#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DDI2	84301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	15956839	15956839	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:15956839C>T	ENST00000480945.1	+	3	459	c.288C>T	c.(286-288)ttC>ttT	p.F96F		NM_032341.4	NP_115717.3	Q5TDH0	DDI2_HUMAN	DNA-damage inducible 1 homolog 2 (S. cerevisiae)	96							aspartic-type endopeptidase activity (GO:0004190)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|stomach(1)	17		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00327)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.03e-07)|COAD - Colon adenocarcinoma(227;4.48e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		GAATAGATTTCAGTAGTATAG	0.463																																					p.F96F		.											.	DDI2-44	0			c.C288T						.						87.0	90.0	89.0					1																	15956839		2203	4300	6503	SO:0001819	synonymous_variant	84301	exon3			AGATTTCAGTAGT		CCDS30607.1	1p36.13	2010-05-04	2010-05-04		ENSG00000197312	ENSG00000197312			24578	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 2 (S. cerevisiae)"""				Standard	NM_032341		Approved	MGC14844	uc001awx.2	Q5TDH0	OTTHUMG00000002381	ENST00000480945.1:c.288C>T	1.37:g.15956839C>T		Somatic	168	0		WXS	Illumina HiSeq	Phase_I	133	66	NM_032341	0	0	0	2	2	A8KAE1|Q7RTZ0|Q9BRT1	Silent	SNP	ENST00000480945.1	37	CCDS30607.1																																																																																			.		0.463	DDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006826.1	NM_032341	
PLA2G5	5322	hgsc.bcm.edu	37	1	20416294	20416294	+	Silent	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:20416294G>A	ENST00000375108.3	+	4	466	c.198G>A	c.(196-198)gcG>gcA	p.A66A	PLA2G5_ENST00000486277.1_3'UTR	NM_000929.2	NP_000920.1	P39877	PA2G5_HUMAN	phospholipase A2, group V	66					arachidonic acid secretion (GO:0050482)|glycerophospholipid biosynthetic process (GO:0046474)|leukotriene biosynthetic process (GO:0019370)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|heparin binding (GO:0008201)			NS(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		GCTGTTGGGCGCATGACCACT	0.567																																					p.A66A		.											.	PLA2G5-515	0			c.G198A						.						92.0	75.0	81.0					1																	20416294		2203	4300	6503	SO:0001819	synonymous_variant	5322	exon4			TTGGGCGCATGAC	U03090	CCDS202.1	1p36-p34	2008-09-19			ENSG00000127472	ENSG00000127472	3.1.1.4		9038	protein-coding gene	gene with protein product		601192				8838795, 8300559	Standard	NM_000929		Approved		uc001bcy.3	P39877	OTTHUMG00000002698	ENST00000375108.3:c.198G>A	1.37:g.20416294G>A		Somatic	89	0		WXS	Illumina HiSeq	Phase_I	59	3	NM_000929	0	0	0	0	0	Q8N435	Silent	SNP	ENST00000375108.3	37	CCDS202.1																																																																																			.		0.567	PLA2G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007668.1	NM_000929	
MSH4	4438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	76269502	76269502	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:76269502G>A	ENST00000263187.3	+	2	435	c.331G>A	c.(331-333)Gat>Aat	p.D111N		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	111					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						TTCTGCACGAGATACTAATTA	0.363								Mismatch excision repair (MMR)																													p.D111N		.											.	MSH4-660	0			c.G331A						.						97.0	101.0	100.0					1																	76269502		2203	4300	6503	SO:0001583	missense	4438	exon2			GCACGAGATACTA	U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.331G>A	1.37:g.76269502G>A	ENSP00000263187:p.Asp111Asn	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	110	52	NM_002440	0	0	0	0	0	Q5T4U6|Q8NEB3|Q9UNP8	Missense_Mutation	SNP	ENST00000263187.3	37	CCDS670.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326532	0.24080	.	.	ENSG00000057468	ENST00000263187	D	0.87256	-2.23	4.73	3.81	0.43845	.	0.591556	0.15780	N	0.245000	T	0.61776	0.2374	N	0.24115	0.695	0.09310	N	1	B	0.19817	0.039	B	0.11329	0.006	T	0.55392	-0.8148	10	0.49607	T	0.09	-16.9831	6.3049	0.21133	0.16:0.0:0.6929:0.147	.	111	O15457	MSH4_HUMAN	N	111	ENSP00000263187:D111N	ENSP00000263187:D111N	D	+	1	0	MSH4	76042090	0.920000	0.31207	0.889000	0.34880	0.806000	0.45545	3.225000	0.51246	0.984000	0.38629	-0.266000	0.10368	GAT	.		0.363	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026983.1	NM_002440	
LRRC8C	84230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	90180228	90180228	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:90180228C>A	ENST00000370454.4	+	3	2354	c.2099C>A	c.(2098-2100)cCt>cAt	p.P700H	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	700					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TTTATCCCCCCTGAAATTGGA	0.383																																					p.P700H		.											.	LRRC8C-97	0			c.C2099A						.						68.0	63.0	65.0					1																	90180228		2203	4299	6502	SO:0001583	missense	84230	exon3			TCCCCCCTGAAAT		CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.2099C>A	1.37:g.90180228C>A	ENSP00000359483:p.Pro700His	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	77	29	NM_032270	0	0	1	1	0	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	ENST00000370454.4	37	CCDS725.1	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849986	0.32699	.	.	ENSG00000171488	ENST00000370454	T	0.25414	1.8	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.24353	0.0590	M	0.78049	2.395	0.80722	D	1	B	0.25351	0.124	B	0.24269	0.052	T	0.02789	-1.1110	10	0.35671	T	0.21	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	700	Q8TDW0	LRC8C_HUMAN	H	700	ENSP00000359483:P700H	ENSP00000359483:P700H	P	+	2	0	LRRC8C	89952816	1.000000	0.71417	0.801000	0.32222	0.989000	0.77384	6.050000	0.71063	2.941000	0.99782	0.655000	0.94253	CCT	.		0.383	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028435.2	NM_032270	
RBM15	64783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	110882978	110882978	+	Silent	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:110882978T>C	ENST00000369784.3	+	1	1851	c.951T>C	c.(949-951)ccT>ccC	p.P317P	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Silent_p.P317P|RBM15_ENST00000487146.2_Silent_p.P317P	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	317					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCCTGCCCCCTCCACCTCCGC	0.607			T	MKL1	acute megakaryocytic leukemia																																p.P317P		.		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	.	RBM15-661	0			c.T951C						.						46.0	52.0	50.0					1																	110882978		2203	4300	6503	SO:0001819	synonymous_variant	64783	exon1			GCCCCCTCCACCT	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.951T>C	1.37:g.110882978T>C		Somatic	214	1		WXS	Illumina HiSeq	Phase_I	112	53	NM_022768	0	0	5	5	0	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Silent	SNP	ENST00000369784.3	37	CCDS822.1																																																																																			.		0.607	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
ANKRD35	148741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	145561688	145561688	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:145561688A>G	ENST00000355594.4	+	10	1463	c.1376A>G	c.(1375-1377)cAg>cGg	p.Q459R		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	459										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CATGCTGACCAGCTGCCTGCT	0.592																																					p.Q459R	Melanoma(9;127 754 22988 51047)	.											.	ANKRD35-95	0			c.A1376G						.						55.0	63.0	60.0					1																	145561688		2203	4300	6503	SO:0001583	missense	148741	exon10			CTGACCAGCTGCC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1376A>G	1.37:g.145561688A>G	ENSP00000347802:p.Gln459Arg	Somatic	169	0		WXS	Illumina HiSeq	Phase_I	113	48	NM_144698	0	0	0	0	0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	a	0.294	-0.978340	0.02197	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.67698	-0.28	5.54	0.0734	0.14390	.	0.859396	0.09865	N	0.745663	T	0.33760	0.0874	M	0.63428	1.95	0.09310	N	1	B	0.26935	0.164	B	0.22601	0.04	T	0.16158	-1.0412	10	0.27785	T	0.31	-2.3373	2.517	0.04670	0.4852:0.2931:0.0804:0.1412	.	459	Q8N283	ANR35_HUMAN	R	368;459	ENSP00000347802:Q459R	ENSP00000347802:Q459R	Q	+	2	0	ANKRD35	144273045	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	1.054000	0.30455	0.044000	0.15775	-0.253000	0.11424	CAG	.		0.592	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
ATP8B2	57198	bcgsc.ca	37	1	154314970	154314970	+	Missense_Mutation	SNP	G	G	C	rs201587979		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:154314970G>C	ENST00000368489.3	+	14	1357	c.1357G>C	c.(1357-1359)Gtc>Ctc	p.V453L		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	439					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGTGTTTGACGTCCTGGGACA	0.488																																					p.V453L													.	ATP8B2-92	0			c.G1357C						.						218.0	191.0	200.0					1																	154314970		2203	4300	6503	SO:0001583	missense	57198	exon14			TTTGACGTCCTGG	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1357G>C	1.37:g.154314970G>C	ENSP00000357475:p.Val453Leu	Somatic	95	0		WXS	Illumina HiSeq	Phase_1	65	14	NM_020452	0	0	7	7	0	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	37	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	G	9.215	1.031832	0.19590	.	.	ENSG00000143515	ENST00000368489	T	0.62639	0.01	5.49	4.55	0.56014	.	0.196433	0.33382	N	0.004963	T	0.19485	0.0468	N	0.03294	-0.36	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.07462	-1.0771	10	0.22109	T	0.4	.	12.1628	0.54113	0.0:0.1722:0.8278:0.0	.	453	P98198-3	.	L	453	ENSP00000357475:V453L	ENSP00000357475:V453L	V	+	1	0	ATP8B2	152581594	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.253000	0.43205	1.267000	0.44247	0.561000	0.74099	GTC	G|0.999;A|0.001		0.488	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
ATP8B2	57198	bcgsc.ca	37	1	154314972	154314972	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:154314972C>T	ENST00000368489.3	+	14	1359	c.1359C>T	c.(1357-1359)gtC>gtT	p.V453V		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	439					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGTTTGACGTCCTGGGACACA	0.483																																					p.V453V													.	ATP8B2-92	0			c.C1359T						.						217.0	190.0	199.0					1																	154314972		2203	4300	6503	SO:0001819	synonymous_variant	57198	exon14			TGACGTCCTGGGA	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1359C>T	1.37:g.154314972C>T		Somatic	96	0		WXS	Illumina HiSeq	Phase_1	65	15	NM_020452	0	0	7	7	0	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Silent	SNP	ENST00000368489.3	37	CCDS1066.1																																																																																			.		0.483	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
MAEL	84944	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	166974561	166974561	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:166974561C>A	ENST00000367872.4	+	8	1016	c.772C>A	c.(772-774)Ctc>Atc	p.L258I	MAEL_ENST00000491055.1_3'UTR|RNA5SP65_ENST00000363166.1_RNA|MAEL_ENST00000367870.2_Missense_Mutation_p.L227I	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	258					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						ACAAAAATTTCTCAAGGAGCC	0.398																																					p.L258I		.											.	MAEL-91	0			c.C772A						.						73.0	78.0	76.0					1																	166974561		2203	4300	6503	SO:0001583	missense	84944	exon8			AAATTTCTCAAGG	AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.772C>A	1.37:g.166974561C>A	ENSP00000356846:p.Leu258Ile	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	62	28	NM_032858	0	0	2	2	0	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	ENST00000367872.4	37	CCDS1257.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825645	0.32237	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624	T;T;T	0.47869	0.85;0.83;0.85	5.66	4.75	0.60458	.	0.324591	0.26193	N	0.025795	T	0.13927	0.0337	N	0.08118	0	0.23765	N	0.996906	B;B	0.32071	0.301;0.355	B;B	0.38225	0.209;0.268	T	0.05920	-1.0856	10	0.42905	T	0.14	.	7.8331	0.29355	0.0:0.7505:0.1634:0.086	.	227;258	E9JVC3;Q96JY0	.;MAEL_HUMAN	I	258;227;227	ENSP00000356846:L258I;ENSP00000356844:L227I;ENSP00000402143:L227I	ENSP00000356844:L227I	L	+	1	0	MAEL	165241185	0.611000	0.26992	0.982000	0.44146	0.989000	0.77384	1.344000	0.33941	1.389000	0.46526	0.591000	0.81541	CTC	.		0.398	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083239.1	NM_032858	
CNTN2	6900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	205028742	205028742	+	Silent	SNP	C	C	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:205028742C>A	ENST00000331830.4	+	7	1013	c.729C>A	c.(727-729)gcC>gcA	p.A243A	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	243	Ig-like C2-type 3.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCATCAAGGCCCGGTTCCCAG	0.582																																					p.A243A	Melanoma(183;2548 2817 37099 41192)	.											.	CNTN2-91	0			c.C729A						.						90.0	91.0	91.0					1																	205028742		2203	4300	6503	SO:0001819	synonymous_variant	6900	exon7			CAAGGCCCGGTTC	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.729C>A	1.37:g.205028742C>A		Somatic	287	0		WXS	Illumina HiSeq	Phase_I	155	53	NM_005076	0	0	0	0	0	P78432|Q5T054	Silent	SNP	ENST00000331830.4	37	CCDS1449.1																																																																																			.		0.582	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
AHCTF1	25909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247070995	247070995	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:247070995C>T	ENST00000391829.2	-	5	745	c.622G>A	c.(622-624)Ggg>Agg	p.G208R	AHCTF1_ENST00000326225.3_Missense_Mutation_p.G217R|AHCTF1_ENST00000366508.1_Missense_Mutation_p.G243R			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	208	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AGATGGCGCCCTTGTCTCATT	0.383																																					p.G217R	Colon(145;197 1800 4745 15099 26333)	.											.	AHCTF1-97	0			c.G649A						.						135.0	127.0	130.0					1																	247070995		2203	4300	6503	SO:0001583	missense	25909	exon5			GGCGCCCTTGTCT		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.622G>A	1.37:g.247070995C>T	ENSP00000375705:p.Gly208Arg	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	124	58	NM_015446	0	0	7	9	2	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	37		.	.	.	.	.	.	.	.	.	.	C	22.0	4.223797	0.79576	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.20738	2.05;2.05;2.05	5.76	5.76	0.90799	.	0.051494	0.85682	D	0.000000	T	0.26195	0.0639	N	0.19112	0.55	0.58432	D	0.999999	D;D	0.59767	0.986;0.981	P;P	0.56474	0.799;0.706	T	0.00761	-1.1577	10	0.37606	T	0.19	-24.8597	15.7857	0.78300	0.0:0.8645:0.1355:0.0	.	243;208	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	R	243;217;208	ENSP00000355464:G243R;ENSP00000355465:G217R;ENSP00000375705:G208R	ENSP00000355465:G217R	G	-	1	0	AHCTF1	245137618	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	5.686000	0.68211	2.880000	0.98712	0.650000	0.86243	GGG	.		0.383	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
OR2L8	391190	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	248112473	248112473	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:248112473C>T	ENST00000357191.3	+	1	314	c.314C>T	c.(313-315)gCa>gTa	p.A105V	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTCTTCTTGGCATTAGGAGGT	0.433																																					p.A105V		.											.	OR2L8-70	0			c.C314T						.						335.0	270.0	292.0					1																	248112473		2203	4300	6503	SO:0001583	missense	391190	exon1			TCTTGGCATTAGG	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.314C>T	1.37:g.248112473C>T	ENSP00000349719:p.Ala105Val	Somatic	233	0		WXS	Illumina HiSeq	Phase_I	393	140	NM_001001963	0	0	0	0	0	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	37	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	.	8.579	0.881879	0.17467	.	.	ENSG00000196936	ENST00000357191	T	0.00349	7.99	1.64	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.542717	0.13750	U	0.365321	T	0.00178	0.0005	N	0.20483	0.58	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.41805	-0.9488	10	0.87932	D	0	.	3.6931	0.08354	0.0:0.5144:0.0:0.4856	.	105	Q8NGY9	OR2L8_HUMAN	V	105	ENSP00000349719:A105V	ENSP00000349719:A105V	A	+	2	0	OR2L8	246179096	0.000000	0.05858	0.699000	0.30290	0.027000	0.11550	-0.195000	0.09546	0.905000	0.36596	0.479000	0.44913	GCA	.		0.433	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
FAM208B	54906	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	5788364	5788364	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr10:5788364T>C	ENST00000328090.5	+	15	3605	c.2980T>C	c.(2980-2982)Tct>Cct	p.S994P	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	994																	ATGTCAGAGCTCTGTGTACGG	0.483																																					p.S994P		.											.	.	0			c.T2980C						.						102.0	100.0	100.0					10																	5788364		2007	4170	6177	SO:0001583	missense	54906	exon15			CAGAGCTCTGTGT	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2980T>C	10.37:g.5788364T>C	ENSP00000328426:p.Ser994Pro	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	113	55	NM_017782	0	0	9	20	11	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	ENST00000328090.5	37	CCDS41485.1	.	.	.	.	.	.	.	.	.	.	T	5.833	0.337978	0.11013	.	.	ENSG00000108021	ENST00000328090	D	0.97811	-4.55	5.37	2.97	0.34412	.	0.115838	0.39407	N	0.001362	D	0.94601	0.8260	L	0.43701	1.375	0.09310	N	1	B	0.34161	0.439	B	0.37422	0.249	D	0.88914	0.3361	10	0.48119	T	0.1	.	4.643	0.12558	0.1675:0.0913:0.0:0.7412	.	994	Q5VWN6	F208B_HUMAN	P	994	ENSP00000328426:S994P	ENSP00000328426:S994P	S	+	1	0	C10orf18	5828370	0.079000	0.21365	0.210000	0.23637	0.008000	0.06430	0.877000	0.28106	0.304000	0.22809	0.460000	0.39030	TCT	.		0.483	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046571.2	NM_017782	
C1QL3	389941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	16556595	16556595	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr10:16556595C>T	ENST00000298943.3	-	2	1639	c.700G>A	c.(700-702)Ggg>Agg	p.G234R		NM_001010908.1	NP_001010908.1	Q5VWW1	C1QL3_HUMAN	complement component 1, q subcomponent-like 3	234	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				regulation of synapse organization (GO:0050807)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)		p.G234W(1)		breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TGGGCTTTCCCGCCATCTAAT	0.393																																					p.G234R		.											.	C1QL3-91	1	Substitution - Missense(1)	lung(1)	c.G700A						.						148.0	137.0	141.0					10																	16556595		2203	4300	6503	SO:0001583	missense	389941	exon2			CTTTCCCGCCATC		CCDS31156.1	10p13	2012-03-26			ENSG00000165985	ENSG00000165985			19359	protein-coding gene	gene with protein product		615227				21378161	Standard	NM_001010908		Approved	K100, C1ql, C1QTNF13, CTRP13	uc001ioj.1	Q5VWW1	OTTHUMG00000017738	ENST00000298943.3:c.700G>A	10.37:g.16556595C>T	ENSP00000298943:p.Gly234Arg	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	118	47	NM_001010908	0	0	4	13	9	A0PJY4|A0PJY5	Missense_Mutation	SNP	ENST00000298943.3	37	CCDS31156.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.486586	0.84854	.	.	ENSG00000165985	ENST00000298943;ENST00000448557	T	0.25749	1.78	5.71	5.71	0.89125	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.85682	D	0.000000	T	0.52322	0.1727	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.44907	-0.9297	10	0.48119	T	0.1	.	19.8415	0.96690	0.0:1.0:0.0:0.0	.	234	Q5VWW1	C1QL3_HUMAN	R	234;211	ENSP00000298943:G234R	ENSP00000298943:G234R	G	-	1	0	C1QL3	16596601	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.818000	0.86416	2.700000	0.92200	0.655000	0.94253	GGG	.		0.393	C1QL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047003.1	XM_372305	
RUFY2	55680	broad.mit.edu;ucsc.edu	37	10	70152941	70152941	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr10:70152941T>A	ENST00000602465.1	-	7	704	c.604A>T	c.(604-606)Ata>Tta	p.I202L	RUFY2_ENST00000388768.2_Missense_Mutation_p.I237L|RUFY2_ENST00000399200.2_Missense_Mutation_p.I168L|RUFY2_ENST00000472394.2_5'UTR|RUFY2_ENST00000454950.2_Missense_Mutation_p.I144L			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	251	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						TGGTCTAATATGGCAGCAATT	0.264																																					p.I237L													.	RUFY2-91	0			c.A709T						.						53.0	54.0	53.0					10																	70152941		1792	4056	5848	SO:0001583	missense	55680	exon7			CTAATATGGCAGC	AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.604A>T	10.37:g.70152941T>A	ENSP00000473462:p.Ile202Leu	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	16	3	NM_017987	0	0	1	1	0	B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Missense_Mutation	SNP	ENST00000602465.1	37		.	.	.	.	.	.	.	.	.	.	T	13.22	2.171217	0.38315	.	.	ENSG00000204130	ENST00000388768;ENST00000399200;ENST00000454950	T;T;T	0.51325	0.71;1.91;1.56	5.17	4.04	0.47022	.	0.512339	0.22301	N	0.061872	T	0.38295	0.1035	L	0.43923	1.385	0.58432	D	0.999997	B;B;B;B	0.24963	0.006;0.004;0.004;0.115	B;B;B;B	0.24974	0.007;0.009;0.009;0.057	T	0.12400	-1.0549	10	0.25751	T	0.34	.	10.6902	0.45867	0.0:0.0746:0.0:0.9254	.	144;202;168;237	B4DFR0;Q8WXA3-2;Q8WXA3-4;Q8WXA3-3	.;.;.;.	L	237;168;144	ENSP00000373420:I237L;ENSP00000382151:I168L;ENSP00000404986:I144L	ENSP00000373420:I237L	I	-	1	0	RUFY2	69822947	1.000000	0.71417	0.974000	0.42286	0.914000	0.54420	6.053000	0.71089	0.988000	0.38734	0.482000	0.46254	ATA	.		0.264	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467567.1	NM_017987	
RUFY2	55680	broad.mit.edu;ucsc.edu	37	10	70152944	70152944	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr10:70152944C>T	ENST00000602465.1	-	7	701	c.601G>A	c.(601-603)Gcc>Acc	p.A201T	RUFY2_ENST00000388768.2_Missense_Mutation_p.A236T|RUFY2_ENST00000399200.2_Missense_Mutation_p.A167T|RUFY2_ENST00000472394.2_5'UTR|RUFY2_ENST00000454950.2_Missense_Mutation_p.A143T			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	250	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						TCTAATATGGCAGCAATTTGA	0.264																																					p.A236T													.	RUFY2-91	0			c.G706A						.						55.0	55.0	55.0					10																	70152944		1792	4057	5849	SO:0001583	missense	55680	exon7			ATATGGCAGCAAT	AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.601G>A	10.37:g.70152944C>T	ENSP00000473462:p.Ala201Thr	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	16	3	NM_017987	0	0	3	3	0	B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Missense_Mutation	SNP	ENST00000602465.1	37		.	.	.	.	.	.	.	.	.	.	C	16.07	3.019397	0.54576	.	.	ENSG00000204130	ENST00000388768;ENST00000399200;ENST00000454950	T;T;T	0.54279	0.58;1.81;1.42	5.17	5.17	0.71159	.	0.353403	0.32459	N	0.006069	T	0.50360	0.1611	L	0.55481	1.735	0.58432	D	0.999999	B;B;B;P	0.38827	0.131;0.206;0.419;0.649	B;B;B;B	0.36666	0.039;0.059;0.168;0.23	T	0.49303	-0.8954	10	0.31617	T	0.26	.	18.8515	0.92232	0.0:1.0:0.0:0.0	.	143;201;167;236	B4DFR0;Q8WXA3-2;Q8WXA3-4;Q8WXA3-3	.;.;.;.	T	236;167;143	ENSP00000373420:A236T;ENSP00000382151:A167T;ENSP00000404986:A143T	ENSP00000373420:A236T	A	-	1	0	RUFY2	69822950	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.829000	0.62737	2.671000	0.90904	0.591000	0.81541	GCC	.		0.264	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467567.1	NM_017987	
NOLC1	9221	hgsc.bcm.edu	37	10	103917063	103917063	+	Silent	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr10:103917063A>G	ENST00000605788.1	+	3	529	c.294A>G	c.(292-294)caA>caG	p.Q98Q	NOLC1_ENST00000405356.1_Silent_p.Q98Q|NOLC1_ENST00000488254.2_Silent_p.Q99Q|NOLC1_ENST00000603742.1_Intron	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	98	11 X 12 AA approximate repeats of an acidic serine cluster.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		AGGAAGTTCAAGGGCCTCCAG	0.512																																					p.Q98Q		.											.	NOLC1-91	0			c.A294G						.						76.0	72.0	74.0					10																	103917063		2203	4300	6503	SO:0001819	synonymous_variant	9221	exon3			AGTTCAAGGGCCT	Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.294A>G	10.37:g.103917063A>G		Somatic	60	1		WXS	Illumina HiSeq	Phase_I	57	3	NM_004741	0	0	31	31	0	Q15030|Q5VV70|Q9BUV3	Silent	SNP	ENST00000605788.1	37	CCDS7530.1																																																																																			.		0.512	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050012.2	NM_004741	
PIDD1	55367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	803185	803185	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:803185G>T	ENST00000347755.5	-	3	839	c.698C>A	c.(697-699)cCa>cAa	p.P233Q	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Missense_Mutation_p.P233Q	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					CAGAGAGGCTGGGAGGCTCTG	0.657																																					p.P233Q		.											.	PIDD-205	0			c.C698A						.						17.0	22.0	20.0					11																	803185		2195	4277	6472	SO:0001583	missense	55367	exon3			GAGGCTGGGAGGC																												ENST00000347755.5:c.698C>A	11.37:g.803185G>T	ENSP00000337797:p.Pro233Gln	Somatic	96	2		WXS	Illumina HiSeq	Phase_I	50	25	NM_145887	0	0	4	5	1		Missense_Mutation	SNP	ENST00000347755.5	37	CCDS7716.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400654	0.83120	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	T;T	0.26518	1.73;1.73	4.55	4.55	0.56014	.	0.151531	0.45126	D	0.000399	T	0.66208	0.2766	H	0.96777	3.88	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	T	0.80084	-0.1530	10	0.87932	D	0	.	17.4818	0.87674	0.0:0.0:1.0:0.0	.	233;87;233	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	Q	233	ENSP00000416801:P233Q;ENSP00000337797:P233Q	ENSP00000337797:P233Q	P	-	2	0	PIDD	793185	1.000000	0.71417	0.936000	0.37596	0.623000	0.37688	5.191000	0.65110	2.369000	0.80426	0.555000	0.69702	CCA	.		0.657	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257103.1		
MUC2	4583	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	1097183	1097183	+	Splice_Site	SNP	T	T	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:1097183T>G	ENST00000441003.2	+	35	6626	c.6599T>G	c.(6598-6600)gTg>gGg	p.V2200G	MUC2_ENST00000361558.6_Splice_Site_p.V338G	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4562					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CGGCCACAGGTGCAGGTGAAC	0.627																																					p.V2196G													.	MUC2-90	0			c.T6587G						.						53.0	68.0	63.0					11																	1097183		2181	4273	6454	SO:0001630	splice_region_variant	4583	exon36			CACAGGTGCAGGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6598-1T>G	11.37:g.1097183T>G		Somatic	140	1		WXS	Illumina HiSeq	Phase_I	51	21	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	t	14.27	2.484198	0.44147	.	.	ENSG00000198788	ENST00000441003;ENST00000361558	T;T	0.69561	-0.41;-0.41	3.72	3.72	0.42706	.	.	.	.	.	T	0.80884	0.4709	M	0.81239	2.535	0.53005	D	0.999963	D	0.89917	1.0	D	0.75484	0.986	D	0.83792	0.0231	9	0.87932	D	0	.	12.583	0.56401	0.0:0.0:0.0:1.0	.	2200	E7EUV1	.	G	2200;338	ENSP00000415183:V2200G;ENSP00000354885:V338G	ENSP00000354885:V338G	V	+	2	0	MUC2	1087183	1.000000	0.71417	0.986000	0.45419	0.327000	0.28475	4.611000	0.61162	1.555000	0.49500	0.459000	0.35465	GTG	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	Missense_Mutation
