#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACAD11	84129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132349391	132349391	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:132349391T>A	ENST00000264990.6	-	7	1824	c.853A>T	c.(853-855)Atg>Ttg	p.M285L	ACAD11_ENST00000481970.2_Missense_Mutation_p.M285L|ACAD11_ENST00000489991.1_5'UTR|ACAD11_ENST00000545291.1_5'UTR|ACAD11_ENST00000355458.3_Missense_Mutation_p.M285L	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	285					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						AGTTCTTCCATTGATGGTATC	0.328																																					p.M285L		.											.	ACAD11	91	0			c.A853T						.						50.0	53.0	52.0					3																	132349391		2202	4300	6502	SO:0001583	missense	84129	exon7			CTTCCATTGATGG	BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.853A>T	3.37:g.132349391T>A	ENSP00000264990:p.Met285Leu	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	22.0	NM_032169	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	ENST00000264990.6	37	CCDS3074.1	.	.	.	.	.	.	.	.	.	.	T	5.919	0.353669	0.11182	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000481970	T;T;T	0.26957	1.7;1.7;1.7	5.57	-4.41	0.03590	Protein kinase-like domain (1);	.	.	.	.	T	0.10852	0.0265	L	0.28608	0.87	0.25836	N	0.98412	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39941	-0.9589	9	0.08381	T	0.77	.	0.5992	0.00742	0.4183:0.188:0.1812:0.2125	.	285;285	D6RDI8;Q709F0	.;ACD11_HUMAN	L	285	ENSP00000347636:M285L;ENSP00000264990:M285L;ENSP00000420907:M285L	ENSP00000264990:M285L	M	-	1	0	ACAD11	133832081	0.003000	0.15002	0.190000	0.23270	0.935000	0.57460	-0.906000	0.04071	-0.510000	0.06523	-0.274000	0.10170	ATG	.		0.328	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357279.2	NM_032169	
AKR1C3	8644	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5144299	5144299	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr10:5144299T>C	ENST00000380554.3	+	6	1229	c.577T>C	c.(577-579)Tgt>Cgt	p.C193R	AKR1C3_ENST00000605149.1_Missense_Mutation_p.C170R|AKR1C3_ENST00000439082.2_Missense_Mutation_p.C74R	NM_001253908.1|NM_003739.5	NP_001240837.1|NP_003730.4	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3	193					arachidonic acid metabolic process (GO:0019369)|cellular response to cadmium ion (GO:0071276)|cellular response to calcium ion (GO:0071277)|cellular response to corticosteroid stimulus (GO:0071384)|cellular response to jasmonic acid stimulus (GO:0071395)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to reactive oxygen species (GO:0034614)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|farnesol catabolic process (GO:0016488)|G-protein coupled receptor signaling pathway (GO:0007186)|keratinocyte differentiation (GO:0030216)|male gonad development (GO:0008584)|multicellular organismal macromolecule metabolic process (GO:0044259)|negative regulation of retinoic acid biosynthetic process (GO:1900053)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|protein import into nucleus, translocation (GO:0000060)|regulation of retinoic acid receptor signaling pathway (GO:0048385)|regulation of testosterone biosynthetic process (GO:2000224)|renal absorption (GO:0070293)|response to nutrient (GO:0007584)|response to prostaglandin (GO:0034694)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	15-hydroxyprostaglandin-D dehydrogenase (NADP+) activity (GO:0047020)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase activity (GO:0047023)|delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|dihydrotestosterone 17-beta-dehydrogenase activity (GO:0035410)|geranylgeranyl reductase activity (GO:0045550)|indanol dehydrogenase activity (GO:0047718)|ketoreductase activity (GO:0045703)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin D2 11-ketoreductase activity (GO:0036131)|prostaglandin F receptor activity (GO:0004958)|prostaglandin-F synthase activity (GO:0047017)|retinal dehydrogenase activity (GO:0001758)|retinol dehydrogenase activity (GO:0004745)|testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)|testosterone dehydrogenase (NAD+) activity (GO:0047035)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|skin(1)	14					Bimatoprost(DB00905)|Doxorubicin(DB00997)	GCAGGTAGAATGTCATCCGTA	0.358																																					p.C193R		.											.	AKR1C3	515	0			c.T577C						.						79.0	71.0	73.0					10																	5144299		2203	4300	6503	SO:0001583	missense	8644	exon6			GTAGAATGTCATC	L43839	CCDS7063.1, CCDS73062.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000196139	ENSG00000196139	1.1.1.213, 1.1.1.188	"""Aldo-keto reductases"""	386	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase X"", ""prostaglandin F synthase"", ""3-alpha hydroxysteroid dehydrogenase, type II"""	603966	"""hydroxysteroid (17-beta) dehydrogenase 5"", ""aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II)"""	HSD17B5		7650035, 9792917	Standard	NM_003739		Approved	KIAA0119, DDX, HAKRB, PGFS	uc021pml.1	P42330	OTTHUMG00000017585	ENST00000380554.3:c.577T>C	10.37:g.5144299T>C	ENSP00000369927:p.Cys193Arg	Somatic	206.0	1.0		WXS	Illumina HiSeq	Phase_I	155.0	60.0	NM_003739	A8K2V0|B4DL37|Q5T2L1|Q96DJ1|Q96KI8|Q99530|Q9UCX1|Q9UII3|Q9UKL9	Missense_Mutation	SNP	ENST00000380554.3	37	CCDS7063.1	.	.	.	.	.	.	.	.	.	.	T	10.12	1.261887	0.23051	.	.	ENSG00000196139	ENST00000439082;ENST00000380554	T;T	0.24350	1.86;1.86	2.15	2.15	0.27550	NADP-dependent oxidoreductase domain (3);	0.000000	0.64402	D	0.000002	T	0.39036	0.1063	L	0.55017	1.72	0.80722	D	1	D;D;D	0.65815	0.987;0.995;0.995	P;D;D	0.67103	0.893;0.949;0.949	T	0.19063	-1.0317	10	0.87932	D	0	.	7.8771	0.29599	0.0:0.0:0.0:1.0	.	74;193;193	B4DL37;P42330;Q2XPP3	.;AK1C3_HUMAN;.	R	74;193	ENSP00000401327:C74R;ENSP00000369927:C193R	ENSP00000369927:C193R	C	+	1	0	AKR1C3	5134299	1.000000	0.71417	0.086000	0.20670	0.082000	0.17680	6.174000	0.71943	0.992000	0.38840	0.402000	0.26972	TGT	.		0.358	AKR1C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046533.2	NM_003739	
AMER1	139285	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	63413037	63413037	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chrX:63413037G>A	ENST00000330258.3	-	2	402	c.130C>T	c.(130-132)Cca>Tca	p.P44S	AMER1_ENST00000403336.1_Missense_Mutation_p.P44S|AMER1_ENST00000374869.3_Missense_Mutation_p.P44S	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	44					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									GATGAGGATGGCTCTGAGGTT	0.547																																					p.P44S		.											.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.C130T						.						231.0	183.0	199.0					X																	63413037		2203	4300	6503	SO:0001583	missense	139285	exon2			AGGATGGCTCTGA	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.130C>T	X.37:g.63413037G>A	ENSP00000329117:p.Pro44Ser	Somatic	205.0	2.0		WXS	Illumina HiSeq	Phase_I	181.0	82.0	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	37	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	G	3.069	-0.191626	0.06299	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.52754	0.65;0.68;0.65	4.59	1.48	0.22813	.	1.194660	0.05865	N	0.623702	T	0.35537	0.0935	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32161	-0.9917	10	0.66056	D	0.02	1.9438	5.0147	0.14330	0.2253:0.0:0.6152:0.1595	.	44	Q5JTC6	F123B_HUMAN	S	44	ENSP00000364003:P44S;ENSP00000329117:P44S;ENSP00000384722:P44S	ENSP00000329117:P44S	P	-	1	0	FAM123B	63329762	0.000000	0.05858	0.016000	0.15963	0.021000	0.10359	0.004000	0.13106	0.142000	0.18901	0.600000	0.82982	CCA	.		0.547	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
AMER3	205147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	131521437	131521437	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:131521437G>A	ENST00000423981.1	+	2	1902	c.1792G>A	c.(1792-1794)Gat>Aat	p.D598N	AMER3_ENST00000321420.4_Missense_Mutation_p.D598N	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	598					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										ACTGTCCAGGGATGCCTCTCG	0.592																																					p.D598N		.											.	.	.	0			c.G1792A						.						65.0	70.0	68.0					2																	131521437		2203	4300	6503	SO:0001583	missense	205147	exon2			TCCAGGGATGCCT	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.1792G>A	2.37:g.131521437G>A	ENSP00000392700:p.Asp598Asn	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	21.0	NM_152698	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.380921	0.42207	.	.	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.48201	0.82;0.82	4.84	3.03	0.35002	.	0.651836	0.12750	N	0.442236	T	0.30262	0.0759	L	0.27053	0.805	0.09310	N	1	B	0.33694	0.421	B	0.30495	0.116	T	0.12066	-1.0562	10	0.27082	T	0.32	.	6.9945	0.24774	0.0959:0.175:0.7292:0.0	.	598	Q8N944	F123C_HUMAN	N	598	ENSP00000314914:D598N;ENSP00000392700:D598N	ENSP00000314914:D598N	D	+	1	0	FAM123C	131237907	0.009000	0.17119	0.013000	0.15412	0.102000	0.19082	1.019000	0.30014	0.567000	0.29293	-0.304000	0.09214	GAT	.		0.592	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
ARX	170302	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	25033826	25033826	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chrX:25033826C>G	ENST00000379044.4	-	1	239	c.29G>C	c.(28-30)tGc>tCc	p.C10S		NM_139058.2	NP_620689.1	Q96QS3	ARX_HUMAN	aristaless related homeobox	10					axon guidance (GO:0007411)|cell proliferation in forebrain (GO:0021846)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex tangential migration (GO:0021800)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|epithelial cell fate commitment (GO:0072148)|globus pallidus development (GO:0021759)|lipid digestion (GO:0044241)|positive regulation of organ growth (GO:0046622)|regulation of cell proliferation (GO:0042127)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			kidney(1)|large_intestine(2)|lung(1)	4						CCTCTCGGAGCAGCCCTCCTC	0.612																																					p.C10S		.											.	ARX	130	0			c.G29C						.						40.0	34.0	36.0					X																	25033826		2201	4297	6498	SO:0001583	missense	170302	exon1			TCGGAGCAGCCCT	AY038071	CCDS14215.1	Xp21.3	2011-06-20			ENSG00000004848	ENSG00000004848		"""Homeoboxes / PRD class"""	18060	protein-coding gene	gene with protein product	"""cancer/testis antigen 121"""	300382	"""mental retardation, X-linked 54"", ""mental retardation, X-linked 43"", ""mental retardation, X-linked 36"", ""mental retardation, X-linked 29"", ""mental retardation, X-linked 32"", ""mental retardation, X-linked 33"", ""mental retardation, X-linked 38"", ""mental retardation, X-linked 87"", ""mental retardation, X-linked 76"""	MRXS1, PRTS, MRX76, MRX54, MRX43, MRX36, MRX29, MRX32, MRX33, MRX38, MRX87		11889467, 15850492, 17480217	Standard	NM_139058		Approved	ISSX, CT121, EIEE1	uc004dbp.4	Q96QS3	OTTHUMG00000021275	ENST00000379044.4:c.29G>C	X.37:g.25033826C>G	ENSP00000368332:p.Cys10Ser	Somatic	341.0	0.0		WXS	Illumina HiSeq	Phase_I	361.0	83.0	NM_139058		Missense_Mutation	SNP	ENST00000379044.4	37	CCDS14215.1	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964084	0.53507	.	.	ENSG00000004848	ENST00000379044	D	0.89552	-2.53	5.3	5.3	0.74995	.	0.465752	0.21298	U	0.076847	D	0.85978	0.5823	L	0.38531	1.155	0.37897	D	0.930911	P	0.52842	0.956	B	0.44224	0.444	D	0.89127	0.3507	10	0.66056	D	0.02	.	15.7804	0.78255	0.0:1.0:0.0:0.0	.	10	Q96QS3	ARX_HUMAN	S	10	ENSP00000368332:C10S	ENSP00000368332:C10S	C	-	2	0	ARX	24943747	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.810000	0.38932	2.194000	0.70268	0.600000	0.82982	TGC	.		0.612	ARX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056109.1		
ASB1	51665	ucsc.edu;bcgsc.ca	37	2	239353034	239353034	+	Silent	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:239353034T>C	ENST00000264607.4	+	4	793	c.546T>C	c.(544-546)ccT>ccC	p.P182P	ASB1_ENST00000409297.1_Silent_p.P81P	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	182					intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		ATGTCCAGCCTCGATTCTCCC	0.612																																					p.P182P		.											.	ASB1	226	0			c.T546C						.						61.0	50.0	54.0					2																	239353034		2203	4300	6503	SO:0001819	synonymous_variant	51665	exon4			CCAGCCTCGATTC	AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.546T>C	2.37:g.239353034T>C		Somatic	63.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_001040445	A6NL50|Q4ZG29|Q9ULS4	Silent	SNP	ENST00000264607.4	37	CCDS33416.1																																																																																			.		0.612	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328294.1	NM_001040445	
ASXL1	171023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31023622	31023622	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr20:31023622A>G	ENST00000375687.4	+	13	3531	c.3107A>G	c.(3106-3108)aAt>aGt	p.N1036S	ASXL1_ENST00000306058.5_Missense_Mutation_p.N1031S	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1036					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GAGAAACCCAATTGGAACCAA	0.522			"""F, N, Mis"""		"""MDS, CMML"""																																p.N1036S		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	2057	0			c.A3107G						.						224.0	186.0	199.0					20																	31023622		2203	4300	6503	SO:0001583	missense	171023	exon12			AACCCAATTGGAA	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3107A>G	20.37:g.31023622A>G	ENSP00000364839:p.Asn1036Ser	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	21.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	37	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	a	0	-2.827394	0.00071	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.21031	2.03;2.03	4.32	-8.64	0.00874	.	1.688650	0.02613	N	0.102362	T	0.08935	0.0221	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.19910	-1.0291	10	0.16896	T	0.51	3.4374	11.7114	0.51626	0.3067:0.1743:0.5191:0.0	.	1031;1036	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	S	1036;1036;1036;957;1031	ENSP00000364839:N1036S;ENSP00000305119:N1031S	ENSP00000305119:N1031S	N	+	2	0	ASXL1	30487283	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.819000	0.01716	-2.367000	0.00605	-2.262000	0.00279	AAT	.		0.522	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
AUTS2	26053	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	70252291	70252291	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr7:70252291C>T	ENST00000342771.4	+	18	2726	c.2405C>T	c.(2404-2406)tCg>tTg	p.S802L	AUTS2_ENST00000406775.2_Missense_Mutation_p.S778L	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	802										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACGCCTCCGTCGTTCCCGACC	0.602																																					p.S802L		.											.	AUTS2	92	0			c.C2405T						.						45.0	40.0	42.0					7																	70252291		2203	4300	6503	SO:0001583	missense	26053	exon18			CTCCGTCGTTCCC	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2405C>T	7.37:g.70252291C>T	ENSP00000344087:p.Ser802Leu	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	31.0	NM_015570	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	ENST00000342771.4	37	CCDS5539.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022037	0.93462	.	.	ENSG00000158321	ENST00000406775;ENST00000342771;ENST00000418686	T;T	0.50813	0.76;0.73	4.88	4.88	0.63580	.	0.186688	0.48767	D	0.000169	T	0.61937	0.2387	M	0.66939	2.045	0.80722	D	1	D;D;D	0.67145	0.991;0.996;0.996	P;P;P	0.55965	0.508;0.788;0.788	T	0.63773	-0.6561	9	.	.	.	-16.1247	18.0311	0.89285	0.0:1.0:0.0:0.0	.	254;778;802	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	L	778;802;82	ENSP00000385263:S778L;ENSP00000344087:S802L	.	S	+	2	0	AUTS2	69890227	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.280000	0.78610	2.251000	0.74343	0.655000	0.94253	TCG	.		0.602	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
BCORL1	63035	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	129159156	129159156	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chrX:129159156C>T	ENST00000218147.7	+	7	4077	c.3880C>T	c.(3880-3882)Cac>Tac	p.H1294Y	BCORL1_ENST00000359304.2_Intron|BCORL1_ENST00000303743.5_Missense_Mutation_p.H1294Y|BCORL1_ENST00000540052.1_Missense_Mutation_p.H1294Y			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1294					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GGGCCGAAGGCACCTGTGGCG	0.617																																					p.H1294Y		.											.	BCORL1	294	0			c.C3880T						.						65.0	64.0	64.0					X																	129159156		2203	4300	6503	SO:0001583	missense	63035	exon6			CGAAGGCACCTGT	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3880C>T	X.37:g.129159156C>T	ENSP00000218147:p.His1294Tyr	Somatic	134.0	1.0		WXS	Illumina HiSeq	Phase_I	109.0	35.0	NM_021946	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	ENST00000218147.7	37	CCDS14616.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185690	0.78789	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000540052;ENST00000456822	T;T;T;T	0.45276	0.9;1.27;0.9;1.34	5.71	5.71	0.89125	.	0.000000	0.38217	N	0.001768	T	0.52917	0.1764	N	0.24115	0.695	0.37073	D	0.898637	D;D	0.67145	0.996;0.985	D;P	0.75484	0.986;0.643	T	0.59830	-0.7380	10	0.49607	T	0.09	-12.1176	18.8012	0.92018	0.0:1.0:0.0:0.0	.	1294;1294	Q5H9F3-3;Q5H9F3	.;BCORL_HUMAN	Y	1294;1294;1294;894	ENSP00000218147:H1294Y;ENSP00000307541:H1294Y;ENSP00000437775:H1294Y;ENSP00000399483:H894Y	ENSP00000218147:H1294Y	H	+	1	0	BCORL1	128986837	0.773000	0.28580	0.994000	0.49952	0.877000	0.50540	1.626000	0.37039	2.385000	0.81259	0.513000	0.50165	CAC	.		0.617	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058223.1	NM_021946	
EDRF1	26098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	127426555	127426555	+	Silent	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr10:127426555A>G	ENST00000356792.4	+	14	2059	c.1827A>G	c.(1825-1827)ctA>ctG	p.L609L	C10orf137_ENST00000337623.3_Silent_p.L575L	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		609					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.L575L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				GCTATGTTCTAGAGGTAAGTT	0.338																																					p.L609L		.											.	C10orf137	590	1	Substitution - coding silent(1)	lung(1)	c.A1827G						.						180.0	171.0	174.0					10																	127426555		2203	4300	6503	SO:0001819	synonymous_variant	26098	exon14			TGTTCTAGAGGTA																												ENST00000356792.4:c.1827A>G	10.37:g.127426555A>G		Somatic	284.0	0.0		WXS	Illumina HiSeq	Phase_I	246.0	87.0	NM_001202438	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	37	CCDS55733.1																																																																																			.		0.338	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
