#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA8	10351	hgsc.bcm.edu;bcgsc.ca	37	17	66879991	66879991	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:66879991A>G	ENST00000269080.2	-	27	3665	c.3528T>C	c.(3526-3528)acT>acC	p.T1176T	ABCA8_ENST00000430352.2_Silent_p.T1216T|ABCA8_ENST00000586539.1_Silent_p.T1216T	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1176					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					GACATCGAAGAGTAAAAAGAA	0.284																																					p.T1176T		.											.	ABCA8	93	0			c.T3528C						.						47.0	47.0	47.0					17																	66879991		2203	4297	6500	SO:0001819	synonymous_variant	10351	exon27			TCGAAGAGTAAAA	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3528T>C	17.37:g.66879991A>G		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	5.0	NM_007168	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	ENST00000269080.2	37	CCDS11680.1																																																																																			.		0.284	ABCA8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450172.1	NM_007168	
ABHD12	26090	hgsc.bcm.edu;bcgsc.ca	37	20	25300910	25300910	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:25300910T>C	ENST00000339157.5	-	4	739	c.467A>G	c.(466-468)gAc>gGc	p.D156G	ABHD12_ENST00000376542.3_Missense_Mutation_p.D156G	NM_001042472.2	NP_001035937.1	Q8N2K0	ABD12_HUMAN	abhydrolase domain containing 12	156					adult walking behavior (GO:0007628)|phosphatidylserine catabolic process (GO:0006660)|response to auditory stimulus (GO:0010996)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)	acylglycerol lipase activity (GO:0047372)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	12						CCACATCTGGTCTTTGCCTTG	0.567																																					p.D156G		.											.	ABHD12	91	0			c.A467G						.						151.0	105.0	120.0					20																	25300910		2203	4300	6503	SO:0001583	missense	26090	exon4			ATCTGGTCTTTGC	AL117442	CCDS13172.1, CCDS42857.1	20p11.21	2007-04-24	2006-03-10	2006-03-10	ENSG00000100997	ENSG00000100997		"""Abhydrolase domain containing"""	15868	protein-coding gene	gene with protein product		613599	"""chromosome 20 open reading frame 22"""	C20orf22			Standard	NM_015600		Approved	DKFZP434P106, dJ965G21.2, BEM46L2, ABHD12A	uc002wuq.3	Q8N2K0	OTTHUMG00000032121	ENST00000339157.5:c.467A>G	20.37:g.25300910T>C	ENSP00000341408:p.Asp156Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_001042472	A6NED4|A6NJ90|A8K450|B4DE71|Q5T710|Q5T711|Q96CR1|Q9BX05|Q9NPX7|Q9UFV6	Missense_Mutation	SNP	ENST00000339157.5	37	CCDS42857.1	.	.	.	.	.	.	.	.	.	.	T	16.94	3.261354	0.59431	.	.	ENSG00000100997	ENST00000376542;ENST00000339157;ENST00000526543;ENST00000450393	T;T;T	0.56444	0.46;0.46;0.46	5.75	4.66	0.58398	.	0.393509	0.32785	N	0.005660	T	0.47097	0.1427	L	0.55743	1.74	0.58432	D	0.999996	B;P;P	0.43287	0.024;0.688;0.802	B;B;B	0.40477	0.03;0.095;0.33	T	0.36939	-0.9727	10	0.30854	T	0.27	-0.0022	11.0318	0.47779	0.0:0.0728:0.0:0.9272	.	111;156;156	Q5T712;Q8N2K0;Q8N2K0-2	.;ABD12_HUMAN;.	G	156;156;118;111	ENSP00000365725:D156G;ENSP00000341408:D156G;ENSP00000413311:D111G	ENSP00000341408:D156G	D	-	2	0	ABHD12	25248910	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.899000	0.56288	1.030000	0.39839	0.533000	0.62120	GAC	.		0.567	ABHD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078423.2	NM_015600	
ADAMTS9	56999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	64617541	64617541	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:64617541C>G	ENST00000498707.1	-	15	2578	c.2236G>C	c.(2236-2238)Ggt>Cgt	p.G746R	ADAMTS9_ENST00000295903.4_Missense_Mutation_p.G718R	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	746	Cys-rich.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTATCGCCACCACAAACCCCA	0.358																																					p.G746R		.											.	ADAMTS9	230	0			c.G2236C						.						119.0	118.0	118.0					3																	64617541		2202	4300	6502	SO:0001583	missense	56999	exon15			CGCCACCACAAAC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.2236G>C	3.37:g.64617541C>G	ENSP00000418735:p.Gly746Arg	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	46.0	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265563	0.95399	.	.	ENSG00000163638	ENST00000295903;ENST00000498707	T;T	0.68025	-0.3;-0.3	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.81545	0.4845	M	0.63169	1.94	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;P	0.97110	0.997;1.0;1.0;0.882	T	0.80567	-0.1325	10	0.59425	D	0.04	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	718;746;746;746	B7ZVX9;Q9P2N4-2;Q9P2N4-1;Q9P2N4	.;.;.;ATS9_HUMAN	R	718;746	ENSP00000295903:G718R;ENSP00000418735:G746R	ENSP00000295903:G718R	G	-	1	0	ADAMTS9	64592581	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	GGT	.		0.358	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
CARF	79800	hgsc.bcm.edu;bcgsc.ca	37	2	203834662	203834662	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:203834662A>G	ENST00000402905.3	+	10	1295	c.974A>G	c.(973-975)cAg>cGg	p.Q325R	WDR12_ENST00000477723.1_Intron|CARF_ENST00000428585.1_Missense_Mutation_p.Q249R|CARF_ENST00000438828.2_Missense_Mutation_p.Q325R|CARF_ENST00000545253.1_Missense_Mutation_p.Q237R|CARF_ENST00000456821.2_3'UTR|CARF_ENST00000414439.1_Missense_Mutation_p.Q223R|CARF_ENST00000545262.1_Missense_Mutation_p.Q249R|CARF_ENST00000320443.8_Missense_Mutation_p.Q325R	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	325					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AAAAAGGTACAGAAGTTTCCT	0.299																																					p.Q325R		.											.	ALS2CR8	136	0			c.A974G						.						59.0	53.0	54.0					2																	203834662		1786	4059	5845	SO:0001583	missense	79800	exon11			AGGTACAGAAGTT	AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.974A>G	2.37:g.203834662A>G	ENSP00000384006:p.Gln325Arg	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_024744	B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Missense_Mutation	SNP	ENST00000402905.3	37	CCDS42801.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.884843	0.33255	.	.	ENSG00000138380	ENST00000402905;ENST00000414439;ENST00000428585;ENST00000545253;ENST00000545262;ENST00000320443;ENST00000438828	.	.	.	5.12	5.12	0.69794	.	0.078378	0.53938	D	0.000054	T	0.27134	0.0665	N	0.08118	0	0.33720	D	0.616834	B;B;B	0.30455	0.118;0.118;0.28	B;B;B	0.31442	0.13;0.09;0.09	T	0.33828	-0.9853	9	0.10636	T	0.68	-5.8278	14.0921	0.64998	1.0:0.0:0.0:0.0	.	237;249;325	B4DIA7;G3V1K7;Q8N187	.;.;AL2S8_HUMAN	R	325;223;249;237;249;325;325	.	ENSP00000316224:Q325R	Q	+	2	0	ALS2CR8	203542907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.588000	0.60999	1.915000	0.55452	0.528000	0.53228	CAG	.		0.299	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335768.5	NM_001104586	
ANKRD12	23253	hgsc.bcm.edu;bcgsc.ca	37	18	9255794	9255794	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:9255794A>G	ENST00000262126.4	+	9	2769	c.2529A>G	c.(2527-2529)aaA>aaG	p.K843K	ANKRD12_ENST00000400020.3_Silent_p.K820K|ANKRD12_ENST00000383440.2_Silent_p.K820K	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	843						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CCTTTGAAAAAGAAAAGAAGA	0.294																																					p.K843K		.											.	ANKRD12	92	0			c.A2529G						.						25.0	27.0	26.0					18																	9255794		2194	4280	6474	SO:0001819	synonymous_variant	23253	exon9			TGAAAAAGAAAAG	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2529A>G	18.37:g.9255794A>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	4.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	ENST00000262126.4	37	CCDS11843.1																																																																																			.		0.294	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANKRD26	22852	hgsc.bcm.edu;broad.mit.edu	37	10	27349321	27349321	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:27349321A>G	ENST00000376087.4	-	15	1682	c.1517T>C	c.(1516-1518)gTt>gCt	p.V506A	ANKRD26_ENST00000436985.2_Missense_Mutation_p.V522A	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	506					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TTTATTTGGAACAGAATCTTT	0.284																																					p.V506A		.											.	ANKRD26	138	0			c.T1517C						.						106.0	103.0	104.0					10																	27349321		1803	4069	5872	SO:0001583	missense	22852	exon15			TTTGGAACAGAAT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1517T>C	10.37:g.27349321A>G	ENSP00000365255:p.Val506Ala	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	5.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.072952	0.36566	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.36157	1.35;1.27	4.5	0.6	0.17524	.	1.170640	0.06861	U	0.799102	T	0.30978	0.0782	L	0.51422	1.61	0.09310	N	1	B;B;B	0.14012	0.002;0.001;0.009	B;B;B	0.12156	0.006;0.003;0.007	T	0.34750	-0.9816	10	0.62326	D	0.03	.	4.0926	0.09976	0.4988:0.1815:0.3197:0.0	.	506;506;522	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	A	506;522	ENSP00000365255:V506A;ENSP00000405112:V522A	ENSP00000365255:V506A	V	-	2	0	ANKRD26	27389327	0.106000	0.21978	0.052000	0.19188	0.846000	0.48090	1.273000	0.33121	-0.148000	0.11234	0.260000	0.18958	GTT	.		0.284	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
ANKRD34C	390616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	79587136	79587136	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:79587136A>T	ENST00000558647.2	+	1	1510	c.1510A>T	c.(1510-1512)Aga>Tga	p.R504*	ANKRD34C_ENST00000421388.2_Nonsense_Mutation_p.R504*			P0C6C1	AN34C_HUMAN	ankyrin repeat domain 34C	504										endometrium(3)|kidney(1)|skin(1)	5						TTCACCAAAGAGAGTTGACTT	0.393																																					p.R504X		.											.	.	.	0			c.A1510T						.						57.0	45.0	48.0					15																	79587136		685	1584	2269	SO:0001587	stop_gained	390616	exon2			CCAAAGAGAGTTG		CCDS53965.1	15q25.1	2013-01-10			ENSG00000235711	ENSG00000235711		"""Ankyrin repeat domain containing"""	33888	protein-coding gene	gene with protein product							Standard	NM_001146341		Approved		uc002bet.3	P0C6C1		ENST00000558647.2:c.1510A>T	15.37:g.79587136A>T	ENSP00000454921:p.Arg504*	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	36.0	NM_001146341	H3BNM1	Nonsense_Mutation	SNP	ENST00000558647.2	37	CCDS53965.1	.	.	.	.	.	.	.	.	.	.	A	38	7.209483	0.98136	.	.	ENSG00000235711	ENST00000421388	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.487	0.33078	0.8034:0.1966:0.0:0.0	.	.	.	.	X	504	.	ENSP00000401089:R504X	R	+	1	2	ANKRD34C	77374191	1.000000	0.71417	0.985000	0.45067	0.218000	0.24690	1.285000	0.33261	1.966000	0.57179	0.533000	0.62120	AGA	.		0.393	ANKRD34C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416713.2	NM_001146341	