API5	8539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	43342441	43342441	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:43342441T>C	ENST00000531273.1	+	3	441	c.302T>C	c.(301-303)aTa>aCa	p.I101T	API5_ENST00000378852.3_Missense_Mutation_p.I101T|API5_ENST00000455725.2_Missense_Mutation_p.I90T|API5_ENST00000420461.2_Missense_Mutation_p.I47T|API5_ENST00000534695.1_Intron|API5_ENST00000534600.1_Missense_Mutation_p.I101T			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	101	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						GTGGCAGATATACTAACGCAA	0.343																																					p.I101T	Pancreas(1;98 122 5625 20895 49453)	.											.	API5-136	0			c.T302C						.						83.0	85.0	84.0					11																	43342441		2203	4300	6503	SO:0001583	missense	8539	exon3			CAGATATACTAAC	U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.302T>C	11.37:g.43342441T>C	ENSP00000431391:p.Ile101Thr	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	93	42	NM_006595	0	0	20	34	14	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Missense_Mutation	SNP	ENST00000531273.1	37	CCDS44572.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.975544	0.74360	.	.	ENSG00000166181	ENST00000455725;ENST00000531273;ENST00000420461;ENST00000378852;ENST00000534600	T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05	6.13	6.13	0.99165	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.36220	0.0959	L	0.45422	1.42	0.58432	D	0.999999	P;P;D;P	0.61697	0.951;0.92;0.99;0.952	P;P;P;P	0.61722	0.675;0.551;0.893;0.6	T	0.01570	-1.1322	10	0.34782	T	0.22	-2.8866	16.4795	0.84153	0.0:0.0:0.0:1.0	.	47;101;90;101	B4DGR0;Q9BZZ5;B4E283;Q9BZZ5-2	.;API5_HUMAN;.;.	T	90;101;47;101;101	ENSP00000399341:I90T;ENSP00000431391:I101T;ENSP00000402540:I47T;ENSP00000368129:I101T;ENSP00000434462:I101T	ENSP00000368129:I101T	I	+	2	0	API5	43299017	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	7.981000	0.88123	2.367000	0.80283	0.529000	0.55759	ATA	.		0.343	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595	
OR8I2	120586	hgsc.bcm.edu;broad.mit.edu	37	11	55861616	55861616	+	Missense_Mutation	SNP	C	C	T	rs140206966	byFrequency	TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:55861616C>T	ENST00000302124.2	+	1	864	c.833C>T	c.(832-834)aCg>aTg	p.T278M		NM_001003750.1	NP_001003750.1	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I, member 2	278						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T278M(1)		NS(1)|breast(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(24)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	53	Esophageal squamous(21;0.00693)					GTATTCTATACGATTGTCATT	0.408																																					p.T278M		.											.	OR8I2-113	1	Substitution - Missense(1)	endometrium(1)	c.C833T						.						62.0	61.0	62.0					11																	55861616		2201	4296	6497	SO:0001583	missense	120586	exon1			TCTATACGATTGT	AB065656	CCDS31517.1	11q11	2012-08-09			ENSG00000172154	ENSG00000172154		"""GPCR / Class A : Olfactory receptors"""	15310	protein-coding gene	gene with protein product							Standard	NM_001003750		Approved		uc010rix.2	Q8N0Y5	OTTHUMG00000166831	ENST00000302124.2:c.833C>T	11.37:g.55861616C>T	ENSP00000303864:p.Thr278Met	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	96	8	NM_001003750	0	0	0	0	0	B2RNN4|Q6IFC0|Q96RC5	Missense_Mutation	SNP	ENST00000302124.2	37	CCDS31517.1	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876897	0.33162	.	.	ENSG00000172154	ENST00000302124	T	0.00262	8.4	4.33	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41605	U	0.000856	T	0.00608	0.0020	M	0.83118	2.625	0.32279	N	0.567785	D	0.89917	1.0	D	0.70935	0.971	T	0.50988	-0.8762	10	0.87932	D	0	-16.3432	15.8041	0.78481	0.0:1.0:0.0:0.0	.	278	Q8N0Y5	OR8I2_HUMAN	M	278	ENSP00000303864:T278M	ENSP00000303864:T278M	T	+	2	0	OR8I2	55618192	0.000000	0.05858	0.985000	0.45067	0.054000	0.15201	0.638000	0.24674	2.120000	0.65058	0.447000	0.29281	ACG	C|0.999;A|0.001		0.408	OR8I2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001003750	
HNRNPUL2	221092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	62488862	62488862	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:62488862T>C	ENST00000301785.5	-	9	1708	c.1516A>G	c.(1516-1518)Aaa>Gaa	p.K506E	HNRNPUL2-BSCL2_ENST00000403734.2_Missense_Mutation_p.K506E	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	506						membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TCTCGGCTTTTGGGGTCCATC	0.428																																					p.K506E		.											.	HNRNPUL2-22	0			c.A1516G						.						153.0	158.0	157.0					11																	62488862		1846	4094	5940	SO:0001583	missense	221092	exon9			GGCTTTTGGGGTC		CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.1516A>G	11.37:g.62488862T>C	ENSP00000301785:p.Lys506Glu	Somatic	180	0		WXS	Illumina HiSeq	Phase_I	214	87	NM_001079559	0	0	91	154	63	Q8N3B3	Missense_Mutation	SNP	ENST00000301785.5	37	CCDS41659.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.709456	0.68730	.	.	ENSG00000214753	ENST00000301785	T	0.40756	1.02	5.99	5.99	0.97316	Zeta toxin domain (1);	0.158288	0.64402	D	0.000020	T	0.40719	0.1128	N	0.25286	0.73	0.35130	D	0.767875	P	0.51791	0.948	P	0.51866	0.682	T	0.49934	-0.8886	10	0.30854	T	0.27	-16.7044	14.4463	0.67352	0.0:0.0:0.0:1.0	.	506	Q1KMD3	HNRL2_HUMAN	E	506	ENSP00000301785:K506E	ENSP00000301785:K506E	K	-	1	0	HNRNPUL2	62245438	0.897000	0.30589	1.000000	0.80357	0.995000	0.86356	1.144000	0.31565	2.291000	0.77112	0.533000	0.62120	AAA	.		0.428	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396208.2	XM_495877	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	82877727	82877727	+	Silent	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:82877727A>G	ENST00000298281.4	+	5	2240	c.1788A>G	c.(1786-1788)agA>agG	p.R596R		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	596					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CTGCCAAAAGATGGAAATCTG	0.343																																					p.R596R		.											.	PCF11-23	0			c.A1788G						.						74.0	75.0	75.0					11																	82877727		1755	3854	5609	SO:0001819	synonymous_variant	51585	exon5			CAAAAGATGGAAA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1788A>G	11.37:g.82877727A>G		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	135	65	NM_015885	0	0	21	34	13	A6H8W7|O43671|Q6P0X8	Silent	SNP	ENST00000298281.4	37	CCDS44689.1																																																																																			.		0.343	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
MAML2	84441	hgsc.bcm.edu	37	11	95825424	95825424	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:95825424G>T	ENST00000524717.1	-	2	3055	c.1771C>A	c.(1771-1773)Cag>Aag	p.Q591K		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	591					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				tgttgctgctgttgctgTTGG	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q591K		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.C1771A						.						53.0	58.0	56.0					11																	95825424		2172	4257	6429	SO:0001583	missense	84441	exon2			GCTGCTGTTGCTG	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1771C>A	11.37:g.95825424G>T	ENSP00000434552:p.Gln591Lys	Somatic	4	1		WXS	Illumina HiSeq	Phase_I	10	4	NM_032427	0	0	31	31	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	ENST00000524717.1	37	CCDS44714.1	.	.	.	.	.	.	.	.	.	.	G	6.985	0.551899	0.13374	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.75154	-0.91;-0.91	4.16	4.16	0.48862	.	0.641420	0.14538	N	0.313463	T	0.65719	0.2718	L	0.48642	1.525	0.36744	D	0.882387	B	0.23316	0.083	B	0.18871	0.023	T	0.62695	-0.6800	10	0.09084	T	0.74	-0.3554	14.8068	0.69962	0.0:0.0:1.0:0.0	.	591	Q8IZL2	MAML2_HUMAN	K	591	ENSP00000434552:Q591K;ENSP00000412394:Q591K	ENSP00000412394:Q591K	Q	-	1	0	MAML2	95465072	1.000000	0.71417	0.944000	0.38274	0.017000	0.09413	3.476000	0.53143	2.151000	0.67156	0.555000	0.69702	CAG	.		0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	113078684	113078684	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:113078684G>C	ENST00000533760.1	+	7	1121	c.522G>C	c.(520-522)aaG>aaC	p.K174N	NCAM1_ENST00000316851.7_Missense_Mutation_p.K282N|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Missense_Mutation_p.K291N	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	292	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CTGAGAACAAGGCTGGCGAGC	0.532																																					p.K292N		.											.	NCAM1-23	0			c.G876C						.						61.0	61.0	61.0					11																	113078684		2078	4216	6294	SO:0001583	missense	4684	exon8			GAACAAGGCTGGC		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.522G>C	11.37:g.113078684G>C	ENSP00000473281:p.Lys174Asn	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	20	6	NM_001242608	0	0	0	0	0	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	G	18.41	3.617792	0.66787	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.68181	-0.31;-0.31	5.57	3.47	0.39725	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.041493	0.85682	D	0.000000	T	0.78400	0.4277	.	.	.	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.997;0.995;0.994;0.983	D;D;D;D;D	0.71870	0.963;0.917;0.975;0.952;0.925	T	0.79697	-0.1695	9	0.87932	D	0	-16.9107	8.6894	0.34258	0.2821:0.0:0.7179:0.0	.	292;292;292;292;292	P13591-5;P13591-1;P13591;P13591-3;P13591-6	.;.;NCAM1_HUMAN;.;.	N	174;291;282	ENSP00000384055:K291N;ENSP00000318472:K282N	ENSP00000318472:K282N	K	+	3	2	NCAM1	112583894	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	3.113000	0.50376	1.347000	0.45714	0.655000	0.94253	AAG	.		0.532	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
C3AR1	719	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	8211578	8211578	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr12:8211578G>A	ENST00000307637.4	-	2	1407	c.1204C>T	c.(1204-1206)Ctt>Ttt	p.L402F		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	402					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		GGGTCAGTAAGCAATGACAGG	0.483																																					p.L402F		.											.	C3AR1-227	0			c.C1204T						.						73.0	68.0	70.0					12																	8211578		2203	4300	6503	SO:0001583	missense	719	exon2			CAGTAAGCAATGA	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.1204C>T	12.37:g.8211578G>A	ENSP00000302079:p.Leu402Phe	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	67	8	NM_004054	0	0	16	16	0	O43771|Q92868	Missense_Mutation	SNP	ENST00000307637.4	37	CCDS8588.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.321727	0.01320	.	.	ENSG00000171860	ENST00000307637	T	0.37235	1.21	5.26	0.103	0.14526	GPCR, rhodopsin-like superfamily (1);	1.231120	0.05729	N	0.599303	T	0.12518	0.0304	N	0.01800	-0.715	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23332	-1.0191	10	0.15499	T	0.54	.	3.1161	0.06375	0.4472:0.0:0.2539:0.2989	.	402	Q16581	C3AR_HUMAN	F	402	ENSP00000302079:L402F	ENSP00000302079:L402F	L	-	1	0	C3AR1	8102845	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.859000	0.04277	0.118000	0.18165	-0.238000	0.12139	CTT	.		0.483	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400254.1		
KLRC1	3821	hgsc.bcm.edu	37	12	10602537	10602537	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr12:10602537A>G	ENST00000359151.3	-	4	494	c.313T>C	c.(313-315)Tcc>Ccc	p.S105P	KLRC1_ENST00000544822.1_Missense_Mutation_p.S105P|KLRC1_ENST00000536188.1_Missense_Mutation_p.S105P|KLRC1_ENST00000347831.5_Intron|KLRC1_ENST00000408006.3_Intron	NM_002259.4	NP_002250	P26715	NKG2A_HUMAN	killer cell lectin-like receptor subfamily C, member 1	105					cell surface receptor signaling pathway (GO:0007166)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16						GTATTCAGGGAAGAATTGTTG	0.224																																					p.S105P		.											.	KLRC1-514	0			c.T313C						.						14.0	15.0	15.0					12																	10602537		2104	4159	6263	SO:0001583	missense	3821	exon4			TCAGGGAAGAATT	U54782	CCDS8625.1, CCDS8626.1	12p13	2010-06-30			ENSG00000134545	ENSG00000134545		"""Killer cell lectin-like receptors"", ""CD molecules"""	6374	protein-coding gene	gene with protein product	"""NKG2-1/B activating NK receptor"""	161555		NKG2		9598306	Standard	NM_002259		Approved	NKG2-A, NKG2-B, CD159a	uc001qyl.3	P26715		ENST00000359151.3:c.313T>C	12.37:g.10602537A>G	ENSP00000352064:p.Ser105Pro	Somatic	4	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_002259	0	0	1	1	0		Missense_Mutation	SNP	ENST00000359151.3	37	CCDS8625.1	.	.	.	.	.	.	.	.	.	.	A	8.768	0.925219	0.18056	.	.	ENSG00000134545	ENST00000536188;ENST00000359151;ENST00000544822	T;T;T	0.09630	2.96;2.96;2.96	2.63	2.63	0.31362	C-type lectin fold (1);	0.831025	0.10137	N	0.711294	T	0.33323	0.0859	M	0.91090	3.175	0.09310	N	1	D	0.63046	0.992	D	0.63381	0.914	T	0.14811	-1.0459	10	0.27082	T	0.32	.	7.1333	0.25515	1.0:0.0:0.0:0.0	.	105	P26715	NKG2A_HUMAN	P	105	ENSP00000441432:S105P;ENSP00000352064:S105P;ENSP00000438038:S105P	ENSP00000352064:S105P	S	-	1	0	KLRC1	10493804	0.002000	0.14202	0.009000	0.14445	0.043000	0.13939	1.323000	0.33701	1.461000	0.47929	0.383000	0.25322	TCC	.		0.224	KLRC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400115.1	NM_002259	
ESPL1	9700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	53687232	53687232	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr12:53687232T>C	ENST00000257934.4	+	31	6428	c.6337T>C	c.(6337-6339)Tat>Cat	p.Y2113H	PFDN5_ENST00000551018.1_5'Flank|PFDN5_ENST00000351500.3_5'Flank|ESPL1_ENST00000552462.1_Missense_Mutation_p.Y2113H|PFDN5_ENST00000334478.4_5'Flank|PFDN5_ENST00000550846.1_5'Flank	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	2113					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						ACCTATAGCCTATGGCTTGCC	0.527																																					p.Y2113H	Colon(53;1069 1201 2587 5382)	.											.	ESPL1-228	0			c.T6337C						.						64.0	65.0	65.0					12																	53687232		2203	4300	6503	SO:0001583	missense	9700	exon31			ATAGCCTATGGCT	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.6337T>C	12.37:g.53687232T>C	ENSP00000257934:p.Tyr2113His	Somatic	133	0		WXS	Illumina HiSeq	Phase_I	97	45	NM_012291	0	0	1	2	1		Missense_Mutation	SNP	ENST00000257934.4	37	CCDS8852.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.234561	0.79800	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.56444	0.46;0.46	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.76702	0.4024	M	0.90198	3.095	0.53688	D	0.999976	D	0.89917	1.0	D	0.87578	0.998	T	0.82204	-0.0573	10	0.87932	D	0	.	13.8969	0.63778	0.0:0.0:0.0:1.0	.	2113	Q14674	ESPL1_HUMAN	H	2113;1788;2113	ENSP00000257934:Y2113H;ENSP00000449831:Y2113H	ENSP00000257934:Y2113H	Y	+	1	0	ESPL1	51973499	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.612000	0.82975	2.178000	0.69098	0.460000	0.39030	TAT	.		0.527	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
ALDH2	217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	112227694	112227694	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr12:112227694T>C	ENST00000261733.2	+	5	569	c.508T>C	c.(508-510)Tac>Cac	p.Y170H	RP11-162P23.2_ENST00000546840.2_Silent_p.A166A|ALDH2_ENST00000416293.3_Missense_Mutation_p.Y123H	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	170					alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	CTTCTTCAGCTACACACGCCA	0.527			T	HMGA2	leiomyoma																																p.Y170H		.		Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	.	ALDH2-228	0			c.T508C						.						100.0	87.0	91.0					12																	112227694		2203	4300	6503	SO:0001583	missense	217	exon5			TTCAGCTACACAC	M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	ENST00000261733.2:c.508T>C	12.37:g.112227694T>C	ENSP00000261733:p.Tyr170His	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	61	21	NM_000690	0	0	152	262	110	B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Missense_Mutation	SNP	ENST00000261733.2	37	CCDS9155.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.792458	0.90453	.	.	ENSG00000257767;ENSG00000111275;ENSG00000111275;ENSG00000111275;ENSG00000111275	ENST00000546840;ENST00000416293;ENST00000261733;ENST00000553044;ENST00000552234	T;T	0.77620	-1.11;-1.11	5.17	5.17	0.71159	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.172373	0.53938	D	0.000059	D	0.89612	0.6765	M	0.88105	2.93	0.53688	D	0.999979	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.987;0.997;0.998	D	0.91609	0.5301	10	0.72032	D	0.01	.	15.3139	0.74059	0.0:0.0:0.0:1.0	.	123;170;170	E7EUE5;F8VXI5;P05091	.;.;ALDH2_HUMAN	H	151;123;170;170;30	ENSP00000403349:Y123H;ENSP00000261733:Y170H	ENSP00000261733:Y170H	Y	+	1	0	ALDH2;RP11-162P23.2	110712077	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.655000	0.83696	2.071000	0.62044	0.460000	0.39030	TAC	.		0.527	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405008.1	NM_000690	
HNF1A	6927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	121437158	121437158	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr12:121437158T>C	ENST00000257555.6	+	8	1815	c.1589T>C	c.(1588-1590)cTg>cCg	p.L530P	HNF1A_ENST00000544413.1_Missense_Mutation_p.L530P|HNF1A_ENST00000541395.1_Missense_Mutation_p.L530P|RP11-216P16.2_ENST00000606238.1_RNA			P20823	HNF1A_HUMAN	HNF1 homeobox A	530					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACCACCAACCTGAGCGCCCTG	0.687									Hepatic Adenoma, Familial Clustering of																												p.L530P		.											.	HNF1A-1745	0			c.T1589C						.						83.0	85.0	84.0					12																	121437158		2203	4300	6503	SO:0001583	missense	6927	exon8	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	CCAACCTGAGCGC	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.1589T>C	12.37:g.121437158T>C	ENSP00000257555:p.Leu530Pro	Somatic	399	0		WXS	Illumina HiSeq	Phase_I	116	54	NM_000545	0	0	12	19	7	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.760491	0.89932	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000537424;ENST00000543027;ENST00000541395;ENST00000544413	D;D;D	0.98617	-5.03;-5.03;-5.03	5.52	5.52	0.82312	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.000000	0.48286	D	0.000189	D	0.98658	0.9550	L	0.52573	1.65	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.993;0.996	D	0.99890	1.1133	10	0.72032	D	0.01	-15.5351	14.8565	0.70341	0.0:0.0:0.0:1.0	.	530;530	F5H0K0;P20823	.;HNF1A_HUMAN	P	530;422;530;351;530;530	ENSP00000257555:L530P;ENSP00000443112:L530P;ENSP00000438804:L530P	ENSP00000257555:L530P	L	+	2	0	HNF1A	119921541	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.616000	0.83018	2.104000	0.64026	0.528000	0.53228	CTG	.		0.687	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
SKA3	221150	hgsc.bcm.edu	37	13	21735928	21735928	+	Splice_Site	SNP	C	C	T	rs202104082		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr13:21735928C>T	ENST00000314759.5	-	5	954		c.e5+1		SKA3_ENST00000400018.3_Splice_Site	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3						chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)				breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						CTTATACTTACCACTTTTTTC	0.368																																					.		.											.	SKA3-90	0			c.829+1G>A						.						134.0	135.0	134.0					13																	21735928		2203	4300	6503	SO:0001630	splice_region_variant	221150	exon6			TACTTACCACTTT	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.829+1G>A	13.37:g.21735928C>T		Somatic	30	1		WXS	Illumina HiSeq	Phase_I	45	4	NM_001166017	0	0	0	0	0	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Splice_Site	SNP	ENST00000314759.5	37	CCDS31946.1	.	.	.	.	.	.	.	.	.	.	C	9.964	1.223604	0.22457	.	.	ENSG00000165480	ENST00000314759;ENST00000400018	.	.	.	4.65	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3533	0.38151	0.0:0.8976:0.0:0.1024	.	.	.	.	.	-1	.	.	.	-	.	.	SKA3	20633928	0.999000	0.42202	0.091000	0.20842	0.007000	0.05969	3.166000	0.50785	1.280000	0.44463	-0.229000	0.12294	.	.		0.368	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061	Intron
BRCA2	675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	32907353	32907353	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr13:32907353A>C	ENST00000380152.3	+	10	1971	c.1738A>C	c.(1738-1740)Ata>Cta	p.I580L	BRCA2_ENST00000544455.1_Missense_Mutation_p.I580L			P51587	BRCA2_HUMAN	breast cancer 2, early onset	580					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGCAGGTTTAATATCCACTTT	0.338			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.I580L	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2-3153	0			c.A1738C						.						44.0	49.0	47.0					13																	32907353		2203	4300	6503	SO:0001583	missense	675	exon10	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	GGTTTAATATCCA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.1738A>C	13.37:g.32907353A>C	ENSP00000369497:p.Ile580Leu	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	93	49	NM_000059	0	0	0	0	0	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	37	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	A	14.91	2.677622	0.47886	.	.	ENSG00000139618	ENST00000380152;ENST00000544455;ENST00000530893	T;T	0.00776	5.71;5.71	5.5	4.32	0.51571	.	0.150989	0.47093	D	0.000244	T	0.00906	0.0030	M	0.70275	2.135	0.25438	N	0.988123	P;B	0.39748	0.686;0.402	B;B	0.32211	0.088;0.142	T	0.45190	-0.9278	10	0.15952	T	0.53	.	5.4332	0.16464	0.7537:0.0:0.0834:0.1629	.	580;580	P51587;A1YBP1	BRCA2_HUMAN;.	L	580;580;578	ENSP00000369497:I580L;ENSP00000439902:I580L	ENSP00000369497:I580L	I	+	1	0	BRCA2	31805353	0.997000	0.39634	0.995000	0.50966	0.698000	0.40448	0.972000	0.29409	1.016000	0.39470	0.528000	0.53228	ATA	.		0.338	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
ESD	2098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	47354151	47354151	+	Silent	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr13:47354151A>G	ENST00000378720.3	-	8	701	c.519T>C	c.(517-519)gcT>gcC	p.A173A	ESD_ENST00000495654.1_5'UTR|ESD_ENST00000378697.1_Silent_p.A144A	NM_001984.1	NP_001975.1	P10768	ESTD_HUMAN	esterase D	173					formaldehyde catabolic process (GO:0046294)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carboxylic ester hydrolase activity (GO:0052689)|hydrolase activity, acting on ester bonds (GO:0016788)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)|S-formylglutathione hydrolase activity (GO:0018738)			endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	9		all_lung(13;3.54e-08)|Lung NSC(96;9.1e-06)|Breast(56;0.000148)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)		GBM - Glioblastoma multiforme(144;2.66e-05)	Glutathione(DB00143)	TGCAAATTGGAGCAAATGCTG	0.333																																					p.A173A		.											.	ESD-91	0			c.T519C						.						91.0	91.0	91.0					13																	47354151		2203	4299	6502	SO:0001819	synonymous_variant	2098	exon8			AATTGGAGCAAAT	M13450	CCDS9404.1	13q14.1-q14.2	2014-05-13	2010-05-07		ENSG00000139684	ENSG00000139684	3.1.2.12		3465	protein-coding gene	gene with protein product	"""S-formylglutathione hydrolase"""	133280	"""esterase D/formylglutathione hydrolase"""				Standard	NM_001984		Approved		uc001vbn.3	P10768	OTTHUMG00000016878	ENST00000378720.3:c.519T>C	13.37:g.47354151A>G		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	101	42	NM_001984	0	0	86	181	95	Q5TBU8|Q5TBV0|Q5TBV2|Q9BVJ2	Silent	SNP	ENST00000378720.3	37	CCDS9404.1	.	.	.	.	.	.	.	.	.	.	A	9.962	1.223120	0.22457	.	.	ENSG00000139684	ENST00000412582	.	.	.	6.16	3.7	0.42460	.	.	.	.	.	T	0.57140	0.2033	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50717	-0.8795	4	.	.	.	-8.9614	7.2303	0.26038	0.6488:0.2815:0.0697:0.0	.	.	.	.	P	121	.	.	L	-	2	0	ESD	46252152	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.509000	0.35780	0.536000	0.28733	-0.299000	0.09455	CTC	.		0.333	ESD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044826.1		
OR11G2	390439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20666034	20666034	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:20666034C>T	ENST00000357366.3	+	1	540	c.540C>T	c.(538-540)acC>acT	p.T180T		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		GTCTCTGTACCAATCTTGTGG	0.448																																					p.T180T		.											.	OR11G2-70	0			c.C540T						.						111.0	94.0	100.0					14																	20666034		2203	4300	6503	SO:0001819	synonymous_variant	390439	exon1			CTGTACCAATCTT		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.540C>T	14.37:g.20666034C>T		Somatic	63	0		WXS	Illumina HiSeq	Phase_I	112	39	NM_001005503	0	0	0	0	0	Q6IF09|Q96R33	Silent	SNP	ENST00000357366.3	37	CCDS32032.1																																																																																			.		0.448	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1		
SLC22A17	51310	hgsc.bcm.edu	37	14	23816377	23816377	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:23816377A>G	ENST00000206544.8	-	8	1597	c.1261T>C	c.(1261-1263)Ttc>Ctc	p.F421L	SLC22A17_ENST00000397260.3_Missense_Mutation_p.F292L|SLC22A17_ENST00000354772.3_Missense_Mutation_p.F403L|SLC22A17_ENST00000397267.1_Missense_Mutation_p.F421L|SLC22A17_ENST00000474057.1_5'UTR	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	421					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TGGGAGGAGAAGAGCCCAAGG	0.612																																					p.F421L		.											.	SLC22A17-226	0			c.T1261C						.						81.0	59.0	66.0					14																	23816377		2203	4300	6503	SO:0001583	missense	51310	exon8			AGGAGAAGAGCCC	AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.1261T>C	14.37:g.23816377A>G	ENSP00000206544:p.Phe421Leu	Somatic	64	0		WXS	Illumina HiSeq	Phase_I	31	2	NM_020372	0	0	40	40	0	A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Missense_Mutation	SNP	ENST00000206544.8	37	CCDS9593.1	.	.	.	.	.	.	.	.	.	.	A	12.93	2.086485	0.36855	.	.	ENSG00000092096	ENST00000354772;ENST00000397260;ENST00000206544;ENST00000397267	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.36	5.36	0.76844	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.39145	0.1067	N	0.21324	0.655	0.53688	D	0.999976	B;P	0.36909	0.114;0.573	B;B	0.36534	0.057;0.227	T	0.36939	-0.9727	10	0.02654	T	1	-21.8141	13.1705	0.59595	1.0:0.0:0.0:0.0	.	403;421	Q8WUG5-2;Q8WUG5	.;S22AH_HUMAN	L	403;292;421;421	ENSP00000346824:F403L;ENSP00000380430:F292L;ENSP00000206544:F421L;ENSP00000380437:F421L	ENSP00000206544:F421L	F	-	1	0	SLC22A17	22886217	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.295000	0.43576	2.163000	0.67991	0.460000	0.39030	TTC	.		0.612	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157223.3	NM_020372	
