#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48315045	48315045	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr7:48315045G>T	ENST00000435803.1	+	17	5806	c.5782G>T	c.(5782-5784)Gtc>Ttc	p.V1928F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1928					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATTACCGTTTGTCCCACCTTC	0.368																																					p.V1928F		.											.	ABCA13	521	0			c.G5782T						.						122.0	123.0	123.0					7																	48315045		1828	4089	5917	SO:0001583	missense	154664	exon17			CCGTTTGTCCCAC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.5782G>T	7.37:g.48315045G>T	ENSP00000411096:p.Val1928Phe	Somatic	280.0	0.0		WXS	Illumina HiSeq	Phase_I	222.0	106.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	4.188	0.033512	0.08101	.	.	ENSG00000179869	ENST00000435803	D	0.88277	-2.36	5.73	-2.97	0.05530	.	1.177540	0.06347	N	0.709239	D	0.82935	0.5145	L	0.57536	1.79	0.09310	N	1	B	0.15473	0.013	B	0.12156	0.007	T	0.63607	-0.6599	9	.	.	.	.	2.6635	0.05033	0.3845:0.1063:0.3891:0.1201	.	1928	Q86UQ4	ABCAD_HUMAN	F	1928	ENSP00000411096:V1928F	.	V	+	1	0	ABCA13	48285591	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	0.347000	0.20014	-0.457000	0.07033	-0.157000	0.13467	GTC	.		0.368	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ACTR6	64431	ucsc.edu;bcgsc.ca	37	12	100594696	100594696	+	Splice_Site	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr12:100594696T>C	ENST00000188312.2	+	1	832	c.67T>C	c.(67-69)Tcg>Ccg	p.S23P	ACTR6_ENST00000550813.1_3'UTR|ACTR6_ENST00000546902.1_5'UTR|ACTR6_ENST00000552376.1_Splice_Site_p.S23P|ACTR6_ENST00000551617.1_5'UTR	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	23						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						TGAAAATGTGTCGTAAGTACT	0.478																																					p.S23P		.											.	ACTR6	91	0			c.T67C						.						227.0	185.0	199.0					12																	100594696		2203	4300	6503	SO:0001630	splice_region_variant	64431	exon1			AATGTGTCGTAAG	AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.68+1T>C	12.37:g.100594696T>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_022496	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	37	CCDS9074.1	.	.	.	.	.	.	.	.	.	.	T	19.90	3.912124	0.72983	.	.	ENSG00000075089	ENST00000188312;ENST00000552376	D;D	0.97232	-4.3;-4.3	5.5	4.31	0.51392	.	0.148995	0.56097	D	0.000032	D	0.95903	0.8666	L	0.38953	1.18	0.80722	D	1	D;P;P	0.58620	0.983;0.914;0.93	P;P;P	0.56751	0.805;0.558;0.686	D	0.95101	0.8230	10	0.72032	D	0.01	.	8.2407	0.31658	0.2515:0.0:0.0:0.7485	.	23;23;23	B4DLG9;F8W057;Q9GZN1	.;.;ARP6_HUMAN	P	23	ENSP00000188312:S23P;ENSP00000447237:S23P	ENSP00000188312:S23P	S	+	1	0	ACTR6	99118827	1.000000	0.71417	0.995000	0.50966	0.394000	0.30568	3.963000	0.56773	2.302000	0.77476	0.533000	0.62120	TCG	.		0.478	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496	Missense_Mutation
AEBP1	165	ucsc.edu;bcgsc.ca	37	7	44147093	44147093	+	Silent	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr7:44147093A>G	ENST00000223357.3	+	3	956	c.651A>G	c.(649-651)gcA>gcG	p.A217A		NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	217	Pro-rich.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						ATGTGGAGGCACGGGAGCACC	0.657																																					p.A217A		.											.	AEBP1	90	0			c.A651G						.						46.0	54.0	51.0					7																	44147093		2203	4300	6503	SO:0001819	synonymous_variant	165	exon3			GGAGGCACGGGAG	D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.651A>G	7.37:g.44147093A>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	.	59.0	5.0	NM_001129	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	ENST00000223357.3	37	CCDS5476.1	.	.	.	.	.	.	.	.	.	.	A	4.989	0.183616	0.09495	.	.	ENSG00000106624	ENST00000455443	.	.	.	3.22	-0.976	0.10286	.	.	.	.	.	T	0.18467	0.0443	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23119	-1.0197	4	.	.	.	-0.6808	0.3126	0.00290	0.3767:0.2263:0.1427:0.2543	.	.	.	.	A	175	.	.	T	+	1	0	AEBP1	44113618	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	-1.148000	0.03185	-0.177000	0.10690	-0.669000	0.03829	ACG	.		0.657	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250993.2	NM_001129	
ANKFY1	51479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4082167	4082167	+	Silent	SNP	G	G	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr17:4082167G>A	ENST00000341657.4	-	18	2618	c.2583C>T	c.(2581-2583)tcC>tcT	p.S861S	CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000570535.1_Silent_p.S903S|ANKFY1_ENST00000574367.1_Silent_p.S862S	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	861					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CAGCAGCCCCGGACTCTCGTT	0.537																																					p.S903S		.											.	ANKFY1	93	0			c.C2709T						.						69.0	70.0	69.0					17																	4082167		1995	4167	6162	SO:0001819	synonymous_variant	51479	exon18			AGCCCCGGACTCT	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.2583C>T	17.37:g.4082167G>A		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	20.0	NM_001257999	A8KA65|Q5RKV4|Q9ULG5	Silent	SNP	ENST00000341657.4	37																																																																																				.		0.537	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
API5	8539	ucsc.edu;bcgsc.ca	37	11	43364048	43364048	+	Silent	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr11:43364048A>G	ENST00000531273.1	+	14	1702	c.1563A>G	c.(1561-1563)ggA>ggG	p.G521G	API5_ENST00000420461.2_3'UTR|API5_ENST00000455725.2_Silent_p.G510G|API5_ENST00000378852.3_3'UTR|RP11-484D2.2_ENST00000526220.1_RNA|API5_ENST00000534695.1_Intron			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	521					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						GTAGTCGGGGAAGACTCTACT	0.463																																					p.G521G	Pancreas(1;98 122 5625 20895 49453)	.											.	API5	136	0			c.A1563G						.						72.0	67.0	69.0					11																	43364048		2203	4300	6503	SO:0001819	synonymous_variant	8539	exon14			TCGGGGAAGACTC	U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.1563A>G	11.37:g.43364048A>G		Somatic	59.0	1.0		WXS	Illumina HiSeq	.	36.0	5.0	NM_001142930	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Silent	SNP	ENST00000531273.1	37	CCDS44572.1																																																																																			.		0.463	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595	
ARID5B	84159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	63817024	63817024	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr10:63817024T>C	ENST00000279873.7	+	6	1405	c.995T>C	c.(994-996)aTg>aCg	p.M332T	ARID5B_ENST00000309334.5_Missense_Mutation_p.M89T	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	332	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					TATAAATACATGAAAGAAAGG	0.373																																					p.M332T		.											.	ARID5B	94	0			c.T995C						.						111.0	120.0	117.0					10																	63817024		2203	4300	6503	SO:0001583	missense	84159	exon6			AATACATGAAAGA	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.995T>C	10.37:g.63817024T>C	ENSP00000279873:p.Met332Thr	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	52.0	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	37	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.014883	0.75161	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.66460	-0.21;-0.21	5.96	5.96	0.96718	ARID/BRIGHT DNA-binding domain (5);	0.000000	0.85682	D	0.000000	D	0.86201	0.5876	M	0.92122	3.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89446	0.3727	10	0.87932	D	0	-23.0836	16.4484	0.83959	0.0:0.0:0.0:1.0	.	89;332	Q14865-2;Q14865	.;ARI5B_HUMAN	T	332;89	ENSP00000279873:M332T;ENSP00000308862:M89T	ENSP00000279873:M332T	M	+	2	0	ARID5B	63487030	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.285000	0.76669	0.533000	0.62120	ATG	.		0.373	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
BAP1	8314	hgsc.bcm.edu;bcgsc.ca	37	3	52440340	52440348	+	In_Frame_Del	DEL	TGCGGTCGG	TGCGGTCGG	-	rs138180791		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	TGCGGTCGG	TGCGGTCGG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr3:52440340_52440348delTGCGGTCGG	ENST00000460680.1	-	9	1175_1183	c.704_712delCCGACCGCA	c.(703-714)cccgaccgcagg>cgg	p.PDR235del	BAP1_ENST00000296288.5_Splice_Site	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TACTTGATCCTGCGGTCGGGCACCACTGC	0.632			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.235_238del	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	1032	0			c.704_712del						.																																			SO:0001651	inframe_deletion	8314	exon9			TGATCCTGCGGTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.704_712delCCGACCGCA	3.37:g.52440340_52440348delTGCGGTCGG	ENSP00000417132:p.Pro235_Arg237del	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	16.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	In_Frame_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.632	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
BMP15	9210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	50653812	50653812	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chrX:50653812T>G	ENST00000252677.3	+	1	29	c.29T>G	c.(28-30)cTt>cGt	p.L10R		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	10					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CTTAGAATTCTTTTTCTTTGT	0.498																																					p.L10R		.											.	BMP15	132	0			c.T29G						.						48.0	41.0	43.0					X																	50653812		2202	4299	6501	SO:0001583	missense	9210	exon1			GAATTCTTTTTCT	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.29T>G	X.37:g.50653812T>G	ENSP00000252677:p.Leu10Arg	Somatic	269.0	0.0		WXS	Illumina HiSeq	Phase_I	236.0	47.0	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	37	CCDS14334.1	.	.	.	.	.	.	.	.	.	.	t	10.94	1.491958	0.26774	.	.	ENSG00000130385	ENST00000252677	D	0.84070	-1.8	4.48	4.48	0.54585	.	1.158760	0.06236	N	0.689464	D	0.87653	0.6231	L	0.47716	1.5	0.09310	N	1	D	0.64830	0.994	D	0.62955	0.909	T	0.73770	-0.3878	10	0.72032	D	0.01	.	9.7051	0.40211	0.0:0.0:0.0:1.0	.	10	O95972	BMP15_HUMAN	R	10	ENSP00000252677:L10R	ENSP00000252677:L10R	L	+	2	0	BMP15	50670552	0.725000	0.28048	0.024000	0.17045	0.098000	0.18820	2.533000	0.45667	1.750000	0.51863	0.441000	0.28932	CTT	.		0.498	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
C14orf37	145407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	58605153	58605153	+	Silent	SNP	A	A	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr14:58605153A>T	ENST00000267485.7	-	2	1118	c.924T>A	c.(922-924)tcT>tcA	p.S308S	C14orf37_ENST00000334342.5_5'UTR	NM_001001872.2	NP_001001872.2	Q86TY3	CN037_HUMAN	chromosome 14 open reading frame 37	308						integral component of membrane (GO:0016021)				breast(7)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|skin(1)	33						CACTTAAGGCAGAGGCAGCTG	0.512																																					p.S308S		.											.	C14orf37	90	0			c.T924A						.						95.0	98.0	97.0					14																	58605153		2203	4300	6503	SO:0001819	synonymous_variant	145407	exon2			TAAGGCAGAGGCA		CCDS32089.1	14q23.1	2012-09-03			ENSG00000139971	ENSG00000139971			19846	protein-coding gene	gene with protein product							Standard	NM_001001872		Approved		uc001xdc.3	Q86TY3	OTTHUMG00000171173	ENST00000267485.7:c.924T>A	14.37:g.58605153A>T		Somatic	227.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	45.0	NM_001001872	A8K8Z8|Q6P5Q1|Q86TY1	Silent	SNP	ENST00000267485.7	37	CCDS32089.1																																																																																			.		0.512	C14orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412059.1	NM_001001872	
