#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	19504023	19504023	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:19504023G>C	ENST00000375254.3	-	19	2596	c.2569C>G	c.(2569-2571)Cgc>Ggc	p.R857G	UBR4_ENST00000375217.2_Missense_Mutation_p.R857G|UBR4_ENST00000375226.2_Missense_Mutation_p.R857G|UBR4_ENST00000375267.2_Missense_Mutation_p.R857G	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	857					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AGAAGGAGGCGAGCCAAGATA	0.498																																					p.R857G		.											.	UBR4-612	0			c.C2569G						.						133.0	126.0	128.0					1																	19504023		2203	4300	6503	SO:0001583	missense	23352	exon19			GGAGGCGAGCCAA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.2569C>G	1.37:g.19504023G>C	ENSP00000364403:p.Arg857Gly	Somatic	248	0		WXS	Illumina HiSeq	Phase_I	256	130	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909893	0.92107	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000419533	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.60728	0.2291	L	0.50333	1.59	0.80722	D	1	D	0.60160	0.987	D	0.67725	0.953	T	0.61043	-0.7142	10	0.87932	D	0	.	19.4792	0.95002	0.0:0.0:1.0:0.0	.	857	Q5T4S7	UBR4_HUMAN	G	857;857;857;857;73	ENSP00000364403:R857G;ENSP00000364416:R857G;ENSP00000364365:R857G;ENSP00000364374:R857G	ENSP00000364365:R857G	R	-	1	0	UBR4	19376610	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.238000	0.95380	2.713000	0.92767	0.655000	0.94253	CGC	.		0.498	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
GJB5	2709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	35223633	35223633	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:35223633C>T	ENST00000338513.1	+	2	875	c.702C>T	c.(700-702)acC>acT	p.T234T	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	234					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				CCCACGGTACCACCTCTTCCT	0.572																																					p.T234T		.											.	GJB5-91	0			c.C702T						.						156.0	129.0	138.0					1																	35223633		2203	4300	6503	SO:0001819	synonymous_variant	2709	exon2			CGGTACCACCTCT	BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.702C>T	1.37:g.35223633C>T		Somatic	415	0		WXS	Illumina HiSeq	Phase_I	332	145	NM_005268	0	0	0	0	0	Q9UPA3	Silent	SNP	ENST00000338513.1	37	CCDS382.1																																																																																			.		0.572	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011561.1	NM_005268	
GNL2	29889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	38040324	38040324	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:38040324C>G	ENST00000373062.3	-	11	1342	c.1244G>C	c.(1243-1245)tGg>tCg	p.W415S		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	415					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				AGCATTCTCCCAAGAATCAAT	0.418																																					p.W415S		.											.	GNL2-91	0			c.G1244C						.						92.0	85.0	88.0					1																	38040324		2203	4300	6503	SO:0001583	missense	29889	exon11			TTCTCCCAAGAAT	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.1244G>C	1.37:g.38040324C>G	ENSP00000362153:p.Trp415Ser	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	92	46	NM_013285	0	0	12	15	3	Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	CCDS421.1	.	.	.	.	.	.	.	.	.	.	C	33	5.223863	0.95139	.	.	ENSG00000134697	ENST00000373062	T	0.12774	2.65	5.87	5.87	0.94306	GTP-binding protein, orthogonal bundle domain (1);	0.000000	0.85682	D	0.000000	T	0.45438	0.1342	M	0.86420	2.815	0.80722	D	1	D	0.63046	0.992	D	0.66497	0.944	T	0.44143	-0.9347	10	0.72032	D	0.01	-11.3487	20.5827	0.99408	0.0:1.0:0.0:0.0	.	415	Q13823	NOG2_HUMAN	S	415	ENSP00000362153:W415S	ENSP00000362153:W415S	W	-	2	0	GNL2	37812911	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.786000	0.85741	2.941000	0.99782	0.655000	0.94253	TGG	.		0.418	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	
ATP1A1	476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	116941337	116941337	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:116941337A>G	ENST00000295598.5	+	16	2471	c.2219A>G	c.(2218-2220)gAt>gGt	p.D740G	ATP1A1_ENST00000369496.4_Missense_Mutation_p.D709G|ATP1A1_ENST00000537345.1_Missense_Mutation_p.D740G	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	740					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	GCTGGCTCAGATGTGTCCAAG	0.493																																					p.D740G		.											.	ATP1A1-91	0			c.A2219G						.						201.0	191.0	194.0					1																	116941337		2203	4300	6503	SO:0001583	missense	476	exon16			GCTCAGATGTGTC	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.2219A>G	1.37:g.116941337A>G	ENSP00000295598:p.Asp740Gly	Somatic	165	0		WXS	Illumina HiSeq	Phase_I	152	60	NM_000701	0	0	140	288	148	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.803837	0.90623	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.83419	-1.72;-1.72;-1.72	5.23	5.23	0.72850	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.92622	0.7656	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.97110	1.0;0.999	D	0.94580	0.7778	10	0.87932	D	0	.	15.2911	0.73868	1.0:0.0:0.0:0.0	.	740;740	F5H3A1;P05023	.;AT1A1_HUMAN	G	740;740;709	ENSP00000295598:D740G;ENSP00000445306:D740G;ENSP00000358508:D709G	ENSP00000295598:D740G	D	+	2	0	ATP1A1	116742860	1.000000	0.71417	0.550000	0.28217	0.991000	0.79684	9.139000	0.94554	2.195000	0.70347	0.533000	0.62120	GAT	.		0.493	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
LCE2A	353139	hgsc.bcm.edu	37	1	152671534	152671534	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:152671534G>A	ENST00000368779.1	+	2	208	c.157G>A	c.(157-159)Ggc>Agc	p.G53S		NM_178428.3	NP_848515.1	Q5TA79	LCE2A_HUMAN	late cornified envelope 2A	53	Cys-rich.				keratinization (GO:0031424)			p.C51_G64delCCGSSSGGCCSSGG(2)		breast(1)|large_intestine(1)|liver(2)|lung(4)	8	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGGCTGCTGCGGCTCCAGCTC	0.692																																					p.G53S		.											.	LCE2A-68	2	Deletion - In frame(2)	liver(2)	c.G157A						.						48.0	61.0	56.0					1																	152671534		2203	4299	6502	SO:0001583	missense	353139	exon2			TGCTGCGGCTCCA		CCDS1021.1	1q21.3	2008-02-05			ENSG00000187173	ENSG00000187173		"""Late cornified envelopes"""	29469	protein-coding gene	gene with protein product		612609				11698679	Standard	NM_178428		Approved	LEP9	uc001faj.3	Q5TA79	OTTHUMG00000012392	ENST00000368779.1:c.157G>A	1.37:g.152671534G>A	ENSP00000357768:p.Gly53Ser	Somatic	16	0		WXS	Illumina HiSeq	Phase_I	40	6	NM_178428	0	0	0	0	0	A4QMZ9	Missense_Mutation	SNP	ENST00000368779.1	37	CCDS1021.1	.	.	.	.	.	.	.	.	.	.	-	6.374	0.437046	0.12104	.	.	ENSG00000187173	ENST00000368779	T	0.03717	3.83	3.72	2.79	0.32731	.	.	.	.	.	T	0.01222	0.0040	L	0.51853	1.615	0.09310	N	1	P	0.39964	0.697	B	0.29353	0.101	T	0.47394	-0.9121	9	0.87932	D	0	.	6.8388	0.23951	0.1374:0.0:0.8626:0.0	.	53	Q5TA79	LCE2A_HUMAN	S	53	ENSP00000357768:G53S	ENSP00000357768:G53S	G	+	1	0	LCE2A	150938158	0.982000	0.34865	0.111000	0.21465	0.270000	0.26580	0.561000	0.23515	0.525000	0.28522	0.580000	0.79431	GGC	.		0.692	LCE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034512.1	NM_178428	
OR6Y1	391112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158517180	158517180	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:158517180C>T	ENST00000302617.3	-	1	715	c.716G>A	c.(715-717)cGc>cAc	p.R239H		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	239						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					TGCCTTTTGGCGGCCCTGAGC	0.522																																					p.R239H		.											.	OR6Y1-69	0			c.G716A						.						137.0	136.0	137.0					1																	158517180		2202	4300	6502	SO:0001583	missense	391112	exon1			TTTTGGCGGCCCT	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.716G>A	1.37:g.158517180C>T	ENSP00000304807:p.Arg239His	Somatic	179	0		WXS	Illumina HiSeq	Phase_I	173	81	NM_001005189	0	0	0	0	0	Q6IFS0	Missense_Mutation	SNP	ENST00000302617.3	37	CCDS30899.1	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487953	0.64074	.	.	ENSG00000197532	ENST00000302617	T	0.00333	8.07	5.34	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42964	D	0.000631	T	0.00524	0.0017	M	0.90759	3.145	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.30297	-0.9983	10	0.87932	D	0	.	13.4384	0.61096	0.0:0.9214:0.0:0.0786	.	239	Q8NGX8	OR6Y1_HUMAN	H	239	ENSP00000304807:R239H	ENSP00000304807:R239H	R	-	2	0	OR6Y1	156783804	0.003000	0.15002	0.951000	0.38953	0.889000	0.51656	1.500000	0.35682	2.763000	0.94921	0.655000	0.94253	CGC	.		0.522	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189	
PRRC2C	23215	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	171506567	171506567	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:171506567A>G	ENST00000338920.4	+	15	2690	c.2453A>G	c.(2452-2454)cAa>cGa	p.Q818R	PRRC2C_ENST00000367742.3_Missense_Mutation_p.Q820R|PRRC2C_ENST00000392078.3_Missense_Mutation_p.Q820R|PRRC2C_ENST00000426496.2_Missense_Mutation_p.Q818R	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	818					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GCTGAGCCTCAACAAGCAACT	0.403																																					p.Q818R													.	.	0			c.A2453G						.						53.0	43.0	47.0					1																	171506567		2203	4299	6502	SO:0001583	missense	23215	exon15			AGCCTCAACAAGC	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.2453A>G	1.37:g.171506567A>G	ENSP00000343629:p.Gln818Arg	Somatic	147	1		WXS	Illumina HiSeq	Phase_I	146	58	NM_015172	0	0	0	0	0	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	37	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	A	10.98	1.503319	0.26949	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.07021	3.23;3.23;3.23;3.23	5.42	3.01	0.34805	.	0.156139	0.29631	N	0.011615	T	0.02494	0.0076	L	0.32530	0.975	0.35787	D	0.822122	P	0.42409	0.779	B	0.38500	0.275	T	0.52983	-0.8502	10	0.21014	T	0.42	.	12.7484	0.57293	0.6068:0.3932:0.0:0.0	.	818	Q9Y520-4	.	R	820;819;818;820;818;575;577	ENSP00000375928:Q820R;ENSP00000410219:Q818R;ENSP00000356716:Q820R;ENSP00000343629:Q818R	ENSP00000343629:Q818R	Q	+	2	0	PRRC2C	169773191	0.998000	0.40836	0.985000	0.45067	0.912000	0.54170	1.913000	0.39956	0.336000	0.23639	-0.320000	0.08662	CAA	.		0.403	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
FAM129A	116496	ucsc.edu	37	1	184767284	184767284	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:184767284G>A	ENST00000367511.3	-	13	1788	c.1595C>T	c.(1594-1596)aCc>aTc	p.T532I	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	532					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						AATCATATTGGTATGATCTGC	0.408																																					p.T532I													.	FAM129A-94	0			c.C1595T						.						101.0	93.0	96.0					1																	184767284		2203	4300	6503	SO:0001583	missense	116496	exon13			ATATTGGTATGAT	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.1595C>T	1.37:g.184767284G>A	ENSP00000356481:p.Thr532Ile	Somatic	29	0		WXS	Illumina HiSeq		41	4	NM_052966	0	0	0	0	0	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	37	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035316	0.54896	.	.	ENSG00000135842	ENST00000367511	T	0.11604	2.76	5.37	5.37	0.77165	.	0.232950	0.42821	D	0.000646	T	0.26991	0.0661	L	0.60455	1.87	0.42181	D	0.991681	P;D	0.71674	0.815;0.998	P;D	0.66351	0.49;0.943	T	0.00406	-1.1759	10	0.59425	D	0.04	-14.0264	13.185	0.59675	0.0:0.0:0.8412:0.1588	.	63;532	Q5TEY9;Q9BZQ8	.;NIBAN_HUMAN	I	532	ENSP00000356481:T532I	ENSP00000356481:T532I	T	-	2	0	FAM129A	183033907	1.000000	0.71417	0.872000	0.34217	0.960000	0.62799	6.237000	0.72345	2.512000	0.84698	0.655000	0.94253	ACC	.		0.408	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
TMEM206	55248	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	212548558	212548558	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:212548558G>A	ENST00000261455.4	-	7	1005	c.868C>T	c.(868-870)Cct>Tct	p.P290S	TMEM206_ENST00000535273.1_Missense_Mutation_p.P351S	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	290						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TGGATGAAAGGATCTTTCCAT	0.318																																					p.P351S													.	TMEM206-153	0			c.C1051T						.						79.0	77.0	78.0					1																	212548558		2203	4300	6503	SO:0001583	missense	55248	exon8			TGAAAGGATCTTT	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.868C>T	1.37:g.212548558G>A	ENSP00000261455:p.Pro290Ser	Somatic	139	1		WXS	Illumina HiSeq	Phase_I	190	68	NM_001198862	0	0	2	3	1	B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	ENST00000261455.4	37	CCDS1504.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751203	0.89753	.	.	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.72953	0.3525	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.946	T	0.73855	-0.3851	9	0.87932	D	0	-7.061	20.5827	0.99408	0.0:0.0:1.0:0.0	.	351;290	B7Z4D6;Q9H813	.;TM206_HUMAN	S	290;351	.	ENSP00000261455:P290S	P	-	1	0	TMEM206	210615181	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.190000	0.65104	2.941000	0.99782	0.655000	0.94253	CCT	.		0.318	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228469852	228469852	+	Nonsense_Mutation	SNP	G	G	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:228469852G>T	ENST00000422127.1	+	31	8460	c.8416G>T	c.(8416-8418)Gag>Tag	p.E2806*	OBSCN_ENST00000570156.2_Nonsense_Mutation_p.E3235*|OBSCN_ENST00000359599.6_Nonsense_Mutation_p.E1653*|OBSCN_ENST00000284548.11_Nonsense_Mutation_p.E2806*|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2806	Ig-like 27.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGATGCCGGGGAGGTGGTCTT	0.647																																					p.E3235X		.											.	OBSCN-403	0			c.G9703T						.						32.0	38.0	36.0					1																	228469852		1989	4156	6145	SO:0001587	stop_gained	84033	exon36			GCCGGGGAGGTGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.8416G>T	1.37:g.228469852G>T	ENSP00000409493:p.Glu2806*	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	232	108	NM_001271223	0	0	1	1	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Nonsense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.448476	0.63178	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706;ENST00000366704	.	.	.	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	16.9495	0.86240	0.0:0.0:1.0:0.0	.	.	.	.	X	2806;2806;1653;505;212	.	ENSP00000284548:E2806X	E	+	1	0	OBSCN	226536475	1.000000	0.71417	0.992000	0.48379	0.321000	0.28281	9.350000	0.97070	2.063000	0.61619	0.462000	0.41574	GAG	.		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	235884164	235884164	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:235884164G>A	ENST00000389794.3	-	40	9531	c.9357C>T	c.(9355-9357)ctC>ctT	p.L3119L	LYST_ENST00000389793.2_Silent_p.L3119L|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3119					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GAAGATTAGGGAGGTTATTTG	0.328																																					p.L3119L		.											.	LYST-143	0			c.C9357T						.						121.0	119.0	120.0					1																	235884164		2203	4300	6503	SO:0001819	synonymous_variant	1130	exon40			ATTAGGGAGGTTA	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9357C>T	1.37:g.235884164G>A		Somatic	76	0		WXS	Illumina HiSeq	Phase_I	71	28	NM_000081	0	0	0	0	0	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1																																																																																			.		0.328	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
ZNF438	220929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	31134006	31134006	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr10:31134006G>A	ENST00000361310.3	-	7	2700	c.2371C>T	c.(2371-2373)Ctc>Ttc	p.L791F	ZNF438_ENST00000452305.1_Missense_Mutation_p.L781F|ZNF438_ENST00000444692.2_Missense_Mutation_p.L781F|ZNF438_ENST00000436087.2_Missense_Mutation_p.L791F|ZNF438_ENST00000331737.6_Missense_Mutation_p.L781F|ZNF438_ENST00000442986.1_Missense_Mutation_p.L791F|ZNF438_ENST00000375311.1_Missense_Mutation_p.L355F|ZNF438_ENST00000538351.2_Missense_Mutation_p.L742F|ZNF438_ENST00000413025.1_Missense_Mutation_p.L791F			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	791					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TGGTGGAGGAGGTCCTCTTTC	0.537																																					p.L791F		.											.	ZNF438-154	0			c.C2371T						.						188.0	181.0	184.0					10																	31134006		2203	4300	6503	SO:0001583	missense	220929	exon8			GGAGGAGGTCCTC	AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.2371C>T	10.37:g.31134006G>A	ENSP00000354663:p.Leu791Phe	Somatic	152	0		WXS	Illumina HiSeq	Phase_I	143	53	NM_182755	0	0	8	12	4	A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	ENST00000361310.3	37	CCDS7168.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766477	0.90020	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.29	5.5	3.62	0.41486	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.115961	0.64402	D	0.000014	T	0.37293	0.0998	M	0.68593	2.085	0.36439	D	0.865386	D;D	0.89917	1.0;1.0	D;D	0.77557	0.976;0.99	T	0.44498	-0.9324	10	0.87932	D	0	-20.022	11.0268	0.47748	0.0708:0.1293:0.7998:0.0	.	791;781	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	F	781;791;791;791;791;781;781;742;510;355	ENSP00000333571:L781F;ENSP00000354663:L791F;ENSP00000406934:L791F;ENSP00000412363:L791F;ENSP00000387546:L791F;ENSP00000413060:L781F;ENSP00000410898:L781F;ENSP00000445461:L742F;ENSP00000364460:L355F	ENSP00000333571:L781F	L	-	1	0	ZNF438	31174012	1.000000	0.71417	0.008000	0.14137	0.846000	0.48090	3.398000	0.52579	0.770000	0.33336	0.655000	0.94253	CTC	.		0.537	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277006.1	NM_182755	
ZNF33B	7582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	43088357	43088357	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr10:43088357T>C	ENST00000359467.3	-	5	2155	c.2041A>G	c.(2041-2043)Att>Gtt	p.I681V	ZNF33B_ENST00000486187.1_RNA	NM_006955.1	NP_008886.1	Q06732	ZN33B_HUMAN	zinc finger protein 33B	681					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(15)|skin(1)|stomach(1)	29						TCATGTAAAATAAGTCCTGAC	0.403																																					p.I681V	Melanoma(137;1247 1767 16772 25727 43810)	.											.	ZNF33B-90	0			c.A2041G						.						123.0	121.0	122.0					10																	43088357		2203	4300	6503	SO:0001583	missense	7582	exon5			GTAAAATAAGTCC	X68688, AJ491697	CCDS7198.1	10q11.2	2013-01-08	2005-03-18		ENSG00000196693	ENSG00000196693		"""Zinc fingers, C2H2-type"", ""-"""	13097	protein-coding gene	gene with protein product		194522	"""zinc finger protein 33b (KOX 31)"", ""zinc finger protein 11B"""	ZNF11B		2014798	Standard	NM_006955		Approved	KOX31, KOX2	uc001jaf.1	Q06732	OTTHUMG00000018014	ENST00000359467.3:c.2041A>G	10.37:g.43088357T>C	ENSP00000352444:p.Ile681Val	Somatic	60	0		WXS	Illumina HiSeq	Phase_I	76	32	NM_006955	0	0	1	1	0	Q06731|Q32MA2|Q86XY8|Q8NDW3	Missense_Mutation	SNP	ENST00000359467.3	37	CCDS7198.1	.	.	.	.	.	.	.	.	.	.	T	4.006	-0.001564	0.07819	.	.	ENSG00000196693	ENST00000359467;ENST00000395836	T	0.35605	1.3	2.54	0.118	0.14667	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.852537	0.09554	N	0.786508	T	0.12902	0.0313	N	0.02842	-0.48	0.19300	N	0.999972	B	0.09022	0.002	B	0.09377	0.004	T	0.23404	-1.0189	10	0.30854	T	0.27	.	2.2255	0.03983	0.2309:0.2698:0.0:0.4993	.	681	Q06732	ZN33B_HUMAN	V	681;647	ENSP00000352444:I681V	ENSP00000352444:I681V	I	-	1	0	ZNF33B	42408363	0.000000	0.05858	0.917000	0.36280	0.797000	0.45037	-1.573000	0.02134	0.016000	0.14998	0.336000	0.21669	ATT	.		0.403	ZNF33B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_006955	
RRP12	23223	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	99116859	99116859	+	Nonsense_Mutation	SNP	G	G	A	rs371319861		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr10:99116859G>A	ENST00000370992.4	-	34	3997	c.3886C>T	c.(3886-3888)Cga>Tga	p.R1296*	RRP12_ENST00000315563.6_Nonsense_Mutation_p.R1196*|RRP12_ENST00000536831.1_Nonsense_Mutation_p.R1014*|RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000414986.1_Nonsense_Mutation_p.R1235*	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1296						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		CCTCAGGGTCGACGATCCTTT	0.622																																					p.R1296X													.	RRP12-92	0			c.C3886T						.	A	stop/ARG,stop/ARG	0,4406		0,0,2203	86.0	82.0	83.0		3703,3886	1.2	0.0	10		83	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained	RRP12	NM_001145114.1,NM_015179.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	1235/1237,1296/1298	99116859	1,13005	2203	4300	6503	SO:0001587	stop_gained	23223	exon34			AGGGTCGACGATC		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3886C>T	10.37:g.99116859G>A	ENSP00000360031:p.Arg1296*	Somatic	62	1		WXS	Illumina HiSeq	Phase_I	59	28	NM_015179	0	0	17	36	19	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Nonsense_Mutation	SNP	ENST00000370992.4	37	CCDS7457.1	.	.	.	.	.	.	.	.	.	.	g	37	6.020086	0.97205	0.0	1.16E-4	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	.	.	.	5.4	1.22	0.21188	.	0.218072	0.37955	N	0.001863	.	.	.	.	.	.	0.22947	N	0.998522	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.913	5.2587	0.15561	0.0662:0.1203:0.4412:0.3724	.	.	.	.	X	1296;1196;1235;1014	.	ENSP00000324315:R1196X	R	-	1	2	RRP12	99106849	0.005000	0.15991	0.003000	0.11579	0.391000	0.30476	0.593000	0.23999	0.243000	0.21327	-0.215000	0.12644	CGA	.		0.622	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049699.4	NM_015179	
AFAP1L2	84632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	116100456	116100456	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr10:116100456G>A	ENST00000304129.4	-	2	80	c.51C>T	c.(49-51)ttC>ttT	p.F17F	AFAP1L2_ENST00000369271.3_Silent_p.F17F|AFAP1L2_ENST00000545353.1_Silent_p.F17F			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	17					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GAATCTTGAGGAAGTCATCCA	0.537																																					p.F17F		.											.	AFAP1L2-136	0			c.C51T						.						87.0	85.0	86.0					10																	116100456		2203	4300	6503	SO:0001819	synonymous_variant	84632	exon2			CTTGAGGAAGTCA	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.51C>T	10.37:g.116100456G>A		Somatic	106	0		WXS	Illumina HiSeq	Phase_I	95	33	NM_032550	0	0	0	0	0	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Silent	SNP	ENST00000304129.4	37	CCDS31286.1																																																																																			.		0.537	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050462.1	NM_032550	
OR51G2	81282	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	4936503	4936503	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:4936503T>C	ENST00000322013.3	-	1	419	c.391A>G	c.(391-393)Atc>Gtc	p.I131V	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGGTGGCAGATAGCCACAAAG	0.493																																					p.I131V		.											.	OR51G2-70	0			c.A391G						.						81.0	80.0	80.0					11																	4936503		2201	4298	6499	SO:0001583	missense	81282	exon1			GGCAGATAGCCAC	AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.391A>G	11.37:g.4936503T>C	ENSP00000322593:p.Ile131Val	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	56	23	NM_001005238	0	0	0	0	0	Q6IFH7	Missense_Mutation	SNP	ENST00000322013.3	37	CCDS31365.1	.	.	.	.	.	.	.	.	.	.	T	16.52	3.145321	0.57044	.	.	ENSG00000176893	ENST00000322013	T	0.50813	0.73	5.58	5.58	0.84498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000099	T	0.55097	0.1899	M	0.86573	2.825	0.44719	D	0.997717	B	0.29301	0.241	B	0.25987	0.065	T	0.60835	-0.7184	10	0.66056	D	0.02	.	14.7227	0.69320	0.0:0.0:0.0:1.0	.	131	Q8NGK0	O51G2_HUMAN	V	131	ENSP00000322593:I131V	ENSP00000322593:I131V	I	-	1	0	OR51G2	4893079	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	7.646000	0.83445	2.343000	0.79666	0.533000	0.62120	ATC	.		0.493	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142174.1	NM_001005238	
SYT13	57586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	45277229	45277229	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:45277229G>C	ENST00000020926.3	-	2	508	c.397C>G	c.(397-399)Ctc>Gtc	p.L133V	CTD-2560E9.5_ENST00000534342.1_RNA|CTD-2560E9.5_ENST00000531663.1_RNA	NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	133					vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)				breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						TTCTGAGGGAGGATGAACAGC	0.592																																					p.L133V		.											.	SYT13-91	0			c.C397G						.						53.0	47.0	49.0					11																	45277229		2203	4299	6502	SO:0001583	missense	57586	exon2			GAGGGAGGATGAA	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.397C>G	11.37:g.45277229G>C	ENSP00000020926:p.Leu133Val	Somatic	52	0		WXS	Illumina HiSeq	Phase_I	39	17	NM_020826	0	0	0	0	0	A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	ENST00000020926.3	37	CCDS31470.1	.	.	.	.	.	.	.	.	.	.	G	15.36	2.810428	0.50421	.	.	ENSG00000019505	ENST00000020926	T	0.08370	3.1	5.39	5.39	0.77823	.	0.077197	0.52532	D	0.000067	T	0.06917	0.0176	N	0.24115	0.695	0.33493	D	0.588914	B	0.23650	0.089	B	0.21917	0.037	T	0.17501	-1.0367	10	0.30078	T	0.28	.	13.5218	0.61572	0.0:0.0:0.8444:0.1556	.	133	Q7L8C5	SYT13_HUMAN	V	133	ENSP00000020926:L133V	ENSP00000020926:L133V	L	-	1	0	SYT13	45233805	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	3.496000	0.53288	2.679000	0.91253	0.561000	0.74099	CTC	.		0.592	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826	