C14orf37	145407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	58563683	58563683	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:58563683C>G	ENST00000267485.7	-	5	2042	c.1848G>C	c.(1846-1848)gaG>gaC	p.E616D		NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	616	Glu-rich.					integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						cctcttcatcctcatcttctt	0.398																																					p.E616D		.											.	C14orf37-90	0			c.G1848C						.						195.0	145.0	162.0					14																	58563683		2203	4300	6503	SO:0001583	missense	145407	exon5			TTCATCCTCATCT		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.1848G>C	14.37:g.58563683C>G	ENSP00000267485:p.Glu616Asp	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	55	27	NM_001001872	0	0	0	2	2	A8K8Z8|Q6P5Q1|Q86TY1	Missense_Mutation	SNP	ENST00000267485.7	37	CCDS32089.1	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093373	0.36952	.	.	ENSG00000139971	ENST00000267485;ENST00000438670	T	0.11063	2.81	4.97	-3.62	0.04543	Armadillo-like helical (1);	0.466239	0.19773	N	0.106394	T	0.07143	0.0181	L	0.38531	1.155	0.30330	N	0.786721	B;B;B	0.24576	0.106;0.106;0.106	B;B;B	0.26770	0.073;0.073;0.073	T	0.12016	-1.0564	10	0.87932	D	0	-0.7422	5.8628	0.18759	0.0:0.3161:0.242:0.4419	.	654;616;616	B4DMS4;A8K990;Q86TY3	.;.;CN037_HUMAN	D	616;654	ENSP00000267485:E616D	ENSP00000267485:E616D	E	-	3	2	C14orf37	57633436	0.186000	0.23225	0.976000	0.42696	0.636000	0.38137	-1.104000	0.03326	-0.558000	0.06118	0.561000	0.74099	GAG	.		0.398	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	64596614	64596614	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:64596614T>A	ENST00000344113.4	+	75	14346	c.14134T>A	c.(14134-14136)Tta>Ata	p.L4712I	ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.L1097I|SYNE2_ENST00000394768.2_Missense_Mutation_p.L1097I|SYNE2_ENST00000554584.1_Missense_Mutation_p.L4629I|SYNE2_ENST00000555002.1_Missense_Mutation_p.L1346I|SYNE2_ENST00000358025.3_Missense_Mutation_p.L4712I	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4712					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGTTTACAAATTAGAGGTATG	0.458																																					p.L4712I		.											.	SYNE2-164	0			c.T14134A						.						113.0	112.0	112.0					14																	64596614		2203	4300	6503	SO:0001583	missense	23224	exon75			TACAAATTAGAGG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14134T>A	14.37:g.64596614T>A	ENSP00000341781:p.Leu4712Ile	Somatic	54	0		WXS	Illumina HiSeq	Phase_I	59	29	NM_182914	0	0	0	0	0	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481904	0.26598	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.71934	1.34;1.34;1.34;-0.61;1.34;1.34	5.23	1.55	0.23275	.	0.000000	0.40144	N	0.001175	T	0.76300	0.3968	M	0.72894	2.215	0.80722	D	1	D;D;D	0.69078	0.997;0.987;0.995	D;P;D	0.67231	0.95;0.841;0.926	T	0.70197	-0.4938	10	0.27785	T	0.31	.	5.4414	0.16511	0.0:0.2145:0.1349:0.6506	.	1097;4712;4712	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	I	4712;1097;4712;4629;4629;1346;1097	ENSP00000350719:L4712I;ENSP00000349969:L1097I;ENSP00000341781:L4712I;ENSP00000452570:L4629I;ENSP00000450831:L1346I;ENSP00000378249:L1097I	ENSP00000261678:L4629I	L	+	1	2	SYNE2	63666367	1.000000	0.71417	0.996000	0.52242	0.717000	0.41224	0.934000	0.28910	0.084000	0.17077	-0.274000	0.10170	TTA	.		0.458	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TTC8	123016	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	89307438	89307438	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:89307438T>A	ENST00000345383.5	+	4	441	c.357T>A	c.(355-357)agT>agA	p.S119R	TTC8_ENST00000358622.5_5'Flank|Y_RNA_ENST00000384612.1_RNA|TTC8_ENST00000346301.4_Missense_Mutation_p.S119R|TTC8_ENST00000380656.2_Missense_Mutation_p.S129R|TTC8_ENST00000536576.1_5'UTR|TTC8_ENST00000338104.6_Missense_Mutation_p.S119R|TTC8_ENST00000354441.6_Intron	NM_198309.2	NP_938051.1	Q8TAM2	TTC8_HUMAN	tetratricopeptide repeat domain 8	129					axon guidance (GO:0007411)|camera-type eye photoreceptor cell differentiation (GO:0060219)|cilium assembly (GO:0042384)|establishment of anatomical structure orientation (GO:0048560)|fat cell differentiation (GO:0045444)|multicellular organism growth (GO:0035264)|nonmotile primary cilium assembly (GO:0035058)|olfactory bulb development (GO:0021772)|protein transport (GO:0015031)|regulation of protein localization (GO:0032880)|renal tubule development (GO:0061326)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)	BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						GCACGCAGAGTGGAAGGCCAG	0.498																																					p.S129R		.											.	TTC8-90	0			c.T387A						.						67.0	75.0	72.0					14																	89307438		2203	4300	6503	SO:0001583	missense	123016	exon5			GCAGAGTGGAAGG	AK093891	CCDS9885.1, CCDS9886.1, CCDS32137.1, CCDS73674.1, CCDS73675.1	14q31.3	2013-02-14				ENSG00000165533		"""Tetratricopeptide (TTC) repeat domain containing"""	20087	protein-coding gene	gene with protein product		608132				14520415, 20451172	Standard	NM_144596		Approved	BBS8, RP51	uc001xxi.3	Q8TAM2		ENST00000345383.5:c.357T>A	14.37:g.89307438T>A	ENSP00000339486:p.Ser119Arg	Somatic	114	0		WXS	Illumina HiSeq	Phase_I	127	52	NM_144596	0	0	3	7	4	A6NFG2|B3KWA5|Q67B97|Q86SY0|Q86TV9|Q86U26|Q8NDH9|Q96DG8	Missense_Mutation	SNP	ENST00000345383.5	37	CCDS9885.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.54|17.54|17.54	3.414274|3.414274|3.414274	0.62511|0.62511|0.62511	.|.|.	.|.|.	ENSG00000165533|ENSG00000165533|ENSG00000165533	ENST00000345383;ENST00000346301;ENST00000338104;ENST00000380656;ENST00000556651|ENST00000554686|ENST00000343648	T;T;T;T|.|.	0.80738|.|.	-1.3;-1.39;-1.41;-1.3|.|.	5.46|5.46|5.46	1.8|1.8|1.8	0.24995|0.24995|0.24995	.|.|.	0.153416|.|.	0.56097|.|.	D|.|.	0.000029|.|.	T|T|T	0.68613|0.68613|0.68613	0.3020|0.3020|0.3020	M|M|M	0.76574|0.76574|0.76574	2.34|2.34|2.34	0.80722|0.80722|0.80722	D|D|D	1|1|1	P;D;B;D;B|.|.	0.54601|.|.	0.808;0.967;0.012;0.967;0.012|.|.	B;P;B;P;B|.|.	0.51918|.|.	0.368;0.595;0.054;0.684;0.054|.|.	T|T|T	0.64045|0.64045|0.64045	-0.6499|-0.6499|-0.6499	10|5|5	0.66056|.|.	D|.|.	0.02|.|.	-16.3432|-16.3432|-16.3432	9.1746|9.1746|9.1746	0.37105|0.37105|0.37105	0.0:0.2088:0.0:0.7912|0.0:0.2088:0.0:0.7912|0.0:0.2088:0.0:0.7912	.|.|.	129;119;129;119;129|.|.	Q8TAM2;G3V2Z9;Q8TAM2-3;G3V324;Q8TAM2-4|.|.	TTC8_HUMAN;.;.;.;.|.|.	R|E|R	119;119;119;129;119|109|171	ENSP00000339486:S119R;ENSP00000298324:S119R;ENSP00000337653:S119R;ENSP00000370031:S129R|.|.	ENSP00000337653:S119R|.|.	S|V|W	+|+|+	3|2|1	2|0|0	TTC8|TTC8|TTC8	88377191|88377191|88377191	0.719000|0.719000|0.719000	0.27986|0.27986|0.27986	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.989000|0.989000|0.989000	0.77384|0.77384|0.77384	-0.225000|-0.225000|-0.225000	0.09151|0.09151|0.09151	0.065000|0.065000|0.065000	0.16485|0.16485|0.16485	0.460000|0.460000|0.460000	0.39030|0.39030|0.39030	AGT|GTG|TGG	.		0.498	TTC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410861.1	NM_144596	
CDC42BPB	9578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	103438368	103438368	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:103438368T>A	ENST00000361246.2	-	13	2060	c.1772A>T	c.(1771-1773)aAg>aTg	p.K591M		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CACCTTCTGCTTCTGGGCACG	0.617																																					p.K591M		.											.	CDC42BPB-581	0			c.A1772T						.						112.0	95.0	100.0					14																	103438368		2203	4300	6503	SO:0001583	missense	9578	exon13			TTCTGCTTCTGGG	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1772A>T	14.37:g.103438368T>A	ENSP00000355237:p.Lys591Met	Somatic	293	0		WXS	Illumina HiSeq	Phase_I	132	60	NM_006035	0	0	64	125	61		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.560047	0.86335	.	.	ENSG00000198752	ENST00000361246	D	0.82619	-1.63	5.31	4.15	0.48705	.	0.045881	0.85682	D	0.000000	D	0.90456	0.7011	M	0.84948	2.725	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.90167	0.4232	10	0.56958	D	0.05	.	10.9197	0.47156	0.0:0.0743:0.0:0.9257	.	591	Q9Y5S2	MRCKB_HUMAN	M	591	ENSP00000355237:K591M	ENSP00000355237:K591M	K	-	2	0	CDC42BPB	102508121	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.228000	0.72288	0.860000	0.35481	0.460000	0.39030	AAG	.		0.617	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
CEP170B	283638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105353612	105353612	+	Missense_Mutation	SNP	T	T	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:105353612T>G	ENST00000414716.3	+	12	3264	c.3036T>G	c.(3034-3036)caT>caG	p.H1012Q	CEP170B_ENST00000418279.1_Missense_Mutation_p.H942Q|CEP170B_ENST00000453495.1_Missense_Mutation_p.H1013Q|CEP170B_ENST00000556508.1_Missense_Mutation_p.H942Q	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1012						cytoplasm (GO:0005737)|microtubule (GO:0005874)											AGAGGCAGCATCACCCACTTG	0.687																																					p.H1012Q		.											.	.	0			c.T3036G						.						11.0	15.0	14.0					14																	105353612		2073	4183	6256	SO:0001583	missense	283638	exon12			GCAGCATCACCCA	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.3036T>G	14.37:g.105353612T>G	ENSP00000404151:p.His1012Gln	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	35	14	NM_001112726	0	0	5	23	18	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	T	4.535	0.099232	0.08681	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	3.85	-6.94	0.01633	.	1.152450	0.06494	N	0.735156	T	0.24736	0.0600	N	0.22421	0.69	0.09310	N	1	B;B;B	0.23735	0.002;0.09;0.01	B;B;B	0.16722	0.008;0.016;0.014	T	0.31971	-0.9924	10	0.59425	D	0.04	-0.1639	8.1321	0.31033	0.0:0.3657:0.4378:0.1965	.	1012;1012;942	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	Q	942;1012;1013;942	ENSP00000451249:H942Q;ENSP00000404151:H1012Q;ENSP00000407238:H1013Q;ENSP00000415006:H942Q	ENSP00000404151:H1012Q	H	+	3	2	KIAA0284	104424657	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-3.141000	0.00586	-1.631000	0.01543	-0.537000	0.04273	CAT	.		0.687	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
CATSPER2	117155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	43928412	43928412	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr15:43928412A>G	ENST00000321596.5	-	8	1047	c.848T>C	c.(847-849)cTc>cCc	p.L283P	CATSPER2_ENST00000355438.2_Missense_Mutation_p.L283P|CATSPER2_ENST00000354127.4_Missense_Mutation_p.L283P|CATSPER2_ENST00000381761.1_Missense_Mutation_p.L289P|CATSPER2_ENST00000396879.1_Missense_Mutation_p.L283P|RNU6-610P_ENST00000384264.1_RNA|STRC_ENST00000541030.1_Intron			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	283					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GGAATTCGGGAGGTCCCTAAA	0.413																																					p.L283P		.											.	CATSPER2-91	0			c.T848C						.						53.0	54.0	53.0					15																	43928412		2199	4296	6495	SO:0001583	missense	117155	exon8			TTCGGGAGGTCCC	AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.848T>C	15.37:g.43928412A>G	ENSP00000321463:p.Leu283Pro	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	73	28	NM_054020	0	0	0	0	0	Q8NHT9|Q96P54|Q96P55	Missense_Mutation	SNP	ENST00000321596.5	37	CCDS10099.1	.	.	.	.	.	.	.	.	.	.	A	5.296	0.239992	0.10023	.	.	ENSG00000166762	ENST00000396879;ENST00000299989;ENST00000381761;ENST00000321596;ENST00000354127;ENST00000355438	D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01	4.81	4.81	0.61882	Ion transport (1);	0.856615	0.09979	N	0.731205	D	0.97885	0.9305	M	0.82823	2.61	0.33841	D	0.631417	B;B	0.29481	0.206;0.245	B;B	0.35727	0.133;0.209	D	0.99974	1.2121	10	0.87932	D	0	.	10.6643	0.45721	1.0:0.0:0.0:0.0	.	289;283	F8W9H2;Q96P56	.;CTSR2_HUMAN	P	283;283;289;283;283;283	ENSP00000380088:L283P;ENSP00000371180:L289P;ENSP00000321463:L283P;ENSP00000339137:L283P;ENSP00000347613:L283P	ENSP00000299989:L283P	L	-	2	0	CATSPER2	41715704	0.211000	0.23529	0.127000	0.21898	0.013000	0.08279	3.770000	0.55310	2.013000	0.59113	0.533000	0.62120	CTC	.		0.413	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133151.2	NM_054020	
NEO1	4756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	73590713	73590713	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr15:73590713C>T	ENST00000339362.5	+	28	4373	c.3926C>T	c.(3925-3927)aCt>aTt	p.T1309I	NEO1_ENST00000560262.1_Missense_Mutation_p.T1256I|NEO1_ENST00000261908.6_Missense_Mutation_p.T1309I|NEO1_ENST00000558964.1_Missense_Mutation_p.T1298I			Q92859	NEO1_HUMAN	neogenin 1	1309					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						ACCCCCAGCACTGACACCATG	0.483																																					p.T1309I		.											.	NEO1-116	0			c.C3926T						.						81.0	76.0	78.0					15																	73590713		2198	4297	6495	SO:0001583	missense	4756	exon27			CCAGCACTGACAC	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.3926C>T	15.37:g.73590713C>T	ENSP00000341198:p.Thr1309Ile	Somatic	88	0		WXS	Illumina HiSeq	Phase_I	70	36	NM_002499	0	0	26	56	30	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	37	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.924141	0.73213	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T	0.42900	0.96	5.28	5.28	0.74379	Neogenin, C-terminal (1);	0.294982	0.37857	N	0.001913	T	0.32704	0.0838	N	0.14661	0.345	0.41912	D	0.990476	B;B;B;P	0.37594	0.408;0.408;0.372;0.601	B;B;B;B	0.42959	0.304;0.324;0.295;0.403	T	0.16247	-1.0409	10	0.36615	T	0.2	-15.6613	14.1931	0.65652	0.0:0.8505:0.1495:0.0	.	1256;1298;1020;1309	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	I	1256;1020;1309	ENSP00000261908:T1309I	ENSP00000261908:T1309I	T	+	2	0	NEO1	71377766	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.492000	0.66893	2.479000	0.83701	0.655000	0.94253	ACT	.		0.483	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
IREB2	3658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	78755356	78755356	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr15:78755356T>A	ENST00000258886.8	+	3	348	c.199T>A	c.(199-201)Tta>Ata	p.L67I	IREB2_ENST00000560440.1_Missense_Mutation_p.L67I	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	67					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TATGAACATTTTAGACTGGAA	0.378																																					p.L67I	NSCLC(200;764 2208 35157 49871 50830)	.											.	IREB2-90	0			c.T199A						.						214.0	201.0	205.0					15																	78755356		2196	4293	6489	SO:0001583	missense	3658	exon3			AACATTTTAGACT	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.199T>A	15.37:g.78755356T>A	ENSP00000258886:p.Leu67Ile	Somatic	107	0		WXS	Illumina HiSeq	Phase_I	183	75	NM_004136	0	0	5	8	3	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	37	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.018887	0.75275	.	.	ENSG00000136381	ENST00000258886	T	0.44881	0.91	5.87	3.57	0.40892	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 1/3 (1);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);	0.000000	0.85682	D	0.000000	T	0.53254	0.1785	L	0.52573	1.65	0.51482	D	0.999929	D;P	0.69078	0.997;0.577	D;P	0.91635	0.999;0.774	T	0.42616	-0.9441	10	0.23891	T	0.37	.	10.2319	0.43260	0.0:0.1334:0.0:0.8666	.	67;67	P48200;Q8WVK6	IREB2_HUMAN;.	I	67	ENSP00000258886:L67I	ENSP00000258886:L67I	L	+	1	2	IREB2	76542411	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.725000	0.25970	0.574000	0.29417	0.533000	0.62120	TTA	.		0.378	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
CEMIP	57214	hgsc.bcm.edu	37	15	81166242	81166242	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr15:81166242G>C	ENST00000394685.3	+	3	441	c.22G>C	c.(22-24)Gac>Cac	p.D8H	KIAA1199_ENST00000220244.3_Missense_Mutation_p.D8H|KIAA1199_ENST00000356249.5_Missense_Mutation_p.D8H			Q8WUJ3	CEMIP_HUMAN		8					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)	p.D8N(1)		breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TGGGAGGCAGGACTTCCTCTT	0.577																																					p.D8H		.											.	KIAA1199-93	1	Substitution - Missense(1)	kidney(1)	c.G22C						.						70.0	54.0	60.0					15																	81166242		2202	4298	6500	SO:0001583	missense	57214	exon2			AGGCAGGACTTCC																												ENST00000394685.3:c.22G>C	15.37:g.81166242G>C	ENSP00000378177:p.Asp8His	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	8	2	NM_018689	0	0	0	0	0	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	ENST00000394685.3	37	CCDS10315.1	.	.	.	.	.	.	.	.	.	.	G	8.342	0.828847	0.16749	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.66460	-0.21;-0.21;-0.21	4.92	-2.97	0.05530	.	6.948940	0.00166	N	0.000000	T	0.48537	0.1505	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17806	-1.0357	10	0.14656	T	0.56	-8.0685	5.165	0.15081	0.3585:0.2796:0.3619:0.0	.	8	Q8WUJ3	K1199_HUMAN	H	8	ENSP00000220244:D8H;ENSP00000378177:D8H;ENSP00000348583:D8H	ENSP00000220244:D8H	D	+	1	0	KIAA1199	78953297	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.356000	0.02609	-0.329000	0.08527	-0.165000	0.13383	GAC	.		0.577	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
ADAMTSL3	57188	hgsc.bcm.edu	37	15	84592741	84592741	+	Silent	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr15:84592741T>C	ENST00000286744.5	+	17	2297	c.2073T>C	c.(2071-2073)ccT>ccC	p.P691P	ADAMTSL3_ENST00000567476.1_Silent_p.P691P	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	691						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			TCCACCGTCCTCCAGCCATGA	0.542																																					p.P691P		.											.	ADAMTSL3-1153	0			c.T2073C						.						114.0	82.0	93.0					15																	84592741		2203	4300	6503	SO:0001819	synonymous_variant	57188	exon17			CCGTCCTCCAGCC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2073T>C	15.37:g.84592741T>C		Somatic	60	1		WXS	Illumina HiSeq	Phase_I	59	4	NM_207517	0	0	17	17	0	A1A566|A1A567|Q9ULI7	Silent	SNP	ENST00000286744.5	37	CCDS10326.1																																																																																			.		0.542	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
SCNN1B	6338	hgsc.bcm.edu	37	16	23366804	23366804	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:23366804A>G	ENST00000343070.2	+	4	946	c.770A>G	c.(769-771)aAc>aGc	p.N257S	SCNN1B_ENST00000568923.1_Missense_Mutation_p.N230S|SCNN1B_ENST00000307331.5_Missense_Mutation_p.N302S|SCNN1B_ENST00000568085.1_Missense_Mutation_p.N257S	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	257					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	GAGCCCTGCAACTACCGGTGA	0.617																																					p.N257S		.											.	SCNN1B-157	0			c.A770G						.						54.0	50.0	51.0					16																	23366804		2197	4300	6497	SO:0001583	missense	6338	exon4			CCTGCAACTACCG	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.770A>G	16.37:g.23366804A>G	ENSP00000345751:p.Asn257Ser	Somatic	135	1		WXS	Illumina HiSeq	Phase_I	56	3	NM_000336	0	0	0	0	0	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Missense_Mutation	SNP	ENST00000343070.2	37	CCDS10609.1	.	.	.	.	.	.	.	.	.	.	A	3.670	-0.067779	0.07228	.	.	ENSG00000168447	ENST00000343070;ENST00000307331	T;T	0.62105	0.05;0.05	5.15	-3.89	0.04193	.	0.496689	0.22488	N	0.059415	T	0.32224	0.0822	N	0.11789	0.175	0.20563	N	0.999889	B	0.06786	0.001	B	0.10450	0.005	T	0.27640	-1.0068	10	0.12103	T	0.63	-23.0248	7.6249	0.28206	0.603:0.1229:0.2741:0.0	.	257	P51168	SCNNB_HUMAN	S	257;302	ENSP00000345751:N257S;ENSP00000302874:N302S	ENSP00000302874:N302S	N	+	2	0	SCNN1B	23274305	0.021000	0.18746	0.394000	0.26270	0.652000	0.38707	-0.173000	0.09854	-0.587000	0.05890	-0.366000	0.07423	AAC	.		0.617	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
HS3ST4	9951	hgsc.bcm.edu	37	16	26147416	26147416	+	Silent	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:26147416G>A	ENST00000331351.5	+	2	1610	c.1218G>A	c.(1216-1218)ccG>ccA	p.P406P	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	406					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		GCAGTGCCCCGAGGTGCTTAG	0.463																																					p.P406P		.											.	HS3ST4-67	0			c.G1218A						.						52.0	48.0	49.0					16																	26147416		1568	3582	5150	SO:0001819	synonymous_variant	9951	exon2			TGCCCCGAGGTGC	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.1218G>A	16.37:g.26147416G>A		Somatic	29	0		WXS	Illumina HiSeq	Phase_I	32	2	NM_006040	0	0	0	0	0	Q5QI42|Q8NDC2	Silent	SNP	ENST00000331351.5	37	CCDS53995.1																																																																																			.		0.463	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040	
SEPHS2	22928	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	30456715	30456715	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:30456715A>G	ENST00000478753.2	-	1	787	c.334T>C	c.(334-336)Ttt>Ctt	p.F112L	SEPHS2_ENST00000500504.2_Missense_Mutation_p.F112L|SEPHS2_ENST00000542752.1_Missense_Mutation_p.F55L			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	112					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						AGGGCTGGAAAGGTGGGGCTG	0.711																																					.	Esophageal Squamous(81;1142 1261 11202 24614 35697)												.	SEPHS2-138	0			.						.						11.0	13.0	12.0					16																	30456715		1861	4083	5944	SO:0001583	missense	22928	.			CTGGAAAGGTGGG	BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.334T>C	16.37:g.30456715A>G	ENSP00000418669:p.Phe112Leu	Somatic	43	0		WXS	Illumina HiSeq	Phase_I	34	19	.	0	0	15	30	15	Q9BUQ2	Missense_Mutation	SNP	ENST00000478753.2	37		.	.	.	.	.	.	.	.	.	.	A	1.894	-0.454758	0.04540	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.40476	1.03;1.06;1.04	5.4	-0.181	0.13291	PurM, N-terminal-like (1);	1.421770	0.04168	N	0.324249	T	0.19927	0.0479	N	0.08118	0	0.09310	N	0.999996	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.15752	-1.0426	10	0.08381	T	0.77	0.0554	5.092	0.14713	0.5253:0.1521:0.3225:0.0	.	112;55	Q99611;F5H8F9	SPS2_HUMAN;.	L	112;55;63;112	ENSP00000418669:F112L;ENSP00000443601:F55L;ENSP00000426234:F112L	ENSP00000390233:F63L	F	-	1	0	SEPHS2	30364216	0.000000	0.05858	0.000000	0.03702	0.148000	0.21650	-0.584000	0.05800	0.073000	0.16731	-0.408000	0.06270	TTT	.		0.711	SEPHS2-001	KNOWN	basic|seleno	protein_coding	protein_coding	OTTHUMT00000109640.11	NM_012248	
SRCAP	10847	hgsc.bcm.edu;bcgsc.ca	37	16	30733505	30733505	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:30733505G>A	ENST00000262518.4	+	22	3989	c.3604G>A	c.(3604-3606)Ggg>Agg	p.G1202R	SRCAP_ENST00000395059.2_Missense_Mutation_p.G1202R|SRCAP_ENST00000344771.4_Missense_Mutation_p.G1106R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1202	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GGCTAATGCAGGGGGAAGCAA	0.572																																					p.G1202R		.											.	SRCAP-94	0			c.G3604A						.						129.0	107.0	114.0					16																	30733505		2197	4300	6497	SO:0001583	missense	10847	exon22			AATGCAGGGGGAA	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3604G>A	16.37:g.30733505G>A	ENSP00000262518:p.Gly1202Arg	Somatic	245	0		WXS	Illumina HiSeq	Phase_I	102	38	NM_006662	0	0	7	7	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	ENST00000262518.4	37	CCDS10689.2	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973443	0.53614	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.90900	-2.71;-2.68;-2.75	4.68	4.68	0.58851	.	0.000000	0.49305	D	0.000153	D	0.85961	0.5819	N	0.14661	0.345	0.20821	N	0.999846	P;D;P	0.53462	0.859;0.96;0.933	P;P;P	0.51229	0.572;0.663;0.462	T	0.78420	-0.2211	10	0.31617	T	0.26	-8.9406	12.9347	0.58307	0.0:0.1644:0.8356:0.0	.	1106;1202;1202	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	R	1202;1202;1106	ENSP00000262518:G1202R;ENSP00000378499:G1202R;ENSP00000343042:G1106R	ENSP00000262518:G1202R	G	+	1	0	SRCAP	30641006	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.941000	0.49011	2.414000	0.81942	0.462000	0.41574	GGG	.		0.572	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
CDH8	1006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	61851550	61851550	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:61851550C>T	ENST00000577390.1	-	7	2064	c.1110G>A	c.(1108-1110)ggG>ggA	p.G370G	CDH8_ENST00000584337.1_Silent_p.G370G|CDH8_ENST00000577730.1_Silent_p.G370G|CDH8_ENST00000299345.6_Silent_p.G370G	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	370	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CTTTAAAGGGCCCCCTGCCAC	0.468																																					p.G370G		.											.	CDH8-161	0			c.G1110A						.						86.0	68.0	74.0					16																	61851550		2203	4300	6503	SO:0001819	synonymous_variant	1006	exon7			AAAGGGCCCCCTG	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1110G>A	16.37:g.61851550C>T		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	90	44	NM_001796	0	0	0	0	0	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	37	CCDS10802.1																																																																																			.		0.468	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
NAE1	8883	hgsc.bcm.edu	37	16	66857505	66857505	+	Splice_Site	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:66857505T>C	ENST00000290810.3	-	5	347		c.e5-2		NAE1_ENST00000564040.2_Splice_Site|NAE1_ENST00000379463.2_Splice_Site|NAE1_ENST00000359087.4_Splice_Site|NAE1_ENST00000394074.2_Splice_Site			Q13564	ULA1_HUMAN	NEDD8 activating enzyme E1 subunit 1						mitotic DNA replication checkpoint (GO:0033314)|neuron apoptotic process (GO:0051402)|protein neddylation (GO:0045116)|regulation of apoptotic process (GO:0042981)|regulation of neuron apoptotic process (GO:0043523)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|protein heterodimerization activity (GO:0046982)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0914)|Epithelial(162;0.214)	Adenosine triphosphate(DB00171)	AGCTCGGTTCTTTTTAAAAAC	0.328																																					.		.											.	NAE1-69	0			c.250-2A>G						.						54.0	53.0	53.0					16																	66857505		2199	4298	6497	SO:0001630	splice_region_variant	8883	exon6			CGGTTCTTTTTAA	U50939	CCDS10820.1, CCDS42171.1, CCDS42172.1, CCDS67050.1	16q22	2013-09-26	2007-12-11	2007-12-11	ENSG00000159593	ENSG00000159593		"""Ubiquitin-like modifier activating enzymes"""	621	protein-coding gene	gene with protein product		603385	"""amyloid beta precursor protein binding protein 1, 59kDa"""	APPBP1		8626687, 12740388	Standard	XM_005256215		Approved	ula-1	uc002eqf.3	Q13564	OTTHUMG00000137513	ENST00000290810.3:c.250-2A>G	16.37:g.66857505T>C		Somatic	26	0		WXS	Illumina HiSeq	Phase_I	47	3	NM_003905	0	0	0	0	0	A6NCK0|A6NFN4|A8MU28|B2R700|B3KUP9	Splice_Site	SNP	ENST00000290810.3	37	CCDS10820.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.269067	0.59540	.	.	ENSG00000159593	ENST00000359087;ENST00000290810;ENST00000379463	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2991	0.73933	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NAE1	65415006	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.688000	0.74557	2.075000	0.62263	0.383000	0.25322	.	.		0.328	NAE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000268832.1	NM_003905	Intron
USP10	9100	hgsc.bcm.edu	37	16	84779219	84779219	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:84779219G>A	ENST00000219473.7	+	4	1245	c.1132G>A	c.(1132-1134)Gtt>Att	p.V378I	USP10_ENST00000570191.1_Missense_Mutation_p.V382I	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	378					autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						TGAAAAGCAGGTTGAAGTCAA	0.468																																					p.V382I		.											.	USP10-636	0			c.G1144A						.						17.0	17.0	17.0					16																	84779219		1844	4089	5933	SO:0001583	missense	9100	exon5			AAGCAGGTTGAAG	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1132G>A	16.37:g.84779219G>A	ENSP00000219473:p.Val378Ile	Somatic	34	1		WXS	Illumina HiSeq	Phase_I	30	4	NM_001272075	0	0	54	54	0	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	ENST00000219473.7	37	CCDS45537.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074841	0.36566	.	.	ENSG00000103194	ENST00000219473	T	0.08370	3.1	5.56	0.819	0.18785	.	1.566310	0.03694	N	0.247484	T	0.06280	0.0162	N	0.12182	0.205	0.32688	N	0.514625	B;B	0.06786	0.001;0.0	B;B	0.10450	0.005;0.002	T	0.33369	-0.9871	10	0.35671	T	0.21	-3.0685	8.9699	0.35899	0.3474:0.0:0.6526:0.0	.	382;378	Q14694-3;Q14694	.;UBP10_HUMAN	I	378	ENSP00000219473:V378I	ENSP00000219473:V378I	V	+	1	0	USP10	83336720	1.000000	0.71417	0.218000	0.23776	0.977000	0.68977	3.318000	0.51975	-0.067000	0.12976	-0.224000	0.12420	GTT	.		0.468	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433660.1		