ACKR3	57007	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	237489915	237489915	+	Silent	SNP	C	C	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr2:237489915C>T	ENST00000272928.3	+	2	1117	c.807C>T	c.(805-807)caC>caT	p.H269H		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	269					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)										TGCCCTACCACGTGGCGGTGC	0.607																																					p.H269H		.											.	CXCR7	1145	0			c.C807T						.						163.0	137.0	146.0					2																	237489915		2203	4300	6503	SO:0001819	synonymous_variant	57007	exon2			CTACCACGTGGCG	BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.807C>T	2.37:g.237489915C>T		Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	23.0	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Silent	SNP	ENST00000272928.3	37	CCDS2516.1																																																																																			.		0.607	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
CYLC1	1538	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	83128315	83128316	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chrX:83128315_83128316delAG	ENST00000329312.4	+	4	636_637	c.599_600delAG	c.(598-600)aagfs	p.K201fs		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	201					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						CAAAAAGATAAGAAAGATTCAA	0.322																																					p.200_200del		.											.	CYLC1	112	0			c.599_600del						.																																			SO:0001589	frameshift_variant	1538	exon4			AAGATAAGAAAGA	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.599_600delAG	X.37:g.83128315_83128316delAG	ENSP00000331556:p.Lys201fs	Somatic	435.0	0.0		WXS	Illumina HiSeq	Phase_I	256.0	79.0	NM_021118	A0AVQ8|Q5JQQ9	Frame_Shift_Del	DEL	ENST00000329312.4	37	CCDS35341.1																																																																																			.		0.322	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
DIP2C	22982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	460026	460026	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr10:460026delG	ENST00000280886.6	-	8	971	c.884delC	c.(883-885)ccafs	p.P295fs	DIP2C_ENST00000381496.3_Frame_Shift_Del_p.P188fs	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	295						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CTCCGGCTTTGGTTGGTTCGG	0.542																																					p.P295fs		.											.	DIP2C	156	0			c.884delC						.						40.0	44.0	43.0					10																	460026		2203	4300	6503	SO:0001589	frameshift_variant	22982	exon8			GGCTTTGGTTGGT	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.884delC	10.37:g.460026delG	ENSP00000280886:p.Pro295fs	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	24.0	NM_014974	B4DPI5|Q5SS78	Frame_Shift_Del	DEL	ENST00000280886.6	37	CCDS7054.1																																																																																			.		0.542	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
DMAP1	55929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	44684030	44684030	+	Silent	SNP	C	C	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr1:44684030C>T	ENST00000372289.2	+	4	704	c.441C>T	c.(439-441)ctC>ctT	p.L147L	DMAP1_ENST00000361745.6_Silent_p.L147L|DMAP1_ENST00000488433.1_3'UTR|DMAP1_ENST00000315913.5_Silent_p.L147L	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1	147					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					AGCTTTATCTCCACGATGATG	0.537											OREG0013437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L147L		.											.	DMAP1	226	0			c.C441T						.						196.0	167.0	176.0					1																	44684030		2203	4300	6503	SO:0001819	synonymous_variant	55929	exon5			TTATCTCCACGAT	AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.441C>T	1.37:g.44684030C>T		Somatic	306.0	0.0	925	WXS	Illumina HiSeq	Phase_I	143.0	38.0	NM_001034023	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	Silent	SNP	ENST00000372289.2	37	CCDS509.1																																																																																			.		0.537	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020027.3	NM_019100	
DMD	1756	broad.mit.edu;ucsc.edu;mdanderson.org	37	X	32486707	32486707	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chrX:32486707C>A	ENST00000357033.4	-	23	3276	c.3070G>T	c.(3070-3072)Gaa>Taa	p.E1024*	DMD_ENST00000378677.2_Nonsense_Mutation_p.E1020*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1024					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCCTCAATTTCTTCAAATTCT	0.428																																					p.E1024X		.											.	DMD	265	0			c.G3070T						.						76.0	69.0	72.0					X																	32486707		2202	4300	6502	SO:0001587	stop_gained	1756	exon23			CAATTTCTTCAAA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3070G>T	X.37:g.32486707C>A	ENSP00000354923:p.Glu1024*	Somatic	794.0	2.0		WXS	Illumina HiSeq	Phase_I	577.0	89.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	39	7.516955	0.98332	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	.	.	.	5.12	4.25	0.50352	.	1.028360	0.07850	U	0.964447	.	.	.	.	.	.	0.19575	N	0.999965	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	5.4345	0.16474	0.1435:0.6406:0.1365:0.0794	.	.	.	.	X	1016;1020;1024;1024;901	.	ENSP00000354923:E1024X	E	-	1	0	DMD	32396628	0.861000	0.29849	0.893000	0.35052	0.162000	0.22319	1.863000	0.39459	1.040000	0.40099	0.538000	0.68166	GAA	.		0.428	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DOK7	285489	ucsc.edu;bcgsc.ca	37	4	3494941	3494941	+	Missense_Mutation	SNP	A	A	G	rs547633164		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr4:3494941A>G	ENST00000340083.5	+	7	1293	c.1228A>G	c.(1228-1230)Agc>Ggc	p.S410G	DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000389653.2_Missense_Mutation_p.S410G|DOK7_ENST00000512714.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	410					neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CACACCACGCAGCCTTTGCCT	0.716													.|||	1	0.000199681	0.0	0.0	5008	,	,		15101	0.0		0.0	False		,,,				2504	0.001				p.S410G		.											.	DOK7	91	0			c.A1228G						.						16.0	16.0	16.0					4																	3494941		2193	4294	6487	SO:0001583	missense	285489	exon7			CCACGCAGCCTTT	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.1228A>G	4.37:g.3494941A>G	ENSP00000344432:p.Ser410Gly	Somatic	32.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_173660	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	.	.	.	.	.	.	.	.	.	.	A	14.18	2.457686	0.43634	.	.	ENSG00000175920	ENST00000389653;ENST00000340083	T;T	0.69435	-0.4;-0.28	3.77	3.77	0.43336	.	0.050418	0.85682	D	0.000000	T	0.75693	0.3884	M	0.72118	2.19	0.31622	N	0.650166	D;P;P	0.67145	0.996;0.942;0.895	P;P;B	0.59056	0.851;0.627;0.351	T	0.79667	-0.1708	10	0.56958	D	0.05	-17.0009	11.8998	0.52675	1.0:0.0:0.0:0.0	.	410;272;410	Q18PE1-3;Q18PE1-2;Q18PE1	.;.;DOK7_HUMAN	G	410	ENSP00000374304:S410G;ENSP00000344432:S410G	ENSP00000344432:S410G	S	+	1	0	DOK7	3464739	1.000000	0.71417	1.000000	0.80357	0.128000	0.20619	7.149000	0.77396	1.600000	0.50102	0.454000	0.30748	AGC	.		0.716	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
DTX3L	151636	ucsc.edu;bcgsc.ca	37	3	122288722	122288722	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr3:122288722T>C	ENST00000296161.4	+	3	1975	c.1786T>C	c.(1786-1788)Tgt>Cgt	p.C596R	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	596					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		TAAGCCAATCTGTCCCACATG	0.433																																					p.C596R		.											.	DTX3L	587	0			c.T1786C						.						149.0	148.0	148.0					3																	122288722		2203	4300	6503	SO:0001583	missense	151636	exon3			CCAATCTGTCCCA		CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1786T>C	3.37:g.122288722T>C	ENSP00000296161:p.Cys596Arg	Somatic	93.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_138287	B3KWH6|Q53ZZ3|Q5MJP7	Missense_Mutation	SNP	ENST00000296161.4	37	CCDS3015.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.946087	0.53079	.	.	ENSG00000163840	ENST00000296161	D	0.99809	-6.86	5.11	5.11	0.69529	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.64402	D	0.000019	D	0.99889	0.9947	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96219	0.9159	10	0.87932	D	0	-33.4409	13.8723	0.63626	0.0:0.0:0.0:1.0	.	596	Q8TDB6	DTX3L_HUMAN	R	596	ENSP00000296161:C596R	ENSP00000296161:C596R	C	+	1	0	DTX3L	123771412	1.000000	0.71417	0.967000	0.41034	0.093000	0.18481	7.800000	0.85949	2.162000	0.67917	0.454000	0.30748	TGT	.		0.433	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355966.1	NM_138287	
DUSP9	1852	hgsc.bcm.edu;broad.mit.edu	37	X	152914788	152914788	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chrX:152914788G>A	ENST00000342782.3	+	3	740	c.475G>A	c.(475-477)Gtg>Atg	p.V159M	DUSP9_ENST00000370167.4_Missense_Mutation_p.V159M			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	159					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGTGCCCGTGGTGGGGTT	0.677																																					p.V159M		.											.	DUSP9	660	0			c.G475A						.						26.0	26.0	26.0					X																	152914788		2202	4292	6494	SO:0001583	missense	1852	exon3			GTGCCCGTGGTGG	Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.475G>A	X.37:g.152914788G>A	ENSP00000345853:p.Val159Met	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	12.0	NM_001395	D3DWU5	Missense_Mutation	SNP	ENST00000342782.3	37	CCDS14724.1	.	.	.	.	.	.	.	.	.	.	g	14.34	2.505811	0.44558	.	.	ENSG00000130829	ENST00000370167;ENST00000342782	T;T	0.44881	0.91;0.91	5.13	5.13	0.70059	.	0.638340	0.12977	N	0.423652	T	0.48677	0.1513	M	0.70595	2.14	0.48511	D	0.99966	P	0.47677	0.899	B	0.41988	0.372	T	0.57458	-0.7808	10	0.72032	D	0.01	.	16.4389	0.83894	0.0:0.0:1.0:0.0	.	159	Q99956	DUS9_HUMAN	M	159	ENSP00000359186:V159M;ENSP00000345853:V159M	ENSP00000345853:V159M	V	+	1	0	DUSP9	152567982	1.000000	0.71417	0.861000	0.33841	0.024000	0.10985	9.585000	0.98223	2.135000	0.66039	0.529000	0.55759	GTG	.		0.677	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061022.3	NM_001395	
ECE2	9718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184001717	184001717	+	Missense_Mutation	SNP	G	G	A	rs370460271		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr3:184001717G>A	ENST00000402825.3	+	8	1315	c.1315G>A	c.(1315-1317)Gac>Aac	p.D439N	ECE2_ENST00000359140.4_Missense_Mutation_p.D292N|ECE2_ENST00000404464.3_Missense_Mutation_p.D321N|ECE2_ENST00000357474.5_Missense_Mutation_p.D367N|EIF2B5_ENST00000444495.1_Intron	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	439	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CCAGCGGCGCGACGAGGAGAA	0.637																																					p.D439N		.											.	ECE2	94	0			c.G1315A						.	G	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	78.0	66.0	70.0		874,1099,961,1315	4.3	0.3	3		70	0,8600		0,0,4300	no	missense,missense,missense,missense	ECE2	NM_001037324.2,NM_001100120.1,NM_001100121.1,NM_014693.3	23,23,23,23	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	292/737,367/812,321/766,439/884	184001717	1,13005	2203	4300	6503	SO:0001583	missense	9718	exon8			CGGCGCGACGAGG	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1315G>A	3.37:g.184001717G>A	ENSP00000384223:p.Asp439Asn	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	30.0	NM_014693	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	ENST00000402825.3	37	CCDS3256.2	.	.	.	.	.	.	.	.	.	.	G	23.3	4.399116	0.83120	2.27E-4	0.0	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	4.3	4.3	0.51218	Peptidase M13 (1);	0.051185	0.85682	D	0.000000	D	0.85195	0.5641	L	0.28740	0.885	0.58432	D	0.999993	D;D;D;B;D;D;D	0.89917	1.0;1.0;0.992;0.349;1.0;1.0;1.0	D;D;P;B;D;D;D	0.87578	0.998;0.998;0.759;0.022;0.996;0.996;0.998	D	0.83595	0.0125	10	0.29301	T	0.29	-15.5575	15.4844	0.75555	0.0:0.0:1.0:0.0	.	41;292;310;321;367;292;439	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	N	439;292;321;367;313	ENSP00000384223:D439N;ENSP00000352052:D292N;ENSP00000385846:D321N;ENSP00000350066:D367N;ENSP00000398444:D313N	ENSP00000350066:D367N	D	+	1	0	ECE2	185484411	1.000000	0.71417	0.299000	0.25016	0.943000	0.58893	9.097000	0.94193	2.222000	0.72286	0.650000	0.86243	GAC	.		0.637	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318874.3	NM_014693	
