#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF25	8718	broad.mit.edu	37	1	6522060	6522060	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr1:6522060C>A	ENST00000356876.3	-	9	1006	c.919G>T	c.(919-921)Gct>Tct	p.A307S	TNFRSF25_ENST00000348333.3_Missense_Mutation_p.A262S|TNFRSF25_ENST00000377782.3_Missense_Mutation_p.A316S|TNFRSF25_ENST00000351748.3_Missense_Mutation_p.A124S|TNFRSF25_ENST00000461703.2_5'Flank|TNFRSF25_ENST00000351959.5_Missense_Mutation_p.A270S	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	307					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		TTACCAAGAGCTCTGCTGGGC	0.607																																					p.A316S													.	TNFRSF25-714	0			c.G946T						.						70.0	68.0	69.0					1																	6522060		2203	4300	6503	SO:0001583	missense	8718	exon9			CAAGAGCTCTGCT	U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.919G>T	1.37:g.6522060C>A	ENSP00000349341:p.Ala307Ser	Somatic	66	1		WXS	Illumina HiSeq	Phase_I	77	6	NM_148965	0	0	0	0	0	B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	ENST00000356876.3	37	CCDS71.1	.	.	.	.	.	.	.	.	.	.	C	9.902	1.207079	0.22205	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959;ENST00000351748;ENST00000348333	D;D;D;T;D	0.92699	-2.92;-3.09;-2.98;2.53;-2.01	4.71	2.8	0.32819	.	529.136000	0.00541	U	0.000220	D	0.89901	0.6849	M	0.65975	2.015	0.23685	N	0.997118	B;B;B;B;B;P	0.43938	0.138;0.112;0.228;0.04;0.138;0.822	B;B;B;B;B;B	0.38264	0.044;0.032;0.121;0.02;0.044;0.269	T	0.74337	-0.3698	10	0.13470	T	0.59	-0.2417	6.9581	0.24582	0.0:0.7774:0.0:0.2226	.	316;262;270;307;308;124	Q93038-11;Q93038-9;Q93038-10;Q93038;Q93038-2;Q93038-8	.;.;.;TNR25_HUMAN;.;.	S	307;316;270;124;262	ENSP00000349341:A307S;ENSP00000367013:A316S;ENSP00000337713:A270S;ENSP00000326762:A124S;ENSP00000314451:A262S	ENSP00000314451:A262S	A	-	1	0	TNFRSF25	6444647	0.001000	0.12720	0.902000	0.35471	0.897000	0.52465	-0.227000	0.09126	0.476000	0.27440	0.655000	0.94253	GCT	.		0.607	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002259.1	NM_148965	
DCLRE1B	64858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	114454514	114454514	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr1:114454514C>T	ENST00000369563.3	+	4	1746	c.1300C>T	c.(1300-1302)Cac>Tac	p.H434Y	DCLRE1B_ENST00000466480.1_Intron	NM_022836.3	NP_073747.1	Q9H816	DCR1B_HUMAN	DNA cross-link repair 1B	434					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|protection from non-homologous end joining at telomere (GO:0031848)|telomere maintenance (GO:0000723)|telomeric 3' overhang formation (GO:0031860)|telomeric loop formation (GO:0031627)	centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(6)|stomach(1)	18	Lung SC(450;0.184)	all_cancers(81;1.46e-05)|all_epithelial(167;2.42e-05)|all_lung(203;0.000353)|Lung NSC(69;0.000518)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTTTCAGTGCACTTAAGGTC	0.473								Other identified genes with known or suspected DNA repair function																													p.H434Y		.											.	DCLRE1B-227	0			c.C1300T						.						168.0	186.0	180.0					1																	114454514		2203	4300	6503	SO:0001583	missense	64858	exon4			TCAGTGCACTTAA	BC029687	CCDS866.1	1p11.1	2010-06-24	2010-06-24		ENSG00000118655	ENSG00000118655			17641	protein-coding gene	gene with protein product	"""APOLLO"", ""PSO2 homolog (S. cerevisiae)"""	609683	"""DNA cross-link repair 1B (PSO2 homolog, S. cerevisiae)"""				Standard	NM_022836		Approved	SNM1B, FLJ12810, FLJ13998	uc001eeg.3	Q9H816	OTTHUMG00000011937	ENST00000369563.3:c.1300C>T	1.37:g.114454514C>T	ENSP00000358576:p.His434Tyr	Somatic	135	0		WXS	Illumina HiSeq	Phase_I	134	18	NM_022836	0	0	4	4	0	Q9H9E5	Missense_Mutation	SNP	ENST00000369563.3	37	CCDS866.1	.	.	.	.	.	.	.	.	.	.	C	16.27	3.075166	0.55646	.	.	ENSG00000118655	ENST00000369563	T	0.75260	-0.92	5.75	2.18	0.27775	.	1.219440	0.05575	N	0.571775	T	0.42086	0.1187	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.42241	-0.9463	10	0.66056	D	0.02	-11.1736	5.1932	0.15220	0.2671:0.6065:0.0:0.1264	.	434	Q9H816	DCR1B_HUMAN	Y	434	ENSP00000358576:H434Y	ENSP00000358576:H434Y	H	+	1	0	DCLRE1B	114256037	0.002000	0.14202	0.004000	0.12327	0.624000	0.37722	0.606000	0.24194	1.186000	0.42985	0.655000	0.94253	CAC	.		0.473	DCLRE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033020.2	NM_022836	
ACP6	51205	broad.mit.edu	37	1	147142085	147142085	+	Missense_Mutation	SNP	A	A	C	rs201678741		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr1:147142085A>C	ENST00000369238.6	-	1	533	c.86T>G	c.(85-87)gTg>gGg	p.V29G	ACP6_ENST00000392988.2_Missense_Mutation_p.V29G	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	29					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					GGCCAGGGCCACCCGCCGCTG	0.657																																					p.V29G													.	ACP6-94	0			c.T86G						.						12.0	10.0	11.0					1																	147142085		2053	4027	6080	SO:0001583	missense	51205	exon1			AGGGCCACCCGCC	BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.86T>G	1.37:g.147142085A>C	ENSP00000358241:p.Val29Gly	Somatic	33	7		WXS	Illumina HiSeq	Phase_I	151	41	NM_016361	0	0	1	1	0	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	ENST00000369238.6	37	CCDS928.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149393	0.37923	.	.	ENSG00000162836	ENST00000369238;ENST00000392988	T;T	0.48522	2.65;0.81	5.28	-5.16	0.02857	.	0.609019	0.16327	N	0.219309	T	0.09555	0.0235	L	0.34521	1.04	0.43385	D	0.99549	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.22730	-1.0208	10	0.19147	T	0.46	.	1.0577	0.01593	0.2021:0.3491:0.2212:0.2275	.	29;29	Q9NPH0-2;Q9NPH0	.;PPA6_HUMAN	G	29	ENSP00000358241:V29G;ENSP00000376714:V29G	ENSP00000358241:V29G	V	-	2	0	ACP6	145608709	0.001000	0.12720	0.927000	0.36925	0.947000	0.59692	-0.635000	0.05471	-0.919000	0.03803	-0.460000	0.05396	GTG	.		0.657	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039420.2	NM_016361	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880061	64880061	+	Missense_Mutation	SNP	C	C	T	rs371186990	byFrequency	TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr11:64880061C>T	ENST00000279263.7	+	2	289	c.127C>T	c.(127-129)Cgc>Tgc	p.R43C	TM7SF2_ENST00000345348.5_Missense_Mutation_p.R43C|TM7SF2_ENST00000540748.1_5'UTR|AP003068.9_ENST00000528887.1_RNA	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	43					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGGCCCCGCGCGCCTGCTGGG	0.761													C|||	2	0.000399361	0.0	0.0	5008	,	,		9764	0.0		0.001	False		,,,				2504	0.001				p.R43C		.											.	TM7SF2-91	0			c.C127T						.	C	CYS/ARG	0,2736		0,0,1368	2.0	2.0	2.0		127	3.8	1.0	11		2	1,6125		0,1,3062	no	missense	TM7SF2	NM_003273.2	180	0,1,4430	TT,TC,CC		0.0163,0.0,0.0113	probably-damaging	43/419	64880061	1,8861	1368	3063	4431	SO:0001583	missense	7108	exon2			CCCGCGCGCCTGC	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.127C>T	11.37:g.64880061C>T	ENSP00000279263:p.Arg43Cys	Somatic	0	0		WXS	Illumina HiSeq	Phase_I	13	8	NM_003273	0	0	0	0	0	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Missense_Mutation	SNP	ENST00000279263.7	37	CCDS41669.1	.	.	.	.	.	.	.	.	.	.	c	18.67	3.674356	0.67928	0.0	1.63E-4	ENSG00000149809	ENST00000526809;ENST00000279263;ENST00000524986;ENST00000534371;ENST00000525385;ENST00000345348;ENST00000531321;ENST00000529414;ENST00000530750	D;D;D;D;D;D;D;D;T	0.99014	-4.71;-4.76;-4.18;-5.17;-4.38;-4.9;-5.33;-4.27;-1.08	4.77	3.78	0.43462	.	1.425240	0.04660	N	0.408682	D	0.98416	0.9473	N	0.22421	0.69	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.66847	0.911;0.947	D	0.95356	0.8451	10	0.56958	D	0.05	-14.5223	9.5491	0.39299	0.3109:0.6891:0.0:0.0	.	43;43	O76062-2;O76062	.;ERG24_HUMAN	C	43;43;14;43;14;43;14;43;43	ENSP00000432171:R43C;ENSP00000279263:R43C;ENSP00000435972:R14C;ENSP00000432187:R43C;ENSP00000433325:R14C;ENSP00000329520:R43C;ENSP00000431300:R14C;ENSP00000433275:R43C;ENSP00000432413:R43C	ENSP00000279263:R43C	R	+	1	0	TM7SF2	64636637	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	1.094000	0.30951	2.484000	0.83849	0.556000	0.70494	CGC	.		0.761	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751497	76751497	+	Missense_Mutation	SNP	A	A	G	rs559157215	byFrequency	TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr11:76751497A>G	ENST00000533140.1	+	2	1040	c.902A>G	c.(901-903)cAc>cGc	p.H301R	B3GNT6_ENST00000421061.1_Intron|B3GNT6_ENST00000354301.5_Missense_Mutation_p.H301R			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						gccgcccgccACACCCCGCTC	0.756													A|||	21	0.00419329	0.0008	0.0288	5008	,	,		10513	0.0		0.0	False		,,,				2504	0.0				p.H301R		.											.	.	0			c.A902G						.																																			SO:0001583	missense	192134	exon2			CCCGCCACACCCC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.902A>G	11.37:g.76751497A>G	ENSP00000435352:p.His301Arg	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	8	4	NM_138706	0	0	0	0	0	Q4TTN0	Missense_Mutation	SNP	ENST00000533140.1	37	CCDS53681.1	.	.	.	.	.	.	.	.	.	.	A	1.535	-0.543236	0.04053	.	.	ENSG00000198488	ENST00000533140;ENST00000354301	T;T	0.44083	0.93;0.93	2.89	0.53	0.17102	.	0.656353	0.15442	N	0.262162	T	0.21921	0.0528	N	0.21097	0.63	0.09310	N	0.999997	B	0.02656	0.0	B	0.09377	0.004	T	0.24368	-1.0162	10	0.11794	T	0.64	.	6.0489	0.19775	0.753:0.0:0.247:0.0	.	301	Q6ZMB0	B3GN6_HUMAN	R	301	ENSP00000435352:H301R;ENSP00000346256:H301R	ENSP00000346256:H301R	H	+	2	0	B3GNT6	76429145	0.000000	0.05858	0.007000	0.13788	0.109000	0.19521	-0.871000	0.04223	0.080000	0.16959	0.374000	0.22700	CAC	.		0.756	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