CA4	762	ucsc.edu;bcgsc.ca	37	17	58235786	58235786	+	Silent	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr17:58235786C>T	ENST00000300900.4	+	7	822	c.723C>T	c.(721-723)ccC>ccT	p.P241P		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	241					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	TCCGGGAGCCCATTCAGCTTC	0.602																																					p.P241P		.											.	CA4	226	0			c.C723T						.						66.0	58.0	61.0					17																	58235786		2203	4300	6503	SO:0001819	synonymous_variant	762	exon7			GGAGCCCATTCAG	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.723C>T	17.37:g.58235786C>T		Somatic	22.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_000717	B4DQA4|Q6FHI7	Silent	SNP	ENST00000300900.4	37	CCDS11624.1																																																																																			.		0.602	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717	
CCDC155	147872	ucsc.edu;bcgsc.ca	37	19	49901246	49901246	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:49901246A>G	ENST00000447857.3	+	7	680	c.475A>G	c.(475-477)Aca>Gca	p.T159A		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	159						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						TAGACAAGCCACAGCTGACCT	0.607																																					p.T159A		.											.	CCDC155	69	0			c.A475G						.						34.0	35.0	35.0					19																	49901246		2012	4185	6197	SO:0001583	missense	147872	exon7			CAAGCCACAGCTG		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.475A>G	19.37:g.49901246A>G	ENSP00000404220:p.Thr159Ala	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	56.0	5.0	NM_144688	Q96MC3	Missense_Mutation	SNP	ENST00000447857.3	37	CCDS46140.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.830276	0.50845	.	.	ENSG00000161609	ENST00000447857	T	0.32988	1.43	5.28	1.82	0.25136	.	0.084792	0.41097	N	0.000941	T	0.45115	0.1326	M	0.76574	2.34	0.24824	N	0.992562	D;D;D	0.76494	0.996;0.996;0.999	D;D;D	0.80764	0.99;0.99;0.994	T	0.24728	-1.0152	10	0.30854	T	0.27	-5.2649	3.2749	0.06894	0.6394:0.0:0.1891:0.1715	.	159;159;239	C9JGW3;Q8N6L0;Q6ZRK4	.;CC155_HUMAN;.	A	159	ENSP00000404220:T159A	ENSP00000404220:T159A	T	+	1	0	CCDC155	54593058	0.035000	0.19736	0.691000	0.30163	0.679000	0.39708	0.504000	0.22626	0.411000	0.25702	0.448000	0.29417	ACA	.		0.607	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465436.2	NM_144688	
CCDC96	257236	ucsc.edu;bcgsc.ca	37	4	7043800	7043800	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr4:7043800C>T	ENST00000310085.4	-	1	928	c.866G>A	c.(865-867)gGc>gAc	p.G289D	TADA2B_ENST00000310074.7_5'Flank|TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	289										endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CTCCAGCATGCCCAGATGGCG	0.662																																					p.G289D		.											.	CCDC96	90	0			c.G866A						.						88.0	95.0	93.0					4																	7043800		2203	4299	6502	SO:0001583	missense	257236	exon1			AGCATGCCCAGAT	AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.866G>A	4.37:g.7043800C>T	ENSP00000309285:p.Gly289Asp	Somatic	62.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_153376	Q8N2I7	Missense_Mutation	SNP	ENST00000310085.4	37	CCDS3395.1	.	.	.	.	.	.	.	.	.	.	C	4.757	0.140769	0.09083	.	.	ENSG00000173013	ENST00000310085	T	0.40756	1.02	3.89	-1.3	0.09259	.	0.662303	0.13403	N	0.390443	T	0.17789	0.0427	N	0.08118	0	0.26939	N	0.966296	B	0.09022	0.002	B	0.06405	0.002	T	0.13548	-1.0505	10	0.35671	T	0.21	-8.8673	4.4594	0.11659	0.0773:0.2331:0.4589:0.2307	.	289	Q2M329	CCD96_HUMAN	D	289	ENSP00000309285:G289D	ENSP00000309285:G289D	G	-	2	0	CCDC96	7094701	0.735000	0.28153	0.334000	0.25495	0.238000	0.25445	0.397000	0.20883	0.024000	0.15214	-1.474000	0.01003	GGC	.		0.662	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246838.1	NM_153376	
CDCA7	83879	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	174224139	174224139	+	Intron	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:174224139G>A	ENST00000347703.3	+	2	291				CDCA7_ENST00000392567.2_Intron|CDCA7_ENST00000410019.3_Intron|CDCA7_ENST00000410101.3_Missense_Mutation_p.E58K|CDCA7_ENST00000306721.3_Missense_Mutation_p.E102K	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7						apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.E102K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			TGTCACTAACGAACTGGCCGG	0.423																																					p.E102K		.											.	CDCA7	91	1	Substitution - Missense(1)	large_intestine(1)	c.G304A						.						101.0	101.0	101.0					2																	174224139		2203	4300	6503	SO:0001627	intron_variant	83879	exon3			ACTAACGAACTGG	BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.147+574G>A	2.37:g.174224139G>A		Somatic	177.0	1.0		WXS	Illumina HiSeq	Phase_I	210.0	64.0	NM_031942	B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	ENST00000347703.3	37	CCDS2253.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078203	0.76528	.	.	ENSG00000144354	ENST00000306721;ENST00000410101	T;T	0.53857	0.6;0.73	6.06	5.19	0.71726	.	0.064355	0.64402	N	0.000012	T	0.65091	0.2658	M	0.65975	2.015	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.59825	0.735;0.864	T	0.63980	-0.6514	10	0.30854	T	0.27	-11.606	13.3714	0.60715	0.0732:0.0:0.9268:0.0	.	58;102	B4DV66;Q9BWT1-2	.;.	K	102;58	ENSP00000306968:E102K;ENSP00000386656:E58K	ENSP00000306968:E102K	E	+	1	0	CDCA7	173932385	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	2.376000	0.44292	1.575000	0.49775	0.650000	0.86243	GAA	.		0.423	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255400.1	NM_031942	
CFH	3075	broad.mit.edu;bcgsc.ca	37	1	196716375	196716375	+	Missense_Mutation	SNP	C	C	T	rs121913059		TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr1:196716375C>T	ENST00000367429.4	+	22	3868	c.3628C>T	c.(3628-3630)Cgt>Tgt	p.R1210C		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1210	Sushi 20. {ECO:0000255|PROSITE- ProRule:PRU00302}.		R -> C (in CFHD and ARMD4; rare penetrant mutation that confers high risk of age- related macular degeneration). {ECO:0000269|PubMed:11158219, ECO:0000269|PubMed:11851332, ECO:0000269|PubMed:22019782}.		complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TCTTTCATCACGTTCTCACAC	0.388																																					p.R1210C		.											.	CFH	566	0			c.C3628T	GRCh37	CM010323	CFH	M	rs121913059	.	A	CYS/ARG	0,4406		0,0,2203	166.0	145.0	152.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	3628	-7.7	0.0	1	dbSNP_133	152	2,8598		0,2,4298	no	missense	CFH	NM_000186.3	180	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1210/1232	196716375	2,13004	2203	4300	6503	SO:0001583	missense	3075	exon22			TCATCACGTTCTC	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3628C>T	1.37:g.196716375C>T	ENSP00000356399:p.Arg1210Cys	Somatic	816.0	1.0		WXS	Illumina HiSeq	Phase_I	1208.0	52.0	NM_000186	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	15.48	2.846423	0.51164	0.0	2.33E-4	ENSG00000000971	ENST00000367429	T	0.66995	-0.24	3.86	-7.71	0.01254	Complement control module (1);Sushi/SCR/CCP (3);	.	.	.	.	T	0.35970	0.0950	N	0.08118	0	0.09310	A	2.01655e-08	B	0.17852	0.024	B	0.08055	0.003	T	0.26985	-1.0087	8	0.62326	D	0.03	.	2.3491	0.04279	0.1024:0.2384:0.3023:0.3569	.	1210	P08603	CFAH_HUMAN	C	1210	ENSP00000356399:R1210C	ENSP00000356399:R1210C	R	+	1	0	CFH	194982998	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.306000	0.00133	-2.908000	0.00309	-1.742000	0.00685	CGT	C|1.000;T|0.000		0.388	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
CNTN1	1272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	41410483	41410483	+	Splice_Site	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:41410483G>A	ENST00000551295.2	+	19	2301		c.e19-1		CNTN1_ENST00000347616.1_Splice_Site|CNTN1_ENST00000550305.1_Splice_Site|CNTN1_ENST00000348761.2_Splice_Site	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				TTTCTATTTAGCCTTTGTCAA	0.368																																					.		.											.	CNTN1	1149	0			c.2185-1G>A						.						53.0	50.0	51.0					12																	41410483		2203	4300	6503	SO:0001630	splice_region_variant	1272	exon19			TATTTAGCCTTTG	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2185-1G>A	12.37:g.41410483G>A		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	57.0	NM_001843	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Splice_Site	SNP	ENST00000551295.2	37	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558606	0.65538	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7385	0.96217	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTN1	39696750	1.000000	0.71417	0.998000	0.56505	0.676000	0.39594	4.105000	0.57797	2.838000	0.97847	0.655000	0.94253	.	.		0.368	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	Intron
CNTRL	11064	ucsc.edu;bcgsc.ca	37	9	123931905	123931905	+	Silent	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr9:123931905A>G	ENST00000373855.1	+	39	6347	c.6087A>G	c.(6085-6087)gaA>gaG	p.E2029E	CNTRL_ENST00000373850.1_Silent_p.E1477E|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000238341.5_Silent_p.E2029E			Q7Z7A1	CNTRL_HUMAN	centriolin	2029	Required for centrosome localization.|Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AGCTTTCAGAAAGGGAGCAGC	0.527																																					p.E2029E		.											.	CNTRL	661	0			c.A6087G						.						74.0	75.0	75.0					9																	123931905		2203	4300	6503	SO:0001819	synonymous_variant	11064	exon37			TTCAGAAAGGGAG	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6087A>G	9.37:g.123931905A>G		Somatic	74.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	ENST00000373855.1	37	CCDS35118.1																																																																																			.		0.527	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
COL6A3	1293	ucsc.edu;bcgsc.ca	37	2	238255185	238255185	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:238255185T>C	ENST00000295550.4	-	32	7505	c.7053A>G	c.(7051-7053)atA>atG	p.I2351M	COL6A3_ENST00000346358.4_Missense_Mutation_p.I2151M|COL6A3_ENST00000347401.3_Missense_Mutation_p.I2150M|COL6A3_ENST00000353578.4_Missense_Mutation_p.I2145M|COL6A3_ENST00000472056.1_Missense_Mutation_p.I1744M|COL6A3_ENST00000409809.1_Missense_Mutation_p.I2145M	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2351	Collagen-like 5.|Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		TCTGTCCAACTATCCCTGGAG	0.517																																					p.I2351M		.											.	COL6A3	526	0			c.A7053G						.						98.0	93.0	95.0					2																	238255185		2203	4300	6503	SO:0001583	missense	1293	exon32			TCCAACTATCCCT	X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.7053A>G	2.37:g.238255185T>C	ENSP00000295550:p.Ile2351Met	Somatic	83.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_004369	A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	ENST00000295550.4	37	CCDS33412.1	.	.	.	.	.	.	.	.	.	.	T	12.08	1.830434	0.32329	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92;-3.92;-3.92	5.23	-2.27	0.06846	.	1.897460	0.02952	N	0.141859	D	0.92763	0.7699	N	0.19112	0.55	0.09310	N	1	P;P;P;D	0.64830	0.526;0.526;0.471;0.994	B;B;B;P	0.55667	0.214;0.214;0.136;0.781	D	0.84888	0.0835	10	0.48119	T	0.1	.	2.8823	0.05650	0.2373:0.0642:0.3314:0.3671	.	1744;1744;2145;2351	E9PFQ6;B7ZMJ7;P12111-2;P12111	.;.;.;CO6A3_HUMAN	M	2351;2150;2145;1744;2145;2151	ENSP00000295550:I2351M;ENSP00000315609:I2150M;ENSP00000315873:I2145M;ENSP00000418285:I1744M;ENSP00000386844:I2145M;ENSP00000295546:I2151M	ENSP00000295550:I2351M	I	-	3	3	COL6A3	237919924	0.000000	0.05858	0.000000	0.03702	0.906000	0.53458	-0.076000	0.11412	-0.553000	0.06158	0.533000	0.62120	ATA	.		0.517	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315790.2	NM_004369	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113421218	113421218	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr8:113421218A>T	ENST00000297405.5	-	33	5683	c.5439T>A	c.(5437-5439)gaT>gaA	p.D1813E	CSMD3_ENST00000343508.3_Missense_Mutation_p.D1773E|CSMD3_ENST00000352409.3_Intron|CSMD3_ENST00000455883.2_Missense_Mutation_p.D1709E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1813	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCTCAACAACATCGTGGAGTG	0.443										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.D1813E		.											.	CSMD3	1132	0			c.T5439A						.						170.0	158.0	162.0					8																	113421218		2203	4300	6503	SO:0001583	missense	114788	exon33			AACAACATCGTGG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5439T>A	8.37:g.113421218A>T	ENSP00000297405:p.Asp1813Glu	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	58.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	A	17.69	3.452061	0.63290	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883	T;T;T	0.29917	1.55;1.55;1.55	5.07	3.9	0.45041	CUB (5);	0.000000	0.64402	D	0.000001	T	0.64929	0.2643	H	0.96691	3.865	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.91635	0.997;0.996;0.999	T	0.69986	-0.4996	10	0.59425	D	0.04	.	8.2404	0.31656	0.8457:0.0:0.1543:0.0	.	1709;1813;1773	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	1773;1813;1709	ENSP00000345799:D1773E;ENSP00000297405:D1813E;ENSP00000412263:D1709E	ENSP00000297405:D1813E	D	-	3	2	CSMD3	113490394	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.178000	0.42519	0.948000	0.37687	0.482000	0.46254	GAT	.		0.443	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
DIDO1	11083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61528282	61528282	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr20:61528282G>A	ENST00000266070.4	-	7	1980	c.1655C>T	c.(1654-1656)cCt>cTt	p.P552L	DIDO1_ENST00000395340.1_Missense_Mutation_p.P552L|DIDO1_ENST00000395335.2_Missense_Mutation_p.P552L|DIDO1_ENST00000395343.1_Missense_Mutation_p.P552L	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	552					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GGAGCCTGGAGGGGCTGTTTT	0.552																																					p.P552L	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1	96	0			c.C1655T						.						30.0	33.0	32.0					20																	61528282		2203	4300	6503	SO:0001583	missense	11083	exon7			CCTGGAGGGGCTG	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1655C>T	20.37:g.61528282G>A	ENSP00000266070:p.Pro552Leu	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	29.0	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	11.60	1.686740	0.29962	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.13196	2.99;2.99;2.61;2.61	5.51	-1.2	0.09554	.	0.553042	0.15080	N	0.281682	T	0.10423	0.0255	L	0.56769	1.78	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.002	T	0.30534	-0.9975	10	0.30078	T	0.28	-1.8123	2.462	0.04544	0.3955:0.1133:0.3752:0.1159	.	552;552	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	L	552	ENSP00000266070:P552L;ENSP00000378752:P552L;ENSP00000378749:P552L;ENSP00000378744:P552L	ENSP00000266070:P552L	P	-	2	0	DIDO1	60998727	0.001000	0.12720	0.000000	0.03702	0.370000	0.29829	0.494000	0.22467	-0.472000	0.06881	-0.251000	0.11542	CCT	.		0.552	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
DSP	1832	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	7583427	7583427	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr6:7583427A>G	ENST00000379802.3	+	24	6273	c.5932A>G	c.(5932-5934)Atg>Gtg	p.M1978V	DSP_ENST00000418664.2_Missense_Mutation_p.M1379V	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1978	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		GGTGACAGCAATGCAGCTCTA	0.502																																					p.M1978V		.											.	DSP	518	0			c.A5932G						.						101.0	101.0	101.0					6																	7583427		2203	4300	6503	SO:0001583	missense	1832	exon24			ACAGCAATGCAGC	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.5932A>G	6.37:g.7583427A>G	ENSP00000369129:p.Met1978Val	Somatic	132.0	1.0		WXS	Illumina HiSeq	Phase_I	126.0	56.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	A	10.78	1.447587	0.26074	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.66815	-0.23;-0.23	5.48	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.30355	0.0762	L	0.34521	1.04	0.09310	N	0.999999	B;B	0.16802	0.019;0.0	B;B	0.12156	0.007;0.001	T	0.13602	-1.0503	10	0.30078	T	0.28	.	6.9741	0.24664	0.6415:0.2862:0.0723:0.0	.	1426;1978	Q4LE79;P15924	.;DESP_HUMAN	V	1978;1379	ENSP00000369129:M1978V;ENSP00000396591:M1379V	ENSP00000369129:M1978V	M	+	1	0	DSP	7528426	0.931000	0.31567	0.750000	0.31169	0.921000	0.55340	2.156000	0.42310	0.893000	0.36288	0.533000	0.62120	ATG	.		0.502	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
DTNB	1838	bcgsc.ca;mdanderson.org	37	2	25611083	25611083	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:25611083C>T	ENST00000406818.3	-	17	1972	c.1723G>A	c.(1723-1725)Gcc>Acc	p.A575T	DTNB_ENST00000545439.1_Missense_Mutation_p.A364T|DTNB_ENST00000407186.1_Missense_Mutation_p.A538T|DTNB_ENST00000404103.3_Missense_Mutation_p.A575T|DTNB_ENST00000407661.3_Missense_Mutation_p.A575T|DTNB_ENST00000407038.3_Missense_Mutation_p.A545T|DTNB_ENST00000288642.8_Missense_Mutation_p.A575T|DTNB_ENST00000496972.2_Missense_Mutation_p.A511T|DTNB_ENST00000405222.1_Missense_Mutation_p.A538T	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	575						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGCGAAGGCCTCCTGCACG	0.607																																					p.A575T		.											.	DTNB	137	0			c.G1723A						.						18.0	23.0	21.0					2																	25611083		2017	4183	6200	SO:0001583	missense	1838	exon17			CGAAGGCCTCCTG	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.1723G>A	2.37:g.25611083C>T	ENSP00000384084:p.Ala575Thr	Somatic	33.0	1.0		WXS	Illumina HiSeq	Phase_1	22.0	12.0	NM_021907	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Missense_Mutation	SNP	ENST00000406818.3	37	CCDS46237.1	.	.	.	.	.	.	.	.	.	.	C	36	5.819810	0.96982	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000407038;ENST00000405222;ENST00000407186;ENST00000288642;ENST00000545439	T;T;T;T;T;T;T;T;T	0.57107	1.71;1.69;2.12;1.69;2.13;2.12;1.71;2.12;0.42	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.72170	0.3427	M	0.79258	2.445	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D	0.71674	0.998;0.997;0.998;0.988;0.996;0.991;0.993;0.996;0.996;0.997;0.998;0.996	D;D;D;P;P;P;D;D;D;D;D;P	0.73708	0.928;0.913;0.928;0.821;0.821;0.881;0.956;0.981;0.981;0.913;0.928;0.821	T	0.70432	-0.4873	10	0.32370	T	0.25	-16.4453	16.7312	0.85435	0.0:1.0:0.0:0.0	.	364;511;568;568;511;538;538;545;575;575;575;575	B7Z202;F5GZG4;B7Z6A9;Q1I0L3;B7Z733;E9PEY4;Q96AW0;O60941-2;O60941-4;G5E9F6;O60941;Q86VR4	.;.;.;.;.;.;.;.;.;.;DTNB_HUMAN;.	T	511;575;575;575;545;538;538;575;364	ENSP00000444463:A511T;ENSP00000384084:A575T;ENSP00000385482:A575T;ENSP00000385193:A575T;ENSP00000384767:A545T;ENSP00000384787:A538T;ENSP00000385784:A538T;ENSP00000288642:A575T;ENSP00000444961:A364T	ENSP00000288642:A575T	A	-	1	0	DTNB	25464587	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.628000	0.83189	2.551000	0.86045	0.561000	0.74099	GCC	.		0.607	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147	
