169:0.0887:0.0	.	178	Q9H977	WDR54_HUMAN	R	126;160;178	ENSP00000387236:Q126R;ENSP00000006526:Q178R	ENSP00000006526:Q178R	Q	+	2	0	WDR54	74504616	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	3.121000	0.50438	0.795000	0.33922	0.528000	0.53228	CAG	.		0.597	WDR54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252213.1	NM_032118	Missense_Mutation
INO80D	54891	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	206921631	206921631	+	Silent	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr2:206921631G>A	ENST00000403263.1	-	4	659	c.255C>T	c.(253-255)atC>atT	p.I85I		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	85					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						CTTTTTTCGGGATAAAGCCAA	0.408																																					p.I85I													.	INO80D-91	0			c.C255T						.						103.0	90.0	94.0					2																	206921631		1900	4118	6018	SO:0001819	synonymous_variant	54891	exon4			TTTCGGGATAAAG		CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.255C>T	2.37:g.206921631G>A		Somatic	113	1		WXS	Illumina HiSeq	Phase_I	134	61	NM_017759	0	0	0	0	0	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Silent	SNP	ENST00000403263.1	37	CCDS46500.1																																																																																			.		0.408	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336459.1	NM_017759	
ERBB4	2066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	212248449	212248449	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr2:212248449C>T	ENST00000342788.4	-	28	4128	c.3818G>A	c.(3817-3819)cGg>cAg	p.R1273Q	ERBB4_ENST00000436443.1_Missense_Mutation_p.R1257Q|ERBB4_ENST00000402597.1_Missense_Mutation_p.R1263Q	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1273					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	AGGCCGGATCCGCCCATTCTG	0.532										TSP Lung(8;0.080)																											p.R1273Q		.											.	ERBB4-1461	0			c.G3818A						.						89.0	91.0	91.0					2																	212248449		2203	4300	6503	SO:0001583	missense	2066	exon28			CGGATCCGCCCAT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3818G>A	2.37:g.212248449C>T	ENSP00000342235:p.Arg1273Gln	Somatic	178	1		WXS	Illumina HiSeq	Phase_I	197	111	NM_005235	0	0	0	0	0	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	37	CCDS2394.1	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328293	0.60743	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.75367	-0.92;-0.93;-0.92	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000001	T	0.72518	0.3470	L	0.44542	1.39	0.52501	D	0.999958	P;P;P;P	0.50710	0.938;0.873;0.938;0.897	P;P;P;B	0.44860	0.462;0.462;0.462;0.273	T	0.73151	-0.4073	10	0.42905	T	0.14	.	19.39	0.94576	0.0:1.0:0.0:0.0	.	1247;1263;1257;1273	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	Q	1273;1257;1263	ENSP00000342235:R1273Q;ENSP00000403204:R1257Q;ENSP00000385565:R1263Q	ENSP00000342235:R1273Q	R	-	2	0	ERBB4	211956694	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.584000	0.67490	2.812000	0.96745	0.557000	0.71058	CGG	.		0.532	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		.											.	KIF1A-91	0			c.G2751T						.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		Somatic	138	0		WXS	Illumina HiSeq	Phase_I	263	15	NM_001244008	0	0	1	1	0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
SALL4	57167	bcgsc.ca	37	20	50406632	50406632	+	Missense_Mutation	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr20:50406632C>T	ENST00000217086.4	-	2	2501	c.2390G>A	c.(2389-2391)aGc>aAc	p.S797N	SALL4_ENST00000395997.3_Intron|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000371539.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	797					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TGACTTGATGCTTTCGGCTTG	0.527																																					p.S797N													.	SALL4-92	0			c.G2390A						.						80.0	78.0	79.0					20																	50406632		2203	4300	6503	SO:0001583	missense	57167	exon2			TTGATGCTTTCGG	AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2390G>A	20.37:g.50406632C>T	ENSP00000217086:p.Ser797Asn	Somatic	205	0		WXS	Illumina HiSeq	Phase_1	213	7	NM_020436	0	0	0	0	0	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	ENST00000217086.4	37	CCDS13438.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.064014	0.36373	.	.	ENSG00000101115	ENST00000217086	T	0.10005	2.92	5.67	5.67	0.87782	.	0.000000	0.50627	D	0.000108	T	0.31513	0.0799	M	0.75777	2.31	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	T	0.00950	-1.1503	10	0.27785	T	0.31	-29.5056	19.7711	0.96366	0.0:1.0:0.0:0.0	.	797	Q9UJQ4	SALL4_HUMAN	N	797	ENSP00000217086:S797N	ENSP00000217086:S797N	S	-	2	0	SALL4	49840039	0.910000	0.30920	0.792000	0.32020	0.831000	0.47069	1.873000	0.39558	2.654000	0.90174	0.655000	0.94253	AGC	.		0.527	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079738.3		