AP2A2	161	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	992671	992671	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:992671A>T	ENST00000448903.2	+	11	1579	c.1438A>T	c.(1438-1440)Aag>Tag	p.K480*	AP2A2_ENST00000332231.5_Nonsense_Mutation_p.K481*|AP2A2_ENST00000534328.1_Intron	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	480					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTACGCGGCCAAGACTGTGTT	0.577																																					p.K481X		.											.	AP2A2	90	0			c.A1441T						.						94.0	92.0	93.0					11																	992671		2173	4253	6426	SO:0001587	stop_gained	161	exon11			GCGGCCAAGACTG	AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1438A>T	11.37:g.992671A>T	ENSP00000413234:p.Lys480*	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	65.0	NM_001242837	O75403|Q53ET1|Q96SI8	Nonsense_Mutation	SNP	ENST00000448903.2	37	CCDS44512.1	.	.	.	.	.	.	.	.	.	.	A	38	7.273358	0.98179	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000529125;ENST00000452310	.	.	.	3.5	3.5	0.40072	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.4067	12.7311	0.57199	1.0:0.0:0.0:0.0	.	.	.	.	X	480;481;481;217;220	.	ENSP00000327694:K481X	K	+	1	0	AP2A2	982671	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	9.190000	0.94934	1.560000	0.49568	0.379000	0.24179	AAG	.		0.577	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385431.2	NM_012305	
AP3B1	8546	hgsc.bcm.edu;bcgsc.ca	37	5	77471657	77471657	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:77471657A>G	ENST00000255194.6	-	10	1221	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	AP3B1_ENST00000519295.1_Missense_Mutation_p.V300A	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	349					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		AATATACTGCACCTCCCTAGA	0.308									Hermansky-Pudlak syndrome																												p.V349A		.											.	AP3B1	90	0			c.T1046C						.						134.0	142.0	139.0					5																	77471657		2202	4296	6498	SO:0001583	missense	8546	exon10	Familial Cancer Database	HPS, HPS1-8	TACTGCACCTCCC	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1046T>C	5.37:g.77471657A>G	ENSP00000255194:p.Val349Ala	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	4.0	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	37	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	A	17.85	3.489424	0.64074	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.18810	2.19;2.19	4.82	4.82	0.62117	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.120339	0.56097	D	0.000034	T	0.24736	0.0600	L	0.58925	1.835	0.58432	D	0.999999	P	0.37370	0.592	B	0.37091	0.241	T	0.05115	-1.0905	10	0.62326	D	0.03	-13.7065	14.3773	0.66886	1.0:0.0:0.0:0.0	.	349	O00203	AP3B1_HUMAN	A	349;300;349;253	ENSP00000255194:V349A;ENSP00000430597:V300A	ENSP00000255194:V349A	V	-	2	0	AP3B1	77507413	1.000000	0.71417	0.986000	0.45419	0.988000	0.76386	8.962000	0.93254	1.797000	0.52628	0.383000	0.25322	GTG	.		0.308	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
AQR	9716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	35222481	35222481	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:35222481T>A	ENST00000156471.5	-	12	1217	c.992A>T	c.(991-993)tAt>tTt	p.Y331F		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	331					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		AATTCTATCATAGTGAATTGT	0.323																																					p.Y331F		.											.	AQR	135	0			c.A992T						.						147.0	141.0	143.0					15																	35222481		1816	4072	5888	SO:0001583	missense	9716	exon12			CTATCATAGTGAA	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.992A>T	15.37:g.35222481T>A	ENSP00000156471:p.Tyr331Phe	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	10.0	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.973549	0.92919	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.94650	-3.48	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.97832	0.9288	M	0.93854	3.465	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	D	0.98019	1.0370	10	0.37606	T	0.19	-17.9983	16.1448	0.81559	0.0:0.0:0.0:1.0	.	331	O60306	AQR_HUMAN	F	331	ENSP00000156471:Y331F	ENSP00000156471:Y331F	Y	-	2	0	AQR	33009773	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.920000	0.87521	2.216000	0.71823	0.482000	0.46254	TAT	.		0.323	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
ARID1B	57492	hgsc.bcm.edu;bcgsc.ca	37	6	157256613	157256613	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:157256613A>G	ENST00000350026.5	+	4	1902	c.1901A>G	c.(1900-1902)gAa>gGa	p.E634G	ARID1B_ENST00000275248.4_Missense_Mutation_p.E576G|ARID1B_ENST00000346085.5_Missense_Mutation_p.E647G|ARID1B_ENST00000367148.1_Missense_Mutation_p.E634G	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	634					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ATGTCTCAGGAAGGCTATGGA	0.368																																					p.E647G		.											.	ARID1B	154	0			c.A1940G						.						174.0	163.0	167.0					6																	157256613		2203	4300	6503	SO:0001583	missense	57492	exon5			CTCAGGAAGGCTA	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.1901A>G	6.37:g.157256613A>G	ENSP00000055163:p.Glu634Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	ENST00000350026.5	37	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	A	22.4	4.284890	0.80803	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000535255;ENST00000414678;ENST00000319584	T;T;T;T;T;T	0.22945	4.62;4.64;4.67;4.67;4.33;1.93	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000004	T	0.32645	0.0836	L	0.38175	1.15	0.41782	D	0.989823	D;D;D;D	0.89917	0.99;0.999;1.0;1.0	D;D;D;D	0.80764	0.972;0.986;0.994;0.994	T	0.14420	-1.0473	10	0.72032	D	0.01	.	15.9855	0.80147	1.0:0.0:0.0:0.0	.	4;634;647;576	F5H333;Q8NFD5;Q8NFD5-2;G3XAA0	.;ARI1B_HUMAN;.;.	G	647;634;634;576;55;4;133;56	ENSP00000344546:E647G;ENSP00000055163:E634G;ENSP00000356116:E634G;ENSP00000275248:E576G;ENSP00000412835:E133G;ENSP00000313006:E56G	ENSP00000275248:E576G	E	+	2	0	ARID1B	157298305	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.141000	0.77330	2.179000	0.69175	0.528000	0.53228	GAA	.		0.368	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
ARID2	196528	hgsc.bcm.edu;bcgsc.ca	37	12	46231166	46231166	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:46231166T>C	ENST00000334344.6	+	9	1258	c.1086T>C	c.(1084-1086)tgT>tgC	p.C362C	ARID2_ENST00000422737.1_Silent_p.C213C|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	362					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TTACAAAATGTCTAATGTCAA	0.303			"""N, S, F"""		hepatocellular carcinoma																																p.C362C		.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	100	0			c.T1086C						.						83.0	91.0	88.0					12																	46231166		2203	4295	6498	SO:0001819	synonymous_variant	196528	exon9			AAAATGTCTAATG		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1086T>C	12.37:g.46231166T>C		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	ENST00000334344.6	37	CCDS31783.1																																																																																			.		0.303	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ATP7B	540	hgsc.bcm.edu;bcgsc.ca	37	13	52532539	52532539	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:52532539T>C	ENST00000242839.4	-	8	2419	c.2263A>G	c.(2263-2265)Aag>Gag	p.K755E	ATP7B_ENST00000344297.5_Intron|ATP7B_ENST00000417240.2_Missense_Mutation_p.K27E|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000418097.2_Missense_Mutation_p.K755E|ATP7B_ENST00000400366.3_Missense_Mutation_p.K644E|ATP7B_ENST00000482841.1_Intron|ATP7B_ENST00000448424.2_Intron|ATP7B_ENST00000542656.1_3'UTR	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	755					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	CTCTCCGCCTTCTCAGCCACA	0.552									Wilson disease																												p.K755E		.											.	ATP7B	92	0			c.A2263G						.						112.0	118.0	116.0					13																	52532539		2081	4217	6298	SO:0001583	missense	540	exon8	Familial Cancer Database		CCGCCTTCTCAGC	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.2263A>G	13.37:g.52532539T>C	ENSP00000242839:p.Lys755Glu	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	5.0	NM_000053	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	ENST00000242839.4	37	CCDS41892.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380353	0.61845	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000417240;ENST00000418097	D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62	5.54	3.12	0.35913	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.340362	0.34986	N	0.003532	D	0.90693	0.7080	L	0.38692	1.165	0.80722	D	1	P;B;B;P	0.38129	0.619;0.0;0.103;0.491	B;B;B;B	0.44108	0.441;0.001;0.024;0.184	D	0.84076	0.0382	10	0.19590	T	0.45	-7.6007	8.1175	0.30953	0.0:0.071:0.1469:0.782	.	755;27;644;755	F5H748;E7EQQ2;P35670-3;P35670	.;.;.;ATP7B_HUMAN	E	755;644;27;755	ENSP00000242839:K755E;ENSP00000383217:K644E;ENSP00000390360:K27E;ENSP00000393343:K755E	ENSP00000242839:K755E	K	-	1	0	ATP7B	51430540	1.000000	0.71417	0.984000	0.44739	0.884000	0.51177	2.560000	0.45896	0.386000	0.24997	0.460000	0.39030	AAG	.		0.552	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045981.1	NM_000053	
ATRX	546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	76856034	76856034	+	Splice_Site	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:76856034C>T	ENST00000373344.5	-	23	5781		c.e23-1		ATRX_ENST00000480283.1_Splice_Site|ATRX_ENST00000395603.3_Splice_Site	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTGCCCACACCTGATCAAAAG	0.353			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														.		.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	248	1	Unknown(1)	bone(1)	c.5567-1G>A						.						162.0	143.0	149.0					X																	76856034		2203	4296	6499	SO:0001630	splice_region_variant	546	exon24			CCACACCTGATCA	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5567-1G>A	X.37:g.76856034C>T		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	47.0	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Splice_Site	SNP	ENST00000373344.5	37	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.413158	0.25465	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	.	.	.	5.05	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1957	0.59736	0.0:0.7029:0.2971:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATRX	76742690	1.000000	0.71417	0.975000	0.42487	0.424000	0.31475	5.696000	0.68287	0.878000	0.35920	-0.347000	0.07816	.	.		0.353	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	Intron