CDT1	81620	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	88872437	88872437	+	Missense_Mutation	SNP	G	G	A	rs368718178		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:88872437G>A	ENST00000301019.4	+	6	1460	c.841G>A	c.(841-843)Gga>Aga	p.G281R		NM_030928.3	NP_112190.2			chromatin licensing and DNA replication factor 1											central_nervous_system(1)|endometrium(2)|kidney(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(80;0.0476)		AGAGGCTGACGGAGCAGCCCC	0.672																																					p.G281R	Melanoma(159;511 3380 30971)	.											.	CDT1-227	0			c.G841A						.	G	ARG/GLY	1,4361		0,1,2180	15.0	17.0	16.0		841	-3.5	0.0	16		16	0,8566		0,0,4283	no	missense	CDT1	NM_030928.3	125	0,1,6463	AA,AG,GG		0.0,0.0229,0.0077	possibly-damaging	281/547	88872437	1,12927	2181	4283	6464	SO:0001583	missense	81620	exon6			GCTGACGGAGCAG	AF070552	CCDS32510.1	16q24.3	2014-08-12			ENSG00000167513	ENSG00000167513			24576	protein-coding gene	gene with protein product		605525				11896191, 11555648	Standard	NM_030928		Approved	DUP, RIS2	uc002flu.3	Q9H211	OTTHUMG00000173467	ENST00000301019.4:c.841G>A	16.37:g.88872437G>A	ENSP00000301019:p.Gly281Arg	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	12	5	NM_030928	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301019.4	37	CCDS32510.1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253471	0.39797	2.29E-4	0.0	ENSG00000167513	ENST00000301019	T	0.23552	1.9	4.83	-3.49	0.04724	.	1.014200	0.07884	N	0.970068	T	0.13030	0.0316	L	0.35487	1.065	0.30312	N	0.788448	P	0.51351	0.944	B	0.38458	0.274	T	0.37033	-0.9723	10	0.20046	T	0.44	.	4.4942	0.11828	0.0996:0.2944:0.5056:0.1004	.	281	Q9H211	CDT1_HUMAN	R	281	ENSP00000301019:G281R	ENSP00000301019:G281R	G	+	1	0	CDT1	87399938	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	0.790000	0.26900	-0.552000	0.06167	0.462000	0.41574	GGA	.		0.672	CDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000423215.1	NM_030928	
DLG4	1742	bcgsc.ca	37	17	7100206	7100206	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr17:7100206C>T	ENST00000399506.2	-	9	1144	c.953G>A	c.(952-954)cGg>cAg	p.R318Q	DLG4_ENST00000399510.2_Missense_Mutation_p.R361Q|DLG4_ENST00000302955.6_Missense_Mutation_p.R315Q			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	318	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	CGTGGAGCCCCGGTGGATCAC	0.642																																					p.R361Q													.	DLG4-24	0			c.G1082A						.						35.0	44.0	41.0					17																	7100206		2118	4260	6378	SO:0001583	missense	1742	exon11			GAGCCCCGGTGGA	U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.953G>A	17.37:g.7100206C>T	ENSP00000382425:p.Arg318Gln	Somatic	72	0		WXS	Illumina HiSeq	Phase_1	41	4	NM_001365	0	0	4	4	0	B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	ENST00000399506.2	37		.	.	.	.	.	.	.	.	.	.	C	29.4	4.999950	0.93227	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674	T;T;T	0.55930	0.49;0.49;0.49	5.28	5.28	0.74379	PDZ/DHR/GLGF (3);	.	.	.	.	T	0.72342	0.3448	M	0.88570	2.965	0.58432	D	0.999997	P;P;D;D	0.76494	0.955;0.904;0.999;0.998	P;P;D;D	0.70716	0.802;0.758;0.955;0.97	T	0.72988	-0.4124	9	0.30078	T	0.28	.	9.9464	0.41611	0.0:0.9084:0.0:0.0916	.	358;318;315;361	B9EGL1;P78352;G5E939;P78352-2	.;DLG4_HUMAN;.;.	Q	318;315;361;361;258;361	ENSP00000382425:R318Q;ENSP00000307471:R315Q;ENSP00000382428:R361Q	ENSP00000293813:R361Q	R	-	2	0	DLG4	7040930	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.127000	0.50484	2.455000	0.83008	0.655000	0.94253	CGG	.		0.642	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000259419.2	NM_001365	
MAP2K4	6416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	12016635	12016635	+	Silent	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr17:12016635T>C	ENST00000353533.5	+	7	834	c.771T>C	c.(769-771)tcT>tcC	p.S257S	MAP2K4_ENST00000415385.3_Silent_p.S268S|MAP2K4_ENST00000581941.1_3'UTR	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TTGTGGACTCTATTGCCAAGA	0.453			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.S257S		.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	MAP2K4-3134	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)	c.T771C						.						105.0	101.0	102.0					17																	12016635		2203	4300	6503	SO:0001819	synonymous_variant	6416	exon7			GGACTCTATTGCC	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.771T>C	17.37:g.12016635T>C		Somatic	81	0		WXS	Illumina HiSeq	Phase_I	159	104	NM_003010	0	0	14	42	28	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Silent	SNP	ENST00000353533.5	37	CCDS11162.1																																																																																			.		0.453	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
NAGLU	4669	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	40695935	40695935	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr17:40695935C>T	ENST00000225927.2	+	6	2012	c.1911C>T	c.(1909-1911)ttC>ttT	p.F637F	RP11-400F19.8_ENST00000585572.1_RNA	NM_000263.3	NP_000254.2	P54802	ANAG_HUMAN	N-acetylglucosaminidase, alpha	637					carbohydrate metabolic process (GO:0005975)|cerebellar Purkinje cell layer development (GO:0021680)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inner ear receptor cell development (GO:0060119)|locomotor rhythm (GO:0045475)|lysosome organization (GO:0007040)|middle ear morphogenesis (GO:0042474)|nervous system development (GO:0007399)|retinal rod cell development (GO:0046548)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-N-acetylglucosaminidase activity (GO:0004561)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|ovary(2)|skin(1)	12		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)	AGGCCGATTTCTACGAGCAGA	0.627																																					p.F637F		.											.	NAGLU-90	0			c.C1911T						.						25.0	21.0	22.0					17																	40695935		2202	4295	6497	SO:0001819	synonymous_variant	4669	exon6			CGATTTCTACGAG		CCDS11427.1	17q21.2	2010-07-27	2010-07-27		ENSG00000108784	ENSG00000108784	3.2.1.50		7632	protein-coding gene	gene with protein product	"""Sanfilippo disease IIIB"""	609701					Standard	XM_006721920		Approved	NAG	uc002hzv.3	P54802		ENST00000225927.2:c.1911C>T	17.37:g.40695935C>T		Somatic	43	0		WXS	Illumina HiSeq	Phase_I	21	10	NM_000263	0	0	12	12	0		Silent	SNP	ENST00000225927.2	37	CCDS11427.1																																																																																			.		0.627	NAGLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450385.1	NM_000263	
LSM12	124801	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	42117589	42117589	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr17:42117589C>T	ENST00000591247.1	-	4	616	c.294G>A	c.(292-294)aaG>aaA	p.K98K	LSM12_ENST00000585388.1_Silent_p.K98K|LSM12_ENST00000293406.3_Silent_p.K98K	NM_152344.3	NP_689557.1	Q3MHD2	LSM12_HUMAN	LSM12 homolog (S. cerevisiae)	98										NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	6		Breast(137;0.0313)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CCTGGCTCAGCTTCTCCTCCT	0.517																																					p.K98K		.											.	LSM12-90	0			c.G294A						.						99.0	72.0	81.0					17																	42117589		2203	4300	6503	SO:0001819	synonymous_variant	124801	exon4			GCTCAGCTTCTCC	BC044587	CCDS11475.1	17q21.31	2007-08-21				ENSG00000161654			26407	protein-coding gene	gene with protein product		611793				15225602	Standard	NM_152344		Approved	FLJ30656	uc002iev.3	Q3MHD2		ENST00000591247.1:c.294G>A	17.37:g.42117589C>T		Somatic	60	0		WXS	Illumina HiSeq	Phase_I	67	42	NM_152344	0	0	14	33	19	Q86YB1|Q96NL5	Silent	SNP	ENST00000591247.1	37	CCDS11475.1																																																																																			.		0.517	LSM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457672.1	NM_152344	
HEATR6	63897	hgsc.bcm.edu	37	17	58156270	58156270	+	Silent	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr17:58156270A>G	ENST00000184956.6	-	1	22	c.6T>C	c.(4-6)gcT>gcC	p.A2A	HEATR6_ENST00000585976.1_Silent_p.A2A|HEATR6_ENST00000585712.1_5'UTR|CTD-2319I12.2_ENST00000589740.1_lincRNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	2							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			CTTGCACAGCAGCCATCTTTT	0.622																																					p.A2A		.											.	HEATR6-227	0			c.T6C						.						11.0	10.0	10.0					17																	58156270		2183	4273	6456	SO:0001819	synonymous_variant	63897	exon1			CACAGCAGCCATC	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.6T>C	17.37:g.58156270A>G		Somatic	37	0		WXS	Illumina HiSeq	Phase_I	24	2	NM_022070	0	0	1	1	0	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Silent	SNP	ENST00000184956.6	37	CCDS11623.1																																																																																			.		0.622	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	
ERN1	2081	hgsc.bcm.edu	37	17	62133043	62133043	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr17:62133043T>C	ENST00000433197.3	-	13	1759	c.1664A>G	c.(1663-1665)gAc>gGc	p.D555G		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						ACCTCCATCGTCTTGTTCCAG	0.562																																					p.D555G		.											.	ERN1-784	0			c.A1664G						.						26.0	28.0	27.0					17																	62133043		2048	4218	6266	SO:0001583	missense	2081	exon13			CCATCGTCTTGTT	AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.1664A>G	17.37:g.62133043T>C	ENSP00000401445:p.Asp555Gly	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	50	3	NM_001433	0	0	0	0	0		Missense_Mutation	SNP	ENST00000433197.3	37	CCDS45762.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.650204	0.29336	.	.	ENSG00000178607	ENST00000433197	T	0.60797	0.16	5.01	5.01	0.66863	.	0.062618	0.64402	D	0.000008	T	0.35624	0.0938	N	0.08118	0	0.47511	D	0.999447	B	0.29037	0.231	B	0.19946	0.027	T	0.25257	-1.0137	10	0.36615	T	0.2	-24.8143	13.317	0.60413	0.0:0.0:0.0:1.0	.	555	O75460	ERN1_HUMAN	G	555	ENSP00000401445:D555G	ENSP00000401445:D555G	D	-	2	0	ERN1	59486775	1.000000	0.71417	0.377000	0.26055	0.153000	0.21895	5.452000	0.66638	1.880000	0.54463	0.334000	0.21626	GAC	.		0.562	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443734.2	NM_001433	
MYOM1	8736	hgsc.bcm.edu	37	18	3188882	3188882	+	Missense_Mutation	SNP	C	C	T	rs200770047		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr18:3188882C>T	ENST00000356443.4	-	4	968	c.635G>A	c.(634-636)aGg>aAg	p.R212K	MYOM1_ENST00000261606.7_Missense_Mutation_p.R212K|MYOM1_ENST00000400569.3_Missense_Mutation_p.R212K|RP13-270P17.2_ENST00000580139.1_RNA	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	212	6 X 6 AA tandem repeats.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.R212K(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CGTGGACTGCCTGGATGCCGT	0.517																																					p.R212K		.											.	MYOM1-94	1	Substitution - Missense(1)	endometrium(1)	c.G635A						.						260.0	242.0	248.0					18																	3188882		2044	4187	6231	SO:0001583	missense	8736	exon4			GACTGCCTGGATG	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.635G>A	18.37:g.3188882C>T	ENSP00000348821:p.Arg212Lys	Somatic	158	2		WXS	Illumina HiSeq	Phase_I	99	5	NM_003803	0	0	0	0	0	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	37	CCDS45824.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	2.966	-0.213546	0.06140	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.45668	1.03;1.04;0.89	3.23	0.752	0.18398	.	0.084010	0.41097	N	0.000942	T	0.14830	0.0358	N	0.08118	0	0.09310	N	0.999995	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28808	-1.0032	10	0.05351	T	0.99	.	4.9448	0.13984	0.0:0.2653:0.0:0.7347	.	212;212	P52179-2;P52179	.;MYOM1_HUMAN	K	212	ENSP00000348821:R212K;ENSP00000383413:R212K;ENSP00000261606:R212K	ENSP00000261606:R212K	R	-	2	0	MYOM1	3178882	0.789000	0.28775	0.018000	0.16275	0.000000	0.00434	1.455000	0.35190	0.165000	0.19558	-1.097000	0.02148	AGG	C|1.000;T|0.000		0.517	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
AMH	268	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	2249551	2249551	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr19:2249551G>T	ENST00000221496.4	+	1	242	c.220G>T	c.(220-222)Ggg>Tgg	p.G74W	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	74					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGGTGGTGGGGGCTCTAAG	0.692									Persistant Mullerian Duct Syndrome (type I and II)																												p.G74W		.											.	AMH-130	0			c.G220T						.						8.0	11.0	10.0					19																	2249551		2163	4282	6445	SO:0001583	missense	268	exon1	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	GTGGTGGGGGCTC	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.220G>T	19.37:g.2249551G>T	ENSP00000221496:p.Gly74Trp	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	11	6	NM_000479	0	0	0	0	0	O75246|Q6GTN3	Missense_Mutation	SNP	ENST00000221496.4	37	CCDS12085.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527815	0.27299	.	.	ENSG00000104899	ENST00000221496	D	0.94687	-3.49	3.75	3.75	0.43078	.	0.168909	0.38548	U	0.001642	D	0.95010	0.8385	L	0.34521	1.04	0.44555	D	0.997518	D	0.89917	1.0	D	0.91635	0.999	D	0.95614	0.8675	10	0.87932	D	0	-23.8931	14.1364	0.65291	0.0:0.0:1.0:0.0	.	74	P03971	MIS_HUMAN	W	74	ENSP00000221496:G74W	ENSP00000221496:G74W	G	+	1	0	AMH	2200551	1.000000	0.71417	0.103000	0.21229	0.001000	0.01503	5.367000	0.66127	1.657000	0.50732	0.462000	0.41574	GGG	.		0.692	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451276.3	NM_000479	
CLEC4M	10332	hgsc.bcm.edu	37	19	7832420	7832420	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr19:7832420A>T	ENST00000327325.5	+	6	1073	c.955A>T	c.(955-957)Act>Tct	p.T319S	CLEC4M_ENST00000595496.1_Missense_Mutation_p.T183S|CLEC4M_ENST00000596363.1_Intron|CLEC4M_ENST00000394122.2_Missense_Mutation_p.T307S|CLEC4M_ENST00000334806.5_Missense_Mutation_p.T268S|CLEC4M_ENST00000357361.2_Intron|CLEC4M_ENST00000597522.1_Intron|CLEC4M_ENST00000359059.5_Missense_Mutation_p.T252S|CLEC4M_ENST00000596707.1_Missense_Mutation_p.T252S|CLEC4M_ENST00000248228.4_Missense_Mutation_p.T297S	NM_001144909.1|NM_014257.4	NP_001138381.1|NP_055072.3	Q9H2X3	CLC4M_HUMAN	C-type lectin domain family 4, member M	319	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|ICAM-3 receptor activity (GO:0030369)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|receptor activity (GO:0004872)|virion binding (GO:0046790)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|pancreas(1)|prostate(1)|skin(1)	26						ACAGCTGCAGACTTCCAGGAG	0.552																																					p.T319S		.											.	CLEC4M-91	0			c.A955T						.						102.0	89.0	94.0					19																	7832420		2203	4300	6503	SO:0001583	missense	10332	exon6			CTGCAGACTTCCA	AB015629	CCDS12187.1, CCDS59346.1, CCDS59347.1, CCDS59348.1	19p13	2008-02-05	2005-02-04	2005-02-11		ENSG00000104938		"""C-type lectin domain containing"", ""CD molecules"""	13523	protein-coding gene	gene with protein product		605872	"""CD299 antigen"""	CD209L, CD299		10072769	Standard	NM_001144904		Approved	HP10347, DC-SIGNR, LSIGN, DCSIGNR, DC-SIGN2	uc010dvt.3	Q9H2X3		ENST00000327325.5:c.955A>T	19.37:g.7832420A>T	ENSP00000316228:p.Thr319Ser	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	90	6	NM_014257	0	0	0	0	0	A6NKI4|A8K8B3|Q69F40|Q969M4|Q96QP3|Q96QP4|Q96QP5|Q96QP6|Q9BXS3|Q9H2Q9|Q9H8F0|Q9Y2A8	Missense_Mutation	SNP	ENST00000327325.5	37	CCDS12187.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.947181	0.00475	.	.	ENSG00000104938	ENST00000327325;ENST00000394122;ENST00000248228;ENST00000334806;ENST00000359059	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	2.42	-4.84	0.03151	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.08044	0.0201	N	0.25426	0.745	0.09310	N	0.999998	B;B;B;B;B;B	0.09022	0.002;0.0;0.001;0.0;0.001;0.001	B;B;B;B;B;B	0.13407	0.007;0.0;0.004;0.007;0.002;0.009	T	0.38735	-0.9647	9	0.13108	T	0.6	.	3.4919	0.07641	0.3644:0.0:0.3242:0.3114	.	268;252;319;307;296;183	B4E2Z5;Q9H2X3-5;Q9H2X3;E7ENS9;Q9H2X3-8;Q9H2X3-7	.;.;CLC4M_HUMAN;.;.;.	S	319;307;297;268;252	ENSP00000316228:T319S;ENSP00000377680:T307S;ENSP00000248228:T297S;ENSP00000335228:T268S;ENSP00000351954:T252S	ENSP00000248228:T297S	T	+	1	0	CLEC4M	7738420	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.311000	0.08124	-2.225000	0.00724	-2.665000	0.00146	ACT	.		0.552	CLEC4M-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461161.1	NM_014257	
ADAMTS10	81794	hgsc.bcm.edu	37	19	8645860	8645860	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr19:8645860A>G	ENST00000597188.1	-	26	3499	c.3229T>C	c.(3229-3231)Tac>Cac	p.Y1077H	AC130469.2_ENST00000597256.1_RNA|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.Y1077H|ADAMTS10_ENST00000595838.1_Missense_Mutation_p.Y564H	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	1077	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						AGGGGGCAGTAGGCGACCTTG	0.617											OREG0025220	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y1077H		.											.	ADAMTS10-229	0			c.T3229C						.						51.0	42.0	45.0					19																	8645860		2203	4300	6503	SO:0001583	missense	81794	exon26			GGCAGTAGGCGAC	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.3229T>C	19.37:g.8645860A>G	ENSP00000471851:p.Tyr1077His	Somatic	68	0	650	WXS	Illumina HiSeq	Phase_I	23	2	NM_030957	0	0	1	1	0	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.904566	0.92035	.	.	ENSG00000142303	ENST00000270328	T	0.48836	0.8	5.47	5.47	0.80525	PLAC (2);	0.000000	0.64402	U	0.000001	T	0.61640	0.2363	L	0.43152	1.355	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.64769	-0.6329	10	0.87932	D	0	.	14.7435	0.69474	1.0:0.0:0.0:0.0	.	1077;564	Q9H324;E9PCI6	ATS10_HUMAN;.	H	1077	ENSP00000270328:Y1077H	ENSP00000270328:Y1077H	Y	-	1	0	ADAMTS10	8551860	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.849000	0.92178	2.075000	0.62263	0.448000	0.29417	TAC	.		0.617	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
DHX34	9704	hgsc.bcm.edu	37	19	47856881	47856881	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr19:47856881C>G	ENST00000328771.4	+	2	943	c.594C>G	c.(592-594)taC>taG	p.Y198*		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	198	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		TGCCCCAGTACCTGCTGGCTG	0.637																																					p.Y198X		.											.	DHX34-231	0			c.C594G						.						22.0	25.0	24.0					19																	47856881		2203	4300	6503	SO:0001587	stop_gained	9704	exon2			CCAGTACCTGCTG	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.594C>G	19.37:g.47856881C>G	ENSP00000331907:p.Tyr198*	Somatic	79	0		WXS	Illumina HiSeq	Phase_I	31	2	NM_014681	0	0	8	8	0	B4DMY8	Nonsense_Mutation	SNP	ENST00000328771.4	37	CCDS12700.1	.	.	.	.	.	.	.	.	.	.	C	40	8.010007	0.98607	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	.	.	.	5.26	5.26	0.73747	.	0.000000	0.49305	D	0.000157	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6164	17.6312	0.88108	0.0:1.0:0.0:0.0	.	.	.	.	X	198	.	ENSP00000257252:Y198X	Y	+	3	2	DHX34	52548721	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.207000	0.32333	2.461000	0.83175	0.555000	0.69702	TAC	.		0.637	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
TAF1B	9014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	10051000	10051000	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:10051000T>C	ENST00000263663.5	+	10	1279	c.1091T>C	c.(1090-1092)gTg>gCg	p.V364A	TAF1B_ENST00000396242.3_Missense_Mutation_p.V109A	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	364	C-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATCATTGTGGTGGTATTGAAA	0.358																																					p.V364A		.											.	TAF1B-92	0			c.T1091C						.						195.0	157.0	170.0					2																	10051000		2203	4300	6503	SO:0001583	missense	9014	exon10			TTGTGGTGGTATT	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.1091T>C	2.37:g.10051000T>C	ENSP00000263663:p.Val364Ala	Somatic	53	1		WXS	Illumina HiSeq	Phase_I	76	32	NM_005680	0	0	2	4	2	B4DI42|F8WD72|Q15574|Q8WVC3	Missense_Mutation	SNP	ENST00000263663.5	37	CCDS33143.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.730164	0.30684	.	.	ENSG00000115750	ENST00000263663;ENST00000396242	T;T	0.04194	3.68;3.68	5.8	5.8	0.92144	.	0.235349	0.42821	D	0.000656	T	0.07188	0.0182	L	0.46885	1.475	0.24866	N	0.992313	B;P	0.46142	0.051;0.873	B;B	0.40782	0.02;0.34	T	0.25502	-1.0130	9	.	.	.	-9.4571	16.1464	0.81575	0.0:0.0:0.0:1.0	.	364;364	Q53T94;Q53T94-2	TAF1B_HUMAN;.	A	364;109	ENSP00000263663:V364A;ENSP00000379542:V109A	.	V	+	2	0	TAF1B	9968451	0.975000	0.34042	0.043000	0.18650	0.218000	0.24690	3.000000	0.49481	2.220000	0.72140	0.383000	0.25322	GTG	.		0.358	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
LPIN1	23175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	11960558	11960558	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:11960558G>C	ENST00000256720.2	+	19	2524	c.2431G>C	c.(2431-2433)Gta>Cta	p.V811L	LPIN1_ENST00000449576.2_Missense_Mutation_p.V896L|LPIN1_ENST00000396097.1_Missense_Mutation_p.V541L|LPIN1_ENST00000425416.2_Missense_Mutation_p.V817L|LPIN1_ENST00000404113.2_Missense_Mutation_p.V312L|LPIN1_ENST00000396099.1_Missense_Mutation_p.V853L	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	811	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		ATACAAGCAAGTAGGAGTGTC	0.348																																					p.V896L		.											.	LPIN1-156	0			c.G2686C						.						117.0	110.0	112.0					2																	11960558		2203	4300	6503	SO:0001583	missense	23175	exon21			AAGCAAGTAGGAG	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.2431G>C	2.37:g.11960558G>C	ENSP00000256720:p.Val811Leu	Somatic	51	0		WXS	Illumina HiSeq	Phase_I	74	28	NM_001261428	0	0	6	6	0	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	37	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	G	35	5.510636	0.96386	.	.	ENSG00000134324	ENST00000449576;ENST00000396099;ENST00000425416;ENST00000256720;ENST00000396097;ENST00000404113	T;T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27;-1.27	6.02	6.02	0.97574	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.055717	0.64402	D	0.000001	D	0.90007	0.6880	M	0.87682	2.9	0.80722	D	1	D;D;D	0.64830	0.994;0.988;0.975	D;P;P	0.68039	0.955;0.907;0.883	D	0.90458	0.4444	10	0.87932	D	0	-24.1549	20.5407	0.99260	0.0:0.0:1.0:0.0	.	312;896;811	B4DET9;F5GY24;Q14693	.;.;LPIN1_HUMAN	L	896;853;817;811;541;312	ENSP00000397908:V896L;ENSP00000379406:V853L;ENSP00000401522:V817L;ENSP00000256720:V811L;ENSP00000379404:V541L;ENSP00000386120:V312L	ENSP00000256720:V811L	V	+	1	0	LPIN1	11878009	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.357000	0.97099	2.865000	0.98341	0.655000	0.94253	GTA	.		0.348	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
LPIN1	23175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	11960560	11960560	+	Silent	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:11960560A>G	ENST00000256720.2	+	19	2526	c.2433A>G	c.(2431-2433)gtA>gtG	p.V811V	LPIN1_ENST00000449576.2_Silent_p.V896V|LPIN1_ENST00000396097.1_Silent_p.V541V|LPIN1_ENST00000425416.2_Silent_p.V817V|LPIN1_ENST00000404113.2_Silent_p.V312V|LPIN1_ENST00000396099.1_Silent_p.V853V	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	811	C-LIP.				cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		ACAAGCAAGTAGGAGTGTCTT	0.348																																					p.V896V		.											.	LPIN1-156	0			c.A2688G						.						118.0	111.0	113.0					2																	11960560		2203	4300	6503	SO:0001819	synonymous_variant	23175	exon21			GCAAGTAGGAGTG	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.2433A>G	2.37:g.11960560A>G		Somatic	50	0		WXS	Illumina HiSeq	Phase_I	75	29	NM_001261428	0	0	7	7	0	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Silent	SNP	ENST00000256720.2	37	CCDS1682.1																																																																																			.		0.348	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
KIF3C	3797	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	26178417	26178417	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:26178417A>C	ENST00000264712.3	-	3	2342	c.1763T>G	c.(1762-1764)cTc>cGc	p.L588R	KIF3C_ENST00000405914.1_Missense_Mutation_p.L588R	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	588					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACCTTCTTGAGTTTCTTGGT	0.587																																					p.L588R		.											.	KIF3C-94	0			c.T1763G						.						229.0	186.0	200.0					2																	26178417		2203	4300	6503	SO:0001583	missense	3797	exon3			TTCTTGAGTTTCT		CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1763T>G	2.37:g.26178417A>C	ENSP00000264712:p.Leu588Arg	Somatic	299	0		WXS	Illumina HiSeq	Phase_I	155	62	NM_002254	0	0	0	0	0	O43544|Q4ZG18|Q53SX5|Q562F7	Missense_Mutation	SNP	ENST00000264712.3	37	CCDS1719.1	.	.	.	.	.	.	.	.	.	.	A	18.30	3.593287	0.66219	.	.	ENSG00000084731	ENST00000264712;ENST00000542511;ENST00000405914	T;T	0.78481	-1.18;-1.18	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.81669	0.4871	M	0.92026	3.265	0.80722	D	1	B;B	0.30686	0.095;0.29	B;B	0.28638	0.037;0.092	D	0.83422	0.0033	10	0.72032	D	0.01	.	13.0867	0.59144	1.0:0.0:0.0:0.0	.	588;588	B7ZM25;O14782	.;KIF3C_HUMAN	R	588;394;588	ENSP00000264712:L588R;ENSP00000385030:L588R	ENSP00000264712:L588R	L	-	2	0	KIF3C	26031921	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.119000	0.94362	1.998000	0.58463	0.459000	0.35465	CTC	.		0.587	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211611.1		
PLEKHH2	130271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	43953471	43953471	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:43953471G>T	ENST00000282406.4	+	17	2712	c.2602G>T	c.(2602-2604)Gat>Tat	p.D868Y		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	868	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CAGATCTTGTGATTCAGATGA	0.388																																					p.D868Y		.											.	PLEKHH2-92	0			c.G2602T						.						108.0	102.0	104.0					2																	43953471		2203	4300	6503	SO:0001583	missense	130271	exon17			TCTTGTGATTCAG	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2602G>T	2.37:g.43953471G>T	ENSP00000282406:p.Asp868Tyr	Somatic	42	0		WXS	Illumina HiSeq	Phase_I	74	27	NM_172069	0	0	27	61	34	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	37	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667945	0.88348	.	.	ENSG00000152527	ENST00000282406	T	0.77750	-1.12	5.57	5.57	0.84162	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.049073	0.85682	D	0.000000	D	0.88887	0.6559	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.991	D	0.89680	0.3890	10	0.87932	D	0	-23.2912	19.5645	0.95388	0.0:0.0:1.0:0.0	.	868;305	Q8IVE3;Q8IVE3-2	PKHH2_HUMAN;.	Y	868	ENSP00000282406:D868Y	ENSP00000282406:D868Y	D	+	1	0	PLEKHH2	43806975	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.386000	0.97228	2.599000	0.87857	0.650000	0.86243	GAT	.		0.388	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
