#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABI2	10152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	204193320	204193320	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:204193320G>T	ENST00000422511.2	+	1	114	c.83G>T	c.(82-84)cGg>cTg	p.R28L	ABI2_ENST00000295851.5_Missense_Mutation_p.R28L|RP11-363J17.1_ENST00000469747.2_RNA|ABI2_ENST00000430418.1_Missense_Mutation_p.R28L|ABI2_ENST00000424558.1_Missense_Mutation_p.R28L|ABI2_ENST00000261016.6_5'UTR|ABI2_ENST00000261017.5_Missense_Mutation_p.R28L			Q9NYB9	ABI2_HUMAN	abl-interactor 2	28					actin polymerization or depolymerization (GO:0008154)|cell migration (GO:0016477)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|Rac protein signal transduction (GO:0016601)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|SCAR complex (GO:0031209)	cytoskeletal adaptor activity (GO:0008093)|DNA binding (GO:0003677)|kinase binding (GO:0019900)|proline-rich region binding (GO:0070064)|protein complex binding (GO:0032403)|SH3 domain binding (GO:0017124)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(3)|large_intestine(1)|liver(2)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	15						AATCTGGAACGGGTGGCCGAT	0.672																																					p.R28L		.											.	ABI2	90	0			c.G83T						.						39.0	46.0	44.0					2																	204193320		2203	4300	6503	SO:0001583	missense	10152	exon1			TGGAACGGGTGGC	AF260261	CCDS2358.1, CCDS63093.1, CCDS63094.1, CCDS74634.1	2q33	2010-09-20	2009-07-23		ENSG00000138443	ENSG00000138443			24011	protein-coding gene	gene with protein product		606442				7590236, 10964520	Standard	XM_005246217		Approved	ABI-2, AIP-1, ABI2B, AblBP3, argBPIA, SSH3BP2	uc002uzz.3	Q9NYB9	OTTHUMG00000132879	ENST00000422511.2:c.83G>T	2.37:g.204193320G>T	ENSP00000396249:p.Arg28Leu	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	34.0	NM_005759	B4DSN1|Q13147|Q13249|Q13801|Q9BV70	Missense_Mutation	SNP	ENST00000422511.2	37		.	.	.	.	.	.	.	.	.	.	G	32	5.121756	0.94385	.	.	ENSG00000138443	ENST00000295851;ENST00000261017;ENST00000430418;ENST00000424558;ENST00000417864;ENST00000422511	D;D;D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51;-1.51;-1.51	3.77	3.77	0.43336	.	0.132117	0.47093	D	0.000245	T	0.81049	0.4742	M	0.76838	2.35	0.80722	D	1	B;B;B	0.17268	0.021;0.002;0.0	B;B;B	0.14578	0.011;0.001;0.005	T	0.81992	-0.0678	10	0.87932	D	0	-0.6104	15.7751	0.78207	0.0:0.0:1.0:0.0	.	28;28;28	Q9NYB9-4;Q9NYB9;Q9NYB9-2	.;ABI2_HUMAN;.	L	28	ENSP00000295851:R28L;ENSP00000261017:R28L;ENSP00000408898:R28L;ENSP00000391433:R28L;ENSP00000414703:R28L;ENSP00000396249:R28L	ENSP00000261017:R28L	R	+	2	0	ABI2	203901565	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	8.342000	0.90049	1.923000	0.55706	0.305000	0.20034	CGG	.		0.672	ABI2-007	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000336179.2	NM_005759	
ACVRL1	94	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52307458	52307458	+	Silent	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:52307458C>T	ENST00000388922.4	+	4	712	c.429C>T	c.(427-429)gtC>gtT	p.V143V	ACVRL1_ENST00000550683.1_Silent_p.V157V|ACVRL1_ENST00000419526.2_Intron	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	143					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	TGTGGCATGTCCGACGGAGGC	0.662																																					p.V143V		.											.	ACVRL1	521	0			c.C429T						.						33.0	29.0	30.0					12																	52307458		2203	4300	6503	SO:0001819	synonymous_variant	94	exon4			GCATGTCCGACGG	L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.429C>T	12.37:g.52307458C>T		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	7.0	NM_000020	A6NGA8	Silent	SNP	ENST00000388922.4	37	CCDS31804.1																																																																																			.		0.662	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404520.2		
ADAMTSL2	9719	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	136402628	136402628	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:136402628G>A	ENST00000354484.4	+	3	749	c.192G>A	c.(190-192)ggG>ggA	p.G64G	ADAMTSL2_ENST00000393061.3_Silent_p.G173G|ADAMTSL2_ENST00000393060.1_Silent_p.G64G	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	64	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		GCAGTTGCGGGGGTGGGGTGA	0.677																																					p.G64G		.											.	ADAMTSL2	91	0			c.G192A						.						33.0	38.0	37.0					9																	136402628		2201	4298	6499	SO:0001819	synonymous_variant	9719	exon3			TTGCGGGGGTGGG	AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.192G>A	9.37:g.136402628G>A		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	25.0	NM_014694	B1B0D5|O60345	Silent	SNP	ENST00000354484.4	37	CCDS6976.1																																																																																			.		0.677	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254619.1	NM_014694	
AKR1C1	1645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	5009199	5009199	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:5009199T>C	ENST00000380872.4	+	3	525	c.333T>C	c.(331-333)gtT>gtC	p.V111V	AKR1C1_ENST00000434459.2_Silent_p.V111V|AKR1C1_ENST00000380859.1_Silent_p.V113V|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	111					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	TGGATTATGTTGACCTCTACC	0.398																																					p.V111V	Colon(130;2054 2316 13360 15380)	.											.	AKR1C1	516	0			c.T333C						.						125.0	115.0	118.0					10																	5009199		2203	4300	6503	SO:0001819	synonymous_variant	1645	exon3			TTATGTTGACCTC	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.333T>C	10.37:g.5009199T>C		Somatic	347.0	0.0		WXS	Illumina HiSeq	Phase_I	311.0	137.0	NM_001353	P52896|Q5SR15|Q7M4N2|Q9UCX2	Silent	SNP	ENST00000380872.4	37	CCDS7061.1	.	.	.	.	.	.	.	.	.	.	T	3.685	-0.064794	0.07273	.	.	ENSG00000187134	ENST00000442997	.	.	.	2.95	-5.91	0.02269	.	.	.	.	.	T	0.37019	0.0988	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37502	-0.9703	4	.	.	.	.	2.0885	0.03651	0.3674:0.0969:0.3694:0.1663	.	.	.	.	S	78	.	.	L	+	2	0	AKR1C1	4999199	0.349000	0.24870	0.022000	0.16811	0.029000	0.11900	-0.852000	0.04308	-2.566000	0.00470	0.254000	0.18369	TTG	.		0.398	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353	
ANKRD11	29123	ucsc.edu;bcgsc.ca	37	16	89351544	89351544	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:89351544A>G	ENST00000301030.4	-	9	1866	c.1406T>C	c.(1405-1407)tTc>tCc	p.F469S	ANKRD11_ENST00000378330.2_Missense_Mutation_p.F469S	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	469					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCGCTTTCCGAAGCGAACCTC	0.517																																					p.F469S		.											ANKRD11,NS,carcinoma,+1	ANKRD11	139	0			c.T1406C						.						30.0	33.0	32.0					16																	89351544		2198	4299	6497	SO:0001583	missense	29123	exon9			TTTCCGAAGCGAA	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.1406T>C	16.37:g.89351544A>G	ENSP00000301030:p.Phe469Ser	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	A	14.80	2.642779	0.47153	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000330736	T;T	0.38240	1.15;1.15	5.49	4.4	0.53042	.	0.109078	0.64402	D	0.000005	T	0.55386	0.1917	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.999;0.987	D;D	0.68943	0.961;0.958	T	0.55049	-0.8201	10	0.48119	T	0.1	.	11.2228	0.48866	0.928:0.0:0.072:0.0	.	88;469	Q7Z5E5;Q6UB99	.;ANR11_HUMAN	S	469;469;88	ENSP00000301030:F469S;ENSP00000367581:F469S	ENSP00000301030:F469S	F	-	2	0	ANKRD11	87879045	1.000000	0.71417	0.999000	0.59377	0.218000	0.24690	5.900000	0.69853	0.929000	0.37192	0.379000	0.24179	TTC	.		0.517	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	9182491	9182491	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:9182491A>G	ENST00000262126.4	+	2	301	c.61A>G	c.(61-63)Atg>Gtg	p.M21V	RP11-21J18.1_ENST00000579126.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.M21V|ANKRD12_ENST00000400020.3_Missense_Mutation_p.M21V|ANKRD12_ENST00000540578.2_3'UTR	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	21						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TGACAGCAATATGGTAGAGAA	0.343																																					p.M21V		.											.	ANKRD12	92	0			c.A61G						.						70.0	71.0	70.0					18																	9182491		2203	4299	6502	SO:0001583	missense	23253	exon2			AGCAATATGGTAG	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.61A>G	18.37:g.9182491A>G	ENSP00000262126:p.Met21Val	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	35.0	NM_001083625	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.708582	0.48517	.	.	ENSG00000101745	ENST00000383440;ENST00000546007;ENST00000262126;ENST00000540578	T;T;T	0.76316	-1.01;0.87;3.49	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.86024	0.5834	M	0.68952	2.095	0.53688	D	0.999978	P;D;P	0.58268	0.865;0.982;0.865	P;D;P	0.68943	0.824;0.961;0.824	D	0.87480	0.2420	10	0.87932	D	0	-1.5897	14.079	0.64909	1.0:0.0:0.0:0.0	.	21;21;21	Q6PG48;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	V	21	ENSP00000372932:M21V;ENSP00000441510:M21V;ENSP00000262126:M21V	ENSP00000262126:M21V	M	+	1	0	ANKRD12	9172491	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.674000	0.68117	2.203000	0.70933	0.482000	0.46254	ATG	.		0.343	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANXA13	312	hgsc.bcm.edu;bcgsc.ca	37	8	124701110	124701112	+	Splice_Site	DEL	CCG	CCG	-	rs367655009		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	CCG	CCG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:124701110_124701112delCCG	ENST00000419625.1	-	9	789_791	c.717_719delCGG	c.(715-720)ctcggg>ctg	p.G240del	ANXA13_ENST00000262219.6_Splice_Site_p.G281del	NM_004306.2	NP_004297.2	P27216	ANX13_HUMAN	annexin A13	240					cell differentiation (GO:0030154)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|exocytic vesicle (GO:0070382)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylglycerol binding (GO:1901611)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	25	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			CTTTACTTTACCGAGAGTTAAAT	0.448																																					p.280_281del		.											.	ANXA13	93	0			c.840_841del						.																																			SO:0001630	splice_region_variant	312	exon10			ACTTTACCGAGAG	Z11502	CCDS34939.1, CCDS47917.1	8q24.13	2005-11-09			ENSG00000104537	ENSG00000104537		"""Annexins"""	536	protein-coding gene	gene with protein product		602573		ANX13		9503022	Standard	NM_004306		Approved		uc003yqt.3	P27216	OTTHUMG00000164987	ENST00000419625.1:c.718+1CGG>-	8.37:g.124701110_124701112delCCG		Somatic	184.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	16.0	NM_001003954	Q9BQR5	Frame_Shift_Del	DEL	ENST00000419625.1	37	CCDS47917.1																																																																																			.		0.448	ANXA13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381308.1	NM_004306	In_Frame_Del
ARHGEF12	23365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	120317715	120317715	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:120317715G>C	ENST00000397843.2	+	18	1676	c.1510G>C	c.(1510-1512)Gag>Cag	p.E504Q	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.E401Q|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.E485Q	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	504	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		ACTTGATGCAGAGCGAGACAA	0.428			T	MLL	AML																																p.E504Q		.		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	.	ARHGEF12	661	0			c.G1510C						.						127.0	119.0	121.0					11																	120317715		1976	4177	6153	SO:0001583	missense	23365	exon18			GATGCAGAGCGAG	AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1510G>C	11.37:g.120317715G>C	ENSP00000380942:p.Glu504Gln	Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	42.0	NM_015313	O15086|Q6P526	Missense_Mutation	SNP	ENST00000397843.2	37	CCDS41727.1	.	.	.	.	.	.	.	.	.	.	G	33	5.252150	0.95336	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	D;D;D	0.85013	-1.93;-1.93;-1.93	5.3	5.3	0.74995	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.000000	0.46758	D	0.000263	D	0.92011	0.7469	M	0.70595	2.14	0.58432	D	0.999995	D;D;D	0.89917	0.994;0.999;1.0	D;D;D	0.79108	0.95;0.979;0.992	D	0.91908	0.5537	10	0.54805	T	0.06	-19.1516	19.3235	0.94252	0.0:0.0:1.0:0.0	.	401;485;504	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	Q	504;485;401	ENSP00000380942:E504Q;ENSP00000349056:E485Q;ENSP00000432984:E401Q	ENSP00000349056:E485Q	E	+	1	0	ARHGEF12	119822925	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.314000	0.96306	2.627000	0.88993	0.650000	0.86243	GAG	.		0.428	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388052.1	NM_015313	
ARMC3	219681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	23297251	23297251	+	Silent	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:23297251C>A	ENST00000298032.5	+	15	1960	c.1876C>A	c.(1876-1878)Cga>Aga	p.R626R	ARMC3_ENST00000409049.3_Silent_p.R626R|ARMC3_ENST00000376528.4_Silent_p.R363R|ARMC3_ENST00000409983.3_Silent_p.R626R	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	626			R -> Q (in dbSNP:rs10828395). {ECO:0000269|PubMed:15489334}.			extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGGTTATGGACGAAGTATTTC	0.279																																					p.R626R		.											.	ARMC3	90	0			c.C1876A						.						35.0	32.0	33.0					10																	23297251		2191	4269	6460	SO:0001819	synonymous_variant	219681	exon15			TATGGACGAAGTA	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1876C>A	10.37:g.23297251C>A		Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	21.0	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Silent	SNP	ENST00000298032.5	37	CCDS7142.1																																																																																			.		0.279	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
ATRIP	84126	broad.mit.edu;bcgsc.ca	37	3	48506379	48506379	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:48506379G>A	ENST00000320211.3	+	12	2318	c.2205G>A	c.(2203-2205)aaG>aaA	p.K735K	TREX1_ENST00000422277.2_5'Flank|TREX1_ENST00000296443.9_5'Flank|ATRIP_ENST00000412052.1_Silent_p.K642K|TREX1_ENST00000433541.1_5'Flank|ATRIP_ENST00000346691.4_Silent_p.K708K|ATRIP_ENST00000357105.6_Silent_p.K608K|TREX1_ENST00000456089.1_5'Flank|SHISA5_ENST00000465449.1_5'Flank|TREX1_ENST00000436480.2_5'Flank|TREX1_ENST00000444177.1_5'Flank	NM_130384.2	NP_569055.1	Q8WXE1	ATRIP_HUMAN	ATR interacting protein	735					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)	22				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGAAGGACAAGCTCTTCATGA	0.632								Other conserved DNA damage response genes																													p.K735K		.											.	ATRIP	23	0			c.G2205A						.						112.0	100.0	104.0					3																	48506379		2203	4300	6503	SO:0001819	synonymous_variant	84126	exon12			GGACAAGCTCTTC	AF451323	CCDS2767.1, CCDS2768.1, CCDS59449.1, CCDS59450.1	3p24.3-p22.1	2007-06-20			ENSG00000164053	ENSG00000164053			33499	protein-coding gene	gene with protein product		606605				11721054	Standard	NM_130384		Approved	FLJ12343, MGC20625, MGC21482, MGC26740	uc003ctf.2	Q8WXE1	OTTHUMG00000133532	ENST00000320211.3:c.2205G>A	3.37:g.48506379G>A		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	7.0	NM_130384	A8K6A3|A8K714|B2RCE7|B4DU92|B5MEB7|Q69YK9|Q8NHQ2|Q8WUG7|Q96CL3|Q9HA30	Silent	SNP	ENST00000320211.3	37	CCDS2768.1																																																																																			.		0.632	ATRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257507.2	NM_130384	
BACE2	25825	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	42622762	42622762	+	Silent	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr21:42622762T>A	ENST00000330333.6	+	7	1531	c.1068T>A	c.(1066-1068)ccT>ccA	p.P356P	BACE2_ENST00000347667.5_Intron|BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_Silent_p.P356P	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	356					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				CTTACTTCCCTAAAATCTCCA	0.458																																					p.P356P		.											.	BACE2	92	0			c.T1068A						.						125.0	107.0	113.0					21																	42622762		2203	4300	6503	SO:0001819	synonymous_variant	25825	exon7			CTTCCCTAAAATC	AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.1068T>A	21.37:g.42622762T>A		Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	96.0	NM_138992	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	ENST00000330333.6	37	CCDS13668.1																																																																																			.		0.458	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195056.1		
BAG6	7917	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31608198	31608198	+	Silent	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:31608198T>A	ENST00000375964.6	-	22	3325	c.3012A>T	c.(3010-3012)tcA>tcT	p.S1004S	BAG6_ENST00000211379.5_Silent_p.S998S|BAG6_ENST00000404765.2_Silent_p.S1034S|BAG6_ENST00000470875.1_5'Flank|BAG6_ENST00000362049.6_Silent_p.S998S|BAG6_ENST00000439687.2_Intron|BAG6_ENST00000375976.4_Silent_p.S998S	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	1004					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						CTGTCTCAGCTGAAGCTCCAT	0.562																																					p.S1004S		.											.	BAG6	154	0			c.A3012T						.						116.0	136.0	129.0					6																	31608198		1511	2709	4220	SO:0001819	synonymous_variant	7917	exon22			CTCAGCTGAAGCT	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.3012A>T	6.37:g.31608198T>A		Somatic	42.0	1.0		WXS	Illumina HiSeq	Phase_I	63.0	35.0	NM_004639	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	ENST00000375964.6	37	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	T	6.797	0.516132	0.12944	.	.	ENSG00000204463	ENST00000441793	.	.	.	5.65	0.343	0.16001	.	.	.	.	.	T	0.08802	0.0218	.	.	.	0.26371	N	0.976882	.	.	.	.	.	.	T	0.35051	-0.9804	4	.	.	.	.	2.9471	0.05849	0.2428:0.0677:0.1267:0.5628	.	.	.	.	L	147	.	.	Q	-	2	0	BAG6	31716177	0.001000	0.12720	0.953000	0.39169	0.992000	0.81027	-1.368000	0.02580	-0.062000	0.13088	-0.333000	0.08304	CAG	.		0.562	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	
BAIAP2L2	80115	ucsc.edu;bcgsc.ca	37	22	38483254	38483254	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr22:38483254T>C	ENST00000381669.3	-	11	1280	c.1136A>G	c.(1135-1137)gAg>gGg	p.E379G	CTA-228A9.3_ENST00000609162.1_lincRNA	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	379	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					CACGTACGCCTCGGGGAACCA	0.602																																					p.E379G		.											.	BAIAP2L2	91	0			c.A1136G						.						45.0	53.0	50.0					22																	38483254		1942	4127	6069	SO:0001583	missense	80115	exon11			TACGCCTCGGGGA	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1136A>G	22.37:g.38483254T>C	ENSP00000371085:p.Glu379Gly	Somatic	63.0	0.0		WXS	Illumina HiSeq	.	36.0	5.0	NM_025045	B0QYE2|Q96BG7	Missense_Mutation	SNP	ENST00000381669.3	37	CCDS43018.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.069556	0.36470	.	.	ENSG00000128298	ENST00000381669;ENST00000402500;ENST00000428572	T;T	0.50001	0.76;0.76	4.85	3.8	0.43715	Src homology-3 domain (3);Variant SH3 (1);	0.176584	0.48286	D	0.000182	T	0.48804	0.1520	N	0.20304	0.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.34825	-0.9813	10	0.26408	T	0.33	-20.382	9.5837	0.39504	0.1563:0.0:0.0:0.8437	.	379	Q6UXY1	BI2L2_HUMAN	G	379;379;70	ENSP00000371085:E379G;ENSP00000410074:E70G	ENSP00000371085:E379G	E	-	2	0	BAIAP2L2	36813200	1.000000	0.71417	0.983000	0.44433	0.527000	0.34593	4.754000	0.62191	0.675000	0.31264	0.459000	0.35465	GAG	.		0.602	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
BCO1	53630	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	81303890	81303890	+	Missense_Mutation	SNP	A	A	G	rs144501132	byFrequency	TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:81303890A>G	ENST00000258168.2	+	7	1431	c.970A>G	c.(970-972)Att>Gtt	p.I324V	BCMO1_ENST00000425577.2_Missense_Mutation_p.I255V	NM_017429.2	NP_059125.2														breast(2)|endometrium(1)|large_intestine(4)|lung(9)|prostate(3)|skin(3)|stomach(1)	23						GTTTGACGTCATTGCCTACGA	0.567																																					p.I324V		.											.	BCMO1	90	0			c.A970G						.	A	VAL/ILE	0,4404		0,0,2202	178.0	131.0	147.0		970	0.9	0.1	16	dbSNP_134	147	1,8599	1.2+/-3.3	0,1,4299	no	missense	BCMO1	NM_017429.2	29	0,1,6501	GG,GA,AA		0.0116,0.0,0.0077	benign	324/548	81303890	1,13003	2202	4300	6502	SO:0001583	missense	53630	exon7			GACGTCATTGCCT																												ENST00000258168.2:c.970A>G	16.37:g.81303890A>G	ENSP00000258168:p.Ile324Val	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	11.0	NM_017429		Missense_Mutation	SNP	ENST00000258168.2	37	CCDS10934.1	.	.	.	.	.	.	.	.	.	.	A	6.092	0.385301	0.11524	0.0	1.16E-4	ENSG00000135697	ENST00000258168;ENST00000425577	D;D	0.94687	-3.49;-3.49	5.62	0.942	0.19525	.	0.324205	0.36268	N	0.002699	D	0.87188	0.6115	N	0.21583	0.68	0.39723	D	0.971496	B;B	0.30146	0.27;0.022	B;B	0.28465	0.09;0.036	T	0.77319	-0.2632	10	0.23302	T	0.38	-13.0786	10.3856	0.44138	0.6793:0.0:0.3207:0.0	.	255;324	E7EM88;Q9HAY6	.;BCDO1_HUMAN	V	324;255	ENSP00000258168:I324V;ENSP00000400586:I255V	ENSP00000258168:I324V	I	+	1	0	BCMO1	79861391	0.998000	0.40836	0.054000	0.19295	0.066000	0.16364	3.398000	0.52579	-0.105000	0.12132	-0.911000	0.02809	ATT	A|1.000;G|0.000		0.567	BCMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269056.1		
CDH22	64405	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	44856179	44856179	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr20:44856179delC	ENST00000372262.3	-	3	1038	c.638delG	c.(637-639)ggcfs	p.G213fs	CDH22_ENST00000537909.1_Frame_Shift_Del_p.G213fs	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	213	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GTGGTGCTCGCCGTCCAGCAC	0.741																																					p.G213fs		.											.	CDH22	95	0			c.638delG						.						27.0	23.0	24.0					20																	44856179		2203	4299	6502	SO:0001589	frameshift_variant	64405	exon4			TGCTCGCCGTCCA	AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.638delG	20.37:g.44856179delC	ENSP00000361336:p.Gly213fs	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	30.0	NM_021248	B9EGK7|O43205	Frame_Shift_Del	DEL	ENST00000372262.3	37	CCDS13395.1																																																																																			.		0.741	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080491.1	NM_021248	
CECR1	51816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	17662466	17662466	+	Splice_Site	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr22:17662466C>A	ENST00000399839.1	-	10	1713	c.1443G>T	c.(1441-1443)aaG>aaT	p.K481N	CECR1_ENST00000330232.4_Splice_Site_p.K240N|CECR1_ENST00000262607.3_Splice_Site_p.K481N|CECR1_ENST00000449907.2_Splice_Site_p.K439N|CECR1_ENST00000399837.2_Splice_Site_p.K481N	NM_001282227.1|NM_001282228.1	NP_001269156.1|NP_001269157.1	Q9NZK5	CECR1_HUMAN	cat eye syndrome chromosome region, candidate 1	481					adenosine catabolic process (GO:0006154)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|multicellular organismal development (GO:0007275)	extracellular space (GO:0005615)	adenosine deaminase activity (GO:0004000)|adenosine receptor binding (GO:0031685)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	25		all_epithelial(15;0.0152)|Lung NSC(13;0.0875)|all_lung(157;0.106)				GGGTACTGTACCTGCAGGAAG	0.532																																					p.K481N		.											.	CECR1	91	0			c.G1443T						.						129.0	131.0	130.0					22																	17662466		2203	4300	6503	SO:0001630	splice_region_variant	51816	exon9			ACTGTACCTGCAG	AF190746	CCDS13742.1, CCDS13743.1, CCDS63395.1, CCDS74809.1	22q11.2	2008-02-22			ENSG00000093072	ENSG00000093072			1839	protein-coding gene	gene with protein product		607575		IDGFL		10756095	Standard	NM_001282225		Approved	ADGF	uc002zmk.1	Q9NZK5	OTTHUMG00000030726	ENST00000399839.1:c.1443-1G>T	22.37:g.17662466C>A		Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	62.0	NM_017424	A8K9H4|Q6ICF1|Q86UB6|Q8NCJ2|Q96K41	Missense_Mutation	SNP	ENST00000399839.1	37	CCDS13742.1	.	.	.	.	.	.	.	.	.	.	C	6.453	0.451754	0.12223	.	.	ENSG00000093072	ENST00000399839;ENST00000330232;ENST00000262607;ENST00000449907;ENST00000399837	D;D;D;D;D	0.95622	-3.76;-3.76;-3.76;-3.76;-3.76	3.62	0.0265	0.14150	Adenosine/AMP deaminase (1);	0.338897	0.33670	N	0.004670	D	0.92051	0.7481	L	0.61387	1.9	0.25253	N	0.989652	B;B	0.30605	0.287;0.01	B;B	0.28991	0.097;0.026	D	0.84961	0.0877	10	0.48119	T	0.1	.	8.2936	0.31971	0.0:0.5987:0.0:0.4013	.	481;240	Q9NZK5;Q9NZK5-2	CECR1_HUMAN;.	N	481;240;481;439;481	ENSP00000382733:K481N;ENSP00000332871:K240N;ENSP00000262607:K481N;ENSP00000406443:K439N;ENSP00000382731:K481N	ENSP00000262607:K481N	K	-	3	2	CECR1	16042466	1.000000	0.71417	0.194000	0.23346	0.038000	0.13279	1.327000	0.33746	0.061000	0.16311	0.655000	0.94253	AAG	.		0.532	CECR1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316079.1		Missense_Mutation