E2F8	79733	broad.mit.edu;ucsc.edu;mdanderson.org	37	11	19251120	19251120	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr11:19251120T>A	ENST00000527884.1	-	10	2006	c.1774A>T	c.(1774-1776)Aag>Tag	p.K592*	RP11-428C19.4_ENST00000527978.1_RNA|E2F8_ENST00000250024.4_Nonsense_Mutation_p.K592*	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	592					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTTCGGCTCTTTGCCCCTTGC	0.542																																					p.K592X		.											.	E2F8	91	0			c.A1774T						.						122.0	110.0	114.0					11																	19251120		2199	4293	6492	SO:0001587	stop_gained	79733	exon10			GGCTCTTTGCCCC		CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.1774A>T	11.37:g.19251120T>A	ENSP00000434199:p.Lys592*	Somatic	190.0	1.0		WXS	Illumina HiSeq	Phase_I	141.0	63.0	NM_024680	A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Nonsense_Mutation	SNP	ENST00000527884.1	37	CCDS7849.1	.	.	.	.	.	.	.	.	.	.	T	36	5.803807	0.96967	.	.	ENSG00000129173	ENST00000527884;ENST00000396159;ENST00000250024	.	.	.	5.35	4.21	0.49690	.	0.571577	0.18468	N	0.140331	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.5216	4.6581	0.12628	0.0:0.1256:0.2131:0.6613	.	.	.	.	X	592	.	ENSP00000250024:K592X	K	-	1	0	E2F8	19207696	0.033000	0.19621	0.083000	0.20561	0.285000	0.27093	1.368000	0.34216	0.856000	0.35383	0.533000	0.62120	AAG	.		0.542	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387830.1	NM_024680	
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184911175	184911175	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:184911175G>T	ENST00000231887.3	-	7	1086	c.1011C>A	c.(1009-1011)aaC>aaA	p.N337K	EHHADH-AS1_ENST00000417720.1_RNA|EHHADH_ENST00000456310.1_Missense_Mutation_p.N241K	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	337	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			TTATCATCTTGTTTGCAGTTG	0.483																																					p.N337K		.											.	EHHADH	93	0			c.C1011A						.						128.0	130.0	129.0					3																	184911175		2203	4300	6503	SO:0001583	missense	1962	exon7			CATCTTGTTTGCA	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1011C>A	3.37:g.184911175G>T	ENSP00000231887:p.Asn337Lys	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	33.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	G	0.480	-0.880108	0.02530	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	T;T	0.76448	-1.02;-1.02	6.08	1.87	0.25490	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.584920	0.20110	N	0.099023	T	0.28400	0.0702	N	0.00064	-2.31	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42865	-0.9426	10	0.15952	T	0.53	-3.1336	0.7779	0.01035	0.1966:0.2589:0.3155:0.229	.	337	Q08426	ECHP_HUMAN	K	337;337;241	ENSP00000231887:N337K;ENSP00000387746:N241K	ENSP00000231887:N337K	N	-	3	2	EHHADH	186393869	0.000000	0.05858	0.002000	0.10522	0.988000	0.76386	0.752000	0.26362	0.855000	0.35359	0.591000	0.81541	AAC	.		0.483	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	79403615	79403615	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr1:79403615A>T	ENST00000370742.3	-	6	700	c.637T>A	c.(637-639)Tta>Ata	p.L213I		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	213					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TTCACAGATAACTTGTCCCAA	0.343																																					p.L213I		.											.	ELTD1	24	0			c.T637A						.						159.0	145.0	149.0					1																	79403615		1843	4096	5939	SO:0001583	missense	64123	exon6			CAGATAACTTGTC	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.637T>A	1.37:g.79403615A>T	ENSP00000359778:p.Leu213Ile	Somatic	296.0	0.0		WXS	Illumina HiSeq	Phase_I	371.0	114.0	NM_022159	B1AR71|Q5KU34	Missense_Mutation	SNP	ENST00000370742.3	37	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	A	13.66	2.303610	0.40795	.	.	ENSG00000162618	ENST00000370742	T	0.12361	2.69	5.79	2.33	0.28932	Domain of unknown function DUF3497 (1);	0.109877	0.64402	D	0.000017	T	0.03434	0.0099	L	0.44542	1.39	0.22620	N	0.998922	B	0.20368	0.044	B	0.28709	0.093	T	0.38156	-0.9674	9	.	.	.	.	3.3665	0.07206	0.5024:0.0:0.3272:0.1704	.	213	Q9HBW9	ELTD1_HUMAN	I	213	ENSP00000359778:L213I	.	L	-	1	2	ELTD1	79176203	0.963000	0.33076	0.600000	0.28864	0.953000	0.61014	2.053000	0.41326	1.021000	0.39600	0.455000	0.32223	TTA	.		0.343	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
FAM182B	728882	bcgsc.ca;mdanderson.org	37	20	25755549	25755549	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr20:25755549C>A	ENST00000376403.1	-	3	785	c.407G>T	c.(406-408)gGc>gTc	p.G136V	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	136										lung(1)	1						TGGTCTGCAGCCTTCCTGGGA	0.716																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	728882	.			CTGCAGCCTTCCT			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.407G>T	20.37:g.25755549C>A	ENSP00000365585:p.Gly136Val	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_1	20.0	4.0	.	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.024	-0.684035	0.03353	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	V	136	.	ENSP00000365585:G136V	G	-	2	0	FAM182B	25703549	0.129000	0.22400	0.158000	0.22627	0.158000	0.22134	-0.337000	0.07852	0.064000	0.16427	0.064000	0.15345	GGC	.		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
EYA2	2139	ucsc.edu;bcgsc.ca	37	20	45702937	45702937	+	Silent	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr20:45702937T>C	ENST00000327619.5	+	7	998	c.624T>C	c.(622-624)tcT>tcC	p.S208S	EYA2_ENST00000317304.6_Silent_p.S208S|EYA2_ENST00000357410.3_Silent_p.S208S	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	208					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				AGGAGGCATCTCACAACGTCC	0.592																																					p.S208S	Pancreas(120;56 1725 18501 25218 43520)	.											.	EYA2	523	0			c.T624C						.						140.0	116.0	124.0					20																	45702937		2203	4300	6503	SO:0001819	synonymous_variant	2139	exon7			GGCATCTCACAAC		CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.624T>C	20.37:g.45702937T>C		Somatic	65.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_172110	Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Silent	SNP	ENST00000327619.5	37	CCDS13403.1																																																																																			.		0.592	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080326.2	NM_005244	
FCGBP	8857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	40360958	40360959	+	Missense_Mutation	DNP	GC	GC	TT	rs371263426		TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:40360958_40360959GC>TT	ENST00000221347.6	-	33	15456_15457	c.15449_15450GC>AA	c.(15448-15450)cGC>cAA	p.R5150Q		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	5150	Cys-rich.|TIL 12.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCTCAAAACAGCGGGTGGTGCA	0.629																																					p.R5150R|p.R5150H		.											.	FCGBP	98	0			c.C15450A|c.G15449A						.																																			SO:0001583	missense	8857	exon33			AAAACAGCGGGTG|AAACAGCGGGTGG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.15449_15450delinsTT	19.37:g.40360958_40360959delinsTT	ENSP00000221347:p.Arg5150Gln	Somatic	69.0|68.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	19.0|18.0	NM_003890	O95784	Silent|Missense_Mutation	SNP	ENST00000221347.6	37	CCDS12546.1																																																																																			.		0.629	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
GCNT3	9245	ucsc.edu;bcgsc.ca	37	15	59911038	59911038	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr15:59911038T>C	ENST00000396065.1	+	3	1049	c.601T>C	c.(601-603)Tcc>Ccc	p.S201P	GCNT3_ENST00000560585.1_Missense_Mutation_p.S201P	NM_004751.2	NP_004742.1	O95395	GCNT3_HUMAN	glucosaminyl (N-acetyl) transferase 3, mucin type	201					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|immunoglobulin production in mucosal tissue (GO:0002426)|intestinal absorption (GO:0050892)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|tissue morphogenesis (GO:0048729)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0047225)|beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGCCTCCTGGTCCAGGGTGCA	0.483																																					p.S201P		.											.	GCNT3	91	0			c.T601C						.						121.0	113.0	115.0					15																	59911038		2190	4290	6480	SO:0001583	missense	9245	exon3			TCCTGGTCCAGGG	AF102542	CCDS10172.1	15q22	2013-02-25			ENSG00000140297	ENSG00000140297	2.4.1.102, 2.4.1.150	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4205	protein-coding gene	gene with protein product		606836				9915862, 9988682	Standard	NM_004751		Approved	C2GnT-M, C2/4GnT, C2GnT2	uc002age.3	O95395	OTTHUMG00000132726	ENST00000396065.1:c.601T>C	15.37:g.59911038T>C	ENSP00000379377:p.Ser201Pro	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_004751		Missense_Mutation	SNP	ENST00000396065.1	37	CCDS10172.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.626096	0.46840	.	.	ENSG00000140297	ENST00000396065	T	0.16196	2.36	6.13	6.13	0.99165	.	0.169123	0.53938	D	0.000046	T	0.22322	0.0538	M	0.77820	2.39	0.53688	D	0.99997	B	0.22541	0.071	B	0.25291	0.059	T	0.13255	-1.0516	10	0.66056	D	0.02	.	6.8686	0.24108	0.1344:0.069:0.0:0.7966	.	201	O95395	GCNT3_HUMAN	P	201	ENSP00000379377:S201P	ENSP00000379377:S201P	S	+	1	0	GCNT3	57698330	0.886000	0.30341	1.000000	0.80357	0.993000	0.82548	1.080000	0.30779	2.367000	0.80283	0.529000	0.55759	TCC	.		0.483	GCNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256068.1	NM_004751	
GLT8D2	83468	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104396997	104396997	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:104396997G>A	ENST00000360814.4	-	5	605	c.200C>T	c.(199-201)gCt>gTt	p.A67V	GLT8D2_ENST00000546436.1_Missense_Mutation_p.A67V|GLT8D2_ENST00000548660.1_Missense_Mutation_p.A67V	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	67						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						ATTGATGGCAGCCATAGTGGC	0.463																																					p.A67V		.											.	GLT8D2	92	0			c.C200T						.						221.0	176.0	191.0					12																	104396997		2203	4300	6503	SO:0001583	missense	83468	exon5			ATGGCAGCCATAG	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.200C>T	12.37:g.104396997G>A	ENSP00000354053:p.Ala67Val	Somatic	154.0	1.0		WXS	Illumina HiSeq	Phase_I	145.0	56.0	NM_031302	Q96KA2	Missense_Mutation	SNP	ENST00000360814.4	37	CCDS9096.1	.	.	.	.	.	.	.	.	.	.	G	33	5.272728	0.95429	.	.	ENSG00000120820	ENST00000360814;ENST00000546436;ENST00000548660;ENST00000546851	T;T;T;T	0.38240	1.15;1.15;1.15;2.28	5.73	5.73	0.89815	.	0.050828	0.85682	D	0.000000	T	0.43656	0.1257	L	0.41356	1.27	0.80722	D	1	D	0.63046	0.992	P	0.56612	0.802	T	0.10245	-1.0638	10	0.06757	T	0.87	.	19.503	0.95104	0.0:0.0:1.0:0.0	.	67	Q9H1C3	GL8D2_HUMAN	V	67;67;67;6	ENSP00000354053:A67V;ENSP00000449750:A67V;ENSP00000447450:A67V;ENSP00000446810:A6V	ENSP00000354053:A67V	A	-	2	0	GLT8D2	102921127	1.000000	0.71417	0.992000	0.48379	0.866000	0.49608	9.038000	0.93771	2.709000	0.92574	0.563000	0.77884	GCT	.		0.463	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407371.1	NM_031302	
GPR12	2835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	27332981	27332981	+	Silent	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr13:27332981C>T	ENST00000381436.2	-	1	1446	c.984G>A	c.(982-984)gcG>gcA	p.A328A	GPR12_ENST00000405846.3_Silent_p.A328A			P47775	GPR12_HUMAN	G protein-coupled receptor 12	328					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		TGGGCGAGCGCGCTCTCTGGG	0.537																																					p.A328A		.											.	GPR12	90	0			c.G984A						.						65.0	67.0	66.0					13																	27332981		2203	4300	6503	SO:0001819	synonymous_variant	2835	exon2			CGAGCGCGCTCTC	U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.984G>A	13.37:g.27332981C>T		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	30.0	NM_005288	Q5T8P3	Silent	SNP	ENST00000381436.2	37	CCDS9319.1																																																																																			.		0.537	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2		
GRIN2B	2904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	13716219	13716219	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:13716219G>C	ENST00000609686.1	-	13	4162	c.3953C>G	c.(3952-3954)gCc>gGc	p.A1318G		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1318					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTGCGCGGGGCCAGGGCGGC	0.592																																					p.A1318G		.											.	GRIN2B	231	0			c.C3953G						.						67.0	76.0	73.0					12																	13716219		2203	4300	6503	SO:0001583	missense	2904	exon13			CGCGGGGCCAGGG		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3953C>G	12.37:g.13716219G>C	ENSP00000477455:p.Ala1318Gly	Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	93.0	NM_000834	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480261	0.44044	.	.	ENSG00000150086	ENST00000279593	T	0.10477	2.87	4.7	4.7	0.59300	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.057069	0.64402	D	0.000001	T	0.10937	0.0267	N	0.14661	0.345	0.53688	D	0.999979	P	0.36086	0.536	B	0.42738	0.396	T	0.32428	-0.9907	10	0.36615	T	0.2	.	18.2005	0.89836	0.0:0.0:1.0:0.0	.	1318	Q13224	NMDE2_HUMAN	G	1318	ENSP00000279593:A1318G	ENSP00000279593:A1318G	A	-	2	0	GRIN2B	13607486	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	9.202000	0.95026	2.579000	0.87056	0.563000	0.77884	GCC	.		0.592	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
HECTD1	25831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	31597908	31597908	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr14:31597908G>A	ENST00000399332.1	-	25	5157	c.4669C>T	c.(4669-4671)Cgg>Tgg	p.R1557W	HECTD1_ENST00000553700.1_Missense_Mutation_p.R1557W	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1557	Ser-rich.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GCATTAGTCCGTGCTATGTTT	0.468																																					p.R1557W		.											.	HECTD1	570	0			c.C4669T						.						151.0	138.0	143.0					14																	31597908		2025	4185	6210	SO:0001583	missense	25831	exon25			TAGTCCGTGCTAT	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.4669C>T	14.37:g.31597908G>A	ENSP00000382269:p.Arg1557Trp	Somatic	276.0	1.0		WXS	Illumina HiSeq	Phase_I	234.0	97.0	NM_015382	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	ENST00000399332.1	37	CCDS41939.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059759	0.55325	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.43688	0.94;0.94;3.07	6.16	6.16	0.99307	.	0.000000	0.64402	U	0.000007	T	0.50326	0.1609	N	0.19112	0.55	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.982	T	0.52283	-0.8596	10	0.87932	D	0	-7.4753	15.5636	0.76269	0.0:0.0:0.8622:0.1378	.	1557;1557	D3DS86;Q9ULT8	.;HECD1_HUMAN	W	1557;1559;1557;984	ENSP00000450697:R1557W;ENSP00000382269:R1557W;ENSP00000451860:R984W	ENSP00000261312:R1559W	R	-	1	2	HECTD1	30667659	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.183000	0.65065	2.937000	0.99478	0.650000	0.86243	CGG	.		0.468	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409942.1		
HIST1H2AG	8969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27101166	27101166	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr6:27101166G>T	ENST00000359193.2	+	1	335	c.316G>T	c.(316-318)Ggc>Tgc	p.G106C	HIST1H2BJ_ENST00000541790.1_5'Flank|HIST1H2BJ_ENST00000339812.2_5'Flank|HIST1H2BJ_ENST00000607124.1_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	106						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						CATCGCACAGGGCGGTGTCCT	0.562																																					p.G106C		.											.	HIST1H2AG	68	0			c.G316T						.						109.0	102.0	105.0					6																	27101166		2203	4300	6503	SO:0001583	missense	8969	exon1			GCACAGGGCGGTG	L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.316G>T	6.37:g.27101166G>T	ENSP00000352119:p.Gly106Cys	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	53.0	NM_021064	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359193.2	37	CCDS4619.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.704086	0.68615	.	.	ENSG00000196787	ENST00000359193	T	0.47869	0.83	4.08	4.08	0.47627	Histone-fold (2);Histone H2A (2);	0.000000	0.41001	D	0.000968	T	0.62588	0.2440	.	.	.	0.43977	D	0.996666	D	0.89917	1.0	D	0.91635	0.999	T	0.68827	-0.5306	9	0.87932	D	0	.	14.6102	0.68510	0.0:0.0:1.0:0.0	.	106	P0C0S8	H2A1_HUMAN	C	106	ENSP00000352119:G106C	ENSP00000352119:G106C	G	+	1	0	HIST1H2AG	27209145	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.086000	0.76885	2.217000	0.71921	0.655000	0.94253	GGC	.		0.562	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064	