BAZ1A	11177	hgsc.bcm.edu;bcgsc.ca	37	14	35272095	35272095	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:35272095T>C	ENST00000382422.2	-	6	1153	c.826A>G	c.(826-828)Aga>Gga	p.R276G	AL355885.1_ENST00000581314.1_RNA|BAZ1A_ENST00000358716.4_Missense_Mutation_p.R276G|BAZ1A_ENST00000360310.1_Missense_Mutation_p.R276G			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	276					chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		GGTCTCCCTCTTCGTCTGTTA	0.353																																					p.R276G		.											.	BAZ1A	291	0			c.A826G						.						118.0	120.0	119.0					14																	35272095		2203	4300	6503	SO:0001583	missense	11177	exon7			TCCCTCTTCGTCT	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.826A>G	14.37:g.35272095T>C	ENSP00000371859:p.Arg276Gly	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_182648	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	ENST00000382422.2	37	CCDS9651.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.218559	0.39201	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310	T;T;T	0.59638	0.25;0.25;0.25	5.42	4.25	0.50352	.	0.050989	0.85682	D	0.000000	T	0.49423	0.1556	L	0.43152	1.355	0.44562	D	0.997526	P;P	0.46859	0.885;0.817	B;B	0.42495	0.389;0.217	T	0.45512	-0.9256	10	0.41790	T	0.15	.	10.5901	0.45304	0.0:0.0:0.3318:0.6681	.	276;276	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	G	276	ENSP00000351555:R276G;ENSP00000371859:R276G;ENSP00000353458:R276G	ENSP00000351555:R276G	R	-	1	2	BAZ1A	34341846	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.745000	0.38278	0.953000	0.37825	0.533000	0.62120	AGA	.		0.353	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
BDH2	56898	hgsc.bcm.edu;bcgsc.ca	37	4	104013835	104013835	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:104013835A>G	ENST00000296424.4	-	4	290	c.170T>C	c.(169-171)cTt>cCt	p.L57P		NM_020139.3	NP_064524.3	Q9BUT1	BDH2_HUMAN	3-hydroxybutyrate dehydrogenase, type 2	57					epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|heme metabolic process (GO:0042168)|iron ion homeostasis (GO:0055072)|siderophore biosynthetic process (GO:0019290)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|urinary_tract(1)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.02e-08)		TGTGACATCAAGGACACGAGT	0.338																																					p.L57P		.											.	BDH2	90	0			c.T170C						.						76.0	77.0	77.0					4																	104013835		2203	4300	6503	SO:0001583	missense	56898	exon4			ACATCAAGGACAC	AF164790	CCDS3663.1	4q24	2011-09-14			ENSG00000164039	ENSG00000164039	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	32389	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 15C, member 1"""		"""dehydrogenase/reductase (SDR family) member 6"""	DHRS6		16380372, 19027726	Standard	XM_005263140		Approved	UCPA-OR, FLJ13261, UNQ6308, PRO20933, SDR15C1	uc003hwz.3	Q9BUT1	OTTHUMG00000074039	ENST00000296424.4:c.170T>C	4.37:g.104013835A>G	ENSP00000296424:p.Leu57Pro	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	6.0	NM_020139	A8K295|B4DUF6|Q503A0|Q6IA46|Q6UWD3|Q9H8S8|Q9NRX8	Missense_Mutation	SNP	ENST00000296424.4	37	CCDS3663.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.831689	0.50845	.	.	ENSG00000164039	ENST00000296424;ENST00000504285;ENST00000509245	T;D;D	0.88354	1.77;-2.37;-2.37	4.83	4.83	0.62350	NAD(P)-binding domain (1);	0.128387	0.48286	D	0.000183	D	0.93913	0.8052	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94619	0.7811	10	0.87932	D	0	.	13.7077	0.62651	1.0:0.0:0.0:0.0	.	57	Q9BUT1	BDH2_HUMAN	P	57	ENSP00000296424:L57P;ENSP00000427442:L57P;ENSP00000422891:L57P	ENSP00000296424:L57P	L	-	2	0	BDH2	104233284	1.000000	0.71417	0.199000	0.23439	0.395000	0.30598	7.419000	0.80179	1.942000	0.56320	0.459000	0.35465	CTT	.		0.338	BDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157159.2	NM_020139	
BIN2	51411	hgsc.bcm.edu;bcgsc.ca	37	12	51693495	51693495	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:51693495T>C	ENST00000267012.4	-	6	473	c.412A>G	c.(412-414)Aga>Gga	p.R138G	BIN2_ENST00000544402.1_Missense_Mutation_p.R112G|BIN2_ENST00000452142.2_Missense_Mutation_p.R106G|BIN2_ENST00000604560.1_Missense_Mutation_p.R111G	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	138	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						TTGGCAATTCTCTCCTGACCC	0.507																																					p.R138G		.											.	BIN2	91	0			c.A412G						.						94.0	91.0	92.0					12																	51693495		2203	4300	6503	SO:0001583	missense	51411	exon6			CAATTCTCTCCTG	AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.412A>G	12.37:g.51693495T>C	ENSP00000267012:p.Arg138Gly	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_016293	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	ENST00000267012.4	37	CCDS8811.1	.	.	.	.	.	.	.	.	.	.	T	18.84	3.710147	0.68730	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	T;T;T	0.64260	-0.09;-0.09;-0.09	5.05	3.83	0.44106	BAR (3);	0.000000	0.85682	D	0.000000	T	0.77294	0.4109	M	0.83774	2.66	0.36007	D	0.837806	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.69824	0.958;0.962;0.966	D	0.83569	0.0111	10	0.66056	D	0.02	-9.568	10.3602	0.43989	0.0:0.0:0.1637:0.8363	.	112;106;138	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	G	106;138;112	ENSP00000410217:R106G;ENSP00000267012:R138G;ENSP00000445874:R112G	ENSP00000267012:R138G	R	-	1	2	BIN2	49979762	0.996000	0.38824	1.000000	0.80357	0.855000	0.48748	1.901000	0.39838	2.260000	0.74910	0.533000	0.62120	AGA	.		0.507	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000469800.1		
LRRC74A	145497	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	77292857	77292857	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:77292857T>C	ENST00000393774.3	+	1	143	c.19T>C	c.(19-21)Tca>Cca	p.S7P	C14orf166B_ENST00000460005.1_3'UTR|C14orf166B_ENST00000216453.5_5'Flank|C14orf166B_ENST00000450042.2_5'UTR	NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CCAATTCCCATCAAAGCCTAC	0.547																																					p.S7P	Ovarian(165;1056 1958 32571 36789 48728)	.											.	.	.	0			c.T19C						.						68.0	71.0	70.0					14																	77292857		692	1591	2283	SO:0001583	missense	145497	exon1			TTCCCATCAAAGC																												ENST00000393774.3:c.19T>C	14.37:g.77292857T>C	ENSP00000377369:p.Ser7Pro	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	5.0	NM_194287		Missense_Mutation	SNP	ENST00000393774.3	37	CCDS9853.2	.	.	.	.	.	.	.	.	.	.	T	0.794	-0.757828	0.03019	.	.	ENSG00000100565	ENST00000393774;ENST00000555189	T	0.37058	1.22	5.23	-1.77	0.07982	.	.	.	.	.	T	0.13756	0.0333	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.19811	-1.0294	9	0.34782	T	0.22	.	0.2718	0.00232	0.2958:0.2877:0.1449:0.2717	.	7	Q0VAA2	CN16B_HUMAN	P	7	ENSP00000377369:S7P	ENSP00000216450:S7P	S	+	1	0	C14orf166B	76362610	0.016000	0.18221	0.002000	0.10522	0.016000	0.09150	-0.442000	0.06871	-0.333000	0.08476	-0.621000	0.04028	TCA	.		0.547	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316592.1		
C16orf13	84326	ucsc.edu;bcgsc.ca	37	16	684744	684744	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:684744G>A	ENST00000301686.8	-	5	553	c.542C>T	c.(541-543)gCc>gTc	p.A181V	C16orf13_ENST00000397665.2_Silent_p.G138G|C16orf13_ENST00000338401.4_Missense_Mutation_p.A84V|C16orf13_ENST00000397664.4_Missense_Mutation_p.A104V|C16orf13_ENST00000397666.2_Silent_p.G158G	NM_032366.3	NP_115742.3	Q96S19	CP013_HUMAN	chromosome 16 open reading frame 13	181										large_intestine(1)	1		Hepatocellular(780;0.00335)				CAGGCCACTGGCCTTTCCCAG	0.657																																					p.A181V		.											.	C16orf13	22	0			c.C542T						.						48.0	52.0	51.0					16																	684744		2191	4295	6486	SO:0001583	missense	84326	exon5			CCACTGGCCTTTC		CCDS32352.1, CCDS42090.1, CCDS42091.1, CCDS45367.1, CCDS45368.1, CCDS73798.1	16p13.3	2012-10-09			ENSG00000130731	ENSG00000130731			14141	protein-coding gene	gene with protein product							Standard	NM_001040160		Approved	MGC13114	uc002chw.1	Q96S19	OTTHUMG00000047855	ENST00000301686.8:c.542C>T	16.37:g.684744G>A	ENSP00000445926:p.Ala181Val	Somatic	62.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_032366	A8MTR1|A8MWJ8|A8MZA1|B4DG95|B4DIJ3|D6REA6|F6TF62|F6VM53|Q96IW1|Q96MD6	Missense_Mutation	SNP	ENST00000301686.8	37	CCDS45368.1	.	.	.	.	.	.	.	.	.	.	G	3.126	-0.179584	0.06380	.	.	ENSG00000130731	ENST00000301686;ENST00000397664;ENST00000338401	T;T;T	0.47869	0.83;0.85;0.85	5.13	2.04	0.26737	.	0.494360	0.22341	N	0.061321	T	0.32675	0.0837	.	.	.	0.19775	N	0.999955	B;B;B	0.23806	0.0;0.004;0.091	B;B;B	0.24006	0.002;0.007;0.05	T	0.18335	-1.0340	9	0.32370	T	0.25	-2.0082	9.6222	0.39727	0.2383:0.0:0.7617:0.0	.	84;104;181	Q96S19-3;D6REA6;Q96S19	.;.;CP013_HUMAN	V	181;104;84	ENSP00000445926:A181V;ENSP00000440475:A104V;ENSP00000444140:A84V	ENSP00000445926:A181V	A	-	2	0	Z84479.1	624745	0.785000	0.28726	0.128000	0.21923	0.795000	0.44927	1.592000	0.36676	0.553000	0.29044	0.561000	0.74099	GCC	.		0.657	C16orf13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109081.2	NM_001040160	
C9orf85	138241	hgsc.bcm.edu;bcgsc.ca	37	9	74561974	74561974	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:74561974T>C	ENST00000377031.3	+	2	345	c.155T>C	c.(154-156)cTt>cCt	p.L52P	C9orf85_ENST00000334731.2_Missense_Mutation_p.L52P|C9orf85_ENST00000486911.2_Missense_Mutation_p.L52P			Q96MD7	CI085_HUMAN	chromosome 9 open reading frame 85	52	Lys-rich.									kidney(2)|large_intestine(1)|lung(4)	7						AAAGAAGTTCTTGAGTGGCGT	0.343																																					p.L52P		.											.	C9orf85	90	0			c.T155C						.						95.0	86.0	89.0					9																	74561974		2203	4300	6503	SO:0001583	missense	138241	exon2			AAGTTCTTGAGTG	BC010179	CCDS6639.1	9q21.2	2012-03-16			ENSG00000155621	ENSG00000155621			28784	protein-coding gene	gene with protein product						12477932	Standard	NM_182505		Approved	MGC61599	uc004ain.3	Q96MD7	OTTHUMG00000020002	ENST00000377031.3:c.155T>C	9.37:g.74561974T>C	ENSP00000366230:p.Leu52Pro	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_182505	Q5W0N1|Q5W0N3|Q6PJW9|Q86U95	Missense_Mutation	SNP	ENST00000377031.3	37		.	.	.	.	.	.	.	.	.	.	T	19.93	3.918533	0.73098	.	.	ENSG00000155621	ENST00000334731;ENST00000377031	T	0.35789	1.29	5.69	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.57651	0.2068	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.60459	-0.7259	10	0.87932	D	0	-15.2433	10.6569	0.45680	0.0:0.0763:0.0:0.9237	.	52	Q96MD7-1	.	P	52	ENSP00000366230:L52P	ENSP00000334289:L52P	L	+	2	0	C9orf85	73751794	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.175000	0.77632	0.998000	0.38996	0.454000	0.30748	CTT	.		0.343	C9orf85-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000052628.2	NM_182505	