GRAMD1B	57476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	123476178	123476178	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr11:123476178C>T	ENST00000529750.1	+	9	1213	c.886C>T	c.(886-888)Ccc>Tcc	p.P296S	GRAMD1B_ENST00000450171.2_5'Flank|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.P296S|GRAMD1B_ENST00000456860.2_Missense_Mutation_p.P303S	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	296						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CAGTGAGGCCCCCGTCTCGGT	0.557																																					p.P296S		.											.	GRAMD1B-69	0			c.C886T						.						142.0	149.0	147.0					11																	123476178		2083	4200	6283	SO:0001583	missense	57476	exon9			GAGGCCCCCGTCT	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.886C>T	11.37:g.123476178C>T	ENSP00000436500:p.Pro296Ser	Somatic	121	0		WXS	Illumina HiSeq	Phase_I	147	45	NM_020716	0	0	0	0	0	Q6UW85|Q9ULL9	Missense_Mutation	SNP	ENST00000529750.1	37	CCDS53720.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.911935	0.72983	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.30714	1.92;1.93;1.93;1.92;1.52	5.03	4.11	0.48088	.	0.000000	0.85682	D	0.000000	T	0.31009	0.0783	L	0.34521	1.04	0.58432	D	0.999998	P;P;D;B	0.57899	0.913;0.734;0.981;0.027	B;B;P;B	0.52109	0.424;0.356;0.69;0.065	T	0.02431	-1.1160	10	0.13470	T	0.59	.	13.3208	0.60432	0.0:0.9228:0.0:0.0772	.	256;303;296;303	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	S	303;303;296;296;256;292	ENSP00000402457:P303S;ENSP00000325628:P296S;ENSP00000436500:P296S;ENSP00000432987:P256S;ENSP00000434214:P292S	ENSP00000325628:P296S	P	+	1	0	GRAMD1B	122981388	0.994000	0.37717	0.842000	0.33263	0.898000	0.52572	3.919000	0.56439	1.112000	0.41740	0.305000	0.20034	CCC	.		0.557	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
CLEC2D	29121	broad.mit.edu;bcgsc.ca	37	12	9840539	9840539	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr12:9840539C>G	ENST00000290855.6	+	3	236	c.214C>G	c.(214-216)Caa>Gaa	p.Q72E	CLEC2D_ENST00000543300.1_Missense_Mutation_p.Q72E|CLEC2D_ENST00000261340.7_Missense_Mutation_p.Q72E|CLEC2D_ENST00000261339.6_Missense_Mutation_p.Q35E|CLEC2D_ENST00000545918.1_Missense_Mutation_p.Q35E	NM_013269.5	NP_037401.1	Q9UHP7	CLC2D_HUMAN	C-type lectin domain family 2, member D	72					cell surface receptor signaling pathway (GO:0007166)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)|stomach(1)	9						AGTATGTCTTCAAGCTGCATG	0.323																																					p.Q72E													.	CLEC2D-90	0			c.C214G						.						85.0	84.0	84.0					12																	9840539		2203	4300	6503	SO:0001583	missense	29121	exon3			TGTCTTCAAGCTG	AF133299	CCDS8602.1, CCDS31741.1, CCDS55800.1, CCDS55801.1, CCDS55802.1	12p13.31	2011-05-24	2005-09-29		ENSG00000069493	ENSG00000069493		"""C-type lectin domain containing"""	14351	protein-coding gene	gene with protein product	"""C-type lectin related f"", ""lectin-like transcript 1"""	605659	"""C-type lectin superfamily 2, member D"""				Standard	NM_013269		Approved	LLT1, CLAX, OCIL	uc001qwf.3	Q9UHP7	OTTHUMG00000168369	ENST00000290855.6:c.214C>G	12.37:g.9840539C>G	ENSP00000290855:p.Gln72Glu	Somatic	49	0		WXS	Illumina HiSeq	Phase_I	48	4	NM_001004419	0	0	18	18	0	D6CI39|D6CI40|D6CI41|Q6YID5|Q8WUP7|Q9HD37|Q9HD38	Missense_Mutation	SNP	ENST00000290855.6	37	CCDS8602.1	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.928952	0.00493	.	.	ENSG00000069493	ENST00000479410;ENST00000261340;ENST00000290855;ENST00000545918;ENST00000543300;ENST00000261339;ENST00000466035;ENST00000430909;ENST00000544322;ENST00000460309	T;T;T;T;T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;4.61;4.47;4.49;2.31;4.39	3.49	-3.81	0.04294	C-type lectin-like (1);	5.044330	0.01431	N	0.014751	T	0.03959	0.0111	N	0.00707	-1.245	0.09310	N	1	B;B;B	0.13145	0.004;0.007;0.004	B;B;B	0.13407	0.004;0.009;0.003	T	0.22591	-1.0212	9	.	.	.	-1.5275	1.3511	0.02173	0.3326:0.3404:0.1947:0.1323	.	72;72;72	Q9UHP7-5;Q9UHP7;Q9UHP7-3	.;CLC2D_HUMAN;.	E	30;72;72;35;72;35;29;51;46;15	ENSP00000442252:Q30E;ENSP00000261340:Q72E;ENSP00000290855:Q72E;ENSP00000444818:Q35E;ENSP00000443065:Q72E;ENSP00000261339:Q35E;ENSP00000446028:Q29E;ENSP00000413045:Q51E;ENSP00000437861:Q46E;ENSP00000443177:Q15E	.	Q	+	1	0	CLEC2D	9731806	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.558000	0.05978	-0.753000	0.04721	-0.450000	0.05554	CAA	.		0.323	CLEC2D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000335424.2	NM_013269	
B4GALNT1	2583	broad.mit.edu	37	12	58021430	58021430	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr12:58021430T>G	ENST00000341156.4	-	10	1939	c.1355A>C	c.(1354-1356)gAc>gCc	p.D452A	B4GALNT1_ENST00000418555.2_Missense_Mutation_p.D397A	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	452					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GAGGCGGGGGTCGAAACCGAC	0.697																																					p.S452S													.	B4GALNT1-514	0			c.C1355C						.						17.0	20.0	19.0					12																	58021430		2182	4277	6459	SO:0001583	missense	2583	exon10			CGGGGGTCGAAAC	M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.1355A>C	12.37:g.58021430T>G	ENSP00000341562:p.Asp452Ala	Somatic	70	13		WXS	Illumina HiSeq	Phase_I	163	44	NM_001478	0	0	1	1	0	B4DE26|Q8N636	Silent	SNP	ENST00000341156.4	37	CCDS8950.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	25.8|25.8	4.671033|4.671033	0.88348|0.88348	.|.	.|.	ENSG00000135454|ENSG00000135454	ENST00000341156;ENST00000418555|ENST00000547741	T;T|.	0.27104|.	1.69;1.69|.	4.5|4.5	4.5|4.5	0.54988|0.54988	.|.	0.117831|.	0.64402|.	D|.	0.000009|.	T|T	0.75824|0.75824	0.3902|0.3902	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.997;1.0|.	P;D|.	0.71870|.	0.888;0.975|.	T|T	0.78555|0.78555	-0.2159|-0.2159	10|5	0.87932|.	D|.	0|.	-12.617|-12.617	12.9089|12.9089	0.58169|0.58169	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	397;452|.	B4DE26;Q00973|.	.;B4GN1_HUMAN|.	A|P	452;397|135	ENSP00000341562:D452A;ENSP00000401601:D397A|.	ENSP00000341562:D452A|.	D|T	-|-	2|1	0|0	B4GALNT1|B4GALNT1	56307697|56307697	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.819000|0.819000	0.46315|0.46315	7.338000|7.338000	0.79269|0.79269	1.902000|1.902000	0.55061|0.55061	0.379000|0.379000	0.24179|0.24179	GAC|ACC	.		0.697	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407853.1	NM_001478	
CUX2	23316	broad.mit.edu	37	12	111757856	111757856	+	Silent	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr12:111757856C>T	ENST00000261726.6	+	17	2197	c.2043C>T	c.(2041-2043)aaC>aaT	p.N681N		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	681					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						GCATCGCCAACGGCACGACCC	0.711																																					p.N681N													.	CUX2-140	0			c.C2043T						.						3.0	4.0	4.0					12																	111757856		1882	3888	5770	SO:0001819	synonymous_variant	23316	exon17			CGCCAACGGCACG	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.2043C>T	12.37:g.111757856C>T		Somatic	16	0		WXS	Illumina HiSeq	Phase_I	77	5	NM_015267	0	0	0	0	0	A7E2Y4	Silent	SNP	ENST00000261726.6	37	CCDS41837.1																																																																																			.		0.711	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	
BRAP	8315	hgsc.bcm.edu;broad.mit.edu	37	12	112096635	112096635	+	Nonsense_Mutation	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr12:112096635G>A	ENST00000327551.6	-	9	1176	c.1036C>T	c.(1036-1038)Cga>Tga	p.R346*	BRAP_ENST00000539060.1_Nonsense_Mutation_p.R197*|BRAP_ENST00000419234.4_Nonsense_Mutation_p.R376*			Q6UWU4	CF089_HUMAN	BRCA1 associated protein	0					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	20						GCAACCAGTCGATGAACATAG	0.353																																					p.R376X	Pancreas(146;846 1904 7830 25130 26065)	.											.	BRAP-710	0			c.C1126T						.						129.0	119.0	122.0					12																	112096635		2203	4300	6503	SO:0001587	stop_gained	8315	exon9			CCAGTCGATGAAC	AF035620	CCDS9154.1	12q24.12	2014-09-11			ENSG00000089234	ENSG00000089234		"""RING-type (C3HC4) zinc fingers"""	1099	protein-coding gene	gene with protein product	"""impedes mitogenic signal propagation"", ""galectin-2-binding protein"""	604986				9497340, 19198608	Standard	XM_005253944		Approved	BRAP2, RNF52, IMP	uc001tsn.4	Q7Z569	OTTHUMG00000169600	ENST00000327551.6:c.1036C>T	12.37:g.112096635G>A	ENSP00000330813:p.Arg346*	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	80	5	NM_006768	0	0	4	4	0	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Nonsense_Mutation	SNP	ENST00000327551.6	37		.	.	.	.	.	.	.	.	.	.	G	36	5.951877	0.97139	.	.	ENSG00000089234	ENST00000419234;ENST00000539060;ENST00000327551;ENST00000547043	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1227	19.4174	0.94706	0.0:0.0:1.0:0.0	.	.	.	.	X	376;197;346;158	.	ENSP00000330813:R346X	R	-	1	2	BRAP	110581018	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.147000	0.94646	2.606000	0.88127	0.650000	0.86243	CGA	.		0.353	BRAP-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404994.2		
MED13L	23389	ucsc.edu	37	12	116428913	116428913	+	Silent	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr12:116428913C>T	ENST00000281928.3	-	17	4052	c.3846G>A	c.(3844-3846)ggG>ggA	p.G1282G		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1282						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CATACTGCCGCCCCTGCTCCA	0.512																																					p.G1282G													.	MED13L-232	0			c.G3846A						.						115.0	110.0	112.0					12																	116428913		2203	4300	6503	SO:0001819	synonymous_variant	23389	exon17			CTGCCGCCCCTGC	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.3846G>A	12.37:g.116428913C>T		Somatic	125	0		WXS	Illumina HiSeq		121	1	NM_015335	0	0	4	4	0	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Silent	SNP	ENST00000281928.3	37	CCDS9177.1																																																																																			.		0.512	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L													.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		Somatic	13	1		WXS	Illumina HiSeq	Phase_I	46	4	NM_080687	0	0	9	9	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