LTBP3	4054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65319017	65319017	+	Splice_Site	SNP	A	A	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:65319017A>T	ENST00000301873.5	-	9	1817		c.e9+1		LTBP3_ENST00000322147.4_Splice_Site|LTBP3_ENST00000532932.1_5'Flank|LTBP3_ENST00000536982.1_Splice_Site	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3						bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						TCTCATACTCACTGAGTCCGT	0.592																																					.		.											.	LTBP3-91	0			c.1197+2T>A						.						68.0	58.0	62.0					11																	65319017		2201	4297	6498	SO:0001630	splice_region_variant	4054	exon10			ATACTCACTGAGT	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.1548+1T>A	11.37:g.65319017A>T		Somatic	128	0		WXS	Illumina HiSeq	Phase_I	107	35	NM_001164266	0	0	0	0	0	O15107|Q96HB9|Q9H7K2|Q9UFN4	Splice_Site	SNP	ENST00000301873.5	37	CCDS44647.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.029156	0.75504	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000526927;ENST00000536982;ENST00000530866	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0038	0.47622	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LTBP3	65075593	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.837000	0.62796	1.861000	0.53984	0.329000	0.21502	.	.		0.592	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	Intron
SIPA1	6494	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	65412463	65412463	+	Missense_Mutation	SNP	G	G	A	rs146916012		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:65412463G>A	ENST00000394224.3	+	5	1318	c.1022G>A	c.(1021-1023)cGg>cAg	p.R341Q	SIPA1_ENST00000394227.3_Missense_Mutation_p.R341Q|SIPA1_ENST00000534313.1_Missense_Mutation_p.R341Q|SIPA1_ENST00000527525.1_Missense_Mutation_p.R341Q	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	341	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						CTGTACTGCCGGGCGGGCCAG	0.622																																					p.R341Q		.											.	SIPA1-90	0			c.G1022A						.	G	GLN/ARG,GLN/ARG	0,4402		0,0,2201	86.0	88.0	87.0		1022,1022	4.8	1.0	11	dbSNP_134	87	2,8592	2.2+/-6.3	0,2,4295	yes	missense,missense	SIPA1	NM_006747.3,NM_153253.29	43,43	0,2,6496	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	341/1043,341/1043	65412463	2,12994	2201	4297	6498	SO:0001583	missense	6494	exon5			ACTGCCGGGCGGG	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.1022G>A	11.37:g.65412463G>A	ENSP00000377771:p.Arg341Gln	Somatic	142	0		WXS	Illumina HiSeq	Phase_I	187	88	NM_006747	0	0	1	1	0	O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	ENST00000394224.3	37	CCDS8108.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.872939	0.91664	0.0	2.33E-4	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.3	4.78	4.78	0.61160	Rap/ran-GAP (1);	0.123367	0.30667	U	0.009135	D	0.94499	0.8229	L	0.41027	1.25	0.47994	D	0.999563	D;D	0.89917	1.0;1.0	D;D	0.69824	0.966;0.926	D	0.94259	0.7500	10	0.45353	T	0.12	-21.0415	15.6687	0.77255	0.0:0.0:1.0:0.0	.	341;341	F6RY50;Q96FS4	.;SIPA1_HUMAN	Q	341	ENSP00000436269:R341Q;ENSP00000433686:R341Q;ENSP00000377771:R341Q;ENSP00000377774:R341Q	ENSP00000377771:R341Q	R	+	2	0	SIPA1	65169039	0.996000	0.38824	0.989000	0.46669	0.990000	0.78478	1.561000	0.36342	2.368000	0.80403	0.561000	0.74099	CGG	G|1.000;A|0.000		0.622	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	NM_006747	
EXPH5	23086	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	108380539	108380539	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:108380539C>T	ENST00000265843.4	-	6	5805	c.5695G>A	c.(5695-5697)Gaa>Aaa	p.E1899K	EXPH5_ENST00000443411.1_Missense_Mutation_p.E1711K|EXPH5_ENST00000525344.1_Missense_Mutation_p.E1892K|EXPH5_ENST00000428840.1_Missense_Mutation_p.E1823K	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1899					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTTACATTTTCTAAGAAAGCT	0.413																																					p.E1899K													.	EXPH5-95	0			c.G5695A						.						74.0	78.0	77.0					11																	108380539		2201	4298	6499	SO:0001583	missense	23086	exon6			CATTTTCTAAGAA		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5695G>A	11.37:g.108380539C>T	ENSP00000265843:p.Glu1899Lys	Somatic	136	1		WXS	Illumina HiSeq	Phase_I	125	42	NM_015065	0	0	0	1	1	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933160	0.92458	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956	T;T;T;T	0.56103	0.48;0.48;0.48;0.48	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000003	T	0.74535	0.3729	M	0.71581	2.175	0.44852	D	0.99786	D	0.89917	1.0	D	0.85130	0.997	T	0.74200	-0.3742	10	0.87932	D	0	-20.3741	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1899	Q8NEV8	EXPH5_HUMAN	K	1899;1823;1711;1892;729	ENSP00000265843:E1899K;ENSP00000391966:E1823K;ENSP00000411390:E1711K;ENSP00000432546:E1892K	ENSP00000265843:E1899K	E	-	1	0	EXPH5	107885749	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	3.765000	0.55272	2.941000	0.99782	0.655000	0.94253	GAA	.		0.413	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
CHEK1	1111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	125497532	125497532	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:125497532A>C	ENST00000534070.1	+	3	351	c.96A>C	c.(94-96)gaA>gaC	p.E32D	CHEK1_ENST00000438015.1_Missense_Mutation_p.E32D|CHEK1_ENST00000532449.1_Intron|CHEK1_ENST00000278916.3_Missense_Mutation_p.E32D|CHEK1_ENST00000428830.2_Missense_Mutation_p.E32D|CHEK1_ENST00000524737.1_Missense_Mutation_p.E32D|CHEK1_ENST00000544373.1_Missense_Mutation_p.E32D|CHEK1_ENST00000427383.2_Intron	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	32	Interaction with CLSPN. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		GAGTAACTGAAGAAGCAGTCG	0.328								Other conserved DNA damage response genes																													p.E32D		.											.	CHEK1-1509	0			c.A96C						.						50.0	54.0	52.0					11																	125497532		2201	4299	6500	SO:0001583	missense	1111	exon3			AACTGAAGAAGCA	AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.96A>C	11.37:g.125497532A>C	ENSP00000435371:p.Glu32Asp	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	71	34	NM_001244846	0	0	0	0	0	A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Missense_Mutation	SNP	ENST00000534070.1	37	CCDS8459.1	.	.	.	.	.	.	.	.	.	.	A	10.22	1.289544	0.23478	.	.	ENSG00000149554	ENST00000438015;ENST00000525396;ENST00000428830;ENST00000544373;ENST00000527013;ENST00000526937;ENST00000534685;ENST00000533778;ENST00000534070;ENST00000524737;ENST00000278916	T;T;T;T;T;T;T;T;T;T;T	0.41400	1.9;1.9;1.9;1.9;1.9;1.9;1.9;1.0;1.9;1.9;1.9	5.21	4.09	0.47781	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.23171	0.0560	N	0.05383	-0.06	0.53688	D	0.999972	B;B;B	0.19200	0.027;0.034;0.034	B;B;B	0.25405	0.036;0.06;0.06	T	0.04537	-1.0944	10	0.37606	T	0.19	.	8.9327	0.35680	0.8441:0.0:0.1559:0.0	.	32;32;32	F5H7S4;B5BTY6;O14757	.;.;CHK1_HUMAN	D	32	ENSP00000388648:E32D;ENSP00000434141:E32D;ENSP00000412504:E32D;ENSP00000442317:E32D;ENSP00000431525:E32D;ENSP00000431815:E32D;ENSP00000432470:E32D;ENSP00000433103:E32D;ENSP00000435371:E32D;ENSP00000432890:E32D;ENSP00000278916:E32D	ENSP00000278916:E32D	E	+	3	2	CHEK1	125002742	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.843000	0.27640	0.957000	0.37930	0.477000	0.44152	GAA	.		0.328	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386714.1	NM_001274	
NFRKB	4798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	129747271	129747271	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:129747271G>A	ENST00000446488.3	-	15	1624	c.1521C>T	c.(1519-1521)gaC>gaT	p.D507D	NFRKB_ENST00000524746.1_Silent_p.D507D|NFRKB_ENST00000524794.1_Silent_p.D532D|NFRKB_ENST00000304521.5_Silent_p.D507D	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	507					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GCACCACATAGTCAGTTCTTC	0.507																																					p.D532D		.											.	NFRKB-93	0			c.C1596T						.						161.0	149.0	153.0					11																	129747271		2201	4297	6498	SO:0001819	synonymous_variant	4798	exon14			CACATAGTCAGTT		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.1521C>T	11.37:g.129747271G>A		Somatic	111	0		WXS	Illumina HiSeq	Phase_I	74	27	NM_006165	0	0	0	0	0	Q12869|Q15312|Q9H048	Silent	SNP	ENST00000446488.3	37	CCDS44770.1																																																																																			.		0.507	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165	
C12orf57	113246	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7053729	7053729	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:7053729G>T	ENST00000229281.5	+	2	242	c.143G>T	c.(142-144)gGt>gTt	p.G48V	C12orf57_ENST00000544681.1_Missense_Mutation_p.G48V|RNU7-1_ENST00000458811.1_RNA|C12orf57_ENST00000542222.1_3'UTR|U47924.31_ENST00000607421.1_RNA|PTPN6_ENST00000447931.2_5'Flank|C12orf57_ENST00000537087.1_Splice_Site|PTPN6_ENST00000399448.1_5'Flank|C12orf57_ENST00000540506.2_Missense_Mutation_p.G13V	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	48						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						AACGACATGGGTAAGATGCTG	0.627											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G48V		.											.	C12orf57-90	0			c.G143T						.						90.0	66.0	74.0					12																	7053729		2203	4300	6503	SO:0001583	missense	113246	exon2			ACATGGGTAAGAT	U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.143G>T	12.37:g.7053729G>T	ENSP00000229281:p.Gly48Val	Somatic	95	0	638	WXS	Illumina HiSeq	Phase_I	203	118	NM_138425	0	0	93	301	208	B2R4Q6	Missense_Mutation	SNP	ENST00000229281.5	37	CCDS8571.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.6|24.6	4.552280|4.552280	0.86127|0.86127	.|.	.|.	ENSG00000111678|ENSG00000111678	ENST00000537087|ENST00000545581;ENST00000229281	.|T;T	.|0.75938	.|-0.98;-0.98	3.74|3.74	3.74|3.74	0.42951|0.42951	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.74412	.|0.3713	L|L	0.31664|0.31664	0.95|0.95	0.80722|0.80722	D|D	1|1	.|D;B	.|0.76494	.|0.999;0.106	.|D;B	.|0.74023	.|0.982;0.013	.|T	.|0.67673	.|-0.5610	.|10	.|0.06625	.|T	.|0.88	.|-25.1478	14.5671|14.5671	0.68185|0.68185	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|48;48	.|F5GXW5;Q99622	.|.;C10_HUMAN	.|V	-1|48	.|ENSP00000440602:G48V;ENSP00000229281:G48V	.|ENSP00000229281:G48V	.|G	+|+	.|2	.|0	C12orf57|C12orf57	6923990|6923990	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	9.007000|9.007000	0.93597|0.93597	2.373000|2.373000	0.80994|0.80994	0.561000|0.561000	0.74099|0.74099	.|GGT	.		0.627	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401959.1	NM_138425	
APOBEC1	339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7818467	7818467	+	Start_Codon_SNP	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:7818467A>G	ENST00000229304.4	-	1	22	c.2T>C	c.(1-3)aTg>aCg	p.M1T		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	1					cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						CTCAGAAGTCATGGTGCTCTG	0.498																																					p.M1T	Pancreas(135;929 1826 4531 10527 41012)	.											.	APOBEC1-226	0			c.T2C						.						298.0	269.0	279.0					12																	7818467		2203	4300	6503	SO:0001582	initiator_codon_variant	339	exon1			GAAGTCATGGTGC	U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.2T>C	12.37:g.7818467A>G	ENSP00000229304:p.Met1Thr	Somatic	153	0		WXS	Illumina HiSeq	Phase_I	226	54	NM_001644	0	0	0	0	0	Q9UE64|Q9UM71	Missense_Mutation	SNP	ENST00000229304.4	37	CCDS8579.1	.	.	.	.	.	.	.	.	.	.	A	14.62	2.590655	0.46214	.	.	ENSG00000111701	ENST00000229304	T	0.63255	-0.03	3.14	3.14	0.36123	.	0.142717	0.32068	N	0.006622	T	0.71333	0.3327	.	.	.	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	T	0.73714	-0.3896	9	0.87932	D	0	-6.9996	8.0961	0.30829	1.0:0.0:0.0:0.0	.	1	P41238	ABEC1_HUMAN	T	1	ENSP00000229304:M1T	ENSP00000229304:M1T	M	-	2	0	APOBEC1	7709734	1.000000	0.71417	0.994000	0.49952	0.848000	0.48234	2.359000	0.44142	1.686000	0.51046	0.379000	0.24179	ATG	.		0.498	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280523.1	NM_001644	Missense_Mutation
PLEKHA5	54477	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	19500042	19500042	+	Intron	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:19500042A>G	ENST00000299275.6	+	18	2406				PLEKHA5_ENST00000317589.4_Missense_Mutation_p.R839G|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.R942G|PLEKHA5_ENST00000538714.1_Intron|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.R758G|PLEKHA5_ENST00000359180.3_Intron|PLEKHA5_ENST00000539256.1_Intron|PLEKHA5_ENST00000424268.1_Missense_Mutation_p.R765G|PLEKHA5_ENST00000355397.3_Intron	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5						reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CTGTTATAGCAGGGGCCCAGT	0.498																																					p.R942G	Pancreas(196;329 2193 11246 14234 19524)	.											.	PLEKHA5-227	0			c.A2824G						.						91.0	80.0	83.0					12																	19500042		692	1591	2283	SO:0001627	intron_variant	54477	exon24			TATAGCAGGGGCC	AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2400+1220A>G	12.37:g.19500042A>G		Somatic	118	0		WXS	Illumina HiSeq	Phase_I	172	47	NM_001256470	0	0	0	0	0	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	ENST00000299275.6	37	CCDS8682.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.391185	0.62066	.	.	ENSG00000052126	ENST00000317589;ENST00000542828;ENST00000429027;ENST00000424268;ENST00000543806;ENST00000536974	T;T;T;T;T	0.10005	2.92;2.92;2.92;2.92;2.92	5.66	4.53	0.55603	.	0.154367	0.42420	D	0.000712	T	0.11196	0.0273	.	.	.	0.80722	D	1	B;B;B;B;B	0.27625	0.08;0.183;0.115;0.115;0.115	B;B;B;B;B	0.33690	0.12;0.168;0.081;0.081;0.031	T	0.06534	-1.0821	9	0.72032	D	0.01	-15.471	7.1521	0.25616	0.7782:0.1481:0.0737:0.0	.	839;758;765;937;942	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;E9PHQ3	.;.;.;.;.	G	839;938;942;765;758;731	ENSP00000325155:R839G;ENSP00000404296:R942G;ENSP00000400411:R765G;ENSP00000439837:R758G;ENSP00000440371:R731G	ENSP00000325155:R839G	R	+	1	2	PLEKHA5	19391309	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.764000	0.62264	2.137000	0.66172	0.528000	0.53228	AGG	.		0.498	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397013.1	NM_019012	
KIF21A	55605	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	39709737	39709737	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:39709737T>C	ENST00000361418.5	-	30	3959	c.3944A>G	c.(3943-3945)cAc>cGc	p.H1315R	KIF21A_ENST00000395670.3_Missense_Mutation_p.H1315R|KIF21A_ENST00000361961.3_Missense_Mutation_p.H1302R|KIF21A_ENST00000541463.2_Intron|KIF21A_ENST00000544797.2_Intron|KIF21A_ENST00000547745.1_Intron			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1315					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				AAAGTACCTGTGTACCTCCGA	0.393																																					p.H1315R													.	KIF21A-97	0			c.A3944G						.						129.0	130.0	130.0					12																	39709737		2203	4300	6503	SO:0001583	missense	55605	exon30			TACCTGTGTACCT	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.3944A>G	12.37:g.39709737T>C	ENSP00000354878:p.His1315Arg	Somatic	308	3		WXS	Illumina HiSeq	Phase_I	544	307	NM_001173464	0	0	0	0	0	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	37	CCDS53776.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.099|9.099	1.003773|1.003773	0.19199|0.19199	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000361418|ENST00000552961	T;T;T|.	0.69306|.	-0.39;-0.34;-0.31|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.000000|.	0.56097|.	D|.	0.000032|.	T|T	0.69895|0.69895	0.3162|0.3162	L|L	0.57536|0.57536	1.79|1.79	0.43841|0.43841	D|D	0.99642|0.99642	B;B;B|.	0.22983|.	0.025;0.078;0.05|.	B;B;B|.	0.23275|.	0.045;0.04;0.037|.	T|T	0.68777|0.68777	-0.5319|-0.5319	10|5	0.14656|.	T|.	0.56|.	.|.	15.2397|15.2397	0.73458|0.73458	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1315;1302;1272|.	Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3|.	KI21A_HUMAN;.;.|.	R|A	1302;1315;1272;1315|620	ENSP00000354851:H1302R;ENSP00000379029:H1315R;ENSP00000354878:H1315R|.	ENSP00000344501:H1272R|.	H|T	-|-	2|1	0|0	KIF21A|KIF21A	37996004|37996004	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.490000|5.490000	0.66881|0.66881	2.001000|2.001000	0.58596|0.58596	0.482000|0.482000	0.46254|0.46254	CAC|ACA	.		0.393	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
SPRYD4	283377	broad.mit.edu;bcgsc.ca	37	12	56862411	56862411	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:56862411C>T	ENST00000338146.5	+	1	111	c.36C>T	c.(34-36)tgC>tgT	p.C12C	MIP_ENST00000555551.1_Intron	NM_207344.3	NP_997227	Q8WW59	SPRY4_HUMAN	SPRY domain containing 4	12	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)	7						TGCGCTTGTGCCGCTGGGGAG	0.567																																					p.C12C													.	SPRYD4-68	0			c.C36T						.						136.0	125.0	129.0					12																	56862411		2203	4300	6503	SO:0001819	synonymous_variant	283377	exon1			CTTGTGCCGCTGG	AL832247	CCDS8920.1	12q13.3	2006-03-09				ENSG00000176422			27468	protein-coding gene	gene with protein product							Standard	NM_207344		Approved	DKFZp686N0877	uc001sli.4	Q8WW59		ENST00000338146.5:c.36C>T	12.37:g.56862411C>T		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	110	5	NM_207344	0	0	6	6	0	A8K7A5	Silent	SNP	ENST00000338146.5	37	CCDS8920.1																																																																																			.		0.567	SPRYD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_207344	
SLC5A8	160728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	101588897	101588897	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:101588897C>T	ENST00000536262.2	-	4	1071	c.513G>A	c.(511-513)gtG>gtA	p.V171V		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						ATGTGCAGACCACCCCCGTTG	0.403																																					p.V171V	GBM(60;420 1056 13605 22380 47675)	.											.	SLC5A8-90	0			c.G513A						.						99.0	86.0	90.0					12																	101588897		2203	4300	6503	SO:0001819	synonymous_variant	160728	exon4			GCAGACCACCCCC	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.513G>A	12.37:g.101588897C>T		Somatic	101	0		WXS	Illumina HiSeq	Phase_I	108	61	NM_145913	0	0	0	0	0		Silent	SNP	ENST00000536262.2	37	CCDS9080.1																																																																																			.		0.403	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913	
BTBD11	121551	hgsc.bcm.edu	37	12	107713245	107713245	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:107713245G>A	ENST00000280758.5	+	1	1056	c.528G>A	c.(526-528)gcG>gcA	p.A176A	BTBD11_ENST00000490090.2_Silent_p.A176A|BTBD11_ENST00000420571.2_Silent_p.A176A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	176						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GCCTGGCCGCGCACTGTACGG	0.697																																					p.A176A		.											.	BTBD11-93	0			c.G528A						.						11.0	10.0	10.0					12																	107713245		2095	4067	6162	SO:0001819	synonymous_variant	121551	exon1			GGCCGCGCACTGT	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.528G>A	12.37:g.107713245G>A		Somatic	2	0		WXS	Illumina HiSeq	Phase_I	10	7	NM_001018072	0	0	0	0	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Silent	SNP	ENST00000280758.5	37	CCDS31893.1																																																																																			.		0.697	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
GPC6	10082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	94197565	94197565	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr13:94197565A>T	ENST00000377047.4	+	2	825	c.210A>T	c.(208-210)gaA>gaT	p.E70D		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	70					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GCACCACAGAAATGGAAGACA	0.408																																					p.E70D		.											.	GPC6-90	0			c.A210T						.						154.0	142.0	146.0					13																	94197565		2203	4300	6503	SO:0001583	missense	10082	exon2			CACAGAAATGGAA	AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.210A>T	13.37:g.94197565A>T	ENSP00000366246:p.Glu70Asp	Somatic	82	0		WXS	Illumina HiSeq	Phase_I	95	42	NM_005708	0	0	0	0	0	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	ENST00000377047.4	37	CCDS9469.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.598483	0.46318	.	.	ENSG00000183098	ENST00000377047	T	0.52983	0.64	5.0	3.82	0.43975	.	0.074354	0.51477	D	0.000081	T	0.43919	0.1269	L	0.51853	1.615	0.31140	N	0.706753	B;B	0.21452	0.031;0.056	B;B	0.30646	0.118;0.101	T	0.50110	-0.8866	10	0.46703	T	0.11	.	10.667	0.45736	0.9242:0.0:0.0758:0.0	.	70;70	B4E2M1;Q9Y625	.;GPC6_HUMAN	D	70	ENSP00000366246:E70D	ENSP00000366246:E70D	E	+	3	2	GPC6	92995566	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	0.672000	0.25187	0.867000	0.35654	0.524000	0.50904	GAA	.		0.408	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045460.4	NM_005708	
LRFN5	145581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	42360768	42360768	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr14:42360768C>T	ENST00000298119.4	+	4	2890	c.1701C>T	c.(1699-1701)agC>agT	p.S567S	LRFN5_ENST00000554120.1_Intron|LRFN5_ENST00000554171.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	567						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CCAAGGTTAGCAATGTTTATT	0.458										HNSCC(30;0.082)																											p.S567S		.											.	LRFN5-97	0			c.C1701T						.						103.0	99.0	100.0					14																	42360768		2203	4300	6503	SO:0001819	synonymous_variant	145581	exon4			GGTTAGCAATGTT	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1701C>T	14.37:g.42360768C>T		Somatic	102	0		WXS	Illumina HiSeq	Phase_I	113	43	NM_152447	0	0	1	1	0	B3KU78|Q86XL2	Silent	SNP	ENST00000298119.4	37	CCDS9678.1																																																																																			.		0.458	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
NEK9	91754	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	75558059	75558059	+	Nonsense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr14:75558059G>A	ENST00000238616.5	-	19	2514	c.2356C>T	c.(2356-2358)Cga>Tga	p.R786*		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	786	Interaction with NEK6.|Pro/Ser/Thr-rich.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TCCATTCCTCGGTCTGCTTCC	0.567																																					p.R786X		.											.	NEK9-359	0			c.C2356T						.						116.0	104.0	108.0					14																	75558059		2203	4300	6503	SO:0001587	stop_gained	91754	exon19			TTCCTCGGTCTGC	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.2356C>T	14.37:g.75558059G>A	ENSP00000238616:p.Arg786*	Somatic	74	0		WXS	Illumina HiSeq	Phase_I	70	32	NM_033116	0	0	1	1	0	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Nonsense_Mutation	SNP	ENST00000238616.5	37	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	G	41	9.014481	0.99037	.	.	ENSG00000119638	ENST00000238616	.	.	.	5.66	5.66	0.87406	.	0.295996	0.31673	N	0.007256	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.752	0.96271	0.0:0.0:1.0:0.0	.	.	.	.	X	786	.	ENSP00000238616:R786X	R	-	1	2	NEK9	74627812	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.628000	0.61282	2.668000	0.90789	0.462000	0.41574	CGA	.		0.567	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116	
ZBTB42	100128927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	105268528	105268528	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr14:105268528G>A	ENST00000342537.7	+	1	1279	c.994G>A	c.(994-996)Gtg>Atg	p.V332M	ZBTB42_ENST00000555360.1_Missense_Mutation_p.V332M	NM_001137601.1	NP_001131073.1	B2RXF5	ZBT42_HUMAN	zinc finger and BTB domain containing 42	332					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACCCGACGGCGTGGCACCCAC	0.637																																					p.V332M		.											.	.	0			c.G994A						.						52.0	60.0	58.0					14																	105268528		692	1590	2282	SO:0001583	missense	100128927	exon2			GACGGCGTGGCAC	AX721091	CCDS45174.1	14q32.33	2013-01-09				ENSG00000179627		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	32550	protein-coding gene	gene with protein product		613915					Standard	NM_001137601		Approved	ZNF925	uc001ypp.3	B2RXF5		ENST00000342537.7:c.994G>A	14.37:g.105268528G>A	ENSP00000409107:p.Val332Met	Somatic	28	0		WXS	Illumina HiSeq	Phase_I	53	22	NM_001137601	0	0	4	7	3	B7ZW21	Missense_Mutation	SNP	ENST00000342537.7	37	CCDS45174.1	.	.	.	.	.	.	.	.	.	.	G	5.044	0.193832	0.09599	.	.	ENSG00000179627	ENST00000555360;ENST00000342537	T;T	0.37752	1.18;1.18	3.91	-6.29	0.02013	.	.	.	.	.	T	0.13243	0.0321	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.17992	-1.0351	9	0.49607	T	0.09	.	1.3352	0.02143	0.3195:0.0839:0.2877:0.3089	.	332	B2RXF5	ZBT42_HUMAN	M	332	ENSP00000450673:V332M;ENSP00000409107:V332M	ENSP00000409107:V332M	V	+	1	0	ZBTB42	104339573	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	0.282000	0.18829	-1.081000	0.03105	-1.012000	0.02466	GTG	.		0.637	ZBTB42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410372.1		