URB1	9875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	33727865	33727865	+	Missense_Mutation	SNP	C	C	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr21:33727865C>A	ENST00000382751.3	-	16	2114	c.1999G>T	c.(1999-2001)Gac>Tac	p.D667Y		NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	667						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						ACCCCCGTGTCCCGCAGAATC	0.517																																					p.D667Y		.											.	.	0			c.G1999T						.						103.0	87.0	92.0					21																	33727865		692	1591	2283	SO:0001583	missense	9875	exon16			CCGTGTCCCGCAG	AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.1999G>T	21.37:g.33727865C>A	ENSP00000372199:p.Asp667Tyr	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	43	31	NM_014825	0	0	0	0	0	D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	ENST00000382751.3	37	CCDS46645.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.825397	0.50739	.	.	ENSG00000142207	ENST00000382751	T	0.36157	1.27	5.63	4.74	0.60224	.	0.052879	0.85682	D	0.000000	T	0.58395	0.2119	M	0.66939	2.045	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.63019	-0.6730	10	0.87932	D	0	-27.1589	14.5715	0.68216	0.0:0.9299:0.0:0.0701	.	667	O60287	NPA1P_HUMAN	Y	667	ENSP00000372199:D667Y	ENSP00000372199:D667Y	D	-	1	0	URB1	32649736	1.000000	0.71417	1.000000	0.80357	0.071000	0.16799	5.731000	0.68554	1.378000	0.46305	-0.140000	0.14226	GAC	.		0.517	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139400.2		
TAB1	10454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	39814795	39814795	+	Silent	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr22:39814795G>A	ENST00000216160.6	+	6	671	c.609G>A	c.(607-609)ctG>ctA	p.L203L	TAB1_ENST00000331454.3_Silent_p.L203L	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	203	PP2C-like.				activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						TGACACAGCTGAACGTGGACC	0.537																																					p.L203L		.											.	TAB1-522	0			c.G609A						.						164.0	122.0	136.0					22																	39814795		2203	4300	6503	SO:0001819	synonymous_variant	10454	exon6			ACAGCTGAACGTG	U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.609G>A	22.37:g.39814795G>A		Somatic	206	0		WXS	Illumina HiSeq	Phase_I	179	68	NM_153497	0	0	5	11	6	Q2PP09|Q8IZW2	Silent	SNP	ENST00000216160.6	37	CCDS13993.1																																																																																			.		0.537	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321313.1	NM_153497	
CCDC66	285331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	56627039	56627039	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr3:56627039A>C	ENST00000394672.3	+	8	1048	c.978A>C	c.(976-978)caA>caC	p.Q326H	CCDC66_ENST00000436465.2_Missense_Mutation_p.Q326H|CCDC66_ENST00000326595.7_Missense_Mutation_p.Q292H	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	326					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		CTGTGAAACAAGAACTGCAAA	0.333																																					p.Q326H		.											.	CCDC66-135	0			c.A978C						.						100.0	108.0	106.0					3																	56627039		2203	4300	6503	SO:0001583	missense	285331	exon8			GAAACAAGAACTG	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.978A>C	3.37:g.56627039A>C	ENSP00000378167:p.Gln326His	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	69	30	NM_001141947	0	0	0	0	0	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	37	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.456082	0.63401	.	.	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	T;T;T	0.23950	1.88;1.88;1.88	5.6	0.516	0.17019	.	0.359209	0.26542	N	0.023798	T	0.19005	0.0456	L	0.55103	1.725	0.80722	D	1	B	0.17038	0.02	B	0.19391	0.025	T	0.06661	-1.0814	10	0.38643	T	0.18	-3.3314	2.9391	0.05824	0.4431:0.0:0.258:0.2989	.	326	A2RUB6	CCD66_HUMAN	H	326;292;326	ENSP00000378167:Q326H;ENSP00000326050:Q292H;ENSP00000404320:Q326H	ENSP00000326050:Q292H	Q	+	3	2	CCDC66	56602079	0.989000	0.36119	0.920000	0.36463	0.969000	0.65631	0.062000	0.14389	-0.134000	0.11516	0.533000	0.62120	CAA	.		0.333	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
TRIM42	287015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	140401754	140401754	+	Silent	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr3:140401754G>A	ENST00000286349.3	+	2	983	c.792G>A	c.(790-792)aaG>aaA	p.K264K		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	264						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACTGCCTCAAGGCCTTCCACT	0.617																																					p.K264K		.											.	TRIM42-227	0			c.G792A						.						115.0	102.0	106.0					3																	140401754		2203	4300	6503	SO:0001819	synonymous_variant	287015	exon2			CCTCAAGGCCTTC	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.792G>A	3.37:g.140401754G>A		Somatic	277	0		WXS	Illumina HiSeq	Phase_I	248	102	NM_152616	0	0	0	0	0	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	ENST00000286349.3	37	CCDS3113.1																																																																																			.		0.617	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
CDKL2	8999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	76532433	76532433	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr4:76532433G>A	ENST00000429927.2	-	4	1179	c.476C>T	c.(475-477)aCt>aTt	p.T159I	CDKL2_ENST00000307465.4_Missense_Mutation_p.T159I	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	159	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CACATAATCAGTATAAACCTC	0.443																																					p.T159I		.											.	CDKL2-454	0			c.C476T						.						90.0	86.0	87.0					4																	76532433		2203	4300	6503	SO:0001583	missense	8999	exon4			TAATCAGTATAAA	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.476C>T	4.37:g.76532433G>A	ENSP00000412365:p.Thr159Ile	Somatic	201	0		WXS	Illumina HiSeq	Phase_I	125	41	NM_003948	0	0	2	2	0	B2R695	Missense_Mutation	SNP	ENST00000429927.2	37	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	g	23.8	4.454370	0.84209	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	T;T	0.68025	-0.3;-0.3	4.72	4.72	0.59763	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.81945	0.4930	M	0.78344	2.41	0.50813	D	0.999894	D;D	0.89917	1.0;1.0	D;D	0.81914	0.988;0.995	D	0.84486	0.0608	9	0.87932	D	0	-11.7169	16.9749	0.86310	0.0:0.0:1.0:0.0	.	159;159	B4DH08;Q92772	.;CDKL2_HUMAN	I	159	ENSP00000412365:T159I;ENSP00000306340:T159I	ENSP00000306340:T159I	T	-	2	0	CDKL2	76751457	1.000000	0.71417	0.946000	0.38457	0.908000	0.53690	8.407000	0.90218	2.605000	0.88082	0.639000	0.83563	ACT	.		0.443	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