CHTF18	63922	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	845334	845334	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:845334C>A	ENST00000262315.9	+	16	2216	c.2153C>A	c.(2152-2154)aCc>aAc	p.T718N	CHTF18_ENST00000455171.2_Missense_Mutation_p.T746N|CHTF18_ENST00000317063.6_Missense_Mutation_p.T927N	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	718					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				CCCAGGATCACCTTCCCCAGC	0.697																																					p.T718N		.											.	CHTF18	227	0			c.C2153A						.						32.0	40.0	37.0					16																	845334		1767	3449	5216	SO:0001583	missense	63922	exon16			GGATCACCTTCCC	BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2153C>A	16.37:g.845334C>A	ENSP00000262315:p.Thr718Asn	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	27.0	NM_022092	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	ENST00000262315.9	37	CCDS45371.1	.	.	.	.	.	.	.	.	.	.	C	1.879	-0.458342	0.04508	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.09817	2.94;2.98;2.98	4.61	2.61	0.31194	.	0.946639	0.08884	N	0.879632	T	0.06142	0.0159	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.29988	0.264;0.083	B;B	0.23275	0.045;0.02	T	0.44050	-0.9353	10	0.19147	T	0.46	-4.3262	8.652	0.34040	0.0:0.7607:0.1531:0.0862	.	746;718	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	N	927;746;718	ENSP00000313029:T927N;ENSP00000406252:T746N;ENSP00000262315:T718N	ENSP00000262315:T718N	T	+	2	0	CHTF18	785335	0.322000	0.24634	0.143000	0.22291	0.579000	0.36224	1.157000	0.31724	0.379000	0.24794	-0.502000	0.04539	ACC	.		0.697	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109061.3	NM_022092	
CLK4	57396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	178040784	178040784	+	Silent	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:178040784A>T	ENST00000316308.4	-	6	771	c.603T>A	c.(601-603)gcT>gcA	p.A201A		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	201	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		TTTCTGAACGAGCTGCTTCAC	0.338																																					p.A201A		.											.	CLK4	359	0			c.T603A						.						133.0	132.0	133.0					5																	178040784		2203	4300	6503	SO:0001819	synonymous_variant	57396	exon6			TGAACGAGCTGCT	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.603T>A	5.37:g.178040784A>T		Somatic	231.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	65.0	NM_020666		Silent	SNP	ENST00000316308.4	37	CCDS4437.1																																																																																			.		0.338	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
CLK4	57396	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	178040789	178040789	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:178040789C>T	ENST00000316308.4	-	6	766	c.598G>A	c.(598-600)Gca>Aca	p.A200T		NM_020666.2	NP_065717.1	Q9HAZ1	CLK4_HUMAN	CDC-like kinase 4	200	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|regulation of RNA splicing (GO:0043484)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(2)	21	all_cancers(89;0.000969)|Renal(175;0.000159)|all_epithelial(37;0.000451)|Lung NSC(126;0.00545)|all_lung(126;0.00918)	all_cancers(40;0.0272)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.235)		GAACGAGCTGCTTCACGGTAA	0.348																																					p.A200T		.											.	CLK4	359	0			c.G598A						.						137.0	134.0	135.0					5																	178040789		2203	4300	6503	SO:0001583	missense	57396	exon6			GAGCTGCTTCACG	AF294429	CCDS4437.1	5q35	2008-05-02			ENSG00000113240	ENSG00000113240		"""CDC-like kinases"""	13659	protein-coding gene	gene with protein product		607969				11170754	Standard	NM_020666		Approved		uc003mjf.1	Q9HAZ1	OTTHUMG00000130893	ENST00000316308.4:c.598G>A	5.37:g.178040789C>T	ENSP00000316948:p.Ala200Thr	Somatic	228.0	1.0		WXS	Illumina HiSeq	Phase_I	168.0	64.0	NM_020666		Missense_Mutation	SNP	ENST00000316308.4	37	CCDS4437.1	.	.	.	.	.	.	.	.	.	.	C	31	5.101441	0.94245	.	.	ENSG00000113240	ENST00000316308;ENST00000536763	T	0.65732	-0.17	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75265	0.3826	L	0.55834	1.745	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.73708	0.981;0.981;0.981	T	0.77498	-0.2565	10	0.87932	D	0	.	16.5089	0.84279	0.0:1.0:0.0:0.0	.	200;200;200	B7ZL31;B9EG64;Q9HAZ1	.;.;CLK4_HUMAN	T	200	ENSP00000316948:A200T	ENSP00000316948:A200T	A	-	1	0	CLK4	177973395	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.711000	0.84669	2.565000	0.86533	0.591000	0.81541	GCA	.		0.348	CLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253479.2		
COL7A1	1294	broad.mit.edu;mdanderson.org	37	3	48630129	48630129	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:48630129T>C	ENST00000328333.8	-	7	957	c.850A>G	c.(850-852)Aac>Gac	p.N284D	COL7A1_ENST00000454817.1_Missense_Mutation_p.N284D	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	284	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GCTGGGACGTTCACCTGCCCA	0.612																																					p.N284D		.											.	COL7A1	160	0			c.A850G						.						60.0	56.0	57.0					3																	48630129		2203	4300	6503	SO:0001583	missense	1294	exon7			GGACGTTCACCTG	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.850A>G	3.37:g.48630129T>C	ENSP00000332371:p.Asn284Asp	Somatic	51.0	2.0		WXS	Illumina HiSeq	Phase_I	28.0	7.0	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	T	10.63	1.402771	0.25291	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.58358	0.34;0.34	4.5	2.03	0.26663	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.143145	0.30800	N	0.008852	T	0.27967	0.0689	N	0.04768	-0.165	0.25669	N	0.985915	B	0.24317	0.101	B	0.25506	0.061	T	0.17501	-1.0367	10	0.51188	T	0.08	.	7.1065	0.25366	0.0:0.0784:0.1481:0.7734	.	284	Q02388	CO7A1_HUMAN	D	284	ENSP00000332371:N284D;ENSP00000412569:N284D	ENSP00000332371:N284D	N	-	1	0	COL7A1	48605133	1.000000	0.71417	0.769000	0.31535	0.769000	0.43574	4.908000	0.63307	0.210000	0.20664	0.379000	0.24179	AAC	.		0.612	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
CPNE5	57699	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	36712088	36712088	+	Silent	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:36712088G>T	ENST00000244751.2	-	19	2070	c.1446C>A	c.(1444-1446)ccC>ccA	p.P482P	CPNE5_ENST00000459703.1_5'UTR|CPNE5_ENST00000393189.2_Silent_p.P190P	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V	482	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						TGATGGACATGGGGAGCTTGG	0.597																																					p.P482P		.											.	CPNE5	91	0			c.C1446A						.						62.0	43.0	50.0					6																	36712088		2198	4296	6494	SO:0001819	synonymous_variant	57699	exon19			GGACATGGGGAGC	H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.1446C>A	6.37:g.36712088G>T		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	40.0	NM_020939	Q7Z6C8	Silent	SNP	ENST00000244751.2	37	CCDS4825.1																																																																																			.		0.597	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040351.1	NM_020939	
CSMD2	114784	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	34312563	34312563	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:34312563T>C	ENST00000373381.4	-	6	1131	c.955A>G	c.(955-957)Agc>Ggc	p.S319G		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TTCTTGCTGCTGATAACGGGG	0.587																																					p.S279G		.											.	CSMD2	103	0			c.A835G						.						63.0	59.0	60.0					1																	34312563		2203	4300	6503	SO:0001583	missense	114784	exon6			TGCTGCTGATAAC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.955A>G	1.37:g.34312563T>C	ENSP00000362479:p.Ser319Gly	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	12.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000373381.4	37		.	.	.	.	.	.	.	.	.	.	T	25.3	4.625944	0.87560	.	.	ENSG00000121904	ENST00000373381	D	0.93488	-3.23	4.82	4.82	0.62117	CUB (5);	0.000000	0.85682	D	0.000000	D	0.97043	0.9034	M	0.93638	3.44	0.80722	D	1	B;D	0.71674	0.008;0.998	B;D	0.72338	0.029;0.977	D	0.96709	0.9524	10	0.29301	T	0.29	.	12.6056	0.56521	0.0:0.0:0.0:1.0	.	279;319	Q7Z408;E7EUA6	CSMD2_HUMAN;.	G	319	ENSP00000362479:S319G	ENSP00000241312:S279G	S	-	1	0	CSMD2	34085150	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.575000	0.82447	1.926000	0.55796	0.459000	0.35465	AGC	.		0.587	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CTC1	80169	ucsc.edu;bcgsc.ca	37	17	8131829	8131829	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:8131829A>G	ENST00000315684.8	-	22	3513	c.3506T>C	c.(3505-3507)gTc>gCc	p.V1169A		NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	1169					bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						ACCTAATGGGACGATCTTCGA	0.517																																					p.V1169A		.											.	CTC1	93	0			c.T3506C						.						325.0	323.0	324.0					17																	8131829		1927	4147	6074	SO:0001583	missense	80169	exon22			AATGGGACGATCT	AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.3506T>C	17.37:g.8131829A>G	ENSP00000313759:p.Val1169Ala	Somatic	99.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_025099	B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Missense_Mutation	SNP	ENST00000315684.8	37	CCDS42259.1	.	.	.	.	.	.	.	.	.	.	A	8.582	0.882607	0.17467	.	.	ENSG00000178971	ENST00000315684	D	0.82711	-1.64	5.8	0.973	0.19710	.	1.663470	0.02704	N	0.112014	T	0.67420	0.2891	N	0.14661	0.345	0.23787	N	0.996848	B	0.02656	0.0	B	0.04013	0.001	T	0.53322	-0.8455	10	0.11794	T	0.64	-0.2088	4.3139	0.10984	0.3481:0.207:0.4449:0.0	.	1169	Q2NKJ3	CTC1_HUMAN	A	1169	ENSP00000313759:V1169A	ENSP00000313759:V1169A	V	-	2	0	CTC1	8072554	0.001000	0.12720	0.009000	0.14445	0.675000	0.39556	0.043000	0.13971	0.139000	0.18822	0.533000	0.62120	GTC	.		0.517	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000442012.1	NM_025099	
CTNND2	1501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	10992757	10992757	+	Silent	SNP	C	C	A	rs531016201		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:10992757C>A	ENST00000304623.8	-	19	3306	c.3117G>T	c.(3115-3117)tcG>tcT	p.S1039S	CTNND2_ENST00000458100.2_Silent_p.S606S|CTNND2_ENST00000359640.2_Silent_p.S981S|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Silent_p.S948S|CTNND2_ENST00000503622.1_Silent_p.S702S	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1039					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGGTTGAAGACGAGGCTACAA	0.542																																					p.S1039S		.											.	CTNND2	293	0			c.G3117T						.						143.0	130.0	134.0					5																	10992757		2203	4300	6503	SO:0001819	synonymous_variant	1501	exon19			TGAAGACGAGGCT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3117G>T	5.37:g.10992757C>A		Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	60.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																			.		0.542	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
CUL4B	8450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	119669737	119669737	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrX:119669737A>C	ENST00000404115.3	-	18	2563	c.2162T>G	c.(2161-2163)cTt>cGt	p.L721R	CUL4B_ENST00000336592.6_Missense_Mutation_p.L708R|CUL4B_ENST00000371322.5_Missense_Mutation_p.L703R	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	721					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CTGCCACTGAAGTTTCCTGCC	0.338																																					p.L721R		.											.	CUL4B	227	0			c.T2162G						.						136.0	139.0	138.0					X																	119669737		2203	4300	6503	SO:0001583	missense	8450	exon18			CACTGAAGTTTCC	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.2162T>G	X.37:g.119669737A>C	ENSP00000384109:p.Leu721Arg	Somatic	574.0	0.0		WXS	Illumina HiSeq	Phase_I	573.0	136.0	NM_003588	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	ENST00000404115.3	37	CCDS35379.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003165	0.74932	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	D;D;D	0.90197	-2.63;-2.63;-2.63	5.79	4.61	0.57282	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.97040	0.9033	H	0.98466	4.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.96750	0.9553	9	.	.	.	-5.702	11.4747	0.50291	0.8516:0.1484:0.0:0.0	.	525;721;703	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	R	703;708;721	ENSP00000360373:L703R;ENSP00000338919:L708R;ENSP00000384109:L721R	.	L	-	2	0	CUL4B	119553765	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.168000	0.94781	0.795000	0.33922	0.472000	0.43445	CTT	.		0.338	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058103.1	NM_003588	
CYTH2	9266	ucsc.edu;bcgsc.ca	37	19	48981822	48981822	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:48981822A>G	ENST00000452733.2	+	11	1561	c.1085A>G	c.(1084-1086)gAg>gGg	p.E362G	CTC-273B12.8_ENST00000599877.1_lincRNA|CYTH2_ENST00000427476.1_Missense_Mutation_p.E363G			Q99418	CYH2_HUMAN	cytohesin 2	363	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						ACGCAGGAGGAGAAGGACGAG	0.627																																					p.E363G		.											.	CYTH2	228	0			c.A1088G						.						46.0	44.0	45.0					19																	48981822		2203	4300	6503	SO:0001583	missense	9266	exon11			AGGAGGAGAAGGA	X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.1085A>G	19.37:g.48981822A>G	ENSP00000408236:p.Glu362Gly	Somatic	67.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_017457	A8K8P0|Q8IXY9|Q92958	Missense_Mutation	SNP	ENST00000452733.2	37	CCDS12722.1	.	.	.	.	.	.	.	.	.	.	A	19.80	3.895230	0.72639	.	.	ENSG00000105443	ENST00000452733;ENST00000427476	T;T	0.79653	1.77;-1.29	4.47	4.47	0.54385	.	0.061993	0.64402	D	0.000008	D	0.89649	0.6776	H	0.94886	3.595	0.58432	D	0.999999	P	0.48162	0.906	P	0.53954	0.738	D	0.92027	0.5630	10	0.87932	D	0	.	12.0407	0.53452	1.0:0.0:0.0:0.0	.	362	Q99418-2	.	G	362;363	ENSP00000408236:E362G;ENSP00000391648:E363G	ENSP00000391648:E363G	E	+	2	0	CYTH2	53673634	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.065000	0.93941	2.001000	0.58596	0.533000	0.62120	GAG	.		0.627	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317060.1	NM_004228	
DDX60	55601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	169201507	169201507	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:169201507C>G	ENST00000393743.3	-	14	2248	c.1957G>C	c.(1957-1959)Gaa>Caa	p.E653Q		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	653					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CGGCAATGTTCTTTCCAGGCT	0.358																																					p.E653Q		.											.	DDX60	25	0			c.G1957C						.						89.0	83.0	85.0					4																	169201507		2203	4300	6503	SO:0001583	missense	55601	exon14			AATGTTCTTTCCA	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.1957G>C	4.37:g.169201507C>G	ENSP00000377344:p.Glu653Gln	Somatic	307.0	0.0		WXS	Illumina HiSeq	Phase_I	247.0	144.0	NM_017631	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	.	.	.	.	.	.	.	.	.	.	C	12.22	1.873492	0.33069	.	.	ENSG00000137628	ENST00000393743	T	0.19532	2.14	5.48	4.64	0.57946	.	0.302034	0.30210	N	0.010142	T	0.35480	0.0933	M	0.75264	2.295	0.32678	N	0.515851	D	0.65815	0.995	P	0.53062	0.717	T	0.52711	-0.8539	10	0.40728	T	0.16	.	11.3079	0.49347	0.0:0.849:0.0:0.151	.	653	Q8IY21	DDX60_HUMAN	Q	653	ENSP00000377344:E653Q	ENSP00000377344:E653Q	E	-	1	0	DDX60	169438082	0.657000	0.27393	0.794000	0.32065	0.056000	0.15407	1.215000	0.32431	1.326000	0.45319	0.563000	0.77884	GAA	.		0.358	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
DDX60L	91351	broad.mit.edu;bcgsc.ca	37	4	169382864	169382864	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:169382864T>C	ENST00000511577.1	-	5	839	c.592A>G	c.(592-594)Act>Gct	p.T198A	DDX60L_ENST00000260184.7_Missense_Mutation_p.T198A|DDX60L_ENST00000505890.1_Missense_Mutation_p.T198A			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	198							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTGGAAAAAGTTTGGTTTCTG	0.318																																					p.T198A		.											.	DDX60L	69	0			c.A592G						.						42.0	40.0	41.0					4																	169382864		1820	4079	5899	SO:0001583	missense	91351	exon5			AAAAAGTTTGGTT	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.592A>G	4.37:g.169382864T>C	ENSP00000422423:p.Thr198Ala	Somatic	125.0	2.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		.	.	.	.	.	.	.	.	.	.	T	0.016	-1.539385	0.00942	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890	T;T;T	0.16597	2.33;2.33;2.33	3.49	-1.41	0.08941	.	89.542900	0.00883	U	0.002152	T	0.13200	0.0320	L	0.46157	1.445	0.09310	N	1	B;B	0.25235	0.046;0.121	B;B	0.20767	0.015;0.031	T	0.14868	-1.0457	10	0.09843	T	0.71	.	3.7214	0.08457	0.3269:0.1022:0.0:0.5709	.	198;198	D6R906;Q5H9U9	.;DDX6L_HUMAN	A	198	ENSP00000260184:T198A;ENSP00000422423:T198A;ENSP00000422202:T198A	ENSP00000260184:T198A	T	-	1	0	DDX60L	169619439	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.237000	0.01200	-0.054000	0.13266	0.383000	0.25322	ACT	.		0.318	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
DDX60L	91351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	169382958	169382958	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:169382958C>T	ENST00000511577.1	-	5	745	c.498G>A	c.(496-498)tgG>tgA	p.W166*	DDX60L_ENST00000260184.7_Nonsense_Mutation_p.W166*|DDX60L_ENST00000505890.1_Nonsense_Mutation_p.W166*			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	166							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CTTTCATTCCCCAGGAATGTA	0.368																																					p.W166X		.											.	DDX60L	69	0			c.G498A						.						56.0	50.0	52.0					4																	169382958		1838	4094	5932	SO:0001587	stop_gained	91351	exon5			CATTCCCCAGGAA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.498G>A	4.37:g.169382958C>T	ENSP00000422423:p.Trp166*	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	30.0	NM_001012967	Q96ND6	Nonsense_Mutation	SNP	ENST00000511577.1	37		.	.	.	.	.	.	.	.	.	.	C	20.1	3.934346	0.73442	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890	.	.	.	3.43	3.43	0.39272	.	0.227351	0.22562	U	0.058453	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	14.7903	0.69837	0.0:1.0:0.0:0.0	.	.	.	.	X	166	.	ENSP00000260184:W166X	W	-	3	0	DDX60L	169619533	0.228000	0.23718	0.006000	0.13384	0.063000	0.16089	3.164000	0.50770	1.604000	0.50143	0.467000	0.42956	TGG	.		0.368	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
DHX9	1660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182823304	182823304	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:182823304A>G	ENST00000367549.3	+	6	727	c.617A>G	c.(616-618)gAt>gGt	p.D206G		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	206	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.|Interaction with CREBBP.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GTGGGTCCTGATCACAACAGG	0.363																																					p.D206G	Colon(69;210 1162 3697 13559 39565)	.											.	DHX9	92	0			c.A617G						.						72.0	71.0	71.0					1																	182823304		1845	4085	5930	SO:0001583	missense	1660	exon6			GTCCTGATCACAA	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.617A>G	1.37:g.182823304A>G	ENSP00000356520:p.Asp206Gly	Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	100.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	37	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.703563	0.88924	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.77098	-1.07	5.39	5.39	0.77823	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.90215	0.6941	M	0.92219	3.285	0.80722	D	1	P	0.46952	0.887	D	0.64042	0.921	D	0.92387	0.5918	10	0.87932	D	0	.	15.0812	0.72117	1.0:0.0:0.0:0.0	.	206	Q08211	DHX9_HUMAN	G	206	ENSP00000356520:D206G	ENSP00000356520:D206G	D	+	2	0	DHX9	181089927	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.661000	0.91125	2.045000	0.60652	0.533000	0.62120	GAT	.		0.363	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
DNAH7	56171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	196825086	196825086	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:196825086A>G	ENST00000312428.6	-	18	2889	c.2789T>C	c.(2788-2790)tTg>tCg	p.L930S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	930	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AACTGATGCCAAAATAAATGT	0.348																																					p.L930S		.											.	DNAH7	102	0			c.T2789C						.						117.0	116.0	116.0					2																	196825086		1856	4101	5957	SO:0001583	missense	56171	exon18			GATGCCAAAATAA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2789T>C	2.37:g.196825086A>G	ENSP00000311273:p.Leu930Ser	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	44.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	37	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.018893	0.75275	.	.	ENSG00000118997	ENST00000312428	T	0.69561	-0.41	5.64	5.64	0.86602	Dynein heavy chain, domain-2 (1);	0.000000	0.35151	U	0.003404	D	0.89441	0.6716	H	0.99090	4.425	0.80722	D	1	D	0.56287	0.975	D	0.68483	0.958	D	0.93764	0.7069	10	0.87932	D	0	.	15.8646	0.79055	1.0:0.0:0.0:0.0	.	930	Q8WXX0	DYH7_HUMAN	S	930	ENSP00000311273:L930S	ENSP00000311273:L930S	L	-	2	0	DNAH7	196533331	1.000000	0.71417	0.805000	0.32314	0.845000	0.48019	7.403000	0.79983	2.149000	0.67028	0.477000	0.44152	TTG	.		0.348	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
DNAH9	1770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11775087	11775087	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:11775087A>T	ENST00000262442.4	+	52	10294	c.10226A>T	c.(10225-10227)tAc>tTc	p.Y3409F	DNAH9_ENST00000454412.2_Missense_Mutation_p.Y3409F	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3409					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TGGAGGCCCTACCTGAGCCAG	0.488																																					p.Y3409F		.											.	DNAH9	168	0			c.A10226T						.						95.0	104.0	101.0					17																	11775087		2203	4300	6503	SO:0001583	missense	1770	exon52			GGCCCTACCTGAG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10226A>T	17.37:g.11775087A>T	ENSP00000262442:p.Tyr3409Phe	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	66.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	A	4.653	0.121327	0.08881	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.75589	-0.95;-0.95	4.82	3.72	0.42706	Dynein heavy chain, coiled coil stalk (1);	0.145258	0.48767	D	0.000178	T	0.43010	0.1228	N	0.01656	-0.775	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.34354	-0.9832	10	0.07482	T	0.82	.	11.1169	0.48266	0.8614:0.0:0.0:0.1386	.	3409	Q9NYC9	DYH9_HUMAN	F	3409;3409;1991	ENSP00000262442:Y3409F;ENSP00000414874:Y3409F	ENSP00000262442:Y3409F	Y	+	2	0	DNAH9	11715812	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.868000	0.69605	0.939000	0.37446	0.523000	0.50628	TAC	.		0.488	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DNAJC6	9829	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	65775451	65775451	+	Intron	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:65775451G>A	ENST00000395325.3	+	1	179				DNAJC6_ENST00000371069.4_Missense_Mutation_p.R8Q|DNAJC6_ENST00000263441.7_Intron	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6						cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						GGGAGCTACCGGAAAAAGACC	0.542																																					p.R8Q		.											.	DNAJC6	272	0			c.G23A						.																																			SO:0001627	intron_variant	9829	exon1			GCTACCGGAAAAA	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.22+44836G>A	1.37:g.65775451G>A		Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	29.0	NM_001256864	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	ENST00000395325.3	37	CCDS30739.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.017727	0.54576	.	.	ENSG00000116675	ENST00000371069	D	0.93019	-3.15	4.12	4.12	0.48240	.	0.620378	0.13604	N	0.375676	D	0.86594	0.5970	.	.	.	0.80722	D	1	P	0.46327	0.876	B	0.35899	0.213	D	0.87541	0.2459	9	0.51188	T	0.08	.	16.2031	0.82102	0.0:0.0:1.0:0.0	.	8	O75061-2	.	Q	8	ENSP00000360108:R8Q	ENSP00000360108:R8Q	R	+	2	0	DNAJC6	65548039	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	5.635000	0.67841	2.149000	0.67028	0.555000	0.69702	CGG	.		0.542	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
DSC2	1824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	28650707	28650707	+	Silent	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:28650707A>T	ENST00000280904.6	-	14	2678	c.2235T>A	c.(2233-2235)ccT>ccA	p.P745P	DSC2_ENST00000251081.6_Silent_p.P745P|snoU13_ENST00000459603.1_RNA	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	745					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TGTCATCTCCAGGAGCTTCTG	0.383																																					p.P745P		.											.	DSC2	517	0			c.T2235A						.						115.0	119.0	117.0					18																	28650707		2203	4300	6503	SO:0001819	synonymous_variant	1824	exon14			ATCTCCAGGAGCT	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2235T>A	18.37:g.28650707A>T		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	73.0	NM_024422		Silent	SNP	ENST00000280904.6	37	CCDS11892.1																																																																																			.		0.383	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	56480865	56480865	+	Missense_Mutation	SNP	C	C	T	rs200851382		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:56480865C>T	ENST00000370765.6	-	24	7507	c.7400G>A	c.(7399-7401)cGt>cAt	p.R2467H	DST_ENST00000370769.4_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1763					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CAAATTTCTACGGGAGGCTTT	0.498																																					p.R2467H		.											.	DST	523	0			c.G7400A						.						61.0	66.0	64.0					6																	56480865		2203	4300	6503	SO:0001583	missense	667	exon24			TTTCTACGGGAGG	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7400G>A	6.37:g.56480865C>T	ENSP00000359801:p.Arg2467His	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	30.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000370765.6	37	CCDS4959.1	.	.	.	.	.	.	.	.	.	.	C	9.092	1.001920	0.19121	.	.	ENSG00000151914	ENST00000370765	T	0.69685	-0.42	5.94	5.94	0.96194	.	.	.	.	.	T	0.30665	0.0772	.	.	.	0.18873	N	0.999989	P	0.41929	0.765	B	0.35727	0.209	T	0.50320	-0.8842	7	0.02654	T	1	.	20.3593	0.98849	0.0:1.0:0.0:0.0	.	2467	Q03001-3	.	H	2467	ENSP00000359801:R2467H	ENSP00000359801:R2467H	R	-	2	0	DST	56588824	1.000000	0.71417	0.967000	0.41034	0.948000	0.59901	5.745000	0.68672	2.822000	0.97130	0.557000	0.71058	CGT	C|0.999;T|0.001		0.498	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