RAB1A	5861	hgsc.bcm.edu	37	2	65318133	65318133	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:65318133T>C	ENST00000409784.3	-	4	462	c.272A>G	c.(271-273)tAt>tGt	p.Y91C	RAB1A_ENST00000409892.1_Intron|RAB1A_ENST00000494188.1_Intron|RAB1A_ENST00000260638.8_Intron|RAB1A_ENST00000398529.3_Intron|RAB1A_ENST00000409751.1_Missense_Mutation_p.Y59C|RAB1A_ENST00000356214.7_Intron	NM_004161.4	NP_004152.1	P62820	RAB1A_HUMAN	RAB1A, member RAS oncogene family	91					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cargo loading into COPII-coated vesicle (GO:0090110)|cell migration (GO:0016477)|defense response to bacterium (GO:0042742)|endocytosis (GO:0006897)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|growth hormone secretion (GO:0030252)|GTP catabolic process (GO:0006184)|interleukin-8 secretion (GO:0072606)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|positive regulation of glycoprotein metabolic process (GO:1903020)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle transport along microtubule (GO:0047496)|vesicle-mediated transport (GO:0016192)|virion assembly (GO:0019068)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|melanosome (GO:0042470)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|kidney(1)|lung(3)|prostate(1)	6						TGTCACATCATACACAACTAT	0.393																																					p.Y91C		.											.	RAB1A-227	0			c.A272G						.						99.0	94.0	95.0					2																	65318133		1908	4132	6040	SO:0001583	missense	5861	exon4			ACATCATACACAA	M28209	CCDS46305.1, CCDS46306.1	2p14	2008-02-05		2002-03-17	ENSG00000138069	ENSG00000138069		"""RAB, member RAS oncogene"""	9758	protein-coding gene	gene with protein product	"""Rab GTPase YPT1 homolog (yeast)"""	179508		RAB1		2501306	Standard	NM_004161		Approved	YPT1	uc002sdm.3	P62820	OTTHUMG00000152725	ENST00000409784.3:c.272A>G	2.37:g.65318133T>C	ENSP00000387286:p.Tyr91Cys	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	32	2	NM_004161	0	0	196	196	0	P11476|Q6FIE7|Q96N61|Q9Y3T2	Missense_Mutation	SNP	ENST00000409784.3	37	CCDS46306.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.498528	0.85069	.	.	ENSG00000138069	ENST00000409784;ENST00000409751	D;D	0.84070	-1.8;-1.8	5.38	5.38	0.77491	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.92564	0.7638	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94061	0.7326	10	0.87932	D	0	.	15.6846	0.77400	0.0:0.0:0.0:1.0	.	91	P62820	RAB1A_HUMAN	C	91;59	ENSP00000387286:Y91C;ENSP00000386672:Y59C	ENSP00000386672:Y59C	Y	-	2	0	RAB1A	65171637	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.161000	0.67846	0.454000	0.30748	TAT	.		0.393	RAB1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327572.1	NM_004161	
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	84777109	84777109	+	Silent	SNP	A	A	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:84777109A>T	ENST00000237449.6	+	8	1421	c.1413A>T	c.(1411-1413)ctA>ctT	p.L471L	DNAH6_ENST00000398278.2_Silent_p.L471L|DNAH6_ENST00000389394.3_Silent_p.L471L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	471	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						CTGACAAGCTAAAACGAACAC	0.358																																					p.L471L		.											.	DNAH6-69	0			c.A1413T						.						94.0	83.0	87.0					2																	84777109		2203	4300	6503	SO:0001819	synonymous_variant	1768	exon9			CAAGCTAAAACGA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1413A>T	2.37:g.84777109A>T		Somatic	34	0		WXS	Illumina HiSeq	Phase_I	66	25	NM_001370	0	0	0	0	0	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.358	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
ATG9A	79065	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	220090289	220090289	+	Missense_Mutation	SNP	A	A	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:220090289A>C	ENST00000409618.1	-	6	657	c.218T>G	c.(217-219)tTc>tGc	p.F73C	ATG9A_ENST00000488833.1_5'Flank|AC068946.1_ENST00000408417.1_RNA|ATG9A_ENST00000396761.2_Missense_Mutation_p.F73C|ATG9A_ENST00000409422.1_Missense_Mutation_p.F12C|ATG9A_ENST00000361242.4_Missense_Mutation_p.F73C			Q7Z3C6	ATG9A_HUMAN	autophagy related 9A	73					autophagic vacuole assembly (GO:0000045)|late nucleophagy (GO:0044805)|mitochondrion degradation (GO:0000422)|piecemeal microautophagy of nucleus (GO:0034727)|protein localization to pre-autophagosomal structure (GO:0034497)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)				endometrium(2)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|stomach(1)	13		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CACAAAGAGGAACTGCCTGGG	0.532																																					p.F73C		.											.	ATG9A-91	0			c.T218G						.						71.0	74.0	73.0					2																	220090289		2019	4190	6209	SO:0001583	missense	79065	exon6			AAGAGGAACTGCC	AK021732	CCDS42820.1	2q35	2014-02-12	2012-06-06	2005-09-11	ENSG00000198925	ENSG00000198925			22408	protein-coding gene	gene with protein product		612204	"""APG9 autophagy 9-like 1 (S. cerevisiae)"", ""ATG9 autophagy related 9 homolog A (S. cerevisiae)"""	APG9L1			Standard	NM_024085		Approved	FLJ22169	uc002vkf.1	Q7Z3C6	OTTHUMG00000154557	ENST00000409618.1:c.218T>G	2.37:g.220090289A>C	ENSP00000386710:p.Phe73Cys	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	59	22	NM_001077198	0	0	0	0	0	Q3ZAQ6|Q6P0N7|Q7Z317|Q7Z320|Q8NDK6|Q8WU65|Q9BVL5|Q9H6L1|Q9HAG7	Missense_Mutation	SNP	ENST00000409618.1	37	CCDS42820.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.360020	0.61403	.	.	ENSG00000198925	ENST00000396761;ENST00000409618;ENST00000361242;ENST00000409422;ENST00000436856;ENST00000457841;ENST00000428226;ENST00000432520;ENST00000439812;ENST00000443140;ENST00000434939	T;T;T;T;T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	5.05	5.05	0.67936	.	0.057192	0.64402	D	0.000001	T	0.73513	0.3596	M	0.78916	2.43	0.58432	D	0.999995	D	0.58620	0.983	B	0.43783	0.431	T	0.79808	-0.1647	10	0.72032	D	0.01	.	15.2471	0.73513	1.0:0.0:0.0:0.0	.	73	Q7Z3C6	ATG9A_HUMAN	C	73;73;73;12;73;73;73;73;73;73;73	ENSP00000379983:F73C;ENSP00000386710:F73C;ENSP00000355173:F73C;ENSP00000386535:F12C;ENSP00000401530:F73C;ENSP00000404750:F73C;ENSP00000409164:F73C;ENSP00000406785:F73C;ENSP00000413569:F73C;ENSP00000416435:F73C;ENSP00000394345:F73C	ENSP00000355173:F73C	F	-	2	0	ATG9A	219798533	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.040000	0.93783	2.251000	0.74343	0.482000	0.46254	TTC	.		0.532	ATG9A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335930.1	NM_024085	
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	228860230	228860230	+	Silent	SNP	G	G	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:228860230G>C	ENST00000392056.3	-	8	4675	c.4629C>G	c.(4627-4629)tcC>tcG	p.S1543S	SPHKAP_ENST00000344657.5_Silent_p.S1543S	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1543						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGTACCTCATGGATCGCTCAC	0.483																																					p.S1543S		.											.	SPHKAP-167	0			c.C4629G						.						226.0	197.0	207.0					2																	228860230		2203	4300	6503	SO:0001819	synonymous_variant	80309	exon8			CCTCATGGATCGC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4629C>G	2.37:g.228860230G>C		Somatic	298	1		WXS	Illumina HiSeq	Phase_I	283	107	NM_030623	0	0	0	0	0	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	CCDS46537.1																																																																																			.		0.483	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
SNPH	9751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	1286555	1286555	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr20:1286555C>T	ENST00000381873.3	+	6	1578	c.1342C>T	c.(1342-1344)Cgg>Tgg	p.R448W	SNPH_ENST00000381867.1_Missense_Mutation_p.R492W	NM_014723.2	NP_055538.2	O15079	SNPH_HUMAN	syntaphilin	448					brain development (GO:0007420)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|synaptic vesicle docking involved in exocytosis (GO:0016081)	cell junction (GO:0030054)|cytoplasmic microtubule (GO:0005881)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)	syntaxin-1 binding (GO:0017075)			endometrium(2)|large_intestine(4)|lung(10)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						CCGCTCCCAGCGGCGCCAGGG	0.672																																					p.R448W		.											.	SNPH-92	0			c.C1342T						.						16.0	10.0	12.0					20																	1286555		2131	4210	6341	SO:0001583	missense	9751	exon6			TCCCAGCGGCGCC		CCDS13012.1	20p13	2008-07-02			ENSG00000101298	ENSG00000101298			15931	protein-coding gene	gene with protein product		604942				10707983	Standard	NM_014723		Approved	bA314N13.5	uc002wes.3	O15079	OTTHUMG00000031662	ENST00000381873.3:c.1342C>T	20.37:g.1286555C>T	ENSP00000371297:p.Arg448Trp	Somatic	33	0		WXS	Illumina HiSeq	Phase_I	13	7	NM_014723	0	0	1	2	1	Q8IYI3	Missense_Mutation	SNP	ENST00000381873.3	37	CCDS13012.1	.	.	.	.	.	.	.	.	.	.	C	15.03	2.712880	0.48517	.	.	ENSG00000101298	ENST00000381873;ENST00000381867	.	.	.	4.24	1.16	0.20824	.	0.431073	0.21513	N	0.073349	T	0.59729	0.2215	M	0.62723	1.935	0.31113	N	0.709748	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.61088	-0.7133	9	0.87932	D	0	-28.0671	7.7271	0.28765	0.5262:0.3946:0.0:0.0791	.	492;448	O15079-2;O15079	.;SNPH_HUMAN	W	448;492	.	ENSP00000371291:R492W	R	+	1	2	SNPH	1234555	0.992000	0.36948	0.981000	0.43875	0.898000	0.52572	0.375000	0.20518	0.083000	0.17047	-0.268000	0.10319	CGG	.		0.672	SNPH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000145240.2	NM_014723	
FRG1B	284802	broad.mit.edu	37	20	29628236	29628236	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr20:29628236G>C	ENST00000278882.3	+	6	618	c.238G>C	c.(238-240)Gct>Cct	p.A80P	FRG1B_ENST00000358464.4_Missense_Mutation_p.A80P|FRG1B_ENST00000439954.2_Missense_Mutation_p.A85P			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	80								p.A80P(8)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GGGGAAAATGGCTTTGTTGGC	0.363																																					.													.	FRG1B-22	8	Substitution - Missense(8)	prostate(4)|kidney(4)	.						.																																			SO:0001583	missense	284802	.			AAAATGGCTTTGT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.238G>C	20.37:g.29628236G>C	ENSP00000278882:p.Ala80Pro	Somatic	162	1		WXS	Illumina HiSeq	Phase_I	272	11	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	g	15.73	2.920277	0.52653	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.57595	0.39	2.08	2.08	0.27032	Actin cross-linking (1);	0.052409	0.85682	D	0.000000	T	0.68952	0.3057	.	.	.	0.80722	D	1	D;D	0.64830	0.994;0.988	D;D	0.85130	0.997;0.993	T	0.72766	-0.4194	9	0.87932	D	0	.	10.2211	0.43198	0.0:0.0:1.0:0.0	.	85;80	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	P	80;85;80	ENSP00000408863:A85P	ENSP00000278882:A80P	A	+	1	0	FRG1B	28241897	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	8.494000	0.90477	1.475000	0.48197	0.423000	0.28283	GCT	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
LSM14B	149986	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	60705292	60705292	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr20:60705292G>A	ENST00000279068.6	+	5	773	c.613G>A	c.(613-615)Gct>Act	p.A205T	LSM14B_ENST00000253001.4_Intron	NM_144703.2	NP_653304.2	Q9BX40	LS14B_HUMAN	LSM14B, SCD6 homolog B (S. cerevisiae)	205					multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)	ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|lung(4)	8	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.28e-07)			CCAGCCGGCAGCTGTGCAAGC	0.567																																					p.A205T		.											.	LSM14B-22	0			c.G613A						.						29.0	30.0	30.0					20																	60705292		2046	4199	6245	SO:0001583	missense	149986	exon5			CCGGCAGCTGTGC	AF172328	CCDS46626.1	20q13.33	2010-01-27	2006-12-21	2006-01-24	ENSG00000149657	ENSG00000149657			15887	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 40"", ""family with sequence similarity 61, member B"", ""LSM14 homolog B (SCD6, S. cerevisiae)"""	C20orf40, FAM61B			Standard	NM_144703		Approved	FT005, bA11M20.3, FLJ25473, LSM13, RAP55B	uc010gjy.1	Q9BX40	OTTHUMG00000032901	ENST00000279068.6:c.613G>A	20.37:g.60705292G>A	ENSP00000279068:p.Ala205Thr	Somatic	29	0		WXS	Illumina HiSeq	Phase_I	12	5	NM_144703	0	0	17	27	10	Q6PFW8|Q96LH8	Missense_Mutation	SNP	ENST00000279068.6	37	CCDS46626.1	.	.	.	.	.	.	.	.	.	.	G	5.458	0.269581	0.10349	.	.	ENSG00000149657	ENST00000279068;ENST00000444156;ENST00000400318;ENST00000370906;ENST00000361670	T;T;T	0.45668	0.94;0.94;0.89	5.59	-1.32	0.09201	.	.	.	.	.	T	0.23846	0.0577	L	0.38531	1.155	0.54753	D	0.999981	B;B;B;B	0.22346	0.003;0.068;0.001;0.002	B;B;B;B	0.15484	0.002;0.013;0.002;0.002	T	0.10543	-1.0625	9	0.16896	T	0.51	.	4.4602	0.11663	0.1547:0.3504:0.4009:0.094	.	125;161;205;231	E9PG81;C9J454;Q9BX40;Q5TBQ0	.;.;LS14B_HUMAN;.	T	205;161;231;161;125	ENSP00000279068:A205T;ENSP00000383172:A231T;ENSP00000355209:A125T	ENSP00000279068:A205T	A	+	1	0	LSM14B	60138687	0.769000	0.28531	0.908000	0.35775	0.211000	0.24417	0.566000	0.23593	0.278000	0.22164	-0.324000	0.08512	GCT	.		0.567	LSM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079996.4	NM_144703	
CABLES2	81928	hgsc.bcm.edu	37	20	60982024	60982024	+	Silent	SNP	C	C	T	rs146975578	byFrequency	TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr20:60982024C>T	ENST00000279101.5	-	1	317	c.309G>A	c.(307-309)ctG>ctA	p.L103L		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	103	Pro-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TGGGGCTGAGCAGGCCCTggg	0.816													C|||	637	0.127196	0.2095	0.17	5008	,	,		6090	0.001		0.2018	False		,,,				2504	0.0389				p.L103L		.											.	CABLES2-91	0			c.G309A						.	C		368,2140		30,308,916	3.0	3.0	3.0		309	0.7	1.0	20	dbSNP_134	3	899,4587		90,719,1934	no	coding-synonymous	CABLES2	NM_031215.2		120,1027,2850	TT,TC,CC		16.3872,14.673,15.8494		103/479	60982024	1267,6727	1254	2743	3997	SO:0001819	synonymous_variant	81928	exon1			GCTGAGCAGGCCC	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.309G>A	20.37:g.60982024C>T		Somatic	6	1		WXS	Illumina HiSeq	Phase_I	3	3	NM_031215	0	0	0	0	0	Q5JWL0|Q9BYK0	Silent	SNP	ENST00000279101.5	37	CCDS33503.1																																																																																			C|0.860;T|0.140		0.816	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265	
DOPEY2	9980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	37626086	37626086	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr21:37626086G>A	ENST00000399151.3	+	23	5223	c.5138G>A	c.(5137-5139)aGt>aAt	p.S1713N		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1713					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CCAACGGCAAGTGCATCCCAG	0.468																																					p.S1713N		.											.	DOPEY2-91	0			c.G5138A						.						139.0	136.0	137.0					21																	37626086		2203	4300	6503	SO:0001583	missense	9980	exon23			CGGCAAGTGCATC	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.5138G>A	21.37:g.37626086G>A	ENSP00000382104:p.Ser1713Asn	Somatic	220	1		WXS	Illumina HiSeq	Phase_I	177	75	NM_005128	0	0	7	7	0	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	ENST00000399151.3	37	CCDS13643.1	.	.	.	.	.	.	.	.	.	.	G	12.59	1.982780	0.34942	.	.	ENSG00000142197	ENST00000399151	T	0.13778	2.56	5.5	1.28	0.21552	.	0.040315	0.85682	N	0.000000	T	0.12518	0.0304	L	0.50919	1.6	0.30386	N	0.781515	B;B	0.27192	0.171;0.107	B;B	0.24848	0.056;0.025	T	0.10177	-1.0641	10	0.31617	T	0.26	-7.5998	11.6148	0.51083	0.0646:0.3448:0.5907:0.0	.	1713;1713	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	N	1713	ENSP00000382104:S1713N	ENSP00000382104:S1713N	S	+	2	0	DOPEY2	36547956	1.000000	0.71417	0.001000	0.08648	0.018000	0.09664	6.006000	0.70724	0.231000	0.21079	0.655000	0.94253	AGT	.		0.468	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
BRWD1	54014	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	40641908	40641908	+	Missense_Mutation	SNP	T	T	A	rs540249994		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr21:40641908T>A	ENST00000333229.2	-	15	1774	c.1447A>T	c.(1447-1449)Att>Ttt	p.I483F	BRWD1_ENST00000380800.3_Missense_Mutation_p.I483F|BRWD1_ENST00000342449.3_Missense_Mutation_p.I483F	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	483					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				GATAACATAATTCTGGAATCA	0.333																																					p.I483F	Melanoma(170;988 1986 4794 16843 39731)	.											.	BRWD1-94	0			c.A1447T						.						105.0	99.0	101.0					21																	40641908		2203	4300	6503	SO:0001583	missense	54014	exon15			ACATAATTCTGGA	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.1447A>T	21.37:g.40641908T>A	ENSP00000330753:p.Ile483Phe	Somatic	20	0		WXS	Illumina HiSeq	Phase_I	48	26	NM_018963	0	0	4	8	4	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	37	CCDS13662.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.9|25.9	4.681151|4.681151	0.88542|0.88542	.|.	.|.	ENSG00000185658|ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800|ENST00000455867	T;T;T|.	0.59224|.	0.28;0.28;0.28|.	5.57|5.57	5.57|5.57	0.84162|0.84162	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.080378|.	0.53938|.	D|.	0.000059|.	T|T	0.45337|0.45337	0.1337|0.1337	L|L	0.27944|0.27944	0.81|0.81	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.999;1.0|.	D;D;D|.	0.91635|.	0.996;0.999;0.99|.	T|T	0.38200|0.38200	-0.9672|-0.9672	10|5	0.87932|.	D|.	0|.	-10.9067|-10.9067	10.1398|10.1398	0.42728|0.42728	0.0:0.0743:0.0:0.9257|0.0:0.0743:0.0:0.9257	.|.	194;483;483|.	Q5R2U6;Q9NSI6-2;Q9NSI6|.	.;.;BRWD1_HUMAN|.	F|I	483|194	ENSP00000330753:I483F;ENSP00000344333:I483F;ENSP00000370178:I483F|.	ENSP00000330753:I483F|.	I|N	-|-	1|2	0|0	BRWD1|BRWD1	39563778|39563778	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.879000|3.879000	0.56138|0.56138	2.130000|2.130000	0.65690|0.65690	0.455000|0.455000	0.32223|0.32223	ATT|AAT	.		0.333	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
PDE9A	5152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	44152003	44152003	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr21:44152003A>G	ENST00000291539.6	+	5	446	c.386A>G	c.(385-387)gAg>gGg	p.E129G	PDE9A_ENST00000398234.3_Intron|PDE9A_ENST00000539837.1_Intron|PDE9A_ENST00000470987.1_Intron|PDE9A_ENST00000398229.3_Intron|PDE9A_ENST00000398225.3_Missense_Mutation_p.E88G|PDE9A_ENST00000398227.3_Intron|PDE9A_ENST00000398236.3_Intron|PDE9A_ENST00000328862.6_Missense_Mutation_p.E103G|PDE9A_ENST00000398224.3_Intron|PDE9A_ENST00000335440.6_Intron|PDE9A_ENST00000349112.3_Intron|PDE9A_ENST00000335512.4_Intron|PDE9A_ENST00000398232.3_Missense_Mutation_p.E62G|PDE9A_ENST00000380328.2_Intron|AP001627.1_ENST00000437426.1_RNA	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	129					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	GGACAGGTAGAGCCCAGGCCC	0.652																																					p.E129G		.											.	PDE9A-92	0			c.A386G						.						56.0	59.0	58.0					21																	44152003		2203	4300	6503	SO:0001583	missense	5152	exon5			AGGTAGAGCCCAG	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.386A>G	21.37:g.44152003A>G	ENSP00000291539:p.Glu129Gly	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	50	26	NM_002606	0	0	9	11	2	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	ENST00000291539.6	37	CCDS13690.1	.	.	.	.	.	.	.	.	.	.	A	5.981	0.364909	0.11296	.	.	ENSG00000160191	ENST00000291539;ENST00000398232;ENST00000328862;ENST00000398225	T;T;T;T	0.69435	-0.37;-0.4;-0.39;-0.38	2.62	-5.23	0.02798	.	2.493450	0.01301	N	0.010305	T	0.41026	0.1141	N	0.08118	0	0.09310	N	1	B;B;B;B	0.19706	0.038;0.003;0.003;0.002	B;B;B;B	0.19391	0.025;0.001;0.001;0.0	T	0.17930	-1.0353	10	0.49607	T	0.09	.	0.789	0.01054	0.4523:0.1816:0.1307:0.2354	.	62;103;88;129	O76083-13;O76083-15;O76083-14;O76083	.;.;.;PDE9A_HUMAN	G	129;62;103;88	ENSP00000291539:E129G;ENSP00000381287:E62G;ENSP00000328699:E103G;ENSP00000381281:E88G	ENSP00000291539:E129G	E	+	2	0	PDE9A	43025072	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.271000	0.18626	-2.215000	0.00733	0.383000	0.25322	GAG	.		0.652	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		
COL6A1	1291	hgsc.bcm.edu	37	21	47421874	47421874	+	Splice_Site	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr21:47421874G>A	ENST00000361866.3	+	31	2070		c.e31-1		COL6A1_ENST00000498614.1_Splice_Site	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CGGTCCCACAGTTCGAGCCAG	0.662																																					.		.											.	COL6A1-91	0			c.1957-1G>A						.						32.0	31.0	31.0					21																	47421874		2203	4300	6503	SO:0001630	splice_region_variant	1291	exon31			CCCACAGTTCGAG	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1957-1G>A	21.37:g.47421874G>A		Somatic	73	0		WXS	Illumina HiSeq	Phase_I	30	2	NM_001848	0	0	0	0	0	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Splice_Site	SNP	ENST00000361866.3	37	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	G	9.648	1.140692	0.21205	.	.	ENSG00000142156	ENST00000361866	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9973	0.86371	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL6A1	46246302	1.000000	0.71417	0.966000	0.40874	0.032000	0.12392	5.447000	0.66606	2.020000	0.59435	0.462000	0.41574	.	.		0.662	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	Intron
SPECC1L	23384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	24734414	24734414	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr22:24734414C>T	ENST00000314328.9	+	10	2906	c.2621C>T	c.(2620-2622)aCc>aTc	p.T874I	SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.T874I|SPECC1L_ENST00000541492.1_Missense_Mutation_p.T874I|SPECC1L_ENST00000437398.1_Missense_Mutation_p.T874I	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	874					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CCTATGAAAACCCCTCCTGCA	0.498																																					p.T874I		.											.	SPECC1L-92	0			c.C2621T						.						162.0	158.0	160.0					22																	24734414		2203	4300	6503	SO:0001583	missense	23384	exon9			TGAAAACCCCTCC	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.2621C>T	22.37:g.24734414C>T	ENSP00000325785:p.Thr874Ile	Somatic	242	0		WXS	Illumina HiSeq	Phase_I	216	89	NM_001145468	0	0	28	51	23	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	c	29.1	4.976045	0.92982	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000314328;ENST00000541492	T;T;T	0.53640	0.61;0.61;0.61	5.69	5.69	0.88448	.	0.050156	0.85682	D	0.000000	T	0.69124	0.3076	M	0.68593	2.085	0.80722	D	1	D;P	0.89917	1.0;0.906	D;P	0.91635	0.999;0.521	T	0.69614	-0.5098	10	0.72032	D	0.01	-23.2113	19.1962	0.93690	0.0:1.0:0.0:0.0	.	874;874	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	I	902;874;874;874	ENSP00000393363:T874I;ENSP00000325785:T874I;ENSP00000439633:T874I	ENSP00000325785:T874I	T	+	2	0	SPECC1L	23064414	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	5.103000	0.64578	2.865000	0.98341	0.655000	0.94253	ACC	.		0.498	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
GGT1	2678	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	25023938	25023938	+	Missense_Mutation	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr22:25023938T>C	ENST00000400382.1	+	13	2083	c.1328T>C	c.(1327-1329)aTc>aCc	p.I443T	GGT1_ENST00000466310.1_3'UTR|GGT1_ENST00000403838.1_Missense_Mutation_p.I99T|GGT1_ENST00000248923.4_Missense_Mutation_p.I443T|GGT1_ENST00000401885.1_Missense_Mutation_p.I99T|GGT1_ENST00000406383.2_Missense_Mutation_p.I443T|GGT1_ENST00000404920.1_Missense_Mutation_p.I99T|GGT1_ENST00000404223.1_Missense_Mutation_p.I99T|GGT1_ENST00000400380.1_Missense_Mutation_p.I443T|GGT1_ENST00000400383.1_Missense_Mutation_p.I443T|GGT1_ENST00000404532.1_Missense_Mutation_p.I99T			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	443					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	GCCAATTTCATCCAGCCAGGT	0.617																																					p.I443T		.											.	GGT1-90	0			c.T1328C						.						42.0	50.0	47.0					22																	25023938		2202	4297	6499	SO:0001583	missense	2678	exon13			ATTTCATCCAGCC	M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.1328T>C	22.37:g.25023938T>C	ENSP00000383232:p.Ile443Thr	Somatic	225	0		WXS	Illumina HiSeq	Phase_I	99	48	NM_013430	0	0	0	0	0	Q08247|Q14404|Q8TBS1|Q9UMK1	Missense_Mutation	SNP	ENST00000400382.1	37	CCDS42992.1	.	.	.	.	.	.	.	.	.	.	.	13.53	2.265969	0.40095	.	.	ENSG00000100031	ENST00000248923;ENST00000412658;ENST00000400382;ENST00000400383;ENST00000400380;ENST00000406383;ENST00000401885;ENST00000404532;ENST00000403838;ENST00000404223;ENST00000404920	T;T;T;T;T;T;T;T;T;T;T	0.09073	3.02;3.02;3.02;3.02;3.02;3.02;3.02;3.02;3.02;3.02;3.02	3.49	3.49	0.39957	.	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	H	0.98256	4.185	0.46901	D	0.999246	D	0.89917	1.0	D	0.79784	0.993	T	0.61232	-0.7104	10	0.87932	D	0	-34.9439	11.6793	0.51448	0.0:0.0:0.0:1.0	.	443	P19440	GGT1_HUMAN	T	443;443;443;443;443;443;99;99;99;99;99	ENSP00000248923:I443T;ENSP00000393537:I443T;ENSP00000383232:I443T;ENSP00000383233:I443T;ENSP00000383231:I443T;ENSP00000385975:I443T;ENSP00000384381:I99T;ENSP00000385445:I99T;ENSP00000384820:I99T;ENSP00000385016:I99T;ENSP00000385001:I99T	ENSP00000248923:I443T	I	+	2	0	GGT1	23353938	1.000000	0.71417	0.952000	0.39060	0.028000	0.11728	7.217000	0.77982	1.593000	0.50029	0.373000	0.22412	ATC	.		0.617	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250797.1	NM_013430	
CHKB	1120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	51018475	51018475	+	Silent	SNP	A	A	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr22:51018475A>C	ENST00000406938.2	-	8	1072	c.855T>G	c.(853-855)gtT>gtG	p.V285V	CPT1B_ENST00000395650.2_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CHKB-CPT1B_ENST00000453634.1_5'Flank|CPT1B_ENST00000360719.2_5'Flank|CHKB-CPT1B_ENST00000452668.1_5'Flank|CHKB-AS1_ENST00000380711.3_RNA|CPT1B_ENST00000457250.1_5'Flank|CPT1B_ENST00000440709.1_5'Flank|CPT1B_ENST00000312108.7_5'Flank|CHKB_ENST00000463053.1_5'Flank|CPT1B_ENST00000405237.3_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	285					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	TATAATCATAAACCCACTCAC	0.522																																					p.V285V		.											.	CHKB-90	0			c.T855G						.						88.0	94.0	92.0					22																	51018475		2203	4300	6503	SO:0001819	synonymous_variant	1120	exon8			ATCATAAACCCAC	AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.855T>G	22.37:g.51018475A>C		Somatic	125	0		WXS	Illumina HiSeq	Phase_I	134	54	NM_005198	0	0	14	20	6	A0PJM6|Q13388	Silent	SNP	ENST00000406938.2	37	CCDS14099.1																																																																																			.		0.522	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317267.3	NM_005198	
CAMK1	8536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9802445	9802445	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr3:9802445C>T	ENST00000256460.3	-	8	817	c.640G>A	c.(640-642)Ggt>Agt	p.G214S	OGG1_ENST00000449570.2_Intron|OGG1_ENST00000302008.8_Intron|OGG1_ENST00000383826.5_Intron|OGG1_ENST00000302036.7_Intron|OGG1_ENST00000349503.5_Intron	NM_003656.4	NP_003647.1	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	214	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|nucleocytoplasmic transport (GO:0006913)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of synapse structural plasticity (GO:0051835)|protein phosphorylation (GO:0006468)|regulation of muscle cell differentiation (GO:0051147)|regulation of protein binding (GO:0043393)|regulation of protein localization (GO:0032880)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)	p.G214S(1)		endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	12	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		GGAGGGTAACCGCAGAGCCTG	0.552																																					p.G214S		.											.	CAMK1-335	1	Substitution - Missense(1)	endometrium(1)	c.G640A						.						82.0	77.0	78.0					3																	9802445		2203	4300	6503	SO:0001583	missense	8536	exon8			GGTAACCGCAGAG	L41816	CCDS2582.1	3p25.3	2004-02-27			ENSG00000134072	ENSG00000134072			1459	protein-coding gene	gene with protein product		604998				7641687	Standard	NM_003656		Approved	CaMKI	uc003bst.3	Q14012	OTTHUMG00000128419	ENST00000256460.3:c.640G>A	3.37:g.9802445C>T	ENSP00000256460:p.Gly214Ser	Somatic	76	0		WXS	Illumina HiSeq	Phase_I	46	22	NM_003656	0	0	2	3	1	Q3KPF6	Missense_Mutation	SNP	ENST00000256460.3	37	CCDS2582.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.258485|5.258485	0.95368|0.95368	.|.	.|.	ENSG00000134072|ENSG00000134072	ENST00000256460|ENST00000421120	T|.	0.58210|.	0.35|.	5.13|5.13	5.13|5.13	0.70059|0.70059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82962|0.82962	0.5151|0.5151	M|M	0.87269|0.87269	2.87|2.87	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.80764|.	0.994|.	D|D	0.85554|0.85554	0.1223|0.1223	10|5	0.87932|.	D|.	0|.	-14.0937|-14.0937	17.3689|17.3689	0.87371|0.87371	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	214|.	Q14012|.	KCC1A_HUMAN|.	S|Q	214|60	ENSP00000256460:G214S|.	ENSP00000256460:G214S|.	G|R	-|-	1|2	0|0	CAMK1|CAMK1	9777445|9777445	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.793000|0.793000	0.44817|0.44817	7.648000|7.648000	0.83479|0.83479	2.384000|2.384000	0.81235|0.81235	0.655000|0.655000	0.94253|0.94253	GGT|CGG	.		0.552	CAMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250206.1	NM_003656	