SYNPO2	171024	hgsc.bcm.edu;bcgsc.ca	37	4	119947961	119947961	+	Missense_Mutation	SNP	A	A	C	rs70944826	byFrequency	TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr4:119947961A>C	ENST00000429713.2	+	3	619	c.437A>C	c.(436-438)cAa>cCa	p.Q146P	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_Missense_Mutation_p.Q146P|SYNPO2_ENST00000434046.2_Missense_Mutation_p.Q146P	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	146						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GCTGAGAACCAAAGAAGTGGT	0.557																																					p.Q146P		.											.	SYNPO2-92	0			c.A437C						.						43.0	45.0	44.0					4																	119947961		2203	4300	6503	SO:0001583	missense	171024	exon3			AGAACCAAAGAAG	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.437A>C	4.37:g.119947961A>C	ENSP00000395143:p.Gln146Pro	Somatic	172	0		WXS	Illumina HiSeq	Phase_I	162	48	NM_001128934	0	0	0	0	0	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	ENST00000429713.2	37	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	A	8.210	0.800113	0.16397	.	.	ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046	T;T;T	0.08896	3.04;3.04;3.04	5.51	2.93	0.34026	.	0.395951	0.21221	N	0.078143	T	0.07999	0.0200	M	0.62723	1.935	0.09310	N	1	B;P;B;B	0.34757	0.165;0.467;0.165;0.165	B;B;B;B	0.28139	0.043;0.086;0.069;0.043	T	0.28459	-1.0043	10	0.59425	D	0.04	-2.8964	4.6069	0.12382	0.561:0.1597:0.2792:0.0	.	146;146;146;146	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.;.;.;SYNP2_HUMAN	P	146	ENSP00000306015:Q146P;ENSP00000395143:Q146P;ENSP00000390965:Q146P	ENSP00000306015:Q146P	Q	+	2	0	SYNPO2	120167409	0.019000	0.18553	0.400000	0.26346	0.322000	0.28314	1.517000	0.35867	0.792000	0.33850	0.455000	0.32223	CAA	.		0.557	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	126240999	126240999	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr4:126240999G>A	ENST00000394329.3	+	1	3446	c.3433G>A	c.(3433-3435)Gat>Aat	p.D1145N		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1145	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGTGCAGCCAGATTTTGAGTT	0.453																																					p.D1145N		.											.	FAT4-108	0			c.G3433A						.						160.0	162.0	162.0					4																	126240999		1913	4132	6045	SO:0001583	missense	79633	exon1			CAGCCAGATTTTG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3433G>A	4.37:g.126240999G>A	ENSP00000377862:p.Asp1145Asn	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	96	30	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	11.28	1.592284	0.28357	.	.	ENSG00000196159	ENST00000394329	T	0.49432	0.78	4.99	4.14	0.48551	Cadherin (4);Cadherin-like (1);	0.223514	0.21270	N	0.077330	T	0.36580	0.0972	L	0.37507	1.11	0.80722	D	1	B	0.11235	0.004	B	0.10450	0.005	T	0.12400	-1.0549	10	0.13108	T	0.6	.	13.9069	0.63841	0.0744:0.0:0.9256:0.0	.	1145	Q6V0I7	FAT4_HUMAN	N	1145	ENSP00000377862:D1145N	ENSP00000377862:D1145N	D	+	1	0	FAT4	126460449	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.076000	0.71267	1.299000	0.44798	0.561000	0.74099	GAT	.		0.453	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
ADCY2	108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	7816984	7816984	+	Silent	SNP	C	C	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr5:7816984C>T	ENST00000338316.4	+	23	2978	c.2889C>T	c.(2887-2889)ccC>ccT	p.P963P	ADCY2_ENST00000537121.1_Silent_p.P783P	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	963					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CTCAGGAGCCCGAGCGGCAGT	0.502											OREG0016499	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P963P		.											.	ADCY2-97	0			c.C2889T						.						148.0	124.0	132.0					5																	7816984		2203	4300	6503	SO:0001819	synonymous_variant	108	exon23			GGAGCCCGAGCGG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2889C>T	5.37:g.7816984C>T		Somatic	234	0	644	WXS	Illumina HiSeq	Phase_I	181	17	NM_020546	0	0	0	0	0	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																			.		0.502	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
NUP155	9631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	37307409	37307409	+	Missense_Mutation	SNP	A	A	G			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr5:37307409A>G	ENST00000231498.3	-	25	3096	c.2893T>C	c.(2893-2895)Ttc>Ctc	p.F965L	NUP155_ENST00000381843.2_Missense_Mutation_p.F906L|NUP155_ENST00000502533.1_5'UTR|NUP155_ENST00000513532.1_Missense_Mutation_p.F901L	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	965					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTTTCTTGGAAGGCCTGAAGT	0.358																																					p.F965L		.											.	NUP155-205	0			c.T2893C						.						112.0	104.0	106.0					5																	37307409		2203	4300	6503	SO:0001583	missense	9631	exon25			CTTGGAAGGCCTG	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.2893T>C	5.37:g.37307409A>G	ENSP00000231498:p.Phe965Leu	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	165	67	NM_153485	0	0	0	0	0	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	37	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.964993	0.74131	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.77750	-1.11;-1.1;-1.12	5.3	5.3	0.74995	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77778	0.4181	L	0.56124	1.755	0.58432	D	0.999999	P;P	0.45827	0.867;0.568	P;P	0.48063	0.565;0.534	T	0.74734	-0.3565	10	0.20046	T	0.44	-2.0962	15.2661	0.73663	1.0:0.0:0.0:0.0	.	901;965	E9PF10;O75694	.;NU155_HUMAN	L	965;906;927;901	ENSP00000231498:F965L;ENSP00000371265:F906L;ENSP00000422019:F901L	ENSP00000231498:F965L	F	-	1	0	NUP155	37343166	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.959000	0.93110	2.016000	0.59253	0.533000	0.62120	TTC	.		0.358	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