CAB39L	81617	hgsc.bcm.edu;bcgsc.ca	37	13	49913821	49913821	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:49913821A>G	ENST00000355854.4	-	7	1179	c.682T>C	c.(682-684)Tct>Cct	p.S228P	CAB39L_ENST00000409130.1_Missense_Mutation_p.S84P|CAB39L_ENST00000409308.1_Missense_Mutation_p.S228P|CAB39L_ENST00000410043.1_Missense_Mutation_p.S228P|CAB39L_ENST00000347776.5_Missense_Mutation_p.S228P	NM_030925.2	NP_112187.2	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	228					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|stomach(1)	12		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		ACCTTTAAAGACTGTCTCTTA	0.313																																					p.S228P		.											.	CAB39L	90	0			c.T682C						.						48.0	48.0	48.0					13																	49913821		2196	4295	6491	SO:0001583	missense	81617	exon7			TTAAAGACTGTCT	AK022639	CCDS9416.2	13q14.11	2008-02-05			ENSG00000102547	ENSG00000102547			20290	protein-coding gene	gene with protein product		612175					Standard	NM_030925		Approved	bA103J18.3, FLJ12577, MO2L	uc001vcw.3	Q9H9S4	OTTHUMG00000016914	ENST00000355854.4:c.682T>C	13.37:g.49913821A>G	ENSP00000348113:p.Ser228Pro	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	4.0	NM_030925	Q5TAW6|Q6WG71|Q96FG1|Q9BZ33	Missense_Mutation	SNP	ENST00000355854.4	37	CCDS9416.2	.	.	.	.	.	.	.	.	.	.	A	24.0	4.482094	0.84747	.	.	ENSG00000102547	ENST00000355854;ENST00000347776;ENST00000378341;ENST00000409308;ENST00000409130;ENST00000425242;ENST00000410043	T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22	5.43	5.43	0.79202	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71151	0.3306	H	0.95850	3.73	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.81502	-0.0904	9	.	.	.	-19.2664	14.6657	0.68907	1.0:0.0:0.0:0.0	.	228	Q9H9S4	CB39L_HUMAN	P	228;228;205;228;84;171;228	ENSP00000348113:S228P;ENSP00000261669:S228P;ENSP00000386375:S228P;ENSP00000387245:S84P;ENSP00000416719:S171P;ENSP00000386328:S228P	.	S	-	1	0	CAB39L	48811822	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.827000	0.92041	2.071000	0.62044	0.418000	0.28097	TCT	.		0.313	CAB39L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044908.3	NM_030925	
CADPS	8618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	62385129	62385129	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:62385129C>T	ENST00000383710.4	-	30	4363	c.4014G>A	c.(4012-4014)caG>caA	p.Q1338Q	CADPS_ENST00000283269.9_Silent_p.Q1299Q|CADPS_ENST00000357948.3_Silent_p.Q1259Q	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1338	Mediates targeting and association with DCVs. {ECO:0000250}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TGCTGATGCCCTGCAGTCCCC	0.522																																					p.Q1338Q		.											.	CADPS	281	0			c.G4014A						.						217.0	189.0	198.0					3																	62385129		2203	4300	6503	SO:0001819	synonymous_variant	8618	exon30			GATGCCCTGCAGT	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.4014G>A	3.37:g.62385129C>T		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	45.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	4.156	0.027463	0.08054	.	.	ENSG00000163618	ENST00000473635	.	.	.	5.86	3.1	0.35709	.	.	.	.	.	T	0.59622	0.2207	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55263	-0.8168	4	.	.	.	.	10.0739	0.42349	0.0:0.7833:0.0:0.2167	.	.	.	.	K	330	.	.	R	-	2	0	CADPS	62360169	0.996000	0.38824	1.000000	0.80357	0.902000	0.53008	0.512000	0.22755	0.809000	0.34255	-0.140000	0.14226	AGG	.		0.522	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
CATSPERD	257062	hgsc.bcm.edu;bcgsc.ca	37	19	5737210	5737210	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:5737210T>C	ENST00000381624.3	+	6	514	c.453T>C	c.(451-453)ttT>ttC	p.F151F	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	151					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											GAAGTTTGTTTTGTGTGGTAA	0.338																																					p.F151F		.											.	.	.	0			c.T453C						.						201.0	173.0	182.0					19																	5737210		1824	4091	5915	SO:0001819	synonymous_variant	257062	exon6			TTTGTTTTGTGTG	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.453T>C	19.37:g.5737210T>C		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_152784	Q6ZRP1	Silent	SNP	ENST00000381624.3	37	CCDS12149.2																																																																																			.		0.338	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
CCDC122	160857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	44433973	44433973	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:44433973T>C	ENST00000444614.3	-	5	648	c.390A>G	c.(388-390)gcA>gcG	p.A130A	CCDC122_ENST00000476570.2_5'UTR|CCDC122_ENST00000281508.3_Silent_p.A130A	NM_144974.3	NP_659411.2	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	130										endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		CTTTTATTTTTGCATAATATG	0.294																																					p.A130A		.											.	CCDC122	90	0			c.A390G						.						112.0	110.0	110.0					13																	44433973		2203	4298	6501	SO:0001819	synonymous_variant	160857	exon5			TATTTTTGCATAA	AK056408	CCDS9390.2	13q14.11	2008-10-30			ENSG00000151773	ENSG00000151773			26478	protein-coding gene	gene with protein product		613408					Standard	NM_144974		Approved	FLJ31846	uc010acf.3	Q5T0U0	OTTHUMG00000017413	ENST00000444614.3:c.390A>G	13.37:g.44433973T>C		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	35.0	NM_144974	B2RP70|B7ZMI9|Q96MV0	Silent	SNP	ENST00000444614.3	37	CCDS9390.2																																																																																			.		0.294	CCDC122-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276172.4	NM_144974	
CCDC158	339965	hgsc.bcm.edu;bcgsc.ca	37	4	77247091	77247091	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:77247091T>C	ENST00000388914.3	-	22	3228	c.3076A>G	c.(3076-3078)Act>Gct	p.T1026A		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	1026	Ser-rich.									breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						ACTGAACTAGTTAGGAGTGAG	0.373																																					p.T1026A		.											.	CCDC158	96	0			c.A3076G						.						170.0	165.0	166.0					4																	77247091		1863	4109	5972	SO:0001583	missense	339965	exon22			AACTAGTTAGGAG	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.3076A>G	4.37:g.77247091T>C	ENSP00000373566:p.Thr1026Ala	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_001042784	Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	ENST00000388914.3	37	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616427	0.46736	.	.	ENSG00000163749	ENST00000388914;ENST00000318586	T	0.35421	1.31	4.83	3.57	0.40892	.	0.135985	0.34245	N	0.004136	T	0.19248	0.0462	N	0.24115	0.695	0.41628	D	0.989001	P	0.36990	0.577	B	0.38264	0.269	T	0.08207	-1.0733	10	0.05833	T	0.94	.	7.3456	0.26662	0.1946:0.0:0.0:0.8054	.	1026	Q5M9N0	CD158_HUMAN	A	1026;446	ENSP00000373566:T1026A	ENSP00000316815:T446A	T	-	1	0	CCDC158	77466115	0.976000	0.34144	0.743000	0.31040	0.279000	0.26890	2.034000	0.41145	2.169000	0.68431	0.374000	0.22700	ACT	.		0.373	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362694.2	NM_001042784	
CCDC3	83643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	13040436	13040436	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:13040436T>C	ENST00000378825.3	-	2	577	c.451A>G	c.(451-453)Aga>Gga	p.R151G	CCDC3_ENST00000378839.1_Missense_Mutation_p.R26G	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	151						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			AACATCCTTCTGTTCTCTTGA	0.458																																					p.R151G		.											.	CCDC3	91	0			c.A451G						.						128.0	115.0	119.0					10																	13040436		2203	4300	6503	SO:0001583	missense	83643	exon2			TCCTTCTGTTCTC	BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.451A>G	10.37:g.13040436T>C	ENSP00000368102:p.Arg151Gly	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	26.0	NM_031455	Q5VYV8|Q5VYV9	Missense_Mutation	SNP	ENST00000378825.3	37	CCDS7093.1	.	.	.	.	.	.	.	.	.	.	T	19.37	3.814588	0.70912	.	.	ENSG00000151468	ENST00000378839;ENST00000378825	.	.	.	4.92	3.76	0.43208	.	0.042937	0.85682	D	0.000000	T	0.67088	0.2856	M	0.72894	2.215	0.48696	D	0.999695	D	0.60575	0.988	P	0.56216	0.794	T	0.67325	-0.5699	9	0.46703	T	0.11	-3.219	11.3499	0.49581	0.0:0.0:0.1522:0.8478	.	151	Q9BQI4	CCDC3_HUMAN	G	26;151	.	ENSP00000368102:R151G	R	-	1	2	CCDC3	13080442	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.910000	0.39927	0.809000	0.34255	0.379000	0.24179	AGA	.		0.458	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046829.1	NM_031455	
CCIN	881	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	36169807	36169807	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:36169807A>T	ENST00000335119.2	+	1	419	c.308A>T	c.(307-309)gAg>gTg	p.E103V		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	103	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			AATGTGGAGGAGCTGCTTCGT	0.522																																					p.E103V		.											.	CCIN	92	0			c.A308T						.						84.0	72.0	76.0					9																	36169807		2203	4300	6503	SO:0001583	missense	881	exon1			TGGAGGAGCTGCT	Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.308A>T	9.37:g.36169807A>T	ENSP00000334996:p.Glu103Val	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	46.0	NM_005893	Q9BXG7	Missense_Mutation	SNP	ENST00000335119.2	37	CCDS6599.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.926934	0.52759	.	.	ENSG00000185972	ENST00000335119	T	0.72615	-0.67	5.26	5.26	0.73747	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.56097	D	0.000040	T	0.69287	0.3094	M	0.61703	1.905	0.38593	D	0.95047	D	0.54207	0.965	P	0.46419	0.516	T	0.69684	-0.5079	10	0.21540	T	0.41	.	11.8391	0.52344	1.0:0.0:0.0:0.0	.	103	Q13939	CALI_HUMAN	V	103	ENSP00000334996:E103V	ENSP00000334996:E103V	E	+	2	0	CCIN	36159807	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.309000	0.65774	2.118000	0.64928	0.379000	0.24179	GAG	.		0.522	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052418.1	NM_005893	
CCNF	899	hgsc.bcm.edu;bcgsc.ca	37	16	2487180	2487180	+	Missense_Mutation	SNP	C	C	T	rs138913390		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:2487180C>T	ENST00000397066.4	+	5	485	c.397C>T	c.(397-399)Cgc>Tgc	p.R133C		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	133					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				GAAGGCCTCTCGCTTCTTCAG	0.607																																					p.R133C		.											.	CCNF	658	0			c.C397T						.	C	CYS/ARG	1,4395	2.1+/-5.4	0,1,2197	93.0	92.0	92.0		397	5.0	0.9	16	dbSNP_134	92	0,8600		0,0,4300	no	missense	CCNF	NM_001761.2	180	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	133/787	2487180	1,12995	2198	4300	6498	SO:0001583	missense	899	exon5			GCCTCTCGCTTCT	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.397C>T	16.37:g.2487180C>T	ENSP00000380256:p.Arg133Cys	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	4.0	NM_001761	B2R8H3|Q96EG9	Missense_Mutation	SNP	ENST00000397066.4	37	CCDS10467.1	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470467	0.63625	2.27E-4	0.0	ENSG00000162063	ENST00000397066;ENST00000293968	T	0.26067	1.76	5.92	4.98	0.66077	.	0.263540	0.45126	D	0.000392	T	0.29061	0.0722	L	0.60455	1.87	0.58432	D	0.999999	D	0.55605	0.972	B	0.42386	0.386	T	0.12553	-1.0543	10	0.87932	D	0	-23.4429	13.8262	0.63352	0.0:0.9263:0.0:0.0737	.	133	P41002	CCNF_HUMAN	C	133;48	ENSP00000380256:R133C	ENSP00000293968:R48C	R	+	1	0	CCNF	2427181	1.000000	0.71417	0.931000	0.37212	0.384000	0.30261	5.888000	0.69758	1.518000	0.48934	-0.136000	0.14681	CGC	C|1.000;T|0.000		0.607	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	