MTMR10	54893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	31251264	31251264	+	Silent	SNP	G	G	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr15:31251264G>C	ENST00000435680.1	-	8	916	c.819C>G	c.(817-819)tcC>tcG	p.S273S	RNU6-466P_ENST00000391224.1_RNA|MTMR10_ENST00000425768.1_3'UTR|MTMR10_ENST00000563714.1_Silent_p.S191S|MTMR10_ENST00000314404.8_Silent_p.S25S	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	273	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		CAAAAGAATGGGAAAAGATCT	0.383																																					p.S273S		.											.	MTMR10-91	0			c.C819G						.						67.0	63.0	64.0					15																	31251264		1866	4106	5972	SO:0001819	synonymous_variant	54893	exon8			AGAATGGGAAAAG	AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.819C>G	15.37:g.31251264G>C		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	85	38	NM_017762	0	0	0	2	2	Q6P4Q6	Silent	SNP	ENST00000435680.1	37	CCDS45204.1																																																																																			.		0.383	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430747.1	NM_017762	
COPS2	9318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	49421727	49421727	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr15:49421727G>A	ENST00000388901.5	-	11	1148	c.1075C>T	c.(1075-1077)Ctt>Ttt	p.L359F	COPS2_ENST00000542928.1_Missense_Mutation_p.L295F|COPS2_ENST00000299259.6_Missense_Mutation_p.L366F	NM_001143887.1|NM_004236.3	NP_001137359.1|NP_004227.1	P61201	CSN2_HUMAN	COP9 signalosome subunit 2	359	PCI.				cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(2)	18		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		AATTTTATAAGCACTTGTGTT	0.229																																					p.L366F	NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)	.											.	COPS2-227	0			c.C1096T						.						24.0	25.0	24.0					15																	49421727		2132	4209	6341	SO:0001583	missense	9318	exon11			TTATAAGCACTTG	AF212227	CCDS32235.1, CCDS45257.1	15q21.2	2013-03-14	2013-03-14						30747	protein-coding gene	gene with protein product		604508	"""COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)"""			7776974, 9535219	Standard	NM_004236		Approved	TRIP15, ALIEN, CSN2	uc001zxh.3	P61201		ENST00000388901.5:c.1075C>T	15.37:g.49421727G>A	ENSP00000373553:p.Leu359Phe	Somatic	104	0		WXS	Illumina HiSeq	Phase_I	85	35	NM_001143887	0	0	14	23	9	O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Missense_Mutation	SNP	ENST00000388901.5	37	CCDS32235.1	.	.	.	.	.	.	.	.	.	.	G	27.8	4.868385	0.91587	.	.	ENSG00000166200	ENST00000299259;ENST00000388901;ENST00000542928	T;T;T	0.44083	0.93;0.93;0.93	5.05	5.05	0.67936	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	T	0.76737	0.4029	H	0.96208	3.785	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.995;0.995;0.998	D	0.84887	0.0834	10	0.72032	D	0.01	-18.1449	18.7719	0.91896	0.0:0.0:1.0:0.0	.	295;367;359	B4DIH5;Q59EL2;P61201	.;.;CSN2_HUMAN	F	366;359;295	ENSP00000299259:L366F;ENSP00000373553:L359F;ENSP00000443664:L295F	ENSP00000299259:L366F	L	-	1	0	COPS2	47209019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.747000	0.98863	2.498000	0.84270	0.655000	0.94253	CTT	.		0.229	COPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417840.1	NM_004236	
AP4E1	23431	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	51294808	51294808	+	Silent	SNP	T	T	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr15:51294808T>G	ENST00000261842.5	+	21	3469	c.3363T>G	c.(3361-3363)acT>acG	p.T1121T	AP4E1_ENST00000561397.1_3'UTR|AP4E1_ENST00000560508.1_Silent_p.T1046T	NM_001252127.1|NM_007347.4	NP_001239056.1|NP_031373.2	Q9UPM8	AP4E1_HUMAN	adaptor-related protein complex 4, epsilon 1 subunit	1121					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	coated pit (GO:0005905)|Golgi apparatus (GO:0005794)|membrane coat (GO:0030117)				breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(5)|skin(2)	27				all cancers(107;0.000893)|GBM - Glioblastoma multiforme(94;0.00364)		CCTGTTCTACTCTTCCTGACT	0.463																																					p.T1121T		.											.	AP4E1-90	0			c.T3363G						.						275.0	213.0	234.0					15																	51294808		2196	4294	6490	SO:0001819	synonymous_variant	23431	exon21			TTCTACTCTTCCT	AB030653	CCDS32240.1, CCDS58362.1	15q21.2	2014-09-17			ENSG00000081014	ENSG00000081014			573	protein-coding gene	gene with protein product		607244				10436028, 21620353	Standard	NM_007347		Approved	AP-4-EPSILON, SPG51	uc001zyx.2	Q9UPM8	OTTHUMG00000172458	ENST00000261842.5:c.3363T>G	15.37:g.51294808T>G		Somatic	169	0		WXS	Illumina HiSeq	Phase_I	128	69	NM_007347	0	0	0	0	0	A0AVD6|A1L4A9|A6NNX7|H0YKX4|Q68D31|Q9Y588	Silent	SNP	ENST00000261842.5	37	CCDS32240.1																																																																																			.		0.463	AP4E1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418656.1		
ADCY9	115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	4164714	4164714	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr16:4164714G>A	ENST00000294016.3	-	2	1268	c.730C>T	c.(730-732)Ctg>Ttg	p.L244L		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	244					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CACAAACTCAGGTACAAAGGT	0.552																																					p.L244L		.											.	ADCY9-139	0			c.C730T						.						58.0	46.0	50.0					16																	4164714		2196	4299	6495	SO:0001819	synonymous_variant	115	exon2			AACTCAGGTACAA	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.730C>T	16.37:g.4164714G>A		Somatic	170	0		WXS	Illumina HiSeq	Phase_I	154	55	NM_001116	0	0	0	0	0	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	ENST00000294016.3	37	CCDS32382.1																																																																																			.		0.552	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
MAP2K4	6416	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	11998978	11998978	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr17:11998978C>T	ENST00000353533.5	+	4	543	c.480C>T	c.(478-480)taC>taT	p.Y160Y	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Silent_p.Y171Y	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		ATTGCCCATACATTGTTCAGT	0.373			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.Y160Y				Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	MAP2K4-3134	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|large_intestine(1)|pancreas(1)	c.C480T						.						184.0	173.0	177.0					17																	11998978		2203	4300	6503	SO:0001819	synonymous_variant	6416	exon4			CCCATACATTGTT	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.480C>T	17.37:g.11998978C>T		Somatic	114	1		WXS	Illumina HiSeq	Phase_I	219	62	NM_003010	0	0	0	0	0	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Silent	SNP	ENST00000353533.5	37	CCDS11162.1																																																																																			.		0.373	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
MPRIP	23164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17075111	17075111	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr17:17075111G>A	ENST00000341712.4	+	16	2243	c.2243G>A	c.(2242-2244)cGg>cAg	p.R748Q	MPRIP_ENST00000395811.5_Missense_Mutation_p.R748Q|RNU6-767P_ENST00000384132.1_RNA|MPRIP_ENST00000444976.1_Missense_Mutation_p.R710Q|MPRIP_ENST00000395804.3_Missense_Mutation_p.R748Q|RP11-45M22.3_ENST00000584203.1_RNA			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	748	Interaction with RHOA.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						CAGCACCAGCGGGAGCTAGAG	0.572																																					p.R748Q		.											.	MPRIP-90	0			c.G2243A						.						71.0	85.0	80.0					17																	17075111		2203	4300	6503	SO:0001583	missense	23164	exon16			ACCAGCGGGAGCT	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2243G>A	17.37:g.17075111G>A	ENSP00000342379:p.Arg748Gln	Somatic	195	0		WXS	Illumina HiSeq	Phase_I	288	176	NM_015134	0	0	13	38	25	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	37	CCDS32578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.7|29.7	5.027583|5.027583	0.93518|0.93518	.|.	.|.	ENSG00000133030|ENSG00000133030	ENST00000414263|ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	.|T;T;T;T	.|0.25579	.|1.79;2.12;2.13;2.13	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.126948	.|0.50627	.|D	.|0.000103	T|T	0.44307|0.44307	0.1287|0.1287	L|L	0.37850|0.37850	1.14|1.14	0.44373|0.44373	D|D	0.99727|0.99727	.|D;P;D	.|0.89917	.|1.0;0.777;1.0	.|D;B;D	.|0.79108	.|0.992;0.346;0.992	T|T	0.12941|0.12941	-1.0528|-1.0528	5|10	.|0.46703	.|T	.|0.11	-16.1602|-16.1602	20.032|20.032	0.97543|0.97543	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1112;748;748	.|Q9Y6X7;Q6WCQ1-2;Q6WCQ1	.|.;.;MPRIP_HUMAN	R|Q	814|710;748;748;748	.|ENSP00000400189:R710Q;ENSP00000379156:R748Q;ENSP00000379149:R748Q;ENSP00000342379:R748Q	.|ENSP00000342379:R748Q	G|R	+|+	1|2	0|0	MPRIP|MPRIP	17015836|17015836	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	9.387000|9.387000	0.97232|0.97232	2.743000|2.743000	0.94032|0.94032	0.655000|0.655000	0.94253|0.94253	GGG|CGG	.		0.572	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
PCGF2	7703	broad.mit.edu	37	17	36891628	36891628	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr17:36891628T>G	ENST00000580830.1	-	12	1584	c.883A>C	c.(883-885)Acc>Ccc	p.T295P	PCGF2_ENST00000581345.1_Missense_Mutation_p.T295P|PCGF2_ENST00000578109.1_3'UTR|PCGF2_ENST00000585100.1_3'UTR|PCGF2_ENST00000360797.2_Missense_Mutation_p.T295P|PCGF2_ENST00000579882.1_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2	295	Pro/Ser-rich.				anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					GTAGGGTGGGTGGCTGGAGGC	0.682											OREG0024367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T295P													.	PCGF2-658	0			c.A883C						.						16.0	12.0	13.0					17																	36891628		2187	4280	6467	SO:0001583	missense	7703	exon11			GGTGGGTGGCTGG	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.883A>C	17.37:g.36891628T>G	ENSP00000461961:p.Thr295Pro	Somatic	38	2	866	WXS	Illumina HiSeq	Phase_I	93	7	NM_007144	0	0	162	163	1	A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	37	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	T	10.42	1.344960	0.24426	.	.	ENSG00000056661	ENST00000360797	T	0.31247	1.5	4.92	-0.193	0.13244	.	0.651897	0.15163	N	0.277024	T	0.13628	0.0330	N	0.04508	-0.205	0.26765	N	0.969921	B	0.02656	0.0	B	0.01281	0.0	T	0.23583	-1.0184	10	0.23891	T	0.37	-6.6811	12.5227	0.56069	0.0:0.0:0.6437:0.3563	.	295	P35227	PCGF2_HUMAN	P	295	ENSP00000354033:T295P	ENSP00000354033:T295P	T	-	1	0	PCGF2	34145154	0.004000	0.15560	0.536000	0.28039	0.978000	0.69477	-0.673000	0.05239	-0.232000	0.09811	0.459000	0.35465	ACC	.		0.682	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144	
PSMC3IP	29893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40729246	40729246	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr17:40729246G>C	ENST00000393795.3	-	3	318	c.210C>G	c.(208-210)atC>atG	p.I70M	PSMC3IP_ENST00000590760.1_De_novo_Start_OutOfFrame|PSMC3IP_ENST00000587209.1_Missense_Mutation_p.I7M|PSMC3IP_ENST00000253789.5_Missense_Mutation_p.I70M	NM_001256015.1|NM_001256016.1|NM_016556.3	NP_001242944.1|NP_001242945.1|NP_057640.1	Q9P2W1	HOP2_HUMAN	PSMC3 interacting protein	70					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)|regulation of RNA biosynthetic process (GO:2001141)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			endometrium(2)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(2)	7		all_cancers(22;0.00426)|Breast(137;0.00116)|all_epithelial(22;0.0395)		BRCA - Breast invasive adenocarcinoma(366;0.13)		CCGCAAAATAGATCTTCTGCT	0.532																																					p.I70M		.											.	PSMC3IP-92	0			c.C210G						.						163.0	113.0	130.0					17																	40729246		2203	4300	6503	SO:0001583	missense	29893	exon3			AAAATAGATCTTC	AB030304, NM_013290, BC008792	CCDS11431.1, CCDS45688.1, CCDS59289.1	17q21.2	2012-04-10				ENSG00000131470		"""Proteasome (prosome, macropain) subunits"""	17928	protein-coding gene	gene with protein product	"""TBP-1 interacting protein"""	608665				7490091, 10806355, 11739747	Standard	NM_016556		Approved	TBPIP, GT198, HUMGT198A	uc002iai.3	Q9P2W1		ENST00000393795.3:c.210C>G	17.37:g.40729246G>C	ENSP00000377384:p.Ile70Met	Somatic	118	0		WXS	Illumina HiSeq	Phase_I	173	66	NM_016556	0	0	3	8	5	C5ILB7|Q14458|Q8WXG2|Q96HA2	Missense_Mutation	SNP	ENST00000393795.3	37	CCDS45688.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105854	0.77096	.	.	ENSG00000131470	ENST00000393795;ENST00000253789	T;T	0.60797	0.16;0.16	5.8	-1.78	0.07957	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.051811	0.85682	D	0.000000	T	0.71753	0.3377	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.71738	-0.4502	10	0.72032	D	0.01	-11.3368	11.3412	0.49533	0.0598:0.0:0.3656:0.5746	.	70;70	Q9P2W1-2;Q9P2W1	.;HOP2_HUMAN	M	70	ENSP00000377384:I70M;ENSP00000253789:I70M	ENSP00000253789:I70M	I	-	3	3	PSMC3IP	37982772	0.947000	0.32204	0.954000	0.39281	0.978000	0.69477	-0.022000	0.12480	-0.533000	0.06323	0.655000	0.94253	ATC	.		0.532	PSMC3IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450427.1	NM_013290	
NPEPPS	9520	broad.mit.edu	37	17	45682709	45682709	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr17:45682709G>A	ENST00000322157.4	+	17	2123	c.1886G>A	c.(1885-1887)gGa>gAa	p.G629E	NPEPPS_ENST00000530173.1_Missense_Mutation_p.G625E|NPEPPS_ENST00000544660.1_Missense_Mutation_p.G549E|RP11-580I16.2_ENST00000582389.1_RNA|RP11-580I16.2_ENST00000582066.1_RNA	NM_006310.3	NP_006301.3	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	629					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular response to hypoxia (GO:0071456)|protein polyubiquitination (GO:0000209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	27						GCTCGAGCTGGAATCATTAGC	0.403																																					p.G629E													.	NPEPPS-90	0			c.G1886A						.						65.0	57.0	59.0					17																	45682709		1841	4087	5928	SO:0001583	missense	9520	exon17			GAGCTGGAATCAT	Y07701	CCDS45721.1	17q12-q21	2008-07-18			ENSG00000141279	ENSG00000141279	3.4.11.2		7900	protein-coding gene	gene with protein product	"""puromycin-sensitive aminopeptidase"", ""metalloproteinase MP100"""	606793				9048733, 10329370	Standard	NM_006310		Approved	PSA, MP100	uc002ilr.4	P55786	OTTHUMG00000165471	ENST00000322157.4:c.1886G>A	17.37:g.45682709G>A	ENSP00000320324:p.Gly629Glu	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	130	6	NM_006310	0	0	0	0	0	B7Z463|Q6P145|Q9NP16|Q9UEM2	Missense_Mutation	SNP	ENST00000322157.4	37	CCDS45721.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044695	0.93685	.	.	ENSG00000141279	ENST00000530173;ENST00000322157;ENST00000544660	T;T;T	0.10860	2.83;2.83;2.83	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.43055	0.1230	M	0.86864	2.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	T	0.32798	-0.9893	10	0.72032	D	0.01	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	625;312;629	E9PLK3;B7Z1H4;P55786	.;.;PSA_HUMAN	E	625;629;549	ENSP00000433287:G625E;ENSP00000320324:G629E;ENSP00000442461:G549E	ENSP00000320324:G629E	G	+	2	0	NPEPPS	43037708	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	GGA	.		0.403	NPEPPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384269.1	NM_006310	
SLC35B1	10237	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	47780367	47780367	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr17:47780367T>G	ENST00000240333.6	-	8	890	c.769A>C	c.(769-771)Atc>Ctc	p.I257L	SLC35B1_ENST00000415270.2_Missense_Mutation_p.I294L			P78383	S35B1_HUMAN	solute carrier family 35, member B1	257					transport (GO:0006810)|UDP-galactose transmembrane transport (GO:0072334)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	UDP-galactose transmembrane transporter activity (GO:0005459)			endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(1)	7						GTCATAAAGATGAAGCTCTAG	0.468																																					p.I257L													.	SLC35B1-90	0			c.A769C						.						119.0	120.0	120.0					17																	47780367		2203	4300	6503	SO:0001583	missense	10237	exon8			TAAAGATGAAGCT	D16978	CCDS11552.1, CCDS11552.2	17q21.32	2013-05-22			ENSG00000121073	ENSG00000121073		"""Solute carriers"""	20798	protein-coding gene	gene with protein product		610790				9010752	Standard	NM_005827		Approved	UGTREL1	uc002iph.1	P78383	OTTHUMG00000161638	ENST00000240333.6:c.769A>C	17.37:g.47780367T>G	ENSP00000240333:p.Ile257Leu	Somatic	165	1		WXS	Illumina HiSeq	Phase_I	201	72	NM_005827	0	0	1	1	0	B4DEC4|J3KQV4|Q96EW7	Missense_Mutation	SNP	ENST00000240333.6	37	CCDS11552.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.828281	0.90955	.	.	ENSG00000121073	ENST00000240333;ENST00000415270;ENST00000504260;ENST00000502406;ENST00000503334	T;T;T	0.39056	1.1;1.1;1.1	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.67458	0.2895	M	0.88570	2.965	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.63381	0.914;0.914	T	0.74604	-0.3610	10	0.62326	D	0.03	0.0724	14.8245	0.70101	0.0:0.0:0.0:1.0	.	190;257	D3DTX1;P78383	.;S35B1_HUMAN	L	257;294;133;133;190	ENSP00000240333:I257L;ENSP00000409548:I294L;ENSP00000423323:I190L	ENSP00000240333:I257L	I	-	1	0	SLC35B1	45135366	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.645000	0.83430	2.153000	0.67306	0.533000	0.62120	ATC	.		0.468	SLC35B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365564.2	NM_005827	
TRIM25	7706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	54969126	54969126	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr17:54969126C>G	ENST00000316881.4	-	9	1877	c.1828G>C	c.(1828-1830)Gct>Cct	p.A610P	MIR3614_ENST00000581261.1_RNA|TRIM25_ENST00000573108.1_5'Flank|RP11-670E13.5_ENST00000574826.1_RNA|TRIM25_ENST00000537230.1_Missense_Mutation_p.A610P	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	610	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					GGGTACAAAGCCTCAGTAAAG	0.547																																					p.A610P		.											.	TRIM25-289	0			c.G1828C						.						58.0	50.0	53.0					17																	54969126		2203	4300	6503	SO:0001583	missense	7706	exon9			ACAAAGCCTCAGT	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.1828G>C	17.37:g.54969126C>G	ENSP00000323889:p.Ala610Pro	Somatic	138	0		WXS	Illumina HiSeq	Phase_I	194	116	NM_005082	0	0	0	1	1		Missense_Mutation	SNP	ENST00000316881.4	37	CCDS11591.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967214	0.53507	.	.	ENSG00000121060	ENST00000316881;ENST00000537230	T;T	0.56103	0.48;0.48	4.87	4.87	0.63330	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.122762	0.36374	N	0.002631	T	0.44787	0.1310	N	0.02345	-0.59	0.58432	D	0.999993	D	0.89917	1.0	D	0.83275	0.996	T	0.43798	-0.9369	10	0.02654	T	1	.	18.0042	0.89205	0.0:1.0:0.0:0.0	.	610	Q14258	TRI25_HUMAN	P	610	ENSP00000323889:A610P;ENSP00000445961:A610P	ENSP00000323889:A610P	A	-	1	0	TRIM25	52324125	0.999000	0.42202	0.446000	0.26920	0.105000	0.19272	3.797000	0.55514	2.251000	0.74343	0.561000	0.74099	GCT	.		0.547	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440609.1	NM_005082	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	21508090	21508090	+	Silent	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr18:21508090T>C	ENST00000313654.9	+	63	8422	c.8181T>C	c.(8179-8181)ttT>ttC	p.F2727F	LAMA3_ENST00000399516.3_Silent_p.F2671F|LAMA3_ENST00000269217.6_Silent_p.F1118F|LAMA3_ENST00000587184.1_Silent_p.F1062F|LAMA3_ENST00000588770.1_3'UTR	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2727	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TAATCAGATTTAACATTTCTA	0.408																																					p.F2727F		.											.	LAMA3-100	0			c.T8181C						.						114.0	97.0	103.0					18																	21508090		2203	4300	6503	SO:0001819	synonymous_variant	3909	exon63			CAGATTTAACATT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8181T>C	18.37:g.21508090T>C		Somatic	117	0		WXS	Illumina HiSeq	Phase_I	137	50	NM_198129	0	0	0	0	0	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	37	CCDS42419.1																																																																																			.		0.408	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	11134305	11134305	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr19:11134305A>G	ENST00000429416.3	+	21	3252	c.2971A>G	c.(2971-2973)Aag>Gag	p.K991E	SMARCA4_ENST00000444061.3_Missense_Mutation_p.K991E|SMARCA4_ENST00000590574.1_Missense_Mutation_p.K991E|SMARCA4_ENST00000413806.3_Missense_Mutation_p.K991E|SMARCA4_ENST00000358026.2_Missense_Mutation_p.K991E|SMARCA4_ENST00000450717.3_Missense_Mutation_p.K991E|SMARCA4_ENST00000589677.1_Missense_Mutation_p.K991E|SMARCA4_ENST00000541122.2_Missense_Mutation_p.K991E|SMARCA4_ENST00000344626.4_Missense_Mutation_p.K991E	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	991					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GTTGCCCGAAAAGGTGATGGA	0.607			"""F, N, Mis"""		NSCLC																																p.K991E		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.A2971G						.						37.0	34.0	35.0					19																	11134305		2202	4299	6501	SO:0001583	missense	6597	exon20			CCCGAAAAGGTGA	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2971A>G	19.37:g.11134305A>G	ENSP00000395654:p.Lys991Glu	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	86	32	NM_003072	0	0	0	0	0	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.303884	0.81136	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46;-3.46;-3.46;-3.46	4.9	4.9	0.64082	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.98601	0.9532	H	0.99705	4.715	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.996;0.996;0.996;0.992;0.981;0.999;0.996;0.996	D	0.99004	1.0812	10	0.87932	D	0	-39.7655	13.6333	0.62208	1.0:0.0:0.0:0.0	.	991;991;991;991;991;211;991;991	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	E	991;991;1055;991;991;991;991;991	ENSP00000395654:K991E;ENSP00000350720:K991E;ENSP00000343896:K991E;ENSP00000445036:K991E;ENSP00000392837:K991E;ENSP00000397783:K991E;ENSP00000414727:K991E	ENSP00000343896:K991E	K	+	1	0	SMARCA4	10995305	1.000000	0.71417	0.964000	0.40570	0.535000	0.34838	8.855000	0.92236	2.055000	0.61198	0.533000	0.62120	AAG	.		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
CYP2A13	1553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	41599643	41599643	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr19:41599643T>G	ENST00000330436.3	+	6	940	c.940T>G	c.(940-942)Ttc>Gtc	p.F314V		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	314					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GCGCTACGGTTTCCTGCTGCT	0.567																																					p.F314V		.											.	CYP2A13-93	0			c.T940G						.						89.0	77.0	81.0					19																	41599643		2203	4300	6503	SO:0001583	missense	1553	exon6			TACGGTTTCCTGC	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.940T>G	19.37:g.41599643T>G	ENSP00000332679:p.Phe314Val	Somatic	116	0		WXS	Illumina HiSeq	Phase_I	113	43	NM_000766	0	0	0	0	0	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	37	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	12.81	2.049285	0.36181	.	.	ENSG00000197838	ENST00000330436	T	0.70045	-0.45	4.58	4.58	0.56647	.	0.157726	0.43919	D	0.000512	T	0.63698	0.2533	N	0.17082	0.46	0.29694	N	0.840704	P	0.51537	0.946	P	0.61003	0.882	T	0.62310	-0.6881	10	0.66056	D	0.02	.	8.6585	0.34077	0.1706:0.0:0.0:0.8293	.	314	Q16696	CP2AD_HUMAN	V	314	ENSP00000332679:F314V	ENSP00000332679:F314V	F	+	1	0	CYP2A13	46291483	0.124000	0.22315	0.995000	0.50966	0.015000	0.08874	0.497000	0.22514	1.945000	0.56424	0.397000	0.26171	TTC	.		0.567	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
FAM110C	642273	hgsc.bcm.edu;broad.mit.edu	37	2	45688	45688	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:45688C>T	ENST00000327669.4	-	1	697	c.698G>A	c.(697-699)gGg>gAg	p.G233E	FAM110C_ENST00000460464.1_5'Flank	NM_001077710.2	NP_001071178.2	Q1W6H9	F110C_HUMAN	family with sequence similarity 110, member C	233					positive regulation of cell migration (GO:0030335)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell projection assembly (GO:0060491)	cell cortex (GO:0005938)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|kidney(1)|lung(2)	4	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00221)		all cancers(51;0.000815)|Epithelial(75;0.00379)|OV - Ovarian serous cystadenocarcinoma(76;0.0127)|GBM - Glioblastoma multiforme(21;0.232)		GTTCTCCCTCCCCAGGGCCTC	0.682																																					p.G233E		.											.	FAM110C-68	0			c.G698A						.						12.0	15.0	14.0					2																	45688		2074	4200	6274	SO:0001583	missense	642273	exon1			TCCCTCCCCAGGG	DQ431183	CCDS42645.1	2p25.3	2011-12-01			ENSG00000184731	ENSG00000184731			33340	protein-coding gene	gene with protein product		611395				17499476, 19698782	Standard	NM_001077710		Approved		uc010yim.2	Q1W6H9	OTTHUMG00000151321	ENST00000327669.4:c.698G>A	2.37:g.45688C>T	ENSP00000328347:p.Gly233Glu	Somatic	15	0		WXS	Illumina HiSeq	Phase_I	18	10	NM_001077710	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327669.4	37	CCDS42645.1	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618544	0.66787	.	.	ENSG00000184731	ENST00000327669	T	0.50548	0.74	4.64	4.64	0.57946	.	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.70595	2.14	0.42278	D	0.992084	D	0.71674	0.998	D	0.74674	0.984	T	0.71879	-0.4459	10	0.72032	D	0.01	-10.2308	15.3421	0.74306	0.0:1.0:0.0:0.0	.	233	Q1W6H9	F110C_HUMAN	E	233	ENSP00000328347:G233E	ENSP00000328347:G233E	G	-	2	0	FAM110C	35688	0.991000	0.36638	0.057000	0.19452	0.348000	0.29142	3.654000	0.54453	2.277000	0.76020	0.561000	0.74099	GGG	.		0.682	FAM110C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322220.1	NM_001077710	