FRK	2444	ucsc.edu;bcgsc.ca	37	6	116381396	116381396	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr6:116381396T>C	ENST00000606080.1	-	1	525	c.79A>G	c.(79-81)Acc>Gcc	p.T27A		NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	27					cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	TCAATCACGGTTGACTTGTCT	0.537																																					p.T27A		.											.	FRK	948	0			c.A79G						.						105.0	103.0	104.0					6																	116381396		2203	4300	6503	SO:0001583	missense	2444	exon1			TCACGGTTGACTT	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.79A>G	6.37:g.116381396T>C	ENSP00000476145:p.Thr27Ala	Somatic	71.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_002031	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	T	0.103	-1.149201	0.01714	.	.	ENSG00000111816	ENST00000368626	T	0.73258	-0.73	4.74	0.571	0.17352	.	1.232740	0.06095	N	0.664390	T	0.22399	0.0540	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.10683	-1.0619	10	0.15499	T	0.54	.	5.7809	0.18306	0.0:0.5259:0.2682:0.2059	.	27	P42685	FRK_HUMAN	A	27	ENSP00000357615:T27A	ENSP00000357615:T27A	T	-	1	0	FRK	116488089	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.307000	0.08167	-0.022000	0.13986	-0.290000	0.09829	ACC	.		0.537	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031	
GALK2	2585	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49531474	49531474	+	Silent	SNP	C	C	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr15:49531474C>T	ENST00000560031.1	+	5	721	c.414C>T	c.(412-414)atC>atT	p.I138I	GALK2_ENST00000544523.1_Silent_p.I114I|GALK2_ENST00000559454.1_Silent_p.I114I|GALK2_ENST00000327171.3_Silent_p.I127I|GALK2_ENST00000543495.1_Silent_p.I9I|GALK2_ENST00000396509.2_Silent_p.I114I|GALK2_ENST00000561014.1_3'UTR			Q01415	GALK2_HUMAN	galactokinase 2	138					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)		ATGGAAATATCCCACCAAGTT	0.448																																					p.I138I		.											.	GALK2	160	0			c.C414T						.						156.0	124.0	135.0					15																	49531474		2196	4295	6491	SO:0001819	synonymous_variant	2585	exon5			AAATATCCCACCA		CCDS32236.1, CCDS42034.1, CCDS73724.1	15q21.1-q21.2	2013-09-20			ENSG00000156958	ENSG00000156958	2.7.1.6		4119	protein-coding gene	gene with protein product		137028					Standard	XM_005254279		Approved	GK2	uc001zxj.1	Q01415	OTTHUMG00000172325	ENST00000560031.1:c.414C>T	15.37:g.49531474C>T		Somatic	345.0	1.0		WXS	Illumina HiSeq	Phase_I	209.0	40.0	NM_002044	Q7Z4Q4	Silent	SNP	ENST00000560031.1	37	CCDS42034.1																																																																																			.		0.448	GALK2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417854.1		
GALNT2	2590	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	230410235	230410235	+	Silent	SNP	G	G	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr1:230410235G>A	ENST00000366672.4	+	15	1557	c.1485G>A	c.(1483-1485)ttG>ttA	p.L495L	GALNT2_ENST00000541865.1_3'UTR|GALNT2_ENST00000543760.1_Silent_p.L457L|GALNT2_ENST00000485438.1_3'UTR	NM_004481.3	NP_004472.1	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2	495	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|immunoglobulin biosynthetic process (GO:0002378)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(5)|skin(2)	32	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				ACATGGATTTGTGCCTTACTG	0.557																																					p.L495L		.											.	GALNT2	92	0			c.G1485A						.						100.0	100.0	100.0					1																	230410235		2203	4300	6503	SO:0001819	synonymous_variant	2590	exon15			GGATTTGTGCCTT	BC041120	CCDS1582.1	1q41-q42	2014-03-13	2014-03-13		ENSG00000143641	ENSG00000143641	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4124	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 2"""	602274	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)"""			9592121, 7592619	Standard	NM_004481		Approved	GalNAc-T2	uc010pwa.1	Q10471	OTTHUMG00000037771	ENST00000366672.4:c.1485G>A	1.37:g.230410235G>A		Somatic	120.0	1.0		WXS	Illumina HiSeq	Phase_I	88.0	8.0	NM_004481	A8K1Y3|B7Z8V8|C5HU00|Q9NPY4	Silent	SNP	ENST00000366672.4	37	CCDS1582.1																																																																																			.		0.557	GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092158.1	NM_004481	
GSTCD	79807	broad.mit.edu;bcgsc.ca	37	4	106766665	106766665	+	Silent	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr4:106766665T>C	ENST00000515279.1	+	12	2053	c.1833T>C	c.(1831-1833)gtT>gtC	p.V611V	GSTCD_ENST00000394728.3_Silent_p.V611V|GSTCD_ENST00000394730.3_Silent_p.V524V|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000360505.5_Silent_p.V611V			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	611						extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GATACTCCGTTCAAGTGATAT	0.428																																					p.V611V		.											.	GSTCD	92	0			c.T1833C						.						104.0	102.0	103.0					4																	106766665		1945	4154	6099	SO:0001819	synonymous_variant	79807	exon12			CTCCGTTCAAGTG	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.1833T>C	4.37:g.106766665T>C		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	5.0	NM_001031720	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Silent	SNP	ENST00000515279.1	37	CCDS43257.1																																																																																			.		0.428	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
HIST2H3D	653604	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	149784882	149784882	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr1:149784882T>C	ENST00000331491.1	-	1	354	c.355A>G	c.(355-357)Acc>Gcc	p.T119A	HIST2H2BF_ENST00000427880.2_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA|HIST2H2BF_ENST00000469483.1_5'Flank|HIST2H2BF_ENST00000369167.1_5'Flank|HIST2H2BF_ENST00000545683.1_5'Flank	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	119					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T119A(1)		biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						GGCATGATGGTCACGCGCTTG	0.612																																					p.T119A		.											.	HIST2H3D	22	1	Substitution - Missense(1)	biliary_tract(1)	c.A355G						.						45.0	47.0	46.0					1																	149784882		1568	3581	5149	SO:0001583	missense	653604	exon1			TGATGGTCACGCG	AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.355A>G	1.37:g.149784882T>C	ENSP00000333277:p.Thr119Ala	Somatic	276.0	1.0		WXS	Illumina HiSeq	Phase_I	208.0	61.0	NM_001123375	A2BDF6|A6NFS4|Q6B053	Missense_Mutation	SNP	ENST00000331491.1	37	CCDS41388.1	.	.	.	.	.	.	.	.	.	.	T	15.10	2.733815	0.48939	.	.	ENSG00000183598	ENST00000331491	T	0.75367	-0.93	3.81	3.81	0.43845	.	0.000000	0.56097	U	0.000038	T	0.75961	0.3921	.	.	.	0.48632	D	0.999684	.	.	.	.	.	.	T	0.80089	-0.1528	7	0.87932	D	0	.	11.8431	0.52366	0.0:0.0:0.0:1.0	.	.	.	.	A	119	ENSP00000333277:T119A	ENSP00000333277:T119A	T	-	1	0	HIST2H3D	148051506	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	5.428000	0.66489	1.745000	0.51790	0.358000	0.22013	ACC	.		0.612	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033452.1	NM_001123375	
HK2	3099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	75104368	75104368	+	Silent	SNP	G	G	A	rs565854734		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr2:75104368G>A	ENST00000290573.2	+	8	1551	c.951G>A	c.(949-951)gaG>gaA	p.E317E	HK2_ENST00000409174.1_Silent_p.E289E	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	317	Hexokinase type-2 1.|Regulatory.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						CCAAGGAGGAGCTGCTCTTTG	0.542																																					p.E317E		.											.	HK2	252	0			c.G951A						.						196.0	197.0	197.0					2																	75104368		2203	4300	6503	SO:0001819	synonymous_variant	3099	exon8			GGAGGAGCTGCTC		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.951G>A	2.37:g.75104368G>A		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	25.0	NM_000189	D6W5J2|Q8WU87|Q9UN82	Silent	SNP	ENST00000290573.2	37	CCDS1956.1																																																																																			.		0.542	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	NM_000189	
HTATSF1	27336	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135593729	135593729	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chrX:135593729A>C	ENST00000218364.4	+	9	1999	c.1825A>C	c.(1825-1827)Aaa>Caa	p.K609Q	HTATSF1_ENST00000535601.1_Missense_Mutation_p.K609Q	NM_014500.4	NP_055315.2	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	609	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K609Q(1)		NS(1)|biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(14)|ovary(3)|prostate(1)	30	Acute lymphoblastic leukemia(192;0.000127)					CGGCTCTGAAAAAGTGTTAGA	0.383																																					p.K609Q		.											.	HTATSF1	132	1	Substitution - Missense(1)	biliary_tract(1)	c.A1825C						.						69.0	74.0	72.0					X																	135593729		2202	4295	6497	SO:0001583	missense	27336	exon10			TCTGAAAAAGTGT	U76992	CCDS14657.1	Xq26.3	2013-02-12	2006-01-09		ENSG00000102241	ENSG00000102241		"""RNA binding motif (RRM) containing"""	5276	protein-coding gene	gene with protein product		300346	"""HIV TAT specific factor 1"""			8849451	Standard	NM_014500		Approved	TAT-SF1	uc004ezx.3	O43719	OTTHUMG00000022510	ENST00000218364.4:c.1825A>C	X.37:g.135593729A>C	ENSP00000218364:p.Lys609Gln	Somatic	244.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	40.0	NM_001163280	D3DWG9|Q59G06|Q99730	Missense_Mutation	SNP	ENST00000218364.4	37	CCDS14657.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.873801	0.33069	.	.	ENSG00000102241	ENST00000535601;ENST00000218364;ENST00000415377	T;T	0.04234	3.67;3.67	4.64	3.48	0.39840	.	0.908123	0.09691	N	0.768412	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	B	0.30793	0.295	B	0.30029	0.11	T	0.44847	-0.9301	10	0.72032	D	0.01	-12.3679	7.6365	0.28270	0.8971:0.0:0.1029:0.0	.	609	O43719	HTSF1_HUMAN	Q	609	ENSP00000442699:K609Q;ENSP00000218364:K609Q	ENSP00000218364:K609Q	K	+	1	0	HTATSF1	135421395	0.002000	0.14202	0.001000	0.08648	0.964000	0.63967	1.353000	0.34045	0.889000	0.36185	0.425000	0.28330	AAA	.		0.383	HTATSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058497.1	NM_014500	
HTR7	3363	ucsc.edu;bcgsc.ca	37	10	92508599	92508599	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr10:92508599A>G	ENST00000336152.3	-	2	1318	c.1292T>C	c.(1291-1293)gTg>gCg	p.V431A	HTR7_ENST00000371721.3_Missense_Mutation_p.V431A|HTR7_ENST00000371719.2_Missense_Mutation_p.V431A|HTR7_ENST00000277874.6_Missense_Mutation_p.V431A	NM_019859.3	NP_062873.1	P34969	5HT7R_HUMAN	5-hydroxytryptamine (serotonin) receptor 7, adenylate cyclase-coupled	431					blood circulation (GO:0008015)|circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|serotonin receptor signaling pathway (GO:0007210)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30					Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Eletriptan(DB00216)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Methysergide(DB00247)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	ACCTTACAGCACAAACTCAGG	0.488																																					p.V431A		.											.	HTR7	91	0			c.T1292C						.						93.0	101.0	98.0					10																	92508599		2203	4300	6503	SO:0001583	missense	3363	exon2			TACAGCACAAACT	BC047526	CCDS7408.1, CCDS7409.1, CCDS7410.1	10q21-q24	2012-08-08	2012-02-03		ENSG00000148680	ENSG00000148680		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5302	protein-coding gene	gene with protein product		182137	"""5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled)"""			8226867	Standard	NM_000872		Approved	5-HT7	uc001kha.3	P34969	OTTHUMG00000018732	ENST00000336152.3:c.1292T>C	10.37:g.92508599A>G	ENSP00000337949:p.Val431Ala	Somatic	95.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_019860	B5BUP6|P78336|P78372|P78516|Q5VX01|Q5VX02|Q5VX03	Missense_Mutation	SNP	ENST00000336152.3	37	CCDS7408.1	.	.	.	.	.	.	.	.	.	.	A	10.84	1.465303	0.26335	.	.	ENSG00000148680	ENST00000336152;ENST00000277874;ENST00000371719;ENST00000371721	T;T;T;T	0.65916	-0.12;-0.05;-0.18;-0.08	5.64	4.5	0.54988	.	0.218306	0.31976	N	0.006780	T	0.42517	0.1206	L	0.27053	0.805	0.28934	N	0.891418	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.29058	-1.0024	10	0.09843	T	0.71	.	7.9455	0.29985	0.8338:0.0:0.1662:0.0	.	431;431	P34969;P34969-2	5HT7R_HUMAN;.	A	431	ENSP00000337949:V431A;ENSP00000277874:V431A;ENSP00000360784:V431A;ENSP00000360786:V431A	ENSP00000277874:V431A	V	-	2	0	HTR7	92498579	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	4.670000	0.61583	0.961000	0.38030	0.528000	0.53228	GTG	.		0.488	HTR7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049343.1	NM_000872	