PAM	5066	hgsc.bcm.edu;broad.mit.edu	37	5	102237063	102237063	+	Missense_Mutation	SNP	G	G	A			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr5:102237063G>A	ENST00000438793.3	+	3	684	c.214G>A	c.(214-216)Gat>Aat	p.D72N	PAM_ENST00000379787.4_5'UTR|PAM_ENST00000348126.2_Missense_Mutation_p.D72N|PAM_ENST00000274392.9_Intron|PAM_ENST00000346918.2_Missense_Mutation_p.D72N|PAM_ENST00000455264.2_Missense_Mutation_p.D72N|PAM_ENST00000304400.7_Missense_Mutation_p.D72N	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	72	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TTAATAGTCCGATACATACTT	0.353																																					p.D72N		.											.	PAM-68	0			c.G214A						.						106.0	107.0	107.0					5																	102237063		2203	4300	6503	SO:0001583	missense	5066	exon3			TAGTCCGATACAT	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.214G>A	5.37:g.102237063G>A	ENSP00000396493:p.Asp72Asn	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	63	4	NM_138822	0	0	0	0	0	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396904	0.83120	.	.	ENSG00000145730	ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000455264	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.39	5.39	0.77823	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.092891	0.64402	D	0.000001	T	0.69205	0.3085	M	0.86651	2.83	0.80722	D	1	D;D;P;D;D	0.76494	0.993;0.997;0.798;0.991;0.999	P;P;B;P;D	0.64237	0.824;0.826;0.236;0.73;0.923	T	0.74494	-0.3647	10	0.66056	D	0.02	.	19.5261	0.95208	0.0:0.0:1.0:0.0	.	72;72;72;72;72	P19021;P19021-4;P19021-3;P19021-5;P19021-2	AMD_HUMAN;.;.;.;.	N	72	ENSP00000396493:D72N;ENSP00000282992:D72N;ENSP00000314638:D72N;ENSP00000306100:D72N;ENSP00000403461:D72N	ENSP00000306100:D72N	D	+	1	0	PAM	102264962	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	6.709000	0.74665	2.668000	0.90789	0.650000	0.86243	GAT	.		0.353	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
RNF14	9604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	141357939	141357939	+	Missense_Mutation	SNP	G	G	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr5:141357939G>T	ENST00000394520.2	+	5	687	c.378G>T	c.(376-378)tgG>tgT	p.W126C	AC005740.5_ENST00000520882.1_RNA|RNF14_ENST00000540015.1_Intron|RNF14_ENST00000502341.1_3'UTR|RNF14_ENST00000394514.2_5'UTR|RNF14_ENST00000394519.1_Missense_Mutation_p.W126C|RNF14_ENST00000347642.3_Missense_Mutation_p.W126C|RNF14_ENST00000394515.3_Intron|RNF14_ENST00000356143.1_Missense_Mutation_p.W126C	NM_001201365.1|NM_004290.4	NP_001188294.1|NP_004281.1	Q9UBS8	RNF14_HUMAN	ring finger protein 14	126	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				androgen receptor signaling pathway (GO:0030521)|positive regulation of transcription, DNA-templated (GO:0045893)|protein ubiquitination (GO:0016567)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|small conjugating protein ligase activity (GO:0019787)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15		all_hematologic(541;0.0536)|Ovarian(839;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		TGTTTGCCTGGATGCAATTTC	0.448																																					p.W126C		.											.	RNF14-226	0			c.G378T						.						126.0	113.0	117.0					5																	141357939		2203	4300	6503	SO:0001583	missense	9604	exon5			TGCCTGGATGCAA	AF060544	CCDS4270.1, CCDS4271.1	5q23.3-q31.1	2008-02-05			ENSG00000013561	ENSG00000013561		"""RING-type (C3HC4) zinc fingers"""	10058	protein-coding gene	gene with protein product		605675				10085091, 10320776	Standard	NM_183399		Approved	ARA54, HFB30, TRIAD2	uc003lmc.3	Q9UBS8	OTTHUMG00000129660	ENST00000394520.2:c.378G>T	5.37:g.141357939G>T	ENSP00000378028:p.Trp126Cys	Somatic	306	0		WXS	Illumina HiSeq	Phase_I	248	70	NM_001201365	0	0	6	16	10	A0AV26|A6NMR2|A8MTW5|B3KN72|B7ZLV2|D3DQE4|O94793|Q6IBV0	Missense_Mutation	SNP	ENST00000394520.2	37	CCDS4270.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419220	0.83559	.	.	ENSG00000013561	ENST00000511961;ENST00000506822;ENST00000356143;ENST00000394520;ENST00000347642;ENST00000506938;ENST00000507163;ENST00000394519	T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.67	5.67	0.87782	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.000000	0.85682	D	0.000000	T	0.72645	0.3486	M	0.90922	3.16	0.80722	D	1	D	0.59767	0.986	D	0.72338	0.977	T	0.74490	-0.3648	10	0.37606	T	0.19	.	19.8351	0.96655	0.0:0.0:1.0:0.0	.	126	Q9UBS8	RNF14_HUMAN	C	126	ENSP00000423420:W126C;ENSP00000423273:W126C;ENSP00000348462:W126C;ENSP00000378028:W126C;ENSP00000324956:W126C;ENSP00000420837:W126C;ENSP00000422527:W126C;ENSP00000378027:W126C	ENSP00000324956:W126C	W	+	3	0	RNF14	141338123	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.513000	0.98010	2.702000	0.92279	0.558000	0.71614	TGG	.		0.448	RNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251860.2	NM_004290	