SMC6	79677	ucsc.edu	37	2	17881597	17881597	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:17881597G>A	ENST00000448223.2	-	21	2541	c.2272C>T	c.(2272-2274)Cat>Tat	p.H758Y	SMC6_ENST00000351948.4_Missense_Mutation_p.H758Y|SMC6_ENST00000402989.1_Missense_Mutation_p.H758Y|SMC6_ENST00000381272.4_Missense_Mutation_p.H784Y	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	758					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TGCTCCATATGTTCCTCAACC	0.264																																					p.H758Y													.	SMC6-292	0			c.C2272T						.						159.0	148.0	152.0					2																	17881597		2202	4300	6502	SO:0001583	missense	79677	exon21			CCATATGTTCCTC	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.2272C>T	2.37:g.17881597G>A	ENSP00000404092:p.His758Tyr	Somatic	40	0		WXS	Illumina HiSeq		42	4	NM_001142286	0	0	2	2	0	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	ENST00000448223.2	37	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.514803	0.27123	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.18	2.74	0.32292	RecF/RecN/SMC (1);	0.479711	0.22822	N	0.055207	T	0.14227	0.0344	N	0.08118	0	0.20307	N	0.999914	B;B	0.18166	0.026;0.001	B;B	0.14578	0.011;0.002	T	0.16928	-1.0386	10	0.51188	T	0.08	.	6.2662	0.20928	0.0:0.1374:0.4642:0.3984	.	784;758	Q96SB8-2;Q96SB8	.;SMC6_HUMAN	Y	758;758;784;758	ENSP00000404092:H758Y;ENSP00000323439:H758Y;ENSP00000370672:H784Y;ENSP00000384539:H758Y	ENSP00000323439:H758Y	H	-	1	0	SMC6	17745078	1.000000	0.71417	0.998000	0.56505	0.854000	0.48673	0.719000	0.25881	0.384000	0.24942	-0.484000	0.04775	CAT	.		0.264	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
DNMT3A	1788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	25469542	25469542	+	Nonsense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:25469542C>T	ENST00000264709.3	-	10	1563	c.1226G>A	c.(1225-1227)tGg>tAg	p.W409*	DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000402667.1_Nonsense_Mutation_p.W186*|DNMT3A_ENST00000321117.5_Nonsense_Mutation_p.W409*|DNMT3A_ENST00000380746.4_Nonsense_Mutation_p.W220*	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	409					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCCAGGGCCCATTCAATCAT	0.647			"""Mis, F, N, S"""		AML																																p.W409X		.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A-1924	0			c.G1226A						.						61.0	61.0	61.0					2																	25469542		2203	4298	6501	SO:0001587	stop_gained	1788	exon10			AGGGCCCATTCAA		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1226G>A	2.37:g.25469542C>T	ENSP00000264709:p.Trp409*	Somatic	124	0		WXS	Illumina HiSeq	Phase_I	112	48	NM_175629	0	0	0	0	0	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Nonsense_Mutation	SNP	ENST00000264709.3	37	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	C	37	6.406269	0.97542	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	.	.	.	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.0978	15.5438	0.76077	0.0:1.0:0.0:0.0	.	.	.	.	X	220;409;409;186	.	ENSP00000264709:W409X	W	-	2	0	DNMT3A	25323046	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	7.528000	0.81941	2.535000	0.85469	0.655000	0.94253	TGG	.		0.647	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
C2orf16	84226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	27801772	27801772	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:27801772A>T	ENST00000408964.2	+	1	2384	c.2333A>T	c.(2332-2334)gAa>gTa	p.E778V	AC074091.1_ENST00000408604.1_RNA	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	778						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TTGCAGCCTGAAGAGACCTAT	0.403																																					p.E778V		.											.	C2orf16-67	0			c.A2333T						.						170.0	168.0	168.0					2																	27801772		1824	4081	5905	SO:0001583	missense	84226	exon1			AGCCTGAAGAGAC	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.2333A>T	2.37:g.27801772A>T	ENSP00000386190:p.Glu778Val	Somatic	44	0		WXS	Illumina HiSeq	Phase_I	39	16	NM_032266	0	0	0	0	0	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	ENST00000408964.2	37	CCDS42666.1	.	.	.	.	.	.	.	.	.	.	A	12.72	2.022880	0.35701	.	.	ENSG00000221843	ENST00000408964	T	0.06768	3.26	5.39	-2.51	0.06365	.	.	.	.	.	T	0.05868	0.0153	N	0.24115	0.695	0.09310	N	1	P	0.46512	0.879	P	0.45449	0.481	T	0.28681	-1.0036	9	0.66056	D	0.02	.	2.4234	0.04454	0.285:0.1502:0.4258:0.139	.	778	Q68DN1	CB016_HUMAN	V	778	ENSP00000386190:E778V	ENSP00000386190:E778V	E	+	2	0	C2orf16	27655276	0.056000	0.20664	0.033000	0.17914	0.105000	0.19272	0.158000	0.16422	-0.136000	0.11475	0.459000	0.35465	GAA	.		0.403	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
GEMIN6	79833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	39008788	39008788	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:39008788C>T	ENST00000281950.3	+	3	374	c.258C>T	c.(256-258)ttC>ttT	p.F86F	GEMIN6_ENST00000409566.1_3'UTR|GEMIN6_ENST00000409011.1_3'UTR	NM_024775.9	NP_079051.9	Q8WXD5	GEMI6_HUMAN	gem (nuclear organelle) associated protein 6	86					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				kidney(1)|large_intestine(3)|pancreas(1)	5		all_hematologic(82;0.21)				TGCATTTGTTCACGTCTGGAG	0.478																																					p.F86F		.											.	GEMIN6-226	0			c.C258T						.						102.0	88.0	92.0					2																	39008788		2203	4300	6503	SO:0001819	synonymous_variant	79833	exon3			TTTGTTCACGTCT	AF453443	CCDS1799.1	2p22.1	2014-05-14			ENSG00000152147	ENSG00000152147			20044	protein-coding gene	gene with protein product		607006				11748230	Standard	NM_024775		Approved	FLJ23459	uc002rrc.3	Q8WXD5	OTTHUMG00000128588	ENST00000281950.3:c.258C>T	2.37:g.39008788C>T		Somatic	127	0		WXS	Illumina HiSeq	Phase_I	127	43	NM_024775	0	0	12	21	9	B2RDP8|Q53SI5|Q8WVB4|Q9H5G6	Silent	SNP	ENST00000281950.3	37	CCDS1799.1																																																																																			.		0.478	GEMIN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250441.3		
TSPYL6	388951	broad.mit.edu	37	2	54482521	54482521	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:54482521G>A	ENST00000317802.7	-	1	888	c.768C>T	c.(766-768)ttC>ttT	p.F256F	ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000606865.1_Intron|ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000303536.4_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	256					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						GGTGGTGGCGGAAAGCAGTGA	0.517																																					p.F256F													.	TSPYL6-90	0			c.C768T						.						72.0	73.0	73.0					2																	54482521		2142	4280	6422	SO:0001819	synonymous_variant	388951	exon1			GTGGCGGAAAGCA	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.768C>T	2.37:g.54482521G>A		Somatic	141	0		WXS	Illumina HiSeq	Phase_I	129	5	NM_001003937	0	0	0	0	0	Q6NUJ3	Silent	SNP	ENST00000317802.7	37	CCDS42682.1																																																																																			.		0.517	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324069.3	XM_371494	
ZNF638	27332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	71607375	71607375	+	Silent	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:71607375T>C	ENST00000409544.1	+	9	2919	c.2289T>C	c.(2287-2289)acT>acC	p.T763T	ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000377802.2_Silent_p.T763T|RNU6-105P_ENST00000363909.1_RNA|ZNF638_ENST00000355812.3_Silent_p.T763T|ZNF638_ENST00000264447.4_Silent_p.T763T	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	763					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						AGAAAAAGACTTTAGAGTCAA	0.249																																					p.T763T		.											.	ZNF638-94	0			c.T2289C						.						33.0	33.0	33.0					2																	71607375		2189	4242	6431	SO:0001819	synonymous_variant	27332	exon9			AAAGACTTTAGAG	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.2289T>C	2.37:g.71607375T>C		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	118	49	NM_014497	0	0	0	1	1	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	ENST00000409544.1	37	CCDS1917.1																																																																																			.		0.249	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
C2orf81	388963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74643027	74643027	+	Silent	SNP	G	G	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:74643027G>T	ENST00000290390.5	-	3	594	c.286C>A	c.(286-288)Cgg>Agg	p.R96R	C2orf81_ENST00000517883.1_5'UTR	NM_001145054.1	NP_001138526.1	A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	89										endometrium(3)|kidney(1)	4						ATGGCCTCCCGGGCCTGGCTG	0.652																																					p.R96R		.											.	.	0			c.C286A						.						31.0	34.0	33.0					2																	74643027		692	1591	2283	SO:0001819	synonymous_variant	388963	exon3			CCTCCCGGGCCTG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000290390.5:c.286C>A	2.37:g.74643027G>T		Somatic	85	0		WXS	Illumina HiSeq	Phase_I	117	49	NM_001145054	0	0	9	23	14		Silent	SNP	ENST00000290390.5	37																																																																																				.		0.652	C2orf81-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_001145054	
FER1L5	90342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	97359251	97359251	+	RNA	SNP	A	A	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:97359251A>T	ENST00000457909.1	+	0	1760							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						AGGGCCCTTCATTCGGGTGGT	0.612																																					p.I1128F		.											.	FER1L5-23	0			c.A3382T						.						58.0	69.0	66.0					2																	97359251		692	1591	2283			90342	exon31			CCCTTCATTCGGG	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97359251A>T		Somatic	78	0		WXS	Illumina HiSeq	Phase_I	85	34	NM_001113382	0	0	0	0	0	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	A	9.661	1.144037	0.21205	.	.	ENSG00000214272	ENST00000414152;ENST00000436930	.	.	.	5.31	-0.268	0.12934	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.57651	0.2068	M	0.62723	1.935	.	.	.	P	0.50369	0.934	P	0.52856	0.711	T	0.66508	-0.5906	7	0.66056	D	0.02	-3.7442	9.6818	0.40074	0.4125:0.0:0.5875:0.0	.	1128	A0AVI2	FR1L5_HUMAN	F	1128;1086	.	ENSP00000444148:I1128F	I	+	1	0	FER1L5	96722978	0.149000	0.22717	0.255000	0.24374	0.514000	0.34195	1.218000	0.32467	-0.049000	0.13379	0.459000	0.35465	ATT	.		0.612	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
ST6GAL2	84620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	107459932	107459932	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:107459932C>G	ENST00000409382.3	-	2	1112	c.502G>C	c.(502-504)Gtc>Ctc	p.V168L	AC016994.2_ENST00000425419.1_RNA|ST6GAL2_ENST00000409087.3_Missense_Mutation_p.V168L|ST6GAL2_ENST00000361686.4_Missense_Mutation_p.V168L	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	168					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						CTCCTCTGGACCTGTGCAGCC	0.662																																					p.V168L		.											.	ST6GAL2-191	0			c.G502C						.						78.0	90.0	86.0					2																	107459932		2203	4300	6503	SO:0001583	missense	84620	exon2			TCTGGACCTGTGC	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.502G>C	2.37:g.107459932C>G	ENSP00000386942:p.Val168Leu	Somatic	123	0		WXS	Illumina HiSeq	Phase_I	165	63	NM_032528	0	0	0	0	0	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Missense_Mutation	SNP	ENST00000409382.3	37	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	C	1.093	-0.663505	0.03428	.	.	ENSG00000144057	ENST00000361686;ENST00000409382;ENST00000409087	T;T;T	0.30714	2.53;2.53;1.52	2.52	1.61	0.23674	.	2.704170	0.01639	N	0.023935	T	0.17109	0.0411	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.17501	-1.0367	10	0.19147	T	0.46	.	6.3831	0.21546	0.0:0.6285:0.0:0.3715	.	168;168	Q96JF0-2;Q96JF0	.;SIAT2_HUMAN	L	168	ENSP00000355273:V168L;ENSP00000386942:V168L;ENSP00000387332:V168L	ENSP00000355273:V168L	V	-	1	0	ST6GAL2	106826364	0.000000	0.05858	0.000000	0.03702	0.186000	0.23388	0.013000	0.13310	0.339000	0.23719	0.561000	0.74099	GTC	.		0.662	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
RANBP2	5903	ucsc.edu;bcgsc.ca	37	2	109381778	109381778	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:109381778C>G	ENST00000283195.6	+	20	4909	c.4783C>G	c.(4783-4785)Cca>Gca	p.P1595A		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1595					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AAGCAAGGCTCCAAAGAGCGG	0.448																																					p.P1595A													.	RANBP2-675	0			c.C4783G						.						122.0	124.0	123.0					2																	109381778		2203	4300	6503	SO:0001583	missense	5903	exon20			AAGGCTCCAAAGA	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4783C>G	2.37:g.109381778C>G	ENSP00000283195:p.Pro1595Ala	Somatic	387	2		WXS	Illumina HiSeq		441	193	NM_006267	0	0	0	0	0	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	c	10.31	1.314111	0.23908	.	.	ENSG00000153201	ENST00000283195	T	0.28069	1.63	4.78	0.353	0.16058	.	.	.	.	.	T	0.16557	0.0398	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.31308	-0.9948	9	0.16896	T	0.51	0.078	4.6119	0.12406	0.2692:0.5227:0.1308:0.0773	.	1595	P49792	RBP2_HUMAN	A	1595	ENSP00000283195:P1595A	ENSP00000283195:P1595A	P	+	1	0	RANBP2	108748210	0.000000	0.05858	0.990000	0.47175	0.914000	0.54420	-1.871000	0.01640	0.124000	0.18369	0.655000	0.94253	CCA	.		0.448	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
TNFAIP6	7130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	152235994	152235994	+	Missense_Mutation	SNP	A	A	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:152235994A>T	ENST00000243347.3	+	6	856	c.781A>T	c.(781-783)Act>Tct	p.T261S		NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	261					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	AAATACAAGTACTACTTCTAC	0.333																																					p.T261S		.											.	TNFAIP6-90	0			c.A781T						.						84.0	90.0	88.0					2																	152235994		2203	4300	6503	SO:0001583	missense	7130	exon6			ACAAGTACTACTT		CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.781A>T	2.37:g.152235994A>T	ENSP00000243347:p.Thr261Ser	Somatic	56	0		WXS	Illumina HiSeq	Phase_I	83	39	NM_007115	0	0	0	3	3	Q53TI7|Q8WWI9	Missense_Mutation	SNP	ENST00000243347.3	37	CCDS2193.1	.	.	.	.	.	.	.	.	.	.	A	8.550	0.875364	0.17395	.	.	ENSG00000123610	ENST00000243347	T	0.18174	2.23	5.56	1.83	0.25207	.	0.332619	0.29185	N	0.012896	T	0.07773	0.0195	N	0.17082	0.46	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.33497	-0.9866	10	0.21540	T	0.41	.	3.4438	0.07473	0.6522:0.0:0.1812:0.1666	.	261	P98066	TSG6_HUMAN	S	261	ENSP00000243347:T261S	ENSP00000243347:T261S	T	+	1	0	TNFAIP6	151944240	0.044000	0.20184	0.250000	0.24296	0.441000	0.31987	1.210000	0.32370	0.063000	0.16370	0.533000	0.62120	ACT	.		0.333	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254834.2	NM_007115	
SLC4A10	57282	bcgsc.ca	37	2	162821643	162821643	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:162821643C>T	ENST00000446997.1	+	23	3212	c.3119C>T	c.(3118-3120)cCc>cTc	p.P1040L	SLC4A10_ENST00000375514.5_Missense_Mutation_p.P1021L|SLC4A10_ENST00000421911.1_Missense_Mutation_p.P1040L|SLC4A10_ENST00000415876.2_Missense_Mutation_p.P1010L|SLC4A10_ENST00000272716.5_Missense_Mutation_p.P1010L	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	1040					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GATTTGATGCCCGAGAGTAAG	0.348																																					p.P1040L													.	SLC4A10-229	0			c.C3119T						.						81.0	75.0	77.0					2																	162821643		1812	4083	5895	SO:0001583	missense	57282	exon23			TGATGCCCGAGAG		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.3119C>T	2.37:g.162821643C>T	ENSP00000393066:p.Pro1040Leu	Somatic	35	0		WXS	Illumina HiSeq	Phase_1	48	4	NM_001178015	0	0	0	0	0	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973232	0.92919	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;D	0.82893	-1.43;-1.43;-1.44;-1.44;-1.66	5.93	5.04	0.67666	.	0.054718	0.85682	D	0.000000	D	0.91205	0.7229	M	0.93550	3.43	0.80722	D	1	P;P;D	0.57571	0.552;0.552;0.98	B;B;P	0.52957	0.331;0.331;0.714	D	0.93475	0.6822	10	0.87932	D	0	.	16.4058	0.83669	0.1326:0.8674:0.0:0.0	.	1021;1010;1040	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	L	1021;1010;1010;1009;1040;1040;1039	ENSP00000364664:P1021L;ENSP00000395797:P1010L;ENSP00000272716:P1010L;ENSP00000393066:P1040L;ENSP00000404486:P1040L	ENSP00000272716:P1010L	P	+	2	0	SLC4A10	162529889	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	1.460000	0.47911	0.655000	0.94253	CCC	.		0.348	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	210742711	210742711	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:210742711G>A	ENST00000439458.1	+	24	3960	c.3880G>A	c.(3880-3882)Ggg>Agg	p.G1294R	UNC80_ENST00000272845.6_Missense_Mutation_p.G1289R	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1294					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GCTGTGCCACGGGGAAAGTGA	0.448																																					p.G1294R		.											.	UNC80-90	0			c.G3880A						.						173.0	133.0	145.0					2																	210742711		692	1590	2282	SO:0001583	missense	285175	exon24			TGCCACGGGGAAA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3880G>A	2.37:g.210742711G>A	ENSP00000391088:p.Gly1294Arg	Somatic	98	0		WXS	Illumina HiSeq	Phase_I	112	36	NM_032504	0	0	0	0	0	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065366	0.36470	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.29142	1.58;1.58	5.75	4.87	0.63330	.	0.378307	0.27609	N	0.018602	T	0.11836	0.0288	N	0.03608	-0.345	0.80722	D	1	P	0.41345	0.746	B	0.33690	0.168	T	0.11397	-1.0589	10	0.34782	T	0.22	-16.4708	9.1501	0.36957	0.2171:0.0:0.7829:0.0	.	1294	Q8N2C7	UNC80_HUMAN	R	1294;1289	ENSP00000391088:G1294R;ENSP00000272845:G1289R	ENSP00000272845:G1289R	G	+	1	0	UNC80	210450956	0.999000	0.42202	0.930000	0.37139	0.908000	0.53690	3.361000	0.52306	1.417000	0.47077	0.557000	0.71058	GGG	.		0.448	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
SMARCAL1	50485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	217285132	217285132	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:217285132G>A	ENST00000357276.4	+	5	1303	c.973G>A	c.(973-975)Gct>Act	p.A325T	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.A325T	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	325					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CCTTCCATCAGCTCCATCCCT	0.562									Schimke Immuno-Osseous Dysplasia																												p.A325T		.											.	SMARCAL1-293	0			c.G973A						.						121.0	100.0	108.0					2																	217285132		2203	4300	6503	SO:0001583	missense	50485	exon5	Familial Cancer Database	SIOD	CCATCAGCTCCAT	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.973G>A	2.37:g.217285132G>A	ENSP00000349823:p.Ala325Thr	Somatic	237	0		WXS	Illumina HiSeq	Phase_I	249	93	NM_014140	0	0	1	2	1	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590173	0.46214	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128;ENST00000412913	D;D;T;D;T	0.86097	-2.04;-2.04;1.45;-2.07;0.63	4.85	4.85	0.62838	.	0.704849	0.14015	N	0.347188	T	0.80711	0.4675	L	0.59436	1.845	0.09310	N	1	P	0.37612	0.602	B	0.31290	0.127	T	0.71968	-0.4432	10	0.28530	T	0.3	-12.6293	13.2969	0.60303	0.0:0.1601:0.8399:0.0	.	325	Q9NZC9	SMAL1_HUMAN	T	325;325;224;189;45	ENSP00000349823:A325T;ENSP00000350940:A325T;ENSP00000392997:A224T;ENSP00000375974:A189T;ENSP00000390248:A45T	ENSP00000349823:A325T	A	+	1	0	SMARCAL1	216993377	0.682000	0.27624	0.373000	0.26003	0.202000	0.24057	4.009000	0.57110	2.531000	0.85337	0.561000	0.74099	GCT	.		0.562	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
IGFBP5	3488	ucsc.edu;bcgsc.ca	37	2	217541549	217541549	+	Silent	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:217541549C>G	ENST00000233813.4	-	4	1493	c.744G>C	c.(742-744)ggG>ggC	p.G248G		NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	248	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCAGCTTCATCCCGTACTTGT	0.612																																					p.G248G													.	IGFBP5-522	0			c.G744C						.						207.0	166.0	180.0					2																	217541549		2203	4300	6503	SO:0001819	synonymous_variant	3488	exon4			CTTCATCCCGTAC		CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.744G>C	2.37:g.217541549C>G		Somatic	317	3		WXS	Illumina HiSeq		329	128	NM_000599	0	0	0	1	1	Q5U0A3	Silent	SNP	ENST00000233813.4	37	CCDS2405.1																																																																																			.		0.612	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256674.2	NM_000599	
KCNJ13	3769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233633228	233633228	+	Silent	SNP	A	A	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:233633228A>T	ENST00000233826.3	-	3	895	c.756T>A	c.(754-756)ccT>ccA	p.P252P	KCNJ13_ENST00000410029.1_Silent_p.P252P|GIGYF2_ENST00000409451.3_Intron|GIGYF2_ENST00000409547.1_Intron|KCNJ13_ENST00000409779.1_3'UTR|GIGYF2_ENST00000409480.1_Intron|GIGYF2_ENST00000409196.3_Intron|GIGYF2_ENST00000373566.3_Intron|GIGYF2_ENST00000373563.4_Intron|GIGYF2_ENST00000452341.2_Intron|AC064852.4_ENST00000427571.1_RNA	NM_002242.4	NP_002233.2	O60928	KCJ13_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 13	252					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	inward rectifier potassium channel activity (GO:0005242)			endometrium(3)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	9		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0306)|Lung NSC(271;0.0908)		Epithelial(121;5.9e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0617)		GAGTAGCCAGAGGACTTGATG	0.443																																					p.P252P		.											.	KCNJ13-90	0			c.T756A						.						129.0	118.0	122.0					2																	233633228		2203	4300	6503	SO:0001819	synonymous_variant	3769	exon3			AGCCAGAGGACTT	AJ006128	CCDS2498.1, CCDS54437.1	2q37	2014-01-28			ENSG00000115474	ENSG00000115474		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6259	protein-coding gene	gene with protein product		603208				9878260, 9620703, 16382105	Standard	NM_002242		Approved	Kir7.1, Kir1.4, LCA16	uc002vtp.3	O60928	OTTHUMG00000153292	ENST00000233826.3:c.756T>A	2.37:g.233633228A>T		Somatic	164	0		WXS	Illumina HiSeq	Phase_I	200	87	NM_002242	0	0	0	0	0	A0PGH1|O76023|Q53SA1|Q8N3Y4	Silent	SNP	ENST00000233826.3	37	CCDS2498.1																																																																																			.		0.443	KCNJ13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257036.1	NM_002242	
GIGYF2	26058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	233659498	233659498	+	Silent	SNP	T	T	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr2:233659498T>A	ENST00000409547.1	+	15	1634	c.1323T>A	c.(1321-1323)ccT>ccA	p.P441P	GIGYF2_ENST00000409451.3_Silent_p.P462P|GIGYF2_ENST00000409480.1_Silent_p.P463P|GIGYF2_ENST00000409196.3_Silent_p.P435P|GIGYF2_ENST00000373566.3_Silent_p.P463P|GIGYF2_ENST00000373563.4_Silent_p.P441P|GIGYF2_ENST00000452341.2_Silent_p.P272P	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	441	Pro-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		CGCAGATTCCTTCAGATACAG	0.478																																					p.P462P		.											.	GIGYF2-28	0			c.T1386A						.						292.0	293.0	293.0					2																	233659498		2203	4300	6503	SO:0001819	synonymous_variant	26058	exon15			GATTCCTTCAGAT	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.1323T>A	2.37:g.233659498T>A		Somatic	94	0		WXS	Illumina HiSeq	Phase_I	92	44	NM_001103147	0	0	0	0	0	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Silent	SNP	ENST00000409547.1	37	CCDS33401.1																																																																																			.		0.478	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