ARIH2OS	646450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	48956091	48956091	+	Silent	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr3:48956091T>A	ENST00000408959.2	-	1	727	c.492A>T	c.(490-492)ccA>ccT	p.P164P	ARIH2_ENST00000356401.4_5'Flank|ARIH2_ENST00000449376.1_5'Flank	NM_001123040.1	NP_001116512.1	Q8N7S6	ARI2O_HUMAN	ariadne homolog 2 opposite strand	164						integral component of membrane (GO:0016021)											CGGGAGACGCTGGTAGGCGAA	0.587																																					p.P164P		.											.	.	0			c.A492T						.						47.0	49.0	49.0					3																	48956091		1568	3582	5150	SO:0001819	synonymous_variant	646450	exon1			AGACGCTGGTAGG	DA461567	CCDS43088.1	3p21.31	2012-10-08	2012-10-08	2012-10-08	ENSG00000221883	ENSG00000221883			34425	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 71"""	C3orf71			Standard	NM_001123040		Approved		uc010hkk.1	Q8N7S6	OTTHUMG00000156672	ENST00000408959.2:c.492A>T	3.37:g.48956091T>A		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	58	34	NM_001123040	0	0	0	0	0		Silent	SNP	ENST00000408959.2	37	CCDS43088.1																																																																																			.		0.587	ARIH2OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345247.1	NM_001123040	
ARHGEF3	50650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	56789065	56789065	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr3:56789065T>A	ENST00000296315.3	-	3	487	c.319A>T	c.(319-321)Acc>Tcc	p.T107S	ARHGEF3_ENST00000497267.1_Missense_Mutation_p.T78S|ARHGEF3_ENST00000413728.2_Missense_Mutation_p.T113S|ARHGEF3_ENST00000338458.4_Missense_Mutation_p.T139S|ARHGEF3_ENST00000495373.1_Missense_Mutation_p.T107S|ARHGEF3_ENST00000496106.1_Missense_Mutation_p.T113S|ARHGEF3_ENST00000498517.1_5'UTR	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	107					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		ACATCGAAGGTCTCACTCCAC	0.587																																					p.T139S		.											.	ARHGEF3-228	0			c.A415T						.						165.0	147.0	153.0					3																	56789065		2203	4300	6503	SO:0001583	missense	50650	exon6			CGAAGGTCTCACT	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.319A>T	3.37:g.56789065T>A	ENSP00000296315:p.Thr107Ser	Somatic	267	1		WXS	Illumina HiSeq	Phase_I	184	87	NM_001128615	0	0	5	7	2	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Missense_Mutation	SNP	ENST00000296315.3	37	CCDS2878.1	.	.	.	.	.	.	.	.	.	.	T	35	5.460720	0.96240	.	.	ENSG00000163947	ENST00000296315;ENST00000338458;ENST00000413728;ENST00000496106;ENST00000497267;ENST00000495373;ENST00000468727;ENST00000473779	T;T;T;T;T;T;T;T	0.67345	1.6;1.6;1.6;1.6;1.6;1.6;-0.26;-0.26	5.32	5.32	0.75619	Dbl homology (DH) domain (1);	0.000000	0.85682	D	0.000000	T	0.79476	0.4452	M	0.74881	2.28	0.54753	D	0.999988	D;P;P;D;D;D	0.58268	0.969;0.938;0.882;0.982;0.982;0.982	P;P;P;P;P;P	0.60682	0.798;0.628;0.55;0.878;0.855;0.878	T	0.81760	-0.0785	10	0.59425	D	0.04	-11.4376	15.6104	0.76713	0.0:0.0:0.0:1.0	.	113;78;107;139;107;113	E9PG37;E7EU49;C9J586;Q9NR81-2;Q9NR81;Q9NR81-3	.;.;.;.;ARHG3_HUMAN;.	S	107;139;113;113;78;107;108;125	ENSP00000296315:T107S;ENSP00000341071:T139S;ENSP00000410922:T113S;ENSP00000420420:T113S;ENSP00000418826:T78S;ENSP00000417986:T107S;ENSP00000417087:T108S;ENSP00000420402:T125S	ENSP00000296315:T107S	T	-	1	0	ARHGEF3	56764105	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.991000	0.88244	2.156000	0.67533	0.533000	0.62120	ACC	.		0.587	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
RNF13	11342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	149678575	149678575	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr3:149678575C>G	ENST00000344229.3	+	11	1532	c.830C>G	c.(829-831)aCc>aGc	p.T277S	RNF13_ENST00000361785.6_Missense_Mutation_p.T158S|RNF13_ENST00000392894.3_Missense_Mutation_p.T277S	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	277					protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ACCAAAAAAACCTGTCCAGTG	0.398																																					p.T277S		.											.	RNF13-227	0			c.C830G						.						67.0	66.0	66.0					3																	149678575		2203	4300	6503	SO:0001583	missense	11342	exon11			AAAAAACCTGTCC	AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.830C>G	3.37:g.149678575C>G	ENSP00000341361:p.Thr277Ser	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	69	24	NM_007282	0	0	46	92	46	A6NC87|B3KR12|Q05D66|Q6IBJ9	Missense_Mutation	SNP	ENST00000344229.3	37	CCDS3146.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.38|17.38	3.374025|3.374025	0.61735|0.61735	.|.	.|.	ENSG00000082996|ENSG00000082996	ENST00000468289|ENST00000392894;ENST00000344229;ENST00000491086;ENST00000543506;ENST00000361785;ENST00000482083	.|T;T;T;T;T	.|0.41065	.|1.01;1.01;1.01;1.01;1.01	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46852|0.46852	0.1414|0.1414	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|B;P	.|0.38565	.|0.213;0.637	.|B;P	.|0.46452	.|0.193;0.517	T|T	0.19745|0.19745	-1.0296|-1.0296	5|10	.|0.41790	.|T	.|0.15	-20.7775|-20.7775	20.6397|20.6397	0.99537|0.99537	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|158;277	.|B3KR12;O43567	.|.;RNF13_HUMAN	K|S	78|277;277;158;277;158;158	.|ENSP00000376628:T277S;ENSP00000341361:T277S;ENSP00000420667:T158S;ENSP00000355268:T158S;ENSP00000418863:T158S	.|ENSP00000341361:T277S	N|T	+|+	3|2	2|0	RNF13|RNF13	151161265|151161265	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.487000|7.487000	0.81328|0.81328	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	AAC|ACC	.		0.398	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356876.1	NM_183384	
PSMD2	5708	hgsc.bcm.edu	37	3	184019770	184019770	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr3:184019770C>T	ENST00000310118.4	+	5	1173	c.615C>T	c.(613-615)tgC>tgT	p.C205C	PSMD2_ENST00000435761.1_Silent_p.C46C|PSMD2_ENST00000439383.1_Silent_p.C75C|EIF2B5_ENST00000444495.1_Intron	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	205					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	ATGAGGCTTGCGACCTGCTTA	0.507																																					p.C205C	Colon(24;313 636 6917 9932 15554)	.											.	PSMD2-90	0			c.C615T						.						115.0	106.0	109.0					3																	184019770		2203	4300	6503	SO:0001819	synonymous_variant	5708	exon5			GGCTTGCGACCTG	AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.615C>T	3.37:g.184019770C>T		Somatic	150	1		WXS	Illumina HiSeq	Phase_I	165	9	NM_002808	0	1	80	82	1	B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Silent	SNP	ENST00000310118.4	37	CCDS3258.1																																																																																			.		0.507	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345843.1	NM_002808	
GABRA2	2555	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	46312218	46312218	+	Silent	SNP	A	A	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr4:46312218A>T	ENST00000510861.1	-	6	704	c.531T>A	c.(529-531)gcT>gcA	p.A177A	GABRA2_ENST00000381620.4_Silent_p.A177A|GABRA2_ENST00000515082.1_Silent_p.A177A|GABRA2_ENST00000507069.1_Silent_p.A177A|GABRA2_ENST00000356504.1_Silent_p.A177A|GABRA2_ENST00000514090.1_Silent_p.A177A|GABRA2_ENST00000540012.1_Silent_p.A122A			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	177					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	GACATGAATGAGCATCCATTG	0.388																																					p.A177A		.											.	GABRA2-94	0			c.T531A						.						135.0	130.0	132.0					4																	46312218		2203	4300	6503	SO:0001819	synonymous_variant	2555	exon6			TGAATGAGCATCC		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.531T>A	4.37:g.46312218A>T		Somatic	67	0		WXS	Illumina HiSeq	Phase_I	125	52	NM_000807	0	0	0	0	0	A8K0U7|B7Z1H8|Q59G14	Silent	SNP	ENST00000510861.1	37	CCDS3471.1																																																																																			.		0.388	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		
CLOCK	9575	hgsc.bcm.edu	37	4	56322462	56322462	+	Missense_Mutation	SNP	C	C	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr4:56322462C>G	ENST00000309964.4	-	11	1048	c.798G>C	c.(796-798)atG>atC	p.M266I	CLOCK_ENST00000381322.1_Missense_Mutation_p.M266I|CLOCK_ENST00000513440.1_Missense_Mutation_p.M266I	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	266	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			CAACAGTGCACATTTCCTACa	0.294																																					p.M266I		.											.	CLOCK-515	0			c.G798C						.						28.0	29.0	29.0					4																	56322462		2196	4288	6484	SO:0001583	missense	9575	exon12			AGTGCACATTTCC	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.798G>C	4.37:g.56322462C>G	ENSP00000308741:p.Met266Ile	Somatic	7	0		WXS	Illumina HiSeq	Phase_I	25	2	NM_004898	0	0	0	0	0	A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	ENST00000309964.4	37	CCDS3500.1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724925	0.89298	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	T;T;T	0.04015	3.73;3.73;3.73	5.5	5.5	0.81552	PAS (1);	0.069843	0.85682	D	0.000000	T	0.10937	0.0267	M	0.68952	2.095	0.80722	D	1	B	0.21520	0.057	B	0.27715	0.082	T	0.03566	-1.1024	10	0.72032	D	0.01	.	19.3891	0.94573	0.0:1.0:0.0:0.0	.	266	O15516	CLOCK_HUMAN	I	266	ENSP00000308741:M266I;ENSP00000370723:M266I;ENSP00000426983:M266I	ENSP00000308741:M266I	M	-	3	0	CLOCK	56017219	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.579000	0.87056	0.591000	0.81541	ATG	.		0.294	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361993.2	NM_004898	
HERC5	51191	hgsc.bcm.edu	37	4	89408218	89408218	+	Splice_Site	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr4:89408218A>G	ENST00000264350.3	+	15	2004		c.e15-1		HERC5_ENST00000508159.1_Splice_Site	NM_016323.3	NP_057407.2	Q9UII4	HERC5_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 5						cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of defense response to virus (GO:0050688)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ISG15 ligase activity (GO:0042296)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|liver(2)|lung(17)|ovary(4)|prostate(1)|skin(4)	53		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TTCCATTTTTAGGACGCTTCA	0.343																																					.	Esophageal Squamous(39;887 1012 34045 50514)	.											.	HERC5-664	0			c.1852-2A>G						.						74.0	73.0	73.0					4																	89408218		2203	4298	6501	SO:0001630	splice_region_variant	51191	exon15			ATTTTTAGGACGC	AB027289	CCDS3630.1	4q22.1-q23	2012-02-23	2012-02-23		ENSG00000138646	ENSG00000138646			24368	protein-coding gene	gene with protein product		608242	"""hect domain and RLD 5"""			10581175	Standard	NM_016323		Approved	CEB1	uc003hrt.4	Q9UII4	OTTHUMG00000130953	ENST00000264350.3:c.1852-1A>G	4.37:g.89408218A>G		Somatic	21	0		WXS	Illumina HiSeq	Phase_I	35	2	NM_016323	0	0	0	0	0	B2RTQ1|Q69G20	Splice_Site	SNP	ENST00000264350.3	37	CCDS3630.1	.	.	.	.	.	.	.	.	.	.	A	12.50	1.955460	0.34471	.	.	ENSG00000138646	ENST00000264350;ENST00000508159	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6988	0.51558	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HERC5	89627241	1.000000	0.71417	1.000000	0.80357	0.496000	0.33645	4.111000	0.57838	2.084000	0.62774	0.482000	0.46254	.	.		0.343	HERC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253554.2	NM_016323	Intron
GALNTL6	442117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	173269759	173269759	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr4:173269759C>T	ENST00000506823.1	+	5	1129	c.472C>T	c.(472-474)Cgg>Tgg	p.R158W	GALNTL6_ENST00000508122.1_Missense_Mutation_p.R141W|GALNTL6_ENST00000457021.1_3'UTR	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	158	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						TTCACTCCTGCGGACCATACA	0.428																																					p.R158W		.											.	GALNTL6-137	0			c.C472T						.						141.0	132.0	135.0					4																	173269759		2203	4300	6503	SO:0001583	missense	442117	exon5			CTCCTGCGGACCA		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.472C>T	4.37:g.173269759C>T	ENSP00000423313:p.Arg158Trp	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	171	88	NM_001034845	0	0	0	0	0	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.376971	0.61735	.	.	ENSG00000174473	ENST00000506823;ENST00000404275;ENST00000508122	T;T	0.63913	-0.07;-0.07	5.38	1.32	0.21799	Glycosyl transferase, family 2 (1);	0.730958	0.11188	N	0.590274	D	0.88228	0.6380	H	0.99425	4.56	0.48341	D	0.999638	D	0.89917	1.0	D	0.97110	1.0	D	0.89622	0.3849	10	0.87932	D	0	.	14.8011	0.69916	0.6209:0.3791:0.0:0.0	.	158	Q49A17	GLTL6_HUMAN	W	158;158;141	ENSP00000423313:R158W;ENSP00000423827:R141W	ENSP00000385382:R158W	R	+	1	2	GALNTL6	173506334	0.987000	0.35691	1.000000	0.80357	0.979000	0.70002	0.342000	0.19926	0.212000	0.20703	-0.470000	0.05040	CGG	.		0.428	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	
SLC9A3	6550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	476140	476140	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:476140T>A	ENST00000264938.3	-	14	2144	c.2135A>T	c.(2134-2136)gAg>gTg	p.E712V	CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.7_ENST00000606288.1_RNA|SLC9A3_ENST00000514375.1_Missense_Mutation_p.E703V|CTD-2228K2.7_ENST00000607286.1_RNA|CTD-2228K2.7_ENST00000606319.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	712					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CGCACCTTTCTCCTTGATGGT	0.642																																					p.E712V		.											.	SLC9A3-90	0			c.A2135T						.						24.0	26.0	25.0					5																	476140		2203	4300	6503	SO:0001583	missense	6550	exon14			CCTTTCTCCTTGA		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2135A>T	5.37:g.476140T>A	ENSP00000264938:p.Glu712Val	Somatic	77	0		WXS	Illumina HiSeq	Phase_I	24	9	NM_004174	0	0	20	20	0	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	T	9.100	1.003901	0.19199	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.72942	-0.7;-0.7	3.93	3.93	0.45458	.	11.221700	0.00508	N	0.000168	T	0.70360	0.3215	M	0.64997	1.995	0.30953	N	0.724513	B;P	0.35433	0.222;0.501	B;B	0.35470	0.059;0.203	T	0.57470	-0.7806	10	0.25106	T	0.35	.	9.4489	0.38714	0.0:0.0:0.0:1.0	.	703;712	E9PF67;P48764	.;SL9A3_HUMAN	V	712;703	ENSP00000264938:E712V;ENSP00000422983:E703V	ENSP00000264938:E712V	E	-	2	0	SLC9A3	529140	0.009000	0.17119	0.998000	0.56505	0.230000	0.25150	0.875000	0.28079	1.565000	0.49641	0.155000	0.16302	GAG	.		0.642	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
ADAMTS16	170690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	5235155	5235155	+	Missense_Mutation	SNP	G	G	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:5235155G>C	ENST00000274181.7	+	13	2017	c.1879G>C	c.(1879-1881)Ggc>Cgc	p.G627R	ADAMTS16_ENST00000513709.1_3'UTR	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	627	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTTCTGTGAGGGCTCCACTCG	0.443																																					p.G627R		.											.	ADAMTS16-275	0			c.G1879C						.						66.0	69.0	68.0					5																	5235155		1926	4118	6044	SO:0001583	missense	170690	exon13			TGTGAGGGCTCCA	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1879G>C	5.37:g.5235155G>C	ENSP00000274181:p.Gly627Arg	Somatic	126	0		WXS	Illumina HiSeq	Phase_I	81	34	NM_139056	0	0	15	22	7	C6G490|Q8IVE2	Missense_Mutation	SNP	ENST00000274181.7	37	CCDS43299.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337693	0.60963	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.09163	3.01	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.54886	0.1886	H	0.99565	4.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.76984	-0.2756	10	0.72032	D	0.01	.	17.2614	0.87071	0.0:0.0:1.0:0.0	.	627;627	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	R	627	ENSP00000274181:G627R	ENSP00000274181:G627R	G	+	1	0	ADAMTS16	5288155	1.000000	0.71417	0.963000	0.40424	0.056000	0.15407	9.323000	0.96364	2.446000	0.82766	0.655000	0.94253	GGC	.		0.443	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
DROSHA	29102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	31526783	31526783	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:31526783G>T	ENST00000511367.2	-	4	501	c.257C>A	c.(256-258)cCt>cAt	p.P86H	DROSHA_ENST00000344624.3_Missense_Mutation_p.P86H|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000513349.1_Missense_Mutation_p.P86H|DROSHA_ENST00000442743.1_Missense_Mutation_p.P86H	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	86	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						CGCTGACGGAGGCATGGGTGG	0.592																																					p.P86H		.											.	DROSHA-227	0			c.C257A						.						29.0	33.0	32.0					5																	31526783		1994	4160	6154	SO:0001583	missense	29102	exon4			GACGGAGGCATGG	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.257C>A	5.37:g.31526783G>T	ENSP00000425979:p.Pro86His	Somatic	47	1		WXS	Illumina HiSeq	Phase_I	46	22	NM_013235	0	0	4	17	13	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	37	CCDS47195.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502885	0.64298	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000507438	T;T;T;T;T	0.48522	1.29;1.29;0.81;0.81;0.88	5.41	5.41	0.78517	.	0.192038	0.44902	D	0.000411	T	0.45816	0.1361	N	0.19112	0.55	0.39763	D	0.972056	P;D;D	0.63046	0.878;0.992;0.992	P;P;P	0.51355	0.575;0.667;0.667	T	0.38824	-0.9643	10	0.30078	T	0.28	-6.4282	19.2155	0.93776	0.0:0.0:1.0:0.0	.	86;86;86	Q9NRR4-2;E7EMP9;Q9NRR4	.;.;RNC_HUMAN	H	86;86;86;86;79;79;86	ENSP00000425979:P86H;ENSP00000339845:P86H;ENSP00000409335:P86H;ENSP00000424161:P86H;ENSP00000430921:P86H	ENSP00000265075:P79H	P	-	2	0	DROSHA	31562540	1.000000	0.71417	0.987000	0.45799	0.985000	0.73830	6.322000	0.72886	2.535000	0.85469	0.655000	0.94253	CCT	.		0.592	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235	
IL7R	3575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	35876145	35876145	+	Missense_Mutation	SNP	G	G	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:35876145G>T	ENST00000303115.3	+	8	1066	c.937G>T	c.(937-939)Gac>Tac	p.D313Y	IL7R_ENST00000343305.4_3'UTR	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	313					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TAGGGTGGATGACATTCAAGC	0.438			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																														p.D313Y		.		Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	.	IL7R-157	0			c.G937T						.						89.0	84.0	85.0					5																	35876145		2203	4300	6503	SO:0001583	missense	3575	exon8			GTGGATGACATTC	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.937G>T	5.37:g.35876145G>T	ENSP00000306157:p.Asp313Tyr	Somatic	62	0		WXS	Illumina HiSeq	Phase_I	87	37	NM_002185	0	0	3	3	0	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	37	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199424	0.79015	.	.	ENSG00000168685	ENST00000303115;ENST00000505875	T;T	0.35421	1.9;1.31	6.06	6.06	0.98353	.	0.458345	0.25467	N	0.030468	T	0.30854	0.0778	N	0.14661	0.345	0.80722	D	1	D	0.56521	0.976	P	0.46975	0.533	T	0.09885	-1.0654	10	0.72032	D	0.01	-1.5157	16.1283	0.81408	0.0:0.0:1.0:0.0	.	313	P16871	IL7RA_HUMAN	Y	313;79	ENSP00000306157:D313Y;ENSP00000420923:D79Y	ENSP00000306157:D313Y	D	+	1	0	IL7R	35911902	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	3.729000	0.54999	2.871000	0.98454	0.655000	0.94253	GAC	.		0.438	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2		
TBCA	6902	hgsc.bcm.edu;broad.mit.edu	37	5	76987260	76987260	+	Missense_Mutation	SNP	C	C	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:76987260C>A	ENST00000380377.4	-	4	413	c.310G>T	c.(310-312)Gtg>Ttg	p.V104L	TBCA_ENST00000517881.1_5'UTR|TBCA_ENST00000306388.6_3'UTR|TBCA_ENST00000517679.1_Missense_Mutation_p.V115L|TBCA_ENST00000518338.2_Missense_Mutation_p.V127L|TBCA_ENST00000520361.1_Missense_Mutation_p.V75L|TBCA_ENST00000522370.1_Missense_Mutation_p.V80L	NM_004607.2	NP_004598.1	O75347	TBCA_HUMAN	tubulin folding cofactor A	104					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tubulin complex assembly (GO:0007021)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	chaperone binding (GO:0051087)|poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_lung(232;0.000511)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;1.02e-49)|Epithelial(54;1.05e-44)|all cancers(79;4.08e-40)		TCTAACTTCACTGAATCCAGT	0.333																																					p.V104L		.											.	TBCA-91	0			c.G310T						.						55.0	53.0	54.0					5																	76987260		2202	4292	6494	SO:0001583	missense	6902	exon4			ACTTCACTGAATC	AF038952	CCDS4040.1, CCDS75263.1	5q14.1	2008-02-05	2006-11-21		ENSG00000171530	ENSG00000171530			11579	protein-coding gene	gene with protein product		610058	"""tubulin-specific chaperone a"""			9653160, 8706133	Standard	XM_005248586		Approved		uc003kfh.1	O75347	OTTHUMG00000102173	ENST00000380377.4:c.310G>T	5.37:g.76987260C>A	ENSP00000369736:p.Val104Leu	Somatic	10	1		WXS	Illumina HiSeq	Phase_I	38	13	NM_004607	0	0	109	215	106	B4DT30	Missense_Mutation	SNP	ENST00000380377.4	37	CCDS4040.1	.	.	.	.	.	.	.	.	.	.	C	14.89	2.671277	0.47781	.	.	ENSG00000171530	ENST00000380377;ENST00000517679;ENST00000520361;ENST00000522370	.	.	.	5.76	4.9	0.64082	.	0.056024	0.64402	D	0.000001	T	0.62913	0.2467	M	0.77820	2.39	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.62553	-0.6830	9	0.54805	T	0.06	.	12.0348	0.53418	0.0:0.8608:0.0:0.1392	.	104	O75347	TBCA_HUMAN	L	104;115;75;80	.	ENSP00000369736:V104L	V	-	1	0	TBCA	77023016	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.282000	0.51693	1.442000	0.47568	-0.143000	0.13931	GTG	.		0.333	TBCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220021.3	NM_004607	
PPIC	5480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	122359696	122359696	+	Silent	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:122359696T>A	ENST00000306442.4	-	5	628	c.513A>T	c.(511-513)acA>acT	p.T171T	RN7SL689P_ENST00000577215.1_RNA	NM_000943.4	NP_000934.1	P45877	PPIC_HUMAN	peptidylprolyl isomerase C (cyclophilin C)	171	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	6		all_cancers(142;0.0168)|Prostate(80;0.0322)|Lung NSC(810;0.102)|all_lung(232;0.163)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	OV - Ovarian serous cystadenocarcinoma(64;0.000331)|Epithelial(69;0.000553)|all cancers(49;0.00505)	L-Proline(DB00172)	AGTGCACCACTGTCTGGTGAG	0.478																																					p.T171T	Ovarian(99;690 1502 20765 45543 49568)	.											.	PPIC-91	0			c.A513T						.						203.0	187.0	192.0					5																	122359696		2203	4300	6503	SO:0001819	synonymous_variant	5480	exon5			CACCACTGTCTGG	S71018	CCDS4133.1	5q23.2	2008-02-05			ENSG00000168938	ENSG00000168938	5.2.1.8		9256	protein-coding gene	gene with protein product		123842				1383094, 8031755	Standard	NM_000943		Approved	CYPC	uc003kth.3	P45877	OTTHUMG00000128921	ENST00000306442.4:c.513A>T	5.37:g.122359696T>A		Somatic	177	0		WXS	Illumina HiSeq	Phase_I	188	76	NM_000943	0	0	0	0	0	A4LBB5	Silent	SNP	ENST00000306442.4	37	CCDS4133.1																																																																																			.		0.478	PPIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250898.2	NM_000943	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140223201	140223201	+	Silent	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:140223201G>A	ENST00000531613.1	+	1	2295	c.2295G>A	c.(2293-2295)ccG>ccA	p.P765P	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA8_ENST00000378123.3_Silent_p.P765P|PCDHA4_ENST00000530339.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	765					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGGCCACCGAAGACGGACC	0.592																																					p.P765P		.											.	PCDHA8-92	0			c.G2295A						.						59.0	60.0	60.0					5																	140223201		2196	4262	6458	SO:0001819	synonymous_variant	56140	exon1			GCCACCGAAGACG	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.2295G>A	5.37:g.140223201G>A		Somatic	64	0		WXS	Illumina HiSeq	Phase_I	40	32	NM_031856	0	0	0	0	0	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																			.		0.592	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCDHGA12	26025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140811805	140811805	+	Silent	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:140811805G>A	ENST00000252085.3	+	1	1621	c.1479G>A	c.(1477-1479)gaG>gaA	p.E493E	PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	493	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCTGGCTGAGAACACCATCC	0.557																																					p.E493E		.											.	PCDHGA12-27	0			c.G1479A						.						75.0	81.0	79.0					5																	140811805		2203	4300	6503	SO:0001819	synonymous_variant	26025	exon1			GGCTGAGAACACC	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.1479G>A	5.37:g.140811805G>A		Somatic	161	0		WXS	Illumina HiSeq	Phase_I	87	36	NM_032094	0	0	0	0	0	O15100|Q6UW70|Q9Y5D7	Silent	SNP	ENST00000252085.3	37	CCDS4260.1																																																																																			.		0.557	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
LARP1	23367	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	154183178	154183178	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:154183178T>A	ENST00000336314.4	+	13	2105	c.2081T>A	c.(2080-2082)gTc>gAc	p.V694D		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	771					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CCAACCACTGTCCCAGAGTCA	0.582																																					p.V694D		.											.	LARP1-94	0			c.T2081A						.						153.0	132.0	139.0					5																	154183178		2203	4300	6503	SO:0001583	missense	23367	exon13			CCACTGTCCCAGA	AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.2081T>A	5.37:g.154183178T>A	ENSP00000336721:p.Val694Asp	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	64	29	NM_015315	0	0	49	85	36	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	ENST00000336314.4	37	CCDS4328.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.11|18.11	3.551818|3.551818	0.65311|0.65311	.|.	.|.	ENSG00000155506|ENSG00000155506	ENST00000518677|ENST00000336314;ENST00000518297;ENST00000524248	.|T;T;T	.|0.38240	.|1.67;1.15;1.22	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59459|0.59459	0.2195|0.2195	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.997;0.998	.|D;D	.|0.74348	.|0.92;0.983	T|T	0.60551|0.60551	-0.7241|-0.7241	5|10	.|0.48119	.|T	.|0.1	-16.9963|-16.9963	15.9212|15.9212	0.79575|0.79575	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|771;694	.|Q6PKG0;Q6PKG0-3	.|LARP1_HUMAN;.	T|D	85|694;771;566	.|ENSP00000336721:V694D;ENSP00000428589:V771D;ENSP00000429904:V566D	.|ENSP00000336721:V694D	S|V	+|+	1|2	0|0	LARP1|LARP1	154163371|154163371	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.186000|0.186000	0.23388|0.23388	7.633000|7.633000	0.83260|0.83260	2.155000|2.155000	0.67459|0.67459	0.460000|0.460000	0.39030|0.39030	TCC|GTC	.		0.582	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252509.1	NM_033551	