GEMIN5	25929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	154278113	154278113	+	Missense_Mutation	SNP	C	C	T	rs144363013	byFrequency	TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr5:154278113C>T	ENST00000285873.7	-	23	3307	c.3232G>A	c.(3232-3234)Gta>Ata	p.V1078I		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	1078					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCCTCTCCTACGATGGCAGCC	0.552													C|||	2	0.000399361	0.0008	0.0	5008	,	,		18001	0.0		0.001	False		,,,				2504	0.0				p.V1078I		.											.	GEMIN5-228	0			c.G3232A						.	C	ILE/VAL	3,4403	6.2+/-15.9	0,3,2200	95.0	86.0	89.0		3232	2.2	0.0	5	dbSNP_134	89	6,8594	5.0+/-18.6	0,6,4294	yes	missense	GEMIN5	NM_015465.3	29	0,9,6494	TT,TC,CC		0.0698,0.0681,0.0692	benign	1078/1509	154278113	9,12997	2203	4300	6503	SO:0001583	missense	25929	exon23			CTCCTACGATGGC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.3232G>A	5.37:g.154278113C>T	ENSP00000285873:p.Val1078Ile	Somatic	301	0		WXS	Illumina HiSeq	Phase_I	244	85	NM_015465	0	0	0	2	2	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	37	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	C	7.692	0.691317	0.15039	6.81E-4	6.98E-4	ENSG00000082516	ENST00000285873	T	0.69806	-0.43	5.91	2.19	0.27852	.	0.811288	0.11495	N	0.558347	T	0.47097	0.1427	L	0.36672	1.1	0.09310	N	1	P;P	0.36768	0.569;0.569	B;B	0.22152	0.038;0.038	T	0.13098	-1.0522	10	0.20519	T	0.43	-0.487	8.1531	0.31152	0.1114:0.6337:0.0:0.2549	.	1077;1078	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	I	1078	ENSP00000285873:V1078I	ENSP00000285873:V1078I	V	-	1	0	GEMIN5	154258306	0.247000	0.23920	0.000000	0.03702	0.428000	0.31595	0.291000	0.18994	0.135000	0.18707	-0.797000	0.03246	GTA	C|1.000;T|0.000		0.552	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
TULP1	7287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	35471606	35471606	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr6:35471606G>C	ENST00000229771.6	-	12	1211	c.1132C>G	c.(1132-1134)Cgc>Ggc	p.R378G	TULP1_ENST00000322263.4_Missense_Mutation_p.R325G	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	378			R -> H (in RP14).		dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						ACCGTGAAGCGGTTCCCCAGG	0.607																																					p.R378G	GBM(55;1027 1091 11115 23439)	.											.	TULP1-92	0			c.C1132G						.						44.0	39.0	41.0					6																	35471606		2203	4300	6503	SO:0001583	missense	7287	exon12			TGAAGCGGTTCCC	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.1132C>G	6.37:g.35471606G>C	ENSP00000229771:p.Arg378Gly	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	44	20	NM_003322	0	0	0	0	0	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	ENST00000229771.6	37	CCDS4807.1	.	.	.	.	.	.	.	.	.	.	G	17.47	3.398726	0.62177	.	.	ENSG00000112041	ENST00000229771;ENST00000322263	D;D	0.85861	-2.04;-2.04	4.95	4.08	0.47627	Tubby, C-terminal (4);	0.060704	0.64402	D	0.000009	D	0.82976	0.5154	L	0.60455	1.87	0.33292	D	0.563614	D;P	0.56035	0.974;0.913	P;P	0.58577	0.841;0.584	D	0.83863	0.0269	10	0.87932	D	0	-13.8748	7.85	0.29448	0.0803:0.0:0.6548:0.2649	.	325;378	O00294-2;O00294	.;TULP1_HUMAN	G	378;325	ENSP00000229771:R378G;ENSP00000319414:R325G	ENSP00000229771:R378G	R	-	1	0	TULP1	35579584	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.638000	0.67861	1.075000	0.40932	0.491000	0.48974	CGC	.		0.607	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2		
COL12A1	1303	broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	75884802	75884802	+	Missense_Mutation	SNP	C	C	T	rs373259425		TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr6:75884802C>T	ENST00000322507.8	-	13	2971	c.2662G>A	c.(2662-2664)Gcg>Acg	p.A888T	COL12A1_ENST00000416123.2_Missense_Mutation_p.A888T|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.A888T	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	888	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GCCCCAGACGCATACAAGGCT	0.478																																					p.A888T													.	COL12A1-142	0			c.G2662A						.						209.0	208.0	208.0					6																	75884802		1993	4171	6164	SO:0001583	missense	1303	exon13			CAGACGCATACAA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2662G>A	6.37:g.75884802C>T	ENSP00000325146:p.Ala888Thr	Somatic	295	2		WXS	Illumina HiSeq	Phase_I	258	98	NM_004370	0	0	0	0	0	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.450680	0.26074	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.56941	0.43;0.43;0.43	5.94	5.06	0.68205	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.273480	0.31847	N	0.006967	T	0.22322	0.0538	L	0.37630	1.12	0.32335	N	0.560601	B	0.22080	0.064	B	0.23275	0.045	T	0.09250	-1.0683	10	0.23891	T	0.37	.	9.8609	0.41114	0.1406:0.7907:0.0:0.0688	.	888	Q99715	COCA1_HUMAN	T	888	ENSP00000325146:A888T;ENSP00000412864:A888T;ENSP00000421216:A888T	ENSP00000325146:A888T	A	-	1	0	COL12A1	75941522	1.000000	0.71417	0.997000	0.53966	0.907000	0.53573	1.159000	0.31749	1.499000	0.48617	-0.319000	0.08680	GCG	.		0.478	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