HMGCLL1	54511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	55360266	55360266	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr6:55360266C>G	ENST00000398661.2	-	8	967	c.836G>C	c.(835-837)tGt>tCt	p.C279S	HMGCLL1_ENST00000508459.1_Intron|HMGCLL1_ENST00000274901.4_Missense_Mutation_p.C249S|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.C217S|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.C146S	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	279					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)	p.C279Y(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			TGTGTCATGACAGTGAACAGC	0.428																																					p.C279S	Ovarian(35;840 893 7837 15538 42887)	.											.	HMGCLL1	94	1	Substitution - Missense(1)	prostate(1)	c.G836C						.						145.0	130.0	135.0					6																	55360266		1903	4119	6022	SO:0001583	missense	54511	exon8			TCATGACAGTGAA	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.836G>C	6.37:g.55360266C>G	ENSP00000381654:p.Cys279Ser	Somatic	203.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	64.0	NM_019036	B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	37	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.400326	0.83120	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000308161	D;D;D;D	0.98313	-4.86;-4.86;-4.86;-4.86	5.62	5.62	0.85841	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.99242	0.9736	M	0.91459	3.21	0.80722	D	1	D;D;D;D	0.89917	0.998;0.995;0.998;1.0	D;D;D;D	0.97110	0.999;0.975;0.996;1.0	D	0.99425	1.0934	10	0.87932	D	0	-16.0907	19.6685	0.95901	0.0:1.0:0.0:0.0	.	146;217;249;279	B7Z212;F8W793;Q8TB92-2;Q8TB92	.;.;.;HMGC2_HUMAN	S	249;279;146;217	ENSP00000274901:C249S;ENSP00000381654:C279S;ENSP00000359887:C146S;ENSP00000309737:C217S	ENSP00000274901:C249S	C	-	2	0	HMGCLL1	55468225	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	6.070000	0.71220	2.639000	0.89480	0.655000	0.94253	TGT	.		0.428	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1	XM_166383	
IBSP	3381	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88732600	88732600	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr4:88732600A>T	ENST00000226284.5	+	7	559	c.492A>T	c.(490-492)gaA>gaT	p.E164D		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	164	Asp/Glu-rich (acidic).				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		aaaacgaagaaagcgaagcag	0.458																																					p.E164D		.											.	IBSP	90	0			c.A492T						.						136.0	125.0	129.0					4																	88732600		2203	4300	6503	SO:0001583	missense	3381	exon7			CGAAGAAAGCGAA		CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.492A>T	4.37:g.88732600A>T	ENSP00000226284:p.Glu164Asp	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	53.0	NM_004967		Missense_Mutation	SNP	ENST00000226284.5	37	CCDS3624.1	.	.	.	.	.	.	.	.	.	.	A	14.96	2.691079	0.48097	.	.	ENSG00000029559	ENST00000226284	T	0.14391	2.51	4.92	0.699	0.18093	.	0.691694	0.13979	N	0.349626	T	0.14917	0.0360	L	0.46157	1.445	0.29739	N	0.837225	P	0.47253	0.892	P	0.49421	0.61	T	0.11542	-1.0583	10	0.39692	T	0.17	.	4.1592	0.10275	0.5304:0.1873:0.2823:0.0	.	164	P21815	SIAL_HUMAN	D	164	ENSP00000226284:E164D	ENSP00000226284:E164D	E	+	3	2	IBSP	88951624	0.505000	0.26131	0.976000	0.42696	0.858000	0.48976	-0.084000	0.11268	0.299000	0.22661	0.482000	0.46254	GAA	.		0.458	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253050.2		
IDS	3423	ucsc.edu;bcgsc.ca	37	X	148578000	148578000	+	Silent	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chrX:148578000A>G	ENST00000340855.6	-	6	965	c.756T>C	c.(754-756)gaT>gaC	p.D252D	IDS_ENST00000541269.1_Silent_p.D41D|IDS_ENST00000370443.4_Silent_p.D252D|IDS_ENST00000370441.4_Silent_p.D252D|IDS_ENST00000422081.2_Silent_p.D41D|IDS_ENST00000490775.1_5'UTR	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	252			D -> N (in MPS2; dbSNP:rs146458524). {ECO:0000269|PubMed:8940265}.		carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					GGACCTCGGGATCGGGGGCCA	0.517																																					p.D252D		.											.	IDS	130	0			c.T756C						.						128.0	120.0	123.0					X																	148578000		2203	4300	6503	SO:0001819	synonymous_variant	3423	exon6			CTCGGGATCGGGG	M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.756T>C	X.37:g.148578000A>G		Somatic	58.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_006123	D3DWT4|Q14604|Q9BRM3	Silent	SNP	ENST00000340855.6	37	CCDS14685.1																																																																																			.		0.517	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058677.3		
IGF2BP1	10642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47117454	47117454	+	Splice_Site	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr17:47117454G>A	ENST00000290341.3	+	7	1152		c.e7+1		IGF2BP1_ENST00000431824.2_Intron	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1						CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						ACACCAAAACGTAAGTCTCCA	0.453																																					.	Esophageal Squamous(198;1041 2123 8248 37119 38268)	.											.	IGF2BP1	226	0			c.818+1G>A						.						136.0	120.0	125.0					17																	47117454		2203	4300	6503	SO:0001630	splice_region_variant	10642	exon7			CAAAACGTAAGTC	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.818+1G>A	17.37:g.47117454G>A		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	24.0	NM_006546	C9JT33	Splice_Site	SNP	ENST00000290341.3	37	CCDS11543.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683950	0.88639	.	.	ENSG00000159217	ENST00000290341	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.512	0.90920	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IGF2BP1	44472453	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.866000	0.99616	2.655000	0.90218	0.655000	0.94253	.	.		0.453	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1	NM_006546	Intron
IL17RD	54756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57154328	57154328	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:57154328G>A	ENST00000296318.7	-	2	228	c.140C>T	c.(139-141)gCc>gTc	p.A47V	IL17RD_ENST00000479825.1_5'UTR|IL17RD_ENST00000320057.5_5'UTR|IL17RD_ENST00000463523.1_5'UTR|IL17RD_ENST00000427856.2_Missense_Mutation_p.A23V	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	47					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		GTTTCTGCTGGCTGGCCCCAC	0.468																																					p.A47V		.											.	IL17RD	500	0			c.C140T						.						99.0	95.0	96.0					3																	57154328		1991	4177	6168	SO:0001583	missense	54756	exon2			CTGCTGGCTGGCC	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.140C>T	3.37:g.57154328G>A	ENSP00000296318:p.Ala47Val	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	31.0	NM_017563	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	ENST00000296318.7	37	CCDS2880.2	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416150	0.25552	.	.	ENSG00000144730	ENST00000296318;ENST00000427856	T;T	0.09723	2.96;2.95	6.06	5.01	0.66863	.	0.313090	0.30742	N	0.008975	T	0.03390	0.0098	N	0.02539	-0.55	0.31469	N	0.66865	B;B	0.11235	0.002;0.004	B;B	0.11329	0.005;0.006	T	0.35025	-0.9805	10	0.07813	T	0.8	3.8493	7.0422	0.25027	0.2312:0.0:0.7687:0.0	.	47;23	Q8NFM7;Q8NFM7-3	I17RD_HUMAN;.	V	47;23	ENSP00000296318:A47V;ENSP00000399209:A23V	ENSP00000296318:A47V	A	-	2	0	IL17RD	57129368	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	2.734000	0.47368	2.882000	0.98803	0.655000	0.94253	GCC	.		0.468	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
ITGA10	8515	hgsc.bcm.edu;mdanderson.org	37	1	145532146	145532146	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr1:145532146C>T	ENST00000369304.3	+	8	965	c.790C>T	c.(790-792)Cga>Tga	p.R264*	ITGA10_ENST00000481236.1_3'UTR|ITGA10_ENST00000538811.1_Nonsense_Mutation_p.R133*|ITGA10_ENST00000539363.1_Nonsense_Mutation_p.R121*	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	264	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCATGGGGGCCGACCCGAGGC	0.547																																					p.R264X		.											.	ITGA10	231	0			c.C790T						.						90.0	91.0	90.0					1																	145532146		2203	4300	6503	SO:0001587	stop_gained	8515	exon8			GGGGGCCGACCCG	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.790C>T	1.37:g.145532146C>T	ENSP00000358310:p.Arg264*	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	14.0	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Nonsense_Mutation	SNP	ENST00000369304.3	37	CCDS918.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712684	0.89112	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	.	.	.	5.2	4.28	0.50868	.	0.174265	0.37715	N	0.001963	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3139	0.49379	0.3285:0.6714:0.0:0.0	.	.	.	.	X	264;230;121;133	.	ENSP00000358310:R264X	R	+	1	2	ITGA10	144243503	0.041000	0.20044	0.998000	0.56505	0.993000	0.82548	0.402000	0.20965	1.325000	0.45301	0.511000	0.50034	CGA	.		0.547	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
KIDINS220	57498	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	8871250	8871250	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:8871250A>G	ENST00000256707.3	-	30	5097	c.4916T>C	c.(4915-4917)aTt>aCt	p.I1639T	KIDINS220_ENST00000427284.1_Missense_Mutation_p.I1620T|KIDINS220_ENST00000418530.1_Missense_Mutation_p.I1540T|KIDINS220_ENST00000473731.1_Missense_Mutation_p.I1620T	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1639					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCGAGCTATAATTGGATCTTG	0.498																																					p.I1639T		.											.	KIDINS220	93	0			c.T4916C						.						82.0	75.0	77.0					2																	8871250		1948	4133	6081	SO:0001583	missense	57498	exon30			GCTATAATTGGAT	AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.4916T>C	2.37:g.8871250A>G	ENSP00000256707:p.Ile1639Thr	Somatic	146.0	2.0		WXS	Illumina HiSeq	Phase_I	98.0	48.0	NM_020738	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	ENST00000256707.3	37	CCDS42650.1	.	.	.	.	.	.	.	.	.	.	A	3.635	-0.074681	0.07184	.	.	ENSG00000134313	ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731	T;T;T;T	0.63913	-0.07;-0.04;-0.01;-0.04	5.92	0.473	0.16763	.	1.602060	0.03163	N	0.169542	T	0.35970	0.0950	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.14012	0.0;0.0;0.009	B;B;B	0.20384	0.001;0.0;0.029	T	0.19386	-1.0307	10	0.17832	T	0.49	.	3.5029	0.07680	0.2548:0.4796:0.1474:0.1183	.	1540;1639;493	Q9ULH0-2;Q9ULH0;B4DG84	.;KDIS_HUMAN;.	T	1639;1620;1540;1620	ENSP00000256707:I1639T;ENSP00000411849:I1620T;ENSP00000414923:I1540T;ENSP00000418974:I1620T	ENSP00000256707:I1639T	I	-	2	0	KIDINS220	8788701	0.000000	0.05858	0.000000	0.03702	0.925000	0.55904	0.661000	0.25023	0.123000	0.18342	0.533000	0.62120	ATT	.		0.498	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323408.2	NM_020738	
KLK12	43849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	51535232	51535232	+	Silent	SNP	G	G	A	rs371203521		TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:51535232G>A	ENST00000525263.1	-	3	476	c.357C>T	c.(355-357)cgC>cgT	p.R119R	KLK12_ENST00000319590.4_Silent_p.R119R|KLK12_ENST00000250351.4_Silent_p.R119R|CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000250352.11_Intron|KLK12_ENST00000529888.1_Intron			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	119	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		TGCTGGTTACGCGGACGGGCA	0.682																																					p.R119R		.											.	KLK12	227	0			c.C357T						.	G	,,	0,4406		0,0,2203	39.0	39.0	39.0		357,357,	0.7	0.0	19		39	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous,coding-synonymous,intron	KLK12	NM_019598.2,NM_145894.1,NM_145895.1	,,	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	,,	119/255,119/249,	51535232	1,13001	2203	4298	6501	SO:0001819	synonymous_variant	43849	exon4			GGTTACGCGGACG		CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.357C>T	19.37:g.51535232G>A		Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	15.0	NM_019598	Q9UKR1|Q9UKR2	Silent	SNP	ENST00000525263.1	37	CCDS12821.1																																																																																			.		0.682	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000386288.1	NM_019598	
KRTAP9-3	83900	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	39389083	39389083	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr17:39389083T>A	ENST00000411528.2	+	1	369	c.330T>A	c.(328-330)agT>agA	p.S110R		NM_031962.2	NP_114168.1	Q9BYQ3	KRA93_HUMAN	keratin associated protein 9-3	110	16 X 5 AA repeats of C-C-[RQVSHE]-[SPTN]- [TASPI].					keratin filament (GO:0045095)				breast(1)|endometrium(3)|lung(2)|ovary(1)|prostate(1)	8		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			ACCCCACAAGTGTTTGTCTGC	0.612																																					p.S110R		.											.	KRTAP9-3	91	0			c.T330A						.						134.0	151.0	145.0					17																	39389083		2103	4300	6403	SO:0001583	missense	83900	exon1			CACAAGTGTTTGT	AJ406947	CCDS11385.1	17q21.2	2013-06-25			ENSG00000204873	ENSG00000204873		"""Keratin associated proteins"""	16927	protein-coding gene	gene with protein product						11279113	Standard	NM_031962		Approved	KAP9.3	uc021txg.1	Q9BYQ3	OTTHUMG00000133427	ENST00000411528.2:c.330T>A	17.37:g.39389083T>A	ENSP00000392189:p.Ser110Arg	Somatic	179.0	2.0		WXS	Illumina HiSeq	Phase_I	116.0	44.0	NM_031962		Missense_Mutation	SNP	ENST00000411528.2	37	CCDS11385.1	.	.	.	.	.	.	.	.	.	.	.	13.44	2.238510	0.39598	.	.	ENSG00000204873	ENST00000411528	T	0.01505	4.82	2.3	-1.0	0.10196	.	.	.	.	.	T	0.04679	0.0127	M	0.78049	2.395	0.09310	N	1	.	.	.	.	.	.	T	0.23297	-1.0192	7	0.72032	D	0.01	.	6.2871	0.21039	0.0:0.5991:0.0:0.4009	.	.	.	.	R	110	ENSP00000392189:S110R	ENSP00000392189:S110R	S	+	3	2	KRTAP9-3	36642609	0.019000	0.18553	0.000000	0.03702	0.003000	0.03518	0.225000	0.17757	-0.090000	0.12462	0.163000	0.16589	AGT	.		0.612	KRTAP9-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257290.1		
MAP1B	4131	ucsc.edu;bcgsc.ca	37	5	71499617	71499617	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr5:71499617A>G	ENST00000296755.7	+	6	7538	c.7240A>G	c.(7240-7242)Agc>Ggc	p.S2414G		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2414	Mediates interaction with TMEM185A.				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TCAGTGGGGCAGCAACATGCA	0.567																																					p.S2414G	Melanoma(17;367 822 11631 31730 47712)	.											.	MAP1B	155	0			c.A7240G						.						51.0	52.0	51.0					5																	71499617		2203	4300	6503	SO:0001583	missense	4131	exon6			TGGGGCAGCAACA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.7240A>G	5.37:g.71499617A>G	ENSP00000296755:p.Ser2414Gly	Somatic	68.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	37	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.823998	0.71143	.	.	ENSG00000131711	ENST00000296755	T	0.03358	3.96	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000001	T	0.03871	0.0109	L	0.34521	1.04	0.40033	D	0.975556	B	0.34015	0.435	B	0.24974	0.057	T	0.50857	-0.8778	10	0.49607	T	0.09	-14.1481	15.3621	0.74487	1.0:0.0:0.0:0.0	.	2414	P46821	MAP1B_HUMAN	G	2414	ENSP00000296755:S2414G	ENSP00000296755:S2414G	S	+	1	0	MAP1B	71535373	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.341000	0.59335	2.281000	0.76405	0.533000	0.62120	AGC	.		0.567	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MAPT	4137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	44051811	44051811	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr17:44051811A>G	ENST00000571987.1	+	3	281	c.281A>G	c.(280-282)cAc>cGc	p.H94R	MAPT_ENST00000344290.5_Missense_Mutation_p.H94R|MAPT_ENST00000574436.1_Missense_Mutation_p.H94R|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000576518.1_5'UTR|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000415613.2_Missense_Mutation_p.H94R|MAPT_ENST00000262410.5_Missense_Mutation_p.H94R|MAPT_ENST00000535772.1_Missense_Mutation_p.H94R|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Missense_Mutation_p.H94R|MAPT_ENST00000431008.3_Missense_Mutation_p.H94R			P10636	TAU_HUMAN	microtubule-associated protein tau	94					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	GCGCAGCCCCACACGGAGATC	0.627																																					p.H94R		.											.	MAPT	91	0			c.A281G						.						26.0	23.0	24.0					17																	44051811		2200	4299	6499	SO:0001583	missense	4137	exon4			AGCCCCACACGGA	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.281A>G	17.37:g.44051811A>G	ENSP00000458742:p.His94Arg	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	19.0	NM_005910	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Missense_Mutation	SNP	ENST00000571987.1	37	CCDS11501.1	.	.	.	.	.	.	.	.	.	.	A	9.268	1.044903	0.19748	.	.	ENSG00000186868	ENST00000344290;ENST00000262410;ENST00000351559;ENST00000535772;ENST00000415613	T;T;T;T;T	0.17370	2.89;2.89;2.28;2.54;2.89	5.22	-4.86	0.03132	.	1.044480	0.07579	N	0.920002	T	0.11537	0.0281	L	0.40543	1.245	0.19575	N	0.999968	B;B;B	0.18166	0.009;0.026;0.001	B;B;B	0.20384	0.015;0.029;0.004	T	0.40942	-0.9536	10	0.16420	T	0.52	0.1525	7.7441	0.28858	0.2822:0.4972:0.2205:0.0	.	94;94;94	P10636-9;P10636-8;P10636	.;.;TAU_HUMAN	R	94	ENSP00000340820:H94R;ENSP00000262410:H94R;ENSP00000303214:H94R;ENSP00000443028:H94R;ENSP00000410838:H94R	ENSP00000262410:H94R	H	+	2	0	MAPT	41407647	0.007000	0.16637	0.011000	0.14972	0.630000	0.37929	-0.062000	0.11674	-1.084000	0.03092	-0.441000	0.05720	CAC	.		0.627	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000440133.1	NM_016835	
MED23	9439	ucsc.edu;bcgsc.ca	37	6	131946047	131946047	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr6:131946047T>C	ENST00000368068.3	-	4	421	c.242A>G	c.(241-243)gAc>gGc	p.D81G	MED23_ENST00000539158.1_Missense_Mutation_p.D81G|MED23_ENST00000368058.1_Missense_Mutation_p.D81G|MED23_ENST00000403834.3_Missense_Mutation_p.D81G|MED23_ENST00000354577.4_Missense_Mutation_p.D81G|MED23_ENST00000368053.4_Missense_Mutation_p.D81G|MED23_ENST00000540546.1_Missense_Mutation_p.D81G|MED23_ENST00000368060.3_Missense_Mutation_p.D81G	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	81					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		TGCTAAGCAGTCATAAAGAAA	0.378																																					p.D81G		.											.	MED23	24	0			c.A242G						.						95.0	97.0	96.0					6																	131946047		2203	4300	6503	SO:0001583	missense	9439	exon4			AAGCAGTCATAAA	AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.242A>G	6.37:g.131946047T>C	ENSP00000357047:p.Asp81Gly	Somatic	55.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_015979	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Missense_Mutation	SNP	ENST00000368068.3	37	CCDS5147.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.857079	0.51376	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000368053;ENST00000540546;ENST00000539158	T;T;T;T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29	5.92	5.92	0.95590	.	0.043136	0.85682	D	0.000000	T	0.67249	0.2873	L	0.36672	1.1	0.80722	D	1	B;B;B	0.32245	0.361;0.0;0.0	B;B;B	0.36567	0.228;0.003;0.002	T	0.69135	-0.5225	10	0.37606	T	0.19	-8.9315	16.3574	0.83241	0.0:0.0:0.0:1.0	.	81;81;81	Q9ULK4-2;Q9ULK4;Q9ULK4-3	.;MED23_HUMAN;.	G	81	ENSP00000346588:D81G;ENSP00000357047:D81G;ENSP00000384536:D81G;ENSP00000357039:D81G;ENSP00000357037:D81G;ENSP00000357032:D81G;ENSP00000437818:D81G;ENSP00000445072:D81G	ENSP00000346588:D81G	D	-	2	0	MED23	131987740	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.270000	0.75569	0.477000	0.44152	GAC	.		0.378	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042215.1		