SEL1L	6400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	81969202	81969202	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr14:81969202C>T	ENST00000336735.4	-	6	756	c.640G>A	c.(640-642)Gca>Aca	p.A214T	SEL1L_ENST00000555824.1_Missense_Mutation_p.A214T	NM_005065.5	NP_005056.3	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like (C. elegans)	214	Interaction with ERLEC1, OS9 and SYVN1.				Notch signaling pathway (GO:0007219)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	28				BRCA - Breast invasive adenocarcinoma(234;0.0299)		TTCATGCTTGCTGCCTTTTGG	0.363																																					p.A214T		.											.	SEL1L-227	0			c.G640A						.						146.0	139.0	142.0					14																	81969202		2203	4300	6503	SO:0001583	missense	6400	exon6			TGCTTGCTGCCTT		CCDS9876.1, CCDS58333.1	14q31	2011-03-31	2001-11-28		ENSG00000071537	ENSG00000071537			10717	protein-coding gene	gene with protein product	"""sel-1 suppressor of lin-12-like 1 (C. elegans)"""	602329	"""sel-1 (suppressor of lin-12, C.elegans)-like"""			9417916, 10051412, 16331677	Standard	NM_005065		Approved	IBD2, SEL1L1	uc010tvv.2	Q9UBV2		ENST00000336735.4:c.640G>A	14.37:g.81969202C>T	ENSP00000337053:p.Ala214Thr	Somatic	61	0		WXS	Illumina HiSeq	Phase_I	79	22	NM_001244984	0	0	0	0	0	Q6UWT6|Q9P1T9|Q9UHK7	Missense_Mutation	SNP	ENST00000336735.4	37	CCDS9876.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191863	0.78902	.	.	ENSG00000071537	ENST00000336735;ENST00000555824	T;T	0.58940	0.35;0.3	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);	0.104952	0.64402	D	0.000004	T	0.71937	0.3399	M	0.66939	2.045	0.80722	D	1	D;D	0.67145	0.985;0.996	D;D	0.64042	0.92;0.921	T	0.74450	-0.3661	10	0.87932	D	0	.	14.4932	0.67665	0.1468:0.8532:0.0:0.0	.	214;214	Q9UBV2;Q9UBV2-2	SE1L1_HUMAN;.	T	214	ENSP00000337053:A214T;ENSP00000450709:A214T	ENSP00000337053:A214T	A	-	1	0	SEL1L	81038955	1.000000	0.71417	0.999000	0.59377	0.746000	0.42486	4.282000	0.58971	2.719000	0.93026	0.655000	0.94253	GCA	.		0.363	SEL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413325.1	NM_005065	
IGDCC3	9543	broad.mit.edu	37	15	65628245	65628245	+	Silent	SNP	A	A	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr15:65628245A>G	ENST00000327987.4	-	3	710	c.459T>C	c.(457-459)ggT>ggC	p.G153G	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	153	Ig-like C2-type 2.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GGGCCACACCACCCTCCTCAC	0.582																																					p.G153G													.	IGDCC3-93	0			c.T459C						.						117.0	102.0	107.0					15																	65628245		2201	4299	6500	SO:0001819	synonymous_variant	9543	exon3			CACACCACCCTCC	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.459T>C	15.37:g.65628245A>G		Somatic	185	1		WXS	Illumina HiSeq	Phase_I	171	4	NM_004884	0	0	0	0	0	O95215	Silent	SNP	ENST00000327987.4	37	CCDS10205.1																																																																																			.		0.582	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256826.1	NM_004884	
ACAN	176	broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	89398215	89398215	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr15:89398215C>T	ENST00000561243.1	+	11	2399	c.2399C>T	c.(2398-2400)tCc>tTc	p.S800F	ACAN_ENST00000439576.2_Missense_Mutation_p.S800F|ACAN_ENST00000352105.7_Missense_Mutation_p.S800F|ACAN_ENST00000559004.1_Missense_Mutation_p.S800F			P16112	PGCA_HUMAN	aggrecan	799	12 X 6 AA approximate tandem repeats of E-[GVE]-P-[SFY]-[APT]-[TSP].|KS.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GAGGAGCCATCCCCCTCAGAG	0.597																																					p.S800F													.	ACAN-25	0			c.C2399T						.						31.0	35.0	34.0					15																	89398215		1944	4139	6083	SO:0001583	missense	176	exon12			AGCCATCCCCCTC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2399C>T	15.37:g.89398215C>T	ENSP00000453342:p.Ser800Phe	Somatic	131	1		WXS	Illumina HiSeq	Phase_I	190	68	NM_001135	0	0	0	0	0	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	37	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	C	4.981	0.182251	0.09495	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02258	4.6;4.37	3.46	0.239	0.15484	.	.	.	.	.	T	0.01124	0.0037	N	0.04880	-0.145	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.49380	-0.8946	9	0.18710	T	0.47	.	4.3783	0.11281	0.0:0.3872:0.1663:0.4465	.	800;800	E7ENV9;E7EX88	.;.	F	800	ENSP00000387356:S800F;ENSP00000341615:S800F	ENSP00000268134:S800F	S	+	2	0	ACAN	87199219	0.000000	0.05858	0.000000	0.03702	0.195000	0.23768	-0.135000	0.10420	-0.205000	0.10219	0.411000	0.27672	TCC	.		0.597	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
PRSS41	360226	hgsc.bcm.edu	37	16	2848501	2848501	+	RNA	SNP	G	G	T	rs182642527|rs568540119	byFrequency	TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr16:2848501G>T	ENST00000399677.1	+	0	16				SNORA3_ENST00000408792.1_RNA			Q7RTY9	PRS41_HUMAN	protease, serine, 41							anchored component of membrane (GO:0031225)|intracellular organelle (GO:0043229)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)										CGCGCGCGGggcgctgctgct	0.796													G|||	140	0.0279553	0.025	0.0634	5008	,	,		9209	0.0546		0.0	False		,,,				2504	0.0082				p.A6S		.											.	.	0			c.G16T						.						3.0	7.0	6.0					16																	2848501		596	1375	1971			360226	exon1			CGCGGGGCGCTGC			16p13.3	2014-04-01			ENSG00000215148	ENSG00000215148		"""Serine peptidases / Serine peptidases"""	30715	other	unknown	"""testis serine protease 1"""					12838346	Standard	NM_001135086		Approved	TESSP1	uc010uwi.2	Q7RTY9	OTTHUMG00000128932		16.37:g.2848501G>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	15	14	NM_001135086	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399677.1	37																																																																																				G|0.965;T|0.035		0.796	PRSS41-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000436450.1	NM_183379	
MYBBP1A	10514	broad.mit.edu	37	17	4445773	4445773	+	Missense_Mutation	SNP	G	G	A	rs369018364		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr17:4445773G>A	ENST00000254718.4	-	22	3379	c.3073C>T	c.(3073-3075)Cgg>Tgg	p.R1025W	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.R1025W			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1025					cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						TGACGGGGCCGCACCGGGCCC	0.617																																					p.R1025W													.	MYBBP1A-92	0			c.C3073T						.	G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	70.0	79.0	76.0		3073,3073	3.2	0.5	17		76	0,8600		0,0,4300	no	missense,missense	MYBBP1A	NM_001105538.1,NM_014520.3	101,101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	1025/1333,1025/1329	4445773	1,13005	2203	4300	6503	SO:0001583	missense	10514	exon22			GGGGCCGCACCGG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3073C>T	17.37:g.4445773G>A	ENSP00000254718:p.Arg1025Trp	Somatic	106	0		WXS	Illumina HiSeq	Phase_I	89	4	NM_014520	0	0	6	6	0	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	ENST00000254718.4	37	CCDS11046.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165834	0.38217	2.27E-4	0.0	ENSG00000132382	ENST00000381556;ENST00000254718	T;T	0.68331	-0.32;-0.32	5.3	3.25	0.37280	Armadillo-type fold (1);	0.054052	0.64402	D	0.000001	T	0.77579	0.4151	M	0.67953	2.075	0.38604	D	0.950742	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77832	-0.2441	10	0.49607	T	0.09	-39.9853	10.7458	0.46179	0.0:0.0:0.6537:0.3463	.	1025;1025	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	W	1025	ENSP00000370968:R1025W;ENSP00000254718:R1025W	ENSP00000254718:R1025W	R	-	1	2	MYBBP1A	4392522	0.575000	0.26692	0.542000	0.28115	0.003000	0.03518	1.047000	0.30367	0.578000	0.29487	0.561000	0.74099	CGG	.		0.617	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
SUPT6H	6830	ucsc.edu	37	17	27002024	27002024	+	Missense_Mutation	SNP	G	G	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr17:27002024G>C	ENST00000314616.6	+	5	665	c.382G>C	c.(382-384)Gag>Cag	p.E128Q	SUPT6H_ENST00000347486.4_Missense_Mutation_p.E128Q|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	128	Asp/Glu-rich.|Interaction with IWS1. {ECO:0000250}.|Interaction with PAAF1.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GTCAGATGACGAGGACGATGA	0.498																																					p.E128Q													.	SUPT6H-93	0			c.G382C						.						84.0	78.0	80.0					17																	27002024		2203	4300	6503	SO:0001583	missense	6830	exon5			GATGACGAGGACG	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.382G>C	17.37:g.27002024G>C	ENSP00000319104:p.Glu128Gln	Somatic	241	1		WXS	Illumina HiSeq		303	1	NM_003170	0	0	0	9	9	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	37	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160827	0.57368	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.41	5.41	0.78517	.	0.098602	0.64402	D	0.000002	T	0.57446	0.2054	M	0.63843	1.955	0.53688	D	0.999971	P	0.49090	0.919	B	0.39503	0.301	T	0.63260	-0.6677	9	0.48119	T	0.1	-16.8028	19.558	0.95361	0.0:0.0:1.0:0.0	.	128	Q7KZ85	SPT6H_HUMAN	Q	128	.	ENSP00000319104:E128Q	E	+	1	0	SUPT6H	24026151	1.000000	0.71417	0.994000	0.49952	0.573000	0.36030	8.702000	0.91338	2.697000	0.92050	0.655000	0.94253	GAG	.		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
KIF19	124602	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	72340927	72340927	+	Silent	SNP	C	C	A	rs146234533		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr17:72340927C>A	ENST00000389916.4	+	7	748	c.610C>A	c.(610-612)Cgg>Agg	p.R204R		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	204	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GAAGGGGAACCGGCAGAGGAC	0.672																																					p.R204R													.	KIF19-90	0			c.C610A						.						34.0	38.0	37.0					17																	72340927		2199	4294	6493	SO:0001819	synonymous_variant	124602	exon7			GGGAACCGGCAGA	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.610C>A	17.37:g.72340927C>A		Somatic	151	2		WXS	Illumina HiSeq	Phase_I	204	53	NM_153209	0	0	0	0	0	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	ENST00000389916.4	37	CCDS32718.2																																																																																			C|1.000;T|0.000		0.672	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
BTBD2	55643	broad.mit.edu	37	19	1986958	1986958	+	Silent	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr19:1986958G>A	ENST00000255608.4	-	8	1303	c.1287C>T	c.(1285-1287)agC>agT	p.S429S	AC005306.3_ENST00000587498.1_RNA|AC005306.3_ENST00000588480.1_RNA	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	429						cytoplasmic mRNA processing body (GO:0000932)				endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGACGGTGTTGCTATCGGTGT	0.662																																					p.S429S													.	BTBD2-92	0			c.C1287T						.						73.0	83.0	80.0					19																	1986958		2203	4300	6503	SO:0001819	synonymous_variant	55643	exon8			GGTGTTGCTATCG	AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.1287C>T	19.37:g.1986958G>A		Somatic	103	0		WXS	Illumina HiSeq	Phase_I	98	3	NM_017797	0	0	111	121	10	O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Silent	SNP	ENST00000255608.4	37	CCDS12078.1																																																																																			.		0.662	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449300.2		