SOGA1	140710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	35438421	35438421	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr20:35438421C>G	ENST00000357779.3	-	7	2159	c.1833G>C	c.(1831-1833)aaG>aaC	p.K611N	SOGA1_ENST00000456801.2_Missense_Mutation_p.K452N|SOGA1_ENST00000279034.6_Missense_Mutation_p.K611N|SOGA1_ENST00000237536.4_Missense_Mutation_p.K849N			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	611					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CGGCCTCCTCCTTTCGTAGCT	0.602																																					p.K849N		.											.	.	0			c.G2547C						.						30.0	32.0	31.0					20																	35438421		1994	4177	6171	SO:0001583	missense	140710	exon7			CTCCTCCTTTCGT	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1833G>C	20.37:g.35438421C>G	ENSP00000350424:p.Lys611Asn	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	69	26	NM_080627	0	0	0	0	0	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	C	19.13	3.768785	0.69878	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.15	0.757	0.18427	.	0.174867	0.47852	D	0.000216	T	0.30417	0.0764	L	0.36672	1.1	0.34718	D	0.728409	P	0.51351	0.944	B	0.44163	0.443	T	0.38564	-0.9655	10	0.31617	T	0.26	-53.0208	8.3632	0.32372	0.0:0.5833:0.0:0.4167	.	611	O94964-4	.	N	849;611;452;611	ENSP00000237536:K849N;ENSP00000279034:K611N;ENSP00000413886:K452N;ENSP00000350424:K611N	ENSP00000237536:K849N	K	-	3	2	KIAA0889	34871835	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	0.612000	0.24283	0.319000	0.23209	0.561000	0.74099	AAG	.		0.602	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
NPEPL1	79716	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	57282247	57282247	+	Silent	SNP	A	A	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr20:57282247A>C	ENST00000356091.6	+	7	1179	c.891A>C	c.(889-891)gcA>gcC	p.A297A	NPEPL1_ENST00000525817.1_Silent_p.A249A|STX16-NPEPL1_ENST00000530122.1_3'UTR|NPEPL1_ENST00000525967.1_Silent_p.A269A	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1	297						cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			TCAGAGCCGCAATCAAGCAGG	0.687																																					p.A297A		.											.	.	0			c.A891C						.						11.0	17.0	15.0					20																	57282247		1969	4059	6028	SO:0001819	synonymous_variant	79716	exon7			AGCCGCAATCAAG	AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060	ENST00000356091.6:c.891A>C	20.37:g.57282247A>C		Somatic	30	0		WXS	Illumina HiSeq	Phase_I	20	9	NM_024663	0	0	0	0	0	A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	Silent	SNP	ENST00000356091.6	37	CCDS46621.1																																																																																			.		0.687	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080402.6	NM_024663	
RRP1B	23076	broad.mit.edu	37	21	45107950	45107950	+	Silent	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr21:45107950C>G	ENST00000340648.4	+	13	1812	c.1695C>G	c.(1693-1695)ccC>ccG	p.P565P		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	565					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		CCACGCTGCCCCAGCGCAGGA	0.632																																					p.P565P													.	RRP1B-91	0			c.C1695G						.						12.0	14.0	13.0					21																	45107950		2190	4292	6482	SO:0001819	synonymous_variant	23076	exon13			GCTGCCCCAGCGC	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.1695C>G	21.37:g.45107950C>G		Somatic	17	0		WXS	Illumina HiSeq	Phase_I	31	15	NM_015056	0	0	0	0	0	Q8TBZ4	Silent	SNP	ENST00000340648.4	37	CCDS33577.1																																																																																			.		0.632	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
KRTAP10-11	386678	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46066418	46066418	+	Missense_Mutation	SNP	G	G	A	rs371095766		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr21:46066418G>A	ENST00000334670.8	+	1	88	c.43G>A	c.(43-45)Gac>Aac	p.D15N	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	15						keratin filament (GO:0045095)				NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						CGCTTACTCCGACTCCTGGCA	0.677																																					p.D15N													.	KRTAP10-11-91	0			c.G43A						.	G	ASN/ASP,	0,4400		0,0,2200	61.0	67.0	65.0		43,	3.7	0.2	21		65	2,8586	2.2+/-6.3	0,2,4292	no	missense,intron	TSPEAR,KRTAP10-11	NM_198692.2,NM_144991.2	23,	0,2,6492	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,	15/299,	46066418	2,12986	2200	4294	6494	SO:0001583	missense	386678	exon1			TACTCCGACTCCT	AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.43G>A	21.37:g.46066418G>A	ENSP00000334197:p.Asp15Asn	Somatic	99	1		WXS	Illumina HiSeq	Phase_I	93	35	NM_198692	0	0	0	0	0	A2RRF9	Missense_Mutation	SNP	ENST00000334670.8	37	CCDS42962.1	.	.	.	.	.	.	.	.	.	.	g	5.038	0.192708	0.09599	0.0	2.33E-4	ENSG00000243489	ENST00000334670	T	0.02812	4.15	3.71	3.71	0.42584	.	.	.	.	.	T	0.03011	0.0089	L	0.53617	1.68	0.09310	N	1	D	0.53462	0.96	B	0.31390	0.129	T	0.48670	-0.9015	9	0.25106	T	0.35	.	12.9535	0.58413	0.0:0.0:1.0:0.0	.	15	P60412	KR10B_HUMAN	N	15	ENSP00000334197:D15N	ENSP00000334197:D15N	D	+	1	0	KRTAP10-11	44890846	0.000000	0.05858	0.176000	0.23000	0.039000	0.13416	0.005000	0.13129	1.614000	0.50241	0.462000	0.41574	GAC	.		0.677	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128029.1	NM_198692	
BID	637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18226632	18226632	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr22:18226632A>G	ENST00000399774.3	-	3	329	c.160T>C	c.(160-162)Tac>Cac	p.Y54H	BID_ENST00000399767.1_5'UTR|BID_ENST00000551952.1_Missense_Mutation_p.Y54H|BID_ENST00000473439.1_5'UTR|BID_ENST00000342111.5_Missense_Mutation_p.Y54H|BID_ENST00000399765.1_Intron|BID_ENST00000317361.7_Missense_Mutation_p.Y100H	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist	54					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)			large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		AGCTCATCGTAGCCCTCCCAC	0.632																																					p.Y100H		.											.	BID-1083	0			c.T298C						.						49.0	50.0	50.0					22																	18226632		2203	4300	6503	SO:0001583	missense	637	exon3			CATCGTAGCCCTC	AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.160T>C	22.37:g.18226632A>G	ENSP00000382674:p.Tyr54His	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	58	16	NM_197966	0	0	16	17	1	Q549M7|Q71T04|Q7Z4M9|Q8IY86	Missense_Mutation	SNP	ENST00000399774.3	37	CCDS13748.1	.	.	.	.	.	.	.	.	.	.	A	14.79	2.641884	0.47153	.	.	ENSG00000015475	ENST00000317361;ENST00000399774;ENST00000342111;ENST00000551952	T;T;T;T	0.21734	1.99;1.99;1.99;1.99	5.08	-10.2	0.00374	.	2.388480	0.01610	N	0.022462	T	0.11623	0.0283	L	0.29908	0.895	0.09310	N	0.999994	B;B	0.02656	0.0;0.0	B;B	0.10450	0.002;0.005	T	0.13818	-1.0495	10	0.14656	T	0.56	.	7.3234	0.26540	0.4392:0.3405:0.2203:0.0	.	54;100	P55957;P55957-2	BID_HUMAN;.	H	100;54;54;54	ENSP00000318822:Y100H;ENSP00000382674:Y54H;ENSP00000344594:Y54H;ENSP00000449236:Y54H	ENSP00000318822:Y100H	Y	-	1	0	BID	16606632	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.197000	0.01240	-1.410000	0.02035	-0.429000	0.05907	TAC	.		0.632	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316178.1	NM_197966	
NEFH	4744	hgsc.bcm.edu	37	22	29885562	29885562	+	Missense_Mutation	SNP	G	G	A	rs370929798		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr22:29885562G>A	ENST00000310624.6	+	4	1966	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	645	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AACGAAGGAGGAAGCAAAGTC	0.562																																					p.E645K		.											.	NEFH-90	0			c.G1933A						.						82.0	88.0	86.0					22																	29885562		2203	4300	6503	SO:0001583	missense	4744	exon4			AAGGAGGAAGCAA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1933G>A	22.37:g.29885562G>A	ENSP00000311997:p.Glu645Lys	Somatic	130	0		WXS	Illumina HiSeq	Phase_I	160	41	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031217	0.19590	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.83914	-1.78	4.97	4.97	0.65823	.	0.115504	0.38778	N	0.001569	D	0.87783	0.6264	L	0.61218	1.895	0.29104	N	0.881289	P	0.36712	0.566	P	0.52267	0.694	D	0.83526	0.0088	10	0.44086	T	0.13	.	16.1111	0.81263	0.0:0.0:1.0:0.0	.	645	P12036	NFH_HUMAN	K	645	ENSP00000311997:E645K	ENSP00000311997:E645K	E	+	1	0	NEFH	28215562	0.001000	0.12720	0.367000	0.25926	0.091000	0.18340	0.923000	0.28757	2.745000	0.94114	0.491000	0.48974	GAA	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu	37	22	29885638	29885638	+	Missense_Mutation	SNP	T	T	A	rs267607535|rs190692435		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr22:29885638T>A	ENST00000310624.6	+	4	2042	c.2009T>A	c.(2008-2010)gTg>gAg	p.V670E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	676	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AAGTCCCCAGTGAAGGCAGAA	0.562																																					p.V670E		.											.	NEFH-90	0			c.T2009A						.						93.0	100.0	98.0					22																	29885638		2203	4299	6502	SO:0001583	missense	4744	exon4			CCCCAGTGAAGGC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2009T>A	22.37:g.29885638T>A	ENSP00000311997:p.Val670Glu	Somatic	385	0		WXS	Illumina HiSeq	Phase_I	332	18	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	37	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.746577	0.00086	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	D	0.82344	-1.6	4.7	1.26	0.21427	.	1.045180	0.07584	N	0.920821	T	0.75162	0.3812	N	0.24115	0.695	0.09310	N	1	B	0.31640	0.333	B	0.41202	0.35	T	0.64050	-0.6498	10	0.45353	T	0.12	.	3.8398	0.08909	0.1553:0.2981:0.0:0.5465	.	676	P12036	NFH_HUMAN	E	670	ENSP00000311997:V670E	ENSP00000311997:V670E	V	+	2	0	NEFH	28215638	0.968000	0.33430	0.005000	0.12908	0.183000	0.23260	0.000000	0.12993	-0.045000	0.13468	0.402000	0.26972	GTG	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
KIAA1407	57577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	113697143	113697143	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr3:113697143A>C	ENST00000295878.3	-	16	2642	c.2496T>G	c.(2494-2496)ttT>ttG	p.F832L		NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	832										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						AATGTACACAAAATTTTCTTA	0.393																																					p.F832L		.											.	KIAA1407-92	0			c.T2496G						.						73.0	74.0	74.0					3																	113697143		2203	4300	6503	SO:0001583	missense	57577	exon16			TACACAAAATTTT	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2496T>G	3.37:g.113697143A>C	ENSP00000295878:p.Phe832Leu	Somatic	45	0		WXS	Illumina HiSeq	Phase_I	63	27	NM_020817	0	0	3	3	0	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	37	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	A	7.654	0.683498	0.14907	.	.	ENSG00000163617	ENST00000295878	T	0.28666	1.6	4.46	-2.16	0.07080	.	0.462954	0.22456	N	0.059825	T	0.05135	0.0137	N	0.00413	-1.525	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38415	-0.9662	10	0.05620	T	0.96	.	5.5621	0.17150	0.256:0.3712:0.3728:0.0	.	832	Q8NCU4	K1407_HUMAN	L	832	ENSP00000295878:F832L	ENSP00000295878:F832L	F	-	3	2	KIAA1407	115179833	0.000000	0.05858	0.000000	0.03702	0.745000	0.42441	-1.005000	0.03674	-0.297000	0.08934	0.528000	0.53228	TTT	.		0.393	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
ABCC5	10057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	183669307	183669307	+	Missense_Mutation	SNP	G	G	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr3:183669307G>C	ENST00000334444.6	-	20	3106	c.2866C>G	c.(2866-2868)Ctt>Gtt	p.L956V	ABCC5_ENST00000265586.6_Missense_Mutation_p.L956V	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	956	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GGGCTTCGAAGGATCCTTCGG	0.542																																					p.L956V		.											.	ABCC5-137	0			c.C2866G						.						74.0	79.0	77.0					3																	183669307		2004	4191	6195	SO:0001583	missense	10057	exon20			TTCGAAGGATCCT	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.2866C>G	3.37:g.183669307G>C	ENSP00000333926:p.Leu956Val	Somatic	86	0		WXS	Illumina HiSeq	Phase_I	71	41	NM_005688	0	0	2	3	1	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299975	0.81136	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.91843	-2.92;-2.92	6.11	5.23	0.72850	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.92616	0.7654	M	0.74647	2.275	0.58432	D	0.999996	P;P	0.43024	0.771;0.798	P;B	0.44422	0.449;0.387	D	0.92434	0.5956	10	0.49607	T	0.09	-14.3754	15.2019	0.73147	0.067:0.0:0.933:0.0	.	956;956	Q86UX3;O15440	.;MRP5_HUMAN	V	956	ENSP00000333926:L956V;ENSP00000265586:L956V	ENSP00000265586:L956V	L	-	1	0	ABCC5	185152001	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	6.461000	0.73522	1.590000	0.49995	0.655000	0.94253	CTT	.		0.542	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
KIAA0226	9711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	197408102	197408102	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr3:197408102G>A	ENST00000296343.5	-	16	2327	c.2328C>T	c.(2326-2328)ttC>ttT	p.F776F	KIAA0226_ENST00000273582.5_Silent_p.F731F|KIAA0226_ENST00000389665.5_Silent_p.F801F	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	776					autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		GGTCCTTGGAGAAGTTGCTGA	0.522																																					p.F776F	Esophageal Squamous(3;167 355 3763 15924)	.											.	KIAA0226-22	0			c.C2328T						.						154.0	149.0	151.0					3																	197408102		2046	4228	6274	SO:0001819	synonymous_variant	9711	exon16			CTTGGAGAAGTTG	D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.2328C>T	3.37:g.197408102G>A		Somatic	177	0		WXS	Illumina HiSeq	Phase_I	154	72	NM_014687	0	0	0	0	0	Q96CK5	Silent	SNP	ENST00000296343.5	37	CCDS43195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.648|8.648	0.897483|0.897483	0.17686|0.17686	.|.	.|.	ENSG00000145016|ENSG00000145016	ENST00000413360|ENST00000415452	.|.	.|.	.|.	4.55|4.55	3.66|3.66	0.41972|0.41972	.|.	.|.	.|.	.|.	.|.	T|T	0.63046|0.63046	0.2478|0.2478	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.61667|0.61667	-0.7016|-0.7016	4|4	.|.	.|.	.|.	.|.	12.4295|12.4295	0.55565|0.55565	0.0825:0.0:0.9175:0.0|0.0825:0.0:0.9175:0.0	.|.	.|.	.|.	.|.	F|F	738|560	.|.	.|.	L|S	-|-	1|2	0|0	KIAA0226|KIAA0226	198892499|198892499	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.909000|0.909000	0.53808|0.53808	2.466000|2.466000	0.45084|0.45084	1.244000|1.244000	0.43870|0.43870	0.555000|0.555000	0.69702|0.69702	CTC|TCT	.		0.522	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	
GAK	2580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	882734	882734	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:882734T>A	ENST00000314167.4	-	11	1216	c.1106A>T	c.(1105-1107)cAg>cTg	p.Q369L	GAK_ENST00000511163.1_Missense_Mutation_p.Q290L	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	369					cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		GCCATACGGCTGGTCGTACTC	0.662																																					p.Q369L		.											.	GAK-568	0			c.A1106T						.						45.0	40.0	42.0					4																	882734		2200	4293	6493	SO:0001583	missense	2580	exon11			TACGGCTGGTCGT	D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.1106A>T	4.37:g.882734T>A	ENSP00000314499:p.Gln369Leu	Somatic	46	0		WXS	Illumina HiSeq	Phase_I	63	29	NM_005255	0	0	6	12	6	Q5U4P5|Q9BVY6	Missense_Mutation	SNP	ENST00000314167.4	37	CCDS3340.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.185496	0.57909	.	.	ENSG00000178950	ENST00000314167;ENST00000511163	T;T	0.79352	-0.8;-1.26	4.55	4.55	0.56014	.	0.739757	0.13112	N	0.412872	T	0.80544	0.4643	M	0.76002	2.32	0.58432	D	0.999999	D;P;P;P	0.54772	0.968;0.883;0.944;0.937	P;P;B;B	0.48654	0.585;0.48;0.4;0.256	T	0.79271	-0.1872	10	0.45353	T	0.12	-33.1852	10.2933	0.43610	0.0:0.0:0.0:1.0	.	290;290;369;265	Q5U4P5;E9PGR2;O14976;Q59HA5	.;.;GAK_HUMAN;.	L	369;290	ENSP00000314499:Q369L;ENSP00000421361:Q290L	ENSP00000314499:Q369L	Q	-	2	0	GAK	872734	1.000000	0.71417	0.993000	0.49108	0.052000	0.14988	6.860000	0.75473	1.679000	0.50963	0.459000	0.35465	CAG	.		0.662	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239188.1	NM_005255	
ADD1	118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	2916729	2916729	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:2916729A>G	ENST00000398129.1	+	12	1744	c.1724A>G	c.(1723-1725)tAc>tGc	p.Y575C	ADD1_ENST00000398125.1_Missense_Mutation_p.Y606C|ADD1_ENST00000355842.3_Missense_Mutation_p.Y606C|ADD1_ENST00000398123.2_Missense_Mutation_p.Y606C|ADD1_ENST00000513328.2_Missense_Mutation_p.Y575C|ADD1_ENST00000264758.7_Missense_Mutation_p.Y606C|ADD1_ENST00000446856.1_Missense_Mutation_p.Y575C|ADD1_ENST00000503455.2_Missense_Mutation_p.Y606C			P35611	ADDA_HUMAN	adducin 1 (alpha)	575					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTGGAGGAGTACCGCAGGGAG	0.587																																					p.Y606C	Esophageal Squamous(71;505 1201 20414 34538 37449)	.											.	ADD1-92	0			c.A1817G						.						100.0	95.0	96.0					4																	2916729		2203	4300	6503	SO:0001583	missense	118	exon13			AGGAGTACCGCAG	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1724A>G	4.37:g.2916729A>G	ENSP00000381197:p.Tyr575Cys	Somatic	197	0		WXS	Illumina HiSeq	Phase_I	196	89	NM_176801	0	0	62	103	41	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	ENST00000398129.1	37	CCDS43205.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.3|26.3	4.720674|4.720674	0.89205|0.89205	.|.	.|.	ENSG00000087274|ENSG00000087274	ENST00000514940;ENST00000541843|ENST00000264758;ENST00000446856;ENST00000398125;ENST00000513328;ENST00000503455;ENST00000355842;ENST00000398123;ENST00000398129	.|T;T;T;T;T;T;T;T	.|0.31247	.|1.5;1.5;1.5;1.5;1.5;1.5;1.5;1.5	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.56775|0.56775	0.2008|0.2008	M|M	0.73430|0.73430	2.235|2.235	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|0.993;1.0;1.0;0.997;1.0	.|D;D;D;P;D	.|0.87578	.|0.928;0.977;0.998;0.863;0.992	T|T	0.61816|0.61816	-0.6985|-0.6985	5|10	.|0.87932	.|D	.|0	-15.9835|-15.9835	15.4885|15.4885	0.75587|0.75587	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|606;575;606;575;606	.|Q86XM2;P35611;P35611-3;P35611-2;A2A3N8	.|.;ADDA_HUMAN;.;.;.	A|C	312;21|606;575;606;575;606;606;606;575	.|ENSP00000264758:Y606C;ENSP00000399828:Y575C;ENSP00000381193:Y606C;ENSP00000421907:Y575C;ENSP00000423024:Y606C;ENSP00000348100:Y606C;ENSP00000381191:Y606C;ENSP00000381197:Y575C	.|ENSP00000264758:Y606C	T|Y	+|+	1|2	0|0	ADD1|ADD1	2886527|2886527	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	8.766000|8.766000	0.91728|0.91728	2.060000|2.060000	0.61445|0.61445	0.460000|0.460000	0.39030|0.39030	ACC|TAC	.		0.587	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242840.1	NM_014189	
SLC10A4	201780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	48487158	48487158	+	Splice_Site	SNP	A	A	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:48487158A>C	ENST00000273861.4	+	2	1019	c.800A>C	c.(799-801)aAg>aCg	p.K267T		NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						TACATTGTGAAGGTAAGGCCC	0.522																																					p.K267T		.											.	SLC10A4-90	0			c.A800C						.						73.0	72.0	72.0					4																	48487158		2203	4300	6503	SO:0001630	splice_region_variant	201780	exon2			TTGTGAAGGTAAG	BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.801+1A>C	4.37:g.48487158A>C		Somatic	157	0		WXS	Illumina HiSeq	Phase_I	198	71	NM_152679	0	0	0	0	0	Q8WUZ2	Missense_Mutation	SNP	ENST00000273861.4	37	CCDS3482.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.242171	0.79912	.	.	ENSG00000145248	ENST00000273861	T	0.10763	2.84	5.03	5.03	0.67393	.	0.044192	0.85682	D	0.000000	T	0.19967	0.0480	L	0.56340	1.77	0.80722	D	1	P	0.51537	0.946	P	0.51550	0.673	T	0.00480	-1.1714	10	0.44086	T	0.13	-29.9309	15.2283	0.73367	1.0:0.0:0.0:0.0	.	267	Q96EP9	NTCP4_HUMAN	T	267	ENSP00000273861:K267T	ENSP00000273861:K267T	K	+	2	0	SLC10A4	48181915	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	8.506000	0.90518	2.237000	0.73441	0.460000	0.39030	AAG	.		0.522	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219926.3	NM_152679	Missense_Mutation
KIAA1211	57482	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	57182735	57182735	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:57182735G>A	ENST00000504228.1	+	6	3172	c.3067G>A	c.(3067-3069)Gaa>Aaa	p.E1023K	KIAA1211_ENST00000541073.1_Missense_Mutation_p.E1016K|KIAA1211_ENST00000264229.6_Missense_Mutation_p.E1023K			Q6ZU35	K1211_HUMAN	KIAA1211	1023										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					AGGCCCCGAGGAAAGGAAGGG	0.647																																					p.E1023K		.											.	KIAA1211-70	0			c.G3067A						.						16.0	19.0	18.0					4																	57182735		1988	4152	6140	SO:0001583	missense	57482	exon8			CCCGAGGAAAGGA	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3067G>A	4.37:g.57182735G>A	ENSP00000423366:p.Glu1023Lys	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	66	18	NM_020722	0	0	0	0	0	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437122	0.43224	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073	T;T;T	0.78003	-1.14;-1.14;-1.14	5.24	3.44	0.39384	.	.	.	.	.	T	0.67970	0.2950	L	0.44542	1.39	0.09310	N	1	B;B;B	0.28350	0.208;0.084;0.084	B;B;B	0.21917	0.022;0.037;0.037	T	0.58301	-0.7660	9	0.44086	T	0.13	-11.2684	8.9225	0.35621	0.2382:0.0:0.7618:0.0	.	1016;1016;1023	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	K	1023;1023;1016	ENSP00000264229:E1023K;ENSP00000423366:E1023K;ENSP00000444006:E1016K	ENSP00000264229:E1023K	E	+	1	0	KIAA1211	56877492	0.169000	0.23002	0.190000	0.23270	0.164000	0.22412	2.380000	0.44327	1.140000	0.42260	0.561000	0.74099	GAA	.		0.647	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
BTC	685	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	75695357	75695357	+	Missense_Mutation	SNP	A	A	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:75695357A>C	ENST00000395743.3	-	2	434	c.74T>G	c.(73-75)aTc>aGc	p.I25S		NM_001729.2	NP_001720.1	P35070	BTC_HUMAN	betacellulin	25					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitosis (GO:0045840)|positive regulation of urine volume (GO:0035810)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10			Lung(101;0.219)			ACAGTGAAGGATCACTAGACC	0.403																																					p.I25S													.	BTC-523	0			c.T74G						.						81.0	78.0	79.0					4																	75695357		2203	4300	6503	SO:0001583	missense	685	exon2			TGAAGGATCACTA	S55606	CCDS3566.1	4q13.3	2012-09-20			ENSG00000174808	ENSG00000174808			1121	protein-coding gene	gene with protein product		600345				8439318, 11522793	Standard	NM_001729		Approved		uc003hig.2	P35070	OTTHUMG00000130107	ENST00000395743.3:c.74T>G	4.37:g.75695357A>C	ENSP00000379092:p.Ile25Ser	Somatic	134	1		WXS	Illumina HiSeq	Phase_I	156	57	NM_001729	0	0	0	0	0	Q96F48	Missense_Mutation	SNP	ENST00000395743.3	37	CCDS3566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.68|15.68	2.903687|2.903687	0.52333|0.52333	.|.	.|.	ENSG00000174808|ENSG00000174808	ENST00000395743|ENST00000512743	T|.	0.12672|.	2.66|.	4.03|4.03	4.03|4.03	0.46877|0.46877	.|.	0.209768|.	0.41823|.	D|.	0.000807|.	T|T	0.46964|0.46964	0.1420|0.1420	L|L	0.47716|0.47716	1.5|1.5	0.29910|0.29910	N|N	0.823672|0.823672	P|.	0.47677|.	0.899|.	P|.	0.48227|.	0.571|.	T|T	0.45352|0.45352	-0.9267|-0.9267	10|5	0.66056|.	D|.	0.02|.	-17.9524|-17.9524	9.6494|9.6494	0.39888|0.39888	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	25|.	P35070|.	BTC_HUMAN|.	S|A	25|4	ENSP00000379092:I25S|.	ENSP00000379092:I25S|.	I|S	-|-	2|1	0|0	BTC|BTC	75914381|75914381	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.841000|0.841000	0.47740|0.47740	2.227000|2.227000	0.42972|0.42972	2.055000|2.055000	0.61198|0.61198	0.482000|0.482000	0.46254|0.46254	ATC|TCC	.		0.403	BTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252413.1		
C4orf17	84103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	100434294	100434294	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:100434294T>C	ENST00000326581.4	+	2	418	c.56T>C	c.(55-57)aTt>aCt	p.I19T	C4orf17_ENST00000514652.1_Missense_Mutation_p.I19T	NM_032149.2	NP_115525.2	Q53FE4	CD017_HUMAN	chromosome 4 open reading frame 17	19										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|prostate(1)|urinary_tract(3)	18				OV - Ovarian serous cystadenocarcinoma(123;2.08e-08)		GGCAGCCATATTATGGCTAGA	0.468																																					p.I19T		.											.	C4orf17-90	0			c.T56C						.						102.0	86.0	92.0					4																	100434294		2203	4300	6503	SO:0001583	missense	84103	exon2			GCCATATTATGGC	AL136838	CCDS3649.1	4q23	2008-02-05			ENSG00000138813	ENSG00000138813			25274	protein-coding gene	gene with protein product						11230166	Standard	NM_032149		Approved	DKFZP434G072	uc003huw.3	Q53FE4	OTTHUMG00000131027	ENST00000326581.4:c.56T>C	4.37:g.100434294T>C	ENSP00000322582:p.Ile19Thr	Somatic	132	0		WXS	Illumina HiSeq	Phase_I	151	65	NM_032149	0	0	0	0	0	Q6FI84|Q6IS77|Q8NA78|Q9H0D9	Missense_Mutation	SNP	ENST00000326581.4	37	CCDS3649.1	.	.	.	.	.	.	.	.	.	.	T	10.04	1.242808	0.22796	.	.	ENSG00000138813	ENST00000326581;ENST00000514652	T;T	0.18338	2.22;2.22	4.76	-9.53	0.00575	.	1.807420	0.02601	N	0.101018	T	0.15089	0.0364	L	0.57536	1.79	0.09310	N	1	B	0.24426	0.103	B	0.25140	0.058	T	0.39354	-0.9618	10	0.66056	D	0.02	1.4304	5.5029	0.16838	0.1118:0.1614:0.5637:0.1631	.	19	Q53FE4	CD017_HUMAN	T	19	ENSP00000322582:I19T;ENSP00000427663:I19T	ENSP00000322582:I19T	I	+	2	0	C4orf17	100653317	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.503000	0.06383	-1.204000	0.02648	-0.256000	0.11100	ATT	.		0.468	C4orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253670.2	NM_032149	