CDC23	8697	hgsc.bcm.edu;bcgsc.ca	37	5	137537070	137537070	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:137537070T>C	ENST00000394886.2	-	5	513	c.483A>G	c.(481-483)aaA>aaG	p.K161K		NM_004661.3	NP_004652.2	Q9UJX2	CDC23_HUMAN	cell division cycle 23	161					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of exit from mitosis (GO:0007096)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(6)|prostate(2)|skin(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			GAGCTTGGTGTTTTTTGCTGA	0.403																																					p.K161K		.											.	CDC23	226	0			c.A483G						.						118.0	118.0	118.0					5																	137537070		2203	4300	6503	SO:0001819	synonymous_variant	8697	exon5			TTGGTGTTTTTTG	AF053977	CCDS4200.2	5q31	2013-01-17	2013-01-17		ENSG00000094880	ENSG00000094880		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1724	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 8"""	603462	"""CDC23 (cell division cycle 23, yeast, homolog)"", ""cell division cycle 23 homolog (S. cerevisiae)"""			9790767	Standard	NM_004661		Approved	APC8, ANAPC8, CUT23	uc003lcl.3	Q9UJX2	OTTHUMG00000129198	ENST00000394886.2:c.483A>G	5.37:g.137537070T>C		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_004661	A8K6E5|B4E3A2|B7WP05|D3DQB7|O75433|Q53FN2|Q9BS73	Silent	SNP	ENST00000394886.2	37	CCDS4200.2																																																																																			.		0.403	CDC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251275.2		
CDHR4	389118	hgsc.bcm.edu;bcgsc.ca	37	3	49832387	49832387	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:49832387A>G	ENST00000412678.2	-	9	1186	c.1178T>C	c.(1177-1179)gTc>gCc	p.V393A	CDHR4_ENST00000462108.1_5'Flank	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	393	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						CACCTCAAGGACTCTGTCATA	0.622																																					p.V393A		.											.	.	.	0			c.T1178C						.						47.0	53.0	51.0					3																	49832387		692	1591	2283	SO:0001583	missense	389118	exon9			TCAAGGACTCTGT		CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.1178T>C	3.37:g.49832387A>G	ENSP00000391409:p.Val393Ala	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	5.0	NM_001007540	Q6UXT0	Missense_Mutation	SNP	ENST00000412678.2	37	CCDS46829.1	.	.	.	.	.	.	.	.	.	.	A	9.067	0.996049	0.19043	.	.	ENSG00000187492	ENST00000412678	T	0.68624	-0.34	4.75	-4.5	0.03493	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.34890	0.0913	N	0.08118	0	0.25389	N	0.988542	B	0.02656	0.0	B	0.04013	0.001	T	0.31223	-0.9951	9	0.08179	T	0.78	.	5.9065	0.19004	0.4414:0.0:0.4237:0.1349	.	393	A6H8M9	CDHR4_HUMAN	A	393	ENSP00000391409:V393A	ENSP00000391409:V393A	V	-	2	0	CDHR4	49807391	0.000000	0.05858	0.029000	0.17559	0.537000	0.34900	-1.076000	0.03420	-0.906000	0.03866	-0.421000	0.06004	GTC	.		0.622	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350387.1	NM_001007540	
CHKA	1119	hgsc.bcm.edu;bcgsc.ca	37	11	67821492	67821492	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:67821492T>C	ENST00000265689.4	-	12	1363	c.1337A>G	c.(1336-1338)gAt>gGt	p.D446G	RP11-802E16.3_ENST00000534517.1_RNA|RP11-802E16.3_ENST00000529934.1_RNA|RP11-802E16.3_ENST00000526897.1_RNA|CHKA_ENST00000356135.5_Missense_Mutation_p.D428G|CHKA_ENST00000533728.1_5'UTR	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	446					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	GAAATAGGCATCAAACCTTGC	0.587																																					p.D446G		.											.	CHKA	91	0			c.A1337G						.						130.0	98.0	109.0					11																	67821492		2200	4294	6494	SO:0001583	missense	1119	exon12			TAGGCATCAAACC	D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.1337A>G	11.37:g.67821492T>C	ENSP00000265689:p.Asp446Gly	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_001277	Q8NE29	Missense_Mutation	SNP	ENST00000265689.4	37	CCDS8178.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855347	0.51376	.	.	ENSG00000110721	ENST00000265689;ENST00000356135	T;T	0.58652	0.32;0.32	4.76	4.76	0.60689	Protein kinase-like domain (1);	0.272209	0.34676	N	0.003772	T	0.63498	0.2516	L	0.49126	1.545	0.58432	D	0.999999	P;B	0.34955	0.477;0.419	P;P	0.49752	0.621;0.455	T	0.58358	-0.7650	10	0.19590	T	0.45	-15.1956	14.4096	0.67106	0.0:0.0:0.0:1.0	.	428;446	P35790-2;P35790	.;CHKA_HUMAN	G	446;428	ENSP00000265689:D446G;ENSP00000348454:D428G	ENSP00000265689:D446G	D	-	2	0	CHKA	67578068	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.335000	0.72949	1.993000	0.58246	0.379000	0.24179	GAT	.		0.587	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394570.1	NM_001277	
CLEC14A	161198	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	38725216	38725216	+	Silent	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:38725216C>A	ENST00000342213.2	-	1	358	c.12G>T	c.(10-12)gcG>gcT	p.A4A		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	4						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		ACAGGGCGAACGCCGGCCTCA	0.726																																					p.A4A		.											.	CLEC14A	94	0			c.G12T						.						2.0	2.0	2.0					14																	38725216		1382	2852	4234	SO:0001819	synonymous_variant	161198	exon1			GGCGAACGCCGGC		CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.12G>T	14.37:g.38725216C>A		Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	46.0	NM_175060	Q695G9|Q6PWT6|Q8N5V5	Silent	SNP	ENST00000342213.2	37	CCDS9667.1																																																																																			.		0.726	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276729.1	NM_175060	
COL11A1	1301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	103481268	103481268	+	Missense_Mutation	SNP	C	C	A	rs150428394		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:103481268C>A	ENST00000370096.3	-	12	1756	c.1444G>T	c.(1444-1446)Gct>Tct	p.A482S	COL11A1_ENST00000358392.2_Missense_Mutation_p.A494S|COL11A1_ENST00000353414.4_Missense_Mutation_p.A443S|COL11A1_ENST00000512756.1_Missense_Mutation_p.A366S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	482	Collagen-like 1.|Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGACCATCAGCCCCTGGTAAG	0.353																																					p.A494S		.											.	COL11A1	586	0			c.G1480T						.						37.0	36.0	36.0					1																	103481268		2203	4299	6502	SO:0001583	missense	1301	exon12			CATCAGCCCCTGG	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1444G>T	1.37:g.103481268C>A	ENSP00000359114:p.Ala482Ser	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	45.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531033	0.45073	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.42	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.91157	0.7215	L	0.40543	1.245	0.80722	D	1	P;P;P;P	0.45348	0.77;0.827;0.827;0.856	B;B;P;P	0.48454	0.376;0.442;0.52;0.578	D	0.89616	0.3845	10	0.16896	T	0.51	.	18.675	0.91525	0.0:1.0:0.0:0.0	.	366;443;494;482	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	S	482;494;443;366;494	ENSP00000359114:A482S;ENSP00000351163:A494S;ENSP00000302551:A443S;ENSP00000426533:A366S;ENSP00000408640:A494S	ENSP00000302551:A443S	A	-	1	0	COL11A1	103253856	1.000000	0.71417	0.997000	0.53966	0.907000	0.53573	5.552000	0.67281	2.510000	0.84645	0.585000	0.79938	GCT	C|1.000;T|0.000		0.353	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
CNST	163882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	246754974	246754974	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:246754974A>T	ENST00000366513.4	+	2	379	c.110A>T	c.(109-111)gAt>gTt	p.D37V	CNST_ENST00000366512.3_Missense_Mutation_p.D37V|CNST_ENST00000483271.1_3'UTR	NM_152609.2	NP_689822.2	Q6PJW8	CNST_HUMAN	consortin, connexin sorting protein	37					negative regulation of phosphatase activity (GO:0010923)|positive regulation of Golgi to plasma membrane protein transport (GO:0042998)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	connexin binding (GO:0071253)|phosphatase binding (GO:0019902)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|urinary_tract(2)	28						TCTGCATCAGATGAAAATGAA	0.493																																					p.D37V		.											.	CNST	90	0			c.A110T						.						144.0	127.0	133.0					1																	246754974		2203	4300	6503	SO:0001583	missense	163882	exon2			CATCAGATGAAAA	AK056563	CCDS1628.1, CCDS44343.1	1q44	2012-04-17	2009-11-03	2009-11-03	ENSG00000162852	ENSG00000162852		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26486	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 64"""	613439	"""chromosome 1 open reading frame 71"""	C1orf71		19864490	Standard	NM_152609		Approved	FLJ32001, PPP1R64	uc001ibp.3	Q6PJW8	OTTHUMG00000040090	ENST00000366513.4:c.110A>T	1.37:g.246754974A>T	ENSP00000355470:p.Asp37Val	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	45.0	NM_152609	Q5VSY9|Q5VTM7|Q8IYA9|Q8N3L5|Q8NB09|Q8TEI2|Q96MR5	Missense_Mutation	SNP	ENST00000366513.4	37	CCDS1628.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443183	0.83993	.	.	ENSG00000162852	ENST00000366513;ENST00000366512;ENST00000366511	T;T;T	0.26223	1.75;1.75;1.75	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.52125	0.1715	M	0.76002	2.32	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.55010	-0.8207	10	0.87932	D	0	-10.1254	14.5632	0.68156	1.0:0.0:0.0:0.0	.	37;37	Q6PJW8;Q6PJW8-2	CNST_HUMAN;.	V	37	ENSP00000355470:D37V;ENSP00000355469:D37V;ENSP00000355468:D37V	ENSP00000355468:D37V	D	+	2	0	CNST	244821597	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.987000	0.70571	2.371000	0.80710	0.533000	0.62120	GAT	.		0.493	CNST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096780.1	NM_152609	