LSM14A	26065	broad.mit.edu	37	19	34710315	34710315	+	Silent	SNP	T	T	G	rs201741862		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr19:34710315T>G	ENST00000433627.5	+	7	876	c.801T>G	c.(799-801)gcT>gcG	p.A267A	LSM14A_ENST00000544216.3_Silent_p.A267A|LSM14A_ENST00000540746.2_Silent_p.A226A	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	267					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A267A(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CTCCTTCAGCTCCAAGGAGAG	0.438																																					p.A267A													.	LSM14A-91	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	c.T801G						.						64.0	74.0	71.0					19																	34710315		2203	4300	6503	SO:0001819	synonymous_variant	26065	exon7			TTCAGCTCCAAGG	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.801T>G	19.37:g.34710315T>G		Somatic	71	2		WXS	Illumina HiSeq	Phase_I	98	3	NM_001114093	0	0	9	9	0	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																			T|0.999;G|0.001		0.438	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
RYR1	6261	broad.mit.edu	37	19	38995663	38995663	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr19:38995663T>C	ENST00000359596.3	+	52	8252	c.8252T>C	c.(8251-8253)cTg>cCg	p.L2751P	RYR1_ENST00000355481.4_Missense_Mutation_p.L2751P|RYR1_ENST00000360985.3_Missense_Mutation_p.L2751P			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2751	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCGGAGAAGCTGGACTCCTTC	0.562																																					p.L2751P													.	RYR1-100	0			c.T8252C						.						87.0	83.0	85.0					19																	38995663		2203	4300	6503	SO:0001583	missense	6261	exon52			AGAAGCTGGACTC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.8252T>C	19.37:g.38995663T>C	ENSP00000352608:p.Leu2751Pro	Somatic	154	0		WXS	Illumina HiSeq	Phase_I	165	5	NM_001042723	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.236978	0.58886	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.93247	-3.19;-3.19;-3.19	4.38	4.38	0.52667	Ryanodine receptor Ryr (1);	0.000000	0.52532	U	0.000075	D	0.96956	0.9006	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97601	1.0123	10	0.87932	D	0	.	12.8832	0.58028	0.0:0.0:0.0:1.0	.	2751;2751	P21817-2;P21817	.;RYR1_HUMAN	P	2751	ENSP00000352608:L2751P;ENSP00000347667:L2751P;ENSP00000354254:L2751P	ENSP00000347667:L2751P	L	+	2	0	RYR1	43687503	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	7.890000	0.87313	1.744000	0.51775	0.402000	0.26972	CTG	.		0.562	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ZNF628	89887	hgsc.bcm.edu	37	19	55993264	55993264	+	Missense_Mutation	SNP	C	C	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr19:55993264C>T	ENST00000598519.1	+	3	1257	c.704C>T	c.(703-705)gCc>gTc	p.A235V	ZNF628_ENST00000391718.2_Missense_Mutation_p.A231V			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	235	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		ccgggtaccgcctccgcggcc	0.766																																					p.A235V		.											.	ZNF628-22	0			c.C704T						.						3.0	4.0	3.0					19																	55993264		1658	3351	5009	SO:0001583	missense	89887	exon3			GTACCGCCTCCGC	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.704C>T	19.37:g.55993264C>T	ENSP00000469591:p.Ala235Val	Somatic	1	0		WXS	Illumina HiSeq	Phase_I	7	5	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	.	.	.	.	.	.	.	.	.	.	.	7.048	0.563911	0.13498	.	.	ENSG00000197483	ENST00000391718	T	0.08807	3.05	3.0	1.93	0.25924	.	.	.	.	.	T	0.06325	0.0163	N	0.19112	0.55	0.09310	N	1	B	0.19445	0.036	B	0.24701	0.055	T	0.35919	-0.9769	9	0.54805	T	0.06	-3.6893	8.11	0.30909	0.0:0.7504:0.2496:0.0	.	231	Q5EBL2	ZN628_HUMAN	V	231	ENSP00000375598:A231V	ENSP00000375598:A231V	A	+	2	0	ZNF628	60685076	0.734000	0.28142	0.009000	0.14445	0.152000	0.21847	0.878000	0.28126	0.836000	0.34901	0.459000	0.35465	GCC	.		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
MTA3	57504	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	42886918	42886918	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr2:42886918C>A	ENST00000405094.1	+	8	618	c.618C>A	c.(616-618)ttC>ttA	p.F206L	MTA3_ENST00000407270.3_Missense_Mutation_p.F206L|MTA3_ENST00000405592.1_Missense_Mutation_p.F150L|MTA3_ENST00000406652.1_Missense_Mutation_p.F150L|MTA3_ENST00000406911.1_Missense_Mutation_p.F206L			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	206	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.					intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						TTGGGACATTCGCCAGAGCCC	0.413																																					p.F206L		.											.	MTA3-24	0			c.C618A						.						78.0	70.0	72.0					2																	42886918		1938	4145	6083	SO:0001583	missense	57504	exon8			GACATTCGCCAGA	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.618C>A	2.37:g.42886918C>A	ENSP00000385823:p.Phe206Leu	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	84	5	NM_020744	0	0	5	5	0	Q9NSP2|Q9ULF4	Missense_Mutation	SNP	ENST00000405094.1	37		.	.	.	.	.	.	.	.	.	.	C	16.73	3.205367	0.58234	.	.	ENSG00000057935	ENST00000405592;ENST00000406652;ENST00000407270;ENST00000282366;ENST00000406911;ENST00000405094	T;T;T;T;T	0.54866	0.55;0.55;0.61;0.59;0.57	4.96	-7.42	0.01388	.	0.000000	0.85682	D	0.000000	T	0.72645	0.3486	M	0.88105	2.93	0.50171	D	0.999857	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.988;0.994;0.999	T	0.80522	-0.1345	10	0.54805	T	0.06	-18.0256	20.3549	0.98835	0.0:0.0897:0.0:0.9103	.	206;206;150	E7EQY4;Q9BTC8-2;D6W5A2	.;.;.	L	150;150;206;206;206;206	ENSP00000383973:F150L;ENSP00000384249:F150L;ENSP00000385045:F206L;ENSP00000385241:F206L;ENSP00000385823:F206L	ENSP00000282366:F206L	F	+	3	2	MTA3	42740422	0.997000	0.39634	0.147000	0.22382	0.489000	0.33432	0.317000	0.19487	-1.514000	0.01786	-0.252000	0.11476	TTC	.		0.413	MTA3-017	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318159.1	NM_020744	
WDSUB1	151525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	160139417	160139417	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr2:160139417T>C	ENST00000409990.3	-	2	420	c.164A>G	c.(163-165)tAt>tGt	p.Y55C	WDSUB1_ENST00000392796.3_Missense_Mutation_p.Y55C|WDSUB1_ENST00000359774.4_Missense_Mutation_p.Y55C|WDSUB1_ENST00000358147.4_Missense_Mutation_p.Y55C|WDSUB1_ENST00000409124.1_Missense_Mutation_p.Y55C	NM_001128213.1	NP_001121685	Q8N9V3	WSDU1_HUMAN	WD repeat, sterile alpha motif and U-box domain containing 1	55							ubiquitin-protein transferase activity (GO:0004842)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|stomach(3)	16						GTGGACAGCATAGGTATGAAA	0.443																																					p.Y55C		.											.	WDSUB1-90	0			c.A164G						.						138.0	135.0	136.0					2																	160139417		2203	4300	6503	SO:0001583	missense	151525	exon2			ACAGCATAGGTAT	AK093494	CCDS2208.1	2q24.2	2013-01-28	2006-02-17	2005-03-25	ENSG00000196151	ENSG00000196151		"""WD repeat domain containing"", ""Sterile alpha motif (SAM) domain containing"", ""U-box domain containing"""	26697	protein-coding gene	gene with protein product			"""WD repeat and SAM domain containing 1"", ""WD repeat, SAM and U-box domain containing 1"""	WDSAM1		12477932	Standard	NM_152528		Approved	UBOX6, FLJ36175	uc002ual.4	Q8N9V3	OTTHUMG00000132028	ENST00000409990.3:c.164A>G	2.37:g.160139417T>C	ENSP00000387078:p.Tyr55Cys	Somatic	243	0		WXS	Illumina HiSeq	Phase_I	261	27	NM_152528	0	0	0	1	1	Q53TI9|Q8N6N8	Missense_Mutation	SNP	ENST00000409990.3	37	CCDS2208.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360032	0.82353	.	.	ENSG00000196151	ENST00000359774;ENST00000358147;ENST00000392796;ENST00000409990;ENST00000409124	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74359	0.3706	M	0.69185	2.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.76353	-0.2990	10	0.56958	D	0.05	.	15.6902	0.77446	0.0:0.0:0.0:1.0	.	55;55;55	Q8N9V3-2;B8ZZF2;Q8N9V3	.;.;WSDU1_HUMAN	C	55	ENSP00000352820:Y55C;ENSP00000350866:Y55C;ENSP00000376545:Y55C;ENSP00000387078:Y55C;ENSP00000386891:Y55C	ENSP00000350866:Y55C	Y	-	2	0	WDSUB1	159847663	1.000000	0.71417	0.989000	0.46669	0.987000	0.75469	7.910000	0.87451	2.115000	0.64714	0.528000	0.53228	TAT	.		0.443	WDSUB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333339.1	NM_152528	
SF3B1	23451	ucsc.edu	37	2	198270048	198270048	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr2:198270048T>C	ENST00000335508.6	-	10	1479	c.1388A>G	c.(1387-1389)aAt>aGt	p.N463S	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'Flank	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	463	Interaction with PPP1R8.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AAATGGAAGATTTCCAGATGG	0.343			Mis		myelodysplastic syndrome																																p.N463S				Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1-140	0			c.A1388G						.						53.0	56.0	55.0					2																	198270048		2203	4300	6503	SO:0001583	missense	23451	exon10			GGAAGATTTCCAG	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1388A>G	2.37:g.198270048T>C	ENSP00000335321:p.Asn463Ser	Somatic	136	0		WXS	Illumina HiSeq		185	1	NM_012433	0	0	0	5	5	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	37	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.663572	0.47572	.	.	ENSG00000115524	ENST00000335508	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.26666	0.0652	N	0.01109	-1.01	0.80722	D	1	B	0.09022	0.002	B	0.14023	0.01	T	0.13953	-1.0490	9	0.41790	T	0.15	.	15.7937	0.78388	0.0:0.0:0.0:1.0	.	463	O75533	SF3B1_HUMAN	S	463	.	ENSP00000335321:N463S	N	-	2	0	SF3B1	197978293	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.883000	0.87264	2.188000	0.69820	0.533000	0.62120	AAT	.		0.343	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