DTNA	1837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	32438291	32438291	+	Silent	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:32438291A>G	ENST00000399113.3	+	15	1494	c.1494A>G	c.(1492-1494)gaA>gaG	p.E498E	DTNA_ENST00000269191.6_Silent_p.E498E|DTNA_ENST00000591182.1_Silent_p.E146E|DTNA_ENST00000269192.7_Silent_p.E207E|DTNA_ENST00000598334.1_Silent_p.E438E|DTNA_ENST00000597674.1_Silent_p.E120E|DTNA_ENST00000597599.1_Silent_p.E438E|DTNA_ENST00000599844.1_Silent_p.E120E|DTNA_ENST00000283365.9_Silent_p.E441E|DTNA_ENST00000269190.7_Silent_p.E499E|DTNA_ENST00000595022.1_Silent_p.E438E|DTNA_ENST00000348997.5_Silent_p.E495E|DTNA_ENST00000556414.3_Silent_p.E150E|DTNA_ENST00000444659.1_Silent_p.E498E|DTNA_ENST00000399097.3_Silent_p.E146E|DTNA_ENST00000596745.1_Silent_p.E248E|DTNA_ENST00000601125.1_Silent_p.E120E|DTNA_ENST00000598774.1_Silent_p.E441E|DTNA_ENST00000399121.5_Silent_p.E438E|DTNA_ENST00000598142.1_Silent_p.E441E			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	498					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						TAGAGCATGAACAAGCTTCTC	0.522																																					p.E498E		.											.	DTNA	153	0			c.A1494G						.						66.0	64.0	65.0					18																	32438291		2203	4300	6503	SO:0001819	synonymous_variant	1837	exon15			GCATGAACAAGCT	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1494A>G	18.37:g.32438291A>G		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	42.0	NM_001390	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Silent	SNP	ENST00000399113.3	37	CCDS59311.1																																																																																			.		0.522	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
DYTN	391475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	207530732	207530732	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:207530732G>T	ENST00000452335.2	-	10	1118	c.1002C>A	c.(1000-1002)aaC>aaA	p.N334K		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	334						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CTTTGTATTGGTTTAACTGTT	0.403																																					p.N334K		.											.	DYTN	23	0			c.C1002A						.						174.0	154.0	161.0					2																	207530732		1826	4080	5906	SO:0001583	missense	391475	exon10			GTATTGGTTTAAC	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.1002C>A	2.37:g.207530732G>T	ENSP00000396593:p.Asn334Lys	Somatic	364.0	1.0		WXS	Illumina HiSeq	Phase_I	283.0	131.0	NM_001093730		Missense_Mutation	SNP	ENST00000452335.2	37	CCDS46502.1	.	.	.	.	.	.	.	.	.	.	G	8.469	0.857115	0.17106	.	.	ENSG00000232125	ENST00000452335	T	0.15718	2.4	4.89	0.962	0.19643	.	.	.	.	.	T	0.07548	0.0190	N	0.24115	0.695	0.09310	N	1	P	0.39282	0.666	B	0.33339	0.162	T	0.24119	-1.0169	9	0.22109	T	0.4	-1.6294	1.7438	0.02958	0.1824:0.162:0.4882:0.1675	.	334	A2CJ06	DYTN_HUMAN	K	334	ENSP00000396593:N334K	ENSP00000396593:N334K	N	-	3	2	DYTN	207238977	0.026000	0.19158	0.013000	0.15412	0.517000	0.34286	-0.050000	0.11904	0.061000	0.16311	0.561000	0.74099	AAC	.		0.403	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336799.1		
ERGIC3	51614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34130635	34130635	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr20:34130635C>A	ENST00000348547.2	+	4	389	c.312C>A	c.(310-312)ttC>ttA	p.F104L	ERGIC3_ENST00000279052.6_Missense_Mutation_p.F104L|ERGIC3_ENST00000357394.4_Missense_Mutation_p.F104L|ERGIC3_ENST00000447986.1_Missense_Mutation_p.F104L	NM_015966.2	NP_057050.1	Q9Y282	ERGI3_HUMAN	ERGIC and golgi 3	104					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)	16	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)			ACAACCTGTTCAAGCAACGAC	0.547																																					p.F104L		.											.	ERGIC3	585	0			c.C312A						.						147.0	112.0	124.0					20																	34130635		2203	4300	6503	SO:0001583	missense	51614	exon4			CCTGTTCAAGCAA	AF077030	CCDS13257.1, CCDS13258.1	20q11.22	2013-09-19	2006-01-19	2006-01-19	ENSG00000125991	ENSG00000125991			15927	protein-coding gene	gene with protein product			"""serologically defined breast cancer antigen 84"", ""chromosome 20 open reading frame 47"""	SDBCAG84, C20orf47		10810093	Standard	NM_015966		Approved	CGI-54, PRO0989, NY-BR-84, Erv46	uc002xcs.3	Q9Y282	OTTHUMG00000032346	ENST00000348547.2:c.312C>A	20.37:g.34130635C>A	ENSP00000341358:p.Phe104Leu	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	53.0	NM_015966	Q5JWS3|Q6ZWP7|Q9H276|Q9P1L3	Missense_Mutation	SNP	ENST00000348547.2	37	CCDS13257.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	15.41|15.41|15.41	2.824972|2.824972|2.824972	0.50739|0.50739|0.50739	.|.|.	.|.|.	ENSG00000125991|ENSG00000125991|ENSG00000125991	ENST00000348547;ENST00000357394;ENST00000447986;ENST00000279052;ENST00000411577|ENST00000413587|ENST00000416206	T;T;T;T;T|.|.	0.42513|.|.	0.98;0.99;0.97;0.98;0.97|.|.	5.25|5.25|5.25	1.22|1.22|1.22	0.21188|0.21188|0.21188	.|.|.	0.050723|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.53769|0.53769|.	0.1817|0.1817|.	L|L|L	0.45422|0.45422|0.45422	1.42|1.42|1.42	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;B;B;B;B;B|.|.	0.09022|.|.	0.002;0.002;0.001;0.001;0.001;0.001|.|.	B;B;B;B;B;B|.|.	0.19148|.|.	0.008;0.024;0.003;0.006;0.008;0.003|.|.	T|T|.	0.41822|0.41822|.	-0.9487|-0.9487|.	10|5|.	0.17369|.|.	T|.|.	0.5|.|.	-18.1001|-18.1001|-18.1001	9.7158|9.7158|9.7158	0.40274|0.40274|0.40274	0.0:0.6255:0.0:0.3745|0.0:0.6255:0.0:0.3745|0.0:0.6255:0.0:0.3745	.|.|.	104;104;104;104;104;104|.|.	B4DV36;E9PFA8;Q9Y282;Q9Y282-3;Q9Y282-2;A2TJK5|.|.	.;.;ERGI3_HUMAN;.;.;.|.|.	L|K|X	104;104;104;104;98|106|103	ENSP00000341358:F104L;ENSP00000349970:F104L;ENSP00000392341:F104L;ENSP00000279052:F104L;ENSP00000414490:F98L|.|.	ENSP00000279052:F104L|.|.	F|Q|S	+|+|+	3|1|2	2|0|0	ERGIC3|ERGIC3|ERGIC3	33594049|33594049|33594049	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.902000|0.902000|0.902000	0.53008|0.53008|0.53008	0.774000|0.774000|0.774000	0.26675|0.26675|0.26675	0.098000|0.098000|0.098000	0.17522|0.17522|0.17522	-0.680000|-0.680000|-0.680000	0.03767|0.03767|0.03767	TTC|CAA|TCA	.		0.547	ERGIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078880.2	NM_015966	
FAM207A	85395	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	46396679	46396679	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr21:46396679G>A	ENST00000291634.6	+	6	702	c.654G>A	c.(652-654)ctG>ctA	p.L218L	FAM207A_ENST00000479127.1_3'UTR|FAM207A_ENST00000397826.3_Silent_p.L203L	NM_058190.2	NP_478070.1	Q9NSI2	F207A_HUMAN	family with sequence similarity 207, member A	218																	GGCAGACGCTGGCCCGGCAGA	0.647																																					p.L218L		.											.	.	.	0			c.G654A						.						9.0	10.0	10.0					21																	46396679		2151	4226	6377	SO:0001819	synonymous_variant	85395	exon6			GACGCTGGCCCGG		CCDS13718.1	21q22.3	2011-08-15	2011-08-15	2011-08-15	ENSG00000160256	ENSG00000160256			15811	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 70"""	C21orf70			Standard	NM_058190		Approved	PRED56	uc002zgl.3	Q9NSI2	OTTHUMG00000090293	ENST00000291634.6:c.654G>A	21.37:g.46396679G>A		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	7.0	NM_058190		Silent	SNP	ENST00000291634.6	37	CCDS13718.1																																																																																			.		0.647	FAM207A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206639.1	NM_058190	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39357273	39357273	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr13:39357273C>T	ENST00000280481.7	+	5	5924	c.5708C>T	c.(5707-5709)cCc>cTc	p.P1903L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1903	Calx-beta 2.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CTGTTCATTCCCATCAGGAGG	0.438																																					p.P1903L		.											.	FREM2	100	0			c.C5708T						.						208.0	192.0	198.0					13																	39357273		2203	4300	6503	SO:0001583	missense	341640	exon5			TCATTCCCATCAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5708C>T	13.37:g.39357273C>T	ENSP00000280481:p.Pro1903Leu	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	120.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954021	0.73902	.	.	ENSG00000150893	ENST00000280481	T	0.27557	1.66	5.84	5.84	0.93424	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	M	0.78916	2.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62539	-0.6833	10	0.87932	D	0	.	20.1336	0.98010	0.0:1.0:0.0:0.0	.	1903	Q5SZK8	FREM2_HUMAN	L	1903	ENSP00000280481:P1903L	ENSP00000280481:P1903L	P	+	2	0	FREM2	38255273	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	7.811000	0.86092	2.751000	0.94390	0.514000	0.50259	CCC	.		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FSTL4	23105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	132534838	132534838	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:132534838C>G	ENST00000265342.7	-	16	2727	c.2478G>C	c.(2476-2478)gaG>gaC	p.E826D	CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	826						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TACCTGACACCTCACACCGCA	0.577																																					p.E826D		.											.	FSTL4	91	0			c.G2478C						.						68.0	65.0	66.0					5																	132534838		2203	4300	6503	SO:0001583	missense	23105	exon16			TGACACCTCACAC	AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.2478G>C	5.37:g.132534838C>G	ENSP00000265342:p.Glu826Asp	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	25.0	NM_015082	Q8TBU0|Q9UPU1	Missense_Mutation	SNP	ENST00000265342.7	37	CCDS34238.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455853	0.63401	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.62364	0.03	5.24	5.24	0.73138	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.75867	0.3908	M	0.82323	2.585	0.80722	D	1	D;D	0.63046	0.962;0.992	P;P	0.53224	0.611;0.721	T	0.80817	-0.1213	10	0.72032	D	0.01	-33.8418	17.4006	0.87459	0.0:1.0:0.0:0.0	.	826;475	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	D	826;657	ENSP00000265342:E826D	ENSP00000265342:E826D	E	-	3	2	FSTL4	132562737	1.000000	0.71417	1.000000	0.80357	0.224000	0.24922	4.688000	0.61715	2.446000	0.82766	0.650000	0.86243	GAG	.		0.577	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370212.1	XM_048786	
GAREM	64762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	29890226	29890226	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:29890226C>A	ENST00000269209.6	-	3	326	c.323G>T	c.(322-324)aGt>aTt	p.S108I	GAREM_ENST00000399218.4_Missense_Mutation_p.S108I|GAREM_ENST00000578619.1_5'UTR			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	108	CABIT.				cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CTCCTCCACACTGTTGAAATA	0.418																																					p.S108I		.											.	.	.	0			c.G323T						.						244.0	210.0	221.0					18																	29890226		2203	4300	6503	SO:0001583	missense	64762	exon3			TCCACACTGTTGA	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.323G>T	18.37:g.29890226C>A	ENSP00000269209:p.Ser108Ile	Somatic	275.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	50.0	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	C	33	5.224369	0.95139	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.20332	2.08;2.08	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.51568	0.1682	M	0.77616	2.38	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.52480	-0.8570	10	0.87932	D	0	-16.913	19.9625	0.97256	0.0:1.0:0.0:0.0	.	108;108	Q9H706;Q9H706-3	FA59A_HUMAN;.	I	108	ENSP00000382165:S108I;ENSP00000269209:S108I	ENSP00000269209:S108I	S	-	2	0	FAM59A	28144224	1.000000	0.71417	0.982000	0.44146	0.991000	0.79684	7.420000	0.80191	2.726000	0.93360	0.655000	0.94253	AGT	.		0.418	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
GEMIN4	50628	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	648872	648872	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:648872T>C	ENST00000319004.5	-	2	2529	c.2411A>G	c.(2410-2412)cAg>cGg	p.Q804R	GEMIN4_ENST00000576778.1_Missense_Mutation_p.Q793R	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	804					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		TGGGTGGGCCTGGGAGGTCCA	0.602																																					p.Q804R		.											.	GEMIN4	206	0			c.A2411G						.						15.0	17.0	17.0					17																	648872		1948	4132	6080	SO:0001583	missense	50628	exon2			TGGGCCTGGGAGG	AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.2411A>G	17.37:g.648872T>C	ENSP00000321706:p.Gln804Arg	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	25.0	NM_015721	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	ENST00000319004.5	37	CCDS45559.1	.	.	.	.	.	.	.	.	.	.	T	2.400	-0.337725	0.05278	.	.	ENSG00000179409	ENST00000319004	T	0.05649	3.41	5.83	4.76	0.60689	.	0.287100	0.33438	N	0.004910	T	0.04907	0.0132	L	0.43152	1.355	0.80722	D	1	B	0.11235	0.004	B	0.14578	0.011	T	0.24512	-1.0158	10	0.06494	T	0.89	-16.1357	5.9518	0.19250	0.1467:0.0762:0.0:0.7771	.	804	P57678	GEMI4_HUMAN	R	804	ENSP00000321706:Q804R	ENSP00000321706:Q804R	Q	-	2	0	GEMIN4	595622	0.918000	0.31147	1.000000	0.80357	0.931000	0.56810	0.996000	0.29719	2.235000	0.73313	0.533000	0.62120	CAG	.		0.602	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437181.1	NM_015721	
GPR151	134391	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	145895523	145895523	+	Missense_Mutation	SNP	C	C	T	rs181265546	byFrequency	TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:145895523C>T	ENST00000311104.2	-	1	230	c.154G>A	c.(154-156)Gtg>Atg	p.V52M		NM_194251.2	NP_919227.2	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(2)	14			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGTTTCCCACGAAGCCCACC	0.552													C|||	3	0.000599042	0.0	0.0	5008	,	,		19817	0.0		0.0	False		,,,				2504	0.0031				p.V52M	Pancreas(78;420 1386 18535 37114 49710)	.											.	GPR151	92	0			c.G154A						.						105.0	104.0	104.0					5																	145895523		2203	4300	6503	SO:0001583	missense	134391	exon1			TTCCCACGAAGCC	AY255557	CCDS34266.1	5q32	2012-08-21						"""GPCR / Class A : Orphans"""	23624	protein-coding gene	gene with protein product	"""galanin receptor 4"""					12679517	Standard	NM_194251		Approved	PGR7, GALR4	uc003lod.1	Q8TDV0		ENST00000311104.2:c.154G>A	5.37:g.145895523C>T	ENSP00000308733:p.Val52Met	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	17.0	NM_194251	Q86SN8|Q8NGV2	Missense_Mutation	SNP	ENST00000311104.2	37	CCDS34266.1	.	.	.	.	.	.	.	.	.	.	C	11.11	1.542848	0.27563	.	.	ENSG00000173250	ENST00000311104	T	0.40225	1.04	5.99	0.66	0.17868	.	0.400813	0.25798	N	0.028236	T	0.31482	0.0798	L	0.54323	1.7	0.27329	N	0.956834	B	0.23806	0.091	B	0.17098	0.017	T	0.15983	-1.0418	10	0.37606	T	0.19	.	6.1039	0.20063	0.0:0.5202:0.2451:0.2347	.	52	Q8TDV0	GP151_HUMAN	M	52	ENSP00000308733:V52M	ENSP00000308733:V52M	V	-	1	0	GPR151	145875716	0.897000	0.30589	0.995000	0.50966	0.984000	0.73092	0.005000	0.13129	0.031000	0.15407	-0.345000	0.07892	GTG	C|0.999;G|0.000		0.552	GPR151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373457.1	NM_194251	
GRIN3A	116443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104449365	104449365	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:104449365C>A	ENST00000361820.3	-	2	1417	c.817G>T	c.(817-819)Gac>Tac	p.D273Y		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	273					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ATGTTCCAGTCTTCCTGGCAC	0.448																																					p.D273Y		.											.	GRIN3A	96	0			c.G817T						.						134.0	122.0	126.0					9																	104449365		2203	4300	6503	SO:0001583	missense	116443	exon2			TCCAGTCTTCCTG		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.817G>T	9.37:g.104449365C>A	ENSP00000355155:p.Asp273Tyr	Somatic	258.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	77.0	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670461	0.67814	.	.	ENSG00000198785	ENST00000361820	D	0.88896	-2.44	5.82	5.82	0.92795	.	0.350421	0.31821	N	0.007002	D	0.84897	0.5574	L	0.44542	1.39	0.58432	D	0.999999	P	0.34780	0.468	B	0.32864	0.154	T	0.81693	-0.0817	10	0.11182	T	0.66	.	20.1178	0.97943	0.0:1.0:0.0:0.0	.	273	Q8TCU5	NMD3A_HUMAN	Y	273	ENSP00000355155:D273Y	ENSP00000355155:D273Y	D	-	1	0	GRIN3A	103489186	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.495000	0.66912	2.759000	0.94783	0.557000	0.71058	GAC	.		0.448	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
GRM1	2911	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	146755325	146755325	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:146755325C>T	ENST00000282753.1	+	8	3213	c.2978C>T	c.(2977-2979)tCc>tTc	p.S993F	GRM1_ENST00000392299.2_3'UTR|GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000361719.2_Missense_Mutation_p.S993F			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	993			S -> P (in dbSNP:rs6923492). {ECO:0000269|PubMed:7476890, ECO:0000269|PubMed:9076744}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CCTCTGCCGTCCCACCTGACC	0.687																																					p.S993F		.											.	GRM1	1080	0			c.C2978T						.						55.0	65.0	61.0					6																	146755325		2203	4300	6503	SO:0001583	missense	2911	exon9			TGCCGTCCCACCT	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.2978C>T	6.37:g.146755325C>T	ENSP00000282753:p.Ser993Phe	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	11.0	NM_000838	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	8.839	0.941832	0.18281	.	.	ENSG00000152822	ENST00000361719;ENST00000282753	D;D	0.88431	-2.38;-2.38	5.38	4.51	0.55191	.	0.585264	0.18293	N	0.145675	T	0.65595	0.2706	N	0.08118	0	0.29859	N	0.827801	B	0.12630	0.006	B	0.11329	0.006	T	0.60865	-0.7178	10	0.59425	D	0.04	.	11.9603	0.53005	0.0:0.811:0.189:0.0	.	993	Q13255	GRM1_HUMAN	F	993	ENSP00000354896:S993F;ENSP00000282753:S993F	ENSP00000282753:S993F	S	+	2	0	GRM1	146797018	0.000000	0.05858	0.897000	0.35233	0.582000	0.36321	0.460000	0.21924	1.245000	0.43885	0.313000	0.20887	TCC	.		0.687	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
GSDMC	56169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	130777987	130777987	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:130777987C>G	ENST00000276708.4	-	4	1338	c.457G>C	c.(457-459)Gac>Cac	p.D153H		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	153						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						TACAGGTTGTCCCCTCTCCTC	0.468																																					p.D153H		.											.	GSDMC	93	0			c.G457C						.						96.0	88.0	91.0					8																	130777987		2203	4300	6503	SO:0001583	missense	56169	exon4			GGTTGTCCCCTCT	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.457G>C	8.37:g.130777987C>G	ENSP00000276708:p.Asp153His	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	18.0	NM_031415	Q5XKF3|Q6P494	Missense_Mutation	SNP	ENST00000276708.4	37	CCDS6360.1	.	.	.	.	.	.	.	.	.	.	C	9.544	1.114025	0.20795	.	.	ENSG00000147697	ENST00000276708	T	0.26660	1.72	4.51	0.607	0.17564	.	1.441670	0.04076	N	0.308803	T	0.22936	0.0554	L	0.39147	1.195	0.09310	N	1	B	0.30068	0.267	B	0.30646	0.118	T	0.27938	-1.0059	10	0.46703	T	0.11	.	6.3838	0.21550	0.0:0.5506:0.0:0.4494	.	153	Q9BYG8	GSDMC_HUMAN	H	153	ENSP00000276708:D153H	ENSP00000276708:D153H	D	-	1	0	GSDMC	130847169	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.393000	0.07305	-0.071000	0.12886	0.591000	0.81541	GAC	.		0.468	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380586.1		
HGD	3081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	120365198	120365198	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:120365198T>A	ENST00000283871.5	-	9	1024	c.565A>T	c.(565-567)Agc>Tgc	p.S189C		NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	189			S -> I (in AKU). {ECO:0000269|PubMed:9529363}.		cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		ACATCTATGCTGAACCGCATT	0.478																																					p.S189C		.											.	HGD	68	0			c.A565T						.						109.0	101.0	104.0					3																	120365198		2203	4300	6503	SO:0001583	missense	3081	exon9			CTATGCTGAACCG		CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.565A>T	3.37:g.120365198T>A	ENSP00000283871:p.Ser189Cys	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	20.0	NM_000187	A8K417|B2R8Z0	Missense_Mutation	SNP	ENST00000283871.5	37	CCDS3000.1	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483529	0.63962	.	.	ENSG00000113924	ENST00000283871	D	0.99042	-5.36	5.91	5.91	0.95273	Cupin, RmlC-type (1);	0.078065	0.85682	D	0.000000	D	0.98359	0.9455	L	0.61036	1.89	0.80722	D	1	P	0.38800	0.648	P	0.45138	0.471	D	0.99019	1.0817	10	0.66056	D	0.02	-20.7815	14.2973	0.66321	0.0:0.0:0.0:1.0	.	189	Q93099	HGD_HUMAN	C	189	ENSP00000283871:S189C	ENSP00000283871:S189C	S	-	1	0	HGD	121847888	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.173000	0.77612	2.261000	0.74972	0.533000	0.62120	AGC	.		0.478	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355410.1		
HIBCH	26275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	191155206	191155206	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:191155206A>C	ENST00000359678.5	-	5	604	c.310T>G	c.(310-312)Tcg>Gcg	p.S104A	HIBCH_ENST00000392332.3_Missense_Mutation_p.S104A	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	104					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			TCAGCTTCCGAGATCACTAGG	0.323																																					p.S104A		.											.	HIBCH	90	0			c.T310G						.						72.0	68.0	70.0					2																	191155206		2203	4300	6503	SO:0001583	missense	26275	exon5			CTTCCGAGATCAC	U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.310T>G	2.37:g.191155206A>C	ENSP00000352706:p.Ser104Ala	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	58.0	NM_014362	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	37	CCDS2304.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.494319	0.01009	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.70282	-0.14;-0.47;-0.14	5.42	-0.0735	0.13735	Crotonase, core (1);	.	.	.	.	T	0.33381	0.0861	N	0.01289	-0.905	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.38564	-0.9655	9	0.05620	T	0.96	0.7649	9.0984	0.36653	0.3045:0.5681:0.0:0.1274	.	104;104	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	A	104;104;158	ENSP00000376144:S104A;ENSP00000352706:S104A;ENSP00000387247:S158A	ENSP00000352706:S104A	S	-	1	0	HIBCH	190863451	0.985000	0.35326	0.903000	0.35520	0.007000	0.05969	0.560000	0.23500	0.111000	0.17947	-0.461000	0.05368	TCG	.		0.323	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1		
HIST1H3F	8968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26250628	26250628	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:26250628T>C	ENST00000446824.2	-	1	207	c.206A>G	c.(205-207)cAg>cGg	p.Q69R	HIST1H2BH_ENST00000356350.2_5'Flank	NM_021018.2	NP_066298.1	P68431	H31_HUMAN	histone cluster 1, H3f	69					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			lung(6)|urinary_tract(1)	7						TACCAGACGCTGGAATGGTAG	0.597											OREG0017241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q69R		.											.	HIST1H3F	68	0			c.A206G						.						124.0	123.0	123.0					6																	26250628		2203	4300	6503	SO:0001583	missense	8968	exon1			AGACGCTGGAATG	Z80786	CCDS4600.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000256316	ENSG00000277775		"""Histones / Replication-dependent"""	4773	protein-coding gene	gene with protein product		602816	"""H3 histone family, member I"", ""histone 1, H3f"""	H3FI		9119399, 12408966	Standard	NM_021018		Approved	H3/i	uc003nhg.1	P68431	OTTHUMG00000014435	ENST00000446824.2:c.206A>G	6.37:g.26250628T>C	ENSP00000444823:p.Gln69Arg	Somatic	191.0	1.0	785	WXS	Illumina HiSeq	Phase_I	194.0	104.0	NM_021018	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000446824.2	37	CCDS4600.1	.	.	.	.	.	.	.	.	.	.	.	15.60	2.880807	0.51801	.	.	ENSG00000256316	ENST00000446824	T	0.67171	-0.25	4.82	4.82	0.62117	.	.	.	.	.	T	0.71273	0.3320	.	.	.	0.39988	D	0.975005	.	.	.	.	.	.	T	0.76639	-0.2885	6	0.87932	D	0	.	14.2481	0.66001	0.0:0.0:0.0:1.0	.	.	.	.	R	69	ENSP00000444823:Q69R	ENSP00000444823:Q69R	Q	-	2	0	HIST1H3F	26358607	1.000000	0.71417	1.000000	0.80357	0.299000	0.27559	6.007000	0.70731	2.103000	0.63969	0.459000	0.35465	CAG	.		0.597	HIST1H3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040098.1	NM_021018	
HOXC4	3221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54447739	54447739	+	Missense_Mutation	SNP	C	C	A	rs377491433		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:54447739C>A	ENST00000430889.2	+	1	79	c.33C>A	c.(31-33)aaC>aaA	p.N11K	HOXC4_ENST00000303406.4_Missense_Mutation_p.N11K|HOXC4_ENST00000609810.1_Missense_Mutation_p.N11K	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	11					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						TGGACTCTAACTACATCGATC	0.423																																					p.N11K		.											.	HOXC4	91	0			c.C33A						.						97.0	96.0	96.0					12																	54447739		2203	4300	6503	SO:0001583	missense	3221	exon3			CTCTAACTACATC		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.33C>A	12.37:g.54447739C>A	ENSP00000399808:p.Asn11Lys	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	20.0	NM_014620		Missense_Mutation	SNP	ENST00000430889.2	37	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960162	0.34565	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	T;T	0.55234	0.53;0.53	3.41	3.41	0.39046	.	0.055508	0.64402	D	0.000002	T	0.62368	0.2422	L	0.46819	1.47	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	T	0.57929	-0.7726	10	0.23302	T	0.38	.	14.7795	0.69754	0.0:1.0:0.0:0.0	.	11	P09017	HXC4_HUMAN	K	11	ENSP00000305973:N11K;ENSP00000399808:N11K	ENSP00000305973:N11K	N	+	3	2	HOXC4	52734006	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.319000	0.43788	2.187000	0.69744	0.462000	0.41574	AAC	.		0.423	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1		