CNKSR3	154043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	154732110	154732110	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr6:154732110T>C	ENST00000607772.1	-	11	1781	c.1237A>G	c.(1237-1239)Aac>Gac	p.N413D	CNKSR3_ENST00000479339.1_Missense_Mutation_p.N333D|CNKSR3_ENST00000433165.2_Missense_Mutation_p.N238D	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	413	DUF1170.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		GGCAGAATGTTGGTTTCCACC	0.502																																					p.N413D		.											.	CNKSR3-26	0			c.A1237G						.						186.0	176.0	179.0					6																	154732110		2203	4300	6503	SO:0001583	missense	154043	exon11			GAATGTTGGTTTC	AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.1237A>G	6.37:g.154732110T>C	ENSP00000475915:p.Asn413Asp	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	163	60	NM_173515	0	0	31	51	20	Q5SGD5|Q96N65	Missense_Mutation	SNP	ENST00000607772.1	37	CCDS5246.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.416814	0.42918	.	.	ENSG00000153721	ENST00000367209;ENST00000367213;ENST00000433165;ENST00000479339;ENST00000424998	T;T;T	0.46063	1.48;0.88;0.89	5.82	5.82	0.92795	Connector enhancer of kinase suppressor of ras 2 (1);	0.275495	0.38326	N	0.001731	T	0.26846	0.0657	L	0.59436	1.845	0.20764	N	0.999854	B	0.27625	0.183	B	0.31495	0.131	T	0.17349	-1.0372	10	0.59425	D	0.04	.	12.6716	0.56870	0.0:0.0:0.1375:0.8625	.	413	Q6P9H4	CNKR3_HUMAN	D	188;413;238;333;175	ENSP00000356182:N413D;ENSP00000414185:N238D;ENSP00000418975:N333D	ENSP00000356178:N188D	N	-	1	0	CNKSR3	154773802	0.999000	0.42202	0.966000	0.40874	0.822000	0.46500	3.065000	0.49994	2.222000	0.72286	0.533000	0.62120	AAC	.		0.502	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042792.2	NM_173515	
MET	4233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	116397543	116397543	+	Missense_Mutation	SNP	A	A	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr7:116397543A>C	ENST00000318493.6	+	7	2102	c.1915A>C	c.(1915-1917)Att>Ctt	p.I639L	MET_ENST00000436117.2_Missense_Mutation_p.I639L|MET_ENST00000397752.3_Missense_Mutation_p.I639L			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			TATGTCCATAATTATTTCAAA	0.323			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.I639L		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	0			c.A1915C						.						88.0	86.0	86.0					7																	116397543		1844	4100	5944	SO:0001583	missense	4233	exon7	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	TCCATAATTATTT	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1915A>C	7.37:g.116397543A>C	ENSP00000317272:p.Ile639Leu	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	86	40	NM_000245	0	0	6	10	4	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	A	12.37	1.917098	0.33815	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.58652	0.32;0.32;0.32	5.4	-0.479	0.12089	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.634640	0.17750	N	0.163272	T	0.36991	0.0987	L	0.33485	1.01	0.58432	D	0.999999	B;B;B;B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.001;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.10450	0.001;0.002;0.004;0.005;0.004;0.004;0.001;0.004	T	0.07731	-1.0757	10	0.33141	T	0.24	.	2.8283	0.05491	0.6225:0.12:0.1419:0.1157	.	639;639;639;639;611;639;639;639	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;P08581-2;P08581	.;.;.;.;.;.;.;MET_HUMAN	L	639	ENSP00000380860:I639L;ENSP00000317272:I639L;ENSP00000410980:I639L	ENSP00000317272:I639L	I	+	1	0	MET	116184779	0.099000	0.21834	0.845000	0.33349	0.858000	0.48976	0.480000	0.22244	0.057000	0.16193	-0.334000	0.08254	ATT	.		0.323	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
COPG2	26958	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	130337745	130337745	+	Missense_Mutation	SNP	G	G	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr7:130337745G>C	ENST00000445977.2	-	5	376	c.287C>G	c.(286-288)gCt>gGt	p.A96G				Q9UBF2	COPG2_HUMAN	coatomer protein complex, subunit gamma 2	96					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)	structural molecule activity (GO:0005198)			large_intestine(1)	1	Melanoma(18;0.0435)					AGAGATGGTAGCCATTTCTTT	0.318																																					.													.	.	0			.						.						85.0	79.0	81.0					7																	130337745		1852	4093	5945	SO:0001583	missense	26958	.			ATGGTAGCCATTT	AF157833	CCDS75662.1	7q32	2010-06-22			ENSG00000158623	ENSG00000158623			2237	protein-coding gene	gene with protein product	"""coat protein, nonclathrin, gamma-2-cop"""	604355				10556286, 10995575	Standard	NM_001290033		Approved	2-COP	uc003vqh.1	Q9UBF2	OTTHUMG00000155364	ENST00000445977.2:c.287C>G	7.37:g.130337745G>C	ENSP00000393912:p.Ala96Gly	Somatic	96	0		WXS	Illumina HiSeq	Phase_I	92	22	.	0	0	1	1	0	A6NH74|Q2NLA0|Q54AC3|Q8WVW8	Missense_Mutation	SNP	ENST00000445977.2	37		.	.	.	.	.	.	.	.	.	.	G	28.6	4.934045	0.92458	.	.	ENSG00000158623	ENST00000445977;ENST00000330992	T;T	0.15487	2.42;2.42	5.11	5.11	0.69529	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.39627	0.1085	M	0.78049	2.395	0.80722	D	1	P	0.45902	0.868	P	0.56216	0.794	T	0.24621	-1.0155	10	0.72032	D	0.01	.	16.3759	0.83392	0.0:0.0:1.0:0.0	.	96	Q9UBF2	COPG2_HUMAN	G	96	ENSP00000393912:A96G;ENSP00000331218:A96G	ENSP00000331218:A96G	A	-	2	0	COPG2	129988285	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.255000	0.89846	2.517000	0.84864	0.585000	0.79938	GCT	.		0.318	COPG2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_012133	