ING5	84289	broad.mit.edu	37	2	242664404	242664404	+	Splice_Site	SNP	G	G	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr2:242664404G>T	ENST00000313552.6	+	8	707	c.681G>T	c.(679-681)tgG>tgT	p.W227C	AC114730.11_ENST00000435195.1_RNA	NM_032329.4	NP_115705.2	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5	227					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|skin(1)	3		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		CTTGTCACAGGTTCTGTCCAC	0.622																																					p.W227C													.	.	0			c.G681T						.						104.0	100.0	102.0					2																	242664404		2203	4296	6499	SO:0001630	splice_region_variant	84289	exon8			TCACAGGTTCTGT	AF189286	CCDS33425.1	2q37.3	2013-01-28			ENSG00000168395	ENSG00000168395		"""Zinc fingers, PHD-type"""	19421	protein-coding gene	gene with protein product		608525				12750254	Standard	NM_032329		Approved	FLJ23842, p28ING5	uc002wcd.3	Q8WYH8	OTTHUMG00000151501	ENST00000313552.6:c.681-1G>T	2.37:g.242664404G>T		Somatic	80	0		WXS	Illumina HiSeq	Phase_I	114	5	NM_032329	0	0	0	0	0	A8K1P3|Q53NU6|Q57Z54|Q9BS30	Missense_Mutation	SNP	ENST00000313552.6	37	CCDS33425.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039152	0.75617	.	.	ENSG00000168395	ENST00000313552	D	0.92348	-3.02	4.8	4.8	0.61643	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	U	0.000000	D	0.98112	0.9377	H	0.99820	4.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99327	1.0908	9	.	.	.	.	15.0483	0.71844	0.0:0.0:1.0:0.0	.	227	Q8WYH8	ING5_HUMAN	C	227	ENSP00000322142:W227C	.	W	+	3	0	ING5	242313077	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	6.130000	0.71663	2.217000	0.71921	0.551000	0.68910	TGG	.		0.622	ING5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322901.3	NM_032329	Missense_Mutation
SLCO4A1	28231	broad.mit.edu	37	20	61288357	61288357	+	Missense_Mutation	SNP	C	C	T	rs559448067		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr20:61288357C>T	ENST00000370507.1	+	1	647	c.551C>T	c.(550-552)tCg>tTg	p.S184L	SLCO4A1_ENST00000217159.1_Missense_Mutation_p.S184L			Q96BD0	SO4A1_HUMAN	solute carrier organic anion transporter family, member 4A1	184					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(3)|prostate(2)	21	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;2.33e-06)		Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GGCACGGGGTCGCTGGTGTTC	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		16738	0.0		0.001	False		,,,				2504	0.0				p.S184L	Pancreas(168;741 2006 10379 40139 45334)												.	SLCO4A1-91	0			c.C551T						.						44.0	40.0	41.0					20																	61288357		2202	4298	6500	SO:0001583	missense	28231	exon2			CGGGGTCGCTGGT	AB031051	CCDS13501.1	20q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000101187	ENSG00000101187		"""Solute carriers"""	10953	protein-coding gene	gene with protein product		612436	"""solute carrier family 21 (organic anion transporter), member 12"""	SLC21A12		10873595	Standard	NM_016354		Approved	OATP-E, OATP4A1	uc002ydb.1	Q96BD0	OTTHUMG00000032923	ENST00000370507.1:c.551C>T	20.37:g.61288357C>T	ENSP00000359538:p.Ser184Leu	Somatic	27	0		WXS	Illumina HiSeq	Phase_I	121	4	NM_016354	0	0	2	2	0	Q9H4T7|Q9H4T8|Q9H8P2|Q9NWX8|Q9UI35|Q9UIG7	Missense_Mutation	SNP	ENST00000370507.1	37	CCDS13501.1	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748817	0.69533	.	.	ENSG00000101187	ENST00000217159;ENST00000370512;ENST00000370507;ENST00000342674	T;T	0.44881	0.91;0.91	4.58	4.58	0.56647	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	M	0.89840	3.065	0.80722	D	1	D	0.56968	0.978	P	0.58077	0.832	T	0.77062	-0.2727	10	0.66056	D	0.02	.	17.3394	0.87291	0.0:1.0:0.0:0.0	.	184	Q96BD0	SO4A1_HUMAN	L	184	ENSP00000217159:S184L;ENSP00000359538:S184L	ENSP00000217159:S184L	S	+	2	0	SLCO4A1	60758802	1.000000	0.71417	0.689000	0.30133	0.027000	0.11550	5.827000	0.69300	2.085000	0.62840	0.462000	0.41574	TCG	.		0.692	SLCO4A1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080048.2	NM_016354	
TOP3B	8940	broad.mit.edu	37	22	22318552	22318552	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr22:22318552T>G	ENST00000398793.2	-	10	1513	c.1079A>C	c.(1078-1080)cAc>cCc	p.H360P	TOP3B_ENST00000413067.2_Missense_Mutation_p.H89P|TOP3B_ENST00000357179.5_Missense_Mutation_p.H360P	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	360					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CCAGTAGGGGTGGTTGGCCTG	0.622																																					p.H360P													.	TOP3B-538	0			c.A1079C						.						107.0	91.0	96.0					22																	22318552		2203	4300	6503	SO:0001583	missense	8940	exon10			TAGGGGTGGTTGG	AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1079A>C	22.37:g.22318552T>G	ENSP00000381773:p.His360Pro	Somatic	124	8		WXS	Illumina HiSeq	Phase_I	133	12	NM_003935	0	0	0	0	0	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	ENST00000398793.2	37	CCDS13797.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.23|17.23	3.336332|3.336332	0.60963|0.60963	.|.	.|.	ENSG00000100038|ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000413067|ENST00000457270	T;T;T|.	0.21932|.	1.98;1.98;1.98|.	5.05|5.05	5.05|5.05	0.67936|0.67936	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 3 (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);|.	0.134123|.	0.64402|.	D|.	0.000003|.	T|T	0.79387|0.79387	0.4437|0.4437	M|M	0.86864|0.86864	2.845|2.845	0.41223|0.41223	D|D	0.986527|0.986527	P;P|.	0.38565|.	0.637;0.584|.	B;B|.	0.40101|.	0.319;0.213|.	T|T	0.83056|0.83056	-0.0150|-0.0150	10|5	0.52906|.	T|.	0.07|.	.|.	14.9623|14.9623	0.71166|0.71166	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	360;360|.	O95985;O95985-2|.	TOP3B_HUMAN;.|.	P|P	360;360;89|155	ENSP00000349705:H360P;ENSP00000381773:H360P;ENSP00000393118:H89P|.	ENSP00000349705:H360P|.	H|T	-|-	2|1	0|0	TOP3B|TOP3B	20648552|20648552	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	2.975000|2.975000	0.49281|0.49281	2.122000|2.122000	0.65172|0.65172	0.459000|0.459000	0.35465|0.35465	CAC|ACC	.		0.622	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320251.1	NM_003935	
POMGNT2	84892	broad.mit.edu	37	3	43121560	43121560	+	Missense_Mutation	SNP	G	G	A	rs368757710		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr3:43121560G>A	ENST00000344697.2	-	2	1709	c.1364C>T	c.(1363-1365)cCg>cTg	p.P455L	POMGNT2_ENST00000441964.1_Missense_Mutation_p.P455L	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	455					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										AATGAGGGACGGGATGTCCAC	0.612																																					p.P455L													.	.	0			c.C1364T						.	G	LEU/PRO	0,4406		0,0,2203	40.0	40.0	40.0		1364	4.6	0.3	3		40	1,8599	1.2+/-3.3	0,1,4299	no	missense	C3orf39	NM_032806.4	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	455/581	43121560	1,13005	2203	4300	6503	SO:0001583	missense	84892	exon2			AGGGACGGGATGT	AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1364C>T	3.37:g.43121560G>A	ENSP00000344125:p.Pro455Leu	Somatic	140	0		WXS	Illumina HiSeq	Phase_I	145	3	NM_032806	0	0	0	0	0	B3KWC3|Q96SY3	Missense_Mutation	SNP	ENST00000344697.2	37	CCDS2709.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514589	0.44763	0.0	1.16E-4	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.78003	-1.14;-1.14	5.53	4.56	0.56223	.	0.180058	0.49916	D	0.000134	T	0.77505	0.4140	M	0.78456	2.415	0.58432	D	0.999992	B	0.22003	0.063	B	0.19148	0.024	T	0.75091	-0.3440	10	0.52906	T	0.07	-28.5664	13.1243	0.59344	0.083:0.0:0.917:0.0	.	455	Q8NAT1	AGO61_HUMAN	L	455	ENSP00000408992:P455L;ENSP00000344125:P455L	ENSP00000344125:P455L	P	-	2	0	C3orf39	43096564	1.000000	0.71417	0.317000	0.25265	0.982000	0.71751	5.425000	0.66470	1.184000	0.42957	0.650000	0.86243	CCG	.		0.612	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256643.1	NM_032806	
ETV5	2119	broad.mit.edu	37	3	185797720	185797720	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr3:185797720T>G	ENST00000306376.5	-	7	782	c.536A>C	c.(535-537)cAt>cCt	p.H179P	ETV5_ENST00000434744.1_Missense_Mutation_p.H179P|ETV5_ENST00000537818.1_Missense_Mutation_p.H221P|ETV5-AS1_ENST00000453370.1_RNA	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	179					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TGGAAGCGAATGGGGGGCGGG	0.617			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.H179P				Dom	yes		3	3q28	2119	ets variant gene 5		E	.	ETV5-706	0			c.A536C						.						54.0	61.0	59.0					3																	185797720		2203	4300	6503	SO:0001583	missense	2119	exon7			AGCGAATGGGGGG	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.536A>C	3.37:g.185797720T>G	ENSP00000306894:p.His179Pro	Somatic	63	6		WXS	Illumina HiSeq	Phase_I	51	8	NM_004454	0	0	0	0	0	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	37	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	T	11.00	1.509461	0.27036	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.10860	2.86;2.86;2.83	5.32	5.32	0.75619	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.445754	0.24894	N	0.034741	T	0.12135	0.0295	N	0.25647	0.755	0.44123	D	0.996905	B;D	0.54207	0.0;0.965	B;P	0.49451	0.001;0.611	T	0.15206	-1.0445	10	0.28530	T	0.3	.	12.7886	0.57520	0.0:0.0:0.0:1.0	.	179;221	P41161;B7Z7D7	ETV5_HUMAN;.	P	179;179;221	ENSP00000306894:H179P;ENSP00000413755:H179P;ENSP00000441737:H221P	ENSP00000306894:H179P	H	-	2	0	ETV5	187280414	0.997000	0.39634	0.611000	0.29010	0.524000	0.34500	3.006000	0.49529	2.009000	0.58944	0.460000	0.39030	CAT	.		0.617	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
MUC4	4585	bcgsc.ca	37	3	195512213	195512213	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr3:195512213G>A	ENST00000463781.3	-	2	6697	c.6238C>T	c.(6238-6240)Cct>Tct	p.P2080S	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P2080S	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAAGAAGAGGGGTGGCGTGA	0.572																																					p.P2080S													.	MUC4-90	0			c.C6238T						.						19.0	21.0	20.0					3																	195512213		686	1573	2259	SO:0001583	missense	4585	exon2			GAAGAGGGGTGGC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6238C>T	3.37:g.195512213G>A	ENSP00000417498:p.Pro2080Ser	Somatic	491	11		WXS	Illumina HiSeq	Phase_1	497	25	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	4.791	0.147050	0.09134	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29655	1.59;1.56	.	.	.	.	.	.	.	.	T	0.09423	0.0232	N	0.02539	-0.55	0.09310	N	1	B	0.15141	0.012	B	0.01281	0.0	T	0.33317	-0.9873	7	.	.	.	.	2.8356	0.05513	3.0E-4:2.0E-4:0.5012:0.4983	.	2080	E7ESK3	.	S	2080	ENSP00000417498:P2080S;ENSP00000420243:P2080S	.	P	-	1	0	MUC4	196996608	0.000000	0.05858	0.053000	0.19242	0.072000	0.16883	-3.060000	0.00624	0.064000	0.16427	0.064000	0.15345	CCT	.		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DOK7	285489	broad.mit.edu	37	4	3494664	3494664	+	Silent	SNP	A	A	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr4:3494664A>C	ENST00000340083.5	+	7	1016	c.951A>C	c.(949-951)ccA>ccC	p.P317P	DOK7_ENST00000512714.1_3'UTR|DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000389653.2_Silent_p.P317P	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	317	Ser-rich.				neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CCTCAAGGCCACCCCCCAAGC	0.692																																					p.P317P													.	DOK7-91	0			c.A951C						.						7.0	8.0	7.0					4																	3494664		2122	4167	6289	SO:0001819	synonymous_variant	285489	exon7			AAGGCCACCCCCC	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.951A>C	4.37:g.3494664A>C		Somatic	30	2		WXS	Illumina HiSeq	Phase_I	134	39	NM_173660	0	0	0	0	0	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Silent	SNP	ENST00000340083.5	37	CCDS3370.2																																																																																			.		0.692	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