HRH4	59340	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	22057509	22057509	+	Silent	SNP	C	C	A	rs115905515	byFrequency	TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:22057509C>A	ENST00000256906.4	+	3	1256	c.1156C>A	c.(1156-1158)Cgg>Agg	p.R386R	HRH4_ENST00000426880.2_Silent_p.R298R	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	386					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	ACAACACAGTCGGTCAGTATC	0.358																																					p.R386R		.											.	HRH4	92	0			c.C1156A						.						48.0	49.0	48.0					18																	22057509		2203	4298	6501	SO:0001819	synonymous_variant	59340	exon3			CACAGTCGGTCAG	AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.1156C>A	18.37:g.22057509C>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	30.0	NM_021624	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Silent	SNP	ENST00000256906.4	37	CCDS11887.1																																																																																			C|0.998;T|0.002		0.358	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254904.1		
HSPA1L	3305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31777908	31777908	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:31777908T>C	ENST00000375654.4	-	2	2031	c.1842A>G	c.(1840-1842)caA>caG	p.Q614Q	HSPA1L_ENST00000417199.3_Silent_p.Q614Q	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	614					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TGCATCCTCCTTGGTAGAGTT	0.473																																					p.Q614Q		.											.	HSPA1L	230	0			c.A1842G						.						114.0	104.0	107.0					6																	31777908		2203	4300	6503	SO:0001819	synonymous_variant	3305	exon2			TCCTCCTTGGTAG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1842A>G	6.37:g.31777908T>C		Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	413.0	120.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Silent	SNP	ENST00000375654.4	37	CCDS34413.1																																																																																			.		0.473	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
IDE	3416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	94225544	94225544	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:94225544T>C	ENST00000265986.6	-	20	2433	c.2377A>G	c.(2377-2379)Ata>Gta	p.I793V	IDE_ENST00000371581.5_Missense_Mutation_p.I238V|IDE_ENST00000496903.1_5'UTR	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	793					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TGGTAGTATATCTCGATGCCA	0.408																																					p.I793V		.											.	IDE	92	0			c.A2377G						.						184.0	168.0	174.0					10																	94225544		2203	4300	6503	SO:0001583	missense	3416	exon20			AGTATATCTCGAT	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2377A>G	10.37:g.94225544T>C	ENSP00000265986:p.Ile793Val	Somatic	282.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	53.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	2.951	-0.216720	0.06101	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.08193	3.12;3.12	6.02	6.02	0.97574	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.03959	0.0111	N	0.02247	-0.625	0.80722	D	1	B;B	0.18013	0.008;0.025	B;B	0.25987	0.015;0.065	T	0.29088	-1.0023	10	0.02654	T	1	-16.6034	16.5494	0.84464	0.0:0.0:0.0:1.0	.	793;238	P14735;B3KSB8	IDE_HUMAN;.	V	793;238	ENSP00000265986:I793V;ENSP00000360637:I238V	ENSP00000265986:I793V	I	-	1	0	IDE	94215524	1.000000	0.71417	0.985000	0.45067	0.187000	0.23431	7.803000	0.85983	2.299000	0.77371	0.528000	0.53228	ATA	.		0.408	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
IL1RAPL2	26280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	105011223	105011223	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrX:105011223T>C	ENST00000372582.1	+	11	2386	c.1630T>C	c.(1630-1632)Tta>Cta	p.L544L	IL1RAPL2_ENST00000344799.4_Silent_p.L544L	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	544	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AAGCAGCAAATTAAATTCTAA	0.408																																					p.L544L		.											.	IL1RAPL2	194	0			c.T1630C						.						102.0	110.0	107.0					X																	105011223		2203	4300	6503	SO:0001819	synonymous_variant	26280	exon11			AGCAAATTAAATT	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1630T>C	X.37:g.105011223T>C		Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	109.0	NM_017416	Q2M3U3|Q9NZN0	Silent	SNP	ENST00000372582.1	37	CCDS14517.1																																																																																			.		0.408	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
IDH3G	3421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153055245	153055245	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chrX:153055245G>A	ENST00000217901.5	-	5	464	c.268C>T	c.(268-270)Cac>Tac	p.H90Y	IDH3G_ENST00000497043.1_5'UTR|IDH3G_ENST00000427365.2_Missense_Mutation_p.H32Y|IDH3G_ENST00000370092.3_Missense_Mutation_p.H90Y|IDH3G_ENST00000370093.1_Missense_Mutation_p.H90Y	NM_004135.3	NP_004126.1	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma	90					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)	17	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GAACTCACGTGCACCTCTTCA	0.647																																					p.H90Y		.											.	IDH3G	90	0			c.C268T						.						86.0	59.0	68.0					X																	153055245		2202	4298	6500	SO:0001583	missense	3421	exon5			TCACGTGCACCTC		CCDS14730.1, CCDS44019.1	Xq28	2008-02-05			ENSG00000067829	ENSG00000067829	1.1.1.41		5386	protein-coding gene	gene with protein product		300089				9286695	Standard	NM_004135		Approved		uc004fip.4	P51553	OTTHUMG00000024219	ENST00000217901.5:c.268C>T	X.37:g.153055245G>A	ENSP00000217901:p.His90Tyr	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	12.0	NM_004135	E9PDD5|Q9BUU5	Missense_Mutation	SNP	ENST00000217901.5	37	CCDS14730.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384208	0.61845	.	.	ENSG00000067829	ENST00000370092;ENST00000217901;ENST00000370093;ENST00000427365;ENST00000444450;ENST00000444338	T;T;T;T;T;T	0.66280	0.64;0.64;0.64;0.64;0.64;-0.2	5.34	5.34	0.76211	Isopropylmalate dehydrogenase-like domain (2);	0.281987	0.39020	N	0.001489	T	0.38825	0.1055	N	0.12569	0.235	0.26986	N	0.965255	P;B	0.34800	0.469;0.137	B;B	0.27380	0.079;0.035	T	0.25882	-1.0119	10	0.21014	T	0.42	.	12.0109	0.53286	0.0:0.0:0.8271:0.1729	.	90;90	E9PDD5;P51553	.;IDH3G_HUMAN	Y	90;90;90;32;67;1	ENSP00000359110:H90Y;ENSP00000217901:H90Y;ENSP00000359111:H90Y;ENSP00000408529:H32Y;ENSP00000401862:H67Y;ENSP00000402747:H1Y	ENSP00000217901:H90Y	H	-	1	0	IDH3G	152708439	0.965000	0.33210	1.000000	0.80357	0.955000	0.61496	3.048000	0.49862	2.238000	0.73509	0.529000	0.55759	CAC	.		0.647	IDH3G-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061084.27		
IRX1	79192	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	3599577	3599577	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:3599577C>A	ENST00000302006.3	+	2	567	c.515C>A	c.(514-516)aCg>aAg	p.T172K	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	172					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						ATGACCCTCACGCAGGTCTCC	0.617																																					p.T172K		.											.	IRX1	228	0			c.C515A						.						154.0	119.0	131.0					5																	3599577		2203	4300	6503	SO:0001583	missense	79192	exon2			CCCTCACGCAGGT	U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.515C>A	5.37:g.3599577C>A	ENSP00000305244:p.Thr172Lys	Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	116.0	NM_024337	Q7Z2F8|Q8N312	Missense_Mutation	SNP	ENST00000302006.3	37	CCDS34132.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.936665	0.92458	.	.	ENSG00000170549	ENST00000302006	D	0.90324	-2.65	4.81	4.81	0.61882	Homeodomain-related (1);Homeobox (2);Homeobox KN domain (1);Homeodomain-like (1);Homeobox, conserved site (1);	0.049539	0.85682	D	0.000000	D	0.92280	0.7551	L	0.36672	1.1	0.80722	D	1	D	0.54964	0.969	P	0.62560	0.904	D	0.93527	0.6866	10	0.87932	D	0	-25.1634	17.5082	0.87753	0.0:1.0:0.0:0.0	.	172	P78414	IRX1_HUMAN	K	172	ENSP00000305244:T172K	ENSP00000305244:T172K	T	+	2	0	IRX1	3652577	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.547000	0.82146	2.173000	0.68751	0.655000	0.94253	ACG	.		0.617	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365546.1	NM_024337	
ITGAX	3687	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31372494	31372494	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:31372494T>C	ENST00000268296.4	+	9	1093	c.972T>C	c.(970-972)gaT>gaC	p.D324D	ITGAX_ENST00000562522.1_Silent_p.D324D	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	324	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						CTCTGAAAGATATTCAAAACC	0.418																																					p.D324D		.											.	ITGAX	229	0			c.T972C						.						125.0	134.0	131.0					16																	31372494		2197	4300	6497	SO:0001819	synonymous_variant	3687	exon9			GAAAGATATTCAA	BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.972T>C	16.37:g.31372494T>C		Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	65.0	NM_000887	Q8IVA6	Silent	SNP	ENST00000268296.4	37	CCDS10711.1																																																																																			.		0.418	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255628.2	NM_000887	
JMJD7	100137047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42126945	42126945	+	Silent	SNP	C	C	T	rs140704362		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr15:42126945C>T	ENST00000397299.4	+	2	112	c.72C>T	c.(70-72)tgC>tgT	p.C24C	PLA2G4B_ENST00000542534.2_Silent_p.C24C|JMJD7_ENST00000408047.1_Intron|JMJD7-PLA2G4B_ENST00000382448.4_Silent_p.C24C|JMJD7_ENST00000405106.2_3'UTR|JMJD7-PLA2G4B_ENST00000342159.4_Silent_p.C24C	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	24										NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						CAGAGCTCTGCGTGCCTCTTG	0.612													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18617	0.0		0.0	False		,,,				2504	0.0				p.C24C		.											.	JMJD7-PLA2G4B	135	0			c.C72T						.	C	,,	2,4404		0,2,2201	126.0	127.0	127.0		72,72,72	-8.2	0.1	15	dbSNP_134	127	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	JMJD7-PLA2G4B,JMJD7	NM_001114632.1,NM_001198588.1,NM_005090.3	,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,	24/317,24/894,24/1013	42126945	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8681	exon2			GCTCTGCGTGCCT		CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.72C>T	15.37:g.42126945C>T		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	17.0	NM_005090	A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Silent	SNP	ENST00000397299.4	37	CCDS45240.1																																																																																			C|1.000;T|0.000		0.612	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326082.1	NM_001114632	
KCNC4	3749	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	110775555	110775555	+	3'UTR	SNP	G	G	A	rs374236746		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:110775555G>A	ENST00000369787.3	+	0	2559				KCNC4_ENST00000413138.3_3'UTR|KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Silent_p.S614S	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		ACGCCCTCTCGTCCAACTATG	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		19127	0.0		0.0	False		,,,				2504	0.001				p.S614S		.											.	KCNC4	154	0			c.G1842A						.	G	,	0,3982		0,0,1991	60.0	63.0	62.0		1842,	2.4	1.0	1		62	1,8313		0,1,4156	no	coding-synonymous,utr-3	KCNC4	NM_001039574.2,NM_004978.4	,	0,1,6147	AA,AG,GG		0.012,0.0,0.0081	,	614/627,	110775555	1,12295	1991	4157	6148	SO:0001624	3_prime_UTR_variant	3749	exon4			CCTCTCGTCCAAC	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.*624G>A	1.37:g.110775555G>A		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	25.0	NM_001039574	Q3MIM4|Q5TBI6	Silent	SNP	ENST00000369787.3	37	CCDS821.1																																																																																			.		0.562	KCNC4-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052146.2	NM_001039574	
KCNJ3	3760	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	155555841	155555841	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:155555841C>A	ENST00000295101.2	+	1	1031	c.554C>A	c.(553-555)tCc>tAc	p.S185Y	KCNJ3_ENST00000544049.1_Missense_Mutation_p.S185Y|AC061961.2_ENST00000443901.1_RNA	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	185					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	ATCAAGATGTCCCAGCCCAAG	0.587																																					p.S185Y		.											.	KCNJ3	92	0			c.C554A						.						77.0	67.0	70.0					2																	155555841		2203	4300	6503	SO:0001583	missense	3760	exon1			AGATGTCCCAGCC	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.554C>A	2.37:g.155555841C>A	ENSP00000295101:p.Ser185Tyr	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	17.0	NM_001260509	B4DEW7|Q8TBI0	Missense_Mutation	SNP	ENST00000295101.2	37	CCDS2200.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.105048	0.77096	.	.	ENSG00000162989	ENST00000295101;ENST00000544049	D;D	0.94793	-3.52;-3.52	5.41	5.41	0.78517	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98185	0.9400	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99391	1.0925	10	0.87932	D	0	.	17.7563	0.88450	0.0:1.0:0.0:0.0	.	185;185	B4DEW7;P48549	.;IRK3_HUMAN	Y	185	ENSP00000295101:S185Y;ENSP00000438410:S185Y	ENSP00000295101:S185Y	S	+	2	0	KCNJ3	155264087	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.035000	0.70940	2.537000	0.85549	0.561000	0.74099	TCC	.		0.587	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
KIAA1407	57577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113737618	113737618	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:113737618A>T	ENST00000295878.3	-	8	1216	c.1070T>A	c.(1069-1071)cTg>cAg	p.L357Q	KIAA1407_ENST00000545063.1_Missense_Mutation_p.L188Q	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	357										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CAGGACCTTCAGCTGAATCTT	0.488																																					p.L357Q		.											.	KIAA1407	92	0			c.T1070A						.						209.0	218.0	215.0					3																	113737618		2203	4300	6503	SO:0001583	missense	57577	exon8			ACCTTCAGCTGAA	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1070T>A	3.37:g.113737618A>T	ENSP00000295878:p.Leu357Gln	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	16.0	NM_020817	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	37	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588477	0.66105	.	.	ENSG00000163617	ENST00000295878;ENST00000545063;ENST00000491000	T;T;T	0.68181	0.82;-0.31;0.26	5.76	5.76	0.90799	.	0.160773	0.42964	D	0.000623	T	0.73393	0.3581	L	0.58810	1.83	0.80722	D	1	P;D;D	0.60575	0.952;0.988;0.988	P;P;P	0.56398	0.678;0.797;0.797	T	0.74572	-0.3621	10	0.48119	T	0.1	.	12.3312	0.55041	0.8737:0.0:0.0:0.1263	.	344;233;357	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	Q	357;188;344	ENSP00000295878:L357Q;ENSP00000446381:L188Q;ENSP00000418099:L344Q	ENSP00000295878:L357Q	L	-	2	0	KIAA1407	115220308	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.828000	0.55753	2.201000	0.70794	0.533000	0.62120	CTG	.		0.488	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
KLF16	83855	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	1863102	1863102	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:1863102G>A	ENST00000250916.4	-	1	465	c.395C>T	c.(394-396)cCg>cTg	p.P132L	KLF16_ENST00000592313.1_5'Flank|CTB-31O20.8_ENST00000586694.1_RNA	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	132					dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCGCAGTCCGGGAAGGGACA	0.741																																					p.P132L		.											.	KLF16	90	0			c.C395T						.						17.0	17.0	17.0					19																	1863102		2174	4263	6437	SO:0001583	missense	83855	exon1			CAGTCCGGGAAGG	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.395C>T	19.37:g.1863102G>A	ENSP00000250916:p.Pro132Leu	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	5.0	NM_031918		Missense_Mutation	SNP	ENST00000250916.4	37	CCDS12075.1	.	.	.	.	.	.	.	.	.	.	g	20.6	4.011973	0.75046	.	.	ENSG00000129911	ENST00000250916;ENST00000541015	D;D	0.94232	-3.38;-3.38	1.14	-2.29	0.06805	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.90147	0.6921	L	0.60455	1.87	0.32341	N	0.559794	D	0.60160	0.987	P	0.47015	0.534	D	0.85829	0.1390	9	0.32370	T	0.25	.	6.3787	0.21521	0.0:0.0:0.5093:0.4906	.	132	Q9BXK1	KLF16_HUMAN	L	132	ENSP00000250916:P132L;ENSP00000439973:P132L	ENSP00000250916:P132L	P	-	2	0	KLF16	1814102	0.001000	0.12720	0.283000	0.24790	0.868000	0.49771	0.087000	0.14958	-0.619000	0.05648	-0.774000	0.03386	CCG	.		0.741	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
LILRA5	353514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54823336	54823336	+	Silent	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:54823336C>A	ENST00000301219.3	-	4	326	c.207G>T	c.(205-207)ggG>ggT	p.G69G	LILRA5_ENST00000346508.3_Silent_p.G57G|LILRA5_ENST00000446712.3_Silent_p.G57G|LILRA5_ENST00000432233.3_Silent_p.G69G|AC008984.2_ENST00000507363.1_RNA	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5	69	Ig-like C2-type 1.				innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTCCAGGGTCCCCTGACACC	0.587																																					p.G69G		.											.	LILRA5	91	0			c.G207T						.						160.0	148.0	152.0					19																	54823336		2203	4300	6503	SO:0001819	synonymous_variant	353514	exon4			CAGGGTCCCCTGA	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.207G>T	19.37:g.54823336C>A		Somatic	297.0	1.0		WXS	Illumina HiSeq	Phase_I	204.0	122.0	NM_181879	A6NHI3	Silent	SNP	ENST00000301219.3	37	CCDS12888.1																																																																																			.		0.587	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985	
LILRA1	11024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55111991	55111991	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:55111991C>A	ENST00000251372.3	+	9	1509	c.1327C>A	c.(1327-1329)Ctc>Atc	p.L443I	LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000453777.1_Missense_Mutation_p.L243I|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000473156.1_3'UTR	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	443					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGCTAACACCCTCAGCCCATC	0.537																																					p.L443I		.											.	LILRA1	93	0			c.C1327A						.						96.0	96.0	96.0					19																	55111991		2203	4300	6503	SO:0001583	missense	11024	exon9			AACACCCTCAGCC	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.1327C>A	19.37:g.55111991C>A	ENSP00000251372:p.Leu443Ile	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	15.0	NM_006863	O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	C	2.191	-0.385190	0.04966	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.00531	6.76;6.89	1.75	-3.5	0.04710	.	.	.	.	.	T	0.00356	0.0011	L	0.43152	1.355	0.09310	N	1	B	0.31519	0.327	B	0.19148	0.024	T	0.34254	-0.9836	9	0.20046	T	0.44	.	7.8519	0.29459	0.2912:0.7088:0.0:0.0	.	443	O75019	LIRA1_HUMAN	I	443;243	ENSP00000251372:L443I;ENSP00000413715:L243I	ENSP00000251372:L443I	L	+	1	0	LILRA1	59803803	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.580000	0.02121	-0.674000	0.05253	0.195000	0.17529	CTC	.		0.537	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
LINC00862	554279	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200311816	200311816	+	lincRNA	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:200311816C>T	ENST00000367355.1	-	0	1272					NR_040064.1		A6NCI5	SIM16_HUMAN	long intergenic non-protein coding RNA 862							integral component of membrane (GO:0016021)											tcactccaatcgctgcctctg	0.498																																					.		.											.	.	.	0			.						.																																					554279	.			TCCAATCGCTGCC	BC040731		1q32.1	2014-04-09	2013-02-22	2013-02-22	ENSG00000203721	ENSG00000203721		"""Long non-coding RNAs"""	21901	other	unknown			"""chromosome 1 open reading frame 98"", ""small integral membrane protein 16"""	C1orf98, SMIM16			Standard	NR_040064		Approved		uc001gvd.1	A6NCI5	OTTHUMG00000035722		1.37:g.200311816C>T		Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	69.0	.		RNA	SNP	ENST00000367355.1	37																																																																																				.		0.498	LINC00862-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000086877.1	NR_040064	
TIMP2	7077	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76888033	76888033	+	Intron	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:76888033C>A	ENST00000262768.7	-	2	429				TIMP2_ENST00000536189.2_Intron|DDC8_ENST00000322630.2_Missense_Mutation_p.G185C	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			TGTTGCTGGCCCAACTCTTCC	0.607																																					p.G185C		.											.	.	.	0			c.G553T						.																																			SO:0001627	intron_variant	0	exon3			GCTGGCCCAACTC		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.131-18032G>T	17.37:g.76888033C>A		Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	238.0	144.0	NM_001243540	Q16121|Q93006|Q9UDF7	Missense_Mutation	SNP	ENST00000262768.7	37	CCDS11758.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604677	0.28623	.	.	ENSG00000178404	ENST00000322630	T	0.22945	1.93	3.61	-7.22	0.01485	.	3.707100	0.01089	N	0.005145	T	0.22244	0.0536	.	.	.	0.09310	N	1	D	0.56521	0.976	P	0.50162	0.633	T	0.44050	-0.9353	9	0.35671	T	0.21	-0.0814	1.0847	0.01650	0.1917:0.1313:0.2908:0.3862	.	185	Q96MC4	.	C	185	ENSP00000312767:G185C	ENSP00000312767:G185C	G	-	1	0	AC100788.1	74399628	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.827000	0.01704	-1.805000	0.01239	0.462000	0.41574	GGC	.		0.607	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
PLEKHH2	130271	ucsc.edu;mdanderson.org	37	2	43903342	43903342	+	Intron	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:43903342G>A	ENST00000282406.4	+	3	233					NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2						negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GATGGTGCTCGTGGTCTTGAG	0.403																																					p.H40H		.											.	.	.	0			c.C120T						.						74.0	72.0	73.0					2																	43903342		2032	4180	6212	SO:0001627	intron_variant	0	exon1			GTGCTCGTGGTCT	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.124-2660G>A	2.37:g.43903342G>A		Somatic	448.0	0.0		WXS	Illumina HiSeq	.	377.0	173.0	NM_001101330	Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	ENST00000282406.4	37	CCDS1812.1																																																																																			.		0.403	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
LPHN3	23284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	62936605	62936605	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:62936605T>C	ENST00000514591.1	+	25	4718	c.4389T>C	c.(4387-4389)gcT>gcC	p.A1463A	LPHN3_ENST00000506720.1_Silent_p.A1574A|LPHN3_ENST00000507164.1_3'UTR|RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000509896.1_3'UTR|LPHN3_ENST00000506746.1_Silent_p.A1565A|RP11-84A1.3_ENST00000509461.1_RNA|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000511324.1_3'UTR|LPHN3_ENST00000545650.1_Silent_p.A1463A|LPHN3_ENST00000508946.1_Silent_p.A1506A|LPHN3_ENST00000514996.1_Silent_p.A1497A|LPHN3_ENST00000507625.1_Silent_p.A1522A|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000512091.2_3'UTR|LPHN3_ENST00000514157.1_3'UTR			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1441					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AAGGACCGGCTCATTTGGTCA	0.443																																					p.A1463A		.											.	LPHN3	508	0			c.T4389C						.						51.0	52.0	52.0					4																	62936605		692	1591	2283	SO:0001819	synonymous_variant	23284	exon23			ACCGGCTCATTTG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4389T>C	4.37:g.62936605T>C		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	56.0	NM_015236	E9PE04|O94867|Q9NWK5	Silent	SNP	ENST00000514591.1	37	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	T	4.504	0.093563	0.08632	.	.	ENSG00000150471	ENST00000502815	.	.	.	5.5	1.47	0.22746	.	.	.	.	.	T	0.55752	0.1940	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48103	-0.9064	4	.	.	.	.	8.4372	0.32795	0.122:0.0:0.4432:0.4348	.	.	.	.	P	912	.	.	S	+	1	0	LPHN3	62619200	0.950000	0.32346	0.998000	0.56505	0.994000	0.84299	-0.010000	0.12743	0.373000	0.24621	0.482000	0.46254	TCA	.		0.443	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
MALT1	10892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	56401614	56401614	+	Splice_Site	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:56401614G>A	ENST00000348428.3	+	12	1733		c.e12+1		RP11-126O1.4_ENST00000588835.1_RNA|MALT1_ENST00000345724.3_Splice_Site	NM_006785.2|NM_173844.1	NP_006776.1|NP_776216.1	Q9UDY8	MALT1_HUMAN	mucosa associated lymphoid tissue lymphoma translocation gene 1						activation of NF-kappaB-inducing kinase activity (GO:0007250)|B-1 B cell differentiation (GO:0001923)|defense response (GO:0006952)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|nuclear export (GO:0051168)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|protein oligomerization (GO:0051259)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of T cell receptor signaling pathway (GO:0050856)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)|protein self-association (GO:0043621)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|large_intestine(7)|lung(1)|ovary(2)|skin(1)	12						GATATGCCACGTAAGAACATT	0.413			T	BIRC3	MALT																																.		.		Dom	yes		18	18q21	10892	mucosa associated lymphoid tissue lymphoma translocation gene 1		L	.	MALT1	660	0			c.1475+1G>A						.						134.0	114.0	121.0					18																	56401614		2203	4300	6503	SO:0001630	splice_region_variant	10892	exon12			TGCCACGTAAGAA		CCDS11967.1, CCDS11968.1	18q21	2013-01-11			ENSG00000172175	ENSG00000172175		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6819	protein-coding gene	gene with protein product	"""paracaspase"""	604860		MLT		10339464, 10406266, 10523859	Standard	NM_006785		Approved		uc002lhm.1	Q9UDY8	OTTHUMG00000132761	ENST00000348428.3:c.1475+1G>A	18.37:g.56401614G>A		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	73.0	NM_006785	Q9NTB7|Q9ULX4	Splice_Site	SNP	ENST00000348428.3	37	CCDS11967.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852421	0.91355	.	.	ENSG00000172175	ENST00000348428;ENST00000345724	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0095	0.92867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MALT1	54552594	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.476000	0.97823	2.779000	0.95612	0.650000	0.86243	.	.		0.413	MALT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256132.2		Intron