MFN1	55669	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	179103488	179103488	+	Silent	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:179103488C>T	ENST00000471841.1	+	15	1920	c.1794C>T	c.(1792-1794)ggC>ggT	p.G598G	MFN1_ENST00000263969.5_Silent_p.G598G|MFN1_ENST00000280653.7_Silent_p.G487G	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	598					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			CTTCTATGGGCATCATTATTG	0.388																																					p.G598G		.											.	MFN1	155	0			c.C1794T						.						120.0	109.0	113.0					3																	179103488		2203	4300	6503	SO:0001819	synonymous_variant	55669	exon15			TATGGGCATCATT	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1794C>T	3.37:g.179103488C>T		Somatic	113.0	1.0		WXS	Illumina HiSeq	Phase_I	132.0	46.0	NM_033540	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Silent	SNP	ENST00000471841.1	37	CCDS3228.1																																																																																			.		0.388	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
MIP	4284	ucsc.edu;bcgsc.ca	37	12	56845248	56845248	+	Splice_Site	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:56845248A>G	ENST00000257979.4	-	4	636	c.608T>C	c.(607-609)gTg>gCg	p.V203A	MIP_ENST00000555551.1_5'Flank|TIMELESS_ENST00000554616.1_5'Flank|TIMELESS_ENST00000229201.4_5'Flank|TIMELESS_ENST00000553532.1_5'Flank	NM_012064.3	NP_036196.1	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	203					canalicular bile acid transport (GO:0015722)|lens development in camera-type eye (GO:0002088)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)|water transport (GO:0006833)	gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|structural constituent of eye lens (GO:0005212)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	16						TACCCAGTACACCTGTAGAAA	0.502																																					p.V203A		.											.	MIP	91	0			c.T608C						.						65.0	72.0	69.0					12																	56845248		2203	4300	6503	SO:0001630	splice_region_variant	4284	exon4			CAGTACACCTGTA		CCDS8919.1	12q13	2012-10-02				ENSG00000135517		"""Ion channels / Aquaporins"""	7103	protein-coding gene	gene with protein product	aquaporin 0	154050				1840563, 7536742	Standard	NM_012064		Approved	MP26, LIM1, AQP0	uc001slh.3	P30301		ENST00000257979.4:c.607-1T>C	12.37:g.56845248A>G		Somatic	80.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_012064	Q17R41	Missense_Mutation	SNP	ENST00000257979.4	37	CCDS8919.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.342917	0.82022	.	.	ENSG00000135517	ENST00000257979	D	0.89939	-2.59	4.7	4.7	0.59300	Aquaporin-like (2);	0.123925	0.53938	D	0.000054	D	0.94016	0.8083	M	0.80028	2.48	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.94734	0.7912	10	0.87932	D	0	-9.7917	13.4699	0.61276	1.0:0.0:0.0:0.0	.	203	P30301	MIP_HUMAN	A	203	ENSP00000257979:V203A	ENSP00000257979:V203A	V	-	2	0	MIP	55131515	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.783000	0.91813	1.878000	0.54408	0.454000	0.30748	GTG	.		0.502	MIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409620.1	NM_012064	Missense_Mutation
KMT2B	9757	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36228046	36228046	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:36228046C>A	ENST00000222270.7	+	33	7432	c.7432C>A	c.(7432-7434)Cag>Aag	p.Q2478K	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_Missense_Mutation_p.Q2478K|IGFLR1_ENST00000587101.1_5'Flank	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	2478	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CCTGGCCGAGCAGCTCCCCGG	0.627																																					p.Q2478K		.											.	MLL4	697	0			c.C7432A						.						26.0	29.0	28.0					19																	36228046		2140	4249	6389	SO:0001583	missense	8085	exon33			GCCGAGCAGCTCC	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.7432C>A	19.37:g.36228046C>A	ENSP00000222270:p.Gln2478Lys	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	9.0	NM_014727	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.909948	0.33721	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	T;T	0.44083	0.93;0.93	4.8	4.8	0.61643	FY-rich, C-terminal (1);FY-rich, C-terminal subgroup (1);	0.000000	0.40728	N	0.001038	T	0.65995	0.2745	M	0.77313	2.365	0.58432	D	0.999992	D	0.69078	0.997	D	0.76071	0.987	T	0.70706	-0.4798	10	0.72032	D	0.01	.	16.7835	0.85568	0.0:1.0:0.0:0.0	.	2478	Q9UMN6	MLL4_HUMAN	K	2478	ENSP00000222270:Q2478K;ENSP00000398837:Q2478K	ENSP00000222270:Q2478K	Q	+	1	0	AD000671.1	40919886	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	7.285000	0.78660	2.489000	0.83994	0.563000	0.77884	CAG	.		0.627	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014727	
MTNR1A	4543	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	187455191	187455191	+	Silent	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr4:187455191C>T	ENST00000307161.5	-	2	906	c.705G>A	c.(703-705)agG>agA	p.R235R	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	235					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	TGACAAAATTCCTGAAGTCCT	0.502																																					p.R235R		.											.	MTNR1A	524	0			c.G705A						.						133.0	143.0	139.0					4																	187455191		2203	4300	6503	SO:0001819	synonymous_variant	4543	exon2			AAAATTCCTGAAG		CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.705G>A	4.37:g.187455191C>T		Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	192.0	47.0	NM_005958	A0AVC5|B0M0L2	Silent	SNP	ENST00000307161.5	37	CCDS3848.1																																																																																			.		0.502	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360189.1		
MYH1	4619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10404040	10404040	+	Silent	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr17:10404040T>C	ENST00000226207.5	-	28	3862	c.3768A>G	c.(3766-3768)ctA>ctG	p.L1256L	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1256					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GTTGATCTTCTAGAGCGCGGC	0.458																																					p.L1256L		.											.	MYH1	171	0			c.A3768G						.						155.0	136.0	142.0					17																	10404040		2203	4300	6503	SO:0001819	synonymous_variant	4619	exon28			ATCTTCTAGAGCG		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3768A>G	17.37:g.10404040T>C		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	25.0	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																			.		0.458	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26294307	26294307	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr22:26294307A>G	ENST00000407587.2	+	29	4874	c.4705A>G	c.(4705-4707)Aag>Gag	p.K1569E	CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000600903.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000594856.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000595093.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.K1568E|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.K1568E|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1568	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TGACGGGGCCAAGAAGATGGC	0.473																																					p.K1568E		.											MYO18B,colon,carcinoma,-1	MYO18B	142	0			c.A4702G						.						108.0	110.0	110.0					22																	26294307		1981	4166	6147	SO:0001583	missense	84700	exon29			GGGGCCAAGAAGA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4705A>G	22.37:g.26294307A>G	ENSP00000386096:p.Lys1569Glu	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	34.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	A	11.20	1.569254	0.28003	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;T	0.86497	-2.13;-2.13;-1.05	5.9	3.71	0.42584	.	0.277591	0.32175	N	0.006475	D	0.82384	0.5025	L	0.54323	1.7	0.28415	N	0.918008	P;B;P;P	0.36789	0.57;0.434;0.51;0.57	B;B;B;B	0.32864	0.154;0.074;0.107;0.154	T	0.74765	-0.3554	10	0.56958	D	0.05	.	11.3383	0.49518	0.7108:0.2892:0.0:0.0	.	1081;1568;1569;1568	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	E	1568;1568;1569	ENSP00000441229:K1568E;ENSP00000334563:K1568E;ENSP00000386096:K1569E	ENSP00000334563:K1568E	K	+	1	0	MYO18B	24624307	1.000000	0.71417	0.984000	0.44739	0.468000	0.32798	1.825000	0.39081	0.443000	0.26582	0.533000	0.62120	AAG	.		0.473	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MYO1E	4643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	59450529	59450529	+	Silent	SNP	A	A	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr15:59450529A>C	ENST00000288235.4	-	25	3234	c.2835T>G	c.(2833-2835)acT>acG	p.T945T		NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	945					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TGGCATTTTGAGTCCCACTGG	0.463																																					p.T945T		.											.	MYO1E	514	0			c.T2835G						.						157.0	119.0	132.0					15																	59450529		2191	4290	6481	SO:0001819	synonymous_variant	4643	exon25			ATTTTGAGTCCCA	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.2835T>G	15.37:g.59450529A>C		Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	81.0	NM_004998	Q14778	Silent	SNP	ENST00000288235.4	37	CCDS32254.1																																																																																			.		0.463	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
NBPF3	84224	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	21808194	21808194	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr1:21808194G>C	ENST00000318249.5	+	13	1888	c.1538G>C	c.(1537-1539)tGc>tCc	p.C513S	NBPF3_ENST00000342104.5_Missense_Mutation_p.C501S|NBPF3_ENST00000318220.6_Missense_Mutation_p.C457S|NBPF3_ENST00000454000.2_Missense_Mutation_p.C443S	NM_032264.3	NP_115640.1	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	513	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	20		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCTGATTCATGCCAGCCCTAC	0.488																																					p.R513T		.											.	NBPF3	92	0			c.G1538C						.						28.0	29.0	29.0					1																	21808194		2199	4276	6475	SO:0001583	missense	84224	exon13			ATTCATGCCAGCC	BC024011	CCDS216.1, CCDS57976.1, CCDS57977.1	1p36.12	2013-01-17			ENSG00000142794	ENSG00000142794		"""neuroblastoma breakpoint family"""	25076	protein-coding gene	gene with protein product		612992				11230166, 16079250	Standard	NM_032264		Approved	AE2	uc001ber.4	Q9H094	OTTHUMG00000002944	ENST00000318249.5:c.1538G>C	1.37:g.21808194G>C	ENSP00000316782:p.Cys513Ser	Somatic	502.0	0.0		WXS	Illumina HiSeq	Phase_I	385.0	84.0	NM_032264	A8K965|B4DSP2|I3L0I8|Q3BBW1|Q5VTG2|Q5VTG3|Q5VTG4|Q8IX78|Q8ND86|Q8TC96	Missense_Mutation	SNP	ENST00000318249.5	37	CCDS216.1	.	.	.	.	.	.	.	.	.	.	.	0.022	-1.407808	0.01155	.	.	ENSG00000142794	ENST00000454000;ENST00000318220;ENST00000318249;ENST00000342104;ENST00000434838	T;T;T;T;T	0.06371	3.31;3.31;3.31;3.31;3.31	0.766	-0.843	0.10744	DUF1220 (2);	.	.	.	.	T	0.08537	0.0212	M	0.77616	2.38	0.09310	N	1	B;B;B	0.32862	0.387;0.054;0.067	B;B;B	0.37267	0.245;0.005;0.062	T	0.36187	-0.9758	9	0.20519	T	0.43	.	3.5553	0.07862	0.0:0.0:0.4385:0.5615	.	443;501;513	B4DSP2;Q9H094-3;Q9H094	.;.;NBPF3_HUMAN	S	443;457;513;501;457	ENSP00000415711:C443S;ENSP00000316739:C457S;ENSP00000316782:C513S;ENSP00000340336:C501S;ENSP00000391865:C457S	ENSP00000316739:C457S	C	+	2	0	NBPF3	21680781	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.599000	0.05700	-0.242000	0.09667	-0.779000	0.03376	TGC	.		0.488	NBPF3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_032264	
NCAM2	4685	ucsc.edu;bcgsc.ca;mdanderson.org	37	21	22804446	22804446	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr21:22804446A>C	ENST00000400546.1	+	12	1748	c.1499A>C	c.(1498-1500)tAt>tCt	p.Y500S	NCAM2_ENST00000284894.7_Missense_Mutation_p.Y358S	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	500	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TCCAGTCCCTATGGAGTGAAG	0.443																																					p.Y500S		.											.	NCAM2	94	0			c.A1499C						.						66.0	62.0	64.0					21																	22804446		1917	4129	6046	SO:0001583	missense	4685	exon12			GTCCCTATGGAGT		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1499A>C	21.37:g.22804446A>C	ENSP00000383392:p.Tyr500Ser	Somatic	216.0	2.0		WXS	Illumina HiSeq	.	197.0	65.0	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	A	9.933	1.215425	0.22373	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.54071	0.59;0.59	5.27	-0.75	0.11080	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.297977	0.38436	N	0.001687	T	0.31827	0.0809	L	0.28458	0.855	0.80722	D	1	B;B	0.11235	0.004;0.004	B;B	0.12837	0.008;0.005	T	0.07233	-1.0783	10	0.14252	T	0.57	-4.186	7.9349	0.29925	0.5582:0.3672:0.0746:0.0	.	358;500	B7Z5K2;O15394	.;NCAM2_HUMAN	S	500;358	ENSP00000383392:Y500S;ENSP00000284894:Y358S	ENSP00000284894:Y358S	Y	+	2	0	NCAM2	21726317	0.999000	0.42202	0.997000	0.53966	0.932000	0.56968	2.843000	0.48238	0.260000	0.21731	0.413000	0.27773	TAT	.		0.443	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
NMB	4828	ucsc.edu;bcgsc.ca	37	15	85198626	85198626	+	Silent	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr15:85198626C>A	ENST00000360476.3	-	3	740	c.345G>T	c.(343-345)ctG>ctT	p.L115L	WDR73_ENST00000434634.2_5'Flank|NMB_ENST00000394588.3_Missense_Mutation_p.G114C|WDR73_ENST00000398528.3_5'Flank			P08949	NMB_HUMAN	neuromedin B	115					arachidonic acid secretion (GO:0050482)|cell-cell signaling (GO:0007267)|glucose homeostasis (GO:0042593)|negative regulation of hormone secretion (GO:0046888)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hormone secretion (GO:0046887)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|neuron projection (GO:0043005)	hormone activity (GO:0005179)			endometrium(1)	1				all cancers(203;3.5e-06)		GTATTTGTACCAGCAGCCTCC	0.502																																					p.G114C		.											.	NMB	90	0			c.G340T						.						192.0	190.0	191.0					15																	85198626		2203	4299	6502	SO:0001819	synonymous_variant	4828	exon3			TTGTACCAGCAGC		CCDS10332.1, CCDS42076.1	15q25.2-q25.3	2013-09-19			ENSG00000197696	ENSG00000197696			7842	protein-coding gene	gene with protein product		162340				2458345	Standard	NM_021077		Approved	MGC2277, MGC3936, MGC17211	uc002bla.3	P08949	OTTHUMG00000148666	ENST00000360476.3:c.345G>T	15.37:g.85198626C>A		Somatic	100.0	1.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_205858	Q96A06|Q96HH5	Missense_Mutation	SNP	ENST00000360476.3	37	CCDS10332.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456802	0.63401	.	.	ENSG00000197696	ENST00000394588	T	0.61510	0.1	4.77	3.81	0.43845	.	.	.	.	.	T	0.70876	0.3274	.	.	.	0.26364	N	0.976994	D	0.76494	0.999	D	0.68483	0.958	T	0.59984	-0.7351	8	0.72032	D	0.01	3.6913	10.2884	0.43581	0.1957:0.8043:0.0:0.0	.	114	P08949-2	.	C	114	ENSP00000378089:G114C	ENSP00000378089:G114C	G	-	1	0	NMB	82999630	0.086000	0.21541	0.953000	0.39169	0.953000	0.61014	0.279000	0.18771	2.472000	0.83506	0.655000	0.94253	GGT	.		0.502	NMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308995.1	NM_021077	
NXF3	56000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	102335094	102335094	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chrX:102335094C>A	ENST00000395065.3	-	11	1079	c.978G>T	c.(976-978)aaG>aaT	p.K326N	NXF3_ENST00000425644.1_Missense_Mutation_p.R17I	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	326					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						TTGGTAACCTCTTGTGGGCTT	0.547																																					p.K326N		.											.	NXF3	205	0			c.G978T						.						195.0	172.0	180.0					X																	102335094		2203	4300	6503	SO:0001583	missense	56000	exon11			TAACCTCTTGTGG	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.978G>T	X.37:g.102335094C>A	ENSP00000378504:p.Lys326Asn	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	37.0	NM_022052	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	ENST00000395065.3	37	CCDS14503.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	9.801|9.801|9.801	1.180415|1.180415|1.180415	0.21787|0.21787|0.21787	.|.|.	.|.|.	ENSG00000147206|ENSG00000147206|ENSG00000147206	ENST00000427570|ENST00000395065|ENST00000425644	.|T|.	.|0.47177|.	.|0.85|.	4.44|4.44|4.44	3.56|3.56|3.56	0.40772|0.40772|0.40772	.|.|.	.|0.105018|.	.|0.64402|.	.|D|.	.|0.000006|.	.|T|T	.|0.44932|0.44932	.|0.1317|0.1317	L|L|L	0.54323|0.54323|0.54323	1.7|1.7|1.7	0.19775|0.19775|0.19775	N|N|N	0.999958|0.999958|0.999958	.|P;B|.	.|0.48503|.	.|0.911;0.207|.	.|P;B|.	.|0.44623|.	.|0.455;0.106|.	.|T|T	.|0.28554|0.28554	.|-1.0040|-1.0040	.|10|6	.|0.16420|0.37606	.|T|T	.|0.52|0.19	-20.0199|-20.0199|-20.0199	10.0461|10.0461|10.0461	0.42188|0.42188|0.42188	0.0:0.7989:0.2011:0.0|0.0:0.7989:0.2011:0.0|0.0:0.7989:0.2011:0.0	.|.|.	.|222;326|.	.|E9PEY7;Q9H4D5|.	.|.;NXF3_HUMAN|.	X|N|I	203|326|17	.|ENSP00000378504:K326N|.	.|ENSP00000378504:K326N|ENSP00000401026:R17I	E|K|R	-|-|-	1|3|2	0|2|0	NXF3|NXF3|NXF3	102221750|102221750|102221750	0.005000|0.005000|0.005000	0.15991|0.15991|0.15991	0.005000|0.005000|0.005000	0.12908|0.12908|0.12908	0.002000|0.002000|0.002000	0.02628|0.02628|0.02628	-0.130000|-0.130000|-0.130000	0.10498|0.10498|0.10498	0.958000|0.958000|0.958000	0.37956|0.37956|0.37956	0.600000|0.600000|0.600000	0.82982|0.82982|0.82982	GAG|AAG|AGA	.		0.547	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