COL5A3	50509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10112330	10112330	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:10112330T>C	ENST00000264828.3	-	8	1065	c.980A>G	c.(979-981)gAc>gGc	p.D327G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	327	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGTTCCACTGTCAGGGTCCAA	0.562											OREG0025228	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D327G		.											.	COL5A3	99	0			c.A980G						.						87.0	86.0	86.0					19																	10112330		2203	4300	6503	SO:0001583	missense	50509	exon8			CCACTGTCAGGGT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.980A>G	19.37:g.10112330T>C	ENSP00000264828:p.Asp327Gly	Somatic	71.0	0.0	662	WXS	Illumina HiSeq	Phase_I	99.0	39.0	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	37	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	T	9.307	1.054540	0.19907	.	.	ENSG00000080573	ENST00000264828	D	0.89617	-2.54	4.88	0.97	0.19692	.	0.752143	0.11294	N	0.578891	T	0.72614	0.3482	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.57087	-0.7871	10	0.22109	T	0.4	.	3.6501	0.08199	0.0:0.2717:0.1921:0.5362	.	327	P25940	CO5A3_HUMAN	G	327	ENSP00000264828:D327G	ENSP00000264828:D327G	D	-	2	0	COL5A3	9973330	0.002000	0.14202	0.001000	0.08648	0.227000	0.25037	0.039000	0.13884	-0.055000	0.13244	0.379000	0.24179	GAC	.		0.562	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
DAB1	1600	hgsc.bcm.edu;bcgsc.ca	37	1	57480890	57480890	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:57480890T>C	ENST00000371231.1	-	13	1243	c.1209A>G	c.(1207-1209)caA>caG	p.Q403Q	DAB1_ENST00000371236.2_Silent_p.Q370Q|DAB1_ENST00000371234.4_Silent_p.Q370Q|DAB1_ENST00000414851.2_Silent_p.Q352Q|DAB1_ENST00000420954.2_Silent_p.Q368Q|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Silent_p.Q284Q			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	403					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GCATAACAGTTTGTGTGGGCA	0.637																																					p.Q370Q		.											.	DAB1	93	0			c.A1110G						.						86.0	74.0	78.0					1																	57480890		2203	4300	6503	SO:0001819	synonymous_variant	1600	exon14			AACAGTTTGTGTG	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1209A>G	1.37:g.57480890T>C		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	5.0	NM_021080	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	ENST00000371231.1	37																																																																																				.		0.637	DAB1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000027962.1	NM_021080	
DAPK2	23604	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	64275877	64275877	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:64275877G>A	ENST00000457488.1	-	3	199	c.169C>T	c.(169-171)Cgg>Tgg	p.R57W	DAPK2_ENST00000261891.3_Missense_Mutation_p.R57W|DAPK2_ENST00000558069.1_Missense_Mutation_p.R57W|DAPK2_ENST00000558482.1_5'UTR	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	57	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		CGGCTCTGCCGCTTCTTGATG	0.622																																					p.R57W		.											.	DAPK2	333	0			c.C169T						.						35.0	35.0	35.0					15																	64275877		2203	4300	6503	SO:0001583	missense	23604	exon3			TCTGCCGCTTCTT	AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.169C>T	15.37:g.64275877G>A	ENSP00000408277:p.Arg57Trp	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	20.0	NM_014326	E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	ENST00000457488.1	37	CCDS10188.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438708	0.83885	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.67698	-0.28;-0.28	5.35	3.38	0.38709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.78342	0.4268	M	0.62154	1.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79157	-0.1919	10	0.87932	D	0	.	13.1348	0.59403	0.0:0.0:0.6989:0.3011	.	57;57	E9JGM7;Q9UIK4	.;DAPK2_HUMAN	W	57	ENSP00000261891:R57W;ENSP00000408277:R57W	ENSP00000261891:R57W	R	-	1	2	DAPK2	62062930	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.616000	0.61197	0.557000	0.29117	0.555000	0.69702	CGG	.		0.622	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256479.1	NM_014326	
DERL1	79139	hgsc.bcm.edu;bcgsc.ca	37	8	124037286	124037286	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:124037286A>G	ENST00000259512.4	-	3	570	c.270T>C	c.(268-270)gcT>gcC	p.A90A	DERL1_ENST00000523036.1_5'UTR|DERL1_ENST00000419562.2_Intron|DERL1_ENST00000519018.1_5'UTR|DERL1_ENST00000405944.3_Silent_p.A90A|RP11-557C18.3_ENST00000521258.1_RNA	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	90					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			TCCCATCAAAAGCTCCTGGAA	0.388																																					p.A90A		.											.	DERL1	226	0			c.T270C						.						58.0	55.0	56.0					8																	124037286		2203	4300	6503	SO:0001819	synonymous_variant	79139	exon3			ATCAAAAGCTCCT	BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.270T>C	8.37:g.124037286A>G		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_001134671	B3KW41|E9PH19	Silent	SNP	ENST00000259512.4	37	CCDS6337.1																																																																																			.		0.388	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381714.2	NM_024295	
DHX37	57647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	125451369	125451369	+	Silent	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:125451369T>A	ENST00000308736.2	-	12	1658	c.1560A>T	c.(1558-1560)tcA>tcT	p.S520S	DHX37_ENST00000544745.1_Silent_p.S307S	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	520	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.						ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CCCTGGCCCTTGACTTCTTAA	0.617																																					p.S520S		.											.	DHX37	227	0			c.A1560T						.						119.0	115.0	116.0					12																	125451369		2203	4300	6503	SO:0001819	synonymous_variant	57647	exon12			GGCCCTTGACTTC	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.1560A>T	12.37:g.125451369T>A		Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	69.0	NM_032656	Q9BUI7|Q9P211	Silent	SNP	ENST00000308736.2	37	CCDS9261.1																																																																																			.		0.617	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
DYNC2LI1	51626	hgsc.bcm.edu;bcgsc.ca	37	2	44032355	44032355	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:44032355A>G	ENST00000260605.8	+	12	1063	c.963A>G	c.(961-963)gaA>gaG	p.E321E	DYNC2LI1_ENST00000605786.1_Silent_p.E322E|DYNC2LI1_ENST00000443170.3_Silent_p.E195E	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	321					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CTGAAAATGAAGTCGATGAGA	0.373																																					p.E322E		.											.	DYNC2LI1	91	0			c.A966G						.						88.0	93.0	91.0					2																	44032355		2203	4300	6503	SO:0001819	synonymous_variant	51626	exon12			AAATGAAGTCGAT		CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.963A>G	2.37:g.44032355A>G		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	6.0	NM_001193464	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Silent	SNP	ENST00000260605.8	37	CCDS1813.1	.	.	.	.	.	.	.	.	.	.	A	7.232	0.599551	0.13939	.	.	ENSG00000138036	ENST00000378587	.	.	.	4.88	3.68	0.42216	.	.	.	.	.	T	0.62575	0.2439	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60094	-0.7330	4	.	.	.	-29.5592	11.8498	0.52405	0.8534:0.1466:0.0:0.0	.	.	.	.	R	305	.	.	K	+	2	0	DYNC2LI1	43885859	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	1.350000	0.34010	0.948000	0.37687	0.533000	0.62120	AAG	.		0.373	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250536.2	NM_016008	
EDC4	23644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67916365	67916365	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:67916365G>A	ENST00000358933.5	+	25	3549	c.3310G>A	c.(3310-3312)Gac>Aac	p.D1104N	NRN1L_ENST00000339176.3_5'Flank|CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1104					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		AGCAGCTGCAGACACATTACA	0.602																																					p.D1104N		.											.	EDC4	92	0			c.G3310A						.						58.0	59.0	58.0					16																	67916365		2198	4300	6498	SO:0001583	missense	23644	exon25			GCTGCAGACACAT	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3310G>A	16.37:g.67916365G>A	ENSP00000351811:p.Asp1104Asn	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	33.0	NM_014329	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352703	0.61293	.	.	ENSG00000038358	ENST00000358933	.	.	.	6.04	6.04	0.98038	.	0.045285	0.85682	D	0.000000	T	0.42404	0.1201	N	0.13098	0.295	0.51767	D	0.999936	B	0.26672	0.156	B	0.17098	0.017	T	0.25882	-1.0119	9	0.18710	T	0.47	-25.5092	20.1899	0.98228	0.0:0.0:1.0:0.0	.	1104	Q6P2E9	EDC4_HUMAN	N	1104	.	ENSP00000351811:D1104N	D	+	1	0	EDC4	66473866	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.711000	0.98735	2.873000	0.98535	0.563000	0.77884	GAC	.		0.602	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
EIF2AK3	9451	hgsc.bcm.edu;bcgsc.ca	37	2	88879055	88879055	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:88879055T>C	ENST00000303236.3	-	11	2168	c.1867A>G	c.(1867-1869)Agg>Ggg	p.R623G	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.R472G	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	623	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						AGACGGATCCTCTTGATAGCA	0.403																																					p.R623G	GBM(138;671 1851 16235 39058 45249)	.											.	EIF2AK3	361	0			c.A1867G						.						167.0	160.0	162.0					2																	88879055		2203	4300	6503	SO:0001583	missense	9451	exon11			GGATCCTCTTGAT	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.1867A>G	2.37:g.88879055T>C	ENSP00000307235:p.Arg623Gly	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	5.0	NM_004836	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	ENST00000303236.3	37	CCDS33241.1	.	.	.	.	.	.	.	.	.	.	T	16.26	3.072809	0.55646	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.21361	2.01;2.01;2.01	6.06	6.06	0.98353	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043020	0.85682	D	0.000000	T	0.32852	0.0843	M	0.84219	2.685	0.80722	D	1	B	0.25235	0.121	B	0.26416	0.069	T	0.12785	-1.0534	10	0.87932	D	0	-24.0879	15.1804	0.72952	0.0:0.0:0.0:1.0	.	623	Q9NZJ5	E2AK3_HUMAN	G	472;623;472;502	ENSP00000408325:R472G;ENSP00000307235:R623G;ENSP00000412076:R502G	ENSP00000307235:R623G	R	-	1	2	EIF2AK3	88660170	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.170000	0.71920	2.324000	0.78689	0.533000	0.62120	AGG	.		0.403	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836	
EMCN	51705	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	101396223	101396223	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:101396223T>C	ENST00000296420.4	-	3	409	c.231A>G	c.(229-231)acA>acG	p.T77T	EMCN_ENST00000305864.3_Silent_p.T77T|EMCN_ENST00000511970.1_Silent_p.T77T|EMCN_ENST00000502327.1_5'UTR	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	77	Thr-rich.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		AAAAAGTAGCTGTTGACATCA	0.239																																					p.T77T		.											.	EMCN	90	0			c.A231G						.						49.0	54.0	53.0					4																	101396223		2184	4274	6458	SO:0001819	synonymous_variant	51705	exon3			AGTAGCTGTTGAC	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.231A>G	4.37:g.101396223T>C		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	4.0	NM_001159694	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Silent	SNP	ENST00000296420.4	37	CCDS3655.1																																																																																			.		0.239	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242	