IDH1	3417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	209113113	209113113	+	Missense_Mutation	SNP	G	G	A	rs121913499		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr2:209113113G>A	ENST00000415913.1	-	4	775	c.394C>T	c.(394-396)Cgt>Tgt	p.R132C	IDH1_ENST00000446179.1_Missense_Mutation_p.R132C|IDH1_ENST00000345146.2_Missense_Mutation_p.R132C	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132			R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:19117336}.|R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation). {ECO:0000269|PubMed:19117336}.|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:19117336}.|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate). {ECO:0000269|PubMed:18772396}.		2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)	p.R132C(446)|p.R132G(125)|p.R132S(106)|p.G131_R132>VL(1)|p.R132V(1)		NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TAAGCATGACGACCTATGATG	0.398			Mis		gliobastoma																																p.R132C	Pancreas(158;264 1958 3300 35450 36047)	.		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	IDH1,brain,glioma,+1	IDH1	23522	679	Substitution - Missense(678)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(280)|central_nervous_system(181)|bone(177)|biliary_tract(21)|soft_tissue(12)|large_intestine(2)|skin(2)|autonomic_ganglia(1)|endometrium(1)|NS(1)|prostate(1)	c.C394T						.						81.0	74.0	76.0					2																	209113113		2203	4300	6503	SO:0001583	missense	3417	exon4			CATGACGACCTAT		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.394C>T	2.37:g.209113113G>A	ENSP00000390265:p.Arg132Cys	Somatic	298.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	89.0	NM_005896	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	37	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550898	0.86127	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.57	5.57	0.84162	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94049	0.8093	H	0.99379	4.54	0.80722	D	1	B	0.29862	0.259	B	0.31245	0.126	D	0.94048	0.7315	10	0.87932	D	0	-20.0399	19.5341	0.95242	0.0:0.0:1.0:0.0	.	132	O75874	IDHC_HUMAN	C	132	ENSP00000260985:R132C;ENSP00000410513:R132C;ENSP00000390265:R132C;ENSP00000391075:R132C	ENSP00000260985:R132C	R	-	1	0	IDH1	208821358	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.074000	0.76791	2.616000	0.88540	0.555000	0.69702	CGT	.		0.398	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1		
IGF2R	3482	ucsc.edu;bcgsc.ca	37	6	160461609	160461609	+	Missense_Mutation	SNP	A	A	G	rs545847434		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr6:160461609A>G	ENST00000356956.1	+	11	1481	c.1333A>G	c.(1333-1335)Act>Gct	p.T445A		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	445					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TGGGAAAGGAACTCCTGTATT	0.473																																					p.T445A		.											.	IGF2R	118	0			c.A1333G						.						152.0	133.0	139.0					6																	160461609		2203	4300	6503	SO:0001583	missense	3482	exon11			AAAGGAACTCCTG	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1333A>G	6.37:g.160461609A>G	ENSP00000349437:p.Thr445Ala	Somatic	109.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_000876	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	A	0.018	-1.485152	0.01027	.	.	ENSG00000197081	ENST00000356956	T	0.03889	3.77	4.79	-3.33	0.04958	Mannose-6-phosphate receptor, binding (1);	1.292100	0.04883	N	0.448066	T	0.00580	0.0019	N	0.10685	0.025	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46176	-0.9210	10	0.07990	T	0.79	-12.1535	4.8824	0.13686	0.3426:0.0:0.3388:0.3185	.	445	P11717	MPRI_HUMAN	A	445	ENSP00000349437:T445A	ENSP00000349437:T445A	T	+	1	0	IGF2R	160381599	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.627000	0.05521	-0.509000	0.06532	-1.545000	0.00906	ACT	.		0.473	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
MAP2K1	5604	ucsc.edu;bcgsc.ca	37	15	66777396	66777396	+	Silent	SNP	A	A	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr15:66777396A>C	ENST00000307102.5	+	7	1293	c.762A>C	c.(760-762)gtA>gtC	p.V254V	MAP2K1_ENST00000566326.1_Silent_p.V78V	NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	254	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	TGTCTCTGGTAGAGATGGCGG	0.557																																					p.V254V		.											.	MAP2K1	978	0			c.A762C						.						131.0	119.0	123.0					15																	66777396		2201	4299	6500	SO:0001819	synonymous_variant	5604	exon7			TCTGGTAGAGATG	L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.762A>C	15.37:g.66777396A>C		Somatic	129.0	0.0		WXS	Illumina HiSeq	.	73.0	7.0	NM_002755		Silent	SNP	ENST00000307102.5	37	CCDS10216.1																																																																																			.		0.557	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256906.4		
KMT2A	4297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118373507	118373507	+	Silent	SNP	G	G	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr11:118373507G>A	ENST00000389506.5	+	27	6891	c.6891G>A	c.(6889-6891)gtG>gtA	p.V2297V	KMT2A_ENST00000354520.4_Silent_p.V2259V|KMT2A_ENST00000534358.1_Silent_p.V2300V			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2297					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAGACTTGGTGTCCAAGAGCT	0.443																																					p.V2300V		.											.	MLL	1255	0			c.G6900A						.						68.0	67.0	67.0					11																	118373507		2200	4296	6496	SO:0001819	synonymous_variant	4297	exon27			CTTGGTGTCCAAG	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.6891G>A	11.37:g.118373507G>A		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	13.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	ENST00000389506.5	37	CCDS31686.1																																																																																			.		0.443	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
MYH2	4620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	10432777	10432777	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr17:10432777C>A	ENST00000245503.5	-	25	3523	c.3139G>T	c.(3139-3141)Gaa>Taa	p.E1047*	MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Nonsense_Mutation_p.E1047*|RP11-799N11.1_ENST00000581304.1_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1047					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						AGTTTCTTTTCTTGCTCCAAG	0.383																																					p.E1047X		.											.	MYH2	194	0			c.G3139T						.						120.0	114.0	116.0					17																	10432777		2203	4300	6503	SO:0001587	stop_gained	4620	exon25			TCTTTTCTTGCTC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.3139G>T	17.37:g.10432777C>A	ENSP00000245503:p.Glu1047*	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	15.0	NM_017534	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Nonsense_Mutation	SNP	ENST00000245503.5	37	CCDS11156.1	.	.	.	.	.	.	.	.	.	.	C	43	10.488073	0.99414	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	.	.	.	5.24	5.24	0.73138	.	0.000000	0.39985	U	0.001214	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.0151	0.92890	0.0:1.0:0.0:0.0	.	.	.	.	X	1047	.	ENSP00000245503:E1047X	E	-	1	0	MYH2	10373502	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.346000	0.79347	2.718000	0.92993	0.591000	0.81541	GAA	.		0.383	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252726.3	NM_017534	
MPRIP	23164	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	17075144	17075144	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr17:17075144G>A	ENST00000341712.4	+	16	2276	c.2276G>A	c.(2275-2277)cGc>cAc	p.R759H	MPRIP_ENST00000444976.1_Missense_Mutation_p.R721H|RNU6-767P_ENST00000384132.1_RNA|MPRIP_ENST00000395804.3_Missense_Mutation_p.R759H|RP11-45M22.3_ENST00000584203.1_RNA|MPRIP_ENST00000395811.5_Missense_Mutation_p.R759H			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	759	Interaction with RHOA.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)		p.R759H(1)		biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						GAGAAAGACCGCCTCCTAGCC	0.562																																					p.R759H		.											.	MPRIP	90	1	Substitution - Missense(1)	biliary_tract(1)	c.G2276A						.						52.0	60.0	58.0					17																	17075144		2203	4300	6503	SO:0001583	missense	23164	exon16			AAGACCGCCTCCT	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.2276G>A	17.37:g.17075144G>A	ENSP00000342379:p.Arg759His	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	11.0	NM_015134	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	37	CCDS32578.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.4|28.4	4.916793|4.916793	0.92249|0.92249	.|.	.|.	ENSG00000133030|ENSG00000133030	ENST00000414263|ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	.|T;T;T;T	.|0.27256	.|1.68;2.0;2.03;2.03	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.057278	.|0.64402	.|D	.|0.000012	T|T	0.51398|0.51398	0.1672|0.1672	M|M	0.68952|0.68952	2.095|2.095	0.44149|0.44149	D|D	0.996948|0.996948	.|D;D;D	.|0.89917	.|1.0;0.999;1.0	.|D;D;D	.|0.80764	.|0.994;0.956;0.993	T|T	0.30534|0.30534	-0.9975|-0.9975	5|10	.|0.33940	.|T	.|0.23	-19.641|-19.641	20.032|20.032	0.97543|0.97543	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1123;759;759	.|Q9Y6X7;Q6WCQ1-2;Q6WCQ1	.|.;.;MPRIP_HUMAN	T|H	825|721;759;759;759	.|ENSP00000400189:R721H;ENSP00000379156:R759H;ENSP00000379149:R759H;ENSP00000342379:R759H	.|ENSP00000342379:R759H	A|R	+|+	1|2	0|0	MPRIP|MPRIP	17015869|17015869	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.982000|0.982000	0.71751|0.71751	9.387000|9.387000	0.97232|0.97232	2.743000|2.743000	0.94032|0.94032	0.655000|0.655000	0.94253|0.94253	GCC|CGC	.		0.562	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
PHKA2	5256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	18919622	18919622	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chrX:18919622A>T	ENST00000379942.4	-	27	3673	c.3008T>A	c.(3007-3009)cTg>cAg	p.L1003Q		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1003					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.L1003Q(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TTCACTCCTCAGTCTGTTAAT	0.552																																					p.L1003Q		.											.	PHKA2	131	1	Substitution - Missense(1)	biliary_tract(1)	c.T3008A						.						201.0	150.0	167.0					X																	18919622		2203	4300	6503	SO:0001583	missense	5256	exon27			CTCCTCAGTCTGT		CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3008T>A	X.37:g.18919622A>T	ENSP00000369274:p.Leu1003Gln	Somatic	315.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	101.0	NM_000292	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	ENST00000379942.4	37	CCDS14190.1	.	.	.	.	.	.	.	.	.	.	A	19.44	3.828428	0.71143	.	.	ENSG00000044446	ENST00000379942	D	0.92911	-3.13	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.93262	0.7853	M	0.77313	2.365	0.80722	D	1	P	0.51933	0.949	P	0.46885	0.53	D	0.93655	0.6976	10	0.62326	D	0.03	-13.6036	15.4998	0.75687	1.0:0.0:0.0:0.0	.	1003	P46019	KPB2_HUMAN	Q	1003	ENSP00000369274:L1003Q	ENSP00000369274:L1003Q	L	-	2	0	PHKA2	18829543	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	8.854000	0.92228	2.044000	0.60594	0.486000	0.48141	CTG	.		0.552	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055960.1	NM_000292	