MFHAS1	9258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	8643536	8643536	+	Missense_Mutation	SNP	T	T	C			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr8:8643536T>C	ENST00000276282.6	-	3	3741	c.3155A>G	c.(3154-3156)cAg>cGg	p.Q1052R	MFHAS1_ENST00000520091.1_5'UTR	NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	1052										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CAAACGTCACTGGTTTCTGTG	0.473																																					p.Q1052R	Melanoma(103;1201 2045 17515 28966)	.											.	MFHAS1-90	0			c.A3155G						.						192.0	159.0	170.0					8																	8643536		2203	4300	6503	SO:0001583	missense	9258	exon3			CGTCACTGGTTTC	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.3155A>G	8.37:g.8643536T>C	ENSP00000276282:p.Gln1052Arg	Somatic	165	0		WXS	Illumina HiSeq	Phase_I	135	13	NM_004225	0	0	1	1	0	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	T	18.70	3.679279	0.68042	.	.	ENSG00000147324	ENST00000276282	T	0.35236	1.32	5.61	5.61	0.85477	.	0.000000	0.42420	D	0.000702	T	0.36580	0.0972	N	0.08118	0	0.31388	N	0.678181	D	0.54601	0.967	P	0.62382	0.901	T	0.47749	-0.9093	10	0.87932	D	0	.	12.4865	0.55877	0.0:0.0:0.0:1.0	.	1052	Q9Y4C4	MFHA1_HUMAN	R	1052	ENSP00000276282:Q1052R	ENSP00000276282:Q1052R	Q	-	2	0	MFHAS1	8680946	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	2.564000	0.45931	2.266000	0.75297	0.533000	0.62120	CAG	.		0.473	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374724.2	NM_004225	
VSTM4	196740	hgsc.bcm.edu;bcgsc.ca	37	10	50311832	50311835	+	Intron	DEL	GGGC	GGGC	-			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	GGGC	GGGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr10:50311832_50311835delGGGC	ENST00000332853.4	-	2	481				VSTM4_ENST00000298454.3_Frame_Shift_Del_p.LP176fs	NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						CTGCGGTGAAGGGCAAAGAGTGAG	0.49																																					p.176_177del		.											.	VSTM4-154	0			c.528_531del						.																																			SO:0001627	intron_variant	196740	exon3			.	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.457+3803GCCC>-	10.37:g.50311832_50311835delGGGC		Somatic	201	0		WXS	Illumina HiSeq	Phase_I	130	34	NM_144984	0	0	0	0	0	B4DNI6|Q96MX7	Frame_Shift_Del	DEL	ENST00000332853.4	37	CCDS31198.1																																																																																			.		0.490	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984	
CHRFAM7A	89832	bcgsc.ca	37	15	30665219	30665220	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr15:30665219_30665220delAT	ENST00000299847.2	-	6	742_743	c.289_290delAT	c.(289-291)atcfs	p.I97fs	CHRFAM7A_ENST00000397827.3_Frame_Shift_Del_p.I6fs|CHRFAM7A_ENST00000567722.1_5'Flank|CHRFAM7A_ENST00000401522.3_Frame_Shift_Del_p.I6fs	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	97						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		ATAGCCACTGATATCTGCCTCC	0.5																																					p.97_97del													.	CHRFAM7A-45	0			c.289_290del						.																																			SO:0001589	frameshift_variant	89832	exon6			CCACTGATATCTG	AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.289_290delAT	15.37:g.30665221_30665222delAT	ENSP00000299847:p.Ile97fs	Somatic	882	1		WXS	Illumina HiSeq	Phase_1	631	230	NM_139320	0	0	0	0	0	A8KAB9	Frame_Shift_Del	DEL	ENST00000299847.2	37	CCDS32184.1																																																																																			.		0.500	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430700.1	NM_148911	
MAP4K1	11184	hgsc.bcm.edu;bcgsc.ca	37	19	39101749	39101755	+	Frame_Shift_Del	DEL	ATGAAGT	ATGAAGT	-			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	ATGAAGT	ATGAAGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr19:39101749_39101755delATGAAGT	ENST00000591517.1	-	11	774_780	c.746_752delACTTCAT	c.(745-753)aacttcatcfs	p.NFI249fs	MAP4K1_ENST00000586296.1_Frame_Shift_Del_p.NFI249fs|MAP4K1_ENST00000396857.2_Frame_Shift_Del_p.NFI249fs|MAP4K1_ENST00000423454.2_Intron|MAP4K1_ENST00000589002.1_Intron|MAP4K1_ENST00000589130.1_Frame_Shift_Del_p.NFI245fs	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	249	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			AGTGACTTTGATGAAGTTGTGGAAGGC	0.575																																					p.249_251del		.											.	MAP4K1-980	0			c.746_752del						.																																			SO:0001589	frameshift_variant	11184	exon11			.	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.746_752delACTTCAT	19.37:g.39101749_39101755delATGAAGT	ENSP00000465039:p.Asn249fs	Somatic	190	0		WXS	Illumina HiSeq	Phase_I	141	29	NM_007181	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000591517.1	37	CCDS59385.1																																																																																			.		0.575	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000453390.1	NM_001042600	
PRKCI	5584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	170013708	170013708	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr3:170013708delA	ENST00000295797.4	+	15	1732	c.1427delA	c.(1426-1428)gaafs	p.E476fs		NM_002740.5	NP_002731.4	P41743	KPCI_HUMAN	protein kinase C, iota	476	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament organization (GO:0007015)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell junction organization (GO:0045216)|cellular response to insulin stimulus (GO:0032869)|cytoskeleton organization (GO:0007010)|establishment of apical/basal cell polarity (GO:0035089)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|eye photoreceptor cell development (GO:0042462)|Golgi vesicle budding (GO:0048194)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of glucose import (GO:0046326)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|protein targeting to membrane (GO:0006612)|response to interleukin-1 (GO:0070555)|secretion (GO:0046903)|tight junction assembly (GO:0070830)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Schmidt-Lanterman incisure (GO:0043220)	ATP binding (GO:0005524)|phospholipid binding (GO:0005543)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	36	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)		Tamoxifen(DB00675)	GTTATTTTGGAAAAACAAATT	0.289																																					p.E476fs		.											