BST1	683	hgsc.bcm.edu	37	4	15704874	15704874	+	Missense_Mutation	SNP	G	G	C	rs2302468	byFrequency	TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr4:15704874G>C	ENST00000265016.4	+	1	302	c.107G>C	c.(106-108)gGg>gCg	p.G36A	BST1_ENST00000382346.3_Missense_Mutation_p.G36A	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	36				G -> A (in Ref. 1; BAA04885). {ECO:0000305}.	humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						cggtggcgcggggAGGGCACC	0.736													G|||	381	0.0760783	0.0212	0.0389	5008	,	,		9714	0.2103		0.008	False		,,,				2504	0.1084				p.G36A		.											.	BST1-90	0			c.G107C						.	G	ALA/GLY	23,3787		0,23,1882	3.0	4.0	4.0		107	3.4	1.0	4	dbSNP_100	4	19,7693		0,19,3837	no	missense	BST1	NM_004334.2	60	0,42,5719	CC,CG,GG		0.2464,0.6037,0.3645	possibly-damaging	36/319	15704874	42,11480	1905	3856	5761	SO:0001583	missense	683	exon1			GGCGCGGGGAGGG	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.107G>C	4.37:g.15704874G>C	ENSP00000265016:p.Gly36Ala	Somatic	2	0		WXS	Illumina HiSeq	Phase_I	18	7	NM_004334	0	0	0	0	0	B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	ENST00000265016.4	37	CCDS3416.1	141	0.06456043956043957	13	0.026422764227642278	10	0.027624309392265192	112	0.1958041958041958	6	0.0079155672823219	G	14.40	2.524166	0.44866	0.006037	0.002464	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.17370	2.28;2.28	3.39	3.39	0.38822	.	0.510528	0.20699	N	0.087320	T	0.00039	0.0001	M	0.63843	1.955	0.36618	P	0.12441999999999998	D	0.76494	0.999	D	0.80764	0.994	T	0.04005	-1.0985	9	0.62326	D	0.03	-9.3919	10.4016	0.44233	0.0:0.0:1.0:0.0	rs2302468	36	Q10588	BST1_HUMAN	A	36	ENSP00000265016:G36A;ENSP00000371783:G36A	ENSP00000265016:G36A	G	+	2	0	BST1	15313972	0.859000	0.29813	0.955000	0.39395	0.020000	0.10135	2.992000	0.49417	1.879000	0.54435	0.462000	0.41574	GGG	G|0.084;C|0.916		0.736	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214968.2	NM_004334	
WDFY3	23001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	85675021	85675021	+	Silent	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr4:85675021T>C	ENST00000295888.4	-	35	5975	c.5568A>G	c.(5566-5568)caA>caG	p.Q1856Q	WDFY3_ENST00000322366.6_Silent_p.Q1856Q	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1856					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTTCTTCTGATTGCCAAGGCT	0.403																																					p.Q1856Q		.											.	WDFY3-93	0			c.A5568G						.						89.0	80.0	83.0					4																	85675021		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon35			TTCTGATTGCCAA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5568A>G	4.37:g.85675021T>C		Somatic	127	0		WXS	Illumina HiSeq	Phase_I	145	39	NM_014991	0	0	0	0	0	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	CCDS3609.1																																																																																			.		0.403	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
MTRR	4552	broad.mit.edu	37	5	7878351	7878351	+	Silent	SNP	A	A	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr5:7878351A>C	ENST00000264668.2	+	5	807	c.777A>C	c.(775-777)gtA>gtC	p.V259V	MTRR_ENST00000341013.6_3'UTR|MTRR_ENST00000440940.2_Silent_p.V232V	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	259	Hinge.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	CCCGTTCGGTACCCCCACTCT	0.443																																					p.V259V													.	MTRR-91	0			c.A777C						.						130.0	134.0	133.0					5																	7878351		2203	4300	6503	SO:0001819	synonymous_variant	4552	exon5			TTCGGTACCCCCA	AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.777A>C	5.37:g.7878351A>C		Somatic	99	16		WXS	Illumina HiSeq	Phase_I	96	12	NM_024010	0	0	2	2	0	O60471|Q32MA9|Q7Z4M8	Silent	SNP	ENST00000264668.2	37	CCDS3874.1																																																																																			.		0.443	MTRR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206931.1		
SNX2	6643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	122154607	122154607	+	Silent	SNP	T	T	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr5:122154607T>G	ENST00000379516.2	+	11	1209	c.1101T>G	c.(1099-1101)ctT>ctG	p.L367L	SNX2_ENST00000510372.1_3'UTR|SNX2_ENST00000514949.1_Silent_p.L250L	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	367					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		TGTCTCAGCTTGCAGAGGTTG	0.393																																					p.L367L		.											.	SNX2-226	0			c.T1101G						.						124.0	117.0	119.0					5																	122154607		2203	4300	6503	SO:0001819	synonymous_variant	6643	exon11			TCAGCTTGCAGAG	AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.1101T>G	5.37:g.122154607T>G		Somatic	100	0		WXS	Illumina HiSeq	Phase_I	123	7	NM_003100	0	0	14	19	5	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Silent	SNP	ENST00000379516.2	37	CCDS34217.1																																																																																			.		0.393	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371392.1	NM_003100	
ARHGAP26	23092	broad.mit.edu	37	5	142281554	142281554	+	Missense_Mutation	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr5:142281554G>A	ENST00000274498.4	+	7	1030	c.652G>A	c.(652-654)Gcc>Acc	p.A218T	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.A218T	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	218					actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTACGAACTGGCCAAGGATTT	0.443																																					p.A218T													.	ARHGAP26-660	0			c.G652A						.						161.0	138.0	146.0					5																	142281554		2203	4300	6503	SO:0001583	missense	23092	exon7			GAACTGGCCAAGG	AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.652G>A	5.37:g.142281554G>A	ENSP00000274498:p.Ala218Thr	Somatic	224	0		WXS	Illumina HiSeq	Phase_I	233	4	NM_015071	0	0	0	0	0	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	ENST00000274498.4	37	CCDS4277.1	.	.	.	.	.	.	.	.	.	.	G	32	5.135201	0.94517	.	.	ENSG00000145819	ENST00000274498;ENST00000378004	T;T	0.04275	3.66;3.66	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.19287	0.0463	M	0.66506	2.035	0.80722	D	1	D;P	0.63880	0.993;0.729	D;P	0.67103	0.949;0.544	T	0.01334	-1.1382	10	0.21540	T	0.41	.	19.6157	0.95633	0.0:0.0:1.0:0.0	.	218;218	Q9UNA1;Q9UNA1-2	RHG26_HUMAN;.	T	218	ENSP00000274498:A218T;ENSP00000367243:A218T	ENSP00000274498:A218T	A	+	1	0	ARHGAP26	142261738	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.739000	0.93911	0.563000	0.77884	GCC	.		0.443	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132744.3	NM_015071	
NKX2-5	1482	broad.mit.edu	37	5	172659730	172659730	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr5:172659730C>A	ENST00000329198.4	-	2	1090	c.817G>T	c.(817-819)Gct>Tct	p.A273S		NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	273	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCGGGGTAAGCGGCAGTGCAG	0.672																																					p.A273S	Esophageal Squamous(72;810 1219 2387 13420 44943)												.	NKX2-5-90	0			c.G817T						.						11.0	13.0	12.0					5																	172659730		2196	4286	6482	SO:0001583	missense	1482	exon2			GGTAAGCGGCAGT	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.817G>T	5.37:g.172659730C>A	ENSP00000327758:p.Ala273Ser	Somatic	68	0		WXS	Illumina HiSeq	Phase_I	224	13	NM_004387	0	0	0	0	0	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	37	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	C	6.919	0.539183	0.13250	.	.	ENSG00000183072	ENST00000329198	D	0.89810	-2.57	4.07	4.07	0.47477	.	.	.	.	.	T	0.70535	0.3235	N	0.02960	-0.455	0.80722	D	1	B	0.25743	0.133	B	0.19391	0.025	T	0.68062	-0.5508	9	0.06625	T	0.88	.	11.6143	0.51080	0.0:1.0:0.0:0.0	.	273	P52952	NKX25_HUMAN	S	273	ENSP00000327758:A273S	ENSP00000327758:A273S	A	-	1	0	NKX2-5	172592336	0.895000	0.30542	0.787000	0.31911	0.085000	0.17905	1.416000	0.34759	2.083000	0.62718	0.542000	0.68232	GCT	.		0.672	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
SERPINB6	5269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	2955761	2955761	+	Silent	SNP	G	G	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr6:2955761G>C	ENST00000380520.1	-	2	2303	c.309C>G	c.(307-309)ctC>ctG	p.L103L	SERPINB6_ENST00000380529.1_Silent_p.L103L|SERPINB6_ENST00000380524.1_Silent_p.L103L|SERPINB6_ENST00000380539.1_Silent_p.L103L|SERPINB6_ENST00000335686.5_Silent_p.L103L|SERPINB6_ENST00000380546.3_Silent_p.L103L			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	103					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	GACTTACTGAGAGGAAATCAC	0.493																																					p.L122L		.											.	SERPINB6-226	0			c.C366G						.						78.0	78.0	78.0					6																	2955761		2203	4300	6503	SO:0001819	synonymous_variant	5269	exon3			TACTGAGAGGAAA	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.309C>G	6.37:g.2955761G>C		Somatic	88	0		WXS	Illumina HiSeq	Phase_I	94	9	NM_001271823	0	0	0	0	0	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Silent	SNP	ENST00000380520.1	37	CCDS4479.1																																																																																			.		0.493	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043422.1		