PKNOX1	5316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	44450022	44450022	+	Silent	SNP	G	G	A	rs533645525		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr21:44450022G>A	ENST00000291547.5	+	11	1333	c.1122G>A	c.(1120-1122)acG>acA	p.T374T	PKNOX1_ENST00000432907.2_Silent_p.T257T	NM_004571.3	NP_004562.2	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	374					angiogenesis (GO:0001525)|camera-type eye development (GO:0043010)|erythrocyte differentiation (GO:0030218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(3)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|prostate(1)	22						CCATCACCACGCCCGTGAACA	0.527													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17474	0.0		0.0	False		,,,				2504	0.0				p.T374T		.											.	PKNOX1	153	0			c.G1122A						.						139.0	125.0	130.0					21																	44450022		2203	4300	6503	SO:0001819	synonymous_variant	5316	exon11			CACCACGCCCGTG		CCDS13692.1, CCDS68211.1	21q22.3	2011-06-20			ENSG00000160199	ENSG00000160199		"""Homeoboxes / TALE class"""	9022	protein-coding gene	gene with protein product		602100				9479508	Standard	NM_001286258		Approved	PREP1	uc002zcq.1	P55347	OTTHUMG00000086833	ENST00000291547.5:c.1122G>A	21.37:g.44450022G>A		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	40.0	NM_004571	O00528|Q8IWT7	Silent	SNP	ENST00000291547.5	37	CCDS13692.1																																																																																			.		0.527	PKNOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195520.3		
PML	5371	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	74290431	74290431	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr15:74290431T>G	ENST00000268058.3	+	2	312	c.216T>G	c.(214-216)tgT>tgG	p.C72W	PML_ENST00000567543.1_Missense_Mutation_p.C72W|PML_ENST00000563500.1_Missense_Mutation_p.C72W|PML_ENST00000359928.4_Missense_Mutation_p.C72W|PML_ENST00000564428.1_Missense_Mutation_p.C72W|PML_ENST00000395132.2_Missense_Mutation_p.C72W|PML_ENST00000565898.1_Missense_Mutation_p.C72W|PML_ENST00000436891.3_Missense_Mutation_p.C72W|PML_ENST00000569477.1_Missense_Mutation_p.C72W|PML_ENST00000435786.2_Missense_Mutation_p.C72W|PML_ENST00000354026.6_Missense_Mutation_p.C72W|PML_ENST00000569965.1_Missense_Mutation_p.C72W|PML_ENST00000395135.3_Missense_Mutation_p.C72W|PML_ENST00000268059.6_Missense_Mutation_p.C72W	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	72					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						TGCTGCCTTGTCTGCACACGC	0.667			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.C72W		.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML	1083	0			c.T216G						.						38.0	37.0	37.0					15																	74290431		2198	4297	6495	SO:0001583	missense	5371	exon2			GCCTTGTCTGCAC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.216T>G	15.37:g.74290431T>G	ENSP00000268058:p.Cys72Trp	Somatic	82.0	1.0		WXS	Illumina HiSeq	Phase_I	85.0	16.0	NM_033250	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	ENST00000268058.3	37	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.125593	0.56721	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	D	0.93076	-3.16	4.39	-0.553	0.11815	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);	0.093209	0.47852	D	0.000203	D	0.97346	0.9132	H	0.97806	4.08	0.58432	D	0.999996	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0;1.0;0.999;1.0	D	0.95454	0.8537	10	0.87932	D	0	-18.2146	9.0279	0.36241	0.0:0.6893:0.0:0.3107	.	72;72;72;72;72;72;72;72;72;72;75	P29590;P29590-11;P29590-12;P29590-5;E9PBR7;P29590-13;P29590-4;P29590-2;P29590-14;P29590-8;Q59H09	PML_HUMAN;.;.;.;.;.;.;.;.;.;.	W	72	ENSP00000268058:C72W	ENSP00000268058:C72W	C	+	3	2	PML	72077484	0.997000	0.39634	0.996000	0.52242	0.975000	0.68041	0.221000	0.17680	-0.254000	0.09500	-0.337000	0.08149	TGT	.		0.667	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
PRDM16	63976	ucsc.edu;bcgsc.ca	37	1	3328268	3328268	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr1:3328268G>T	ENST00000270722.5	+	9	1556	c.1507G>T	c.(1507-1509)Gcg>Tcg	p.A503S	PRDM16_ENST00000511072.1_Missense_Mutation_p.A504S|PRDM16_ENST00000441472.2_Missense_Mutation_p.A503S|PRDM16_ENST00000378391.2_Missense_Mutation_p.A503S|PRDM16_ENST00000442529.2_Missense_Mutation_p.A503S|PRDM16_ENST00000378398.3_Missense_Mutation_p.A504S|PRDM16_ENST00000514189.1_Missense_Mutation_p.A504S|PRDM16_ENST00000512462.1_3'UTR			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	503	Pro-rich.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CTTCTCCACGGCGCCTCCCAC	0.667			T	EVI1	"""MDS, AML"""																																p.A503S		.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16	660	0			c.G1507T						.						64.0	81.0	75.0					1																	3328268		1959	4116	6075	SO:0001583	missense	63976	exon9			TCCACGGCGCCTC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1507G>T	1.37:g.3328268G>T	ENSP00000270722:p.Ala503Ser	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	37	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349210	0.61183	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.06294	3.33;3.34;3.35;3.36;3.34;3.38;3.35;3.33;3.32	5.33	4.4	0.53042	.	0.000000	0.49916	U	0.000121	T	0.21145	0.0509	M	0.65975	2.015	0.39159	D	0.962364	P;D;D;D	0.76494	0.919;0.972;0.999;0.986	B;P;D;P	0.66979	0.324;0.673;0.948;0.733	T	0.03394	-1.1041	10	0.30854	T	0.27	.	15.8997	0.79362	0.0:0.1359:0.8641:0.0	.	503;503;503;503	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	S	504;504;503;503;503;504;503;319;319;312	ENSP00000426975:A504S;ENSP00000367651:A504S;ENSP00000407968:A503S;ENSP00000405253:A503S;ENSP00000367643:A503S;ENSP00000421400:A504S;ENSP00000270722:A503S;ENSP00000422504:A319S;ENSP00000425796:A312S	ENSP00000270722:A503S	A	+	1	0	PRDM16	3318128	1.000000	0.71417	0.012000	0.15200	0.566000	0.35808	7.797000	0.85911	1.239000	0.43787	0.603000	0.83216	GCG	.		0.667	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
RAB24	53917	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176728924	176728924	+	Splice_Site	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr5:176728924A>G	ENST00000303251.6	-	7	967		c.e7+1		PRELID1_ENST00000503216.1_5'Flank|PRELID1_ENST00000303204.4_5'Flank|RAB24_ENST00000393611.2_Splice_Site|RAB24_ENST00000303270.6_Splice_Site	NM_001031677.2	NP_001026847.1	Q969Q5	RAB24_HUMAN	RAB24, member RAS oncogene family						autophagy (GO:0006914)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	autophagic vacuole (GO:0005776)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGAAGCACACACCTGTCATCA	0.537																																					.		.											.	RAB24	159	0			c.547+2T>C						.						123.0	121.0	122.0					5																	176728924		2203	4300	6503	SO:0001630	splice_region_variant	53917	exon8			GCACACACCTGTC	AF087904	CCDS34300.1	5q35.3	2009-10-06			ENSG00000169228	ENSG00000169228		"""RAB, member RAS oncogene"""	9765	protein-coding gene	gene with protein product		612415					Standard	NM_001031677		Approved		uc003mfw.3	Q969Q5	OTTHUMG00000130849	ENST00000303251.6:c.547+1T>C	5.37:g.176728924A>G		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	10.0	NM_001031677	Q7Z4Z7	Splice_Site	SNP	ENST00000303251.6	37	CCDS34300.1	.	.	.	.	.	.	.	.	.	.	A	17.82	3.483375	0.63962	.	.	ENSG00000169228	ENST00000393611;ENST00000303251;ENST00000303270	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2969	0.66318	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RAB24	176661530	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	8.270000	0.89880	1.969000	0.57287	0.459000	0.35465	.	.		0.537	RAB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253416.1	NM_130781	Intron
RAF1	5894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	12645687	12645687	+	Missense_Mutation	SNP	G	G	C	rs397516828		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr3:12645687G>C	ENST00000251849.4	-	7	1221	c.782C>G	c.(781-783)cCt>cGt	p.P261R	RAF1_ENST00000442415.2_Missense_Mutation_p.P261R|RAF1_ENST00000534997.1_Missense_Mutation_p.P46R|RAF1_ENST00000542177.1_Missense_Mutation_p.P180R	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	261			P -> A (in NS5; shows in vitro greater kinase activity and enhanced MAPK1 activation than wild-type). {ECO:0000269|PubMed:17603482}.|P -> L (in NS5; shows greater kinase activity and enhanced MAPK1 activation than wild-type). {ECO:0000269|PubMed:17603483}.|P -> S (in NS5; shows in vitro greater kinase activity and enhanced MAPK1 activation than wild-type). {ECO:0000269|PubMed:17603482, ECO:0000269|PubMed:17603483, ECO:0000269|PubMed:20683980}.		activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.P261R(1)	ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	GTGGACATTAGGTGTGGATGT	0.522			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																												p.P261R		.		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	.	RAF1	1404	1	Substitution - Missense(1)	biliary_tract(1)	c.C782G	GRCh37	CM073296	RAF1	M		.						153.0	136.0	142.0					3																	12645687		2203	4300	6503	SO:0001583	missense	5894	exon7	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	ACATTAGGTGTGG	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.782C>G	3.37:g.12645687G>C	ENSP00000251849:p.Pro261Arg	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	57.0	NM_002880	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	ENST00000251849.4	37	CCDS2612.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932839	0.73442	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	T;T;T;T;T	0.78707	-1.04;-1.2;-0.99;-0.9;-1.02	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.89375	0.6697	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.994;0.996	D	0.89645	0.3865	10	0.87932	D	0	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	180;46;261	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	R	261;261;140;46;180	ENSP00000251849:P261R;ENSP00000401888:P261R;ENSP00000398591:P140R;ENSP00000441186:P46R;ENSP00000443567:P180R	ENSP00000251849:P261R	P	-	2	0	RAF1	12620687	1.000000	0.71417	0.932000	0.37286	0.271000	0.26615	9.807000	0.99171	2.861000	0.98227	0.655000	0.94253	CCT	.		0.522	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252015.2	NM_002880	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	109380447	109380447	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr2:109380447A>G	ENST00000283195.6	+	20	3578	c.3452A>G	c.(3451-3453)aAc>aGc	p.N1151S		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1151					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.N1151S(2)	RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						GAGACAGCAAACAAGAATCAT	0.433																																					p.N1151S		.											.	RANBP2	675	2	Substitution - Missense(2)	biliary_tract(2)	c.A3452G						.						112.0	108.0	110.0					2																	109380447		2203	4299	6502	SO:0001583	missense	5903	exon20			CAGCAAACAAGAA	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3452A>G	2.37:g.109380447A>G	ENSP00000283195:p.Asn1151Ser	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	71.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	A	1.687	-0.505119	0.04261	.	.	ENSG00000153201	ENST00000283195	T	0.27890	1.64	5.44	-1.4	0.08968	.	.	.	.	.	T	0.19005	0.0456	L	0.31294	0.92	0.22034	N	0.999406	B	0.02656	0.0	B	0.06405	0.002	T	0.20505	-1.0273	9	0.44086	T	0.13	-1.5985	6.1143	0.20117	0.5948:0.1234:0.2817:0.0	.	1151	P49792	RBP2_HUMAN	S	1151	ENSP00000283195:N1151S	ENSP00000283195:N1151S	N	+	2	0	RANBP2	108746879	0.848000	0.29623	0.108000	0.21378	0.011000	0.07611	0.900000	0.28431	-0.502000	0.06596	-0.472000	0.04984	AAC	.		0.433	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RBM20	282996	ucsc.edu;bcgsc.ca	37	10	112559555	112559555	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr10:112559555A>G	ENST00000369519.3	+	7	1737	c.1679A>G	c.(1678-1680)gAg>gGg	p.E560G		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	560	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						GCCTTTTTAGAGATGGCTTAC	0.423																																					p.E560G		.											.	.	.	0			c.A1679G						.						87.0	80.0	82.0					10																	112559555		692	1591	2283	SO:0001583	missense	282996	exon7			TTTTAGAGATGGC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.1679A>G	10.37:g.112559555A>G	ENSP00000358532:p.Glu560Gly	Somatic	101.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001134363	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.651328	0.88056	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	T	0.79845	-1.31	5.19	5.19	0.71726	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.248134	0.33631	N	0.004718	D	0.90940	0.7152	M	0.88310	2.945	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.92710	0.6182	10	0.87932	D	0	-25.5553	15.0212	0.71632	1.0:0.0:0.0:0.0	.	560	Q5T481	RBM20_HUMAN	G	560	ENSP00000358532:E560G	ENSP00000358532:E560G	E	+	2	0	RBM20	112549545	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.178000	0.94855	2.095000	0.63458	0.533000	0.62120	GAG	.		0.423	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