NDST3	9348	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	118975229	118975229	+	Missense_Mutation	SNP	T	T	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:118975229T>G	ENST00000296499.5	+	2	567	c.164T>G	c.(163-165)cTc>cGc	p.L55R	NDST3_ENST00000433996.2_Missense_Mutation_p.L55R	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	55	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						TGTGGCGACCTCCAACACCTA	0.443																																					p.L55R													.	NDST3-153	0			c.T164G						.						115.0	113.0	114.0					4																	118975229		2203	4300	6503	SO:0001583	missense	9348	exon2			GCGACCTCCAACA	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.164T>G	4.37:g.118975229T>G	ENSP00000296499:p.Leu55Arg	Somatic	173	1		WXS	Illumina HiSeq	Phase_I	173	52	NM_004784	0	0	0	0	0	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	ENST00000296499.5	37	CCDS3708.1	.	.	.	.	.	.	.	.	.	.	T	12.23	1.875654	0.33162	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.44881	1.24;0.91	5.53	5.53	0.82687	.	0.404758	0.24922	N	0.034522	T	0.29491	0.0735	N	0.26042	0.785	0.31434	N	0.672752	B;B;P	0.49559	0.001;0.091;0.925	B;B;P	0.44990	0.002;0.148;0.466	T	0.17806	-1.0357	10	0.15499	T	0.54	.	7.5856	0.27991	0.0:0.0731:0.1414:0.7856	.	55;55;55	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	R	55	ENSP00000296499:L55R;ENSP00000396625:L55R	ENSP00000296499:L55R	L	+	2	0	NDST3	119194677	0.051000	0.20477	0.954000	0.39281	0.344000	0.29017	1.922000	0.40045	2.083000	0.62718	0.528000	0.53228	CTC	.		0.443	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
SH3D19	152503	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	152096316	152096316	+	Missense_Mutation	SNP	T	T	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:152096316T>A	ENST00000409252.2	-	6	907	c.200A>T	c.(199-201)gAg>gTg	p.E67V	SH3D19_ENST00000455740.1_Missense_Mutation_p.E67V|SH3D19_ENST00000304527.4_Missense_Mutation_p.E67V|SH3D19_ENST00000427414.2_Missense_Mutation_p.E67V|SH3D19_ENST00000409598.4_Missense_Mutation_p.E67V|SH3D19_ENST00000424281.1_Missense_Mutation_p.E67V|SH3D19_ENST00000604030.1_5'Flank|SH3D19_ENST00000514152.1_Missense_Mutation_p.E67V			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	67					cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				AGAGTCCCACTCTCCAGAAGC	0.517																																					p.E67V		.											.	SH3D19-92	0			c.A200T						.						85.0	85.0	85.0					4																	152096316		2203	4300	6503	SO:0001583	missense	152503	exon1			TCCCACTCTCCAG	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.200A>T	4.37:g.152096316T>A	ENSP00000386848:p.Glu67Val	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	76	34	NM_001128924	0	0	0	0	0	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	37	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	T	21.3	4.134175	0.77662	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.06449	3.3;3.3;3.3;3.3;3.3;3.3;3.3	6.07	3.59	0.41128	.	2.410060	0.02778	U	0.120587	T	0.23451	0.0567	M	0.62723	1.935	0.38335	D	0.943906	D;D;D	0.63046	0.969;0.982;0.992	P;P;P	0.61397	0.625;0.849;0.888	T	0.00024	-1.2325	10	0.87932	D	0	-8.5478	10.825	0.46627	0.0:0.1277:0.0:0.8723	.	67;67;67	Q5HYK7;Q5HYK7-2;Q5HYK7-3	SH319_HUMAN;.;.	V	67	ENSP00000387030:E67V;ENSP00000302913:E67V;ENSP00000416708:E67V;ENSP00000404542:E67V;ENSP00000415694:E67V;ENSP00000386848:E67V;ENSP00000423449:E67V	ENSP00000302913:E67V	E	-	2	0	SH3D19	152315766	0.997000	0.39634	0.976000	0.42696	0.954000	0.61252	2.976000	0.49289	0.514000	0.28300	0.533000	0.62120	GAG	.		0.517	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
SH3D19	152503	hgsc.bcm.edu;bcgsc.ca	37	4	152096322	152096322	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:152096322G>A	ENST00000409252.2	-	6	901	c.194C>T	c.(193-195)tCt>tTt	p.S65F	SH3D19_ENST00000455740.1_Missense_Mutation_p.S65F|SH3D19_ENST00000304527.4_Missense_Mutation_p.S65F|SH3D19_ENST00000427414.2_Missense_Mutation_p.S65F|SH3D19_ENST00000409598.4_Missense_Mutation_p.S65F|SH3D19_ENST00000424281.1_Missense_Mutation_p.S65F|SH3D19_ENST00000604030.1_5'Flank|SH3D19_ENST00000514152.1_Missense_Mutation_p.S65F			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	65					cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CCACTCTCCAGAAGCTCTGTT	0.527																																					p.S65F		.											.	SH3D19-92	0			c.C194T						.						85.0	85.0	85.0					4																	152096322		2203	4300	6503	SO:0001583	missense	152503	exon1			TCTCCAGAAGCTC	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.194C>T	4.37:g.152096322G>A	ENSP00000386848:p.Ser65Phe	Somatic	85	0		WXS	Illumina HiSeq	Phase_I	83	40	NM_001128924	0	0	0	0	0	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	ENST00000409252.2	37	CCDS34077.2	.	.	.	.	.	.	.	.	.	.	G	19.49	3.838322	0.71373	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.06068	3.35;3.35;3.35;3.35;3.35;3.35;3.35	6.07	4.34	0.51931	.	0.591075	0.16731	N	0.201834	T	0.21674	0.0522	M	0.64997	1.995	0.35608	D	0.808417	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.08534	-1.0717	10	0.87932	D	0	-5.1533	12.0719	0.53622	0.0648:0.1217:0.8135:0.0	.	65;65;65	Q5HYK7;Q5HYK7-2;Q5HYK7-3	SH319_HUMAN;.;.	F	65	ENSP00000387030:S65F;ENSP00000302913:S65F;ENSP00000416708:S65F;ENSP00000404542:S65F;ENSP00000415694:S65F;ENSP00000386848:S65F;ENSP00000423449:S65F	ENSP00000302913:S65F	S	-	2	0	SH3D19	152315772	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	5.083000	0.64456	0.883000	0.36040	0.655000	0.94253	TCT	.		0.527	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
FSTL5	56884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	162307106	162307106	+	Silent	SNP	T	T	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:162307106T>A	ENST00000306100.5	-	16	2773	c.2337A>T	c.(2335-2337)atA>atT	p.I779I	FSTL5_ENST00000536695.1_Silent_p.I778I|RP11-234O6.2_ENST00000508189.1_RNA|FSTL5_ENST00000427802.2_Silent_p.I769I|FSTL5_ENST00000379164.4_Silent_p.I778I	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	779						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TGAGACTCTTTATCATCTTGA	0.458																																					p.I779I		.											.	FSTL5-158	0			c.A2337T						.						179.0	163.0	168.0					4																	162307106		2203	4300	6503	SO:0001819	synonymous_variant	56884	exon16			ACTCTTTATCATC	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.2337A>T	4.37:g.162307106T>A		Somatic	132	0		WXS	Illumina HiSeq	Phase_I	153	74	NM_020116	0	0	0	0	0	E9PCP6|Q9NSW7|Q9ULF7	Silent	SNP	ENST00000306100.5	37	CCDS3802.1																																																																																			.		0.458	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
WDR17	116966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	177089815	177089815	+	Missense_Mutation	SNP	G	G	C	rs371828424		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:177089815G>C	ENST00000280190.4	+	25	3256	c.3100G>C	c.(3100-3102)Gtt>Ctt	p.V1034L	WDR17_ENST00000393643.2_Missense_Mutation_p.V1010L|WDR17_ENST00000507824.2_Intron|WDR17_ENST00000508596.1_Intron			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1034										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CTTTTGTTACGTTAACAGGAA	0.338																																					p.V1034L		.											.	WDR17-95	0			c.G3100C						.						134.0	127.0	129.0					4																	177089815		2203	4300	6503	SO:0001583	missense	116966	exon25			TGTTACGTTAACA	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3100G>C	4.37:g.177089815G>C	ENSP00000280190:p.Val1034Leu	Somatic	63	0		WXS	Illumina HiSeq	Phase_I	77	30	NM_170710	0	0	0	0	0	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	g	1.369	-0.586595	0.03827	.	.	ENSG00000150627	ENST00000393643;ENST00000280190;ENST00000507824	T;T	0.54866	0.61;0.55	5.1	-2.02	0.07388	.	0.528184	0.15689	N	0.249514	T	0.20292	0.0488	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27773	-1.0064	10	0.02654	T	1	0.4761	4.7601	0.13104	0.4883:0.0:0.3534:0.1582	.	1034	Q8IZU2	WDR17_HUMAN	L	1010;1034;1010	ENSP00000377258:V1010L;ENSP00000280190:V1034L	ENSP00000280190:V1034L	V	+	1	0	WDR17	177326809	0.081000	0.21417	0.000000	0.03702	0.003000	0.03518	-0.019000	0.12546	-0.243000	0.09653	-1.290000	0.01357	GTT	.		0.338	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
CCDC110	256309	ucsc.edu;bcgsc.ca	37	4	186382296	186382296	+	Silent	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:186382296A>G	ENST00000307588.3	-	5	330	c.255T>C	c.(253-255)agT>agC	p.S85S	CCDC110_ENST00000507501.1_5'UTR|CCDC110_ENST00000393540.3_Intron|CCDC110_ENST00000510617.1_Silent_p.S85S	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	85						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TCAATATTTCACTGATTTCCG	0.284																																					p.S85S													.	CCDC110-90	0			c.T255C						.						101.0	100.0	101.0					4																	186382296		2203	4297	6500	SO:0001819	synonymous_variant	256309	exon5			TATTTCACTGATT	AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.255T>C	4.37:g.186382296A>G		Somatic	43	0		WXS	Illumina HiSeq		40	4	NM_152775	0	0	0	0	0	Q86YI9|Q8N7W0	Silent	SNP	ENST00000307588.3	37	CCDS3843.1																																																																																			.		0.284	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2	NM_152775	
TNPO1	3842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	72183032	72183032	+	Nonsense_Mutation	SNP	T	T	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr5:72183032T>G	ENST00000337273.5	+	12	1712	c.1286T>G	c.(1285-1287)tTa>tGa	p.L429*	TNPO1_ENST00000523768.1_Nonsense_Mutation_p.L379*|TNPO1_ENST00000454282.1_Nonsense_Mutation_p.L379*|TNPO1_ENST00000506351.2_Nonsense_Mutation_p.L421*	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	429					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		ATTTTGGTTTTAGGAGCAATT	0.358																																					p.L429X		.											.	TNPO1-228	0			c.T1286G						.						99.0	97.0	98.0					5																	72183032		2203	4300	6503	SO:0001587	stop_gained	3842	exon12			TGGTTTTAGGAGC	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.1286T>G	5.37:g.72183032T>G	ENSP00000336712:p.Leu429*	Somatic	72	0		WXS	Illumina HiSeq	Phase_I	72	10	NM_002270	0	0	0	0	0	B4DVC6|Q92957|Q92975	Nonsense_Mutation	SNP	ENST00000337273.5	37	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.770905	0.90108	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	.	.	.	5.19	5.19	0.71726	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.9103	15.3454	0.74334	0.0:0.0:0.0:1.0	.	.	.	.	X	429;379;379;421	.	ENSP00000336712:L429X	L	+	2	0	TNPO1	72218788	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.651000	0.83577	2.099000	0.63709	0.528000	0.53228	TTA	.		0.358	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
BRD8	10902	ucsc.edu;bcgsc.ca	37	5	137507060	137507060	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr5:137507060C>T	ENST00000254900.5	-	4	597	c.226G>A	c.(226-228)Gag>Aag	p.E76K	BRD8_ENST00000411594.2_Missense_Mutation_p.E76K|BRD8_ENST00000455658.2_Missense_Mutation_p.E35K|BRD8_ENST00000230901.5_Missense_Mutation_p.E76K|BRD8_ENST00000402931.1_Missense_Mutation_p.E76K	NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	76					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTTGGTGTCTCAGTGGTCTCT	0.368																																					p.E76K													.	BRD8-91	0			c.G226A						.						121.0	122.0	122.0					5																	137507060		2203	4300	6503	SO:0001583	missense	10902	exon4			GTGTCTCAGTGGT	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.226G>A	5.37:g.137507060C>T	ENSP00000254900:p.Glu76Lys	Somatic	37	0		WXS	Illumina HiSeq		38	4	NM_001164326	0	0	0	0	0	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	C	34	5.410624	0.96072	.	.	ENSG00000112983	ENST00000254900;ENST00000454473;ENST00000418329;ENST00000230901;ENST00000402931;ENST00000411594;ENST00000455658;ENST00000430331	T;T;T;T;T;T;T	0.48201	1.29;0.84;0.84;0.98;1.05;0.82;1.08	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.60418	0.2267	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D	0.69078	0.99;0.997;0.993;0.996;0.996;0.997	D;D;D;D;D;D	0.76071	0.979;0.98;0.956;0.987;0.987;0.985	T	0.62553	-0.6830	10	0.72032	D	0.01	-12.8674	18.5411	0.91029	0.0:1.0:0.0:0.0	.	35;60;76;76;76;76	F8W820;B4DN43;A8K1N6;Q9H0E9-4;Q9H0E9-2;Q9H0E9	.;.;.;.;.;BRD8_HUMAN	K	76;71;71;76;76;76;35;120	ENSP00000254900:E76K;ENSP00000398067:E71K;ENSP00000398873:E71K;ENSP00000230901:E76K;ENSP00000384845:E76K;ENSP00000394330:E76K;ENSP00000408396:E35K	ENSP00000230901:E76K	E	-	1	0	BRD8	137534959	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.719000	0.84751	2.697000	0.92050	0.563000	0.77884	GAG	.		0.368	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
SLC23A1	9963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	138718252	138718252	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr5:138718252G>A	ENST00000348729.3	-	2	125	c.79C>T	c.(79-81)Cct>Tct	p.P27S	SLC23A1_ENST00000503919.1_5'UTR|SLC23A1_ENST00000353963.3_Missense_Mutation_p.P27S	NM_005847.4	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 1	27					brain development (GO:0007420)|dehydroascorbic acid transport (GO:0070837)|L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|lung development (GO:0030324)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|brush border (GO:0005903)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular organelle (GO:0043229)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dehydroascorbic acid transporter activity (GO:0033300)|L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium ion transmembrane transporter activity (GO:0015081)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(5)|ovary(1)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	TCAAACTTAGGCTCTGTGGGT	0.582																																					p.P27S		.											.	SLC23A1-90	0			c.C79T						.						134.0	111.0	118.0					5																	138718252		2203	4300	6503	SO:0001583	missense	9963	exon2			ACTTAGGCTCTGT	AF058317	CCDS4212.1, CCDS4213.1	5q31.2	2013-07-18	2013-07-18	2003-03-21	ENSG00000170482	ENSG00000170482		"""Solute carriers"""	10974	protein-coding gene	gene with protein product		603790	"""solute carrier family 23 (nucleobase transporters), member 2"""	SLC23A2		9804989, 10331392	Standard	NM_005847		Approved	YSPL3, SVCT1	uc003leg.3	Q9UHI7	OTTHUMG00000129228	ENST00000348729.3:c.79C>T	5.37:g.138718252G>A	ENSP00000302701:p.Pro27Ser	Somatic	199	0		WXS	Illumina HiSeq	Phase_I	170	76	NM_005847	0	0	1	1	0	O95191|Q8WWB6|Q9UGH4|Q9UI39	Missense_Mutation	SNP	ENST00000348729.3	37	CCDS4212.1	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410755	0.25465	.	.	ENSG00000170482	ENST00000353963;ENST00000348729;ENST00000339881;ENST00000453898;ENST00000508270	T;T	0.17370	2.28;2.29	4.68	2.9	0.33743	.	0.428794	0.24659	N	0.036652	T	0.08670	0.0215	N	0.08118	0	0.31262	N	0.692759	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.06552	-1.0820	10	0.87932	D	0	-27.6722	8.6703	0.34145	0.1818:0.0:0.8182:0.0	.	27;27	Q9UHI7;Q9UHI7-2	S23A1_HUMAN;.	S	27;27;27;27;101	ENSP00000302851:P27S;ENSP00000302701:P27S	ENSP00000343584:P27S	P	-	1	0	SLC23A1	138746151	0.993000	0.37304	0.987000	0.45799	0.446000	0.32137	1.322000	0.33689	0.600000	0.29862	0.456000	0.33151	CCT	.		0.582	SLC23A1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000374185.1	NM_152685	
FAT2	2196	hgsc.bcm.edu	37	5	150911353	150911353	+	Silent	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr5:150911353G>A	ENST00000261800.5	-	13	9618	c.9606C>T	c.(9604-9606)ggC>ggT	p.G3202G		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3202	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGTGACGGTGCCCAGCGTGG	0.672																																					p.G3202G		.											.	FAT2-96	0			c.C9606T						.						101.0	89.0	93.0					5																	150911353		2203	4300	6503	SO:0001819	synonymous_variant	2196	exon13			GACGGTGCCCAGC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9606C>T	5.37:g.150911353G>A		Somatic	9	0		WXS	Illumina HiSeq	Phase_I	16	7	NM_001447	0	0	0	0	0	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	G	5.409	0.260626	0.10239	.	.	ENSG00000086570	ENST00000520200	.	.	.	5.34	3.55	0.40652	.	.	.	.	.	T	0.55673	0.1935	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49133	-0.8971	4	.	.	.	.	6.8949	0.24251	0.1533:0.1441:0.7025:0.0	.	.	.	.	Y	61	.	.	H	-	1	0	FAT2	150891546	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	2.210000	0.42816	0.630000	0.30394	0.557000	0.71058	CAC	.		0.672	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
LCP2	3937	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	169680134	169680134	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr5:169680134C>T	ENST00000046794.5	-	18	1849	c.1234G>A	c.(1234-1236)Gcg>Acg	p.A412T	LCP2_ENST00000521416.1_Missense_Mutation_p.A207T	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	412					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TCTTCCTCCGCGGGGGATGGG	0.458																																					p.A412T		.											.	LCP2-23	0			c.G1234A						.						36.0	34.0	35.0					5																	169680134		1815	4077	5892	SO:0001583	missense	3937	exon18			CCTCCGCGGGGGA		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.1234G>A	5.37:g.169680134C>T	ENSP00000046794:p.Ala412Thr	Somatic	38	0		WXS	Illumina HiSeq	Phase_I	43	12	NM_005565	0	0	0	0	0	A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	37	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.293873	0.23564	.	.	ENSG00000043462	ENST00000046794;ENST00000521416	D;D	0.92805	-3.11;-3.11	5.74	3.01	0.34805	.	0.541975	0.19974	N	0.101934	T	0.75481	0.3855	N	0.02539	-0.55	0.09310	N	1	B;B	0.18610	0.029;0.001	B;B	0.08055	0.003;0.001	T	0.62835	-0.6770	9	.	.	.	-3.3438	5.838	0.18617	0.154:0.685:0.0:0.1611	.	207;412	E7ESF6;Q13094	.;LCP2_HUMAN	T	412;207	ENSP00000046794:A412T;ENSP00000428871:A207T	.	A	-	1	0	LCP2	169612712	0.001000	0.12720	0.002000	0.10522	0.112000	0.19704	0.873000	0.28052	0.445000	0.26639	0.563000	0.77884	GCG	.		0.458	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
ADAMTS2	9509	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	178553061	178553061	+	Silent	SNP	G	G	T	rs370747086		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr5:178553061G>T	ENST00000251582.7	-	18	2789	c.2688C>A	c.(2686-2688)gcC>gcA	p.A896A		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	896	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TCGAGAGGGCGGCACAGAAGC	0.637																																					p.A896A													.	ADAMTS2-228	0			c.C2688A						.						84.0	84.0	84.0					5																	178553061		2203	4300	6503	SO:0001819	synonymous_variant	9509	exon18			GAGGGCGGCACAG	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.2688C>A	5.37:g.178553061G>T		Somatic	65	1		WXS	Illumina HiSeq	Phase_I	86	27	NM_014244	0	0	0	0	0		Silent	SNP	ENST00000251582.7	37	CCDS4444.1																																																																																			.		0.637	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
ZSCAN12	9753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	28359289	28359289	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr6:28359289C>G	ENST00000361028.1	-	4	923	c.778G>C	c.(778-780)Gac>Cac	p.D260H	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.D260H			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	260					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						TCAGTATGGTCAGAGTTCTCA	0.433																																					p.D260H		.											.	.	0			c.G778C						.						219.0	181.0	192.0					6																	28359289		692	1591	2283	SO:0001583	missense	9753	exon4			TATGGTCAGAGTT	AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.778G>C	6.37:g.28359289C>G	ENSP00000354305:p.Asp260His	Somatic	161	0		WXS	Illumina HiSeq	Phase_I	141	51	NM_001163391	0	0	0	0	0	O43724	Missense_Mutation	SNP	ENST00000361028.1	37		.	.	.	.	.	.	.	.	.	.	C	3.906	-0.021133	0.07634	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.27557	1.66;1.66	3.93	-0.342	0.12635	.	0.768215	0.10643	N	0.650758	T	0.02342	0.0072	N	0.02539	-0.55	0.09310	N	1	P;B	0.47302	0.893;0.38	B;B	0.34301	0.179;0.054	T	0.24548	-1.0157	10	0.22706	T	0.39	.	4.3597	0.11196	0.1506:0.4779:0.0:0.3715	.	260;260	A8K187;O43309	.;ZSC12_HUMAN	H	260	ENSP00000354305:D260H;ENSP00000380039:D260H	ENSP00000354305:D260H	D	-	1	0	ZSCAN12	28467268	0.000000	0.05858	0.000000	0.03702	0.383000	0.30230	-1.601000	0.02081	0.004000	0.14682	0.650000	0.86243	GAC	.		0.433	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000040190.1	NM_014724	
HSD17B8	7923	broad.mit.edu	37	6	33172821	33172821	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr6:33172821C>T	ENST00000374662.3	+	2	222	c.195C>T	c.(193-195)ccC>ccT	p.P65P	MIR219-1_ENST00000362166.1_RNA|HSD17B8_ENST00000469186.1_3'UTR	NM_014234.4	NP_055049.1	Q92506	DHB8_HUMAN	hydroxysteroid (17-beta) dehydrogenase 8	65					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|fatty acid biosynthetic process (GO:0006633)	mitochondrial envelope (GO:0005740)|mitochondrial matrix (GO:0005759)|plasma membrane (GO:0005886)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	9						AGGGGCCGCCCCGAGGGAACC	0.706																																					p.P65P													.	HSD17B8-153	0			c.C195T						.						9.0	11.0	10.0					6																	33172821		1498	2702	4200	SO:0001819	synonymous_variant	7923	exon2			GCCGCCCCGAGGG	D82061	CCDS4769.1	6p21.3	2011-09-14	2002-02-19	2002-02-22	ENSG00000204228	ENSG00000204228	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	3554	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 30C, member 1"""	601417	"""FabG (beta-ketoacyl-[acyl-carrier-protein] reductase, E coli) like (E. coli)"""	FABGL		8812499, 19027726	Standard	NM_014234		Approved	HKE6, D6S2245E, RING2, KE6, H2-KE6, SDR30C1	uc003odi.2	Q92506	OTTHUMG00000031117	ENST00000374662.3:c.195C>T	6.37:g.33172821C>T		Somatic	8	0		WXS	Illumina HiSeq	Phase_I	18	4	NM_014234	0	0	22	22	0	A6NLX7|Q5STP7|Q9UIQ1	Silent	SNP	ENST00000374662.3	37	CCDS4769.1																																																																																			.		0.706	HSD17B8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076196.1	NM_014234	
TAAR9	134860	broad.mit.edu;bcgsc.ca	37	6	132859693	132859693	+	RNA	SNP	A	A	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr6:132859693A>C	ENST00000434551.1	+	0	265					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		GATGCCCTTCAGCACAGTGAG	0.453																																					.	Colon(10;433 445 15992 45047 47213)												.	.	0			.						.						203.0	198.0	200.0					6																	132859693		2178	4286	6464			134860	.			CCCTTCAGCACAG	AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132859693A>C		Somatic	206	3		WXS	Illumina HiSeq	Phase_I	248	7	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434551.1	37																																																																																				.		0.453	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000042254.2	NM_175057	
C6orf211	79624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	151790234	151790234	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr6:151790234G>A	ENST00000367294.3	+	5	1574	c.1315G>A	c.(1315-1317)Ggt>Agt	p.G439S	C6orf211_ENST00000545879.1_Missense_Mutation_p.G320S	NM_024573.1	NP_078849.1	Q9H993	CF211_HUMAN	chromosome 6 open reading frame 211	439										breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(7)	15			BRCA - Breast invasive adenocarcinoma(37;0.183)	OV - Ovarian serous cystadenocarcinoma(155;5.27e-11)		TCAGTACGATGGTCCCCTTTG	0.507																																					p.G439S		.											.	C6orf211-90	0			c.G1315A						.						21.0	22.0	22.0					6																	151790234		1959	4161	6120	SO:0001583	missense	79624	exon5			TACGATGGTCCCC	AJ420548	CCDS5233.1, CCDS69224.1	6q25.1	2013-01-07			ENSG00000146476	ENSG00000146476			17872	protein-coding gene	gene with protein product							Standard	NM_001286562		Approved	FLJ12910	uc003qok.1	Q9H993	OTTHUMG00000015838	ENST00000367294.3:c.1315G>A	6.37:g.151790234G>A	ENSP00000356263:p.Gly439Ser	Somatic	65	0		WXS	Illumina HiSeq	Phase_I	64	24	NM_024573	0	0	8	25	17	Q96FC6|Q9UFY5	Missense_Mutation	SNP	ENST00000367294.3	37	CCDS5233.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.730830	0.30684	.	.	ENSG00000146476	ENST00000367294;ENST00000545879	T;T	0.13089	3.04;2.62	6.16	5.3	0.74995	.	0.212744	0.47852	D	0.000212	T	0.05181	0.0138	L	0.45352	1.415	0.41042	D	0.985231	B	0.22983	0.078	B	0.20184	0.028	T	0.18777	-1.0326	10	0.15499	T	0.54	.	13.6292	0.62186	0.0707:0.0:0.9293:0.0	.	439	Q9H993	CF211_HUMAN	S	439;320	ENSP00000356263:G439S;ENSP00000444121:G320S	ENSP00000356263:G439S	G	+	1	0	C6orf211	151831927	0.998000	0.40836	0.986000	0.45419	0.154000	0.21943	2.502000	0.45398	1.626000	0.50381	0.650000	0.86243	GGT	.		0.507	C6orf211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042724.1	NM_024573	