PANK3	79646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	167995656	167995656	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr5:167995656G>A	ENST00000239231.6	-	2	692	c.376C>T	c.(376-378)Cgc>Tgc	p.R126C	PANK3_ENST00000520504.1_5'Flank	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	126					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)	p.R126C(1)		NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CCTACTGTGCGAAAATCTTTT	0.373																																					p.R126C		.											.	PANK3-91	1	Substitution - Missense(1)	cervix(1)	c.C376T						.						80.0	77.0	78.0					5																	167995656		2203	4300	6503	SO:0001583	missense	79646	exon2			CTGTGCGAAAATC	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.376C>T	5.37:g.167995656G>A	ENSP00000239231:p.Arg126Cys	Somatic	71	0		WXS	Illumina HiSeq	Phase_I	102	36	NM_024594	0	0	0	0	0	D3DQL1|Q53FJ9|Q7RTX4	Missense_Mutation	SNP	ENST00000239231.6	37	CCDS4368.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021887	0.75275	.	.	ENSG00000120137	ENST00000239231;ENST00000522176	D;D	0.99582	-6.22;-6.22	5.81	5.81	0.92471	.	0.045054	0.85682	D	0.000000	D	0.99387	0.9784	M	0.72118	2.19	0.80722	D	1	D	0.61697	0.99	P	0.54856	0.762	D	0.99429	1.0935	10	0.54805	T	0.06	-7.4746	19.0666	0.93114	0.0:0.0:1.0:0.0	.	126	Q9H999	PANK3_HUMAN	C	126;111	ENSP00000239231:R126C;ENSP00000428631:R111C	ENSP00000239231:R126C	R	-	1	0	PANK3	167928234	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.446000	0.66600	2.736000	0.93811	0.655000	0.94253	CGC	.		0.373	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594	
DHX16	8449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30640454	30640454	+	Silent	SNP	G	G	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr6:30640454G>T	ENST00000376442.3	-	1	360	c.165C>A	c.(163-165)ctC>ctA	p.L55L		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	55					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						CCGGCCCACTGAGATCCAAGG	0.652																																					p.L55L		.											.	DHX16-228	0			c.C165A						.						51.0	54.0	53.0					6																	30640454		1508	2709	4217	SO:0001819	synonymous_variant	8449	exon1			CCCACTGAGATCC	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.165C>A	6.37:g.30640454G>T		Somatic	174	0		WXS	Illumina HiSeq	Phase_I	66	24	NM_003587	0	0	10	10	0	O60322|Q5JP45|Q969X7|Q96QC1	Silent	SNP	ENST00000376442.3	37	CCDS4685.1																																																																																			.		0.652	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
DHX16	8449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	30640464	30640464	+	Missense_Mutation	SNP	G	G	T	rs375439029		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr6:30640464G>T	ENST00000376442.3	-	1	350	c.155C>A	c.(154-156)aCc>aAc	p.T52N		NM_001164239.1|NM_003587.4	NP_001157711.1|NP_003578.2	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	52					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			kidney(2)|ovary(2)	4						GAGATCCAAGGTATCAGTGTC	0.647																																					p.T52N		.											.	DHX16-228	0			c.C155A						.						52.0	55.0	54.0					6																	30640464		1509	2709	4218	SO:0001583	missense	8449	exon1			TCCAAGGTATCAG	AB001601	CCDS4685.1	6p21.3	2010-02-17	2003-06-13	2003-06-20	ENSG00000204560	ENSG00000204560		"""DEAH-boxes"""	2739	protein-coding gene	gene with protein product		603405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16"""	DDX16		9547260	Standard	NM_003587		Approved	DBP2, Prp2, PRPF2	uc003nqz.3	O60231	OTTHUMG00000031060	ENST00000376442.3:c.155C>A	6.37:g.30640464G>T	ENSP00000365625:p.Thr52Asn	Somatic	177	0		WXS	Illumina HiSeq	Phase_I	70	23	NM_003587	0	0	13	13	0	O60322|Q5JP45|Q969X7|Q96QC1	Missense_Mutation	SNP	ENST00000376442.3	37	CCDS4685.1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604490	0.46423	.	.	ENSG00000204560	ENST00000376442	T	0.02709	4.19	4.61	4.61	0.57282	.	0.054721	0.64402	D	0.000001	T	0.01661	0.0053	L	0.52364	1.645	0.80722	D	1	P	0.41673	0.759	B	0.37267	0.245	T	0.63844	-0.6545	10	0.17832	T	0.49	.	16.3585	0.83245	0.0:0.0:1.0:0.0	.	52	O60231	DHX16_HUMAN	N	52	ENSP00000365625:T52N	ENSP00000365625:T52N	T	-	2	0	DHX16	30748443	1.000000	0.71417	0.876000	0.34364	0.601000	0.36947	7.517000	0.81783	2.395000	0.81488	0.400000	0.26472	ACC	.		0.647	DHX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076076.2	NM_003587	
MDN1	23195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	90426453	90426453	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr6:90426453C>T	ENST00000369393.3	-	44	6774	c.6659G>A	c.(6658-6660)gGc>gAc	p.G2220D	MDN1_ENST00000428876.1_Missense_Mutation_p.G2220D			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2220					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TTCAAATGTGCCATGGCTATG	0.473																																					p.G2220D		.											.	MDN1-100	0			c.G6659A						.						114.0	95.0	101.0					6																	90426453		2203	4300	6503	SO:0001583	missense	23195	exon44			AATGTGCCATGGC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.6659G>A	6.37:g.90426453C>T	ENSP00000358400:p.Gly2220Asp	Somatic	73	0		WXS	Illumina HiSeq	Phase_I	94	38	NM_014611	0	0	2	4	2	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900696	0.72754	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.58210	0.35;0.35	5.35	5.35	0.76521	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.75428	0.3848	M	0.91768	3.24	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.77640	-0.2512	10	0.42905	T	0.14	.	19.4391	0.94811	0.0:1.0:0.0:0.0	.	2220	Q9NU22	MDN1_HUMAN	D	2220	ENSP00000358400:G2220D;ENSP00000413970:G2220D	ENSP00000358400:G2220D	G	-	2	0	MDN1	90483174	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	7.600000	0.82769	2.660000	0.90430	0.557000	0.71058	GGC	.		0.473	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
SIM1	6492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	100895187	100895187	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr6:100895187A>T	ENST00000369208.3	-	9	1737	c.955T>A	c.(955-957)Tcc>Acc	p.S319T	SIM1_ENST00000262901.4_Missense_Mutation_p.S319T			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	319	PAC.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		GGCCTGGAGGAGCGACTGTTG	0.597																																					p.S319T		.											.	SIM1-94	0			c.T955A						.						165.0	123.0	137.0					6																	100895187		2203	4300	6503	SO:0001583	missense	6492	exon8			TGGAGGAGCGACT	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.955T>A	6.37:g.100895187A>T	ENSP00000358210:p.Ser319Thr	Somatic	100	0		WXS	Illumina HiSeq	Phase_I	59	22	NM_005068	0	0	8	17	9	Q5TDP7	Missense_Mutation	SNP	ENST00000369208.3	37	CCDS5045.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.772481	0.90108	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	T;T	0.16457	2.34;2.34	6.17	6.17	0.99709	PAS fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	L	0.39085	1.19	0.58432	D	0.999999	D	0.76494	0.999	D	0.73380	0.98	T	0.01273	-1.1399	10	0.49607	T	0.09	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	319	P81133	SIM1_HUMAN	T	319	ENSP00000358210:S319T;ENSP00000262901:S319T	ENSP00000262901:S319T	S	-	1	0	SIM1	101001908	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	7.296000	0.78790	2.371000	0.80710	0.533000	0.62120	TCC	.		0.597	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041628.3	NM_005068	
AHR	196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	17362177	17362177	+	Missense_Mutation	SNP	A	A	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:17362177A>T	ENST00000242057.4	+	3	949	c.306A>T	c.(304-306)agA>agT	p.R102S		NM_001621.4	NP_001612.1	P35869	AHR_HUMAN	aryl hydrocarbon receptor	102					apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|cell cycle (GO:0007049)|circadian regulation of gene expression (GO:0032922)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|regulation of B cell proliferation (GO:0030888)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to toxic substance (GO:0009636)|response to xenobiotic stimulus (GO:0009410)|transcription from RNA polymerase II promoter (GO:0006366)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosolic aryl hydrocarbon receptor complex (GO:0034752)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|Hsp90 protein binding (GO:0051879)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|urinary_tract(3)	33	Lung NSC(10;0.0392)|all_lung(11;0.0754)				Atorvastatin(DB01076)|Flutamide(DB00499)|Ginseng(DB01404)|Leflunomide(DB01097)|Mexiletine(DB00379)|Nimodipine(DB00393)	ATAACTGTAGAGCAGCAAATT	0.333																																					p.R102S		.											.	AHR-227	0			c.A306T						.						67.0	68.0	68.0					7																	17362177		2203	4299	6502	SO:0001583	missense	196	exon3			CTGTAGAGCAGCA	L19872	CCDS5366.1	7p15	2013-05-21			ENSG00000106546	ENSG00000106546		"""Basic helix-loop-helix proteins"""	348	protein-coding gene	gene with protein product		600253				8125016	Standard	NM_001621		Approved	bHLHe76	uc011jxz.1	P35869	OTTHUMG00000149967	ENST00000242057.4:c.306A>T	7.37:g.17362177A>T	ENSP00000242057:p.Arg102Ser	Somatic	24	0		WXS	Illumina HiSeq	Phase_I	102	47	NM_001621	0	0	91	177	86	A4D130|Q13728|Q13803|Q13804	Missense_Mutation	SNP	ENST00000242057.4	37	CCDS5366.1	.	.	.	.	.	.	.	.	.	.	A	2.672	-0.277392	0.05679	.	.	ENSG00000106546	ENST00000242057	T	0.05199	3.48	0.235	-0.47	0.12131	.	0.875214	0.10272	N	0.694599	T	0.07503	0.0189	M	0.69823	2.125	0.09310	N	1	B	0.29162	0.235	B	0.30401	0.115	T	0.42015	-0.9476	9	0.22706	T	0.39	.	.	.	.	.	102	P35869	AHR_HUMAN	S	102	ENSP00000242057:R102S	ENSP00000242057:R102S	R	+	3	2	AHR	17328702	0.648000	0.27313	0.005000	0.12908	0.666000	0.39218	-0.535000	0.06142	-0.797000	0.04450	-0.818000	0.03119	AGA	.		0.333	AHR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314620.2	NM_001621	
TWISTNB	221830	ucsc.edu	37	7	19738032	19738032	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:19738032C>T	ENST00000222567.5	-	4	994	c.924G>A	c.(922-924)aaG>aaA	p.K308K		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	308	Lys-rich.				transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						TCTTTTTTTTCTTTTTATGGT	0.378																																					p.K308K													.	TWISTNB-91	0			c.G924A						.						113.0	126.0	122.0					7																	19738032		2200	4298	6498	SO:0001819	synonymous_variant	221830	exon4			TTTTTTCTTTTTA	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.924G>A	7.37:g.19738032C>T		Somatic	125	0		WXS	Illumina HiSeq		419	5	NM_001002926	0	0	16	16	0	A0PJ45|B7Z724	Silent	SNP	ENST00000222567.5	37	CCDS34606.1																																																																																			.		0.378	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
CHN2	1124	ucsc.edu;bcgsc.ca	37	7	29519827	29519827	+	Intron	SNP	T	T	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:29519827T>C	ENST00000222792.6	+	7	1106				CHN2_ENST00000435288.2_Intron|CHN2_ENST00000409041.4_Missense_Mutation_p.F34S|CHN2_ENST00000546235.1_Intron|CHN2_ENST00000439711.2_Missense_Mutation_p.F34S|CHN2_ENST00000539389.1_Intron|CHN2_ENST00000495789.2_Intron|CHN2_ENST00000539406.1_Intron|CHN2_ENST00000421775.2_Missense_Mutation_p.F34S|CHN2_ENST00000424025.2_Missense_Mutation_p.F34S	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2						positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						GCCGTAGCCTTCGGGGTGAAG	0.537																																					p.F34S	Ovarian(1;44 48 13232 18918 31480)												.	CHN2-229	0			c.T101C						.						119.0	128.0	125.0					7																	29519827		1327	2309	3636	SO:0001627	intron_variant	1124	exon1			TAGCCTTCGGGGT	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.577-68T>C	7.37:g.29519827T>C		Somatic	38	0		WXS	Illumina HiSeq		46	26	NM_001039936	0	0	0	0	0	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.428851	0.25726	.	.	ENSG00000106069	ENST00000409041;ENST00000424025;ENST00000439711;ENST00000421775	T;T;T;T	0.74737	-0.36;0.05;-0.87;0.26	5.64	3.21	0.36854	.	.	.	.	.	T	0.59459	0.2195	N	0.22421	0.69	0.22424	N	0.99911	P;B;B;B;B;B;B;B	0.34909	0.475;0.072;0.0;0.013;0.017;0.021;0.003;0.135	B;B;B;B;B;B;B;B	0.26202	0.067;0.029;0.0;0.006;0.022;0.007;0.001;0.058	T	0.49652	-0.8917	9	0.87932	D	0	.	12.6683	0.56853	0.0:0.0:0.2607:0.7393	.	34;34;34;34;34;34;34;34	B3VCF1;B3VCF2;B3VCF5;B3VCF4;B3VCF7;B3VCF3;B3VCF6;E9PGE0	.;.;.;.;.;.;.;.	S	34	ENSP00000386849:F34S;ENSP00000406337:F34S;ENSP00000387425:F34S;ENSP00000394284:F34S	ENSP00000386849:F34S	F	+	2	0	CHN2	29486352	1.000000	0.71417	0.308000	0.25141	0.080000	0.17528	4.766000	0.62279	0.475000	0.27415	-0.299000	0.09455	TTC	.		0.537	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
PDE1C	5137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	31877507	31877507	+	Silent	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:31877507C>T	ENST00000396191.1	-	10	1514	c.1059G>A	c.(1057-1059)aaG>aaA	p.K353K	PDE1C_ENST00000396182.2_Silent_p.K353K|PDE1C_ENST00000396184.3_Silent_p.K353K|PDE1C_ENST00000396193.1_Silent_p.K413K|PDE1C_ENST00000321453.7_Silent_p.K353K	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	353	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	GCAGAGCAGTCTTCATTGCTT	0.433																																					p.K413K		.											.	PDE1C-94	0			c.G1239A						.						194.0	187.0	189.0					7																	31877507		2203	4300	6503	SO:0001819	synonymous_variant	5137	exon11			AGCAGTCTTCATT	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1059G>A	7.37:g.31877507C>T		Somatic	130	0		WXS	Illumina HiSeq	Phase_I	416	169	NM_001191058	0	0	0	0	0	B3KPC6|E9PE92|Q14124|Q8NB10	Silent	SNP	ENST00000396191.1	37	CCDS55099.1																																																																																			.		0.433	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	82579067	82579067	+	Missense_Mutation	SNP	C	C	A	rs370030206		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:82579067C>A	ENST00000333891.9	-	6	11174	c.10837G>T	c.(10837-10839)Gct>Tct	p.A3613S	PCLO_ENST00000437081.1_Missense_Mutation_p.A333S|PCLO_ENST00000423517.2_Missense_Mutation_p.A3613S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGGGAAGGAGCCAGCTGTACT	0.483																																					p.A3613S		.											.	PCLO-29	0			c.G10837T						.	C	SER/ALA,SER/ALA	1,4111		0,1,2055	106.0	107.0	106.0		10837,10837	5.6	1.0	7		106	1,8435		0,1,4217	no	missense,missense	PCLO	NM_033026.5,NM_014510.2	99,99	0,2,6272	AA,AC,CC		0.0119,0.0243,0.0159	benign,benign	3613/5143,3613/4936	82579067	2,12546	2056	4218	6274	SO:0001583	missense	27445	exon6			AAGGAGCCAGCTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10837G>T	7.37:g.82579067C>A	ENSP00000334319:p.Ala3613Ser	Somatic	87	0		WXS	Illumina HiSeq	Phase_I	234	127	NM_014510	0	0	8	15	7		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536177	0.27475	2.43E-4	1.19E-4	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.15603	2.41;2.41	5.61	5.61	0.85477	.	.	.	.	.	T	0.19327	0.0464	L	0.33485	1.01	0.30557	N	0.764896	B;B;B	0.28419	0.008;0.211;0.211	B;B;B	0.29716	0.004;0.106;0.106	T	0.09443	-1.0674	9	0.87932	D	0	.	19.6465	0.95778	0.0:1.0:0.0:0.0	.	3544;3613;3613	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	S	3544;3613;3613;333	ENSP00000334319:A3613S;ENSP00000388393:A3613S	ENSP00000334319:A3613S	A	-	1	0	PCLO	82417003	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.155000	0.58131	2.642000	0.89623	0.650000	0.86243	GCT	.		0.483	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
MET	4233	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	116422117	116422117	+	Missense_Mutation	SNP	T	T	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:116422117T>A	ENST00000318493.6	+	18	3839	c.3652T>A	c.(3652-3654)Ttt>Att	p.F1218I	MET_ENST00000539704.1_Missense_Mutation_p.F70I|MET_ENST00000397752.3_Missense_Mutation_p.F1200I			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.F1218V(1)		NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AAGCAAAAAGTTTGTCCACAG	0.393			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)																												p.F1218I		.		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	.	MET-5874	1	Substitution - Missense(1)	kidney(1)	c.T3652A						.						57.0	55.0	56.0					7																	116422117		1836	4092	5928	SO:0001583	missense	4233	exon18	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	AAAAAGTTTGTCC	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.3652T>A	7.37:g.116422117T>A	ENSP00000317272:p.Phe1218Ile	Somatic	22	0		WXS	Illumina HiSeq	Phase_I	75	31	NM_001127500	1	0	296	546	249	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	ENST00000318493.6	37	CCDS47689.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735740	0.89482	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000539704	T;T;T	0.25414	1.8;1.8;1.8	5.87	5.87	0.94306	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.37128	0.0992	N	0.16862	0.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.35201	-0.9798	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	1218;1200	P08581-2;P08581	.;MET_HUMAN	I	1200;1218;70	ENSP00000380860:F1200I;ENSP00000317272:F1218I;ENSP00000445020:F70I	ENSP00000317272:F1218I	F	+	1	0	MET	116209353	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.972000	0.88022	2.371000	0.80710	0.533000	0.62120	TTT	.		0.393	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059620.3		
CHRNB3	1142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	42565553	42565553	+	Missense_Mutation	SNP	G	G	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr8:42565553G>A	ENST00000289957.2	+	3	353	c.225G>A	c.(223-225)atG>atA	p.M75I	RP11-412B14.1_ENST00000527318.1_RNA	NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	75					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	ATCAGCTGATGACAACCAATG	0.313																																					p.M75I		.											.	CHRNB3-91	0			c.G225A						.						72.0	73.0	72.0					8																	42565553		2203	4300	6503	SO:0001583	missense	1142	exon3			GCTGATGACAACC	U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.225G>A	8.37:g.42565553G>A	ENSP00000289957:p.Met75Ile	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	37	21	NM_000749	0	0	0	0	0	Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	g	19.35	3.810373	0.70797	.	.	ENSG00000147432	ENST00000534391;ENST00000289957	T	0.78816	-1.21	6.03	6.03	0.97812	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.76702	0.4024	L	0.33624	1.015	0.80722	D	1	P	0.36712	0.566	B	0.43990	0.438	T	0.77763	-0.2466	10	0.87932	D	0	.	18.1139	0.89545	0.0:0.0:1.0:0.0	.	75	Q05901	ACHB3_HUMAN	I	1;75	ENSP00000289957:M75I	ENSP00000289957:M75I	M	+	3	0	CHRNB3	42684710	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.752000	0.91632	2.876000	0.98609	0.644000	0.83932	ATG	.		0.313	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1		
RBM12B	389677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	94747484	94747484	+	Silent	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr8:94747484A>G	ENST00000399300.2	-	3	1368	c.1155T>C	c.(1153-1155)caT>caC	p.H385H	RBM12B_ENST00000520961.1_Intron|RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000517700.1_Silent_p.H385H	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	385							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TTTGTGAAACATGTCCGGGCC	0.368																																					p.H385H		.											.	RBM12B-90	0			c.T1155C						.						124.0	121.0	122.0					8																	94747484		1836	4085	5921	SO:0001819	synonymous_variant	389677	exon3			TGAAACATGTCCG		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1155T>C	8.37:g.94747484A>G		Somatic	133	0		WXS	Illumina HiSeq	Phase_I	236	96	NM_203390	0	0	5	8	3	A8MYB5	Silent	SNP	ENST00000399300.2	37	CCDS43755.1																																																																																			.		0.368	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
VPS13B	157680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	100514063	100514063	+	Missense_Mutation	SNP	C	C	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr8:100514063C>T	ENST00000358544.2	+	26	4130	c.4019C>T	c.(4018-4020)cCa>cTa	p.P1340L	VPS13B_ENST00000395996.1_Missense_Mutation_p.P1340L|VPS13B_ENST00000357162.2_Missense_Mutation_p.P1340L	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1340					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			CTCTTTGCTCCAGATCCTGAA	0.483																																					p.P1340L	Colon(161;2205 2542 7338 31318)	.											.	VPS13B-301	0			c.C4019T						.						132.0	135.0	134.0					8																	100514063		2203	4300	6503	SO:0001583	missense	157680	exon26			TTGCTCCAGATCC	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4019C>T	8.37:g.100514063C>T	ENSP00000351346:p.Pro1340Leu	Somatic	111	0		WXS	Illumina HiSeq	Phase_I	140	54	NM_152564	0	0	2	4	2	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.507355	0.44558	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.45276	0.9;0.9;0.9	5.22	5.22	0.72569	.	0.215869	0.38548	N	0.001641	T	0.32315	0.0825	L	0.34521	1.04	0.53688	D	0.999974	B;B;B;B	0.09022	0.001;0.002;0.001;0.001	B;B;B;B	0.10450	0.005;0.004;0.004;0.002	T	0.06807	-1.0806	10	0.31617	T	0.26	.	12.4938	0.55916	0.0:0.9229:0.0:0.0771	.	1339;1340;1340;1340	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	L	1340	ENSP00000349685:P1340L;ENSP00000351346:P1340L;ENSP00000379318:P1340L	ENSP00000349685:P1340L	P	+	2	0	VPS13B	100583239	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.508000	0.67006	2.589000	0.87451	0.557000	0.71058	CCA	.		0.483	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
DGAT1	8694	ucsc.edu	37	8	145540219	145540219	+	Nonstop_Mutation	SNP	A	A	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr8:145540219A>T	ENST00000332324.4	-	17	1738	c.1465T>A	c.(1465-1467)Tga>Aga	p.*489R	DGAT1_ENST00000527438.1_5'UTR|GS1-393G12.12_ENST00000525023.1_RNA	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	0					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GGTGCAGCTCAGGCCTCTGCC	0.632																																					p.X489R													.	.	0			c.T1465A						.						45.0	37.0	39.0					8																	145540219		2190	4290	6480	SO:0001578	stop_lost	8694	exon17			CAGCTCAGGCCTC	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.1465T>A	8.37:g.145540219A>T		Somatic	24	0		WXS	Illumina HiSeq		6	1	NM_012079	0	0	14	14	0	B2RWQ2|D3DWL6|Q96BB8	Missense_Mutation	SNP	ENST00000332324.4	37	CCDS6420.1	.	.	.	.	.	.	.	.	.	.	A	11.14	1.549930	0.27652	.	.	ENSG00000185000	ENST00000332324	.	.	.	3.37	3.37	0.38596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.464	0.32944	1.0:0.0:0.0:0.0	.	.	.	.	R	489	.	.	X	-	1	0	DGAT1	145511027	0.544000	0.26441	0.972000	0.41901	0.034000	0.12701	0.494000	0.22467	1.800000	0.52685	0.459000	0.35465	TGA	.		0.632	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382059.3	NM_012079	
HUWE1	10075	hgsc.bcm.edu	37	X	53563131	53563131	+	Missense_Mutation	SNP	A	A	G			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chrX:53563131A>G	ENST00000342160.3	-	79	12965	c.12508T>C	c.(12508-12510)Tat>Cat	p.Y4170H	HUWE1_ENST00000262854.6_Missense_Mutation_p.Y4170H			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	4170	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GTGAGGTCATAGCCTAGTGTG	0.428																																					p.Y4170H		.											.	HUWE1-280	0			c.T12508C						.						187.0	126.0	147.0					X																	53563131		2203	4300	6503	SO:0001583	missense	10075	exon80			GGTCATAGCCTAG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.12508T>C	X.37:g.53563131A>G	ENSP00000340648:p.Tyr4170His	Somatic	23	0		WXS	Illumina HiSeq	Phase_I	40	2	NM_031407	0	0	58	58	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.03|11.03	1.517867|1.517867	0.27211|0.27211	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052;ENST00000426907|ENST00000342160;ENST00000262854	.|T;T	.|0.57595	.|0.39;0.39	5.57|5.57	4.39|4.39	0.52855|0.52855	.|HECT (4);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65069|0.65069	0.2656|0.2656	M|M	0.75777|0.75777	2.31|2.31	0.58432|0.58432	D|D	0.999998|0.999998	.|P;P	.|0.47604	.|0.735;0.898	.|P;P	.|0.56648	.|0.646;0.803	T|T	0.64028|0.64028	-0.6503|-0.6503	5|10	.|0.44086	.|T	.|0.13	.|.	10.3659|10.3659	0.44024|0.44024	0.8507:0.0:0.0:0.1493|0.8507:0.0:0.0:0.1493	.|.	.|4170;4154	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	P|H	3203;992|4170	.|ENSP00000340648:Y4170H;ENSP00000262854:Y4170H	.|ENSP00000262854:Y4170H	L|Y	-|-	2|1	0|0	HUWE1|HUWE1	53579856|53579856	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.465000|0.465000	0.32709|0.32709	8.644000|8.644000	0.91044|0.91044	0.816000|0.816000	0.34421|0.34421	-0.415000|-0.415000	0.06103|0.06103	CTA|TAT	.		0.428	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
ATP8B2	57198	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	154314963	154314968	+	In_Frame_Del	DEL	GTTTGA	GTTTGA	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	GTTTGA	GTTTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:154314963_154314968delGTTTGA	ENST00000368489.3	+	14	1350_1355	c.1350_1355delGTTTGA	c.(1348-1356)gtgtttgac>gtc	p.FD451del		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	437					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TAGGTGATGTGTTTGACGTCCTGGGA	0.49																																					p.450_452del		.											.	ATP8B2-92	0			c.1350_1355del						.																																			SO:0001651	inframe_deletion	57198	exon14			.	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1350_1355delGTTTGA	1.37:g.154314963_154314968delGTTTGA	ENSP00000357475:p.Phe451_Asp452del	Somatic	101	0		WXS	Illumina HiSeq	Phase_I	67	13	NM_020452	0	0	0	0	0	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	In_Frame_Del	DEL	ENST00000368489.3	37	CCDS1066.1																																																																																			.		0.490	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
ATP8B2	57198	hgsc.bcm.edu	37	1	154314963	154314972	+	Frame_Shift_Del	DEL	GTTTGACGTC	GTTTGACGTC	-	rs201587979|rs376489334		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	GTTTGACGTC	GTTTGACGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr1:154314963_154314972delGTTTGACGTC	ENST00000368489.3	+	14	1350_1359	c.1350_1359delGTTTGACGTC	c.(1348-1359)gtgtttgacgtcfs	p.VFDV450fs		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	436					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TAGGTGATGTGTTTGACGTCCTGGGACACA	0.49																																					p.450_453del		.											.	ATP8B2-92	0			c.1350_1359del						.																																			SO:0001589	frameshift_variant	57198	exon14			.	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.1350_1359delGTTTGACGTC	1.37:g.154314963_154314972delGTTTGACGTC	ENSP00000357475:p.Val450fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	68	11	NM_020452	0	0	0	0	0	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Frame_Shift_Del	DEL	ENST00000368489.3	37	CCDS1066.1																																																																																			.		0.490	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