EPHX1	2052	hgsc.bcm.edu;bcgsc.ca	37	1	226016567	226016567	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:226016567A>G	ENST00000366837.4	+	2	333	c.137A>G	c.(136-138)gAc>gGc	p.D46G	EPHX1_ENST00000272167.5_Missense_Mutation_p.D46G|EPHX1_ENST00000467015.1_3'UTR	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	46					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					AGGGAGGACGACAGCATCCGC	0.602																																					p.D46G		.											.	EPHX1	281	0			c.A137G						.						43.0	38.0	40.0					1																	226016567		2203	4300	6503	SO:0001583	missense	2052	exon2			AGGACGACAGCAT	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.137A>G	1.37:g.226016567A>G	ENSP00000355802:p.Asp46Gly	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	5.0	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	A	8.638	0.895363	0.17613	.	.	ENSG00000143819	ENST00000445856;ENST00000272167;ENST00000448202;ENST00000366837	T;T;T;T	0.03831	3.79;3.79;3.79;3.79	5.0	3.85	0.44370	.	0.319521	0.30949	N	0.008543	T	0.04003	0.0112	N	0.19112	0.55	0.23232	N	0.998072	B	0.18013	0.025	B	0.20184	0.028	T	0.39292	-0.9621	10	0.33940	T	0.23	0.0749	11.7659	0.51930	0.6484:0.3516:0.0:0.0	.	46	P07099	HYEP_HUMAN	G	46	ENSP00000398491:D46G;ENSP00000272167:D46G;ENSP00000408469:D46G;ENSP00000355802:D46G	ENSP00000272167:D46G	D	+	2	0	EPHX1	224083190	0.856000	0.29760	0.988000	0.46212	0.303000	0.27691	1.829000	0.39121	0.726000	0.32339	0.379000	0.24179	GAC	.		0.602	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	144944633	144944633	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:144944633C>T	ENST00000525985.1	-	2	2860	c.2789G>A	c.(2788-2790)gGa>gAa	p.G930E				P58107	EPIPL_HUMAN	epiplakin 1	930						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCCACAGCTCCCAGGCCGCA	0.682																																					p.G930E		.											.	EPPK1	25	0			c.G2789A						.						14.0	18.0	17.0					8																	144944633		2051	4175	6226	SO:0001583	missense	83481	exon1			ACAGCTCCCAGGC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.2789G>A	8.37:g.144944633C>T	ENSP00000436337:p.Gly930Glu	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	12.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	16.54	3.152170	0.57259	.	.	ENSG00000227184	ENST00000525985	T	0.72615	-0.67	4.94	4.04	0.47022	.	.	.	.	.	T	0.64692	0.2621	N	0.19112	0.55	0.09310	N	1	D	0.58268	0.982	P	0.57620	0.824	T	0.51513	-0.8696	9	0.23891	T	0.37	.	6.6665	0.23042	0.0:0.7232:0.1825:0.0943	.	930	E9PPU0	.	E	930	ENSP00000436337:G930E	ENSP00000436337:G930E	G	-	2	0	EPPK1	145016621	0.011000	0.17503	0.031000	0.17742	0.002000	0.02628	1.450000	0.35134	1.271000	0.44313	0.655000	0.94253	GGA	.		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
ERCC4	2072	hgsc.bcm.edu;bcgsc.ca	37	16	14024746	14024746	+	Splice_Site	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:14024746A>G	ENST00000311895.7	+	5	981	c.972A>G	c.(970-972)tcA>tcG	p.S324S	CTD-2135D7.2_ENST00000570663.1_RNA|ERCC4_ENST00000575156.1_Splice_Site_p.S324S|CTD-2135D7.2_ENST00000575137.1_RNA	NM_005236.2	NP_005227.1	Q92889	XPF_HUMAN	excision repair cross-complementation group 4	324	Helicase-like.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair involved in interstrand cross-link repair (GO:1901255)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|resolution of meiotic recombination intermediates (GO:0000712)|response to UV (GO:0009411)|telomere maintenance (GO:0000723)|telomere maintenance via telomere shortening (GO:0010834)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	chromosome, telomeric region (GO:0000781)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleotide-excision repair factor 1 complex (GO:0000110)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endodeoxyribonuclease activity (GO:0004520)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(5)|lung(12)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	38						GTCAGAATTCAGGTGGGAGAT	0.353			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.S324S		.	yes	Rec		Xeroderma pigmentosum (F)	16	16p13.3-p13.13	2072	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""		E	.	ERCC4	665	0			c.A972G						.						39.0	39.0	39.0					16																	14024746		2197	4300	6497	SO:0001630	splice_region_variant	2072	exon5	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GAATTCAGGTGGG	L76568	CCDS32390.1	16p13.3	2014-09-17	2014-03-07		ENSG00000175595	ENSG00000175595			3436	protein-coding gene	gene with protein product	"""xeroderma pigmentosum, complementation group F"""	133520	"""excision repair cross-complementing rodent repair deficiency, complementation group 4"""	XPF		9579555, 8887684	Standard	NM_005236		Approved	RAD1, FANCQ	uc002dce.2	Q92889	OTTHUMG00000048194	ENST00000311895.7:c.973+1A>G	16.37:g.14024746A>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_005236	A5PKV6|A8K111|O00140|Q8TD83	Silent	SNP	ENST00000311895.7	37	CCDS32390.1																																																																																			.		0.353	ERCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109634.2	NM_005236	Silent
FAM160B1	57700	hgsc.bcm.edu;bcgsc.ca	37	10	116605202	116605202	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:116605202T>C	ENST00000369248.4	+	8	1425	c.1090T>C	c.(1090-1092)Ttt>Ctt	p.F364L	FAM160B1_ENST00000369250.3_Missense_Mutation_p.F364L	NM_020940.3	NP_065991.3	Q5W0V3	F16B1_HUMAN	family with sequence similarity 160, member B1	364										NS(1)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)	25						TCTTTCCTGGTTTGATTATTG	0.308																																					p.F364L		.											.	FAM160B1	91	0			c.T1090C						.						114.0	106.0	109.0					10																	116605202		2203	4300	6503	SO:0001583	missense	57700	exon8			TCCTGGTTTGATT	AB046820	CCDS31290.1, CCDS44480.1	10q26.11	2008-06-05	2008-06-05	2008-06-05	ENSG00000151553	ENSG00000151553			29320	protein-coding gene	gene with protein product			"""KIAA1600"""	KIAA1600		10997877	Standard	NM_020940		Approved	bA106M7.3	uc001lcb.3	Q5W0V3	OTTHUMG00000019092	ENST00000369248.4:c.1090T>C	10.37:g.116605202T>C	ENSP00000358251:p.Phe364Leu	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_020940	Q5H9P7|Q5W0V2|Q8IY76|Q9HCH2	Missense_Mutation	SNP	ENST00000369248.4	37	CCDS31290.1	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638410	0.29157	.	.	ENSG00000151553	ENST00000369248;ENST00000369250	T;T	0.19669	2.13;2.13	5.43	5.43	0.79202	.	0.049336	0.85682	D	0.000000	T	0.09247	0.0228	N	0.03253	-0.375	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.15052	0.012;0.003	T	0.11991	-1.0565	10	0.02654	T	1	-29.9027	15.7673	0.78138	0.0:0.0:0.0:1.0	.	364;364	Q5W0V3-2;Q5W0V3	.;F16B1_HUMAN	L	364	ENSP00000358251:F364L;ENSP00000358253:F364L	ENSP00000358251:F364L	F	+	1	0	FAM160B1	116595192	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.768000	0.62293	2.186000	0.69663	0.450000	0.29827	TTT	.		0.308	FAM160B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050499.1	XM_049351	
FAM188B	84182	hgsc.bcm.edu;bcgsc.ca	37	7	30821784	30821784	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:30821784A>G	ENST00000265299.6	+	3	452	c.375A>G	c.(373-375)gaA>gaG	p.E125E	INMT-FAM188B_ENST00000458257.1_3'UTR	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	125										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TTTCAGATGAAGATGCAGGAT	0.373																																					p.E125E		.											.	FAM188B	90	0			c.A375G						.						76.0	66.0	69.0					7																	30821784		1883	4119	6002	SO:0001819	synonymous_variant	84182	exon3			AGATGAAGATGCA	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.375A>G	7.37:g.30821784A>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_032222	Q71AZ7|Q9H6D2	Silent	SNP	ENST00000265299.6	37	CCDS43565.1																																																																																			.		0.373	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327962.1	NM_032222	
FAM98A	25940	hgsc.bcm.edu;bcgsc.ca	37	2	33811687	33811687	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:33811687A>G	ENST00000238823.8	-	6	802	c.662T>C	c.(661-663)cTg>cCg	p.L221P	FAM98A_ENST00000441530.2_Missense_Mutation_p.L26P|FAM98A_ENST00000403368.1_Missense_Mutation_p.L221P|FAM98A_ENST00000498340.1_5'Flank			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	222							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TTTTATTAGCAGCTTTCTCCG	0.348																																					p.L221P		.											.	FAM98A	91	0			c.T662C						.						144.0	140.0	141.0					2																	33811687		2203	4300	6503	SO:0001583	missense	25940	exon6			ATTAGCAGCTTTC		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.662T>C	2.37:g.33811687A>G	ENSP00000238823:p.Leu221Pro	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_015475	B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	ENST00000238823.8	37	CCDS33179.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252846	0.80135	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000403368;ENST00000441530	T;T;T	0.48836	0.8;0.8;0.8	5.76	4.59	0.56863	.	0.061993	0.64402	D	0.000014	T	0.63058	0.2479	L	0.52905	1.665	0.80722	D	1	D;D;P	0.71674	0.995;0.998;0.936	P;D;B	0.75484	0.879;0.986;0.367	T	0.65615	-0.6125	10	0.87932	D	0	-5.4484	13.2866	0.60247	0.8677:0.1323:0.0:0.0	.	222;52;221	Q8NCA5;B4DY25;Q8NCA5-2	FA98A_HUMAN;.;.	P	221;222;221;26	ENSP00000238823:L221P;ENSP00000384711:L221P;ENSP00000408716:L26P	ENSP00000238823:L221P	L	-	2	0	FAM98A	33665191	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.415000	0.80131	1.090000	0.41315	0.528000	0.53228	CTG	.		0.348	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45623916	45623916	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:45623916A>G	ENST00000267430.5	+	7	1285	c.1200A>G	c.(1198-1200)aaA>aaG	p.K400K	FANCM_ENST00000542564.2_Silent_p.K374K|FANCM_ENST00000556036.1_Silent_p.K400K	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	400					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CACGGTCAAAAAATGAACTTG	0.284								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.K400K		.											.	FANCM	569	0			c.A1200G						.						74.0	72.0	73.0					14																	45623916		2203	4300	6503	SO:0001819	synonymous_variant	57697	exon7	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GTCAAAAAATGAA	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1200A>G	14.37:g.45623916A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	23.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	37	CCDS32070.1																																																																																			.		0.284	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