EIF2AK1	27102	hgsc.bcm.edu;bcgsc.ca	37	7	6078297	6078297	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:6078297C>G	ENST00000199389.6	-	10	1271	c.1125G>C	c.(1123-1125)caG>caC	p.Q375H	EIF2AK1_ENST00000495565.1_5'Flank|EIF2AK1_ENST00000536084.1_Missense_Mutation_p.Q251H	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	375	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		TCAGGTGGTACTGTGCCTAGG	0.507																																					p.Q375H		.											.	EIF2AK1-408	0			c.G1125C						.						108.0	94.0	99.0					7																	6078297		2203	4300	6503	SO:0001583	missense	27102	exon10			GTGGTACTGTGCC	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1125G>C	7.37:g.6078297C>G	ENSP00000199389:p.Gln375His	Somatic	93	0		WXS	Illumina HiSeq	Phase_I	134	21	NM_014413	0	0	0	0	0	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Missense_Mutation	SNP	ENST00000199389.6	37	CCDS5345.1	.	.	.	.	.	.	.	.	.	.	.	9.811	1.183288	0.21870	.	.	ENSG00000086232	ENST00000199389;ENST00000536084;ENST00000426957	T;T	0.65549	-0.16;-0.16	5.57	2.56	0.30785	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.521490	0.21777	N	0.069272	T	0.53334	0.1790	M	0.64630	1.985	0.31933	N	0.61189	B;B;B	0.20368	0.044;0.007;0.005	B;B;B	0.22386	0.039;0.009;0.01	T	0.56062	-0.8041	10	0.37606	T	0.19	-7.4865	5.5568	0.17121	0.1395:0.6391:0.0:0.2214	.	251;374;375	B4DIP4;Q9BQI3-2;Q9BQI3	.;.;E2AK1_HUMAN	H	375;251;2	ENSP00000199389:Q375H;ENSP00000445784:Q251H	ENSP00000199389:Q375H	Q	-	3	2	EIF2AK1	6044823	1.000000	0.71417	0.996000	0.52242	0.286000	0.27126	0.647000	0.24812	1.341000	0.45600	0.650000	0.86243	CAG	.		0.507	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
SKAP2	8935	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	26729973	26729973	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:26729973C>G	ENST00000345317.2	-	10	1118	c.805G>C	c.(805-807)Gag>Cag	p.E269Q	SKAP2_ENST00000489977.1_5'UTR|SKAP2_ENST00000539623.1_Missense_Mutation_p.E97Q	NM_003930.3	NP_003921.2	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2	269					B cell activation (GO:0042113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(3)	17						GCACTGTCCTCTTCTTCTTCT	0.388																																					p.E269Q													.	SKAP2-91	0			c.G805C						.						231.0	179.0	197.0					7																	26729973		2203	4300	6503	SO:0001583	missense	8935	exon10			TGTCCTCTTCTTC		CCDS5400.1	7p15.2	2013-01-10	2006-09-28	2006-09-28	ENSG00000005020	ENSG00000005020		"""Pleckstrin homology (PH) domain containing"""	15687	protein-coding gene	gene with protein product		605215	"""src family associated phosphoprotein 2"""	SCAP2		9837776, 9755858	Standard	NM_003930		Approved	RA70, SKAP-HOM, SKAP55R, SAPS	uc003syc.3	O75563	OTTHUMG00000023495	ENST00000345317.2:c.805G>C	7.37:g.26729973C>G	ENSP00000005587:p.Glu269Gln	Somatic	81	1		WXS	Illumina HiSeq	Phase_I	206	45	NM_003930	0	0	0	0	0	A4D173|Q53GP6|Q75MK6|Q75MZ4|Q9UBZ3|Q9UED8	Missense_Mutation	SNP	ENST00000345317.2	37	CCDS5400.1	.	.	.	.	.	.	.	.	.	.	C	6.838	0.523906	0.13066	.	.	ENSG00000005020	ENST00000345317;ENST00000539623;ENST00000535331	T;T	0.33654	1.87;1.4	6.17	6.17	0.99709	Src homology-3 domain (1);	0.266780	0.38111	N	0.001812	T	0.30198	0.0757	L	0.34521	1.04	0.47308	D	0.999385	P;P	0.38922	0.651;0.514	B;B	0.35240	0.198;0.151	T	0.02226	-1.1192	10	0.32370	T	0.25	-4.5212	17.7962	0.88572	0.0:1.0:0.0:0.0	.	254;269	B7Z5N4;O75563	.;SKAP2_HUMAN	Q	269;97;254	ENSP00000005587:E269Q;ENSP00000443593:E97Q	ENSP00000005587:E269Q	E	-	1	0	SKAP2	26696498	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	2.839000	0.48207	2.941000	0.99782	0.655000	0.94253	GAG	.		0.388	SKAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214128.1		
PLEKHA8	84725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	30094389	30094389	+	Silent	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:30094389T>C	ENST00000449726.1	+	8	1211	c.861T>C	c.(859-861)acT>acC	p.T287T	PLEKHA8_ENST00000396259.1_Silent_p.T287T|PLEKHA8_ENST00000396257.2_Silent_p.T287T|PLEKHA8_ENST00000258679.7_Silent_p.T287T	NM_001197027.1	NP_001183956.1	Q96JA3	PKHA8_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8	287				T -> S (in Ref. 1; AAK55424). {ECO:0000305}.	ER to Golgi ceramide transport (GO:0035621)|lipid transport (GO:0006869)|protein transport (GO:0015031)	membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ceramide binding (GO:0097001)|glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)|phosphatidylinositol-4-phosphate binding (GO:0070273)			breast(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	17						ATAACTTGACTCAGTCTGGAT	0.383																																					p.T287T		.											.	PLEKHA8-357	0			c.T861C						.						149.0	143.0	145.0					7																	30094389		2203	4300	6503	SO:0001819	synonymous_variant	84725	exon8			CTTGACTCAGTCT	BC053990	CCDS5424.1, CCDS56473.1, CCDS75574.1	7p21-p11.2	2013-01-10			ENSG00000106086	ENSG00000106086		"""Pleckstrin homology (PH) domain containing"""	30037	protein-coding gene	gene with protein product		608639				11001876	Standard	NM_001197027		Approved	FAPP2, MGC3358	uc003taq.3	Q96JA3	OTTHUMG00000097751	ENST00000449726.1:c.861T>C	7.37:g.30094389T>C		Somatic	143	0		WXS	Illumina HiSeq	Phase_I	353	139	NM_001197027	0	0	0	0	0	B4DH00|Q7Z5V8|Q9BU78|Q9H274|Q9H8Z7	Silent	SNP	ENST00000449726.1	37	CCDS56473.1																																																																																			.		0.383	PLEKHA8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032639	
POLM	27434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44114102	44114102	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:44114102G>A	ENST00000242248.5	-	7	964	c.863C>T	c.(862-864)aCc>aTc	p.T288I	POLM_ENST00000492971.1_5'UTR|POLM_ENST00000335195.6_Silent_p.H285H|POLM_ENST00000395831.3_Silent_p.H242H	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	288					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						CAGGACTGGGGTGCTCAGGTC	0.697								DNA polymerases (catalytic subunits)																													p.T288I		.											.	POLM-229	0			c.C863T						.						21.0	19.0	20.0					7																	44114102		2201	4299	6500	SO:0001583	missense	27434	exon7			ACTGGGGTGCTCA	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.863C>T	7.37:g.44114102G>A	ENSP00000242248:p.Thr288Ile	Somatic	31	0		WXS	Illumina HiSeq	Phase_I	130	40	NM_013284	0	0	22	28	6	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	37	CCDS34625.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122221	0.37436	.	.	ENSG00000122678	ENST00000242248	T	0.44083	0.93	5.38	1.23	0.21249	DNA-directed DNA polymerase X (1);DNA polymerase lambda, fingers domain (1);	.	.	.	.	T	0.42471	0.1204	M	0.68317	2.08	0.80722	D	1	P	0.40211	0.707	B	0.42959	0.403	T	0.33803	-0.9854	9	0.56958	D	0.05	-0.2386	8.6696	0.34143	0.0841:0.4398:0.4761:0.0	.	288	Q9NP87	DPOLM_HUMAN	I	288	ENSP00000242248:T288I	ENSP00000242248:T288I	T	-	2	0	POLM	44080627	0.013000	0.17824	0.506000	0.27664	0.637000	0.38172	0.038000	0.13862	0.231000	0.21079	0.555000	0.69702	ACC	.		0.697	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284	
OGDH	4967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44735721	44735721	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:44735721G>T	ENST00000222673.5	+	13	1808	c.1766G>T	c.(1765-1767)tGg>tTg	p.W589L	OGDH_ENST00000543843.1_Missense_Mutation_p.W540L|OGDH_ENST00000444676.1_Missense_Mutation_p.W604L|OGDH_ENST00000439616.2_Missense_Mutation_p.W439L|OGDH_ENST00000447398.1_Missense_Mutation_p.W600L|OGDH_ENST00000449767.1_Missense_Mutation_p.W585L	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	589					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	GACTCTCCCTGGCCTGGTGAG	0.438																																					p.W589L		.											.	OGDH-228	0			c.G1766T						.						71.0	67.0	68.0					7																	44735721		2203	4300	6503	SO:0001583	missense	4967	exon13			CTCCCTGGCCTGG	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1766G>T	7.37:g.44735721G>T	ENSP00000222673:p.Trp589Leu	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	155	35	NM_002541	0	0	0	0	0	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	37	CCDS34627.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713754	0.89112	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	T;T;T;T;T;T	0.06608	3.33;3.28;3.29;3.29;3.29;3.3	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.36303	0.0962	M	0.94021	3.485	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.51132	-0.8744	10	0.87932	D	0	-15.9477	17.8672	0.88799	0.0:0.0:1.0:0.0	.	384;439;585;600;491;589	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	L	439;585;600;604;589;540	ENSP00000398576:W439L;ENSP00000392878:W585L;ENSP00000388183:W600L;ENSP00000414662:W604L;ENSP00000222673:W589L;ENSP00000443821:W540L	ENSP00000222673:W589L	W	+	2	0	OGDH	44702246	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.657000	0.98554	2.556000	0.86216	0.655000	0.94253	TGG	.		0.438	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
OGDH	4967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	44735723	44735723	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:44735723C>A	ENST00000222673.5	+	13	1810	c.1768C>A	c.(1768-1770)Cct>Act	p.P590T	OGDH_ENST00000543843.1_Missense_Mutation_p.P541T|OGDH_ENST00000444676.1_Missense_Mutation_p.P605T|OGDH_ENST00000439616.2_Missense_Mutation_p.P440T|OGDH_ENST00000447398.1_Missense_Mutation_p.P601T|OGDH_ENST00000449767.1_Missense_Mutation_p.P586T	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	590					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	CTCTCCCTGGCCTGGTGAGTG	0.438																																					p.P590T		.											.	OGDH-228	0			c.C1768A						.						69.0	65.0	67.0					7																	44735723		2203	4300	6503	SO:0001583	missense	4967	exon13			CCCTGGCCTGGTG	D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1768C>A	7.37:g.44735723C>A	ENSP00000222673:p.Pro590Thr	Somatic	81	0		WXS	Illumina HiSeq	Phase_I	153	34	NM_002541	0	0	0	0	0	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	ENST00000222673.5	37	CCDS34627.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050408	0.36181	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	T;T;T;T;T;T	0.05199	3.49;3.48;3.48;3.48;3.48;3.49	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.06554	0.0168	L	0.31294	0.92	0.80722	D	1	B;B;B;B;B;B	0.17268	0.007;0.007;0.01;0.01;0.001;0.021	B;B;B;B;B;B	0.16289	0.004;0.004;0.015;0.015;0.002;0.009	T	0.40194	-0.9576	10	0.19590	T	0.45	-15.3111	17.8673	0.88799	0.0:1.0:0.0:0.0	.	385;440;586;601;492;590	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	T	440;586;601;605;590;541	ENSP00000398576:P440T;ENSP00000392878:P586T;ENSP00000388183:P601T;ENSP00000414662:P605T;ENSP00000222673:P590T;ENSP00000443821:P541T	ENSP00000222673:P590T	P	+	1	0	OGDH	44702248	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.651000	0.83577	2.556000	0.86216	0.655000	0.94253	CCT	.		0.438	OGDH-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339391.1		
NACAD	23148	broad.mit.edu	37	7	45123065	45123065	+	Missense_Mutation	SNP	G	G	A	rs61740894|rs201818400	byFrequency	TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:45123065G>A	ENST00000490531.2	-	2	2733	c.2714C>T	c.(2713-2715)cCt>cTt	p.P905L		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	905					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						CTGGGACACAGGCGTGGCTGC	0.627																																					p.P905L													.	.	0			c.C2714T						.						4.0	5.0	4.0					7																	45123065		601	1442	2043	SO:0001583	missense	23148	exon2			GACACAGGCGTGG	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.2714C>T	7.37:g.45123065G>A	ENSP00000420477:p.Pro905Leu	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	94	4	NM_001146334	0	0	6	15	9		Missense_Mutation	SNP	ENST00000490531.2	37	CCDS47582.1	.	.	.	.	.	.	.	.	.	.	A	3.542	-0.093403	0.07053	.	.	ENSG00000136274	ENST00000490531	T	0.11821	2.74	2.5	-3.46	0.04767	.	.	.	.	.	T	0.06781	0.0173	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37337	-0.9710	9	0.27785	T	0.31	.	11.1749	0.48593	0.3581:0.0:0.6419:0.0	.	905	O15069	NACAD_HUMAN	L	905	ENSP00000420477:P905L	ENSP00000420477:P905L	P	-	2	0	NACAD	45089590	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.538000	0.02204	-1.522000	0.01769	-2.936000	0.00087	CCT	G|0.998;A|0.002		0.627	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
GRB10	2887	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	50660660	50660660	+	Missense_Mutation	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:50660660C>T	ENST00000401949.1	-	19	2243	c.1774G>A	c.(1774-1776)Gtg>Atg	p.V592M	GRB10_ENST00000406641.1_Missense_Mutation_p.V534M|GRB10_ENST00000439599.1_Missense_Mutation_p.V586M|GRB10_ENST00000402578.1_Missense_Mutation_p.V534M|GRB10_ENST00000407526.1_Missense_Mutation_p.V534M|GRB10_ENST00000398810.2_Missense_Mutation_p.V534M|GRB10_ENST00000398812.2_Missense_Mutation_p.V592M|GRB10_ENST00000357271.5_Missense_Mutation_p.V546M|GRB10_ENST00000335866.3_Missense_Mutation_p.V534M|GRB10_ENST00000403097.1_Missense_Mutation_p.V586M|GRB10_ENST00000402497.1_Missense_Mutation_p.V534M			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	592					insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					CATAAGGCCACTCGGATGCAG	0.512									Russell-Silver syndrome																												p.V592M													.	GRB10-1272	0			c.G1774A						.						146.0	146.0	146.0					7																	50660660		2080	4226	6306	SO:0001583	missense	2887	exon16	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	AGGCCACTCGGAT		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.1774G>A	7.37:g.50660660C>T	ENSP00000385770:p.Val592Met	Somatic	187	1		WXS	Illumina HiSeq	Phase_I	307	73	NM_005311	0	0	33	42	9	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Missense_Mutation	SNP	ENST00000401949.1	37	CCDS43582.1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589636	0.86851	.	.	ENSG00000106070	ENST00000398812;ENST00000439599;ENST00000335866;ENST00000398810;ENST00000402578;ENST00000403097;ENST00000406641;ENST00000357271;ENST00000407526;ENST00000401949;ENST00000398791;ENST00000402497	D;D;D;D;D;D;D;D;D;D;D	0.85702	-1.93;-1.92;-2.02;-2.02;-2.02;-1.92;-2.02;-1.73;-2.02;-1.93;-2.02	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.89287	0.6672	L	0.57536	1.79	0.80722	D	1	D;D;P	0.54964	0.969;0.969;0.869	P;P;B	0.54815	0.761;0.761;0.361	D	0.89034	0.3444	10	0.52906	T	0.07	-32.1431	19.7417	0.96234	0.0:1.0:0.0:0.0	.	586;546;592	Q13322-4;Q13322-2;Q13322	.;.;GRB10_HUMAN	M	592;586;534;534;534;586;534;546;534;592;124;534	ENSP00000381793:V592M;ENSP00000406716:V586M;ENSP00000338543:V534M;ENSP00000381790:V534M;ENSP00000385189:V534M;ENSP00000385544:V586M;ENSP00000385366:V534M;ENSP00000349818:V546M;ENSP00000385046:V534M;ENSP00000385770:V592M;ENSP00000385748:V534M	ENSP00000338543:V534M	V	-	1	0	GRB10	50628154	1.000000	0.71417	0.975000	0.42487	0.994000	0.84299	7.818000	0.86416	2.661000	0.90470	0.655000	0.94253	GTG	.		0.512	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319157.1		
ARFGEF1	10565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	68107797	68107797	+	IGR	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr8:68107797C>T	ENST00000262215.3	-	0	7225				ARFGEF1_ENST00000520381.1_Intron|ARFGEF1_ENST00000517955.1_5'Flank|CSPP1_ENST00000262210.5_Missense_Mutation_p.T1212I|CSPP1_ENST00000412460.1_Missense_Mutation_p.T867I	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)						endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GGCACTTTCACTTGGCAGGGC	0.493																																					p.T1212I		.											.	CSPP1-138	0			c.C3635T						.						50.0	51.0	51.0					8																	68107797		1953	4158	6111	SO:0001628	intergenic_variant	79848	exon29			CTTTCACTTGGCA	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626		8.37:g.68107797C>T		Somatic	222	0		WXS	Illumina HiSeq	Phase_I	263	84	NM_024790	0	0	5	12	7	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	ENST00000262215.3	37	CCDS6199.1	.	.	.	.	.	.	.	.	.	.	C	6.942	0.543635	0.13250	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.32272	1.46;1.48;1.48	5.51	-0.424	0.12321	.	0.554792	0.18305	N	0.145291	T	0.21550	0.0519	L	0.44542	1.39	0.09310	N	1	B;P;P	0.41569	0.256;0.755;0.755	B;B;B	0.35470	0.176;0.203;0.203	T	0.10177	-1.0641	10	0.66056	D	0.02	-1.672	10.1481	0.42776	0.2208:0.5604:0.2188:0.0	.	867;1212;1247	Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;CSPP1_HUMAN	I	1212;1247;867;867	ENSP00000262210:T1212I;ENSP00000415782:T867I;ENSP00000430092:T867I	ENSP00000262210:T1212I	T	+	2	0	CSPP1	68270351	0.000000	0.05858	0.008000	0.14137	0.141000	0.21300	0.200000	0.17257	-0.223000	0.09943	-0.181000	0.13052	ACT	.		0.493	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
DCAF13	25879	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	104444950	104444950	+	Missense_Mutation	SNP	G	G	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr8:104444950G>T	ENST00000297579.5	+	7	1499	c.1222G>T	c.(1222-1224)Gca>Tca	p.A408S	DCAF13_ENST00000521999.1_3'UTR	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	256					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						CATTTTTACAGCAGCAAATGA	0.308																																					p.A408S													.	DCAF13-135	0			c.G1222T						.						80.0	87.0	85.0					8																	104444950		2203	4297	6500	SO:0001583	missense	25879	exon7			TTTACAGCAGCAA	AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.1222G>T	8.37:g.104444950G>T	ENSP00000297579:p.Ala408Ser	Somatic	18	1		WXS	Illumina HiSeq	Phase_I	17	5	NM_015420	0	0	5	5	0	Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	ENST00000297579.5	37	CCDS34934.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895183	0.52121	.	.	ENSG00000164934	ENST00000297579	T	0.01397	4.94	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.236141	0.41938	D	0.000800	T	0.02380	0.0073	L	0.43152	1.355	0.80722	D	1	B	0.34241	0.444	B	0.32677	0.15	T	0.62120	-0.6921	10	0.46703	T	0.11	-21.6615	19.6374	0.95740	0.0:0.0:1.0:0.0	.	256	Q9NV06	DCA13_HUMAN	S	408	ENSP00000297579:A408S	ENSP00000297579:A408S	A	+	1	0	DCAF13	104514126	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.624000	0.61254	2.711000	0.92665	0.563000	0.77884	GCA	.		0.308	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380797.2	NM_015420	
PKHD1L1	93035	broad.mit.edu	37	8	110453596	110453596	+	Missense_Mutation	SNP	G	G	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr8:110453596G>A	ENST00000378402.5	+	34	4296	c.4192G>A	c.(4192-4194)Ggg>Agg	p.G1398R		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1398	IPT/TIG 7.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TACCAACAATGGGAAAGATTC	0.289										HNSCC(38;0.096)																											p.G1398R													.	PKHD1L1-145	0			c.G4192A						.						39.0	39.0	39.0					8																	110453596		1809	4056	5865	SO:0001583	missense	93035	exon34			AACAATGGGAAAG	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.4192G>A	8.37:g.110453596G>A	ENSP00000367655:p.Gly1398Arg	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	130	5	NM_177531	0	0	0	0	0	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735401	0.69189	.	.	ENSG00000205038	ENST00000378402	D	0.90261	-2.64	5.48	5.48	0.80851	Cupredoxin (1);Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);	0.000000	0.64402	D	0.000002	D	0.95268	0.8465	M	0.78049	2.395	0.38053	D	0.935856	D	0.89917	1.0	D	0.91635	0.999	D	0.96317	0.9233	10	0.87932	D	0	.	17.2099	0.86928	0.0:0.0:1.0:0.0	.	1398	Q86WI1	PKHL1_HUMAN	R	1398	ENSP00000367655:G1398R	ENSP00000367655:G1398R	G	+	1	0	PKHD1L1	110522772	1.000000	0.71417	0.348000	0.25681	0.725000	0.41563	5.168000	0.64978	2.730000	0.93505	0.650000	0.86243	GGG	.		0.289	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PUF60	22827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	144902839	144902839	+	Silent	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr8:144902839T>C	ENST00000526683.1	-	5	900	c.345A>G	c.(343-345)caA>caG	p.Q115Q	PUF60_ENST00000524570.1_5'UTR|PUF60_ENST00000456095.2_Silent_p.Q86Q|PUF60_ENST00000313352.7_Intron|PUF60_ENST00000453551.2_Silent_p.Q72Q|PUF60_ENST00000527197.1_Intron|PUF60_ENST00000349157.6_Intron	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	115	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			TATTGACCGATTGCAAAGGTG	0.562																																					p.Q115Q		.											.	.	0			c.A345G						.						199.0	208.0	205.0					8																	144902839		2085	4208	6293	SO:0001819	synonymous_variant	22827	exon5			GACCGATTGCAAA	AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.345A>G	8.37:g.144902839T>C		Somatic	82	0		WXS	Illumina HiSeq	Phase_I	62	26	NM_078480	0	0	0	0	0	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Silent	SNP	ENST00000526683.1	37	CCDS47934.1	.	.	.	.	.	.	.	.	.	.	T	9.393	1.076050	0.20227	.	.	ENSG00000179950	ENST00000527744	.	.	.	5.28	4.14	0.48551	.	.	.	.	.	T	0.59972	0.2233	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55927	-0.8063	4	.	.	.	.	9.9314	0.41525	0.0:0.0798:0.0:0.9202	.	.	.	.	S	113	.	.	N	-	2	0	PUF60	144974827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.482000	0.60257	0.868000	0.35678	0.533000	0.62120	AAT	.		0.562	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382222.1	NM_014281	
STOML2	30968	ucsc.edu;bcgsc.ca	37	9	35102144	35102144	+	Missense_Mutation	SNP	C	C	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr9:35102144C>G	ENST00000356493.5	-	3	293	c.231G>C	c.(229-231)caG>caC	p.Q77H	STOML2_ENST00000452248.2_Missense_Mutation_p.Q77H|STOML2_ENST00000487490.1_5'UTR	NM_013442.1	NP_038470.1	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2	77					CD4-positive, alpha-beta T cell activation (GO:0035710)|cellular calcium ion homeostasis (GO:0006874)|interleukin-2 production (GO:0032623)|lipid localization (GO:0010876)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|mitochondrial calcium ion transport (GO:0006851)|mitochondrial protein processing (GO:0034982)|mitochondrion organization (GO:0007005)|positive regulation of cardiolipin metabolic process (GO:1900210)|positive regulation of mitochondrial DNA replication (GO:0090297)|positive regulation of mitochondrial membrane potential (GO:0010918)|protein oligomerization (GO:0051259)|stress-induced mitochondrial fusion (GO:1990046)|T cell receptor signaling pathway (GO:0050852)	cytoskeleton (GO:0005856)|extrinsic component of plasma membrane (GO:0019897)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	cardiolipin binding (GO:1901612)|receptor binding (GO:0005102)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	16			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CCTTGAGACTCTGCACATATC	0.532																																					p.Q77H													.	STOML2-90	0			c.G231C						.						102.0	93.0	96.0					9																	35102144		2203	4300	6503	SO:0001583	missense	30968	exon3			GAGACTCTGCACA	AF190167	CCDS6577.1, CCDS69588.1, CCDS75830.1	9p13.1	2008-02-05			ENSG00000165283	ENSG00000165283			14559	protein-coding gene	gene with protein product		608292				10713127, 17121834	Standard	NM_001287031		Approved	SLP-2, HSPC108	uc003zwi.3	Q9UJZ1	OTTHUMG00000019851	ENST00000356493.5:c.231G>C	9.37:g.35102144C>G	ENSP00000348886:p.Gln77His	Somatic	196	2		WXS	Illumina HiSeq		199	80	NM_013442	0	0	23	44	21	B4E1K7|D3DRN3|O60376|Q53G29|Q96FY2|Q9P042	Missense_Mutation	SNP	ENST00000356493.5	37	CCDS6577.1	.	.	.	.	.	.	.	.	.	.	C	5.880	0.346502	0.11126	.	.	ENSG00000165283	ENST00000356493;ENST00000452248	D;D	0.94457	-3.43;-3.43	5.56	4.66	0.58398	.	0.051019	0.85682	D	0.000000	D	0.89375	0.6697	N	0.21240	0.645	0.58432	D	0.999999	B;B	0.27700	0.002;0.186	B;B	0.37833	0.01;0.259	T	0.83332	-0.0012	10	0.06625	T	0.88	-15.0706	11.5082	0.50479	0.0:0.8569:0.0:0.1431	.	77;77	B4E1K7;Q9UJZ1	.;STML2_HUMAN	H	77	ENSP00000348886:Q77H;ENSP00000395743:Q77H	ENSP00000348886:Q77H	Q	-	3	2	STOML2	35092144	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.331000	0.43894	1.580000	0.49851	0.655000	0.94253	CAG	.		0.532	STOML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052273.1	NM_013442	
ALDH1B1	219	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	38397069	38397069	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr9:38397069T>C	ENST00000377698.3	+	2	1477	c.1324T>C	c.(1324-1326)Tat>Cat	p.Y442H		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	442					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		CAACACCAGGTATGGCCTGGC	0.552																																					p.Y442H													.	ALDH1B1-227	0			c.T1324C						.						69.0	66.0	67.0					9																	38397069		2203	4300	6503	SO:0001583	missense	219	exon2			ACCAGGTATGGCC	M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.1324T>C	9.37:g.38397069T>C	ENSP00000366927:p.Tyr442His	Somatic	133	2		WXS	Illumina HiSeq	Phase_I	139	51	NM_000692	0	0	8	20	12	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	37	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	T	17.07	3.294921	0.60086	.	.	ENSG00000137124	ENST00000377698;ENST00000540055	D	0.81659	-1.52	5.7	5.7	0.88788	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.64402	D	0.000018	D	0.92485	0.7614	H	0.95816	3.725	0.54753	D	0.999985	D	0.89917	1.0	D	0.83275	0.996	D	0.94386	0.7609	10	0.87932	D	0	.	13.9161	0.63899	0.0:0.0:0.0:1.0	.	442	P30837	AL1B1_HUMAN	H	442;143	ENSP00000366927:Y442H	ENSP00000366927:Y442H	Y	+	1	0	ALDH1B1	38387069	1.000000	0.71417	0.927000	0.36925	0.539000	0.34962	7.743000	0.85020	2.169000	0.68431	0.533000	0.62120	TAT	.		0.552	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1		