.	PRKCI-1378	0			c.1427delA						.						51.0	55.0	54.0					3																	170013708		2202	4298	6500	SO:0001589	frameshift_variant	5584	exon15			.		CCDS3212.2	3q26.3	2008-07-18			ENSG00000163558	ENSG00000163558	2.7.11.13		9404	protein-coding gene	gene with protein product		600539		DXS1179E		7607695, 11978974	Standard	NM_002740		Approved	PKCI	uc003fgs.2	P41743	OTTHUMG00000150214	ENST00000295797.4:c.1427delA	3.37:g.170013708delA	ENSP00000295797:p.Glu476fs	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	85	42	NM_002740	0	0	0	0	0	D3DNQ4|Q8WW06	Frame_Shift_Del	DEL	ENST00000295797.4	37	CCDS3212.2																																																																																			.		0.289	PRKCI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316866.3	NM_002740	
SYNPO2	171024	hgsc.bcm.edu	37	4	119947965	119947967	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr4:119947965_119947967delAAG	ENST00000429713.2	+	3	623_625	c.441_443delAAG	c.(439-444)agaagt>agt	p.R147del	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_In_Frame_Del_p.R147del|SYNPO2_ENST00000434046.2_In_Frame_Del_p.R147del	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	147				Missing (in Ref. 3; AL832031). {ECO:0000305}.		actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGAACCAAAGAAGTGGTCCCGAC	0.552																																					p.147_148del		.											.	SYNPO2-92	0			c.441_443del						.																																			SO:0001651	inframe_deletion	171024	exon3			.	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.441_443delAAG	4.37:g.119947965_119947967delAAG	ENSP00000395143:p.Arg147del	Somatic	171	0		WXS	Illumina HiSeq	Phase_I	165	32	NM_001128934	0	0	0	0	0	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	In_Frame_Del	DEL	ENST00000429713.2	37	CCDS47129.1																																																																																			.		0.552	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
LRRC37A	9884	broad.mit.edu	37	17	44410017	44410018	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr17:44410017_44410018insT	ENST00000320254.5	+	10	4807_4808	c.4804_4805insT	c.(4804-4806)attfs	p.I1602fs	ARL17B_ENST00000575960.1_Intron|LRRC37A_ENST00000393465.3_Frame_Shift_Ins_p.I1602fs|LRRC37A_ENST00000496930.1_Frame_Shift_Ins_p.I640fs|ARL17B_ENST00000434041.2_Intron|ARL17B_ENST00000570618.1_Intron|ARL17B_ENST00000575698.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1602						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		TTTCTGCCTCATTGTGGTAAGG	0.376																																					p.I1602fs													.	LRRC37A-22	0			c.4804_4805insT						.																																			SO:0001589	frameshift_variant	9884	exon10			TGCCTCATTGTGG	BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.4806dupT	17.37:g.44410019_44410019dupT	ENSP00000326324:p.Ile1602fs	Somatic	349	2		WXS	Illumina HiSeq	Phase_I	412	111	NM_014834	0	0	0	0	0	Q68DY2|Q8IWC7	Frame_Shift_Ins	INS	ENST00000320254.5	37	CCDS11504.2																																																																																			.		0.376	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313519.3	NM_014834	
C9orf89	84270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	95874554	95874555	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr9:95874554_95874555TG>GT	ENST00000375464.2	+	5	547_548	c.419_420TG>GT	c.(418-420)cTG>cGT	p.L140R	C9orf89_ENST00000488630.1_3'UTR	NM_032310.3	NP_115686.3	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	145					negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						GCCCTGCTCCTGTACTGCTATC	0.668																																					p.L140R		.											.	C9orf89-90	0			c.G420T						.																																			SO:0001583	missense	84270	exon5			GCTCCTGTACTGC	AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	Exception_encountered	9.37:g.95874554_95874555delinsGT	ENSP00000364613:p.Leu140Arg	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	23.0	NM_032310	0	0	0	0	0	Q5BJH8|Q9BSY2	Missense_Mutation	DNP	ENST00000375464.2	37	CCDS6702.2																																																																																			.		0.668	C9orf89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053128.1	NM_032310	
RBM19	9904	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	114400219	114400220	+	Splice_Site	DNP	TC	TC	CT			TCGA-IA-A40U-01A-11D-A25F-10	TCGA-IA-A40U-10A-01D-A25F-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dd80d4b5-7825-4f99-b2e2-2559763b8661	384b9f8f-9231-4ab8-b556-8083ee51d965	g.chr12:114400219_114400220TC>CT	ENST00000545145.2	-	2	115	c.37_37GA>AG	c.(37-39)GAat>AGaat	p.E13R	RBM19_ENST00000261741.5_Splice_Site_p.E13R|RBM19_ENST00000392561.3_Splice_Site_p.E13R	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	13	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TCCTCCTTCATCTAGGACAGAG	0.54																																					.													.	RBM19-95	0			c.37-1G>A						.																																			SO:0001630	splice_region_variant	9904	exon3			CTTCATCTAGGAC	AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.37_37delinsCT	12.37:g.114400219_114400220delinsCT		Somatic	104	1		WXS	Illumina HiSeq	Phase_I	130	91	NM_001146699	0	0	0	0	0	A8K5X9|Q9BPY6|Q9UFN5	Splice_Site	DNP	ENST00000545145.2	37	CCDS9172.1																																																																																			.		0.540	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405251.1	NM_016196	Missense_Mutation