RSRC2	65117	broad.mit.edu;bcgsc.ca	37	12	122991425	122991425	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr12:122991425T>C	ENST00000331738.7	-	9	1226	c.1081A>G	c.(1081-1083)Aac>Gac	p.N361D	RSRC2_ENST00000354654.2_Missense_Mutation_p.N313D|RSRC2_ENST00000392442.2_5'UTR	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	361							poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TGGTCCTTGTTTCCAAAATTC	0.333																																					p.N361D		.											.	RSRC2	91	0			c.A1081G						.						174.0	169.0	171.0					12																	122991425		2203	4300	6503	SO:0001583	missense	65117	exon9			CCTTGTTTCCAAA	AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.1081A>G	12.37:g.122991425T>C	ENSP00000330188:p.Asn361Asp	Somatic	230.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	7.0	NM_023012	Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	ENST00000331738.7	37	CCDS31920.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.28|15.28	2.787893|2.787893	0.49997|0.49997	.|.	.|.	ENSG00000111011|ENSG00000111011	ENST00000418773|ENST00000331738;ENST00000354654	.|T;T	.|0.36878	.|1.23;1.23	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.30166|0.30166	0.0756|0.0756	N|N	0.02225|0.02225	-0.63|-0.63	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B;P	.|0.49696	.|0.017;0.017;0.927	.|B;B;D	.|0.67725	.|0.021;0.031;0.953	T|T	0.22277|0.22277	-1.0221|-1.0221	6|10	0.87932|0.02654	D|T	0|1	.|.	16.3123|16.3123	0.82883|0.82883	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|313;361;130	.|Q7L4I2-2;Q7L4I2;B3KMH4	.|.;RSRC2_HUMAN;.	R|D	362|361;313	.|ENSP00000330188:N361D;ENSP00000346678:N313D	ENSP00000398858:K362R|ENSP00000330188:N361D	K|N	-|-	2|1	0|0	RSRC2|RSRC2	121557378|121557378	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.638000|7.638000	0.83328|0.83328	2.308000|2.308000	0.77769|0.77769	0.533000|0.533000	0.62120|0.62120	AAA|AAC	.		0.333	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395096.3	NM_023012	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39010081	39010081	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr19:39010081G>A	ENST00000359596.3	+	67	10246	c.10246G>A	c.(10246-10248)Gtg>Atg	p.V3416M	RYR1_ENST00000360985.3_Missense_Mutation_p.V3416M|RYR1_ENST00000355481.4_Missense_Mutation_p.V3416M			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3416					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CATCCGCTACGTGGACAACAA	0.682																																					p.V3416M		.											.	RYR1	100	0			c.G10246A						.						44.0	34.0	37.0					19																	39010081		2202	4298	6500	SO:0001583	missense	6261	exon67			CGCTACGTGGACA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.10246G>A	19.37:g.39010081G>A	ENSP00000352608:p.Val3416Met	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	17.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.293923	0.40594	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985;ENST00000538206	D;D;D	0.98028	-4.64;-4.67;-4.65	3.71	3.71	0.42584	.	0.091083	0.42294	U	0.000730	D	0.98661	0.9551	M	0.85542	2.76	0.52099	D	0.99994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.992	D	0.99655	1.0992	10	0.87932	D	0	.	15.3029	0.73969	0.0:0.0:1.0:0.0	.	3416;3416;3416	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	M	3416;3416;3416;336	ENSP00000352608:V3416M;ENSP00000347667:V3416M;ENSP00000354254:V3416M	ENSP00000347667:V3416M	V	+	1	0	RYR1	43701921	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	9.520000	0.98027	1.921000	0.55644	0.555000	0.69702	GTG	.		0.682	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
SGMS1	259230	ucsc.edu;bcgsc.ca	37	10	52103374	52103374	+	Silent	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr10:52103374A>G	ENST00000361781.2	-	7	1460	c.501T>C	c.(499-501)ccT>ccC	p.P167P	SGMS1_ENST00000361543.2_Silent_p.P167P|SGMS1_ENST00000492601.2_5'Flank|SGMS1_ENST00000429490.1_Intron	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	173					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						CCGGTAGTGGAGGCTGCACCT	0.458																																					p.P167P		.											.	SGMS1	227	0			c.T501C						.						48.0	44.0	45.0					10																	52103374		2203	4300	6503	SO:0001819	synonymous_variant	259230	exon7			TAGTGGAGGCTGC	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.501T>C	10.37:g.52103374A>G		Somatic	118.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_147156	Q68U43|Q6EKK0|Q75SP1	Silent	SNP	ENST00000361781.2	37	CCDS7240.1																																																																																			.		0.458	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156	
SLC35A3	23443	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	100483326	100483326	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr1:100483326C>T	ENST00000370155.3	+	7	1234	c.842C>T	c.(841-843)tCa>tTa	p.S281L	SLC35A3_ENST00000427993.2_Missense_Mutation_p.S281L|SLC35A3_ENST00000370156.3_3'UTR|SLC35A3_ENST00000465289.1_Intron|SLC35A3_ENST00000370153.1_Missense_Mutation_p.S323L	NM_012243.1	NP_036375.1	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3	281					transmembrane transport (GO:0055085)|UDP-N-acetylglucosamine metabolic process (GO:0006047)|UDP-N-acetylglucosamine transport (GO:0015788)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)|UDP-N-acetylglucosamine transmembrane transporter activity (GO:0005462)	p.S281L(1)		biliary_tract(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	11		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		ATAATATTATCAACATTGATC	0.303																																					p.S323L	Ovarian(7;298 356 944 2149 6911)	.											.	SLC35A3	90	1	Substitution - Missense(1)	biliary_tract(1)	c.C968T						.						62.0	64.0	63.0					1																	100483326		2202	4286	6488	SO:0001583	missense	23443	exon7			TATTATCAACATT	AB021981	CCDS762.1, CCDS60204.1, CCDS60205.1	1p21	2013-05-22			ENSG00000117620	ENSG00000117620		"""Solute carriers"""	11023	protein-coding gene	gene with protein product		605632	"""solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3"""			10393322	Standard	NM_001271685		Approved		uc001dsr.2	Q9Y2D2	OTTHUMG00000010805	ENST00000370155.3:c.842C>T	1.37:g.100483326C>T	ENSP00000359174:p.Ser281Leu	Somatic	913.0	2.0		WXS	Illumina HiSeq	.	495.0	74.0	NM_001271685	A8K3F8|D3DT54|Q68CR2|Q9BSB7	Missense_Mutation	SNP	ENST00000370155.3	37	CCDS762.1	.	.	.	.	.	.	.	.	.	.	C	33	5.289102	0.95517	.	.	ENSG00000117620	ENST00000370155;ENST00000427993;ENST00000370153	T;T;T	0.46819	0.86;0.86;0.86	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.74137	0.3677	H	0.96489	3.83	0.80722	D	1	D;P	0.57899	0.981;0.866	P;P	0.60117	0.869;0.619	T	0.83062	-0.0147	10	0.87932	D	0	-28.8252	19.3509	0.94384	0.0:1.0:0.0:0.0	.	322;281	Q9Y2D2-2;Q9Y2D2	.;S35A3_HUMAN	L	281;281;323	ENSP00000359174:S281L;ENSP00000414947:S281L;ENSP00000359172:S323L	ENSP00000359172:S323L	S	+	2	0	SLC35A3	100255914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.774000	0.85478	2.653000	0.90120	0.655000	0.94253	TCA	.		0.303	SLC35A3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000029783.1	NM_012243	
SNX19	399979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	130785772	130785772	+	Silent	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr11:130785772A>G	ENST00000265909.4	-	1	632	c.63T>C	c.(61-63)aaT>aaC	p.N21N	SNX19_ENST00000533318.1_Intron|SNX19_ENST00000533214.1_Silent_p.N21N|SNX19_ENST00000530356.1_Intron|SNX19_ENST00000528555.1_Intron|SNX19_ENST00000539184.1_Intron	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	21					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TCAACAGGTTATTGAGGTGAC	0.562																																					p.N21N		.											.	SNX19	229	0			c.T63C						.						72.0	61.0	65.0					11																	130785772		2201	4297	6498	SO:0001819	synonymous_variant	399979	exon1			CAGGTTATTGAGG	D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.63T>C	11.37:g.130785772A>G		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	11.0	NM_014758	E9PKB9|Q8IV55	Silent	SNP	ENST00000265909.4	37	CCDS31721.1																																																																																			.		0.562	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385649.1	NM_014758	
SRSF12	135295	ucsc.edu;bcgsc.ca	37	6	89816912	89816912	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr6:89816912T>C	ENST00000452027.2	-	2	324	c.131A>G	c.(130-132)gAc>gGc	p.D44G		NM_080743.4	NP_542781.3	Q8WXF0	SRS12_HUMAN	serine/arginine-rich splicing factor 12	44	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytoplasmic transport (GO:0016482)|mRNA 5'-splice site recognition (GO:0000395)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|spliceosomal tri-snRNP complex assembly (GO:0000244)	nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RS domain binding (GO:0050733)|unfolded protein binding (GO:0051082)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)	8						AGTGTAGAAGTCAAGTGGAAT	0.393																																					p.D44G		.											.	SRSF12	90	0			c.A131G						.						118.0	125.0	123.0					6																	89816912		2167	4296	6463	SO:0001583	missense	135295	exon2			TAGAAGTCAAGTG	AF449428	CCDS47459.1	6q16.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000154548	ENSG00000154548		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	21220	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 19"", ""SR splicing factor 12"""		"""splicing factor, arginine/serine-rich 13B"""	SFRS13B		11684676, 20516191	Standard	NM_080743		Approved	SRrp35, SFRS19	uc021zcq.1	Q8WXF0	OTTHUMG00000015192	ENST00000452027.2:c.131A>G	6.37:g.89816912T>C	ENSP00000414302:p.Asp44Gly	Somatic	130.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_080743	B2RA22|Q5T7K0|Q8WW25	Missense_Mutation	SNP	ENST00000452027.2	37	CCDS47459.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.335766	0.81801	.	.	ENSG00000154548	ENST00000452027	T	0.48522	0.81	5.34	5.34	0.76211	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.182572	0.36665	N	0.002468	T	0.67998	0.2953	M	0.88775	2.98	0.50313	D	0.999865	D	0.76494	0.999	D	0.79108	0.992	T	0.75309	-0.3363	10	0.87932	D	0	.	14.7212	0.69308	0.0:0.0:0.0:1.0	.	44	Q8WXF0	SRS12_HUMAN	G	44	ENSP00000414302:D44G	ENSP00000414302:D44G	D	-	2	0	SRSF12	89873631	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.026000	0.76455	2.367000	0.80283	0.528000	0.53228	GAC	.		0.393	SRSF12-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041474.2	NM_080743	