MCTP2	55784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	94901825	94901825	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr15:94901825G>C	ENST00000357742.4	+	9	1285	c.1285G>C	c.(1285-1287)Gag>Cag	p.E429Q	MCTP2_ENST00000451018.3_Missense_Mutation_p.E429Q|MCTP2_ENST00000543482.1_3'UTR|MCTP2_ENST00000331706.4_Missense_Mutation_p.E17Q|MCTP2_ENST00000557742.1_Missense_Mutation_p.E17Q	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	429	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			CAAAAAGCATGAGGAACGTCT	0.507																																					p.E429Q		.											.	MCTP2	93	0			c.G1285C						.						114.0	99.0	104.0					15																	94901825		2197	4298	6495	SO:0001583	missense	55784	exon9			AAGCATGAGGAAC	AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1285G>C	15.37:g.94901825G>C	ENSP00000350377:p.Glu429Gln	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	95.0	NM_001159643	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Missense_Mutation	SNP	ENST00000357742.4	37	CCDS32338.1	.	.	.	.	.	.	.	.	.	.	G	18.30	3.593492	0.66219	.	.	ENSG00000140563	ENST00000451018;ENST00000331706;ENST00000357742	T;T;T	0.71579	2.97;-0.58;2.97	5.87	4.95	0.65309	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.093845	0.64402	N	0.000001	T	0.69691	0.3139	L	0.48362	1.52	0.58432	D	0.999997	B;B;B	0.32188	0.023;0.332;0.359	B;B;B	0.39503	0.073;0.135;0.301	T	0.67565	-0.5638	10	0.36615	T	0.2	.	16.6123	0.84886	0.0:0.1405:0.8595:0.0	.	429;17;429	Q6DN12-2;Q6DN12-4;Q6DN12	.;.;MCTP2_HUMAN	Q	429;17;429	ENSP00000395109:E429Q;ENSP00000329646:E17Q;ENSP00000350377:E429Q	ENSP00000329646:E17Q	E	+	1	0	MCTP2	92702829	1.000000	0.71417	0.990000	0.47175	0.914000	0.54420	6.074000	0.71253	1.454000	0.47793	0.650000	0.86243	GAG	.		0.507	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415060.3	NM_018349	
MYLK	4638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123411616	123411616	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:123411616G>A	ENST00000475616.1	-	16	3530	c.3531C>T	c.(3529-3531)ggC>ggT	p.G1177G	MYLK_ENST00000354792.5_5'Flank|MYLK_ENST00000360304.3_Silent_p.G1177G|MYLK_ENST00000346322.5_Silent_p.G1108G|MYLK_ENST00000359169.1_Silent_p.G1177G|MYLK_ENST00000510775.1_5'UTR|MYLK-AS2_ENST00000510827.1_RNA|MYLK-AS2_ENST00000515464.1_RNA|MYLK_ENST00000360772.3_Silent_p.G1177G			Q15746	MYLK_HUMAN	myosin light chain kinase	1177	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Ig-like C2-type 7.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		ACTCCGCCTGGCCAGCGTCAT	0.597																																					p.G1177G		.											.	MYLK	365	0			c.C3531T						.						91.0	70.0	77.0					3																	123411616		2203	4300	6503	SO:0001819	synonymous_variant	4638	exon19			CGCCTGGCCAGCG	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3531C>T	3.37:g.123411616G>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	24.0	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	ENST00000475616.1	37	CCDS46896.1																																																																																			.		0.597	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
MYO3A	53904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	26462898	26462898	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:26462898T>C	ENST00000265944.5	+	30	3871	c.3705T>C	c.(3703-3705)gcT>gcC	p.A1235A	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1235					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AAGAGGAAGCTATGATCCAGA	0.438																																					p.A1235A		.											.	MYO3A	1007	0			c.T3705C						.						110.0	112.0	111.0					10																	26462898		2203	4300	6503	SO:0001819	synonymous_variant	53904	exon30			GGAAGCTATGATC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3705T>C	10.37:g.26462898T>C		Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	61.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	ENST00000265944.5	37	CCDS7148.1																																																																																			.		0.438	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
NBEAL2	23218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47030821	47030821	+	Silent	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:47030821C>G	ENST00000450053.3	+	5	602	c.423C>G	c.(421-423)ctC>ctG	p.L141L	NBEAL2_ENST00000292309.5_Silent_p.L141L|NBEAL2_ENST00000383740.2_5'UTR	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	141					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CTCTGCTTCTCTGCGAGGGCC	0.632																																					p.L141L		.											.	NBEAL2	69	0			c.C423G						.						32.0	38.0	36.0					3																	47030821		2066	4181	6247	SO:0001819	synonymous_variant	23218	exon5			GCTTCTCTGCGAG	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.423C>G	3.37:g.47030821C>G		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	29.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	37	CCDS46817.1																																																																																			.		0.632	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
NBR1	4077	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41345518	41345518	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:41345518C>T	ENST00000422280.1	+	12	1846	c.1387C>T	c.(1387-1389)Cac>Tac	p.H463Y	NBR1_ENST00000542611.1_Missense_Mutation_p.H442Y|NBR1_ENST00000389312.4_Missense_Mutation_p.H463Y|NBR1_ENST00000590996.1_Missense_Mutation_p.H463Y|NBR1_ENST00000589872.1_Missense_Mutation_p.H463Y|NBR1_ENST00000341165.6_Missense_Mutation_p.H463Y	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	463					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GCGTCTTTCTCACAAAGGCCA	0.522																																					p.H463Y		.											.	NBR1	130	0			c.C1387T						.						70.0	68.0	69.0					17																	41345518		1904	4120	6024	SO:0001583	missense	4077	exon12			CTTTCTCACAAAG	X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1387C>T	17.37:g.41345518C>T	ENSP00000411250:p.His463Tyr	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	32.0	NM_031862	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	ENST00000422280.1	37	CCDS45694.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039340	0.93630	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.48836	1.39;0.8;1.39;1.38	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.70245	0.3202	M	0.74881	2.28	0.80722	D	1	D;D;D;P	0.62365	0.972;0.972;0.991;0.939	P;P;D;P	0.64506	0.703;0.703;0.926;0.703	T	0.70008	-0.4990	10	0.72032	D	0.01	-4.6646	20.8794	0.99867	0.0:1.0:0.0:0.0	.	463;442;463;463	A8K1U0;B7Z5R6;Q14596-2;Q14596	.;.;.;NBR1_HUMAN	Y	463;442;463;463;463	ENSP00000411250:H463Y;ENSP00000437545:H442Y;ENSP00000343479:H463Y;ENSP00000373963:H463Y	ENSP00000343479:H463Y	H	+	1	0	NBR1	38599044	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CAC	.		0.522	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453461.1	NM_005899	
NID2	22795	ucsc.edu;bcgsc.ca	37	14	52534860	52534860	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr14:52534860A>G	ENST00000216286.5	-	2	249	c.250T>C	c.(250-252)Tcc>Ccc	p.S84P	NID2_ENST00000541773.1_Missense_Mutation_p.S31P	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	84					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TCCTGAGTGGAGATGATGCCG	0.592																																					p.S84P		.											.	NID2	158	0			c.T250C						.						47.0	61.0	56.0					14																	52534860		2203	4299	6502	SO:0001583	missense	22795	exon2			GAGTGGAGATGAT	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.250T>C	14.37:g.52534860A>G	ENSP00000216286:p.Ser84Pro	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_007361	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	ENST00000216286.5	37	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.987730	0.93106	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.19938	2.11;2.11	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.51753	0.1693	M	0.90759	3.145	0.45390	D	0.99837	D;B;B	0.67145	0.996;0.293;0.015	D;B;B	0.63877	0.919;0.068;0.018	T	0.62205	-0.6903	10	0.56958	D	0.05	.	15.1564	0.72746	1.0:0.0:0.0:0.0	.	31;86;84	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	P	84;84;31;86	ENSP00000216286:S84P;ENSP00000443730:S31P	ENSP00000216286:S84P	S	-	1	0	NID2	51604610	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.754000	0.74909	1.979000	0.57680	0.460000	0.39030	TCC	.		0.592	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
NPY5R	4889	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	164272591	164272591	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:164272591T>A	ENST00000515560.1	+	4	2688	c.1166T>A	c.(1165-1167)gTg>gAg	p.V389E	NPY5R_ENST00000338566.3_Missense_Mutation_p.V389E|NPY5R_ENST00000506953.1_Missense_Mutation_p.V389E			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	389					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				CTTTTCCATGTGGTAACTGAT	0.348																																					p.V389E	Melanoma(139;1287 1774 9781 19750 25599)	.											.	NPY5R	523	0			c.T1166A						.						160.0	152.0	155.0					4																	164272591		2203	4300	6503	SO:0001583	missense	4889	exon4			TCCATGTGGTAAC	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.1166T>A	4.37:g.164272591T>A	ENSP00000423917:p.Val389Glu	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	86.0	NM_006174	Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	37	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453285	0.63290	.	.	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.55930	0.49;0.49;0.49	4.9	3.7	0.42460	GPCR, rhodopsin-like superfamily (1);	0.283599	0.24294	N	0.039799	T	0.63331	0.2502	M	0.68317	2.08	0.35343	D	0.786634	D	0.61080	0.989	P	0.58172	0.834	T	0.74349	-0.3694	10	0.62326	D	0.03	.	11.1021	0.48182	0.0:0.0772:0.0:0.9228	.	389	Q15761	NPY5R_HUMAN	E	389	ENSP00000339377:V389E;ENSP00000423917:V389E;ENSP00000423474:V389E	ENSP00000339377:V389E	V	+	2	0	NPY5R	164492041	1.000000	0.71417	0.999000	0.59377	0.854000	0.48673	5.294000	0.65687	1.966000	0.57179	0.377000	0.23210	GTG	.		0.348	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174	
OR10P1	121130	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56030750	56030750	+	Silent	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:56030750C>A	ENST00000309675.2	+	1	107	c.75C>A	c.(73-75)ggC>ggA	p.G25G	RP11-644F5.16_ENST00000556606.1_RNA	NM_206899.1	NP_996782.1	Q8NGE3	O10P1_HUMAN	olfactory receptor, family 10, subfamily P, member 1	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|large_intestine(3)|lung(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26						CCCTGCAGGGCCCCCTGTTCT	0.587																																					p.G25G		.											.	OR10P1	69	0			c.C75A						.						109.0	102.0	104.0					12																	56030750		2203	4300	6503	SO:0001819	synonymous_variant	121130	exon1			GCAGGGCCCCCTG	BK004259	CCDS31828.1	12q13.13	2012-08-09		2004-03-10		ENSG00000175398		"""GPCR / Class A : Olfactory receptors"""	15378	protein-coding gene	gene with protein product				OR10P1P, OR10P2P, OR10P3P			Standard	NM_206899		Approved	OST701	uc010spq.2	Q8NGE3	OTTHUMG00000169961	ENST00000309675.2:c.75C>A	12.37:g.56030750C>A		Somatic	176.0	1.0		WXS	Illumina HiSeq	Phase_I	105.0	26.0	NM_206899	B9EGY4	Silent	SNP	ENST00000309675.2	37	CCDS31828.1																																																																																			.		0.587	OR10P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406680.1		
OSBPL6	114880	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179170928	179170928	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:179170928A>G	ENST00000190611.4	+	3	393	c.17A>G	c.(16-18)aAg>aGg	p.K6R	OSBPL6_ENST00000359685.3_Missense_Mutation_p.K6R|OSBPL6_ENST00000357080.4_Missense_Mutation_p.K6R|OSBPL6_ENST00000409045.3_Missense_Mutation_p.K6R|OSBPL6_ENST00000392505.2_Missense_Mutation_p.K6R|OSBPL6_ENST00000409631.1_Missense_Mutation_p.K6R	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	6					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			TCAGATGAGAAGGGCATTTCC	0.438																																					p.K6R		.											.	OSBPL6	69	0			c.A17G						.						155.0	132.0	140.0					2																	179170928		2203	4300	6503	SO:0001583	missense	114880	exon3			ATGAGAAGGGCAT	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.17A>G	2.37:g.179170928A>G	ENSP00000190611:p.Lys6Arg	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	46.0	NM_001201482	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.359892	0.61403	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000357080;ENST00000409045;ENST00000190611;ENST00000409631	T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61	5.87	4.72	0.59763	.	0.176314	0.34986	U	0.003537	T	0.27933	0.0688	N	0.05510	-0.035	0.39990	D	0.975022	B;B;B;B;B	0.17667	0.008;0.004;0.021;0.005;0.023	B;B;B;B;B	0.15484	0.009;0.004;0.013;0.004;0.006	T	0.07102	-1.0790	10	0.45353	T	0.12	-15.2766	11.0392	0.47820	0.9264:0.0:0.0736:0.0	.	6;6;6;6;6	Q9BZF3-4;Q9BZF3-2;Q9BZF3-5;Q9BZF3;Q86V84	.;.;.;OSBL6_HUMAN;.	R	6	ENSP00000376293:K6R;ENSP00000352713:K6R;ENSP00000349591:K6R;ENSP00000387248:K6R;ENSP00000190611:K6R;ENSP00000386885:K6R	ENSP00000190611:K6R	K	+	2	0	OSBPL6	178879174	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.699000	0.61796	1.160000	0.42584	0.533000	0.62120	AAG	.		0.438	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30724910	30724910	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:30724910C>A	ENST00000361762.2	+	1	2874	c.1866C>A	c.(1864-1866)agC>agA	p.S622R	PCDH7_ENST00000543491.1_Missense_Mutation_p.S622R	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	622	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGCAGGGCAGCACTACGGTGA	0.488																																					p.S622R		.											.	PCDH7	229	0			c.C1866A						.						92.0	97.0	95.0					4																	30724910		2203	4300	6503	SO:0001583	missense	5099	exon1			GGGCAGCACTACG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1866C>A	4.37:g.30724910C>A	ENSP00000355243:p.Ser622Arg	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	36.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.82|13.82	2.352629|2.352629	0.41700|0.41700	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	.|T;T	.|0.50813	.|0.73;0.73	5.37|5.37	3.65|3.65	0.41850|0.41850	.|Cadherin (5);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.45054|0.45054	0.1323|0.1323	N|N	0.25957|0.25957	0.775|0.775	0.48975|0.48975	D|D	0.99973|0.99973	.|D;D;P	.|0.55800	.|0.973;0.973;0.872	.|P;P;P	.|0.55871	.|0.786;0.786;0.756	T|T	0.41342|0.41342	-0.9514|-0.9514	5|9	.|0.72032	.|D	.|0.01	.|.	6.8325|6.8325	0.23917|0.23917	0.1414:0.7145:0.0:0.1441|0.1414:0.7145:0.0:0.1441	.|.	.|622;575;622	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	N|R	312|622;622;575	.|ENSP00000355243:S622R;ENSP00000441802:S622R	.|ENSP00000330302:S575R	H|S	+|+	1|3	0|2	PCDH7|PCDH7	30334008|30334008	0.845000|0.845000	0.29573|0.29573	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	-0.058000|-0.058000	0.11750|0.11750	0.839000|0.839000	0.34971|0.34971	0.655000|0.655000	0.94253|0.94253	CAC|AGC	.		0.488	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30725405	30725405	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:30725405T>A	ENST00000361762.2	+	1	3369	c.2361T>A	c.(2359-2361)aaT>aaA	p.N787K	PCDH7_ENST00000543491.1_Missense_Mutation_p.N787K	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	787	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						TGGGAGGAAATCCCTTCAAGC	0.468																																					p.N787K		.											.	PCDH7	229	0			c.T2361A						.						54.0	53.0	54.0					4																	30725405		2203	4300	6503	SO:0001583	missense	5099	exon1			AGGAAATCCCTTC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2361T>A	4.37:g.30725405T>A	ENSP00000355243:p.Asn787Lys	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	38.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.57|14.57	2.575956|2.575956	0.45902|0.45902	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.53857|.	0.6;0.6|.	4.96|4.96	3.79|3.79	0.43588|0.43588	Cadherin (4);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.65217|0.65217	0.2670|0.2670	M|M	0.77616|0.77616	2.38|2.38	0.48288|0.48288	D|D	0.99962|0.99962	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	T|T	0.63677|0.63677	-0.6583|-0.6583	9|5	0.87932|.	D|.	0|.	.|.	6.7845|6.7845	0.23665|0.23665	0.0:0.2297:0.0:0.7703|0.0:0.2297:0.0:0.7703	.|.	787;740;787|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	K|T	787;787;740|477	ENSP00000355243:N787K;ENSP00000441802:N787K|.	ENSP00000330302:N740K|.	N|S	+|+	3|1	2|0	PCDH7|PCDH7	30334503|30334503	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.940000|0.940000	0.28992|0.28992	0.930000|0.930000	0.37217|0.37217	0.533000|0.533000	0.62120|0.62120	AAT|TCC	.		0.468	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
PCDHA6	56142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140209550	140209550	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:140209550G>A	ENST00000529310.1	+	1	1988	c.1874G>A	c.(1873-1875)gGg>gAg	p.G625E	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	625	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCGCGTGGGGCTGTACACG	0.667																																					p.G625E		.											.	PCDHA6	92	0			c.G1874A						.						72.0	77.0	75.0					5																	140209550		2203	4300	6503	SO:0001583	missense	56142	exon1			GCGTGGGGCTGTA	AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1874G>A	5.37:g.140209550G>A	ENSP00000433378:p.Gly625Glu	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	49.0	NM_018909	O75283|Q9NRT8	Missense_Mutation	SNP	ENST00000529310.1	37	CCDS47281.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.416124	0.25552	.	.	ENSG00000081842	ENST00000529310	T	0.37752	1.18	3.98	2.09	0.27110	Cadherin (4);Cadherin-like (1);	0.443885	0.16053	U	0.231876	T	0.54663	0.1872	M	0.61703	1.905	0.80722	D	1	D;D	0.71674	0.994;0.998	D;D	0.70716	0.924;0.97	T	0.53906	-0.8372	10	0.51188	T	0.08	.	13.7146	0.62689	0.0:0.2959:0.7041:0.0	.	625;625	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	E	625	ENSP00000433378:G625E	ENSP00000433378:G625E	G	+	2	0	PCDHA6	140189734	0.914000	0.31030	0.974000	0.42286	0.181000	0.23173	1.727000	0.38095	0.410000	0.25675	0.306000	0.20318	GGG	.		0.667	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372829.3	NM_018909	
PCDHAC2	56134	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140347607	140347607	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:140347607A>G	ENST00000289269.5	+	1	1788	c.1256A>G	c.(1255-1257)tAt>tGt	p.Y419C	PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	419	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAACTCCTATACACTGGTG	0.577																																					p.Y419C	Melanoma(190;638 2083 3390 11909 52360)	.											.	PCDHAC2	26	0			c.A1256G						.						90.0	89.0	89.0					5																	140347607		2203	4300	6503	SO:0001583	missense	56134	exon1			ACTCCTATACACT	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1256A>G	5.37:g.140347607A>G	ENSP00000289269:p.Tyr419Cys	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	49.0	NM_031883	Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	ENST00000289269.5	37	CCDS4242.1	.	.	.	.	.	.	.	.	.	.	A	10.47	1.358951	0.24598	.	.	ENSG00000243232	ENST00000289269	T	0.68181	-0.31	5.82	5.82	0.92795	Cadherin (4);Cadherin-like (1);	0.000000	0.38164	N	0.001799	D	0.88115	0.6350	H	0.97077	3.935	0.58432	D	0.999995	D;D	0.89917	0.999;1.0	D;D	0.97110	0.97;1.0	D	0.92032	0.5634	10	0.87932	D	0	.	16.1728	0.81831	1.0:0.0:0.0:0.0	.	419;419	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	C	419	ENSP00000289269:Y419C	ENSP00000289269:Y419C	Y	+	2	0	PCDHAC2	140327791	1.000000	0.71417	0.978000	0.43139	0.029000	0.11900	5.199000	0.65152	2.228000	0.72767	0.533000	0.62120	TAT	.		0.577	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHB7	56129	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140554546	140554546	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr5:140554546G>A	ENST00000231137.3	+	1	2304	c.2130G>A	c.(2128-2130)cgG>cgA	p.R710R	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	710					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCGGTGCGGCTGTGCAGGA	0.682																																					p.R710R		.											.	PCDHB7	95	0			c.G2130A						.						72.0	122.0	105.0					5																	140554546		2197	4285	6482	SO:0001819	synonymous_variant	56129	exon1			GGTGCGGCTGTGC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2130G>A	5.37:g.140554546G>A		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	28.0	NM_018940	A1L3Y8	Silent	SNP	ENST00000231137.3	37	CCDS4249.1																																																																																			G|1.000;T|0.000		0.682	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PDZRN4	29951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	41967431	41967431	+	Silent	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:41967431G>T	ENST00000402685.2	+	10	2858	c.2850G>T	c.(2848-2850)ctG>ctT	p.L950L	PDZRN4_ENST00000298919.7_Silent_p.L690L|PDZRN4_ENST00000539469.2_Silent_p.L692L	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	950							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AGCAGCACCTGGTTAGGGCCA	0.562																																					p.L950L		.											.	PDZRN4	296	0			c.G2850T						.						94.0	87.0	89.0					12																	41967431		2203	4300	6503	SO:0001819	synonymous_variant	29951	exon10			GCACCTGGTTAGG	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2850G>T	12.37:g.41967431G>T		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	14.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Silent	SNP	ENST00000402685.2	37	CCDS53777.1																																																																																			.		0.562	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
PIGN	23556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	59768329	59768329	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:59768329T>C	ENST00000357637.5	-	22	2471	c.2056A>G	c.(2056-2058)Att>Gtt	p.I686V	PIGN_ENST00000400334.3_Missense_Mutation_p.I686V	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	686					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				CAGCTAATAATTTGATTCATG	0.398																																					p.I686V		.											.	PIGN	227	0			c.A2056G						.						94.0	88.0	90.0					18																	59768329		1895	4119	6014	SO:0001583	missense	23556	exon22			TAATAATTTGATT	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2056A>G	18.37:g.59768329T>C	ENSP00000350263:p.Ile686Val	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	37.0	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	37	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	T	7.451	0.642660	0.14451	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.53640	0.61;0.61	5.57	3.2	0.36748	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.407110	0.26971	N	0.021573	T	0.29716	0.0742	L	0.28504	0.86	0.38908	D	0.957467	B;B	0.15473	0.013;0.013	B;B	0.20955	0.032;0.032	T	0.10847	-1.0612	10	0.05959	T	0.93	-8.9591	9.6172	0.39698	0.0:0.1423:0.0:0.8577	.	686;686	B2RCI8;O95427	.;PIGN_HUMAN	V	686	ENSP00000350263:I686V;ENSP00000383188:I686V	ENSP00000350263:I686V	I	-	1	0	PIGN	57919309	0.993000	0.37304	0.796000	0.32109	0.887000	0.51463	0.908000	0.28545	0.928000	0.37168	0.477000	0.44152	ATT	.		0.398	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
PLA2G3	50487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	22	31533849	31533849	+	Nonsense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr22:31533849T>A	ENST00000215885.3	-	4	1165	c.913A>T	c.(913-915)Aag>Tag	p.K305*		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	305					acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						AGGTGCTGCTTCTGTCGAGGC	0.652																																					p.K305X		.											.	PLA2G3	226	0			c.A913T						.						82.0	94.0	90.0					22																	31533849		2203	4300	6503	SO:0001587	stop_gained	50487	exon4			GCTGCTTCTGTCG	AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.913A>T	22.37:g.31533849T>A	ENSP00000215885:p.Lys305*	Somatic	304.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	101.0	NM_015715	O95768	Nonsense_Mutation	SNP	ENST00000215885.3	37	CCDS13889.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.612473	0.87258	.	.	ENSG00000100078	ENST00000215885	.	.	.	3.68	1.48	0.22813	.	0.904173	0.09678	N	0.770218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9249	4.5179	0.11945	0.0:0.1107:0.3999:0.4894	.	.	.	.	X	305	.	ENSP00000215885:K305X	K	-	1	0	PLA2G3	29863849	0.001000	0.12720	0.006000	0.13384	0.023000	0.10783	0.169000	0.16641	0.257000	0.21650	0.533000	0.62120	AAG	.		0.652	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321938.1	NM_015715	