SRRT	51593	broad.mit.edu	37	7	100482130	100482130	+	Missense_Mutation	SNP	G	G	A	rs140745082		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr7:100482130G>A	ENST00000347433.4	+	7	1057	c.899G>A	c.(898-900)cGc>cAc	p.R300H	SRRT_ENST00000457580.2_Missense_Mutation_p.R300H|SRRT_ENST00000388793.4_Missense_Mutation_p.R300H|SRRT_ENST00000432932.1_Missense_Mutation_p.R300H			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	300	Glu-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GACGGGGAGCGCAAAACCAAC	0.637																																					p.R300H													.	SRRT-92	0			c.G899A						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4404		0,0,2202	49.0	51.0	51.0		899,899,899,899	3.9	1.0	7	dbSNP_134	51	3,8595	3.0+/-9.4	0,3,4296	yes	missense,missense,missense,missense	SRRT	NM_001128852.1,NM_001128853.1,NM_001128854.1,NM_015908.5	29,29,29,29	0,3,6498	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	300/876,300/873,300/872,300/877	100482130	3,12999	2202	4299	6501	SO:0001583	missense	51593	exon7			GGGAGCGCAAAAC		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.899G>A	7.37:g.100482130G>A	ENSP00000314491:p.Arg300His	Somatic	191	0		WXS	Illumina HiSeq	Phase_I	199	6	NM_001128853	0	0	30	30	0	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	ENST00000347433.4	37	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021553	0.35701	0.0	3.49E-4	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433	T;T	0.17691	2.26;2.26	3.91	3.91	0.45181	.	0.231821	0.36555	N	0.002525	T	0.17831	0.0428	N	0.14661	0.345	0.38836	D	0.955963	D;D;D;D	0.69078	0.997;0.997;0.997;0.995	P;P;P;P	0.56343	0.796;0.796;0.796;0.63	T	0.04885	-1.0920	10	0.42905	T	0.14	.	11.5862	0.50920	0.0:0.0:1.0:0.0	.	300;300;300;300	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	H	300	ENSP00000416553:R300H;ENSP00000314491:R300H	ENSP00000314491:R300H	R	+	2	0	SRRT	100320066	0.917000	0.31117	0.999000	0.59377	0.004000	0.04260	4.689000	0.61723	2.203000	0.70933	0.491000	0.48974	CGC	G|1.000;A|0.000		0.637	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
SGK223	157285	broad.mit.edu	37	8	8239069	8239069	+	Missense_Mutation	SNP	C	C	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr8:8239069C>A	ENST00000520004.1	-	2	453	c.189G>T	c.(187-189)agG>agT	p.R63S	SGK223_ENST00000330777.4_Missense_Mutation_p.R63S			Q86YV5	SG223_HUMAN		63							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AGTTCTCAGGCCTGGGAGGCA	0.657																																					p.R63S	GBM(34;731 755 10259 33573 33867)												.	.	0			c.G189T						.						48.0	49.0	49.0					8																	8239069		2004	4157	6161	SO:0001583	missense	0	exon1			CTCAGGCCTGGGA																												ENST00000520004.1:c.189G>T	8.37:g.8239069C>A	ENSP00000428054:p.Arg63Ser	Somatic	55	1		WXS	Illumina HiSeq	Phase_I	117	9	NM_001080826	0	0	0	0	0	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236881	0.39498	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.59083	0.29;0.29	4.49	2.69	0.31865	.	0.226672	0.30658	N	0.009160	T	0.41696	0.1170	L	0.38531	1.155	0.27832	N	0.941416	B	0.31968	0.349	B	0.24701	0.055	T	0.44802	-0.9304	10	0.72032	D	0.01	.	8.2345	0.31618	0.0:0.7459:0.0:0.2541	.	63	Q86YV5	SG223_HUMAN	S	63	ENSP00000330930:R63S;ENSP00000428054:R63S	ENSP00000330930:R63S	R	-	3	2	AC068353.1	8276479	1.000000	0.71417	0.887000	0.34795	0.775000	0.43874	0.980000	0.29513	1.272000	0.44329	-0.230000	0.12252	AGG	.		0.657	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
TERF1	7013	broad.mit.edu;bcgsc.ca	37	8	73926211	73926211	+	Missense_Mutation	SNP	C	C	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr8:73926211C>G	ENST00000276603.5	+	2	424	c.401C>G	c.(400-402)gCa>gGa	p.A134G	TERF1_ENST00000276602.6_Missense_Mutation_p.A134G	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	134	TRFH dimerization.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			AGAATTGCAGCAGGAAAAACC	0.318																																					p.A134G													.	TERF1-228	0			c.C401G						.						57.0	61.0	60.0					8																	73926211		2200	4298	6498	SO:0001583	missense	7013	exon2			TTGCAGCAGGAAA	U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.401C>G	8.37:g.73926211C>G	ENSP00000276603:p.Ala134Gly	Somatic	283	0		WXS	Illumina HiSeq	Phase_I	251	7	NM_017489	0	0	0	0	0	A7XP29|Q15553|Q8NHT6|Q93029	Missense_Mutation	SNP	ENST00000276603.5	37	CCDS6211.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.904898	0.33628	.	.	ENSG00000147601	ENST00000276603;ENST00000276602;ENST00000517390;ENST00000538958	.	.	.	5.24	3.15	0.36227	Telomere repeat-binding factor, dimerisation domain (4);	0.401124	0.26840	N	0.022235	T	0.30572	0.0769	L	0.44542	1.39	0.23198	N	0.998131	P;P	0.49090	0.701;0.919	B;P	0.45753	0.205;0.492	T	0.12682	-1.0538	9	0.51188	T	0.08	.	5.681	0.17776	0.2799:0.6202:0.0:0.0999	.	134;134	P54274-2;P54274	.;TERF1_HUMAN	G	134;134;30;30	.	ENSP00000276602:A134G	A	+	2	0	TERF1	74088765	1.000000	0.71417	0.942000	0.38095	0.753000	0.42808	2.151000	0.42263	1.353000	0.45828	0.313000	0.20887	GCA	.		0.318	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379093.1	NM_017489	
NBN	4683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	90967743	90967743	+	Missense_Mutation	SNP	T	T	C			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr8:90967743T>C	ENST00000265433.3	-	10	1319	c.1165A>G	c.(1165-1167)Atg>Gtg	p.M389V	NBN_ENST00000409330.1_Missense_Mutation_p.M307V	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	389	Interaction with MTOR, MAPKAP1 and RICTOR.				blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			TTTTGTTCCATTTTGGAGACT	0.338								Homologous recombination																													p.M389V		.											.	NBN-1395	0			c.A1165G						.						104.0	98.0	100.0					8																	90967743		2203	4300	6503	SO:0001583	missense	4683	exon10			GTTCCATTTTGGA	AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.1165A>G	8.37:g.90967743T>C	ENSP00000265433:p.Met389Val	Somatic	35	0		WXS	Illumina HiSeq	Phase_I	42	14	NM_002485	0	0	0	3	3	B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Missense_Mutation	SNP	ENST00000265433.3	37	CCDS6249.1	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.453422	0.01071	.	.	ENSG00000104320	ENST00000265433;ENST00000409330;ENST00000452387	T;T	0.56941	2.1;0.43	5.45	-1.76	0.08006	.	0.952676	0.09006	N	0.862316	T	0.20659	0.0497	N	0.05383	-0.06	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24119	-1.0169	10	0.02654	T	1	3.3137	1.3277	0.02128	0.1323:0.1639:0.2892:0.4145	.	389;389	A6H8Y5;O60934	.;NBN_HUMAN	V	389;307;389	ENSP00000265433:M389V;ENSP00000386924:M307V	ENSP00000265433:M389V	M	-	1	0	NBN	91036919	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.078000	0.14761	-0.233000	0.09797	-0.321000	0.08615	ATG	.		0.338	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331583.3	NM_001024688	
FREM1	158326	broad.mit.edu	37	9	14770686	14770686	+	Nonsense_Mutation	SNP	G	G	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr9:14770686G>T	ENST00000380880.3	-	26	5759	c.4976C>A	c.(4975-4977)tCa>tAa	p.S1659*	FREM1_ENST00000380894.1_Nonsense_Mutation_p.S195*|FREM1_ENST00000422223.2_Nonsense_Mutation_p.S1659*|FREM1_ENST00000486223.1_5'UTR|FREM1_ENST00000380881.4_Nonsense_Mutation_p.S1660*			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1659					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		GTCAGGGTCTGATGCCTTCAA	0.478																																					p.S1659X													.	FREM1-138	0			c.C4976A						.						145.0	137.0	139.0					9																	14770686		1971	4155	6126	SO:0001587	stop_gained	158326	exon27			GGGTCTGATGCCT	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.4976C>A	9.37:g.14770686G>T	ENSP00000370262:p.Ser1659*	Somatic	169	1		WXS	Illumina HiSeq	Phase_I	175	4	NM_144966	0	0	0	0	0	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Nonsense_Mutation	SNP	ENST00000380880.3	37	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189900	0.57909	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880;ENST00000380892	.	.	.	5.8	4.9	0.64082	.	0.372091	0.28712	N	0.014390	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-3.8618	11.5807	0.50889	0.136:0.0:0.864:0.0	.	.	.	.	X	1660;1659;195;1659;72	.	ENSP00000370262:S1659X	S	-	2	0	FREM1	14760686	0.648000	0.27313	0.054000	0.19295	0.348000	0.29142	2.486000	0.45259	2.743000	0.94032	0.650000	0.86243	TCA	.		0.478	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	
TAF1L	138474	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	32633310	32633310	+	Silent	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr9:32633310G>A	ENST00000242310.4	-	1	2357	c.2268C>T	c.(2266-2268)ggC>ggT	p.G756G	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	756					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GCAGTAATTGGCCAGGATGGA	0.443																																					p.G756G		.											.	TAF1L-870	0			c.C2268T						.						184.0	180.0	182.0					9																	32633310		2203	4300	6503	SO:0001819	synonymous_variant	138474	exon1			TAATTGGCCAGGA	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2268C>T	9.37:g.32633310G>A		Somatic	254	0		WXS	Illumina HiSeq	Phase_I	254	20	NM_153809	0	0	0	0	0	Q0VG57	Silent	SNP	ENST00000242310.4	37	CCDS35003.1																																																																																			.		0.443	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
DCAF10	79269	hgsc.bcm.edu	37	9	37800965	37800965	+	Silent	SNP	G	G	T	rs373032176		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr9:37800965G>T	ENST00000377724.3	+	1	467	c.102G>T	c.(100-102)ccG>ccT	p.P34P	RP11-613M10.9_ENST00000540557.1_Intron|DCAF10_ENST00000242323.7_Silent_p.P34P	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	34	Pro-rich.				protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						CCACCGGGCCGCCCTCGCCAC	0.761													G|||	1	0.000199681	0.0	0.0	5008	,	,		10350	0.0		0.001	False		,,,				2504	0.0				p.P34P		.											.	DCAF10-115	0			c.G102T						.	G		2,2882		0,2,1440	3.0	4.0	3.0		102	-2.9	0.1	9		3	5,6809		0,5,3402	no	coding-synonymous	DCAF10	NM_024345.3		0,7,4842	TT,TG,GG		0.0734,0.0693,0.0722		34/560	37800965	7,9691	1442	3407	4849	SO:0001819	synonymous_variant	79269	exon1			CGGGCCGCCCTCG	BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.102G>T	9.37:g.37800965G>T		Somatic	0	0		WXS	Illumina HiSeq	Phase_I	12	8	NM_024345	0	0	0	0	0	A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Silent	SNP	ENST00000377724.3	37	CCDS6613.2																																																																																			.		0.761	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052485.2	NM_024345	