PC	5091	ucsc.edu;bcgsc.ca	37	11	66633672	66633672	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr11:66633672T>C	ENST00000393958.2	-	10	1264	c.1171A>G	c.(1171-1173)Acc>Gcc	p.T391A	PC_ENST00000355677.3_Missense_Mutation_p.T391A|PC_ENST00000393960.1_Missense_Mutation_p.T391A|PC_ENST00000524491.1_Missense_Mutation_p.T351A|PC_ENST00000393955.2_Missense_Mutation_p.T391A	NM_000920.3	NP_000911.2	P11498	PYC_HUMAN	pyruvate carboxylase	391	Biotin carboxylation.				biotin metabolic process (GO:0006768)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|oxaloacetate metabolic process (GO:0006107)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|pyruvate carboxylase activity (GO:0004736)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Melanoma(852;0.0525)		Lung(977;0.153)|LUSC - Lung squamous cell carcinoma(976;0.227)	Biotin(DB00121)|Pyruvic acid(DB00119)	ATGCGGCCGGTGTCCGGCTGG	0.677																																					p.T391A		.											.	PC	228	0			c.A1171G						.						47.0	49.0	49.0					11																	66633672		2200	4294	6494	SO:0001583	missense	5091	exon10			GGCCGGTGTCCGG	U04641	CCDS8152.1	11q13.4-q13.5	2012-07-11			ENSG00000173599	ENSG00000173599	6.4.1.1		8636	protein-coding gene	gene with protein product		608786				6548474	Standard	NM_022172		Approved	PCB	uc001ojn.1	P11498	OTTHUMG00000167099	ENST00000393958.2:c.1171A>G	11.37:g.66633672T>C	ENSP00000377530:p.Thr391Ala	Somatic	42.0	1.0		WXS	Illumina HiSeq	.	36.0	5.0	NM_000920	B4DN00|Q16705	Missense_Mutation	SNP	ENST00000393958.2	37	CCDS8152.1	.	.	.	.	.	.	.	.	.	.	T	16.58	3.163933	0.57476	.	.	ENSG00000173599	ENST00000393955;ENST00000393958;ENST00000393960;ENST00000524491;ENST00000355677	D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52	4.67	4.67	0.58626	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);Biotin carboxylase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.80341	0.4605	L	0.58669	1.825	0.80722	D	1	P	0.39003	0.654	B	0.43783	0.431	T	0.81722	-0.0803	10	0.59425	D	0.04	-22.0938	12.0639	0.53578	0.0:0.0:0.0:1.0	.	391	P11498	PYC_HUMAN	A	391;391;391;351;391	ENSP00000377527:T391A;ENSP00000377530:T391A;ENSP00000377532:T391A;ENSP00000434192:T351A;ENSP00000347900:T391A	ENSP00000347900:T391A	T	-	1	0	PC	66390248	1.000000	0.71417	0.890000	0.34922	0.883000	0.51084	7.165000	0.77544	1.736000	0.51660	0.379000	0.24179	ACC	.		0.677	PC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393115.1	NM_001040716	
PEBP1	5037	ucsc.edu;bcgsc.ca	37	12	118575893	118575893	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:118575893A>G	ENST00000261313.2	+	2	537	c.185A>G	c.(184-186)aAg>aGg	p.K62R		NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	62						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GATTCAGGGAAGCTCTACACC	0.483																																					p.K62R	NSCLC(44;94 1357 12187 49467)	.											.	PEBP1	779	0			c.A185G						.						61.0	52.0	55.0					12																	118575893		2203	4300	6503	SO:0001583	missense	5037	exon2			CAGGGAAGCTCTA	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.185A>G	12.37:g.118575893A>G	ENSP00000261313:p.Lys62Arg	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_002567	B2R4S1	Missense_Mutation	SNP	ENST00000261313.2	37	CCDS9187.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.531805	0.45073	.	.	ENSG00000089220	ENST00000261313;ENST00000418769	T	0.51574	0.7	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.48909	0.1526	M	0.67397	2.05	0.80722	D	1	B;B	0.20459	0.045;0.014	B;B	0.25759	0.063;0.028	T	0.52245	-0.8601	10	0.56958	D	0.05	-18.4926	14.0279	0.64597	1.0:0.0:0.0:0.0	.	62;62	B4DRT4;P30086	.;PEBP1_HUMAN	R	62	ENSP00000261313:K62R	ENSP00000261313:K62R	K	+	2	0	PEBP1	117060276	1.000000	0.71417	0.968000	0.41197	0.602000	0.36980	8.652000	0.91083	1.902000	0.55061	0.533000	0.62120	AAG	.		0.483	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401405.1	NM_002567	
PGPEP1L	145814	ucsc.edu;bcgsc.ca	37	15	99512659	99512659	+	Silent	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr15:99512659T>C	ENST00000378919.6	-	4	571	c.366A>G	c.(364-366)gcA>gcG	p.A122A	PGPEP1L_ENST00000535714.1_Silent_p.A68A|RP11-654A16.3_ENST00000559468.1_RNA	NM_001102612.2	NP_001096082.2	A6NFU8	PGPIL_HUMAN	pyroglutamyl-peptidase I-like	122							cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(2)|skin(1)|stomach(1)	14						CATACCTGCCTGCATCTCGGG	0.597																																					p.A122A		.											.	.	.	0			c.A366G						.						98.0	101.0	100.0					15																	99512659		2192	4295	6487	SO:0001819	synonymous_variant	145814	exon4			CCTGCCTGCATCT		CCDS53977.1, CCDS58400.1	15q26.3	2010-02-16			ENSG00000183571	ENSG00000183571			27080	protein-coding gene	gene with protein product							Standard	NM_001102612		Approved		uc002bum.3	A6NFU8		ENST00000378919.6:c.366A>G	15.37:g.99512659T>C		Somatic	59.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_001102612	H0YF86	Silent	SNP	ENST00000378919.6	37	CCDS53977.1																																																																																			.		0.597	PGPEP1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415703.1	NM_001102612.2	
PIWIL1	9271	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130834407	130834407	+	Silent	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:130834407C>T	ENST00000245255.3	+	9	1211	c.939C>T	c.(937-939)aaC>aaT	p.N313N		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	313	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CTAGGTATAACAATAAGACAT	0.378																																					p.N313N		.											.	PIWIL1	92	0			c.C939T						.						78.0	79.0	79.0					12																	130834407		2203	4300	6503	SO:0001819	synonymous_variant	9271	exon9			GTATAACAATAAG	AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.939C>T	12.37:g.130834407C>T		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	33.0	NM_004764	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Silent	SNP	ENST00000245255.3	37	CCDS9268.1																																																																																			.		0.378	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399510.1		
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	121158902	121158903	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:121158902_121158903delGG	ENST00000264233.5	-	27	7453_7454	c.7325_7326delCC	c.(7324-7326)accfs	p.T2442fs		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2442					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TTCCCAAAATGGTCTGAACAAA	0.322								DNA polymerases (catalytic subunits)																													p.2442_2442del	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ	664	0			c.7325_7326del						.																																			SO:0001589	frameshift_variant	10721	exon27			CAAAATGGTCTGA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7325_7326delCC	3.37:g.121158902_121158903delGG	ENSP00000264233:p.Thr2442fs	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	23.0	NM_199420	O95160|Q6VMB5	Frame_Shift_Del	DEL	ENST00000264233.5	37	CCDS33833.1																																																																																			.		0.322	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	48856412	48856412	+	Splice_Site	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr8:48856412C>A	ENST00000523565.1	-	9	865		c.e9+1		PRKDC_ENST00000314191.2_Splice_Site|PRKDC_ENST00000338368.3_Splice_Site			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CAGAATCCTACCTGAGGGCAC	0.294								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			c.808+1G>T						.						34.0	33.0	33.0					8																	48856412		1806	4065	5871	SO:0001630	splice_region_variant	5591	exon10			ATCCTACCTGAGG		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.12643+1G>T	8.37:g.48856412C>A		Somatic	166.0	2.0		WXS	Illumina HiSeq	Phase_I	129.0	57.0	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Splice_Site	SNP	ENST00000523565.1	37		.	.	.	.	.	.	.	.	.	.	C	21.7	4.184371	0.78677	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4438	0.90676	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKDC	49018965	1.000000	0.71417	0.983000	0.44433	0.939000	0.58152	5.808000	0.69165	2.601000	0.87937	0.563000	0.77884	.	.		0.294	PRKDC-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000377896.1	NM_001081640	Intron
QSER1	79832	broad.mit.edu;bcgsc.ca	37	11	32987853	32987853	+	Silent	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr11:32987853A>G	ENST00000399302.2	+	9	4925	c.4590A>G	c.(4588-4590)gaA>gaG	p.E1530E	QSER1_ENST00000527788.1_Silent_p.E1291E	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1530										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					CAGAATTTGAACCTCCCGCTC	0.408																																					p.E1530E		.											.	QSER1	95	0			c.A4590G						.						108.0	101.0	103.0					11																	32987853		1813	4070	5883	SO:0001819	synonymous_variant	79832	exon9			ATTTGAACCTCCC	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4590A>G	11.37:g.32987853A>G		Somatic	111.0	2.0		WXS	Illumina HiSeq	Phase_I	95.0	7.0	NM_001076786	Q6ZU30|Q6ZUR5	Silent	SNP	ENST00000399302.2	37	CCDS41631.1	.	.	.	.	.	.	.	.	.	.	A	7.955	0.745809	0.15710	.	.	ENSG00000060749	ENST00000524678	.	.	.	5.6	-0.0752	0.13728	.	.	.	.	.	T	0.41994	0.1183	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24083	-1.0170	4	.	.	.	.	1.8663	0.03199	0.263:0.0782:0.3092:0.3496	.	.	.	.	S	551	.	.	N	+	2	0	QSER1	32944429	0.796000	0.28864	1.000000	0.80357	0.910000	0.53928	-0.187000	0.09656	0.056000	0.16144	-0.354000	0.07668	AAC	.		0.408	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388448.1	NM_024774	
RAB18	22931	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	27826828	27826828	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr10:27826828G>A	ENST00000356940.6	+	7	571	c.469G>A	c.(469-471)Ggt>Agt	p.G157S	RAB18_ENST00000535776.1_Missense_Mutation_p.G93S|RAB18_ENST00000375802.3_Missense_Mutation_p.G112S|RAB18_ENST00000465772.1_3'UTR	NM_001256410.1|NM_001256415.1|NM_021252.4	NP_001243339.1|NP_001243344.1|NP_067075.1	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family	157					brain development (GO:0007420)|endoplasmic reticulum tubular network organization (GO:0071786)|eye development (GO:0001654)|GTP catabolic process (GO:0006184)|lipid particle organization (GO:0034389)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(1)|lung(1)	3						AACCTGTGATGGTGTACAATG	0.398																																					p.G186S		.											.	RAB18	227	0			c.G556A						.						99.0	96.0	97.0					10																	27826828		2203	4300	6503	SO:0001583	missense	22931	exon8			TGTGATGGTGTAC	AJ277145	CCDS7155.1, CCDS58073.1, CCDS73080.1, CCDS73081.1	10p12	2011-03-07			ENSG00000099246	ENSG00000099246		"""RAB, member RAS oncogene"""	14244	protein-coding gene	gene with protein product		602207				10648831	Standard	NM_021252		Approved		uc001itw.4	Q9NP72	OTTHUMG00000017861	ENST00000356940.6:c.469G>A	10.37:g.27826828G>A	ENSP00000349415:p.Gly157Ser	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	31.0	NM_001256410	B3KMC7|B7Z333|D3DRW1|Q53FX8|Q56UN9|Q6FIH1	Missense_Mutation	SNP	ENST00000356940.6	37	CCDS7155.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.6|29.6	5.022809|5.022809	0.93462|0.93462	.|.	.|.	ENSG00000099246|ENSG00000099246	ENST00000356940;ENST00000535776;ENST00000540268;ENST00000375802|ENST00000423465	T;D;T|.	0.82433|.	-0.41;-1.61;-0.41|.	6.02|6.02	6.02|6.02	0.97574|0.97574	Small GTP-binding protein domain (1);|.	.|.	.|.	.|.	.|.	T|.	0.71134|.	0.3304|.	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.993;1.0;0.998|.	P;D;D|.	0.87578|.	0.877;0.998;0.98|.	T|.	0.65315|.	-0.6198|.	9|.	0.72032|.	D|.	0.01|.	.|.	19.5352|19.5352	0.95251|0.95251	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	93;186;157|.	B7Z333;Q56UN9;Q9NP72|.	.;.;RAB18_HUMAN|.	S|X	157;93;135;112|269	ENSP00000349415:G157S;ENSP00000439321:G93S;ENSP00000364960:G112S|.	ENSP00000349415:G157S|.	G|W	+|+	1|2	0|0	RAB18|RAB18	27866834|27866834	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.776000|9.776000	0.99001|0.99001	2.850000|2.850000	0.98022|0.98022	0.650000|0.650000	0.86243|0.86243	GGT|TGG	.		0.398	RAB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047326.2	NM_021252	
RASGRF2	5924	ucsc.edu;bcgsc.ca	37	5	80503111	80503111	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr5:80503111A>G	ENST00000265080.4	+	21	3081	c.3014A>G	c.(3013-3015)gAg>gGg	p.E1005G	CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	1005	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TCGGCCATGGAGCTGGCAGAA	0.572																																					p.E1005G		.											.	RASGRF2	725	0			c.A3014G						.						110.0	95.0	100.0					5																	80503111		2203	4300	6503	SO:0001583	missense	5924	exon21			CCATGGAGCTGGC	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.3014A>G	5.37:g.80503111A>G	ENSP00000265080:p.Glu1005Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	52.0	4.0	NM_006909	B9EG89|Q9UK56	Missense_Mutation	SNP	ENST00000265080.4	37	CCDS4052.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605790	0.87157	.	.	ENSG00000113319	ENST00000265080	T	0.37235	1.21	5.26	5.26	0.73747	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.67850	0.2937	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76556	-0.2916	10	0.87932	D	0	.	14.8437	0.70243	1.0:0.0:0.0:0.0	.	1005	O14827	RGRF2_HUMAN	G	1005	ENSP00000265080:E1005G	ENSP00000265080:E1005G	E	+	2	0	RASGRF2	80538867	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	9.339000	0.96797	1.993000	0.58246	0.454000	0.30748	GAG	.		0.572	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239215.2	NM_006909	
RBMS2	5939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56975266	56975266	+	Missense_Mutation	SNP	C	C	T	rs376730098		TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:56975266C>T	ENST00000262031.5	+	7	801	c.706C>T	c.(706-708)Cgg>Tgg	p.R236W	RBMS2_ENST00000550726.1_Missense_Mutation_p.R111W|RBMS2_ENST00000542360.1_Missense_Mutation_p.R91W|RBMS2_ENST00000552247.2_Missense_Mutation_p.R236W	NM_002898.3	NP_002889.1	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting protein 2	236					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(3)|skin(2)|urinary_tract(1)	18						GCAAAATGGACGGGCTTGGCC	0.488																																					p.R236W		.											.	RBMS2	90	0			c.C706T						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	59.0	52.0	55.0		706	3.3	1.0	12		55	0,8600		0,0,4300	no	missense	RBMS2	NM_002898.3	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	236/408	56975266	1,13005	2203	4300	6503	SO:0001583	missense	5939	exon7			AATGGACGGGCTT	D28483	CCDS8923.1	12q13.13	2013-02-12			ENSG00000076067	ENSG00000076067		"""RNA binding motif (RRM) containing"""	9909	protein-coding gene	gene with protein product		602387				8041632	Standard	NM_002898		Approved	SCR3	uc001sln.2	Q15434	OTTHUMG00000170488	ENST00000262031.5:c.706C>T	12.37:g.56975266C>T	ENSP00000262031:p.Arg236Trp	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	21.0	NM_002898		Missense_Mutation	SNP	ENST00000262031.5	37	CCDS8923.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051563	0.55218	2.27E-4	0.0	ENSG00000076067	ENST00000262031;ENST00000552247;ENST00000550726;ENST00000542360	T;T;T	0.75704	2.56;-0.96;-0.96	5.21	3.35	0.38373	.	0.000000	0.85682	D	0.000000	T	0.71904	0.3395	M	0.67700	2.07	0.80722	D	1	P;P	0.48589	0.912;0.592	B;B	0.43728	0.429;0.189	T	0.72663	-0.4225	10	0.87932	D	0	.	9.2655	0.37639	0.1451:0.7777:0.0:0.0772	.	91;236	F5H5C8;Q15434	.;RBMS2_HUMAN	W	236;236;111;91	ENSP00000262031:R236W;ENSP00000447426:R236W;ENSP00000449678:R111W	ENSP00000262031:R236W	R	+	1	2	RBMS2	55261533	0.454000	0.25728	0.998000	0.56505	0.996000	0.88848	0.927000	0.28818	0.680000	0.31366	0.655000	0.94253	CGG	.		0.488	RBMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409366.2	NM_002898	
RNASEL	6041	hgsc.bcm.edu;broad.mit.edu	37	1	182551358	182551360	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr1:182551358_182551360delCTT	ENST00000367559.3	-	4	1853_1855	c.1600_1602delAAG	c.(1600-1602)aagdel	p.K534del	RNASEL_ENST00000444138.1_In_Frame_Del_p.K534del|RNASEL_ENST00000539397.1_In_Frame_Del_p.K534del	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	534	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						AGATGCTTCCCTTCTTTACCACA	0.443																																					p.534_534del		.											.	RNASEL	336	0			c.1600_1602del						.																																			SO:0001651	inframe_deletion	6041	exon4			GCTTCCCTTCTTT	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1600_1602delAAG	1.37:g.182551361_182551363delCTT	ENSP00000356530:p.Lys534del	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	15.0	NM_021133	Q5W0L2|Q6AI46	In_Frame_Del	DEL	ENST00000367559.3	37	CCDS1347.1																																																																																			.		0.443	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085189.1	NM_021133	
RTN1	6252	broad.mit.edu;bcgsc.ca	37	14	60194386	60194386	+	Splice_Site	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr14:60194386T>C	ENST00000267484.5	-	3	1351	c.1016A>G	c.(1015-1017)gAa>gGa	p.E339G		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	339					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		AGCAGATGGTTCTGTCGTCCC	0.527																																					p.E339G		.											.	RTN1	516	0			c.A1016G						.						22.0	21.0	21.0					14																	60194386		2193	4246	6439	SO:0001630	splice_region_variant	6252	exon3			GATGGTTCTGTCG	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1016-1A>G	14.37:g.60194386T>C		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	6.0	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	37	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	T	16.28	3.078718	0.55753	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.28454	1.61	5.53	5.53	0.82687	.	0.320112	0.31589	N	0.007394	T	0.30039	0.0752	L	0.43152	1.355	0.58432	D	0.999996	B	0.10296	0.003	B	0.06405	0.002	T	0.04855	-1.0922	10	0.66056	D	0.02	.	15.6444	0.77036	0.0:0.0:0.0:1.0	.	339	Q16799	RTN1_HUMAN	G	339;265	ENSP00000267484:E339G	ENSP00000267484:E339G	E	-	2	0	RTN1	59264139	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.443000	0.66581	2.104000	0.64026	0.496000	0.49642	GAA	.		0.527	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		Missense_Mutation