ZNF462	58499	broad.mit.edu	37	9	109689599	109689599	+	Missense_Mutation	SNP	A	A	G			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr9:109689599A>G	ENST00000277225.5	+	3	3695	c.3406A>G	c.(3406-3408)Aga>Gga	p.R1136G	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.R1136G			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1136					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						CTACCAGAAAAGACACCCAGA	0.537																																					p.R1136G													.	ZNF462-95	0			c.A3406G						.						92.0	96.0	95.0					9																	109689599		2203	4300	6503	SO:0001583	missense	58499	exon3			CAGAAAAGACACC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3406A>G	9.37:g.109689599A>G	ENSP00000277225:p.Arg1136Gly	Somatic	36	0		WXS	Illumina HiSeq	Phase_I	18	3	NM_021224	0	0	0	0	0	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	37	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	A	15.28	2.786838	0.49997	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686	T;T;T	0.12147	2.71;3.1;3.6	5.37	5.37	0.77165	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.33323	0.0859	L	0.54323	1.7	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.77557	0.99;0.987	T	0.03403	-1.1040	10	0.72032	D	0.01	.	15.3692	0.74548	1.0:0.0:0.0:0.0	.	1136;1136	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	G	1136;1136;19	ENSP00000277225:R1136G;ENSP00000414570:R1136G;ENSP00000363818:R19G	ENSP00000277225:R1136G	R	+	1	2	ZNF462	108729420	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.785000	0.62418	2.033000	0.60031	0.459000	0.35465	AGA	.		0.537	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
C9orf50	375759	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	132377793	132377793	+	Missense_Mutation	SNP	T	T	C			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr9:132377793T>C	ENST00000372478.4	-	4	1051	c.850A>G	c.(850-852)Acg>Gcg	p.T284A	NTMT1_ENST00000372486.1_Intron	NM_199350.3	NP_955382.3	Q5SZB4	CI050_HUMAN	chromosome 9 open reading frame 50	284										central_nervous_system(1)|endometrium(4)|large_intestine(2)|ovary(1)|skin(1)|urinary_tract(1)	10		Ovarian(14;0.00556)				TAGCGGAGCGTTGTGTCCTGC	0.642																																					p.T284A													.	C9orf50-91	0			c.A850G						.						65.0	56.0	59.0					9																	132377793		2203	4300	6503	SO:0001583	missense	375759	exon4			GGAGCGTTGTGTC	AK093122	CCDS35159.1	9q34.2	2012-03-15			ENSG00000179058	ENSG00000179058			23677	protein-coding gene	gene with protein product							Standard	NM_199350		Approved	FLJ35803	uc004byc.4	Q5SZB4	OTTHUMG00000020786	ENST00000372478.4:c.850A>G	9.37:g.132377793T>C	ENSP00000361556:p.Thr284Ala	Somatic	70	0		WXS	Illumina HiSeq	Phase_I	61	19	NM_199350	0	0	0	2	2	Q2M1I2|Q8NA65	Missense_Mutation	SNP	ENST00000372478.4	37	CCDS35159.1	.	.	.	.	.	.	.	.	.	.	t	0.001	-2.889554	0.00060	.	.	ENSG00000179058	ENST00000372478	T	0.10099	2.91	3.17	0.155	0.14906	.	0.496540	0.15341	N	0.267481	T	0.02380	0.0073	N	0.01168	-0.975	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.44711	-0.9310	10	0.02654	T	1	-2.9125	5.3025	0.15785	0.0:0.4706:0.407:0.1224	.	284	Q5SZB4	CI050_HUMAN	A	284	ENSP00000361556:T284A	ENSP00000361556:T284A	T	-	1	0	C9orf50	131417614	0.003000	0.15002	0.001000	0.08648	0.108000	0.19459	0.323000	0.19593	0.038000	0.15604	-1.709000	0.00716	ACG	.		0.642	C9orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054593.1	NM_199350	
TPRN	286262	hgsc.bcm.edu	37	9	140094091	140094091	+	Missense_Mutation	SNP	A	A	G	rs60910563	byFrequency	TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr9:140094091A>G	ENST00000409012.4	-	1	1159	c.1073T>C	c.(1072-1074)cTg>cCg	p.L358P	TPRN_ENST00000541945.1_Intron|TPRN_ENST00000321773.2_Missense_Mutation_p.L297P	NM_001128228.2	NP_001121700.2	Q4KMQ1	TPRN_HUMAN	taperin	358					sensory perception of sound (GO:0007605)	stereocilium (GO:0032420)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	8						GGCCGGGCCCAGGTCTCCCTT	0.672													A|||	94	0.01877	0.0696	0.0029	5008	,	,		12735	0.0		0.0	False		,,,				2504	0.0				p.L358P		.											.	TPRN-90	0			c.T1073C						.	A	PRO/LEU	133,3959		1,131,1914	5.0	5.0	5.0		1073	-2.5	0.0	9	dbSNP_129	5	0,8162		0,0,4081	yes	missense	TPRN	NM_001128228.2	98	1,131,5995	GG,GA,AA		0.0,3.2502,1.0854	probably-damaging	358/712	140094091	133,12121	2046	4081	6127	SO:0001583	missense	286262	exon1			GGGCCCAGGTCTC	AK074735	CCDS56594.1	9q34.3	2011-01-06	2010-03-24	2010-03-24	ENSG00000176058	ENSG00000176058			26894	protein-coding gene	gene with protein product		613354	"""chromosome 9 open reading frame 75"", ""deafness, autosomal recessive 79"""	C9orf75, DFNB79		20170898, 20170899	Standard	NM_001128228		Approved	FLJ90254	uc004clu.3	Q4KMQ1	OTTHUMG00000020984	ENST00000409012.4:c.1073T>C	9.37:g.140094091A>G	ENSP00000387100:p.Leu358Pro	Somatic	5	0		WXS	Illumina HiSeq	Phase_I	16	7	NM_001128228	0	0	14	21	7	B7ZKU5|Q5VSG5|Q5VSG6|Q6IPP2|Q8NCH2	Missense_Mutation	SNP	ENST00000409012.4	37	CCDS56594.1	35	0.016025641025641024	34	0.06910569105691057	1	0.0027624309392265192	0	0.0	0	0.0	A	0.935	-0.711322	0.03230	0.032502	0.0	ENSG00000176058	ENST00000333046;ENST00000409012;ENST00000321773	.	.	.	3.47	-2.46	0.06461	.	1.261530	0.05899	N	0.629706	T	0.01189	0.0039	N	0.14661	0.345	0.09310	N	0.999999	B	0.24483	0.104	B	0.17433	0.018	T	0.17440	-1.0369	9	0.56958	D	0.05	.	0.3333	0.00322	0.3035:0.2092:0.282:0.2053	rs60910563	358	Q4KMQ1	TPRN_HUMAN	P	156;358;297	.	ENSP00000313704:L297P	L	-	2	0	TPRN	139213912	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	-0.236000	0.09003	-0.352000	0.08237	0.374000	0.22700	CTG	A|0.984;G|0.016		0.672	TPRN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055323.3	NM_173691	
AKAP17A	8227	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	1719998	1719998	+	Silent	SNP	C	C	T			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chrX:1719998C>T	ENST00000313871.3	+	5	1795	c.1599C>T	c.(1597-1599)ccC>ccT	p.P533P		NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	533					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GTGTGGTCCCCGAGGATGGCT	0.657													c|||	1	0.000199681	0.0	0.0	5008	,	,		14923	0.001		0.0	False		,,,				2504	0.0				p.P533P		.											.	AKAP17A-40	0			c.C1599T						.						57.0	56.0	56.0					X																	1719998		2203	4296	6499	SO:0001819	synonymous_variant	8227	exon5			GGTCCCCGAGGAT	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1599C>T	X.37:g.1719998C>T		Somatic	113	0		WXS	Illumina HiSeq	Phase_I	96	7	NM_005088	0	0	11	12	1	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Silent	SNP	ENST00000313871.3	37	CCDS14116.1																																																																																			.		0.657	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
LPAR4	2846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	78010716	78010716	+	Missense_Mutation	SNP	C	C	A			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chrX:78010716C>A	ENST00000435339.3	+	2	736	c.350C>A	c.(349-351)gCa>gAa	p.A117E		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	117					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						TCTGGAACTGCATTCCTTACC	0.423																																					p.A117E		.											.	LPAR4-133	0			c.C350A						.						190.0	152.0	165.0					X																	78010716		2203	4299	6502	SO:0001583	missense	2846	exon2			GAACTGCATTCCT	U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.350C>A	X.37:g.78010716C>A	ENSP00000408205:p.Ala117Glu	Somatic	128	0		WXS	Illumina HiSeq	Phase_I	110	92	NM_005296	0	0	0	0	0	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	ENST00000435339.3	37	CCDS14441.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.002367	0.54254	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.38077	1.16;1.16	4.21	4.21	0.49690	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59293	0.2183	M	0.80183	2.485	0.50171	D	0.999859	D	0.63880	0.993	D	0.63877	0.919	T	0.66771	-0.5839	10	0.72032	D	0.01	.	14.3969	0.67018	0.0:1.0:0.0:0.0	.	117	Q99677	LPAR4_HUMAN	E	117	ENSP00000408205:A117E;ENSP00000362398:A117E	ENSP00000362398:A117E	A	+	2	0	LPAR4	77897372	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.452000	0.60054	1.943000	0.56356	0.422000	0.28245	GCA	.		0.423	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057322.2	NM_005296	
MKI67	4288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	129902143	129902143	+	Frame_Shift_Del	DEL	G	G	-			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr10:129902143delG	ENST00000368654.3	-	13	8336	c.7961delC	c.(7960-7962)ccafs	p.P2654fs	MKI67_ENST00000368653.3_Frame_Shift_Del_p.P2294fs	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2654	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TACTGGGTTTGGTTTCTTCTT	0.522																																					p.P2654fs		.											.	MKI67-519	0			c.7961delC						.						171.0	175.0	174.0					10																	129902143		2203	4300	6503	SO:0001589	frameshift_variant	4288	exon13			.	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.7961delC	10.37:g.129902143delG	ENSP00000357643:p.Pro2654fs	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	118	50	NM_002417	0	0	0	0	0	Q5VWH2	Frame_Shift_Del	DEL	ENST00000368654.3	37	CCDS7659.1																																																																																			.		0.522	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
BDNF	627	hgsc.bcm.edu;bcgsc.ca	37	11	27680049	27680056	+	Frame_Shift_Del	DEL	CATGGGGG	CATGGGGG	-			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	CATGGGGG	CATGGGGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr11:27680049_27680056delCATGGGGG	ENST00000525528.1	-	1	1149_1156	c.56_63delCCCCCATG	c.(55-63)gcccccatgfs	p.APM19fs	BDNF_ENST00000395980.2_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000395986.2_Frame_Shift_Del_p.APM34fs|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000356660.4_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000438929.1_Frame_Shift_Del_p.APM101fs|BDNF-AS_ENST00000532965.1_RNA|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000533131.1_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000439476.2_Frame_Shift_Del_p.APM19fs|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000395978.3_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000395981.3_Frame_Shift_Del_p.APM19fs|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000395983.3_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000533246.1_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000418212.1_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000530861.1_Frame_Shift_Del_p.APM19fs|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000532997.1_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000525950.1_Frame_Shift_Del_p.APM19fs|BDNF_ENST00000314915.6_Frame_Shift_Del_p.APM27fs|BDNF_ENST00000420794.1_Frame_Shift_Del_p.APM19fs|BDNF-AS_ENST00000530313.1_RNA|BDNF-AS_ENST00000530686.1_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	19					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						TTGCTTCTTTCATGGGGGCAGCCTTCAT	0.514																																					p.101_103del		.											.	BDNF-514	0			c.302_309del						.																																			SO:0001589	frameshift_variant	627	exon3			.	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.56_63delCCCCCATG	11.37:g.27680049_27680056delCATGGGGG	ENSP00000437138:p.Ala19fs	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	91	27	NM_001143810	0	0	0	0	0	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Frame_Shift_Del	DEL	ENST00000525528.1	37	CCDS7866.1																																																																																			.		0.514	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388135.1	NM_170735	
TAS2R43	259289	hgsc.bcm.edu	37	12	11244149	11244149	+	Frame_Shift_Del	DEL	G	G	-	rs73064964	byFrequency	TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr12:11244149delG	ENST00000531678.1	-	1	763	c.680delC	c.(679-681)gctfs	p.A227fs	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	227					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AGTTTGCAAAGCTTTTATGTG	0.393																																					p.A227fs		.											.	TAS2R43-1	0			c.680delC						.						137.0	119.0	125.0					12																	11244149		2179	4249	6428	SO:0001589	frameshift_variant	259289	exon1			.	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.680delC	12.37:g.11244149delG	ENSP00000431719:p.Ala227fs	Somatic	10	0		WXS	Illumina HiSeq	Phase_I	32	17	NM_176884	0	0	0	0	0	P59546|Q645X4	Frame_Shift_Del	DEL	ENST00000531678.1	37	CCDS53749.1																																																																																			.		0.393	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
PHF11	51131	bcgsc.ca	37	13	50098263	50098272	+	Frame_Shift_Del	DEL	CAGGACTTCT	CAGGACTTCT	-			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	CAGGACTTCT	CAGGACTTCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr13:50098263_50098272delCAGGACTTCT	ENST00000378319.3	+	8	721_730	c.680_689delCAGGACTTCT	c.(679-690)gcaggacttcttfs	p.AGLL227fs	PHF11_ENST00000357596.3_Frame_Shift_Del_p.AGLL188fs|PHF11_ENST00000488958.1_Frame_Shift_Del_p.AGLL188fs	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		TGCAAGGAAGCAGGACTTCTTAATTACTTA	0.329																																					p.227_230del													.	PHF11-90	0			c.680_689del						.																																			SO:0001589	frameshift_variant	51131	exon8			AGGAAGCAGGACT	AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.680_689delCAGGACTTCT	13.37:g.50098263_50098272delCAGGACTTCT	ENSP00000367570:p.Ala227fs	Somatic	76	0		WXS	Illumina HiSeq	Phase_1	60	6	NM_001040443	0	0	0	0	0	Q5W0A4|Q5W0A6|Q9Y5A2	Frame_Shift_Del	DEL	ENST00000378319.3	37	CCDS31975.1																																																																																			.		0.329	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044915.1	NM_016119	
TBCK	93627	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	107163709	107163709	+	Frame_Shift_Del	DEL	C	C	-	rs371959745		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:107163709delC	ENST00000273980.5	-	13	1535	c.1088delG	c.(1087-1089)ggtfs	p.G363fs	TBCK_ENST00000432496.2_Frame_Shift_Del_p.G363fs|TBCK_ENST00000394706.3_Frame_Shift_Del_p.G324fs|TBCK_ENST00000394708.2_Frame_Shift_Del_p.G363fs|TBCK_ENST00000361687.4_Frame_Shift_Del_p.G300fs					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						AAAGCTTTCACCATCCTCAAA	0.313																																					p.G363fs		.											.	TBCK-336	0			c.1088delG						.						67.0	65.0	66.0					4																	107163709		2203	4300	6503	SO:0001589	frameshift_variant	93627	exon12			.		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1088delG	4.37:g.107163709delC	ENSP00000273980:p.Gly363fs	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	28	17	NM_001163436	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000273980.5	37	CCDS54788.1																																																																																			.		0.313	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
SH3D19	152503	hgsc.bcm.edu;bcgsc.ca	37	4	152096326	152096326	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr4:152096326delC	ENST00000409252.2	-	6	897	c.190delG	c.(190-192)gctfs	p.A64fs	SH3D19_ENST00000455740.1_Frame_Shift_Del_p.A64fs|SH3D19_ENST00000304527.4_Frame_Shift_Del_p.A64fs|SH3D19_ENST00000427414.2_Frame_Shift_Del_p.A64fs|SH3D19_ENST00000409598.4_Frame_Shift_Del_p.A64fs|SH3D19_ENST00000424281.1_Frame_Shift_Del_p.A64fs|SH3D19_ENST00000604030.1_5'Flank|SH3D19_ENST00000514152.1_Frame_Shift_Del_p.A64fs			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	64					cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCTCCAGAAGCTCTGTTAGCA	0.532																																					p.A64fs		.											.	SH3D19-92	0			c.190delG						.						86.0	86.0	86.0					4																	152096326		2203	4300	6503	SO:0001589	frameshift_variant	152503	exon1			.	BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.190delG	4.37:g.152096326delC	ENSP00000386848:p.Ala64fs	Somatic	84	0		WXS	Illumina HiSeq	Phase_I	81	39	NM_001128924	0	0	0	0	0	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Frame_Shift_Del	DEL	ENST00000409252.2	37	CCDS34077.2																																																																																			.		0.532	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335132.3	NM_001009555	
CANX	821	hgsc.bcm.edu;bcgsc.ca	37	5	179136997	179136997	+	Frame_Shift_Del	DEL	C	C	-			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr5:179136997delC	ENST00000247461.4	+	7	852	c.652delC	c.(652-654)catfs	p.H218fs	CANX_ENST00000415618.2_Frame_Shift_Del_p.H253fs|CANX_ENST00000452673.2_Frame_Shift_Del_p.H218fs|CANX_ENST00000503126.1_3'UTR|CANX_ENST00000512607.2_Frame_Shift_Del_p.H110fs|CANX_ENST00000504734.1_Frame_Shift_Del_p.H218fs	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	218					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	TGAAGAAAAACATGCTAAGAG	0.373																																					p.H218fs		.											.	CANX-90	0			c.652delC						.						132.0	135.0	134.0					5																	179136997		2203	4300	6503	SO:0001589	frameshift_variant	821	exon7			.	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.652delC	5.37:g.179136997delC	ENSP00000247461:p.His218fs	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	59	19	NM_001746	0	0	0	0	0	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Frame_Shift_Del	DEL	ENST00000247461.4	37	CCDS4447.1																																																																																			.		0.373	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649	
NFE2L3	9603	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	26224635	26224636	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:26224635_26224636delCT	ENST00000056233.3	+	4	1576_1577	c.1317_1318delCT	c.(1315-1320)cactctfs	p.S440fs		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	440					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						ATTCCTCTCACTCTGTGTGTGA	0.421																																					p.439_440del		.											.	NFE2L3-94	0			c.1317_1318del						.																																			SO:0001589	frameshift_variant	9603	exon4			.	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1317_1318delCT	7.37:g.26224637_26224638delCT	ENSP00000056233:p.Ser440fs	Somatic	97	0		WXS	Illumina HiSeq	Phase_I	172	42	NM_004289	0	0	0	0	0	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Frame_Shift_Del	DEL	ENST00000056233.3	37	CCDS5396.1																																																																																			.		0.421	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214088.1		
Unknown	0	broad.mit.edu	37	1	144615250	144615251	+	IGR	INS	-	-	AA	rs202042060|rs10625215	byFrequency	TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr1:144615250_144615251insAA								RP11-640M9.2 (9359 upstream) : NBPF9 (196492 downstream)																							ACCTCAAAGAGATGTTTTCTAA	0.46														497	0.0992412	0.0076	0.1009	5008	,	,		14193	0.2589		0.0606	False		,,,				2504	0.0971				.													.	.	0			.						.																																			SO:0001628	intergenic_variant	400818	.			CAAAGAGATGTTT																													1.37:g.144615250_144615251insAA		Somatic	7	0		WXS	Illumina HiSeq	Phase_I	8	2	.	0	0	0	0	0		Frame_Shift_Ins	INS		37																																																																																				-|0.759;AA|0.241	0	0.460								
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE													.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	Somatic	342	0		WXS	Illumina HiSeq	Phase_I	294	8	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
EIF2AK1	27102	broad.mit.edu;bcgsc.ca	37	7	6078295	6078296	+	Frame_Shift_Ins	INS	-	-	A	rs150001751		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:6078295_6078296insA	ENST00000199389.6	-	10	1272_1273	c.1126_1127insT	c.(1126-1128)tacfs	p.Y376fs	EIF2AK1_ENST00000495565.1_5'Flank|EIF2AK1_ENST00000536084.1_Frame_Shift_Ins_p.Y252fs	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	376	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		CATCAGGTGGTACTGTGCCTAG	0.505																																					p.Y376fs													.	EIF2AK1-408	0			c.1127_1128insT						.																																			SO:0001589	frameshift_variant	27102	exon10			AGGTGGTACTGTG	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1127dupT	7.37:g.6078296_6078296dupA	ENSP00000199389:p.Tyr376fs	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	137	20	NM_014413	0	0	0	0	0	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Frame_Shift_Ins	INS	ENST00000199389.6	37	CCDS5345.1																																																																																			.		0.505	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
EIF2AK1	27102	broad.mit.edu;bcgsc.ca	37	7	6078298	6078299	+	Frame_Shift_Ins	INS	-	-	A	rs372398524		TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr7:6078298_6078299insA	ENST00000199389.6	-	10	1269_1270	c.1123_1124insT	c.(1123-1125)cagfs	p.Q375fs	EIF2AK1_ENST00000495565.1_5'Flank|EIF2AK1_ENST00000536084.1_Frame_Shift_Ins_p.Q251fs	NM_001134335.1|NM_014413.3	NP_001127807.1|NP_055228.2	Q9BQI3	E2AK1_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 1	375	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|negative regulation of hemoglobin biosynthetic process (GO:0046986)|negative regulation of translational initiation by iron (GO:0045993)|protein autophosphorylation (GO:0046777)|protoporphyrinogen IX metabolic process (GO:0046501)|regulation of eIF2 alpha phosphorylation by heme (GO:0010999)|response to external stimulus (GO:0009605)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	27		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.106)|OV - Ovarian serous cystadenocarcinoma(56;5.22e-14)		CAGGTGGTACTGTGCCTAGGAG	0.51																																					p.Q375fs													.	EIF2AK1-408	0			c.1124_1125insT						.																																			SO:0001589	frameshift_variant	27102	exon10			TGGTACTGTGCCT	BC006524	CCDS5345.1	7p22	2005-01-20			ENSG00000086232	ENSG00000086232			24921	protein-coding gene	gene with protein product	"""heme regulated initiation factor 2 alpha kinase"""	613635				7709427, 10718198	Standard	NM_014413		Approved	HRI, KIAA1369	uc003spp.3	Q9BQI3	OTTHUMG00000090689	ENST00000199389.6:c.1123_1124insT	7.37:g.6078298_6078299insA	ENSP00000199389:p.Gln375fs	Somatic	92	0		WXS	Illumina HiSeq	Phase_I	134	20	NM_014413	0	0	0	0	0	A8K2R2|Q549K6|Q8NBW3|Q9HC02|Q9NYE0|Q9P0V6|Q9P1J5|Q9P2H8|Q9UHG4	Frame_Shift_Ins	INS	ENST00000199389.6	37	CCDS5345.1																																																																																			.		0.510	EIF2AK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207373.2	NM_014413	
VLDLR	7436	hgsc.bcm.edu;bcgsc.ca	37	9	2643309	2643310	+	In_Frame_Ins	INS	-	-	GCA			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr9:2643309_2643310insGCA	ENST00000382100.3	+	5	954_955	c.598_599insGCA	c.(598-600)tgc>tGCAgc	p.201_202insS	RP11-125B21.2_ENST00000599229.1_RNA|VLDLR_ENST00000382099.2_In_Frame_Ins_p.201_202insS	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	201	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		TGAGTTCCAGTGCAGCACCTCC	0.589																																					p.C200delinsCS		.											.	VLDLR-516	0			c.598_599insGCA						.																																			SO:0001652	inframe_insertion	7436	exon5			.		CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.602_604dupGCA	9.37:g.2643313_2643315dupGCA	ENSP00000371532:p.Ser203_Ser204dup	Somatic	131	0		WXS	Illumina HiSeq	Phase_I	141	52	NM_003383	0	0	0	0	0	B2RMZ7|D3DRH6|Q5VVF6	In_Frame_Ins	INS	ENST00000382100.3	37	CCDS6446.1																																																																																			.		0.589	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383	
ZNF407	55628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	72345617	72345618	+	Missense_Mutation	DNP	GC	GC	AT			TCGA-MH-A55Z-01A-11D-A26P-10	TCGA-MH-A55Z-10A-01D-A26P-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b19ec4cd-2876-4a2b-bcb9-b3c8db54fc15	3d292f02-ebb2-457b-b5a3-1590b60833a6	g.chr18:72345617_72345618GC>AT	ENST00000299687.5	+	1	2642_2643	c.2642_2643GC>AT	c.(2641-2643)tGC>tAT	p.C881Y	ZNF407_ENST00000309902.6_Missense_Mutation_p.C881Y|ZNF407_ENST00000577538.1_Missense_Mutation_p.C881Y|ZNF407_ENST00000582337.1_Missense_Mutation_p.C881Y	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	881					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		AGTTATTTATGCAAAGTGTGTA	0.401																																					p.C881Y		.											.	ZNF407-92	0			c.C2643T						.																																			SO:0001583	missense	55628	exon1			TTTATGCAAAGTG	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		Exception_encountered	18.37:g.72345617_72345618delinsAT	ENSP00000299687:p.Cys881Tyr	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	38.0	NM_001146190	0	0	0	0	0	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	DNP	ENST00000299687.5	37	CCDS45885.1																																																																																			.		0.401	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444903.1	NM_017757	