STX17	55014	broad.mit.edu	37	9	102730843	102730843	+	Missense_Mutation	SNP	T	T	G			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr9:102730843T>G	ENST00000259400.6	+	8	933	c.797T>G	c.(796-798)gTg>gGg	p.V266G	STX17_ENST00000525847.1_3'UTR|STX17_ENST00000525640.1_Missense_Mutation_p.V266G|STX17_ENST00000534052.1_Missense_Mutation_p.V266G	NM_017919.2	NP_060389.2	P56962	STX17_HUMAN	syntaxin 17	266	Necessary and sufficient for localization to autophagosome.				autophagic vacuole fusion (GO:0000046)|endoplasmic reticulum-Golgi intermediate compartment organization (GO:0097111)|ER to Golgi vesicle-mediated transport (GO:0006888)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|protein localization to pre-autophagosomal structure (GO:0034497)	autophagic vacuole membrane (GO:0000421)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle (GO:0030134)|ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|smooth endoplasmic reticulum membrane (GO:0030868)|SNARE complex (GO:0031201)	protein phosphatase binding (GO:0019903)|SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				GGTGGTGGGGTGTTGGGCTTC	0.517																																					p.V266G													.	STX17-153	0			c.T797G						.						60.0	67.0	65.0					9																	102730843		2203	4300	6503	SO:0001583	missense	55014	exon8			GTGGGGTGTTGGG	AL834371	CCDS6745.1	9q31.1	2008-02-05			ENSG00000136874	ENSG00000136874			11432	protein-coding gene	gene with protein product		604204				9852078	Standard	NM_017919		Approved	FLJ20651	uc004bal.4	P56962	OTTHUMG00000020359	ENST00000259400.6:c.797T>G	9.37:g.102730843T>G	ENSP00000259400:p.Val266Gly	Somatic	130	14		WXS	Illumina HiSeq	Phase_I	159	21	NM_017919	0	0	2	2	0	Q4VXC2	Missense_Mutation	SNP	ENST00000259400.6	37	CCDS6745.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222238	0.39300	.	.	ENSG00000136874	ENST00000259400;ENST00000525640;ENST00000534052	.	.	.	5.28	5.28	0.74379	.	0.347306	0.27130	N	0.020792	T	0.48943	0.1528	L	0.34521	1.04	0.58432	D	0.999998	B	0.34214	0.442	B	0.34991	0.193	T	0.54761	-0.8245	9	0.87932	D	0	-7.5824	13.8021	0.63206	0.0:0.0:0.0:1.0	.	266	P56962	STX17_HUMAN	G	266	.	ENSP00000259400:V266G	V	+	2	0	STX17	101770664	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.856000	0.55964	1.999000	0.58509	0.533000	0.62120	GTG	.		0.517	STX17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053398.3	NM_017919	
SLC2A6	11182	broad.mit.edu	37	9	136340607	136340607	+	Missense_Mutation	SNP	G	G	T			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr9:136340607G>T	ENST00000371899.4	-	5	766	c.689C>A	c.(688-690)gCc>gAc	p.A230D	SLC2A6_ENST00000371897.4_Missense_Mutation_p.A230D|SLC2A6_ENST00000485978.1_5'UTR	NM_017585.3	NP_060055.2	Q9UGQ3	GTR6_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 6	230					glucose transport (GO:0015758)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)	p.A230D(3)		cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(3)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(145;8.47e-08)|Epithelial(140;9.37e-07)|all cancers(34;1.03e-05)		CGCCCGCAGGGCCTCTTCGTC	0.667																																					p.A230D													.	SLC2A6-90	3	Substitution - Missense(3)	prostate(2)|lung(1)	c.C689A						.						29.0	26.0	27.0					9																	136340607		2201	4298	6499	SO:0001583	missense	11182	exon5			CGCAGGGCCTCTT	AJ011372	CCDS6975.1, CCDS48052.1	9q34	2013-05-22			ENSG00000160326	ENSG00000160326		"""Solute carriers"""	11011	protein-coding gene	gene with protein product		606813				10970791	Standard	NM_001145099		Approved	GLUT9, GLUT6, HSA011372	uc004cee.3	Q9UGQ3	OTTHUMG00000020874	ENST00000371899.4:c.689C>A	9.37:g.136340607G>T	ENSP00000360966:p.Ala230Asp	Somatic	79	1		WXS	Illumina HiSeq	Phase_I	190	8	NM_017585	0	0	0	0	0	A6NNU6|Q5SXD7|Q8NCC2	Missense_Mutation	SNP	ENST00000371899.4	37	CCDS6975.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.9|27.9	4.870626|4.870626	0.91587|0.91587	.|.	.|.	ENSG00000160326|ENSG00000160326	ENST00000371897;ENST00000371899;ENST00000414172|ENST00000432868	D;D|D	0.83673|0.90620	-1.75;-1.75|-2.7	5.39|5.39	5.39|5.39	0.77823|0.77823	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.97062|0.97062	0.9040|0.9040	H|H	0.97077|0.97077	3.935|3.935	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	D|D	0.97265|0.97265	0.9907|0.9907	10|7	0.72032|0.41790	D|T	0.01|0.15	.|.	18.1313|18.1313	0.89602|0.89602	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	230;230|.	Q9UGQ3-2;Q9UGQ3|.	.;GTR6_HUMAN|.	D|T	230;230;120|192	ENSP00000360964:A230D;ENSP00000360966:A230D|ENSP00000405124:P192T	ENSP00000360964:A230D|ENSP00000405124:P192T	A|P	-|-	2|1	0|0	SLC2A6|SLC2A6	135330428|135330428	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.835000|0.835000	0.47333|0.47333	9.238000|9.238000	0.95380|0.95380	2.515000|2.515000	0.84797|0.84797	0.561000|0.561000	0.74099|0.74099	GCC|CCC	.		0.667	SLC2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054909.1	NM_017585	
RNF128	79589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	106034465	106034465	+	Splice_Site	SNP	G	G	A			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chrX:106034465G>A	ENST00000255499.2	+	6	1403		c.e6+1		RNF128_ENST00000324342.3_Splice_Site	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase						negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						CAGTCAACAAGTAAGCATCAT	0.453																																					.		.											.	RNF128-227	0			c.1075+1G>A						.						172.0	148.0	156.0					X																	106034465		2203	4300	6503	SO:0001630	splice_region_variant	79589	exon6			CAACAAGTAAGCA	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.1153+1G>A	X.37:g.106034465G>A		Somatic	141	0		WXS	Illumina HiSeq	Phase_I	136	33	NM_024539	0	0	0	0	0	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Splice_Site	SNP	ENST00000255499.2	37	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781964	0.70222	.	.	ENSG00000133135	ENST00000324342;ENST00000255499	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.497	0.67694	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF128	105921121	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	6.181000	0.71988	2.165000	0.68154	0.506000	0.49869	.	.		0.453	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	Intron
HS3ST4	9951	broad.mit.edu;bcgsc.ca	37	16	26147018	26147018	+	Frame_Shift_Del	DEL	A	A	-			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr16:26147018delA	ENST00000331351.5	+	2	1212	c.820delA	c.(820-822)attfs	p.I274fs	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	274					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		TCCCAAGCGCATTCACTCCAT	0.498																																					p.I274fs													.	HS3ST4-67	0			c.820delA						.						122.0	111.0	115.0					16																	26147018		1568	3582	5150	SO:0001589	frameshift_variant	9951	exon2			AAGCGCATTCACT	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.820delA	16.37:g.26147018delA	ENSP00000330606:p.Ile274fs	Somatic	78	0		WXS	Illumina HiSeq	Phase_I	112	12	NM_006040	0	0	0	0	0	Q5QI42|Q8NDC2	Frame_Shift_Del	DEL	ENST00000331351.5	37	CCDS53995.1																																																																																			.		0.498	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040	
HS3ST4	9951	broad.mit.edu;bcgsc.ca	37	16	26147021	26147023	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr16:26147021_26147023delCAC	ENST00000331351.5	+	2	1215_1217	c.823_825delCAC	c.(823-825)cacdel	p.H275del	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	275					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		CAAGCGCATTCACTCCATGGCCA	0.498																																					p.275_275del													.	HS3ST4-67	0			c.823_825del						.																																			SO:0001651	inframe_deletion	9951	exon2			CGCATTCACTCCA	AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.823_825delCAC	16.37:g.26147021_26147023delCAC	ENSP00000330606:p.His275del	Somatic	80	0		WXS	Illumina HiSeq	Phase_I	115	12	NM_006040	0	0	0	0	0	Q5QI42|Q8NDC2	In_Frame_Del	DEL	ENST00000331351.5	37	CCDS53995.1																																																																																			.		0.498	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133286.2	NM_006040	
SYN2	6854	broad.mit.edu	37	3	12046124	12046126	+	RNA	DEL	AGC	AGC	-	rs76272937|rs74800608|rs375843790|rs74185804|rs202010288	byFrequency	TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	AGC	AGC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr3:12046124_12046126delAGC	ENST00000432424.2	+	0	245_247							Q92777	SYN2_HUMAN	synapsin II						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(5)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	18						AGCCCCAGCAAGCGCCGAcgccg	0.764														5004	0.999201	0.9992	1.0	5008	,	,		2724	1.0		0.999	False		,,,				2504	0.998				.													.	SYN2-24	0			.						.																																					6854	.			CCAGCAAGCGCCG		CCDS74900.1, CCDS74901.1	3p25.2	2013-09-20			ENSG00000157152	ENSG00000157152			11495	protein-coding gene	gene with protein product		600755				8530057	Standard	XM_006713311		Approved	SYNII, SYNIIa, SYNIIb	uc003bwm.3	Q92777	OTTHUMG00000155335		3.37:g.12046124_12046126delAGC		Somatic	5	0		WXS	Illumina HiSeq	Phase_I	15	5	.	0	0	0	0	0	A8MY98	In_Frame_Del	DEL	ENST00000432424.2	37																																																																																				.		0.764	SYN2-002	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000339528.3	NM_133625	
TCHH	7062	hgsc.bcm.edu	37	1	152084657	152084658	+	In_Frame_Ins	INS	-	-	CTC	rs558731460		TCGA-P4-A5ED-01A-11D-A28G-10	TCGA-P4-A5ED-11A-11D-A28G-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	79d11c73-74ff-468d-b0e9-b8ddc72de15a	1bc9f60c-2dc6-4bfe-9965-6014f49dc9ac	g.chr1:152084657_152084658insCTC	ENST00000368804.1	-	2	1034_1035	c.1035_1036insGAG	c.(1033-1038)gagagg>gagGAGagg	p.345_346insE		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	345	5 X 13 AA tandem repeats of R-R-E-Q-E-E- E-R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tgctcgcgcctctcctcctgct	0.718																																					p.R346delinsER		.											.	TCHH-72	0			c.1036_1037insGAG						.																																			SO:0001652	inframe_insertion	7062	exon3			.	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1036_1038dupGAG	1.37:g.152084661_152084663dupCTC	ENSP00000357794:p.Glu345_Glu345dup	Somatic	9	0		WXS	Illumina HiSeq	Phase_I	48	10	NM_007113	0	0	0	0	0	Q5VUI3	In_Frame_Ins	INS	ENST00000368804.1	37	CCDS41396.1																																																																																			.		0.718	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