STEAP4	79689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	87912274	87912274	+	Missense_Mutation	SNP	G	G	C	rs370475892		TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr7:87912274G>C	ENST00000380079.4	-	3	767	c.666C>G	c.(664-666)gaC>gaG	p.D222E	STEAP4_ENST00000414498.1_Missense_Mutation_p.D222E|AC003991.3_ENST00000595121.1_RNA|AC003991.3_ENST00000600908.1_RNA|STEAP4_ENST00000301959.5_Intron|AC003991.3_ENST00000434733.1_RNA|AC003991.3_ENST00000447758.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	222					copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					GGTAGATTACGTCTCTTATAA	0.373																																					p.D222E		.											.	STEAP4	90	0			c.C666G						.						88.0	85.0	86.0					7																	87912274		1883	4108	5991	SO:0001583	missense	79689	exon4			GATTACGTCTCTT	AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.666C>G	7.37:g.87912274G>C	ENSP00000369419:p.Asp222Glu	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	43.0	NM_001205315	Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Missense_Mutation	SNP	ENST00000380079.4	37	CCDS43611.1	.	.	.	.	.	.	.	.	.	.	G	0.001	-3.158991	0.00028	.	.	ENSG00000127954	ENST00000380079;ENST00000414498	T;T	0.10005	3.27;2.92	6.08	-12.2	0.00006	.	0.488014	0.25154	N	0.032740	T	0.04452	0.0122	N	0.25789	0.76	0.22050	N	0.999399	B;B	0.17038	0.02;0.008	B;B	0.17098	0.017;0.017	T	0.70781	-0.4779	10	0.16896	T	0.51	-0.4377	6.9941	0.24772	0.4511:0.1088:0.3663:0.0738	.	222;222	C9JS50;Q687X5	.;STEA4_HUMAN	E	222	ENSP00000369419:D222E;ENSP00000394399:D222E	ENSP00000369419:D222E	D	-	3	2	STEAP4	87750210	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-6.432000	0.00066	-8.793000	0.00000	-2.933000	0.00087	GAC	.		0.373	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332712.4	NM_024636	
TARM1	441864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54573362	54573362	+	Silent	SNP	C	C	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr19:54573362C>T	ENST00000432826.1	-	5	735	c.711G>A	c.(709-711)ctG>ctA	p.L237L	TARM1_ENST00000446034.2_Silent_p.L245L	NM_001135686.1	NP_001129158.2	B6A8C7	TARM1_HUMAN	T cell-interacting, activating receptor on myeloid cells 1	237						integral component of membrane (GO:0016021)				endometrium(1)|stomach(2)	3						CAGCCAGACCCAGTCGTACGA	0.557																																					p.L237L		.											.	.	.	0			c.G711A						.						78.0	79.0	79.0					19																	54573362		692	1591	2283	SO:0001819	synonymous_variant	441864	exon5			CAGACCCAGTCGT		CCDS46173.1	19q13.42	2013-01-29			ENSG00000248385	ENSG00000248385		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	37250	protein-coding gene	gene with protein product							Standard	XM_005258952		Approved		uc010yei.1	B6A8C7		ENST00000432826.1:c.711G>A	19.37:g.54573362C>T		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	8.0	NM_001135686	B4DWY4	Silent	SNP	ENST00000432826.1	37	CCDS46173.1																																																																																			.		0.557	TARM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465679.1	NM_001135686	
TMEM151B	441151	ucsc.edu;bcgsc.ca	37	6	44243417	44243417	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr6:44243417T>C	ENST00000451188.2	+	3	1131	c.854T>C	c.(853-855)gTg>gCg	p.V285A	RP11-444E17.6_ENST00000505802.1_Intron|TMEM151B_ENST00000438774.2_Intron	NM_001137560.1	NP_001131032.1	Q8IW70	T151B_HUMAN	transmembrane protein 151B	285						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)	6						GAGTTCATGGTGGCCTTCCCG	0.692																																					p.V285A		.											.	.	.	0			c.T854C						.						92.0	100.0	98.0					6																	44243417		692	1591	2283	SO:0001583	missense	441151	exon3			TCATGGTGGCCTT	AK126839	CCDS47437.1	6p21.1	2009-04-17	2007-10-25	2007-10-25	ENSG00000178233	ENSG00000178233			21315	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 137"", ""transmembrane protein 193"""	C6orf137, TMEM193			Standard	NM_001137560		Approved	bA444E17.5	uc003oxh.2	Q8IW70	OTTHUMG00000014765	ENST00000451188.2:c.854T>C	6.37:g.44243417T>C	ENSP00000393161:p.Val285Ala	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_001137560	Q5T9V7	Missense_Mutation	SNP	ENST00000451188.2	37	CCDS47437.1	.	.	.	.	.	.	.	.	.	.	T	17.12	3.308470	0.60305	.	.	ENSG00000178233	ENST00000451188	.	.	.	4.67	3.49	0.39957	.	0.123056	0.53938	D	0.000051	T	0.41673	0.1169	L	0.53249	1.67	0.80722	D	1	P	0.42871	0.792	B	0.43301	0.415	T	0.41893	-0.9483	9	0.51188	T	0.08	.	11.7639	0.51920	0.0:0.0:0.1477:0.8523	.	285	Q8IW70	T151B_HUMAN	A	285	.	ENSP00000393161:V285A	V	+	2	0	TMEM151B	44351395	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.064000	0.71169	0.893000	0.36288	0.379000	0.24179	GTG	.		0.692	TMEM151B-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040740.2	NM_001039704	
TNPO1	3842	hgsc.bcm.edu;bcgsc.ca	37	5	72144303	72144303	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr5:72144303delC	ENST00000337273.5	+	2	533	c.107delC	c.(106-108)accfs	p.T36fs	TNPO1_ENST00000447967.2_Frame_Shift_Del_p.T28fs|TNPO1_ENST00000506351.2_Frame_Shift_Del_p.T28fs|TNPO1_ENST00000513944.1_3'UTR|TNPO1_ENST00000523768.1_Frame_Shift_Del_p.T36fs|TNPO1_ENST00000454282.1_Frame_Shift_Del_p.T36fs	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	36					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		CCAGACACCACCATCCAGAGA	0.632																																					p.T36fs		.											.	TNPO1	228	0			c.107delC						.						88.0	77.0	81.0					5																	72144303		2203	4300	6503	SO:0001589	frameshift_variant	3842	exon2			ACACCACCATCCA	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.107delC	5.37:g.72144303delC	ENSP00000336712:p.Thr36fs	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	30.0	NM_002270	B4DVC6|Q92957|Q92975	Frame_Shift_Del	DEL	ENST00000337273.5	37	CCDS43329.1																																																																																			.		0.632	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
TPM4	7171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16186928	16186928	+	5'Flank	SNP	G	G	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr19:16186928G>C	ENST00000300933.4	+	0	0				TPM4_ENST00000538887.1_Missense_Mutation_p.E62D|TPM4_ENST00000344824.6_Missense_Mutation_p.E62D	NM_003290.2	NP_003281.1	P67936	TPM4_HUMAN	tropomyosin 4						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|osteoblast differentiation (GO:0001649)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|membrane (GO:0016020)|muscle thin filament tropomyosin (GO:0005862)|podosome (GO:0002102)|stress fiber (GO:0001725)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)		TPM4/ALK(12)	breast(1)|large_intestine(3)	4						AATATTCCGAGGACCTGAAGG	0.627			T	ALK	ALCL																																p.E62D		.		Dom	yes		19	19p13.1	7171	tropomyosin 4		L	.	TPM4	316	0			c.G186C						.						30.0	32.0	31.0					19																	16186928		1566	3576	5142	SO:0001631	upstream_gene_variant	7171	exon2			TTCCGAGGACCTG		CCDS12338.1, CCDS46007.1	19p13.1	2013-03-11			ENSG00000167460	ENSG00000167460		"""Tropomyosins"""	12013	protein-coding gene	gene with protein product		600317				8641132	Standard	NM_003290		Approved		uc002ndi.2	P67936	OTTHUMG00000182134		19.37:g.16186928G>C	Exception_encountered	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	95.0	NM_001145160	P07226|Q15659|Q5U0D9|Q9BU85|Q9H8Q3|Q9UCS1|Q9UCS2|Q9UCS3|Q9UCS4	Missense_Mutation	SNP	ENST00000300933.4	37	CCDS12338.1	.	.	.	.	.	.	.	.	.	.	G	9.144	1.014589	0.19355	.	.	ENSG00000167460	ENST00000344824;ENST00000538887	T;T	0.80033	-1.33;-1.33	3.74	1.45	0.22620	.	0.522755	0.15047	N	0.283506	T	0.69133	0.3077	.	.	.	0.24558	N	0.993989	B	0.11235	0.004	B	0.19148	0.024	T	0.61397	-0.7071	9	0.59425	D	0.04	-9.6471	6.5984	0.22687	0.3507:0.0:0.6493:0.0	.	62	P67936-2	.	D	62	ENSP00000345230:E62D;ENSP00000439135:E62D	ENSP00000345230:E62D	E	+	3	2	TPM4	16047928	0.994000	0.37717	0.029000	0.17559	0.004000	0.04260	1.668000	0.37481	0.776000	0.33473	0.591000	0.81541	GAG	.		0.627	TPM4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000459673.2	NM_003290	
TPST1	8460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	65705902	65705902	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr7:65705902C>G	ENST00000304842.5	+	2	915	c.490C>G	c.(490-492)Ctg>Gtg	p.L164V	TPST1_ENST00000480281.1_Intron	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	164					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)	p.L164V(1)		NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						TCCTTTTGCCCTGAAATCTTT	0.418																																					p.L164V		.											.	TPST1	90	1	Substitution - Missense(1)	biliary_tract(1)	c.C490G						.						57.0	58.0	58.0					7																	65705902		2203	4300	6503	SO:0001583	missense	8460	exon2			TTTGCCCTGAAAT	AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.490C>G	7.37:g.65705902C>G	ENSP00000302413:p.Leu164Val	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	32.0	NM_003596	A4D2M0|Q6FGM7	Missense_Mutation	SNP	ENST00000304842.5	37	CCDS5533.1	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357593	0.61293	.	.	ENSG00000169902	ENST00000304842;ENST00000544114	T	0.51071	0.72	5.75	4.87	0.63330	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000001	T	0.55593	0.1930	M	0.72353	2.195	0.54753	D	0.999989	P;P	0.47677	0.895;0.899	P;P	0.51297	0.567;0.665	T	0.57429	-0.7813	10	0.48119	T	0.1	-11.2355	9.1999	0.37251	0.0:0.7746:0.0:0.2254	.	164;164	F5H7U7;O60507	.;TPST1_HUMAN	V	164	ENSP00000302413:L164V	ENSP00000302413:L164V	L	+	1	2	TPST1	65343337	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.688000	0.37690	1.416000	0.47057	0.585000	0.79938	CTG	.		0.418	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251705.2	NM_003596	
TRPV3	162514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	3417232	3417232	+	Silent	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr17:3417232T>C	ENST00000576742.1	-	18	2673	c.2352A>G	c.(2350-2352)gaA>gaG	p.E784E	TRPV3_ENST00000301365.4_Silent_p.E785E|SPATA22_ENST00000541913.1_5'Flank	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	784					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	TTTCCGGGAATTCCTCGACTT	0.468																																					p.E785E		.											.	TRPV3	94	0			c.A2355G						.						124.0	113.0	117.0					17																	3417232		2203	4300	6503	SO:0001819	synonymous_variant	162514	exon18			CGGGAATTCCTCG	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.2352A>G	17.37:g.3417232T>C		Somatic	314.0	1.0		WXS	Illumina HiSeq	Phase_I	217.0	71.0	NM_001258205	Q8NDW7|Q8NET9|Q8NFH2	Silent	SNP	ENST00000576742.1	37	CCDS11029.1																																																																																			.		0.468	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179412302	179412302	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr2:179412302A>G	ENST00000591111.1	-	289	89352	c.89128T>C	c.(89128-89130)Tcg>Ccg	p.S29710P	TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S22478P|TTN_ENST00000342992.6_Missense_Mutation_p.S28783P|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S31351P|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S22286P|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S22411P|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29710	Fibronectin type-III 116. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGTACCCGATTCACGCTTT	0.433																																					p.S31351P		.											.	TTN	636	0			c.T94051C						.						100.0	100.0	100.0					2																	179412302		1931	4130	6061	SO:0001583	missense	7273	exon339			TACCCGATTCACG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89128T>C	2.37:g.179412302A>G	ENSP00000465570:p.Ser29710Pro	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	31.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	16.80	3.223076	0.58668	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.92	5.92	0.95590	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65974	0.2743	L	0.41124	1.26	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.68554	-0.5378	9	0.87932	D	0	.	16.3526	0.83220	1.0:0.0:0.0:0.0	.	22286;22411;22478;29710	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	P	28783;22286;22478;22411;22283	ENSP00000343764:S28783P;ENSP00000434586:S22286P;ENSP00000340554:S22478P;ENSP00000352154:S22411P	ENSP00000340554:S22478P	S	-	1	0	TTN	179120548	1.000000	0.71417	0.984000	0.44739	0.913000	0.54294	9.339000	0.96797	2.255000	0.74692	0.533000	0.62120	TCG	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	179532037	179532037	+	Intron	SNP	G	G	A			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr2:179532037G>A	ENST00000591111.1	-	153	34489				TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.T11908I|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCTCTGGTTGTATCAGGTTC	0.338																																					p.T11908I		.											.	TTN	636	0			c.C35723T						.						18.0	18.0	18.0					2																	179532037		875	1991	2866	SO:0001627	intron_variant	7273	exon162			CTGGTTGTATCAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34264+2907C>T	2.37:g.179532037G>A		Somatic	280.0	1.0		WXS	Illumina HiSeq	Phase_I	160.0	42.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	0.167	-1.075556	0.01903	.	.	ENSG00000155657	ENST00000541862;ENST00000392423	.	.	.	5.32	-0.169	0.13339	.	.	.	.	.	T	0.18299	0.0439	.	.	.	0.09310	N	1	B	0.22346	0.068	B	0.13407	0.009	T	0.23691	-1.0181	6	.	.	.	.	4.6533	0.12605	0.5242:0.1717:0.3041:0.0	.	210	Q71S18	.	I	210;62	.	.	T	-	2	0	TTN	179240282	0.000000	0.05858	0.108000	0.21378	0.040000	0.13550	0.570000	0.23653	0.063000	0.16370	-1.058000	0.02302	ACA	.		0.338	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