PLEKHO1	51177	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	150131276	150131276	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:150131276C>T	ENST00000369124.4	+	6	1066	c.788C>T	c.(787-789)cCc>cTc	p.P263L	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.P229L|PLEKHO1_ENST00000369126.1_Missense_Mutation_p.P80L	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	263	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGTTGACGCCCACAGAGAAA	0.642																																					p.P263L		.											.	PLEKHO1	226	0			c.C788T						.						32.0	38.0	36.0					1																	150131276		2203	4300	6503	SO:0001583	missense	51177	exon6			TGACGCCCACAGA	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.788C>T	1.37:g.150131276C>T	ENSP00000358120:p.Pro263Leu	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	303.0	15.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	37	CCDS945.1	.	.	.	.	.	.	.	.	.	.	C	3.672	-0.067277	0.07273	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124;ENST00000441340	T;T	0.40476	1.03;1.04	4.97	4.04	0.47022	.	0.833567	0.11286	N	0.579801	T	0.13713	0.0332	L	0.36672	1.1	0.09310	N	0.999999	B	0.13594	0.008	B	0.14578	0.011	T	0.20140	-1.0284	10	0.24483	T	0.36	-8.0699	7.7059	0.28650	0.2855:0.5641:0.1504:0.0	.	263	Q53GL0	PKHO1_HUMAN	L	80;229;263;143	ENSP00000025469:P229L;ENSP00000358120:P263L	ENSP00000025469:P229L	P	+	2	0	PLEKHO1	148397900	0.011000	0.17503	0.074000	0.20217	0.636000	0.38137	1.493000	0.35605	1.275000	0.44379	0.655000	0.94253	CCC	.		0.642	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
PLEKHO1	51177	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	150131673	150131673	+	Silent	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:150131673C>G	ENST00000369124.4	+	6	1463	c.1185C>G	c.(1183-1185)ctC>ctG	p.L395L	PLEKHO1_ENST00000025469.6_Silent_p.L361L|PLEKHO1_ENST00000369126.1_Silent_p.L212L	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	395	Negative regulator of AP-1 activity.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			ACTCCCACCTCAGACAGACCA	0.587																																					p.L395L		.											.	PLEKHO1	226	0			c.C1185G						.						27.0	30.0	29.0					1																	150131673		2203	4300	6503	SO:0001819	synonymous_variant	51177	exon6			CCACCTCAGACAG	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.1185C>G	1.37:g.150131673C>G		Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	390.0	16.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Silent	SNP	ENST00000369124.4	37	CCDS945.1																																																																																			.		0.587	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
PLXNA4	91584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	131912231	131912231	+	Missense_Mutation	SNP	G	G	A	rs533775501		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr7:131912231G>A	ENST00000359827.3	-	7	2823	c.1861C>T	c.(1861-1863)Ccc>Tcc	p.P621S	PLXNA4_ENST00000321063.4_Missense_Mutation_p.P621S			Q9HCM2	PLXA4_HUMAN	plexin A4	621					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ATGATCCGGGGCACCTCCTTG	0.582																																					p.P621S		.											.	PLXNA4	91	0			c.C1861T						.						64.0	68.0	66.0					7																	131912231		2078	4217	6295	SO:0001583	missense	91584	exon7			TCCGGGGCACCTC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1861C>T	7.37:g.131912231G>A	ENSP00000352882:p.Pro621Ser	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	21.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211224	0.79240	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.01192	5.2;5.2	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.02571	0.0078	L	0.56340	1.77	0.80722	D	1	B	0.29212	0.237	B	0.32149	0.141	T	0.55927	-0.8063	10	0.66056	D	0.02	.	19.9025	0.96993	0.0:0.0:1.0:0.0	.	621	Q9HCM2	PLXA4_HUMAN	S	621	ENSP00000323194:P621S;ENSP00000352882:P621S	ENSP00000323194:P621S	P	-	1	0	PLXNA4	131562771	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	6.351000	0.73022	2.722000	0.93159	0.655000	0.94253	CCC	.		0.582	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
RANBP2	5903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	109381074	109381074	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:109381074G>A	ENST00000283195.6	+	20	4205	c.4079G>A	c.(4078-4080)aGc>aAc	p.S1360N		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1360					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CATTGTAACAGCTGCTCATTA	0.388																																					p.S1360N		.											.	RANBP2	675	0			c.G4079A						.						88.0	89.0	89.0					2																	109381074		2203	4300	6503	SO:0001583	missense	5903	exon20			GTAACAGCTGCTC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.4079G>A	2.37:g.109381074G>A	ENSP00000283195:p.Ser1360Asn	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	53.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	37	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	5.864	0.343570	0.11126	.	.	ENSG00000153201	ENST00000283195	T	0.57595	0.39	5.48	5.48	0.80851	Zinc finger, RanBP2-type (4);	.	.	.	.	T	0.46737	0.1408	L	0.47716	1.5	0.20196	N	0.999923	B	0.32010	0.351	B	0.34038	0.174	T	0.37174	-0.9717	9	0.29301	T	0.29	-5.1313	11.2651	0.49106	0.0:0.1352:0.7251:0.1397	.	1360	P49792	RBP2_HUMAN	N	1360	ENSP00000283195:S1360N	ENSP00000283195:S1360N	S	+	2	0	RANBP2	108747506	0.890000	0.30428	0.998000	0.56505	0.992000	0.81027	1.266000	0.33039	2.554000	0.86153	0.655000	0.94253	AGC	.		0.388	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
RECQL	5965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21643210	21643210	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:21643210C>G	ENST00000444129.2	-	4	785	c.317G>C	c.(316-318)gGa>gCa	p.G106A	RECQL_ENST00000421138.2_Missense_Mutation_p.G106A	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	106	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TACCTCCTTTCCAGCCATTGT	0.348								Other identified genes with known or suspected DNA repair function																													p.G106A		.											.	RECQL	228	0			c.G317C						.						120.0	121.0	120.0					12																	21643210		2203	4300	6503	SO:0001583	missense	5965	exon5			TCCTTTCCAGCCA	D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.317G>C	12.37:g.21643210C>G	ENSP00000416739:p.Gly106Ala	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	88.0	NM_032941	A8K6G2	Missense_Mutation	SNP	ENST00000444129.2	37	CCDS31756.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708568	0.89018	.	.	ENSG00000004700	ENST00000444129;ENST00000421138;ENST00000396093;ENST00000314748;ENST00000542432;ENST00000536240	T;T;T;T;T;T	0.76968	-0.97;-0.97;-0.53;-0.53;-0.53;-1.06	5.29	5.29	0.74685	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.117022	0.64402	D	0.000017	D	0.84790	0.5550	M	0.91038	3.17	0.58432	D	0.999992	P	0.48407	0.91	B	0.43575	0.424	D	0.88762	0.3258	10	0.66056	D	0.02	-1.1318	19.2899	0.94095	0.0:1.0:0.0:0.0	.	106	P46063	RECQ1_HUMAN	A	106	ENSP00000416739:G106A;ENSP00000395449:G106A;ENSP00000379400:G106A;ENSP00000318727:G106A;ENSP00000445555:G106A;ENSP00000439069:G106A	ENSP00000318727:G106A	G	-	2	0	RECQL	21534477	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.570000	0.82390	2.615000	0.88500	0.650000	0.86243	GGA	.		0.348	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402371.1	NM_002907	
RELN	5649	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	103276844	103276844	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr7:103276844C>T	ENST00000428762.1	-	18	2300	c.2141G>A	c.(2140-2142)aGc>aAc	p.S714N	RELN_ENST00000424685.2_Missense_Mutation_p.S714N|RELN_ENST00000343529.5_Missense_Mutation_p.S714N	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	714					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACTGCCAAAGCTTTCAGAAAT	0.458																																					p.S714N	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN	574	0			c.G2141A						.						60.0	62.0	61.0					7																	103276844		2203	4300	6503	SO:0001583	missense	5649	exon18			CCAAAGCTTTCAG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.2141G>A	7.37:g.103276844C>T	ENSP00000392423:p.Ser714Asn	Somatic	202.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	39.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436206	0.43224	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.22945	1.93;1.93;1.93	5.76	5.76	0.90799	.	0.043835	0.85682	D	0.000000	T	0.30541	0.0768	N	0.12182	0.205	0.50632	D	0.999887	D;D	0.60160	0.96;0.987	P;D	0.63381	0.577;0.914	T	0.07424	-1.0773	10	0.11485	T	0.65	.	19.9658	0.97266	0.0:1.0:0.0:0.0	.	714;714	P78509-2;P78509	.;RELN_HUMAN	N	714	ENSP00000392423:S714N;ENSP00000345694:S714N;ENSP00000388446:S714N	ENSP00000345694:S714N	S	-	2	0	RELN	103064080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.295000	0.78780	2.721000	0.93114	0.591000	0.81541	AGC	.		0.458	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
RIMS1	22999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	72968729	72968729	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:72968729C>A	ENST00000521978.1	+	18	2968	c.2968C>A	c.(2968-2970)Cca>Aca	p.P990T	RIMS1_ENST00000538414.1_5'UTR|RIMS1_ENST00000517960.1_Missense_Mutation_p.P989T|RIMS1_ENST00000523963.1_Missense_Mutation_p.P464T|RIMS1_ENST00000517827.1_Missense_Mutation_p.P449T|RIMS1_ENST00000348717.5_Missense_Mutation_p.P989T|RIMS1_ENST00000520567.1_Missense_Mutation_p.P989T|RIMS1_ENST00000264839.7_Missense_Mutation_p.P990T|RIMS1_ENST00000491071.2_Missense_Mutation_p.P990T|RIMS1_ENST00000518273.1_Missense_Mutation_p.P990T|RIMS1_ENST00000401910.3_Missense_Mutation_p.P463T|RIMS1_ENST00000425662.2_Missense_Mutation_p.P383T|RIMS1_ENST00000522291.1_Missense_Mutation_p.P989T	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	990					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GTCACGTTCTCCAACCAGACA	0.378																																					p.P990T		.											.	RIMS1	144	0			c.C2968A						.						137.0	137.0	137.0					6																	72968729		1944	4129	6073	SO:0001583	missense	22999	exon18			CGTTCTCCAACCA	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2968C>A	6.37:g.72968729C>A	ENSP00000428417:p.Pro990Thr	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	41.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	37	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.53|14.53	2.561642|2.561642	0.45590|0.45590	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420|ENST00000517433	T;T;T;T;T;T;T;T;T;T;T;T;T;T|T	0.17370|0.15952	2.56;2.7;2.57;2.7;2.7;2.72;2.65;2.54;2.7;2.74;2.68;2.49;2.68;2.28|2.38	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.000000|.	0.64402|.	D|.	0.000005|.	T|T	0.27169|0.27169	0.0666|0.0666	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	B;D;D;P;B;B;B;B;D;B;D;D|.	0.89917|.	0.012;0.998;1.0;0.584;0.021;0.434;0.001;0.069;0.999;0.063;1.0;0.999|.	B;D;D;B;B;B;B;B;D;B;D;D|.	0.87578|.	0.005;0.981;0.998;0.113;0.015;0.417;0.001;0.032;0.991;0.05;0.998;0.993|.	T|T	0.00837|0.00837	-1.1546|-1.1546	10|7	0.15066|0.87932	T|D	0.55|0	-15.6514|-15.6514	19.5526|19.5526	0.95328|0.95328	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	449;464;990;449;463;989;242;990;989;243;990;990|.	B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;E7EX08;Q5JY22;E7ERQ1;E7ENC2;Q5JY21;C9JNW6;Q86UR5|.	.;.;.;.;.;.;.;.;.;.;.;RIMS1_HUMAN|.	T|Y	990;990;990;989;990;989;990;989;990;989;989;990;463;464;383;383;449;215|563	ENSP00000430101:P990T;ENSP00000275037:P989T;ENSP00000264839:P990T;ENSP00000429959:P989T;ENSP00000430408:P990T;ENSP00000430502:P989T;ENSP00000430932:P989T;ENSP00000428417:P990T;ENSP00000385649:P463T;ENSP00000428328:P464T;ENSP00000411235:P383T;ENSP00000389503:P383T;ENSP00000428367:P449T;ENSP00000359448:P215T|ENSP00000430359:S563Y	ENSP00000264839:P990T|ENSP00000430359:S563Y	P|S	+|+	1|2	0|0	RIMS1|RIMS1	73025450|73025450	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.610000|5.610000	0.67668|0.67668	2.701000|2.701000	0.92244|0.92244	0.563000|0.563000	0.77884|0.77884	CCA|TCC	.		0.378	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
ROBO2	6092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	77629195	77629195	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:77629195A>C	ENST00000461745.1	+	16	3326	c.2426A>C	c.(2425-2427)cAa>cCa	p.Q809P	ROBO2_ENST00000332191.8_Missense_Mutation_p.Q809P|ROBO2_ENST00000487694.3_Missense_Mutation_p.Q825P	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	809	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCAGGTATTCAATACCGGGTA	0.448																																					p.Q809P		.											.	ROBO2	328	0			c.A2426C						.						124.0	122.0	122.0					3																	77629195		1888	4118	6006	SO:0001583	missense	6092	exon16			GTATTCAATACCG	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.2426A>C	3.37:g.77629195A>C	ENSP00000417164:p.Gln809Pro	Somatic	206.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	86.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	A	11.95	1.790591	0.31685	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.57436	0.4;0.4;0.4	5.53	5.53	0.82687	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.38492	U	0.001662	T	0.43500	0.1250	L	0.35414	1.06	0.42344	D	0.992343	B;B;B	0.11235	0.002;0.004;0.002	B;B;B	0.16289	0.007;0.015;0.007	T	0.48115	-0.9063	9	0.30078	T	0.28	.	15.3169	0.74089	1.0:0.0:0.0:0.0	.	825;809;809	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	P	825;825;829;809;809;530	ENSP00000417335:Q825P;ENSP00000417164:Q809P;ENSP00000327536:Q809P	ENSP00000327536:Q809P	Q	+	2	0	ROBO2	77711885	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	3.750000	0.55157	2.095000	0.63458	0.460000	0.39030	CAA	.		0.448	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
RP1L1	94137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	10467732	10467732	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:10467732T>A	ENST00000382483.3	-	4	4099	c.3876A>T	c.(3874-3876)ttA>ttT	p.L1292F		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1292	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGTTTTCAGCTAACTGCTCCA	0.512																																					p.L1292F		.											.	RP1L1	139	0			c.A3876T						.						174.0	170.0	171.0					8																	10467732		2043	4197	6240	SO:0001583	missense	94137	exon4			TTCAGCTAACTGC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.3876A>T	8.37:g.10467732T>A	ENSP00000371923:p.Leu1292Phe	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	26.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	T	5.704	0.314484	0.10789	.	.	ENSG00000183638	ENST00000382483	T	0.04406	3.63	4.08	-8.17	0.01057	.	1.971510	0.03439	N	0.209094	T	0.02230	0.0069	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.42766	-0.9432	10	0.52906	T	0.07	6.4955	2.7625	0.05311	0.1113:0.3826:0.2254:0.2808	.	1292	A6NKC6	.	F	1292	ENSP00000371923:L1292F	ENSP00000371923:L1292F	L	-	3	2	RP1L1	10505142	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.375000	0.02563	-1.498000	0.01824	-1.144000	0.01866	TTA	.		0.512	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RPS27A	6233	ucsc.edu;bcgsc.ca	37	2	55462628	55462628	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:55462628G>A	ENST00000272317.6	+	6	710	c.386G>A	c.(385-387)gGg>gAg	p.G129E	RPS27A_ENST00000404735.1_Missense_Mutation_p.G129E|RPS27A_ENST00000402285.3_Missense_Mutation_p.G129E|CLHC1_ENST00000406076.1_5'Flank	NM_002954.5	NP_002945.1	P62979	RS27A_HUMAN	ribosomal protein S27a	129					activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|viral transcription (GO:0019083)|virion assembly (GO:0019068)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|small ribosomal subunit (GO:0015935)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|ovary(1)|urinary_tract(1)	3						TGTGGTGCTGGGGTGTTTATG	0.403																																					p.G129E		.											.	RPS27A	91	0			c.G386A						.						127.0	117.0	121.0					2																	55462628		2203	4297	6500	SO:0001583	missense	6233	exon6			GTGCTGGGGTGTT	AB007163	CCDS33202.1	2p16	2011-04-06			ENSG00000143947	ENSG00000143947		"""S ribosomal proteins"""	10417	protein-coding gene	gene with protein product	"""ubiquitin carboxyl extension protein 80"""	191343				9582194	Standard	NM_001135592		Approved	UBCEP80, Uba80, S27A	uc010yow.2	P62979	OTTHUMG00000151919	ENST00000272317.6:c.386G>A	2.37:g.55462628G>A	ENSP00000272317:p.Gly129Glu	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_001135592	P02248|P02249|P02250|P14798|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BQ77|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000272317.6	37	CCDS33202.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929574	0.73327	.	.	ENSG00000143947	ENST00000402285;ENST00000272317;ENST00000404735	T;T;T	0.80393	-1.37;-1.37;-1.37	4.68	4.68	0.58851	Ribosomal protein S27a (1);	0.000000	0.85682	D	0.000000	D	0.85673	0.5751	M	0.92923	3.36	0.80722	D	1	B	0.11235	0.004	B	0.15870	0.014	D	0.85321	0.1084	10	0.54805	T	0.06	.	17.602	0.88028	0.0:0.0:1.0:0.0	.	129	P62979	RS27A_HUMAN	E	129	ENSP00000383981:G129E;ENSP00000272317:G129E;ENSP00000385659:G129E	ENSP00000272317:G129E	G	+	2	0	RPS27A	55316132	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.603000	0.98315	2.143000	0.66587	0.591000	0.81541	GGG	.		0.403	RPS27A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324423.15		
SAA1	6288	hgsc.bcm.edu;broad.mit.edu	37	11	18290820	18290820	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:18290820delG	ENST00000405158.2	+	3	354	c.170delG	c.(169-171)cggfs	p.R57fs	SAA1_ENST00000532858.1_Frame_Shift_Del_p.R57fs|RNA5SP334_ENST00000364825.1_RNA|SAA1_ENST00000356524.4_Frame_Shift_Del_p.R57fs	NM_000331.4	NP_000322	P0DJI8	SAA1_HUMAN	serum amyloid A1	57					acute-phase response (GO:0006953)|innate immune response (GO:0045087)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of inflammatory response (GO:0050728)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of interleukin-1 secretion (GO:0050716)|regulation of protein secretion (GO:0050708)	endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)			endometrium(1)|large_intestine(3)|lung(2)|stomach(3)	9					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	TTCCATGCTCGGGGGAACTAT	0.557																																					p.R57fs		.											.	SAA1	650	0			c.170delG						.						25.0	26.0	26.0					11																	18290820		2196	4270	6466	SO:0001589	frameshift_variant	6288	exon3			ATGCTCGGGGGAA	M10906	CCDS7835.1	11p15.1	2014-01-30			ENSG00000173432	ENSG00000173432		"""Endogenous ligands"""	10513	protein-coding gene	gene with protein product		104750		SAA		2595451, 9305847	Standard	NM_199161		Approved	PIG4, TP53I4	uc021qeo.1	P0DJI8	OTTHUMG00000166147	ENST00000405158.2:c.170delG	11.37:g.18290820delG	ENSP00000384906:p.Arg57fs	Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	60.0	NM_199161	P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Frame_Shift_Del	DEL	ENST00000405158.2	37	CCDS7835.1																																																																																			.		0.557	SAA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395864.1	NM_199161	
SAA2	6289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	18267513	18267513	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:18267513delC	ENST00000526900.1	-	3	357	c.174delG	c.(172-174)gggfs	p.G58fs	SAA2_ENST00000414546.2_Frame_Shift_Del_p.G58fs|SAA2-SAA4_ENST00000524555.1_RNA|SAA2_ENST00000528349.1_Frame_Shift_Del_p.G58fs|RNA5SP333_ENST00000363466.1_RNA|SAA2_ENST00000529528.1_Frame_Shift_Del_p.G58fs|SAA2_ENST00000256733.4_Frame_Shift_Del_p.G58fs|SAA2_ENST00000530400.1_Frame_Shift_Del_p.G58fs			P0DJI9	SAA2_HUMAN	serum amyloid A2	58					acute-phase response (GO:0006953)	extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)				central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(1)	6						CATCATAGTTCCCCCGAGCAT	0.552																																					p.G58fs		.											.	SAA2	514	0			c.174delG						.						76.0	72.0	74.0					11																	18267513		2199	4290	6489	SO:0001589	frameshift_variant	6289	exon3			ATAGTTCCCCCGA	M26152	CCDS7833.1, CCDS44548.1	11p15.1-p14	2008-07-21			ENSG00000134339	ENSG00000134339			10514	protein-coding gene	gene with protein product		104751				7686132	Standard	NM_030754		Approved			P0DJI9	OTTHUMG00000166484	ENST00000526900.1:c.174delG	11.37:g.18267513delC	ENSP00000436126:p.Gly58fs	Somatic	429.0	0.0		WXS	Illumina HiSeq	Phase_I	372.0	60.0	NM_030754	G3XAK9|P02735|P02736|P02737|Q16730|Q16834|Q16835|Q16879|Q3KRB3|Q6FG67|Q96QN0|Q9UCK9|Q9UCL0	Frame_Shift_Del	DEL	ENST00000526900.1	37	CCDS7833.1																																																																																			.		0.552	SAA2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389983.1	NM_030754	
SENP2	59343	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	185318579	185318579	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:185318579G>A	ENST00000296257.5	+	5	625	c.385G>A	c.(385-387)Gac>Aac	p.D129N	SENP2_ENST00000545472.1_Missense_Mutation_p.D119N|SENP2_ENST00000465201.1_3'UTR|SENP2_ENST00000427465.2_5'UTR	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	129					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			TGGAATAAGTGACTATCCAAA	0.343																																					p.D129N		.											.	SENP2	658	0			c.G385A						.						152.0	161.0	158.0					3																	185318579		2203	4300	6503	SO:0001583	missense	59343	exon5			ATAAGTGACTATC	AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.385G>A	3.37:g.185318579G>A	ENSP00000296257:p.Asp129Asn	Somatic	166.0	1.0		WXS	Illumina HiSeq	Phase_I	186.0	89.0	NM_021627	B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	ENST00000296257.5	37	CCDS33902.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384474	0.82792	.	.	ENSG00000163904	ENST00000430355;ENST00000545472;ENST00000296257	T;T	0.23754	1.89;1.9	6.07	4.26	0.50523	.	0.381500	0.25648	N	0.029236	T	0.12220	0.0297	N	0.14661	0.345	0.80722	D	1	B;B	0.29862	0.259;0.259	B;B	0.23716	0.048;0.048	T	0.11991	-1.0565	10	0.16420	T	0.52	-13.3332	9.2212	0.37377	0.139:0.0:0.861:0.0	.	119;129	B4DQ42;Q9HC62	.;SENP2_HUMAN	N	183;119;129	ENSP00000439653:D119N;ENSP00000296257:D129N	ENSP00000296257:D129N	D	+	1	0	SENP2	186801273	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.967000	0.40491	2.890000	0.99128	0.585000	0.79938	GAC	.		0.343	SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345159.1	NM_021627	
SGOL2	151246	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	201400832	201400832	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:201400832G>C	ENST00000357799.4	+	4	452	c.354G>C	c.(352-354)ttG>ttC	p.L118F	SGOL2_ENST00000469840.1_3'UTR|SGOL2_ENST00000409203.3_Missense_Mutation_p.L118F	NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	118					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						ACAATAACTTGATAACTGCAA	0.294																																					p.L118F		.											.	SGOL2	94	0			c.G354C						.						131.0	131.0	131.0					2																	201400832		1813	4058	5871	SO:0001583	missense	151246	exon4			TAACTTGATAACT	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.354G>C	2.37:g.201400832G>C	ENSP00000350447:p.Leu118Phe	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	40.0	NM_001160046	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	37	CCDS42796.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216060	0.58452	.	.	ENSG00000163535	ENST00000357799;ENST00000409203	T;T	0.65178	-0.14;-0.14	5.34	3.48	0.39840	.	0.000000	0.43110	D	0.000604	T	0.70037	0.3178	M	0.66939	2.045	0.31308	N	0.687501	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.73380	0.98;0.98;0.98;0.974	T	0.70547	-0.4842	10	0.72032	D	0.01	-1.3662	2.0135	0.03493	0.172:0.1518:0.52:0.1561	.	118;118;118;118	B7Z7S9;Q562F6-2;Q562F6;Q562F6-3	.;.;SGOL2_HUMAN;.	F	118	ENSP00000350447:L118F;ENSP00000386249:L118F	ENSP00000350447:L118F	L	+	3	2	SGOL2	201109077	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	0.877000	0.28106	0.766000	0.33244	0.655000	0.94253	TTG	.		0.294	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
SHC4	399694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49148299	49148299	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr15:49148299G>A	ENST00000332408.4	-	8	1521	c.1093C>T	c.(1093-1095)Cat>Tat	p.H365Y	SHC4_ENST00000537958.1_Missense_Mutation_p.H79Y|SHC4_ENST00000396535.3_Missense_Mutation_p.H122Y	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	365	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TCCTCGGCATGGCTATCAATA	0.448																																					p.H365Y		.											.	SHC4	95	0			c.C1093T						.						137.0	129.0	132.0					15																	49148299		2197	4294	6491	SO:0001583	missense	399694	exon8			CGGCATGGCTATC	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1093C>T	15.37:g.49148299G>A	ENSP00000329668:p.His365Tyr	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	37.0	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	37	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	4.357	0.065842	0.08388	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.30182	3.55;1.54;1.55	5.14	0.673	0.17941	.	1.508310	0.03699	N	0.248252	T	0.15089	0.0364	N	0.08118	0	0.09310	N	1	B;B	0.30709	0.291;0.035	B;B	0.25884	0.064;0.009	T	0.18366	-1.0339	10	0.62326	D	0.03	-6.9214	2.2079	0.03940	0.1485:0.1126:0.3831:0.3559	.	122;365	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	Y	365;122;79	ENSP00000329668:H365Y;ENSP00000379786:H122Y;ENSP00000443300:H79Y	ENSP00000329668:H365Y	H	-	1	0	SHC4	46935591	0.003000	0.15002	0.002000	0.10522	0.041000	0.13682	0.523000	0.22925	0.010000	0.14839	0.655000	0.94253	CAT	.		0.448	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