ITGB1	3688	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	33201013	33201013	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr10:33201013delG	ENST00000396033.2	-	12	1644	c.1509delC	c.(1507-1509)agcfs	p.S503fs	ITGB1_ENST00000374956.4_Frame_Shift_Del_p.S503fs|ITGB1_ENST00000423113.1_Frame_Shift_Del_p.S503fs|ITGB1_ENST00000302278.3_Frame_Shift_Del_p.S503fs	NM_133376.2	NP_596867.1	P05556	ITB1_HUMAN	integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)	503	Cysteine-rich tandem repeats.				axon extension (GO:0048675)|axon guidance (GO:0007411)|B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cardiac muscle cell differentiation (GO:0055007)|cell fate specification (GO:0001708)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular response to ionizing radiation (GO:0071479)|cellular response to mechanical stimulus (GO:0071260)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|formation of radial glial scaffolds (GO:0021943)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell migration (GO:0008354)|heterotypic cell-cell adhesion (GO:0034113)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|maternal process involved in female pregnancy (GO:0060135)|mesodermal cell differentiation (GO:0048333)|negative regulation of anoikis (GO:2000811)|negative regulation of cell projection organization (GO:0031345)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein transport within lipid bilayer (GO:0032594)|regulation of cell cycle (GO:0051726)|regulation of collagen catabolic process (GO:0010710)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of immune response (GO:0050776)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|response to transforming growth factor beta (GO:0071559)|sarcomere organization (GO:0045214)|tight junction assembly (GO:0070830)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha1-beta1 complex (GO:0034665)|integrin alpha10-beta1 complex (GO:0034680)|integrin alpha11-beta1 complex (GO:0034681)|integrin alpha2-beta1 complex (GO:0034666)|integrin alpha3-beta1 complex (GO:0034667)|integrin alpha7-beta1 complex (GO:0034677)|integrin alpha8-beta1 complex (GO:0034678)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|intercalated disc (GO:0014704)|invadopodium membrane (GO:0071438)|membrane (GO:0016020)|membrane raft (GO:0045121)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|cell adhesion molecule binding (GO:0050839)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|peptide binding (GO:0042277)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|virus receptor activity (GO:0001618)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Ovarian(717;1.34e-05)|Breast(68;0.0634)			Antithymocyte globulin(DB00098)	CTTCATCTGTGCTGCATTCAC	0.413																																					p.S503fs		.											.	ITGB1-1084	0			c.1509delC						.						143.0	120.0	128.0					10																	33201013		2203	4300	6503	SO:0001589	frameshift_variant	3688	exon12			.	BC020057	CCDS7174.1	10p11.2	2010-10-13			ENSG00000150093	ENSG00000150093		"""CD molecules"", ""Integrins"""	6153	protein-coding gene	gene with protein product		135630		FNRB, MSK12, MDF2		2524991	Standard	NM_033668		Approved	CD29, GPIIA	uc001iwt.4	P05556	OTTHUMG00000017928	ENST00000396033.2:c.1509delC	10.37:g.33201013delG	ENSP00000379350:p.Ser503fs	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	95	41	NM_002211	0	0	0	0	0	A8K6N2|D3DRX9|D3DRY3|D3DRY4|D3DRY5|P78466|P78467|Q13089|Q13090|Q13091|Q13212|Q14622|Q14647|Q29RW2|Q7Z3V1|Q8WUM6	Frame_Shift_Del	DEL	ENST00000396033.2	37	CCDS7174.1																																																																																			.		0.413	ITGB1-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047496.1	NM_002211	
TPP1	1200	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	6638089	6638089	+	Splice_Site	DEL	A	A	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr11:6638089delA	ENST00000299427.6	-	7	749	c.689delT	c.(688-690)ttc>tc	p.F230fs	RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000533371.1_5'UTR	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	CTGCTCCAGGAACTATGGAGG	0.567																																					p.F230fs		.											.	TPP1-90	0			c.689delT						.						84.0	82.0	83.0					11																	6638089		2201	4296	6497	SO:0001630	splice_region_variant	1200	exon7			.	AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.688-1T>-	11.37:g.6638089delA		Somatic	171	0		WXS	Illumina HiSeq	Phase_I	103	54	NM_000391	0	0	0	0	0	Q71V64	Frame_Shift_Del	DEL	ENST00000299427.6	37	CCDS7770.1																																																																																			.		0.567	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2		Frame_Shift_Del
DUSP6	1848	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	89743102	89743107	+	In_Frame_Del	DEL	CTGGAA	CTGGAA	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	CTGGAA	CTGGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr12:89743102_89743107delCTGGAA	ENST00000279488.7	-	3	2301_2306	c.1070_1075delTTCCAG	c.(1069-1077)gttccagca>gca	p.VP357del	DUSP6_ENST00000547140.1_5'Flank|DUSP6_ENST00000547291.1_In_Frame_Del_p.VP232del|DUSP6_ENST00000308385.6_In_Frame_Del_p.VP211del	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	357	Tyrosine-protein phosphatase.				cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						AGCTGCTGTGCTGGAACCCTGTTGTC	0.5																																					p.357_359del	Colon(132;3456 5224)	.											.	DUSP6-846	0			c.1070_1075del						.																																			SO:0001651	inframe_deletion	1848	exon3			.	BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.1070_1075delTTCCAG	12.37:g.89743102_89743107delCTGGAA	ENSP00000279488:p.Val357_Pro358del	Somatic	146	0		WXS	Illumina HiSeq	Phase_I	129	41	NM_001946	0	0	0	0	0	O75109|Q53Y75|Q9BSH6	In_Frame_Del	DEL	ENST00000279488.7	37	CCDS9033.1																																																																																			.		0.500	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406534.2	NM_001946, NM_022652	
MIS18BP1	55320	broad.mit.edu	37	14	45693722	45693722	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr14:45693722delT	ENST00000310806.4	-	11	2526	c.2068delA	c.(2068-2070)agtfs	p.S690fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	690					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						CTGATGGGACTTTTTTTTTGA	0.373																																					p.S690fs													.	MIS18BP1-90	0			c.2068delA						.			10,4254		2,6,2124	97.0	100.0	99.0			-1.0	0.0	14		100	20,8234		2,16,4109	no	frameshift	MIS18BP1	NM_018353.4		4,22,6233	A1A1,A1R,RR		0.2423,0.2345,0.2397			45693722	30,12488	2203	4300	6503	SO:0001589	frameshift_variant	55320	exon11			TGGGACTTTTTTT	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2068delA	14.37:g.45693722delT	ENSP00000309790:p.Ser690fs	Somatic	67	0		WXS	Illumina HiSeq	Phase_I	152	7	NM_018353	0	0	0	0	0	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Del	DEL	ENST00000310806.4	37	CCDS9684.1																																																																																			.		0.373	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
SRCAP	10847	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30733503	30733503	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:30733503delC	ENST00000262518.4	+	22	3987	c.3602delC	c.(3601-3603)gcafs	p.A1201fs	SRCAP_ENST00000395059.2_Frame_Shift_Del_p.A1201fs|SRCAP_ENST00000344771.4_Frame_Shift_Del_p.A1105fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1201	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			GTGGCTAATGCAGGGGGAAGC	0.577																																					p.A1201fs		.											.	SRCAP-94	0			c.3602delC						.						128.0	106.0	113.0					16																	30733503		2197	4300	6497	SO:0001589	frameshift_variant	10847	exon22			.	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3602delC	16.37:g.30733503delC	ENSP00000262518:p.Ala1201fs	Somatic	238	0		WXS	Illumina HiSeq	Phase_I	97	33	NM_006662	0	0	0	0	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Del	DEL	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.577	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SRCAP	10847	hgsc.bcm.edu	37	16	30733507	30733507	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr16:30733507delG	ENST00000262518.4	+	22	3991	c.3606delG	c.(3604-3606)gggfs	p.G1203fs	SRCAP_ENST00000395059.2_Frame_Shift_Del_p.G1203fs|SRCAP_ENST00000344771.4_Frame_Shift_Del_p.G1107fs	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1203	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTAATGCAGGGGGAAGCAAAC	0.572																																					p.G1202fs		.											.	SRCAP-94	0			c.3606delG						.						129.0	107.0	114.0					16																	30733507		2197	4300	6497	SO:0001589	frameshift_variant	10847	exon22			.	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3606delG	16.37:g.30733507delG	ENSP00000262518:p.Gly1203fs	Somatic	245	0		WXS	Illumina HiSeq	Phase_I	102	27	NM_006662	0	0	0	0	0	B0JZA6|O15026|Q7Z744|Q9Y5L9	Frame_Shift_Del	DEL	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.572	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
SUPT6H	6830	broad.mit.edu	37	17	27001303	27001305	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr17:27001303_27001305delGAG	ENST00000314616.6	+	3	395_397	c.112_114delGAG	c.(112-114)gagdel	p.E43del	AC010761.13_ENST00000578819.1_RNA|SUPT6H_ENST00000347486.4_In_Frame_Del_p.E43del	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	43	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					TCTTCCAGATGAGGAGGAGGAGG	0.453																																					p.38_38del													.	SUPT6H-93	0			c.112_114del						.																																			SO:0001651	inframe_deletion	6830	exon3			CCAGATGAGGAGG	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.112_114delGAG	17.37:g.27001312_27001314delGAG	ENSP00000319104:p.Glu43del	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	83	7	NM_003170	0	0	0	0	0	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	In_Frame_Del	DEL	ENST00000314616.6	37	CCDS32596.1																																																																																			.		0.453	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
MBOAT2	129642	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	9002791	9002791	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:9002791delA	ENST00000305997.3	-	11	1312	c.1114delT	c.(1114-1116)tggfs	p.W372fs	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	372					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACCCCGTGCCAAATGGCAGAG	0.408																																					p.W372fs	Ovarian(194;1699 3813 22401)	.											.	MBOAT2-90	0			c.1114delT						.						96.0	91.0	93.0					2																	9002791		2203	4300	6503	SO:0001589	frameshift_variant	129642	exon11			.	BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.1114delT	2.37:g.9002791delA	ENSP00000302177:p.Trp372fs	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	86	39	NM_138799	0	0	0	0	0	A9EDR2|Q8NCE7|Q96KY4	Frame_Shift_Del	DEL	ENST00000305997.3	37	CCDS1660.1																																																																																			.		0.408	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206735.1	NM_138799	
POTEF	728378	hgsc.bcm.edu	37	2	130872496	130872496	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:130872496delT	ENST00000409914.2	-	5	1167	c.768delA	c.(766-768)aaafs	p.K256fs	POTEF_ENST00000361163.4_Frame_Shift_Del_p.K266fs|POTEF_ENST00000360967.5_Frame_Shift_Del_p.K256fs|POTEF_ENST00000357462.5_Frame_Shift_Del_p.K256fs	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	256					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						AGAGCAGTGCTTTGGCCATTA	0.338																																					p.K256fs		.											.	POTEF-27	0			c.768delA						.						3.0	3.0	3.0					2																	130872496		1247	2882	4129	SO:0001589	frameshift_variant	728378	exon5			.	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.768delA	2.37:g.130872496delT	ENSP00000386786:p.Lys256fs	Somatic	91	0		WXS	Illumina HiSeq	Phase_I	114	18	NM_001099771	0	0	0	0	0	A6NC34	Frame_Shift_Del	DEL	ENST00000409914.2	37	CCDS46409.1																																																																																			.		0.338	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
POTEE	445582	hgsc.bcm.edu	37	2	131981572	131981572	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:131981572delA	ENST00000356920.5	+	3	860	c.766delA	c.(766-768)aaafs	p.K256fs	POTEE_ENST00000358087.5_Frame_Shift_Del_p.K266fs|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	256					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											ATTAATGGCCAAAGCACTGCT	0.338																																					p.K256fs		.											.	.	0			c.766delA						.						1.0	1.0	1.0					2																	131981572		992	2313	3305	SO:0001589	frameshift_variant	445582	exon3			.	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.766delA	2.37:g.131981572delA	ENSP00000439189:p.Lys256fs	Somatic	69	0		WXS	Illumina HiSeq	Phase_I	131	29	NM_001083538	0	0	0	0	0	Q6S8J4|Q6S8J5|Q6S8J8	Frame_Shift_Del	DEL	ENST00000356920.5	37	CCDS46414.1																																																																																			.		0.338	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
HOXD8	3234	broad.mit.edu;bcgsc.ca	37	2	176995325	176995341	+	Frame_Shift_Del	DEL	GCCCTCCGGGACTGGGT	GCCCTCCGGGACTGGGT	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	GCCCTCCGGGACTGGGT	GCCCTCCGGGACTGGGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:176995325_176995341delGCCCTCCGGGACTGGGT	ENST00000313173.4	+	1	858_874	c.231_247delGCCCTCCGGGACTGGGT	c.(229-249)ccgccctccgggactgggtgcfs	p.PSGTGC78fs	HOXD-AS2_ENST00000440016.2_RNA|HOXD8_ENST00000429017.1_Intron|HOXD8_ENST00000544999.1_Frame_Shift_Del_p.PSGTGC78fs|HOXD8_ENST00000548663.1_Intron|HOXD8_ENST00000450510.2_Frame_Shift_Del_p.PSGTGC78fs	NM_001199746.1|NM_019558.3	NP_001186675.1|NP_062458.1	P13378	HXD8_HUMAN	homeobox D8	78					anterior/posterior axis specification, embryo (GO:0008595)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(5)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		CGTCCCCGCCGCCCTCCGGGACTGGGTGCGGCGGTAG	0.788																																					p.77_83del													.	HOXD8-90	0			c.231_247del						.																																			SO:0001589	frameshift_variant	3234	exon1			CCCGCCGCCCTCC		CCDS2268.1, CCDS56148.1, CCDS56149.1	2q31.1	2011-06-20	2005-12-22		ENSG00000175879	ENSG00000175879		"""Homeoboxes / ANTP class : HOXL subclass"""	5139	protein-coding gene	gene with protein product		142985	"""homeo box D8"""	HOX4, HOX4E		1973146, 1358459	Standard	NM_001199747		Approved		uc002uko.3	P13378	OTTHUMG00000132513	ENST00000313173.4:c.231_247delGCCCTCCGGGACTGGGT	2.37:g.176995325_176995341delGCCCTCCGGGACTGGGT	ENSP00000315949:p.Pro78fs	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	14	6	NM_001199746	0	0	0	0	0	F8WBG7|Q5BL00|Q8IXZ1	Frame_Shift_Del	DEL	ENST00000313173.4	37	CCDS2268.1																																																																																			.		0.788	HOXD8-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255694.1		
TNF	7124	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31545047	31545049	+	In_Frame_Del	DEL	CCC	CCC	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr6:31545047_31545049delCCC	ENST00000449264.2	+	4	610_612	c.435_437delCCC	c.(433-438)tgcccc>tgc	p.P146del		NM_000594.3	NP_000585.2	P01375	TNFA_HUMAN	tumor necrosis factor	146					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nicotine (GO:0071316)|cellular response to organic cyclic compound (GO:0071407)|chronic inflammatory response to antigenic stimulus (GO:0002439)|defense response to Gram-positive bacterium (GO:0050830)|embryonic digestive tract development (GO:0048566)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glucose metabolic process (GO:0006006)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JNK cascade (GO:0007254)|leukocyte tethering or rolling (GO:0050901)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|necroptotic signaling pathway (GO:0097527)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of branching involved in lung morphogenesis (GO:0061048)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of glucose import (GO:0046325)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of L-glutamate transport (GO:0002037)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of lipid storage (GO:0010888)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|organ morphogenesis (GO:0009887)|osteoclast differentiation (GO:0030316)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of chemokine production (GO:0032722)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fever generation (GO:0031622)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle development (GO:0051798)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mitosis (GO:0045840)|positive regulation of mononuclear cell migration (GO:0071677)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of podosome assembly (GO:0071803)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein transport (GO:0051222)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translational initiation by iron (GO:0045994)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|receptor biosynthetic process (GO:0032800)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of immunoglobulin secretion (GO:0051023)|regulation of insulin secretion (GO:0050796)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to salt stress (GO:0009651)|response to virus (GO:0009615)|sequestering of triglyceride (GO:0030730)|skeletal muscle contraction (GO:0003009)|transformed cell apoptotic process (GO:0006927)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	cytokine activity (GO:0005125)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|transcription regulatory region DNA binding (GO:0044212)|tumor necrosis factor receptor binding (GO:0005164)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(3)	8		Ovarian(999;0.00556)			Adalimumab(DB00051)|Amrinone(DB01427)|Certolizumab pegol(DB08904)|Chloroquine(DB00608)|Clenbuterol(DB01407)|Epinephrine(DB00668)|Etanercept(DB00005)|Glucosamine(DB01296)|golimumab(DB06674)|Infliximab(DB00065)|Pomalidomide(DB08910)|Pranlukast(DB01411)|Pseudoephedrine(DB00852)|Thalidomide(DB01041)	GCCAAGGCTGCCCCTCCACCCAT	0.611									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																												p.145_146del		.											.	TNF-1085	0			c.435_437del						.																																			SO:0001651	inframe_deletion	7124	exon4	Familial Cancer Database	incl.: Familial Head and Neck Cancer	.	X02910	CCDS4702.1	6p21.3	2013-05-22	2010-05-04		ENSG00000232810	ENSG00000232810		"""Tumor necrosis factor (ligand) superfamily"""	11892	protein-coding gene	gene with protein product	"""TNF superfamily, member 2"""	191160	"""tumor necrosis factor (TNF superfamily, member 2)"""	TNFA		2413547, 6392892	Standard	NM_000594		Approved	TNFSF2, DIF, TNF-alpha	uc003nui.4	P01375	OTTHUMG00000031194	ENST00000449264.2:c.435_437delCCC	6.37:g.31545047_31545049delCCC	ENSP00000398698:p.Pro146del	Somatic	259	0		WXS	Illumina HiSeq	Phase_I	119	42	NM_000594	0	0	0	0	0	O43647|Q9P1Q2|Q9UIV3	In_Frame_Del	DEL	ENST00000449264.2	37	CCDS4702.1																																																																																			.		0.611	TNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076390.2		
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	111695488	111695488	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr6:111695488delT	ENST00000358835.3	-	14	4524	c.4070delA	c.(4069-4071)aatfs	p.N1357fs	REV3L_ENST00000368805.1_Frame_Shift_Del_p.N1357fs|REV3L_ENST00000368802.3_Frame_Shift_Del_p.N1357fs|REV3L_ENST00000435970.1_Frame_Shift_Del_p.N1279fs			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1357					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GTCAAATATATTTTTTTGAAT	0.308								DNA polymerases (catalytic subunits)																													p.N1357fs		.											.	REV3L-294	0			c.4070delA						.						63.0	69.0	67.0					6																	111695488		2201	4296	6497	SO:0001589	frameshift_variant	5980	exon13			.	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4070delA	6.37:g.111695488delT	ENSP00000351697:p.Asn1357fs	Somatic	55	0		WXS	Illumina HiSeq	Phase_I	134	52	NM_002912	0	0	0	0	0	O43214|Q5TC33	Frame_Shift_Del	DEL	ENST00000358835.3	37	CCDS5091.2																																																																																			.		0.308	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
CTTNBP2	83992	hgsc.bcm.edu;bcgsc.ca	37	7	117431391	117431391	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:117431391delG	ENST00000160373.3	-	4	1950	c.1859delC	c.(1858-1860)actfs	p.T620fs	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	620					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		AGGTGCCACAGTTAAATCTAT	0.562																																					p.T620fs		.											.	CTTNBP2-94	0			c.1859delC						.						65.0	62.0	63.0					7																	117431391		2203	4300	6503	SO:0001589	frameshift_variant	83992	exon4			.		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1859delC	7.37:g.117431391delG	ENSP00000160373:p.Thr620fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	105	29	NM_033427	0	0	0	0	0	O43389|Q7LG11|Q9C0A5	Frame_Shift_Del	DEL	ENST00000160373.3	37	CCDS5774.1																																																																																			.		0.562	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
CD97	976	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	14518917	14518918	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr19:14518917_14518918insA	ENST00000242786.5	+	20	2572_2573	c.2492_2493insA	c.(2491-2496)tcagagfs	p.E832fs	DDX39A_ENST00000592927.1_5'Flank|CD97_ENST00000357355.3_Frame_Shift_Ins_p.E783fs|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Frame_Shift_Ins_p.E739fs	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	832					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTCAGGGCATCAGAGTCCGGCA	0.663																																					p.S831fs		.											.	CD97-570	0			c.2492_2493insA						.																																			SO:0001589	frameshift_variant	976	exon20			.		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.2493dupA	19.37:g.14518918_14518918dupA	ENSP00000242786:p.Glu832fs	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	47	18	NM_078481	0	0	0	0	0	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Frame_Shift_Ins	INS	ENST00000242786.5	37	CCDS32929.1																																																																																			.		0.663	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
RBKS	64080	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	28004505	28004506	+	Frame_Shift_Ins	INS	-	-	T			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:28004505_28004506insT	ENST00000302188.3	-	8	1697_1698	c.945_946insA	c.(943-948)aaagacfs	p.D316fs	AC110084.1_ENST00000601759.1_Intron	NM_022128.1	NP_071411.1	Q9H477	RBSK_HUMAN	ribokinase	316					D-ribose catabolic process (GO:0019303)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ribokinase activity (GO:0004747)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7	Acute lymphoblastic leukemia(172;0.155)					AGCGGAAGGTCTTTTTTGTAAG	0.421																																					p.D316fs		.											.	RBKS-92	0			c.946_947insA						.																																			SO:0001589	frameshift_variant	64080	exon8			.	BC017425	CCDS1762.1	2p23.3	2008-02-05			ENSG00000171174	ENSG00000171174	2.7.1.15		30325	protein-coding gene	gene with protein product		611132				8382990	Standard	NM_022128		Approved	DKFZp686G13268, RBSK	uc002rlo.1	Q9H477	OTTHUMG00000097833	ENST00000302188.3:c.946dupA	2.37:g.28004511_28004511dupT	ENSP00000306817:p.Asp316fs	Somatic	108	0		WXS	Illumina HiSeq	Phase_I	134	42	NM_022128	0	0	0	0	0	A9UK04|B4DV96	Frame_Shift_Ins	INS	ENST00000302188.3	37	CCDS1762.1																																																																																			.		0.421	RBKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215118.1	NM_022128	
DAXX	1616	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	33287821	33287822	+	Frame_Shift_Ins	INS	-	-	A	rs145347312		TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr6:33287821_33287822insA	ENST00000374542.5	-	5	1635_1636	c.1431_1432insT	c.(1429-1434)gatgaafs	p.E478fs	ZBTB22_ENST00000431845.2_5'Flank|DAXX_ENST00000477162.1_5'UTR|DAXX_ENST00000414083.2_Frame_Shift_Ins_p.E403fs|DAXX_ENST00000266000.6_Frame_Shift_Ins_p.E478fs|ZBTB22_ENST00000418724.1_5'Flank	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	478	Asp/Glu-rich (acidic).|Necessary for interaction with USP7.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						tcctcctcttcatcatcctcct	0.505			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																p.E490_E491delinsX		.		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	.	DAXX-731	0			c.1468_1469insT						.																																			SO:0001589	frameshift_variant	1616	exon5			.	AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.1432dupT	6.37:g.33287822_33287822dupA	ENSP00000363668:p.Glu478fs	Somatic	30	0		WXS	Illumina HiSeq	Phase_I	22	10	NM_001141970	0	0	0	0	0	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Nonsense_Mutation	INS	ENST00000374542.5	37	CCDS4776.1																																																																																			.		0.505	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076403.1		
CTTNBP2	83992	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	117431390	117431391	+	Frame_Shift_Ins	INS	-	-	C			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr7:117431390_117431391insC	ENST00000160373.3	-	4	1950_1951	c.1859_1860insG	c.(1858-1860)actfs	p.T620fs	CTTNBP2_ENST00000487820.1_5'Flank	NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	620					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CAGGTGCCACAGTTAAATCTAT	0.559																																					p.T620fs		.											.	CTTNBP2-94	0			c.1860_1861insG						.																																			SO:0001589	frameshift_variant	83992	exon4			.		CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.1859_1860insG	7.37:g.117431390_117431391insC	ENSP00000160373:p.Thr620fs	Somatic	102	0		WXS	Illumina HiSeq	Phase_I	103	55	NM_033427	0	0	0	0	0	O43389|Q7LG11|Q9C0A5	Frame_Shift_Ins	INS	ENST00000160373.3	37	CCDS5774.1																																																																																			.		0.559	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059201.4	NM_033427	
MCM6	4175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	136620201	136620202	+	Missense_Mutation	DNP	CT	CT	AG			TCGA-IZ-8196-01A-11D-2396-08	TCGA-IZ-8196-10A-01D-2396-08	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	dccd5469-1539-42f2-9023-47320e9e4275	d5a2fa8f-8c51-4867-b806-5f49d4b33c1a	g.chr2:136620201_136620202CT>AG	ENST00000264156.2	-	8	1255_1256	c.1195_1196AG>CT	c.(1195-1197)AGt>CTt	p.S399L	MCM6_ENST00000492091.1_5'UTR	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	399	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		CTTAGCTGTACTTGGGTCACCA	0.485																																					p.S399L	Ovarian(196;141 2104 8848 24991 25939)	.											.	MCM6	0			c.A1195C						.																																			SO:0001583	missense	4175	exon8			CTGTACTTGGGTC		CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1195_1196delinsAG	2.37:g.136620201_136620202delinsAG	ENSP00000264156:p.Ser399Leu	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	78.0		0	0	0	0	0	B2R6H2|Q13504|Q99859	Missense_Mutation	DNP	ENST00000264156.2	37	CCDS2179.1																																																																																			.		0.485	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1	NM_005915	