SEMA5B	54437	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122662337	122662337	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:122662337T>A	ENST00000357599.3	-	4	760	c.374A>T	c.(373-375)gAt>gTt	p.D125V	SEMA5B_ENST00000195173.4_Missense_Mutation_p.D125V|SEMA5B_ENST00000451055.2_Missense_Mutation_p.D179V|SEMA5B_ENST00000465147.1_5'UTR	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	125	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CTGGGAGAAATCCCGGGCTCC	0.632																																					p.D179V		.											.	SEMA5B	157	0			c.A536T						.						46.0	53.0	51.0					3																	122662337		2203	4300	6503	SO:0001583	missense	54437	exon4			GAGAAATCCCGGG	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.374A>T	3.37:g.122662337T>A	ENSP00000350215:p.Asp125Val	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	14.0	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	T	18.44	3.624969	0.66901	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583;ENST00000421053	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	4.97	4.97	0.65823	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.000000	0.85682	D	0.000000	T	0.47655	0.1457	M	0.81942	2.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.998	T	0.51818	-0.8657	10	0.66056	D	0.02	.	12.6592	0.56803	0.0:0.0:0.0:1.0	.	67;125;125	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	V	125;125;67;179;125;125	ENSP00000350215:D125V;ENSP00000195173:D125V;ENSP00000389588:D179V;ENSP00000377208:D125V	ENSP00000195173:D125V	D	-	2	0	SEMA5B	124145027	1.000000	0.71417	0.999000	0.59377	0.578000	0.36192	6.133000	0.71682	2.094000	0.63399	0.454000	0.30748	GAT	.		0.632	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
RTP1	132112	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	186917604	186917604	+	Missense_Mutation	SNP	C	C	T	rs372732386		TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:186917604C>T	ENST00000312295.4	+	2	568	c.538C>T	c.(538-540)Cgc>Tgc	p.R180C	RP11-208N14.4_ENST00000356133.3_RNA	NM_153708.2	NP_714919.2	P59025	RTP1_HUMAN	receptor (chemosensory) transporter protein 1	180					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			breast(2)|endometrium(4)|large_intestine(5)|lung(6)|ovary(3)|skin(2)	22	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		CGTGGCCAGCCGCCAGGACAA	0.682																																					p.R180C		.											.	RTP1	155	0			c.C538T						.	C	CYS/ARG	0,4400		0,0,2200	24.0	25.0	25.0		538	4.8	1.0	3		25	1,8583		0,1,4291	no	missense	RTP1	NM_153708.2	180	0,1,6491	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	180/264	186917604	1,12983	2200	4292	6492	SO:0001583	missense	132112	exon2			GCCAGCCGCCAGG	BC034744	CCDS3287.2	3q27.3	2014-02-20	2006-11-21		ENSG00000175077	ENSG00000175077		"""Receptor transporter proteins"""	28580	protein-coding gene	gene with protein product	"""receptor transporting protein 1"", ""zinc finger, 3CxxC-type 1"""	609137	"""receptor transporter protein 1"""			16271481, 15550249, 16720576	Standard	NM_153708		Approved	MGC35450, Z3CXXC1	uc003frg.3	P59025	OTTHUMG00000149886	ENST00000312295.4:c.538C>T	3.37:g.186917604C>T	ENSP00000311712:p.Arg180Cys	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	18.0	NM_153708		Missense_Mutation	SNP	ENST00000312295.4	37	CCDS3287.2	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746024	0.69418	0.0	1.16E-4	ENSG00000175077	ENST00000312295	T	0.23950	1.88	5.7	4.82	0.62117	.	0.381494	0.30649	N	0.009169	T	0.33731	0.0873	L	0.44542	1.39	0.39746	D	0.97181	D	0.61697	0.99	P	0.54060	0.741	T	0.12192	-1.0557	10	0.52906	T	0.07	.	12.2521	0.54603	0.1691:0.8309:0.0:0.0	.	180	P59025	RTP1_HUMAN	C	180	ENSP00000311712:R180C	ENSP00000311712:R180C	R	+	1	0	RTP1	188400298	0.604000	0.26932	1.000000	0.80357	0.963000	0.63663	0.710000	0.25748	1.403000	0.46800	0.561000	0.74099	CGC	.		0.682	RTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313731.2	NM_153708	
SERINC2	347735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	31907019	31907019	+	Silent	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr1:31907019C>A	ENST00000373709.3	+	10	1491	c.1341C>A	c.(1339-1341)ctC>ctA	p.L447L	SERINC2_ENST00000373710.1_Silent_p.L456L|SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000536384.1_Silent_p.L451L|SERINC2_ENST00000536859.1_Silent_p.L451L	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	447					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)			cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		TAGCCCCACTCCTCCTGCGCA	0.647																																					p.L456L		.											.	SERINC2	90	0			c.C1368A						.						173.0	166.0	168.0					1																	31907019		2203	4300	6503	SO:0001819	synonymous_variant	347735	exon11			CCCACTCCTCCTG	AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.1341C>A	1.37:g.31907019C>A		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	30.0	NM_001199038	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Silent	SNP	ENST00000373709.3	37	CCDS30662.1																																																																																			.		0.647	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010680.1	NM_018565	
SLC8B1	80024	ucsc.edu;bcgsc.ca	37	12	113758428	113758428	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:113758428A>G	ENST00000552014.1	-	7	999	c.484T>C	c.(484-486)Tct>Cct	p.S162P	SLC8B1_ENST00000553238.1_5'UTR|SLC8B1_ENST00000202831.3_Missense_Mutation_p.S162P|SLC8B1_ENST00000546737.1_Missense_Mutation_p.S162P			Q6J4K2	NCKX6_HUMAN	solute carrier family 8 (sodium/lithium/calcium exchanger), member B1	162					cytosolic calcium ion homeostasis (GO:0051480)|glucose homeostasis (GO:0042593)|ion transport (GO:0006811)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of insulin secretion (GO:0050796)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial crista (GO:0030061)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)|calcium:sodium antiporter activity involved in regulation of cardiac muscle cell membrane potential (GO:0086038)|protein homodimerization activity (GO:0042803)										TGCGGGTCAGAGAAGGCCACC	0.652																																					p.S162P		.											.	SLC24A6	90	0			c.T484C						.						44.0	45.0	45.0					12																	113758428		2203	4300	6503	SO:0001583	missense	80024	exon6			GGTCAGAGAAGGC	AK025886	CCDS31909.1	12q24.13	2013-07-19	2013-07-19	2013-07-19	ENSG00000089060	ENSG00000089060		"""Solute carriers"""	26175	protein-coding gene	gene with protein product		609841	"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 6"", ""solute carrier family 24 (sodium/lithium/calcium exchanger), member 6"""	SLC24A6		14625281, 23506867	Standard	NM_024959		Approved	FLJ22233, NCKX6, NCLX	uc001tvc.3	Q6J4K2	OTTHUMG00000169566	ENST00000552014.1:c.484T>C	12.37:g.113758428A>G	ENSP00000447091:p.Ser162Pro	Somatic	38.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_024959	A6NP50|Q4KMS9|Q6J4K1|Q9H6I8	Missense_Mutation	SNP	ENST00000552014.1	37	CCDS31909.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.237954	0.79800	.	.	ENSG00000089060	ENST00000552014;ENST00000202831;ENST00000377458;ENST00000546737;ENST00000549181	T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06	4.61	3.42	0.39159	Sodium/calcium exchanger membrane region (1);	0.000000	0.64402	D	0.000001	T	0.77219	0.4098	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.74896	-0.3508	10	0.30078	T	0.28	.	11.1659	0.48543	0.8454:0.1546:0.0:0.0	.	162	Q6J4K2	NCKX6_HUMAN	P	162	ENSP00000447091:S162P;ENSP00000202831:S162P;ENSP00000450081:S162P;ENSP00000448703:S162P	ENSP00000202831:S162P	S	-	1	0	SLC24A6	112242811	1.000000	0.71417	0.970000	0.41538	0.938000	0.57974	6.904000	0.75708	0.602000	0.29896	0.379000	0.24179	TCT	.		0.652	SLC8B1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404830.3	NM_024959	
SLC5A7	60482	bcgsc.ca;mdanderson.org	37	2	108627264	108627264	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:108627264C>A	ENST00000264047.2	+	9	1966	c.1690C>A	c.(1690-1692)Ctt>Att	p.L564I	SLC5A7_ENST00000540517.1_Missense_Mutation_p.L459I|SLC5A7_ENST00000409059.1_Missense_Mutation_p.L564I	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	564					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	AGAGGCCTTCCTTGATGTTGA	0.388																																					p.L564I		.											.	SLC5A7	93	0			c.C1690A						.						37.0	38.0	38.0					2																	108627264		2203	4299	6502	SO:0001583	missense	60482	exon9			GCCTTCCTTGATG	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.1690C>A	2.37:g.108627264C>A	ENSP00000264047:p.Leu564Ile	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_1	16.0	3.0	NM_021815	Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780715	0.31502	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.92149	-2.73;-2.98;-2.73	5.84	4.96	0.65561	.	0.592434	0.17289	N	0.179726	D	0.88198	0.6372	L	0.45581	1.43	0.20764	N	0.999859	B	0.06786	0.001	B	0.06405	0.002	T	0.78735	-0.2088	10	0.41790	T	0.15	-13.7841	9.8179	0.40865	0.2656:0.6206:0.1138:0.0	.	564	Q9GZV3	SC5A7_HUMAN	I	564;459;564	ENSP00000387346:L564I;ENSP00000445351:L459I;ENSP00000264047:L564I	ENSP00000264047:L564I	L	+	1	0	SLC5A7	107993696	1.000000	0.71417	0.308000	0.25141	0.906000	0.53458	5.134000	0.64770	1.462000	0.47948	0.650000	0.86243	CTT	.		0.388	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
SLC6A2	6530	ucsc.edu;bcgsc.ca	37	16	55731912	55731912	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr16:55731912T>C	ENST00000379906.2	+	9	1619	c.1364T>C	c.(1363-1365)cTt>cCt	p.L455P	SLC6A2_ENST00000414754.3_Missense_Mutation_p.L455P|SLC6A2_ENST00000567238.1_Missense_Mutation_p.L350P|SLC6A2_ENST00000561820.1_Missense_Mutation_p.L455P|SLC6A2_ENST00000219833.8_Missense_Mutation_p.L455P|SLC6A2_ENST00000568943.1_Missense_Mutation_p.L455P|SLC6A2_ENST00000566163.1_Missense_Mutation_p.L410P	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	455					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AGCACTTTCCTTCTCGCCCTG	0.562																																					p.L455P		.											.	SLC6A2	526	0			c.T1364C						.						140.0	125.0	130.0					16																	55731912		2198	4300	6498	SO:0001583	missense	6530	exon10			CTTTCCTTCTCGC		CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1364T>C	16.37:g.55731912T>C	ENSP00000369237:p.Leu455Pro	Somatic	78.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001172501	B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	ENST00000379906.2	37	CCDS10754.1	.	.	.	.	.	.	.	.	.	.	T	20.0	3.930867	0.73327	.	.	ENSG00000103546	ENST00000414754;ENST00000537705;ENST00000379906;ENST00000219833	T;T;T	0.79141	-1.24;-1.24;-1.24	5.34	5.34	0.76211	.	0.125171	0.56097	D	0.000033	D	0.91603	0.7347	H	0.97077	3.935	0.80722	D	1	D;D;D;D	0.76494	0.997;0.973;0.999;0.997	D;P;D;D	0.70935	0.971;0.894;0.971;0.971	D	0.94189	0.7439	10	0.87932	D	0	.	14.2964	0.66316	0.0:0.0:0.0:1.0	.	455;169;350;455	Q96KH8;F5H0T4;B4DX48;P23975	.;.;.;SC6A2_HUMAN	P	455;169;455;455	ENSP00000394956:L455P;ENSP00000369237:L455P;ENSP00000219833:L455P	ENSP00000219833:L455P	L	+	2	0	SLC6A2	54289413	1.000000	0.71417	0.940000	0.37924	0.777000	0.43975	7.247000	0.78257	2.020000	0.59435	0.459000	0.35465	CTT	.		0.562	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256922.2		
SLC8A3	6547	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	70633754	70633754	+	Silent	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr14:70633754C>T	ENST00000381269.2	-	2	2139	c.1386G>A	c.(1384-1386)aaG>aaA	p.K462K	SLC8A3_ENST00000357887.3_Silent_p.K462K|SLC8A3_ENST00000528359.1_Silent_p.K462K|SLC8A3_ENST00000534137.1_Silent_p.K462K|SLC8A3_ENST00000356921.2_Silent_p.K462K	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	462	Calx-beta 1.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		CGGAGAACTCCTTCTGGGTCT	0.502																																					p.K462K		.											.	SLC8A3	225	0			c.G1386A						.						165.0	164.0	165.0					14																	70633754		2203	4300	6503	SO:0001819	synonymous_variant	6547	exon2			GAACTCCTTCTGG	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1386G>A	14.37:g.70633754C>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	7.0	NM_183002	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	37	CCDS35498.1																																																																																			.		0.502	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	152651593	152651593	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr6:152651593T>G	ENST00000367255.5	-	78	14828	c.14227A>C	c.(14227-14229)Aca>Cca	p.T4743P	SYNE1_ENST00000341594.5_Missense_Mutation_p.T4490P|SYNE1_ENST00000265368.4_Missense_Mutation_p.T4743P|SYNE1_ENST00000423061.1_Missense_Mutation_p.T4672P|SYNE1_ENST00000448038.1_Missense_Mutation_p.T4672P	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4743					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGCTGACCTGTGCTGCGAAAA	0.512										HNSCC(10;0.0054)																											p.T4743P		.											.	SYNE1	607	0			c.A14227C						.						88.0	93.0	91.0					6																	152651593		2203	4300	6503	SO:0001583	missense	23345	exon78			GACCTGTGCTGCG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.14227A>C	6.37:g.152651593T>G	ENSP00000356224:p.Thr4743Pro	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	25.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	16.66	3.183698	0.57800	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000006	T	0.51415	0.1673	L	0.52573	1.65	0.80722	D	1	D;D;D;D	0.60575	0.988;0.98;0.98;0.988	P;B;B;P	0.61397	0.888;0.439;0.439;0.759	T	0.50110	-0.8866	10	0.41790	T	0.15	.	16.2087	0.82144	0.0:0.0:0.0:1.0	.	4743;4743;4743;4672	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	P	4743;4672;4743;4672;4490	ENSP00000356224:T4743P;ENSP00000396024:T4672P;ENSP00000265368:T4743P;ENSP00000390975:T4672P;ENSP00000341887:T4490P	ENSP00000265368:T4743P	T	-	1	0	SYNE1	152693286	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.040000	0.89188	2.233000	0.73108	0.482000	0.46254	ACA	.		0.512	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYT15	83849	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	46968625	46968625	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr10:46968625C>A	ENST00000374321.4	-	3	377	c.311G>T	c.(310-312)tGc>tTc	p.C104F	SYT15_ENST00000374325.3_Missense_Mutation_p.C104F|SYT15_ENST00000503753.1_Missense_Mutation_p.C104F|RP11-38L15.3_ENST00000506914.1_RNA|SYT15_ENST00000374323.4_Missense_Mutation_p.C157F	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						TGATGCCGGGCAGGGGTCCCA	0.677																																					p.C104F	Ovarian(57;1152 1428 19651 37745)	.											.	SYT15	22	0			c.G311T						.						33.0	42.0	39.0					10																	46968625		2083	4209	6292	SO:0001583	missense	83849	exon3			GCCGGGCAGGGGT	AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.311G>T	10.37:g.46968625C>A	ENSP00000363441:p.Cys104Phe	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	5.0	NM_031912	A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	ENST00000374321.4	37	CCDS44376.1	.	.	.	.	.	.	.	.	.	.	.	5.470	0.271822	0.10349	.	.	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374323;ENST00000374321	T;T;T;T	0.13901	2.55;2.55;2.84;2.79	4.59	1.71	0.24356	.	0.416381	0.25344	N	0.031345	T	0.10680	0.0261	L	0.56769	1.78	0.27196	N	0.960292	B;B	0.09022	0.001;0.002	B;B	0.06405	0.001;0.002	T	0.34875	-0.9811	10	0.10377	T	0.69	.	5.8725	0.18810	0.0:0.5943:0.0:0.4057	.	104;104	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	F	104;104;104;157;104	ENSP00000363445:C104F;ENSP00000427607:C104F;ENSP00000363443:C157F;ENSP00000363441:C104F	ENSP00000363441:C104F	C	-	2	0	SYT15	46388631	0.097000	0.21791	0.037000	0.18230	0.007000	0.05969	0.045000	0.14013	0.679000	0.31345	0.555000	0.69702	TGC	.		0.677	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367008.1	NM_031912	
TCF7L1	83439	hgsc.bcm.edu;broad.mit.edu	37	2	85536399	85536400	+	In_Frame_Ins	INS	-	-	GCA			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:85536399_85536400insGCA	ENST00000282111.3	+	12	1856_1857	c.1581_1582insGCA	c.(1582-1584)gca>GCAgca	p.528_528A>AA		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	528					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CGGCTAAGGCTGCAGCCTCCTC	0.688																																					p.A527delinsAA		.											.	TCF7L1	585	0			c.1581_1582insGCA						.																																			SO:0001652	inframe_insertion	83439	exon12			TAAGGCTGCAGCC	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.1582_1584dupGCA	2.37:g.85536400_85536402dupGCA	ENSP00000282111:p.Ala529dup	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	19.0	NM_031283	Q53R97|Q6PD70|Q9NP00	In_Frame_Ins	INS	ENST00000282111.3	37	CCDS1971.1																																																																																			.		0.688	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	
TGOLN2	10618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	85552051	85552051	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr2:85552051C>T	ENST00000409232.3	-	3	1356	c.1295G>A	c.(1294-1296)cGt>cAt	p.R432H	TGOLN2_ENST00000409015.1_Missense_Mutation_p.R432H|TGOLN2_ENST00000377386.3_Missense_Mutation_p.R432H|TGOLN2_ENST00000444342.2_Missense_Mutation_p.R432H|TGOLN2_ENST00000282120.2_Missense_Mutation_p.R276H|TGOLN2_ENST00000398263.2_Missense_Mutation_p.R374H			O43493	TGON2_HUMAN	trans-golgi network protein 2	432						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)											CTGGTCCAAACGTTGGTAGTC	0.493																																					p.R432H		.											.	TGOLN2	22	0			c.G1295A						.						80.0	83.0	82.0					2																	85552051		1928	4094	6022	SO:0001583	missense	10618	exon3			TCCAAACGTTGGT	AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.1295G>A	2.37:g.85552051C>T	ENSP00000386443:p.Arg432His	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	35.0	NM_001206841	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Missense_Mutation	SNP	ENST00000409232.3	37	CCDS56126.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418580	0.83559	.	.	ENSG00000152291	ENST00000377386;ENST00000282120;ENST00000398263;ENST00000409232;ENST00000409015;ENST00000444342	T;T;T;T;T;T	0.33438	1.52;1.68;1.41;1.57;1.5;1.58	5.46	4.57	0.56435	.	.	.	.	.	T	0.51227	0.1662	L	0.59436	1.845	0.35098	D	0.764987	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.995;0.992;0.993;0.996	T	0.65689	-0.6107	9	0.87932	D	0	-12.8409	13.6679	0.62407	0.1558:0.8442:0.0:0.0	.	432;432;374;432	O43493;O43493-5;O43493-4;O43493-2	TGON2_HUMAN;.;.;.	H	432;276;374;432;432;432	ENSP00000366603:R432H;ENSP00000282120:R276H;ENSP00000381312:R374H;ENSP00000386443:R432H;ENSP00000387035:R432H;ENSP00000391190:R432H	ENSP00000282120:R276H	R	-	2	0	TGOLN2	85405562	0.991000	0.36638	1.000000	0.80357	0.996000	0.88848	3.085000	0.50151	1.406000	0.46857	0.555000	0.69702	CGT	.		0.493	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000329045.2	NM_006464	