SHOX2	6474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	157820591	157820591	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:157820591C>T	ENST00000425436.3	-	2	456	c.431G>A	c.(430-432)cGg>cAg	p.R144Q	SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000490689.2_Missense_Mutation_p.R15Q|SHOX2_ENST00000483851.2_Missense_Mutation_p.R144Q|SHOX2_ENST00000389589.4_Missense_Mutation_p.R168Q|SHOX2_ENST00000441443.2_Missense_Mutation_p.R15Q	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	144					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			GAAATTGGTCCGACTTCGCCT	0.567																																					p.R168Q		.											.	SHOX2	90	0			c.G503A						.						185.0	150.0	162.0					3																	157820591		2203	4300	6503	SO:0001583	missense	6474	exon3			TTGGTCCGACTTC	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.431G>A	3.37:g.157820591C>T	ENSP00000398704:p.Arg144Gln	Somatic	264.0	1.0		WXS	Illumina HiSeq	Phase_I	202.0	95.0	NM_003030	O60465|O60467|O60903	Missense_Mutation	SNP	ENST00000425436.3	37	CCDS43164.1	.	.	.	.	.	.	.	.	.	.	C	36	5.790320	0.96945	.	.	ENSG00000168779;ENSG00000168779;ENSG00000168779;ENSG00000168779;ENSG00000168779;ENSG00000258518	ENST00000425436;ENST00000490689;ENST00000389589;ENST00000313019;ENST00000441443;ENST00000483851	D;D;D;D;D	0.99150	-5.49;-5.49;-5.49;-5.49;-5.49	5.49	5.49	0.81192	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000001	D	0.99664	0.9875	H	0.98833	4.345	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.986;0.999;1.0	D	0.97355	0.9966	10	0.87932	D	0	.	19.3594	0.94431	0.0:1.0:0.0:0.0	.	144;168;144	O60902-2;O60902-3;O60902	.;.;SHOX2_HUMAN	Q	168;15;144;15;15;144	ENSP00000398704:R168Q;ENSP00000451888:R15Q;ENSP00000374240:R144Q;ENSP00000397099:R15Q;ENSP00000419362:R144Q	ENSP00000327294:R15Q	R	-	2	0	SHOX2;AC112502.1	159303285	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.576000	0.86940	0.655000	0.94253	CGG	.		0.567	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352057.2		
SHPRH	257218	broad.mit.edu;bcgsc.ca	37	6	146248354	146248354	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:146248354T>C	ENST00000367505.2	-	15	3436	c.3172A>G	c.(3172-3174)Aaa>Gaa	p.K1058E	SHPRH_ENST00000367503.3_Missense_Mutation_p.K1067E|SHPRH_ENST00000275233.7_Missense_Mutation_p.K1058E|SHPRH_ENST00000438092.2_Missense_Mutation_p.K1067E			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1058					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		AGTTTTCCTTTGTGTTCCTCC	0.333																																					p.K1067E		.											.	SHPRH	92	0			c.A3199G						.						140.0	122.0	128.0					6																	146248354		1842	4089	5931	SO:0001583	missense	257218	exon15			TTCCTTTGTGTTC	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.3172A>G	6.37:g.146248354T>C	ENSP00000356475:p.Lys1058Glu	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	5.0	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	T	21.5	4.151267	0.78001	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.74526	-0.85;-0.84;-0.82;-0.85	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	L	0.28400	0.85	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.83275	0.99;0.996	T	0.67059	-0.5766	10	0.10377	T	0.69	-24.3633	15.9985	0.80270	0.0:0.0:0.0:1.0	.	1058;1067	Q149N8;Q149N8-4	SHPRH_HUMAN;.	E	1058;1067;1067;1058	ENSP00000356475:K1058E;ENSP00000356473:K1067E;ENSP00000412797:K1067E;ENSP00000275233:K1058E	ENSP00000275233:K1058E	K	-	1	0	SHPRH	146290047	1.000000	0.71417	0.997000	0.53966	0.946000	0.59487	7.674000	0.83992	2.233000	0.73108	0.455000	0.32223	AAA	.		0.333	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
SLC12A5	57468	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	44686186	44686186	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr20:44686186T>G	ENST00000454036.2	+	26	3411	c.3362T>G	c.(3361-3363)cTg>cGg	p.L1121R	SLC12A5_ENST00000243964.3_Missense_Mutation_p.L1098R	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1121					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	ACAGAGCACCTGGACCGGGTG	0.677																																					p.L1121R		.											.	SLC12A5	156	0			c.T3362G						.						49.0	54.0	52.0					20																	44686186		2203	4300	6503	SO:0001583	missense	57468	exon26			AGCACCTGGACCG	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3362T>G	20.37:g.44686186T>G	ENSP00000387694:p.Leu1121Arg	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	67.0	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	37	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.941138	0.73557	.	.	ENSG00000124140	ENST00000454036;ENST00000243964	T;T	0.60672	0.17;0.17	4.24	4.24	0.50183	.	0.175663	0.38720	N	0.001585	T	0.80199	0.4579	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.947;0.998	D	0.85025	0.0914	10	0.87932	D	0	.	12.6986	0.57018	0.0:0.0:0.0:1.0	.	1121;1098	Q9H2X9;Q9H2X9-2	S12A5_HUMAN;.	R	1121;1098	ENSP00000387694:L1121R;ENSP00000243964:L1098R	ENSP00000243964:L1098R	L	+	2	0	SLC12A5	44119593	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.637000	0.67854	1.778000	0.52293	0.454000	0.30748	CTG	.		0.677	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
SLC39A13	91252	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47436693	47436693	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:47436693G>T	ENST00000362021.4	+	9	1065	c.1023G>T	c.(1021-1023)ttG>ttT	p.L341F	SLC39A13_ENST00000524928.1_3'UTR|SLC39A13_ENST00000533076.1_3'UTR|SLC39A13_ENST00000354884.4_Missense_Mutation_p.L334F	NM_001128225.2	NP_001121697	Q96H72	S39AD_HUMAN	solute carrier family 39 (zinc transporter), member 13	341					cellular zinc ion homeostasis (GO:0006882)|connective tissue development (GO:0061448)|zinc ion transmembrane transport (GO:0071577)	Golgi apparatus (GO:0005794)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|kidney(1)|lung(1)|prostate(1)	4				Lung(87;0.0936)		CTGACCTCTTGGAAGAAGAGG	0.632																																					p.L341F		.											.	SLC39A13	90	0			c.G1023T						.						43.0	40.0	41.0					11																	47436693		2201	4297	6498	SO:0001583	missense	91252	exon9			CCTCTTGGAAGAA		CCDS7934.1, CCDS44592.1	11p11.2	2013-05-22			ENSG00000165915	ENSG00000165915		"""Solute carriers"""	20859	protein-coding gene	gene with protein product		608735	"""solute carrier family 39 (metal ion transporter), member 13"""			12659941	Standard	NM_001128225		Approved	FLJ25785	uc009ylq.3	Q96H72	OTTHUMG00000166890	ENST00000362021.4:c.1023G>T	11.37:g.47436693G>T	ENSP00000354689:p.Leu341Phe	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	48.0	NM_001128225	D3DQR6|D3DQR7|E9PLY1|E9PQV3|Q659D9|Q8N7C9|Q8WV10	Missense_Mutation	SNP	ENST00000362021.4	37	CCDS44592.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.691759	0.68271	.	.	ENSG00000165915	ENST00000362021;ENST00000354884	T;T	0.51574	0.7;0.7	5.46	4.55	0.56014	.	0.072955	0.56097	D	0.000022	T	0.69296	0.3095	M	0.89478	3.035	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.981	T	0.71341	-0.4622	10	0.45353	T	0.12	-16.5436	8.6848	0.34232	0.2285:0.0:0.7715:0.0	.	341;334	Q96H72;Q96H72-2	S39AD_HUMAN;.	F	341;334	ENSP00000354689:L341F;ENSP00000346956:L334F	ENSP00000346956:L334F	L	+	3	2	SLC39A13	47393269	0.998000	0.40836	1.000000	0.80357	0.968000	0.65278	0.471000	0.22100	1.303000	0.44873	0.462000	0.41574	TTG	.		0.632	SLC39A13-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395652.1	NM_152264	
SLC44A5	204962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	75805298	75805298	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:75805298C>A	ENST00000370855.5	-	4	183	c.70G>T	c.(70-72)Gac>Tac	p.D24Y	SLC44A5_ENST00000535611.1_5'UTR|SLC44A5_ENST00000370859.3_Missense_Mutation_p.D24Y|SLC44A5_ENST00000469525.1_5'UTR	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	24					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						AAATCTGGGTCATATGTCCTT	0.343																																					p.D24Y		.											.	SLC44A5	95	0			c.G70T						.						198.0	218.0	211.0					1																	75805298		2203	4300	6503	SO:0001583	missense	204962	exon4			CTGGGTCATATGT	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.70G>T	1.37:g.75805298C>A	ENSP00000359892:p.Asp24Tyr	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	14.0	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	37	CCDS667.1	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083835	0.36758	.	.	ENSG00000137968	ENST00000370859;ENST00000536707;ENST00000370855;ENST00000535790	T;T	0.44482	0.92;0.92	5.54	4.62	0.57501	.	0.221145	0.44688	D	0.000432	T	0.57548	0.2061	M	0.85197	2.74	0.54753	D	0.99998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.996;0.993;0.992;0.997	T	0.66031	-0.6024	10	0.87932	D	0	-4.9098	10.5386	0.45020	0.0:0.9103:0.0:0.0897	.	18;63;24;24	B7Z5Y4;B7Z470;Q8NCS7;Q8NCS7-2	.;.;CTL5_HUMAN;.	Y	24;63;24;17	ENSP00000359896:D24Y;ENSP00000359892:D24Y	ENSP00000359892:D24Y	D	-	1	0	SLC44A5	75577886	0.872000	0.30054	0.058000	0.19502	0.574000	0.36063	1.692000	0.37731	1.468000	0.48064	0.650000	0.86243	GAC	.		0.343	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
SLC4A4	8671	broad.mit.edu;bcgsc.ca	37	4	72412081	72412081	+	Silent	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:72412081T>C	ENST00000264485.5	+	19	2574	c.2457T>C	c.(2455-2457)taT>taC	p.Y819Y	SLC4A4_ENST00000425175.1_Silent_p.Y819Y|SLC4A4_ENST00000351898.6_Intron|SLC4A4_ENST00000340595.3_Silent_p.Y775Y	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	819					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	GAGCAGGGTATCACTTGGATC	0.443																																					p.Y819Y		.											.	SLC4A4	95	0			c.T2457C						.						253.0	208.0	223.0					4																	72412081		2203	4300	6503	SO:0001819	synonymous_variant	8671	exon19			AGGGTATCACTTG	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2457T>C	4.37:g.72412081T>C		Somatic	160.0	1.0		WXS	Illumina HiSeq	Phase_I	149.0	6.0	NM_001098484	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Silent	SNP	ENST00000264485.5	37	CCDS43236.1																																																																																			.		0.443	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
SLFN12	55106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33749277	33749277	+	Silent	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:33749277G>T	ENST00000394562.1	-	4	1294	c.771C>A	c.(769-771)ctC>ctA	p.L257L	SLFN12_ENST00000460530.1_5'Flank|SLFN12_ENST00000304905.5_Silent_p.L257L|SLFN12_ENST00000452764.3_Silent_p.L257L			Q8IYM2	SLN12_HUMAN	schlafen family member 12	257							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTAAGTCATCGAGGTCACTCA	0.338																																					p.L257L		.											.	SLFN12	91	0			c.C771A						.						84.0	89.0	87.0					17																	33749277		2203	4300	6503	SO:0001819	synonymous_variant	55106	exon2			GTCATCGAGGTCA	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.771C>A	17.37:g.33749277G>T		Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	60.0	NM_018042	A8K711|Q9NP47	Silent	SNP	ENST00000394562.1	37	CCDS11295.1																																																																																			.		0.338	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042	
SORL1	6653	ucsc.edu;bcgsc.ca	37	11	121474906	121474906	+	Silent	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr11:121474906A>G	ENST00000260197.7	+	33	4653	c.4524A>G	c.(4522-4524)acA>acG	p.T1508T	SORL1_ENST00000532694.1_Silent_p.T354T|SORL1_ENST00000525532.1_Silent_p.T452T|SORL1_ENST00000527934.1_Silent_p.T123T|SORL1_ENST00000534286.1_Silent_p.T418T	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1508	LDL-receptor class A 10. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TTTCAGCCACACACAGCACCT	0.562																																					p.T1508T		.											.	SORL1	228	0			c.A4524G						.						135.0	130.0	132.0					11																	121474906		2203	4299	6502	SO:0001819	synonymous_variant	6653	exon33			AGCCACACACAGC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.4524A>G	11.37:g.121474906A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_003105	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	37	CCDS8436.1																																																																																			.		0.562	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
SPATA20	64847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48629417	48629417	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:48629417G>A	ENST00000356488.4	+	13	1868	c.1785G>A	c.(1783-1785)gcG>gcA	p.A595A	SPATA20_ENST00000393244.3_Silent_p.A551A|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000006658.6_Silent_p.A611A	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	595					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGGAGAGTGCGTGGCTCGAGT	0.657																																					p.A611A		.											.	SPATA20	90	0			c.G1833A						.						31.0	35.0	33.0					17																	48629417		2202	4299	6501	SO:0001819	synonymous_variant	64847	exon14			GAGTGCGTGGCTC		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1785G>A	17.37:g.48629417G>A		Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	81.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	ENST00000356488.4	37	CCDS58563.1																																																																																			.		0.657	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152583243	152583243	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:152583243C>A	ENST00000367255.5	-	101	19497	c.18896G>T	c.(18895-18897)tGg>tTg	p.W6299L	SYNE1_ENST00000341594.5_Missense_Mutation_p.W5911L|SYNE1_ENST00000265368.4_Missense_Mutation_p.W6299L|SYNE1_ENST00000448038.1_Missense_Mutation_p.W6228L|SYNE1_ENST00000356820.4_Missense_Mutation_p.W823L|SYNE1_ENST00000423061.1_Missense_Mutation_p.W6228L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6299					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TAGGCTTTCCCATTTCATTCT	0.373										HNSCC(10;0.0054)																											p.W6299L		.											.	SYNE1	607	0			c.G18896T						.						157.0	144.0	148.0					6																	152583243		2203	4300	6503	SO:0001583	missense	23345	exon101			CTTTCCCATTTCA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.18896G>T	6.37:g.152583243C>A	ENSP00000356224:p.Trp6299Leu	Somatic	238.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	49.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982397	0.93044	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	D;D;D;D;D;T	0.86865	-2.09;-2.12;-2.18;-2.1;-1.56;0.05	5.96	5.96	0.96718	.	0.000000	0.56097	D	0.000035	D	0.92198	0.7526	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.89072	0.3470	10	0.32370	T	0.25	.	20.4192	0.99033	0.0:1.0:0.0:0.0	.	6299;6299;6228	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	L	6299;6228;6299;6228;5911;823	ENSP00000356224:W6299L;ENSP00000396024:W6228L;ENSP00000265368:W6299L;ENSP00000390975:W6228L;ENSP00000341887:W5911L;ENSP00000349276:W823L	ENSP00000265368:W6299L	W	-	2	0	SYNE1	152624936	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.439000	0.73430	2.831000	0.97527	0.650000	0.86243	TGG	.		0.373	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64518635	64518635	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr14:64518635G>T	ENST00000344113.4	+	48	8216	c.8004G>T	c.(8002-8004)ttG>ttT	p.L2668F	SYNE2_ENST00000554584.1_Missense_Mutation_p.L2701F|SYNE2_ENST00000358025.3_Missense_Mutation_p.L2668F|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2668					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGATTGCCTTGACCACTGACC	0.453																																					p.L2668F		.											.	SYNE2	164	0			c.G8004T						.						102.0	103.0	103.0					14																	64518635		1970	4153	6123	SO:0001583	missense	23224	exon48			TGCCTTGACCACT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.8004G>T	14.37:g.64518635G>T	ENSP00000341781:p.Leu2668Phe	Somatic	291.0	0.0		WXS	Illumina HiSeq	Phase_I	252.0	126.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	4.015	0.000139	0.07819	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.59224	0.65;0.66;0.28	5.68	2.39	0.29439	.	0.797647	0.10644	N	0.650623	T	0.51398	0.1672	L	0.27053	0.805	0.18873	N	0.999986	P;P	0.50272	0.933;0.919	P;P	0.48704	0.462;0.587	T	0.40776	-0.9545	10	0.62326	D	0.03	.	9.9368	0.41556	0.2556:0.0:0.7444:0.0	.	2668;2668	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	F	2668;2668;2701;2701	ENSP00000350719:L2668F;ENSP00000341781:L2668F;ENSP00000452570:L2701F	ENSP00000261678:L2701F	L	+	3	2	SYNE2	63588388	0.058000	0.20735	0.032000	0.17829	0.036000	0.12997	1.632000	0.37102	0.730000	0.32425	0.563000	0.77884	TTG	.		0.453	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SYT3	84258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51133064	51133064	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:51133064G>T	ENST00000338916.4	-	3	1672	c.1039C>A	c.(1039-1041)Cgc>Agc	p.R347S	SYT3_ENST00000593901.1_Missense_Mutation_p.R347S|SYT3_ENST00000544769.1_Missense_Mutation_p.R347S|SYT3_ENST00000600079.1_Missense_Mutation_p.R347S	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	347	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		TTTTTCTTGCGGTCAGGCAGC	0.622																																					p.R347S		.											.	SYT3	155	0			c.C1039A						.						61.0	61.0	61.0					19																	51133064		2203	4300	6503	SO:0001583	missense	84258	exon3			TCTTGCGGTCAGG	AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1039C>A	19.37:g.51133064G>T	ENSP00000340914:p.Arg347Ser	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	6.0	NM_032298	Q8N5Z1|Q8N640	Missense_Mutation	SNP	ENST00000338916.4	37	CCDS12798.1	.	.	.	.	.	.	.	.	.	.	G	19.21	3.783077	0.70222	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.08546	3.08;3.08	4.67	4.67	0.58626	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	U	0.000011	T	0.19644	0.0472	L	0.38692	1.165	0.58432	D	0.999997	D	0.76494	0.999	D	0.66602	0.945	T	0.00978	-1.1493	10	0.87932	D	0	.	16.7093	0.85381	0.0:0.0:1.0:0.0	.	347	Q9BQG1	SYT3_HUMAN	S	347	ENSP00000340914:R347S;ENSP00000438883:R347S	ENSP00000340914:R347S	R	-	1	0	SYT3	55824876	1.000000	0.71417	0.998000	0.56505	0.783000	0.44284	2.641000	0.46587	2.301000	0.77427	0.655000	0.94253	CGC	.		0.622	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464910.1	NM_032298	
TBC1D14	57533	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	7026792	7026792	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:7026792T>C	ENST00000409757.4	+	13	1943	c.1819T>C	c.(1819-1821)Ttc>Ctc	p.F607L	TBC1D14_ENST00000410031.1_Missense_Mutation_p.F379L|TBC1D14_ENST00000448507.1_Missense_Mutation_p.F607L|TBC1D14_ENST00000451522.2_Missense_Mutation_p.F327L|TBC1D14_ENST00000446947.2_Missense_Mutation_p.F254L	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	607	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						CTGGGACGTGTTCTGTCGCGA	0.498																																					p.F607L		.											.	TBC1D14	92	0			c.T1819C						.						174.0	159.0	164.0					4																	7026792		2203	4300	6503	SO:0001583	missense	57533	exon13			GACGTGTTCTGTC	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1819T>C	4.37:g.7026792T>C	ENSP00000386921:p.Phe607Leu	Somatic	276.0	1.0		WXS	Illumina HiSeq	Phase_I	203.0	47.0	NM_001113361	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	ENST00000409757.4	37	CCDS3394.2	.	.	.	.	.	.	.	.	.	.	T	22.4	4.280978	0.80692	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522;ENST00000446947	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	5.15	5.15	0.70609	Rab-GAP/TBC domain (4);	0.049635	0.85682	D	0.000000	T	0.27278	0.0669	L	0.42632	1.34	0.80722	D	1	P;B;B	0.42375	0.778;0.357;0.226	B;B;P	0.47528	0.399;0.219;0.549	T	0.01496	-1.1340	10	0.45353	T	0.12	-24.8858	14.1839	0.65592	0.0:0.0:0.0:1.0	.	254;327;607	F5GXK4;Q9P2M4-2;Q9P2M4	.;.;TBC14_HUMAN	L	607;607;379;327;254	ENSP00000404041:F607L;ENSP00000386921:F607L;ENSP00000386343:F379L;ENSP00000388886:F327L;ENSP00000405875:F254L	ENSP00000386921:F607L	F	+	1	0	TBC1D14	7077693	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.658000	0.83755	1.953000	0.56701	0.459000	0.35465	TTC	.		0.498	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773	
TCF7L1	83439	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	85361140	85361140	+	Splice_Site	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:85361140C>A	ENST00000282111.3	+	2	526	c.251C>A	c.(250-252)gCg>gAg	p.A84E		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	84					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						CCTCCGCAGGCGGAGAGGCGC	0.692																																					p.A84E		.											.	TCF7L1	585	0			c.C251A						.						18.0	24.0	22.0					2																	85361140		2201	4299	6500	SO:0001630	splice_region_variant	83439	exon2			CGCAGGCGGAGAG	X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.250-1C>A	2.37:g.85361140C>A		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	24.0	NM_031283	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000282111.3	37	CCDS1971.1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671724	0.67928	.	.	ENSG00000152284	ENST00000282111	D	0.98777	-5.13	4.11	3.2	0.36748	CTNNB1 binding, N-teminal (1);	0.222293	0.37669	N	0.001996	D	0.97235	0.9096	M	0.68317	2.08	0.32570	N	0.529866	P	0.43169	0.8	P	0.45881	0.496	D	0.95871	0.8891	10	0.33141	T	0.24	.	4.9863	0.14190	0.2109:0.677:0.0:0.112	.	84	Q9HCS4	TF7L1_HUMAN	E	84	ENSP00000282111:A84E	ENSP00000282111:A84E	A	+	2	0	TCF7L1	85214651	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.685000	0.61693	0.665000	0.31066	0.462000	0.41574	GCG	.		0.692	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252301.2	NM_031283	Missense_Mutation
TELO2	9894	hgsc.bcm.edu;bcgsc.ca	37	16	1551758	1551758	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr16:1551758G>C	ENST00000262319.6	+	11	1735	c.1456G>C	c.(1456-1458)Gac>Cac	p.D486H	TELO2_ENST00000564507.1_3'UTR	NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	486					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				GGCGGGCTCTGACTCGGACCT	0.697																																					p.D486H		.											.	TELO2	90	0			c.G1456C						.						31.0	37.0	35.0					16																	1551758		2197	4299	6496	SO:0001583	missense	9894	exon11			GGCTCTGACTCGG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.1456G>C	16.37:g.1551758G>C	ENSP00000262319:p.Asp486His	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	12.0	NM_016111	D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	ENST00000262319.6	37	CCDS32363.1	.	.	.	.	.	.	.	.	.	.	G	13.20	2.167598	0.38315	.	.	ENSG00000100726	ENST00000437914;ENST00000262319	T	0.19806	2.12	5.08	3.09	0.35607	.	0.182951	0.56097	D	0.000023	T	0.38639	0.1048	M	0.74258	2.255	0.09310	N	0.999997	D	0.76494	0.999	D	0.65443	0.935	T	0.08106	-1.0738	10	0.48119	T	0.1	-10.842	7.215	0.25955	0.1996:0.0:0.8004:0.0	.	486	Q9Y4R8	TELO2_HUMAN	H	100;486	ENSP00000262319:D486H	ENSP00000262319:D486H	D	+	1	0	TELO2	1491759	0.363000	0.24989	0.032000	0.17829	0.211000	0.24417	3.391000	0.52530	1.283000	0.44513	0.655000	0.94253	GAC	.		0.697	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
TMEM175	84286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	944240	944240	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:944240C>A	ENST00000264771.4	+	4	409	c.224C>A	c.(223-225)gCa>gAa	p.A75E	TMEM175_ENST00000504180.1_3'UTR|TMEM175_ENST00000515740.1_5'UTR|TMEM175_ENST00000508204.1_5'UTR	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	75						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			AGGCTTCTGGCAACACGGATT	0.577																																					p.A75E		.											.	TMEM175	90	0			c.C224A						.						130.0	113.0	119.0					4																	944240		2203	4300	6503	SO:0001583	missense	84286	exon4			TTCTGGCAACACG	BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.224C>A	4.37:g.944240C>A	ENSP00000264771:p.Ala75Glu	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	44.0	NM_032326	D3DVN4|Q8ND13	Missense_Mutation	SNP	ENST00000264771.4	37	CCDS3341.1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.418695	0.42918	.	.	ENSG00000127419	ENST00000507319;ENST00000264771;ENST00000514453;ENST00000514546	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	4.9	4.9	0.64082	.	0.331079	0.28252	N	0.016034	T	0.50548	0.1622	L	0.46157	1.445	0.80722	D	1	D	0.64830	0.994	P	0.61658	0.892	T	0.35051	-0.9804	10	0.15066	T	0.55	-22.9253	13.6304	0.62191	0.0:1.0:0.0:0.0	.	75	Q9BSA9	TM175_HUMAN	E	74;75;62;75	ENSP00000424746:A74E;ENSP00000264771:A75E;ENSP00000425181:A62E;ENSP00000425763:A75E	ENSP00000264771:A75E	A	+	2	0	TMEM175	934240	0.998000	0.40836	0.929000	0.37066	0.014000	0.08584	3.836000	0.55813	2.290000	0.77057	0.549000	0.68633	GCA	.		0.577	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239193.2	NM_032326	
TMPPE	643853	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33134374	33134374	+	Silent	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr3:33134374C>G	ENST00000342462.4	-	2	1504	c.1314G>C	c.(1312-1314)ctG>ctC	p.L438L	GLB1_ENST00000399402.3_Intron|GLB1_ENST00000445488.2_Intron|TMPPE_ENST00000416695.2_Silent_p.L301L|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Intron	NM_001039770.2	NP_001034859.2	Q6ZT21	TMPPE_HUMAN	transmembrane protein with metallophosphoesterase domain	438						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|large_intestine(5)|lung(6)|prostate(1)	13						CCCTGCTACCCAGCCTCATGG	0.602																																					p.L438L		.											.	TMPPE	90	0			c.G1314C						.						57.0	54.0	55.0					3																	33134374		2203	4300	6503	SO:0001819	synonymous_variant	643853	exon2			GCTACCCAGCCTC	AK126979	CCDS33732.1, CCDS46786.1	3p22.3	2014-02-12	2009-02-24		ENSG00000188167	ENSG00000188167			33865	protein-coding gene	gene with protein product							Standard	NM_001039770		Approved	FLJ45032	uc003cfk.2	Q6ZT21	OTTHUMG00000155779	ENST00000342462.4:c.1314G>C	3.37:g.33134374C>G		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	15.0	NM_001039770	B2RNG5|Q6ZRG1	Silent	SNP	ENST00000342462.4	37	CCDS33732.1																																																																																			.		0.602	TMPPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341566.1	NM_001039770	