U2AF2	11338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	56185355	56185355	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr19:56185355C>T	ENST00000308924.4	+	12	1389	c.1349C>T	c.(1348-1350)aCg>aTg	p.T450M	EPN1_ENST00000270460.6_5'Flank|U2AF2_ENST00000450554.2_Missense_Mutation_p.T446M|CTD-2537I9.13_ENST00000592252.1_RNA|EPN1_ENST00000085079.7_5'Flank|U2AF2_ENST00000590551.1_Missense_Mutation_p.T282M|CTD-2537I9.12_ENST00000589456.1_RNA|EPN1_ENST00000411543.2_5'Flank|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	450	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.T450M(1)		biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CAGGGCCTGACGGGCCGCAAG	0.577																																					p.T450M		.											.	U2AF2	91	1	Substitution - Missense(1)	biliary_tract(1)	c.C1349T						.						89.0	84.0	86.0					19																	56185355		2203	4300	6503	SO:0001583	missense	11338	exon12			GCCTGACGGGCCG	BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.1349C>T	19.37:g.56185355C>T	ENSP00000307863:p.Thr450Met	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	22.0	NM_007279	Q96HC5	Missense_Mutation	SNP	ENST00000308924.4	37	CCDS12933.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373101	0.82573	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.16324	2.35;2.35	4.42	4.42	0.53409	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	T	0.40619	0.1124	M	0.71871	2.18	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.978;0.943	T	0.24190	-1.0167	10	0.42905	T	0.14	-22.4265	16.161	0.81712	0.0:1.0:0.0:0.0	.	450;446	P26368;P26368-2	U2AF2_HUMAN;.	M	450;446	ENSP00000307863:T450M;ENSP00000388475:T446M	ENSP00000307863:T450M	T	+	2	0	U2AF2	60877167	1.000000	0.71417	0.951000	0.38953	0.990000	0.78478	5.200000	0.65158	2.173000	0.68751	0.478000	0.44815	ACG	.		0.577	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453599.1	NM_007279	
USP28	57646	broad.mit.edu;bcgsc.ca	37	11	113699932	113699932	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr11:113699932T>C	ENST00000003302.4	-	10	1114	c.1046A>G	c.(1045-1047)aAg>aGg	p.K349R	USP28_ENST00000544967.1_Missense_Mutation_p.K57R|USP28_ENST00000260188.5_Missense_Mutation_p.K349R|USP28_ENST00000545540.1_Missense_Mutation_p.K224R|USP28_ENST00000537706.1_Missense_Mutation_p.K349R|USP28_ENST00000542033.1_5'Flank	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	349	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTGTCCATACTTCACCGAGTG	0.478																																					p.K349R	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	.											.	USP28	706	0			c.A1046G						.						175.0	131.0	146.0					11																	113699932		2201	4296	6497	SO:0001583	missense	57646	exon10			CCATACTTCACCG	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1046A>G	11.37:g.113699932T>C	ENSP00000003302:p.Lys349Arg	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	6.0	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	37	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	T	7.362	0.624955	0.14257	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475;ENST00000537706	T;T;T;T;T;T	0.73897	1.33;1.31;0.82;1.32;0.78;-0.79	5.36	4.21	0.49690	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.330121	0.35040	N	0.003485	T	0.54382	0.1855	N	0.13327	0.33	0.29423	N	0.860406	B;B;B;B	0.20261	0.043;0.025;0.001;0.016	B;B;B;B	0.21360	0.026;0.034;0.012;0.011	T	0.48352	-0.9043	10	0.34782	T	0.22	-20.0537	7.0279	0.24950	0.0:0.0743:0.1505:0.7751	.	224;349;349;57	B4E3L3;Q6NZX9;Q96RU2;G3V1N5	.;.;UBP28_HUMAN;.	R	349;349;57;224;113;349	ENSP00000003302:K349R;ENSP00000260188:K349R;ENSP00000442431:K57R;ENSP00000444991:K224R;ENSP00000442257:K113R;ENSP00000445743:K349R	ENSP00000003302:K349R	K	-	2	0	USP28	113205142	0.996000	0.38824	0.999000	0.59377	0.218000	0.24690	2.098000	0.41757	0.842000	0.35045	0.379000	0.24179	AAG	.		0.478	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
WDR26	80232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	224585919	224585919	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr1:224585919A>T	ENST00000414423.2	-	12	1847	c.1654T>A	c.(1654-1656)Tta>Ata	p.L552I	MIR4742_ENST00000581069.1_RNA|WDR26_ENST00000366852.2_3'UTR|WDR26_ENST00000479727.1_5'UTR|WDR26_ENST00000295024.6_Missense_Mutation_p.L405I	NM_001115113.2|NM_025160.6	NP_001108585.2|NP_079436.4	Q9H7D7	WDR26_HUMAN	WD repeat domain 26	552						cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.L552I(1)|p.L405I(1)		biliary_tract(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)	18				GBM - Glioblastoma multiforme(131;0.0104)		AAGTCCCATAAATGAACTCCC	0.343																																					p.L552I		.											.	WDR26	90	2	Substitution - Missense(2)	biliary_tract(2)	c.T1654A						.						87.0	86.0	87.0					1																	224585919		2203	4300	6503	SO:0001583	missense	80232	exon12			CCCATAAATGAAC	AK024669	CCDS31037.1, CCDS31037.2	1q42.13	2013-01-09			ENSG00000162923	ENSG00000162923		"""WD repeat domain containing"""	21208	protein-coding gene	gene with protein product	"""GID complex subunit 7 homolog (S. cerevisiae)"""						Standard	NM_001115113		Approved	FLJ21016, GID7	uc001hop.4	Q9H7D7	OTTHUMG00000037636	ENST00000414423.2:c.1654T>A	1.37:g.224585919A>T	ENSP00000408108:p.Leu552Ile	Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	30.0	NM_025160	A0MNN3|Q4G100|Q59EC4|Q5GLZ9|Q86UY4|Q9H3C2	Missense_Mutation	SNP	ENST00000414423.2	37	CCDS31037.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.0|25.0	4.592110|4.592110	0.86953|0.86953	.|.	.|.	ENSG00000162923|ENSG00000162923	ENST00000480676|ENST00000414423;ENST00000295024	.|D;D	.|0.82433	.|-1.61;-1.61	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91229|0.91229	0.7236|0.7236	M|M	0.84326|0.84326	2.69|2.69	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.91799|0.91799	0.5450|0.5450	5|10	.|0.49607	.|T	.|0.09	.|.	15.1926|15.1926	0.73057|0.73057	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|536	.|Q9H7D7-2	.|.	Y|I	185|552;405	.|ENSP00000408108:L552I;ENSP00000295024:L405I	.|ENSP00000295024:L405I	F|L	-|-	2|1	0|2	WDR26|WDR26	222652542|222652542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.118000|5.118000	0.64673|0.64673	2.053000|2.053000	0.61076|0.61076	0.482000|0.482000	0.46254|0.46254	TTT|TTA	.		0.343	WDR26-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091760.2	NM_025160	
ZAN	7455	ucsc.edu;bcgsc.ca	37	7	100392945	100392945	+	RNA	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr7:100392945T>C	ENST00000348028.3	+	0	8144				ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			ATGCGCCACCTCCCAGAAAGC	0.552																																					.		.											.	ZAN	142	0			.						.						32.0	37.0	35.0					7																	100392945		1989	4153	6142			7455	.			GCCACCTCCCAGA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100392945T>C		Somatic	52.0	1.0		WXS	Illumina HiSeq	.	40.0	6.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	ENST00000348028.3	37																																																																																				.		0.552	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZMYND8	23613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45920579	45920579	+	Silent	SNP	T	T	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr20:45920579T>C	ENST00000311275.7	-	6	814	c.561A>G	c.(559-561)gaA>gaG	p.E187E	ZMYND8_ENST00000471951.2_Silent_p.E207E|ZMYND8_ENST00000536340.1_Silent_p.E214E|ZMYND8_ENST00000458360.2_Silent_p.E182E|ZMYND8_ENST00000446994.2_Silent_p.E124E|ZMYND8_ENST00000360911.3_Silent_p.E182E|ZMYND8_ENST00000372023.3_Silent_p.E182E|ZMYND8_ENST00000540497.1_Silent_p.E182E|ZMYND8_ENST00000262975.4_Silent_p.E187E|ZMYND8_ENST00000355972.4_Silent_p.E187E|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000461685.1_Silent_p.E207E|ZMYND8_ENST00000352431.2_Silent_p.E207E|ZMYND8_ENST00000396281.4_Silent_p.E187E	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	187	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GGAAGATGTATTCCGCATAGT	0.463																																					p.E207E		.											.	ZMYND8	252	0			c.A621G						.						125.0	104.0	111.0					20																	45920579		2203	4300	6503	SO:0001819	synonymous_variant	23613	exon6			GATGTATTCCGCA	U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.561A>G	20.37:g.45920579T>C		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	31.0	NM_183047	B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Silent	SNP	ENST00000311275.7	37		.	.	.	.	.	.	.	.	.	.	T	10.26	1.299902	0.23650	.	.	ENSG00000101040	ENST00000467200	.	.	.	5.52	-2.29	0.06805	.	.	.	.	.	T	0.57095	0.2030	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52472	-0.8571	4	.	.	.	-26.6872	11.2096	0.48790	0.0:0.3859:0.0:0.6141	.	.	.	.	V	114	.	.	I	-	1	0	ZMYND8	45353986	0.560000	0.26570	0.641000	0.29422	0.970000	0.65996	-0.200000	0.09478	-0.798000	0.04444	-0.256000	0.11100	ATA	.		0.463	ZMYND8-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000079596.2	NM_183047	
ZNF578	147660	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	53014251	53014251	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A10Q-01A-11D-A12Z-10	TCGA-BC-A10Q-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f7e9eed5-7a0b-4b2d-bea3-fd8c42a3b90e	454f62ca-7688-48e6-8a59-0149d11f1fe3	g.chr19:53014251A>C	ENST00000421239.2	+	6	861	c.617A>C	c.(616-618)aAt>aCt	p.N206T	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	206					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		CATACTCCTAATAACTATGGG	0.368																																					p.N206T		.											.	.	.	0			c.A617C						.						66.0	70.0	69.0					19																	53014251		2197	4297	6494	SO:0001583	missense	147660	exon6			CTCCTAATAACTA	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.617A>C	19.37:g.53014251A>C	ENSP00000459216:p.Asn206Thr	Somatic	398.0	0.0		WXS	Illumina HiSeq	Phase_I	233.0	14.0	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	12.33	1.906973	0.33628	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.42	1.42	0.22433	.	.	.	.	.	T	0.29749	0.0743	L	0.53671	1.685	0.09310	N	1	P	0.40180	0.705	B	0.38327	0.271	T	0.12889	-1.0530	7	.	.	.	.	5.7141	0.17950	0.486:0.514:0.0:0.0	.	206	G3V4F6	.	T	206	.	.	N	+	2	0	ZNF578	57706063	0.000000	0.05858	0.004000	0.12327	0.279000	0.26890	0.549000	0.23329	0.660000	0.30964	0.113000	0.15668	AAT	.		0.368	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