TMEM260	54916	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	57083918	57083918	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr14:57083918C>T	ENST00000261556.6	+	9	1081	c.959C>T	c.(958-960)tCa>tTa	p.S320L	TMEM260_ENST00000536419.1_5'UTR|TMEM260_ENST00000538838.1_Missense_Mutation_p.S320L|TMEM260_ENST00000553335.1_3'UTR	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	320						integral component of membrane (GO:0016021)											CAGAATCCATCATTAGTATGG	0.284																																					p.S320L		.											.	.	.	0			c.C959T						.						135.0	125.0	129.0					14																	57083918		2203	4297	6500	SO:0001583	missense	0	exon9			ATCCATCATTAGT	AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.959C>T	14.37:g.57083918C>T	ENSP00000261556:p.Ser320Leu	Somatic	186.0	2.0		WXS	Illumina HiSeq	Phase_I	167.0	56.0	NM_017799	A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	ENST00000261556.6	37	CCDS9727.2	.	.	.	.	.	.	.	.	.	.	C	11.63	1.695478	0.30052	.	.	ENSG00000070269	ENST00000261556;ENST00000538838	T;T	0.47528	1.44;0.84	5.64	5.64	0.86602	.	0.276660	0.36101	N	0.002792	T	0.47985	0.1475	M	0.72894	2.215	0.80722	D	1	B	0.24258	0.1	B	0.19148	0.024	T	0.43766	-0.9371	10	0.15066	T	0.55	-16.0042	17.8819	0.88843	0.0:1.0:0.0:0.0	.	320	Q9NX78	CN101_HUMAN	L	320	ENSP00000261556:S320L;ENSP00000441934:S320L	ENSP00000261556:S320L	S	+	2	0	C14orf101	56153671	0.734000	0.28142	0.841000	0.33234	0.066000	0.16364	3.409000	0.52657	2.660000	0.90430	0.563000	0.77884	TCA	.		0.284	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276924.1	NM_017799	
TMEM92	162461	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48351885	48351885	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr17:48351885G>A	ENST00000300433.3	+	2	133	c.23G>A	c.(22-24)gGc>gAc	p.G8D	TMEM92_ENST00000507382.1_Missense_Mutation_p.G8D	NM_001168215.1	NP_001161687.1	Q6UXU6	TMM92_HUMAN	transmembrane protein 92	8						integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	7						TGGGTCCCCGGCCTCGCGCCC	0.612																																					p.G8D		.											.	TMEM92	90	0			c.G23A						.						42.0	40.0	41.0					17																	48351885		2203	4300	6503	SO:0001583	missense	162461	exon1			TCCCCGGCCTCGC		CCDS11562.1	17q21.33	2005-12-13							26579	protein-coding gene	gene with protein product						12975309	Standard	NM_153229		Approved	FLJ33318	uc002iqn.2	Q6UXU6		ENST00000300433.3:c.23G>A	17.37:g.48351885G>A	ENSP00000300433:p.Gly8Asp	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	10.0	NM_153229	Q8NBF0	Missense_Mutation	SNP	ENST00000300433.3	37	CCDS11562.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980865	0.53827	.	.	ENSG00000167105	ENST00000300433;ENST00000507382	T;T	0.08720	3.06;3.06	4.33	3.36	0.38483	.	1.383730	0.04871	N	0.445972	T	0.17746	0.0426	M	0.63843	1.955	0.09310	N	0.999999	D	0.58268	0.982	P	0.51135	0.66	T	0.13124	-1.0521	10	0.37606	T	0.19	-4.001	7.7658	0.28978	0.1143:0.0:0.8857:0.0	.	8	Q6UXU6	TMM92_HUMAN	D	8	ENSP00000300433:G8D;ENSP00000425144:G8D	ENSP00000300433:G8D	G	+	2	0	TMEM92	45706884	0.000000	0.05858	0.514000	0.27761	0.556000	0.35491	0.371000	0.20450	1.040000	0.40099	0.491000	0.48974	GGC	.		0.612	TMEM92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367053.2	NM_153229	
TOPBP1	11073	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	133339026	133339026	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr3:133339026C>A	ENST00000260810.5	-	20	3475	c.3344G>T	c.(3343-3345)gGa>gTa	p.G1115V		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1115					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TCTACTTCGTCCACTGCGAGC	0.502								Other conserved DNA damage response genes																													p.G1115V	Ovarian(21;193 658 4424 15423 17362)	.											.	TOPBP1	540	0			c.G3344T						.						98.0	98.0	98.0					3																	133339026		2047	4188	6235	SO:0001583	missense	11073	exon20			CTTCGTCCACTGC	AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.3344G>T	3.37:g.133339026C>A	ENSP00000260810:p.Gly1115Val	Somatic	105.0	1.0		WXS	Illumina HiSeq	Phase_I	71.0	28.0	NM_007027	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	ENST00000260810.5	37	CCDS46919.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784235	0.90282	.	.	ENSG00000163781	ENST00000260810	T	0.12774	2.65	6.06	6.06	0.98353	.	0.090297	0.85682	D	0.000000	T	0.35098	0.0920	M	0.64997	1.995	0.80722	D	1	D;D	0.71674	0.998;0.969	D;P	0.65233	0.933;0.787	T	0.00228	-1.1899	10	0.27082	T	0.32	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	1028;1115	A0AV47;Q92547	.;TOPB1_HUMAN	V	1115	ENSP00000260810:G1115V	ENSP00000260810:G1115V	G	-	2	0	TOPBP1	134821716	1.000000	0.71417	0.781000	0.31783	0.939000	0.58152	6.921000	0.75805	2.882000	0.98803	0.655000	0.94253	GGA	.		0.502	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357254.1	NM_007027	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R248W	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,+1	TP53	70225	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	c.C742T	GRCh37	CM010465|CM900211	TP53	M	rs121912651	.						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCCTCCGGTTCAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic	114.0	1.0		WXS	Illumina HiSeq	Phase_I	46.0	31.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	.		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP53BP2	7159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	224002032	224002032	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr1:224002032G>A	ENST00000343537.7	-	3	490	c.199C>T	c.(199-201)Cga>Tga	p.R67*	TP53BP2_ENST00000391878.2_5'UTR	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	61					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TCAAACATTCGCTCATTATCC	0.413																																					p.R67X		.											.	TP53BP2	229	0			c.C199T						.						119.0	118.0	118.0					1																	224002032		1914	4130	6044	SO:0001587	stop_gained	7159	exon3			ACATTCGCTCATT	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.199C>T	1.37:g.224002032G>A	ENSP00000341957:p.Arg67*	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	9.0	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Nonsense_Mutation	SNP	ENST00000343537.7	37	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	G	40	8.038094	0.98621	.	.	ENSG00000143514	ENST00000343537	.	.	.	5.61	2.26	0.28386	.	0.110648	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8993	0.79359	0.0:0.0:0.6418:0.3582	.	.	.	.	X	67	.	ENSP00000341957:R67X	R	-	1	2	TP53BP2	222068655	1.000000	0.71417	0.882000	0.34594	0.997000	0.91878	3.453000	0.52978	0.684000	0.31448	0.563000	0.77884	CGA	.		0.413	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
TPPP3	51673	ucsc.edu;bcgsc.ca	37	16	67424851	67424851	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr16:67424851A>G	ENST00000564104.1	-	1	1005	c.164T>C	c.(163-165)gTg>gCg	p.V55A	TPPP3_ENST00000562206.1_Missense_Mutation_p.V55A|RNU1-123P_ENST00000458950.1_RNA|TPPP3_ENST00000290942.5_Missense_Mutation_p.V55A|TPPP3_ENST00000393957.2_Missense_Mutation_p.V55A			Q9BW30	TPPP3_HUMAN	tubulin polymerization-promoting protein family member 3	55					microtubule bundle formation (GO:0001578)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	tubulin binding (GO:0015631)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	7		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0336)|Epithelial(162;0.0781)		GACGATGTCCACATCGGTCCC	0.587																																					p.V55A		.											.	TPPP3	90	0			c.T164C						.						139.0	106.0	117.0					16																	67424851		2198	4300	6498	SO:0001583	missense	51673	exon3			ATGTCCACATCGG	BC000691	CCDS10835.1	16q22.1	2008-02-05			ENSG00000159713	ENSG00000159713			24162	protein-coding gene	gene with protein product						15590652, 17105200	Standard	XM_005255979		Approved	CGI-38, p25gamma, p20	uc002etb.3	Q9BW30	OTTHUMG00000137516	ENST00000564104.1:c.164T>C	16.37:g.67424851A>G	ENSP00000462435:p.Val55Ala	Somatic	55.0	1.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_016140	Q49AH9|Q9Y326|Q9Y6H0	Missense_Mutation	SNP	ENST00000564104.1	37	CCDS10835.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.018085	0.75275	.	.	ENSG00000159713	ENST00000393957;ENST00000290942	T;T	0.42900	0.96;0.96	4.29	3.2	0.36748	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.56077	0.1961	L	0.42581	1.335	0.51767	D	0.999931	B	0.30193	0.272	P	0.61800	0.894	T	0.54132	-0.8339	10	0.33940	T	0.23	-28.2757	8.8683	0.35300	0.9109:0.0:0.0891:0.0	.	55	Q9BW30	TPPP3_HUMAN	A	55	ENSP00000377529:V55A;ENSP00000290942:V55A	ENSP00000290942:V55A	V	-	2	0	TPPP3	65982352	1.000000	0.71417	0.215000	0.23724	0.989000	0.77384	9.117000	0.94347	0.703000	0.31848	0.402000	0.26972	GTG	.		0.587	TPPP3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421787.2	NM_015964	
TWISTNB	221830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	19738145	19738145	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr7:19738145A>G	ENST00000222567.5	-	4	881	c.811T>C	c.(811-813)Tgg>Cgg	p.W271R		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	271	Lys-rich.				transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						TCCTCCTCCCAGATGCCATTC	0.468																																					p.W271R		.											.	TWISTNB	91	0			c.T811C						.						289.0	312.0	305.0					7																	19738145		2203	4300	6503	SO:0001583	missense	221830	exon4			CCTCCCAGATGCC	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.811T>C	7.37:g.19738145A>G	ENSP00000222567:p.Trp271Arg	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	59.0	NM_001002926	A0PJ45|B7Z724	Missense_Mutation	SNP	ENST00000222567.5	37	CCDS34606.1	.	.	.	.	.	.	.	.	.	.	A	9.776	1.174034	0.21704	.	.	ENSG00000105849	ENST00000222567	.	.	.	5.54	-1.33	0.09172	.	1.477610	0.03093	N	0.160111	T	0.31263	0.0791	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06006	-1.0851	9	0.25106	T	0.35	12.4601	2.3197	0.04207	0.5795:0.1174:0.1905:0.1126	.	271	Q3B726	RPA43_HUMAN	R	271	.	ENSP00000222567:W271R	W	-	1	0	TWISTNB	19704670	0.000000	0.05858	0.002000	0.10522	0.372000	0.29890	0.404000	0.20999	-0.371000	0.08004	-0.755000	0.03482	TGG	.		0.468	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
USP15	9958	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	62775287	62775287	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr12:62775287C>T	ENST00000280377.5	+	9	990	c.932C>T	c.(931-933)cCt>cTt	p.P311L	USP15_ENST00000353364.3_Missense_Mutation_p.P282L|USP15_ENST00000393654.3_Missense_Mutation_p.P286L	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	311	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		AGCAACACACCTCCACTTACT	0.294																																					p.P311L	Melanoma(181;615 2041 39364 49691 50001)	.											.	USP15	1084	0			c.C932T						.						105.0	98.0	100.0					12																	62775287		2203	4300	6503	SO:0001583	missense	9958	exon9			ACACACCTCCACT	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.932C>T	12.37:g.62775287C>T	ENSP00000280377:p.Pro311Leu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	31.0	NM_001252078	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	ENST00000280377.5	37	CCDS58251.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561086	0.86335	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.35973	1.28;1.28;1.28	5.09	5.09	0.68999	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.110987	0.64402	D	0.000006	T	0.51398	0.1672	L	0.42245	1.32	0.80722	D	1	D;P	0.63880	0.993;0.575	D;B	0.64410	0.925;0.288	T	0.38866	-0.9641	9	.	.	.	-10.5756	18.6711	0.91512	0.0:1.0:0.0:0.0	.	311;282	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	L	282;311;286	ENSP00000258123:P282L;ENSP00000280377:P311L;ENSP00000377264:P286L	.	P	+	2	0	USP15	61061554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.648000	0.89879	0.585000	0.79938	CCT	.		0.294	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
VPS26B	112936	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	134113163	134113163	+	Silent	SNP	G	G	A			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr11:134113163G>A	ENST00000281187.5	+	4	1174	c.696G>A	c.(694-696)gaG>gaA	p.E232E	VPS26B_ENST00000525095.2_Silent_p.E232E	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	232					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		CCAAGTACGAGATCATGGACG	0.537																																					p.E232E	Colon(171;1263 1952 15904 45703 47982)	.											.	VPS26B	90	0			c.G696A						.						99.0	78.0	85.0					11																	134113163		2201	4297	6498	SO:0001819	synonymous_variant	112936	exon4			GTACGAGATCATG		CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.696G>A	11.37:g.134113163G>A		Somatic	87.0	1.0		WXS	Illumina HiSeq	Phase_I	52.0	21.0	NM_052875	Q96A55	Silent	SNP	ENST00000281187.5	37	CCDS8495.1																																																																																			.		0.537	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393591.1	NM_052875	
ZNF208	7757	hgsc.bcm.edu;bcgsc.ca	37	19	22171610	22171610	+	Silent	SNP	C	C	T	rs201303510		TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:22171610C>T	ENST00000397126.4	-	2	253	c.105G>A	c.(103-105)gaG>gaA	p.E35E	ZNF208_ENST00000599916.1_Silent_p.E35E|ZNF208_ENST00000597040.1_Silent_p.E3E|ZNF208_ENST00000601773.1_Silent_p.E35E	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	35	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTCTGTAGTTCTCTAACATCA	0.408																																					p.E35E		.											.	ZNF208	7	0			c.G105A						.						139.0	149.0	146.0					19																	22171610		2203	4298	6501	SO:0001819	synonymous_variant	7757	exon2			GTAGTTCTCTAAC	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.105G>A	19.37:g.22171610C>T		Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	14.0	NM_007153		Silent	SNP	ENST00000397126.4	37	CCDS54240.1																																																																																			.		0.408	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF490	57474	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12721447	12721447	+	Silent	SNP	C	C	T			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:12721447C>T	ENST00000311437.6	-	1	170	c.48G>A	c.(46-48)gaG>gaA	p.E16E	ZNF791_ENST00000446165.1_5'Flank|ZNF791_ENST00000458122.3_5'Flank|ZNF791_ENST00000540038.1_5'Flank|ZNF791_ENST00000343325.4_5'Flank|ZNF490_ENST00000465656.1_Intron	NM_020714.2	NP_065765.1	Q9ULM2	ZN490_HUMAN	zinc finger protein 490	16					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	18						GGACTTGCTCCTCGAGGGGTC	0.577																																					p.E16E		.											.	ZNF490	90	0			c.G48A						.						162.0	126.0	139.0					19																	12721447		2203	4300	6503	SO:0001819	synonymous_variant	57474	exon1			TTGCTCCTCGAGG	AB033024	CCDS12272.1	19p13.2	2013-01-08			ENSG00000188033	ENSG00000188033		"""Zinc fingers, C2H2-type"", ""-"""	23705	protein-coding gene	gene with protein product							Standard	NM_020714		Approved	KIAA1198	uc002mtz.2	Q9ULM2	OTTHUMG00000156398	ENST00000311437.6:c.48G>A	19.37:g.12721447C>T		Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	7.0	NM_020714		Silent	SNP	ENST00000311437.6	37	CCDS12272.1																																																																																			.		0.577	ZNF490-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344073.1	NM_020714	
ZNF676	163223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22364341	22364341	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:22364341C>G	ENST00000397121.2	-	3	495	c.178G>C	c.(178-180)Gaa>Caa	p.E60Q		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	60					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AAAGAATCTTCTATGCCTTGC	0.299																																					p.E60Q		.											.	ZNF676	90	0			c.G178C						.						48.0	43.0	45.0					19																	22364341		1887	4137	6024	SO:0001583	missense	163223	exon3			AATCTTCTATGCC	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.178G>C	19.37:g.22364341C>G	ENSP00000380310:p.Glu60Gln	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	54.0	NM_001001411	A8MVX5	Missense_Mutation	SNP	ENST00000397121.2	37	CCDS42539.1	.	.	.	.	.	.	.	.	.	.	.	2.906	-0.226528	0.06022	.	.	ENSG00000196109	ENST00000397121	T	0.08102	3.13	0.814	-0.526	0.11913	.	.	.	.	.	T	0.07143	0.0181	N	0.13168	0.305	0.09310	N	1	P	0.51653	0.947	P	0.53490	0.727	T	0.29912	-0.9996	9	0.40728	T	0.16	.	2.6619	0.05029	0.0:0.5266:0.0:0.4734	.	60	Q8N7Q3	ZN676_HUMAN	Q	60	ENSP00000380310:E60Q	ENSP00000380310:E60Q	E	-	1	0	ZNF676	22156181	0.000000	0.05858	0.100000	0.21137	0.100000	0.18952	-0.520000	0.06252	0.183000	0.20059	0.186000	0.17326	GAA	.		0.299	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464392.1	NM_001001411	
ZNF350	59348	broad.mit.edu;bcgsc.ca	37	19	52469455	52469455	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A216-01A-11D-A152-10	TCGA-BC-A216-11A-11D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c1d9ed06-7498-4c6c-a0de-dbf28e868109	baf0c971-0005-4e18-bfdf-a2d71a3aff12	g.chr19:52469455A>G	ENST00000243644.4	-	5	478	c.251T>C	c.(250-252)gTt>gCt	p.V84A	HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'Flank|HCCAT3_ENST00000595010.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	84					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		CACATGATCAACTTTCCATAT	0.328																																					p.V84A		.											.	ZNF350	227	0			c.T251C						.						54.0	56.0	55.0					19																	52469455		2198	4282	6480	SO:0001583	missense	59348	exon5			TGATCAACTTTCC	AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.251T>C	19.37:g.52469455A>G	ENSP00000243644:p.Val84Ala	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	5.0	NM_021632	Q96G73|Q9HAQ4	Missense_Mutation	SNP	ENST00000243644.4	37	CCDS12845.1	.	.	.	.	.	.	.	.	.	.	A	6.945	0.544240	0.13312	.	.	ENSG00000256683	ENST00000243644	T	0.05786	3.39	3.58	-1.26	0.09376	.	1.522520	0.04804	N	0.434004	T	0.03136	0.0092	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40421	-0.9564	10	0.07482	T	0.82	.	2.8188	0.05465	0.4339:0.0:0.358:0.2081	.	84	Q9GZX5	ZN350_HUMAN	A	84	ENSP00000243644:V84A	ENSP00000243644:V84A	V	-	2	0	ZNF350	57161267	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.133000	0.10451	-0.188000	0.10499	-0.361000	0.07541	GTT	.		0.328	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462278.1	NM_021632	