TOM1	10043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	35717981	35717981	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr22:35717981A>G	ENST00000449058.2	+	3	292	c.167A>G	c.(166-168)aAg>aGg	p.K56R	TOM1_ENST00000411850.1_Missense_Mutation_p.K56R|TOM1_ENST00000436462.2_Intron|TOM1_ENST00000382034.5_5'UTR|TOM1_ENST00000425375.1_Missense_Mutation_p.K56R|TOM1_ENST00000447733.1_Missense_Mutation_p.K23R	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	56	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						GCAGTAAAGAAGAGAATCGTG	0.527																																					p.K56R		.											.	TOM1	91	0			c.A167G						.						128.0	113.0	118.0					22																	35717981		2203	4300	6503	SO:0001583	missense	10043	exon3			TAAAGAAGAGAAT	AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.167A>G	22.37:g.35717981A>G	ENSP00000394466:p.Lys56Arg	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	24.0	NM_001135732	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	ENST00000449058.2	37	CCDS13913.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.772105	0.90108	.	.	ENSG00000100284	ENST00000447733;ENST00000456128;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000450839;ENST00000451197;ENST00000443206	T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6	5.03	5.03	0.67393	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.046850	0.85682	D	0.000000	T	0.34424	0.0897	L	0.35341	1.055	0.80722	D	1	P;P;P;D	0.56035	0.834;0.888;0.823;0.974	B;P;B;P	0.51516	0.188;0.624;0.298;0.672	T	0.06162	-1.0842	10	0.42905	T	0.14	-30.0149	14.7793	0.69754	1.0:0.0:0.0:0.0	.	56;56;56;56	O60784-3;B4DKQ5;O60784-2;O60784	.;.;.;TOM1_HUMAN	R	23;56;56;56;56;56;56;23	ENSP00000398876:K23R;ENSP00000393714:K56R;ENSP00000394466:K56R;ENSP00000413697:K56R;ENSP00000394924:K56R;ENSP00000389789:K23R	ENSP00000338422:K56R	K	+	2	0	TOM1	34047981	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.389000	0.79806	1.895000	0.54865	0.459000	0.35465	AAG	.		0.527	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320641.1	NM_005488	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000455263.2_Missense_Mutation_p.R273H|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				p.R273H	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,brain,glioma,-1	TP53	70225	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	c.G818A	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576	.						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CAAACACGCACCT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	27.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	C|0.002;G|0.998		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TREM2	54209	broad.mit.edu;bcgsc.ca	37	6	41126794	41126794	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr6:41126794C>T	ENST00000373113.3	-	4	586	c.493G>A	c.(493-495)Gaa>Aaa	p.E165K	TREM2_ENST00000338469.3_Intron|TREM2_ENST00000373122.4_Missense_Mutation_p.G178E	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2	165					axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					ATTTCTCCTTCCAAGAGGCTC	0.542																																					p.E165K		.											.	TREM2	91	0			c.G493A						.						34.0	39.0	37.0					6																	41126794		2203	4300	6503	SO:0001583	missense	54209	exon4			CTCCTTCCAAGAG	AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.493G>A	6.37:g.41126794C>T	ENSP00000362205:p.Glu165Lys	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	8.0	NM_018965	Q8N5H8|Q8WYN6	Missense_Mutation	SNP	ENST00000373113.3	37	CCDS4852.1	.	.	.	.	.	.	.	.	.	.	C	10.31	1.315648	0.23908	.	.	ENSG00000095970	ENST00000373113	T	0.38722	1.12	3.81	2.93	0.34026	.	0.575698	0.15819	N	0.243089	T	0.11537	0.0281	L	0.48362	1.52	0.09310	N	0.999994	B	0.15141	0.012	B	0.09377	0.004	T	0.31998	-0.9923	10	0.06494	T	0.89	-0.6728	6.5454	0.22402	0.0:0.8697:0.0:0.1303	.	165	Q9NZC2	TREM2_HUMAN	K	165	ENSP00000362205:E165K	ENSP00000362205:E165K	E	-	1	0	TREM2	41234772	0.002000	0.14202	0.023000	0.16930	0.072000	0.16883	0.518000	0.22847	2.142000	0.66516	0.643000	0.83706	GAA	.		0.542	TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040499.1	NM_018965	
TRIM13	10206	ucsc.edu;mdanderson.org	37	13	50592279	50592279	+	3'UTR	SNP	T	T	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr13:50592279T>C	ENST00000378182.3	+	0	6941				TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_Intron|KCNRG_ENST00000312942.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		AAAATAAGTTTAAACTTTATA	0.299																																					.		.											.	TRIM13	228	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			TAAGTTTAAACTT	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*4979T>C	13.37:g.50592279T>C		Somatic	284.0	0.0		WXS	Illumina HiSeq	.	95.0	69.0	.	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	SNP	ENST00000378182.3	37	CCDS9423.1																																																																																			.		0.299	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
TRIM54	57159	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27528584	27528584	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:27528584G>C	ENST00000380075.2	+	5	1082	c.742G>C	c.(742-744)Ggc>Cgc	p.G248R	TRIM54_ENST00000296098.4_Missense_Mutation_p.G290R	NM_187841.2	NP_912730.2	Q9BYV2	TRI54_HUMAN	tripartite motif containing 54	248					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|negative regulation of microtubule depolymerization (GO:0007026)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCGCGTCCGCGGCCTCATCCG	0.632																																					p.G290R		.											.	TRIM54	227	0			c.G868C						.						34.0	32.0	33.0					2																	27528584		2202	4300	6502	SO:0001583	missense	57159	exon6			GTCCGCGGCCTCA	AJ291714	CCDS1745.2, CCDS1746.2	2p23.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000138100	ENSG00000138100		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16008	protein-coding gene	gene with protein product		606474	"""ring finger protein 30"", ""tripartite motif-containing 54"""	RNF30		11243782	Standard	NM_032546		Approved	MURF, MURF-3	uc002rjn.3	Q9BYV2	OTTHUMG00000097078	ENST00000380075.2:c.742G>C	2.37:g.27528584G>C	ENSP00000369415:p.Gly248Arg	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	33.0	NM_032546	A5D8T7|Q53SY4|Q9BYV3	Missense_Mutation	SNP	ENST00000380075.2	37	CCDS1746.2	.	.	.	.	.	.	.	.	.	.	G	15.64	2.894559	0.52121	.	.	ENSG00000138100	ENST00000380075;ENST00000380073;ENST00000296098	T;T	0.40225	1.24;1.04	4.85	3.04	0.35103	.	0.386929	0.26867	N	0.022083	T	0.43478	0.1249	L	0.46157	1.445	0.18873	N	0.999989	P;P	0.41366	0.488;0.747	B;P	0.52823	0.357;0.71	T	0.20438	-1.0275	10	0.33141	T	0.24	-14.4805	4.6928	0.12788	0.1859:0.0:0.6429:0.1711	.	248;290	Q9BYV2;Q9BYV2-2	TRI54_HUMAN;.	R	248;69;290	ENSP00000369415:G248R;ENSP00000296098:G290R	ENSP00000296098:G290R	G	+	1	0	TRIM54	27382088	0.002000	0.14202	0.852000	0.33557	0.858000	0.48976	0.624000	0.24462	0.461000	0.27071	-0.291000	0.09656	GGC	.		0.632	TRIM54-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214199.2	NM_187841	
TRMT44	152992	hgsc.bcm.edu;broad.mit.edu	37	4	8469838	8469838	+	Silent	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr4:8469838C>T	ENST00000389737.4	+	9	1692	c.1692C>T	c.(1690-1692)gtC>gtT	p.V564V	TRMT44_ENST00000513449.2_Silent_p.V323V	NM_152544.2	NP_689757.2	Q8IYL2	TRM44_HUMAN	tRNA methyltransferase 44 homolog (S. cerevisiae)	564					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										ACGCCAGGGTCGGGTGTGTAA	0.632																																					p.V564V		.											.	.	.	0			c.C1692T						.						36.0	34.0	35.0					4																	8469838		2203	4300	6503	SO:0001819	synonymous_variant	152992	exon9			CAGGGTCGGGTGT	AK093044	CCDS3402.1, CCDS3402.2	4p16.1	2012-06-12	2012-06-12	2012-06-12	ENSG00000155275	ENSG00000155275			26653	protein-coding gene	gene with protein product	"""tRNA methyltransferase 44 homolog (S. cerevisiae)"""	614309	"""chromosome 4 open reading frame 23"", ""methyltransferase like 19"""	C4orf23, METTL19		21658913	Standard	NM_152544		Approved	FLJ35725, TRM44	uc003glg.2	Q8IYL2	OTTHUMG00000160935	ENST00000389737.4:c.1692C>T	4.37:g.8469838C>T		Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	5.0	NM_152544	Q8NA95	Silent	SNP	ENST00000389737.4	37	CCDS3402.2																																																																																			.		0.632	TRMT44-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359197.2	NM_152544	
TYRO3	7301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41865515	41865515	+	Silent	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr15:41865515G>A	ENST00000263798.3	+	17	2219	c.1995G>A	c.(1993-1995)gaG>gaA	p.E665E	TYRO3_ENST00000559066.1_Silent_p.E620E	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	665	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGCTGGCAGAGGACATGACAG	0.557																																					p.E665E		.											.	TYRO3	1388	0			c.G1995A						.						211.0	212.0	212.0					15																	41865515		2203	4300	6503	SO:0001819	synonymous_variant	7301	exon17			GGCAGAGGACATG	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1995G>A	15.37:g.41865515G>A		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	12.0	NM_006293	O14953|Q86VR3	Silent	SNP	ENST00000263798.3	37	CCDS10080.1																																																																																			.		0.557	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		
VPS13A	23230	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	79824389	79824389	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr9:79824389C>T	ENST00000360280.3	+	6	696	c.436C>T	c.(436-438)Cag>Tag	p.Q146*	VPS13A_ENST00000376634.4_Nonsense_Mutation_p.Q146*|VPS13A_ENST00000376636.3_Nonsense_Mutation_p.Q146*|VPS13A_ENST00000357409.5_Nonsense_Mutation_p.Q146*	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	146					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ATTAGTTACACAGATCATAAA	0.254																																					p.Q146X		.											.	VPS13A	161	0			c.C436T						.						38.0	40.0	39.0					9																	79824389		2203	4290	6493	SO:0001587	stop_gained	23230	exon6			GTTACACAGATCA	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.436C>T	9.37:g.79824389C>T	ENSP00000353422:p.Gln146*	Somatic	332.0	0.0		WXS	Illumina HiSeq	Phase_I	233.0	127.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Nonsense_Mutation	SNP	ENST00000360280.3	37	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	C	38	6.912853	0.97928	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.4521	0.94872	0.0:1.0:0.0:0.0	.	.	.	.	X	146	.	ENSP00000349985:Q146X	Q	+	1	0	VPS13A	79014209	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.182000	0.77689	2.703000	0.92315	0.655000	0.94253	CAG	.		0.254	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
VWA5B1	127731	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	20657389	20657389	+	Missense_Mutation	SNP	C	C	A	rs372275354		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:20657389C>A	ENST00000375079.2	+	11	1681	c.1485C>A	c.(1483-1485)aaC>aaA	p.N495K	VWA5B1_ENST00000289815.8_Missense_Mutation_p.N495K|VWA5B1_ENST00000289825.4_Missense_Mutation_p.N212K|VWA5B1_ENST00000375083.4_Missense_Mutation_p.N495K	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	495	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TTGGACCCAACGTCTGCCACA	0.557																																					p.N495K		.											.	.	.	0			c.C1485A						.						76.0	71.0	73.0					1																	20657389		692	1591	2283	SO:0001583	missense	127731	exon11			ACCCAACGTCTGC	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.1485C>A	1.37:g.20657389C>A	ENSP00000364220:p.Asn495Lys	Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	81.0	NM_001039500	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	37		.	.	.	.	.	.	.	.	.	.	C	3.122	-0.180229	0.06380	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000289825;ENST00000375079	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	5.19	-3.76	0.04359	von Willebrand factor, type A (3);	0.693341	0.14842	N	0.295238	T	0.03477	0.0100	N	0.25144	0.715	0.21984	N	0.999432	B;B;B	0.26081	0.027;0.056;0.141	B;B;B	0.23716	0.048;0.024;0.028	T	0.43814	-0.9368	10	0.13470	T	0.59	-5.6013	2.9084	0.05728	0.1154:0.3275:0.108:0.4491	.	495;495;212	Q5TIE3;Q5TIE3-2;Q5TIE3-3	VW5B1_HUMAN;.;.	K	495;495;495;212;495	ENSP00000289815:N495K;ENSP00000364224:N495K;ENSP00000289825:N212K;ENSP00000364220:N495K	ENSP00000289815:N495K	N	+	3	2	VWA5B1	20529976	0.000000	0.05858	0.893000	0.35052	0.983000	0.72400	-2.824000	0.00747	-0.282000	0.09128	-0.152000	0.13540	AAC	.		0.557	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
WAPAL	23063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	88206050	88206050	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr10:88206050C>T	ENST00000298767.5	-	16	3743	c.3271G>A	c.(3271-3273)Gaa>Aaa	p.E1091K	WAPAL_ENST00000484070.1_5'Flank|WAPAL_ENST00000372075.1_Missense_Mutation_p.E303K|WAPAL_ENST00000263070.7_Missense_Mutation_p.E303K	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	1091	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TGTTTCTCTTCTGTACCATCA	0.388																																					p.E1091K		.											.	WAPAL	91	0			c.G3271A						.						186.0	185.0	186.0					10																	88206050		2203	4300	6503	SO:0001583	missense	23063	exon16			TCTCTTCTGTACC	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.3271G>A	10.37:g.88206050C>T	ENSP00000298767:p.Glu1091Lys	Somatic	261.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	104.0	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	37	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300015	0.60195	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T;T;T	0.36520	1.25;1.25;1.25	5.51	5.51	0.81932	Armadillo-type fold (1);	0.269247	0.36628	N	0.002493	T	0.37489	0.1005	L	0.48642	1.525	0.54753	D	0.999989	P;B;P;B	0.37864	0.61;0.06;0.61;0.447	B;B;B;B	0.40982	0.345;0.018;0.345;0.168	T	0.06899	-1.0801	10	0.13853	T	0.58	.	19.4394	0.94811	0.0:1.0:0.0:0.0	.	1085;1129;1091;1128	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	K	1176;1091;1176;303;303	ENSP00000298767:E1091K;ENSP00000361145:E303K;ENSP00000263070:E303K	ENSP00000263070:E303K	E	-	1	0	WAPAL	88196030	1.000000	0.71417	0.984000	0.44739	0.994000	0.84299	3.385000	0.52485	2.581000	0.87130	0.655000	0.94253	GAA	.		0.388	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
WIF1	11197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	65448938	65448938	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr12:65448938G>C	ENST00000286574.4	-	9	1352	c.978C>G	c.(976-978)tgC>tgG	p.C326W		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	326	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		CTTGACATTGGCATTTGTTGG	0.393			T	HMGA2	pleomorphic salivary gland adenoma																																p.C326W	Esophageal Squamous(148;1595 1816 48559 49439 49664)	.		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	WIF1	1110	0			c.C978G						.						92.0	87.0	89.0					12																	65448938		2203	4300	6503	SO:0001583	missense	11197	exon9			ACATTGGCATTTG	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.978C>G	12.37:g.65448938G>C	ENSP00000286574:p.Cys326Trp	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	24.0	NM_007191	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	37	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851565	0.51270	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	D;D	0.99984	-11.36;-6.54	5.71	3.89	0.44902	EGF, extracellular (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99986	0.9997	H	0.95611	3.695	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.96261	0.9191	9	.	.	.	.	9.9417	0.41585	0.2071:0.0:0.7929:0.0	.	326	Q9Y5W5	WIF1_HUMAN	W	326;75	ENSP00000286574:C326W;ENSP00000439024:C75W	.	C	-	3	2	WIF1	63735205	1.000000	0.71417	0.998000	0.56505	0.601000	0.36947	3.540000	0.53611	0.887000	0.36136	0.655000	0.94253	TGC	.		0.393	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168100239	168100239	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr2:168100239G>T	ENST00000409195.1	+	9	2426	c.2337G>T	c.(2335-2337)ttG>ttT	p.L779F	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.L557F|XIRP2_ENST00000295237.9_Missense_Mutation_p.L779F|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	604					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CACAGCCGTTGGACACAATTA	0.408																																					p.L779F		.											.	XIRP2	104	0			c.G2337T						.						70.0	66.0	67.0					2																	168100239		1860	4098	5958	SO:0001583	missense	129446	exon9			GCCGTTGGACACA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2337G>T	2.37:g.168100239G>T	ENSP00000386840:p.Leu779Phe	Somatic	305.0	0.0		WXS	Illumina HiSeq	Phase_I	230.0	114.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	37	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718542	0.30503	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.57907	0.37;0.37;0.37	5.92	-0.957	0.10350	.	0.000000	0.64402	D	0.000001	T	0.63510	0.2517	M	0.77486	2.375	0.49389	D	0.999786	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.59847	-0.7377	10	0.87932	D	0	-4.3371	2.694	0.05129	0.413:0.1095:0.366:0.1114	.	604;604;557	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	F	779;779;557	ENSP00000386840:L779F;ENSP00000295237:L779F;ENSP00000387255:L557F	ENSP00000295237:L779F	L	+	3	2	XIRP2	167808485	0.566000	0.26618	0.346000	0.25655	0.605000	0.37080	-0.080000	0.11339	-0.499000	0.06623	-0.355000	0.07637	TTG	.		0.408	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
ZBTB40	9923	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22816452	22816452	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr1:22816452C>G	ENST00000375647.4	+	2	218	c.11C>G	c.(10-12)cCc>cGc	p.P4R	ZBTB40_ENST00000374651.4_Missense_Mutation_p.P4R|ZBTB40_ENST00000404138.1_Missense_Mutation_p.P4R	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	4					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		ATGGAGCTCCCCAACTACAGC	0.532																																					p.P4R		.											.	ZBTB40	91	0			c.C11G						.						61.0	65.0	64.0					1																	22816452		2203	4299	6502	SO:0001583	missense	9923	exon3			AGCTCCCCAACTA	AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.11C>G	1.37:g.22816452C>G	ENSP00000364798:p.Pro4Arg	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	25.0	NM_001083621	O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	ENST00000375647.4	37	CCDS224.1	.	.	.	.	.	.	.	.	.	.	C	31	5.074472	0.94000	.	.	ENSG00000184677	ENST00000404138;ENST00000374649;ENST00000375647;ENST00000400239;ENST00000374651	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.56	5.56	0.83823	BTB/POZ fold (2);	0.000000	0.52532	D	0.000066	D	0.86522	0.5953	M	0.87900	2.915	0.47214	D	0.999358	D;D	0.89917	1.0;0.999	D;D	0.75484	0.986;0.956	D	0.88536	0.3106	10	0.87932	D	0	-18.7881	18.0968	0.89493	0.0:1.0:0.0:0.0	.	4;4	F8WAI8;Q9NUA8	.;ZBT40_HUMAN	R	4	ENSP00000384527:P4R;ENSP00000364798:P4R;ENSP00000383098:P4R;ENSP00000363782:P4R	ENSP00000363780:P4R	P	+	2	0	ZBTB40	22689039	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.766000	0.85320	2.604000	0.88044	0.591000	0.81541	CCC	.		0.532	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008094.1	NM_014870	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	77618337	77618337	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr8:77618337G>A	ENST00000521891.2	+	2	2462	c.2014G>A	c.(2014-2016)Ggc>Agc	p.G672S	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.G672S|ZFHX4_ENST00000455469.2_Missense_Mutation_p.G672S|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G672S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	672					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G672C(1)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGAGCCGGGTGGCTCTTGTGT	0.498										HNSCC(33;0.089)																											p.G672S		.											.	ZFHX4	98	1	Substitution - Missense(1)	lung(1)	c.G2014A						.						49.0	54.0	52.0					8																	77618337		1998	4193	6191	SO:0001583	missense	79776	exon2			CCGGGTGGCTCTT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.2014G>A	8.37:g.77618337G>A	ENSP00000430497:p.Gly672Ser	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	8.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	18.19	3.570096	0.65765	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50813	0.73;0.8;0.77;0.76	5.3	5.3	0.74995	.	0.000000	0.45361	U	0.000367	T	0.58133	0.2101	L	0.41236	1.265	0.80722	D	1	D;D;D;B	0.69078	0.996;0.997;0.997;0.328	P;D;D;B	0.68353	0.907;0.957;0.957;0.413	T	0.45175	-0.9279	10	0.12430	T	0.62	.	19.15	0.93483	0.0:0.0:1.0:0.0	.	672;672;672;672	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	S	672	ENSP00000430497:G672S;ENSP00000399605:G672S;ENSP00000050961:G672S;ENSP00000430848:G672S	ENSP00000050961:G672S	G	+	1	0	ZFHX4	77780892	1.000000	0.71417	0.968000	0.41197	0.996000	0.88848	9.657000	0.98554	2.750000	0.94351	0.655000	0.94253	GGC	.		0.498	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZNF229	7772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44934591	44934591	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr19:44934591C>G	ENST00000588931.1	-	6	798	c.365G>C	c.(364-366)tGt>tCt	p.C122S	ZNF229_ENST00000291187.4_Missense_Mutation_p.C116S|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000591289.1_Intron	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				ATTTACTCTACAGTCTTGGCT	0.443																																					p.C122S		.											.	ZNF229	94	0			c.G365C						.						80.0	78.0	79.0					19																	44934591		1874	4089	5963	SO:0001583	missense	7772	exon6			ACTCTACAGTCTT	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.365G>C	19.37:g.44934591C>G	ENSP00000466519:p.Cys122Ser	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	25.0	NM_014518	B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	ENST00000588931.1	37	CCDS42574.1	.	.	.	.	.	.	.	.	.	.	C	0.308	-0.969550	0.02232	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.33	-6.65	0.01795	.	.	.	.	.	T	0.14141	0.0342	N	0.12746	0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08889	-1.0700	8	0.21014	T	0.42	.	3.3636	0.07196	0.0871:0.4048:0.2242:0.284	.	122	Q9UJW7	ZN229_HUMAN	S	122	.	ENSP00000291187:C122S	C	-	2	0	ZNF229	49626431	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.896000	0.00172	-3.665000	0.00124	-0.198000	0.12761	TGT	.		0.443	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518	
ZNF521	25925	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	22806650	22806650	+	Missense_Mutation	SNP	T	T	C	rs533662951		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr18:22806650T>C	ENST00000361524.3	-	4	1380	c.1232A>G	c.(1231-1233)aAc>aGc	p.N411S	ZNF521_ENST00000538137.2_Missense_Mutation_p.N411S|ZNF521_ENST00000584787.1_Missense_Mutation_p.N191S|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	411					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TAATTGTTTGTTGCAGTAAAT	0.443			T	PAX5	ALL								T|||	1	0.000199681	0.0	0.0	5008	,	,		22222	0.0		0.0	False		,,,				2504	0.001				p.N411S		.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	275	0			c.A1232G						.						92.0	91.0	91.0					18																	22806650		2203	4300	6503	SO:0001583	missense	25925	exon4			TGTTTGTTGCAGT	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1232A>G	18.37:g.22806650T>C	ENSP00000354794:p.Asn411Ser	Somatic	275.0	2.0		WXS	Illumina HiSeq	Phase_I	197.0	112.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	37	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	T	6.523	0.464735	0.12402	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.07688	3.17;3.22	6.16	2.55	0.30701	Zinc finger, C2H2-like (1);	0.140918	0.64402	N	0.000005	T	0.02418	0.0074	N	0.01352	-0.895	0.24716	N	0.993173	B	0.02656	0.0	B	0.04013	0.001	T	0.42865	-0.9426	10	0.27082	T	0.32	-36.6138	5.7734	0.18265	0.0:0.1992:0.13:0.6708	.	411	Q96K83	ZN521_HUMAN	S	411;445;411	ENSP00000354794:N411S;ENSP00000382352:N411S	ENSP00000354794:N411S	N	-	2	0	ZNF521	21060648	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.195000	0.51013	0.558000	0.29135	0.528000	0.53228	AAC	.		0.443	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
HGF	3082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	81339555	81339556	+	Missense_Mutation	DNP	GG	GG	TT	rs375872396		TCGA-BC-A217-01A-11D-A152-10	TCGA-BC-A217-10A-01D-A152-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	2bff30d5-be79-4686-8164-7a7d9619d3c0	b12f2a60-b900-4c83-9b9e-d1f6bbd469f9	g.chr7:81339555_81339556GG>TT	ENST00000222390.5	-	13	1674_1675	c.1448_1449CC>AA	c.(1447-1449)cCC>cAA	p.P483Q	HGF_ENST00000457544.2_Missense_Mutation_p.P478Q	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	483					activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						AAGATATTACGGGATCTGAAAC	0.317																																					p.P483Q		.											.	.	.	0			.						.																																			SO:0001583	missense	3082	.			TATTACGGGATCT		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.1448_1449delinsTT	7.37:g.81339555_81339556delinsTT	ENSP00000222390:p.Pro483Gln	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	58.0	.	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	DNP	ENST00000222390.5	37	CCDS5597.1																																																																																			.		0.317	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