FN1	2335	hgsc.bcm.edu;bcgsc.ca	37	2	216264012	216264012	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:216264012T>C	ENST00000359671.1	-	21	3581	c.3316A>G	c.(3316-3318)Aca>Gca	p.T1106A	FN1_ENST00000323926.6_Missense_Mutation_p.T1106A|FN1_ENST00000432072.2_Missense_Mutation_p.T1106A|FN1_ENST00000356005.4_Missense_Mutation_p.T1106A|FN1_ENST00000336916.4_Missense_Mutation_p.T1106A|FN1_ENST00000354785.4_Missense_Mutation_p.T1106A|FN1_ENST00000346544.3_Missense_Mutation_p.T1106A|FN1_ENST00000357009.2_Missense_Mutation_p.T1106A|FN1_ENST00000421182.1_Missense_Mutation_p.T1106A|FN1_ENST00000345488.5_Missense_Mutation_p.T1106A|FN1_ENST00000357867.4_Missense_Mutation_p.T1106A|FN1_ENST00000446046.1_Missense_Mutation_p.T1106A|FN1_ENST00000443816.1_Missense_Mutation_p.T1106A			P02751	FINC_HUMAN	fibronectin 1	1106	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GGCGTCCATGTGATCACAATG	0.468																																					p.T1106A		.											.	FN1	584	0			c.A3316G						.						172.0	164.0	166.0					2																	216264012		2203	4300	6503	SO:0001583	missense	2335	exon21			TCCATGTGATCAC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3316A>G	2.37:g.216264012T>C	ENSP00000352696:p.Thr1106Ala	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	37		.	.	.	.	.	.	.	.	.	.	T	22.9	4.348521	0.82132	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36	5.75	5.75	0.90469	.	0.000000	0.64402	D	0.000001	T	0.67306	0.2879	L	0.47716	1.5	0.54753	D	0.999989	D;D;D;D;D;P;D;D;D;D	0.71674	0.994;0.987;0.957;0.994;0.99;0.863;0.998;0.988;0.994;0.987	D;P;D;D;D;P;D;D;D;D	0.85130	0.992;0.891;0.936;0.992;0.996;0.729;0.997;0.992;0.992;0.992	T	0.69401	-0.5155	10	0.66056	D	0.02	.	16.0707	0.80928	0.0:0.0:0.0:1.0	.	1106;1106;1106;1106;1106;1106;1106;1106;1106;1106	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	A	1106	ENSP00000394423:T1106A;ENSP00000323534:T1106A;ENSP00000338200:T1106A;ENSP00000350534:T1106A;ENSP00000346839:T1106A;ENSP00000352696:T1106A;ENSP00000265312:T1106A;ENSP00000273049:T1106A;ENSP00000349509:T1106A;ENSP00000410422:T1106A;ENSP00000415018:T1106A;ENSP00000399538:T1106A;ENSP00000348285:T1106A	ENSP00000265313:T1106A	T	-	1	0	FN1	215972257	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	3.912000	0.56386	2.194000	0.70268	0.533000	0.62120	ACA	.		0.468	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
GHDC	84514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	40342899	40342899	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:40342899G>A	ENST00000301671.8	-	6	1546	c.1105C>T	c.(1105-1107)Cga>Tga	p.R369*	GHDC_ENST00000414034.3_Nonsense_Mutation_p.R369*|GHDC_ENST00000428494.2_Nonsense_Mutation_p.R330*|GHDC_ENST00000587427.1_Nonsense_Mutation_p.R369*|GHDC_ENST00000436923.2_Nonsense_Mutation_p.R369*|GHDC_ENST00000593209.1_Nonsense_Mutation_p.R369*|GHDC_ENST00000590520.1_5'Flank			Q8N2G8	GHDC_HUMAN	GH3 domain containing	369						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CCAACCACTCGCACCACATCA	0.627																																					p.R369X		.											.	GHDC	90	0			c.C1105T						.						92.0	91.0	91.0					17																	40342899		2203	4300	6503	SO:0001587	stop_gained	84514	exon7			CCACTCGCACCAC	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.1105C>T	17.37:g.40342899G>A	ENSP00000301671:p.Arg369*	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	25.0	NM_001142623	B4DQS4|E9PDB5|Q9BXM6	Nonsense_Mutation	SNP	ENST00000301671.8	37	CCDS11422.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070655	0.76301	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.18	4.18	0.49190	.	0.643001	0.15310	N	0.269145	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0714	13.8103	0.63260	0.0:0.0:1.0:0.0	.	.	.	.	X	313;330;369;369;369	.	ENSP00000301671:R369X	R	-	1	2	GHDC	37596425	0.238000	0.23825	0.049000	0.19019	0.218000	0.24690	3.442000	0.52900	2.146000	0.66826	0.561000	0.74099	CGA	.		0.627	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
GLI2	2736	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	121748010	121748010	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:121748010C>A	ENST00000452319.1	+	14	4580	c.4520C>A	c.(4519-4521)gCc>gAc	p.A1507D	GLI2_ENST00000314490.11_Intron|GLI2_ENST00000361492.4_Missense_Mutation_p.A1507D					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CTCCTGGAGGCCCCCCAGATT	0.622																																					p.A1507D		.											.	GLI2	954	0			c.C4520A						.						89.0	98.0	95.0					2																	121748010		2203	4300	6503	SO:0001583	missense	2736	exon13			TGGAGGCCCCCCA		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.4520C>A	2.37:g.121748010C>A	ENSP00000390436:p.Ala1507Asp	Somatic	133.0	1.0		WXS	Illumina HiSeq	Phase_I	82.0	53.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	37	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	C	7.283	0.609412	0.14066	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.14144	2.53;2.53	4.87	4.87	0.63330	.	0.175056	0.49305	D	0.000144	T	0.20333	0.0489	L	0.51422	1.61	0.80722	D	1	P;D	0.53885	0.883;0.963	B;P	0.48270	0.368;0.572	T	0.01884	-1.1254	10	0.23302	T	0.38	.	18.2163	0.89886	0.0:1.0:0.0:0.0	.	1507;1162	P10070;P10070-2	GLI2_HUMAN;.	D	1507	ENSP00000390436:A1507D;ENSP00000354586:A1507D	ENSP00000354586:A1507D	A	+	2	0	GLI2	121464480	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	4.716000	0.61916	2.525000	0.85131	0.555000	0.69702	GCC	.		0.622	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
GPR119	139760	hgsc.bcm.edu;bcgsc.ca	37	X	129518585	129518585	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:129518585A>G	ENST00000276218.2	-	1	926	c.837T>C	c.(835-837)taT>taC	p.Y279Y		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	279					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						GCCAATAGGCATAGATGAGTG	0.572																																					p.Y279Y		.											.	GPR119	132	0			c.T837C						.						77.0	70.0	73.0					X																	129518585		2203	4300	6503	SO:0001819	synonymous_variant	139760	exon1			ATAGGCATAGATG	AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.837T>C	X.37:g.129518585A>G		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	6.0	NM_178471	Q495H7|Q4VBN3	Silent	SNP	ENST00000276218.2	37	CCDS14625.1																																																																																			.		0.572	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058270.1	NM_178471	
GRIK3	2899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	37282833	37282833	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:37282833C>A	ENST00000373091.3	-	13	1935	c.1919G>T	c.(1918-1920)gGc>gTc	p.G640V	GRIK3_ENST00000373093.4_Missense_Mutation_p.G640V	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	640					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CCACCAGATGCCACCAATGAT	0.552																																					p.G640V		.											.	GRIK3	158	0			c.G1919T						.						164.0	143.0	150.0					1																	37282833		2203	4300	6503	SO:0001583	missense	2899	exon13			CAGATGCCACCAA	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1919G>T	1.37:g.37282833C>A	ENSP00000362183:p.Gly640Val	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	72.0	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029633	0.93518	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	D;D	0.96913	-4.17;-4.17	5.74	5.74	0.90152	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	D	0.98143	0.9387	M	0.78285	2.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98686	1.0694	10	0.87932	D	0	.	19.9326	0.97124	0.0:1.0:0.0:0.0	.	640;640	A9Z1Z8;Q13003	.;GRIK3_HUMAN	V	640	ENSP00000362183:G640V;ENSP00000362185:G640V	ENSP00000362183:G640V	G	-	2	0	GRIK3	37055420	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.720000	0.93068	0.650000	0.86243	GGC	.		0.552	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
GSTP1	2950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	67352159	67352159	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:67352159T>C	ENST00000398606.3	+	4	397	c.148T>C	c.(148-150)Tac>Cac	p.Y50H	GSTP1_ENST00000398603.1_Missense_Mutation_p.Y50H|GSTP1_ENST00000498765.1_3'UTR	NM_000852.3	NP_000843.1	P09211	GSTP1_HUMAN	glutathione S-transferase pi 1	50	GST N-terminal.				cellular response to lipopolysaccharide (GO:0071222)|central nervous system development (GO:0007417)|common myeloid progenitor cell proliferation (GO:0035726)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biosynthetic process (GO:0009890)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of leukocyte proliferation (GO:0070664)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of monocyte chemotactic protein-1 production (GO:0071638)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|nitric oxide storage (GO:0035732)|positive regulation of superoxide anion generation (GO:0032930)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of stress-activated MAPK cascade (GO:0032872)|response to reactive oxygen species (GO:0000302)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|TRAF2-GSTP1 complex (GO:0097057)|vesicle (GO:0031982)	dinitrosyl-iron complex binding (GO:0035731)|glutathione transferase activity (GO:0004364)|JUN kinase binding (GO:0008432)|kinase regulator activity (GO:0019207)|nitric oxide binding (GO:0070026)|S-nitrosoglutathione binding (GO:0035730)			central_nervous_system(1)|cervix(1)|endometrium(4)|lung(2)|ovary(1)	9					Busulfan(DB01008)|Carboplatin(DB00958)|Chlorambucil(DB00291)|Cisplatin(DB00515)|Clomipramine(DB01242)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	CCAACAGCTATACGGGCAGCT	0.642																																					p.Y50H		.											.	GSTP1	91	0			c.T148C						.						89.0	101.0	97.0					11																	67352159		2020	4163	6183	SO:0001583	missense	2950	exon4			CAGCTATACGGGC	U12472	CCDS41679.1	11q13.2	2014-09-17	2008-07-18		ENSG00000084207	ENSG00000084207	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4638	protein-coding gene	gene with protein product		134660		FAEES3, GST3		1885604, 7587384, 19915149	Standard	NM_000852		Approved	GSTP	uc001omf.3	P09211	OTTHUMG00000137430	ENST00000398606.3:c.148T>C	11.37:g.67352159T>C	ENSP00000381607:p.Tyr50His	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	48.0	NM_000852	O00460|Q15690|Q5TZY3	Missense_Mutation	SNP	ENST00000398606.3	37	CCDS41679.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.659769	0.47572	.	.	ENSG00000084207	ENST00000398606;ENST00000398603	T;T	0.06528	3.29;3.29	5.65	3.22	0.36961	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.440715	0.20425	N	0.092595	T	0.19167	0.0460	M	0.78916	2.43	0.25396	N	0.988486	D	0.55172	0.97	D	0.64237	0.923	T	0.16100	-1.0414	9	0.87932	D	0	-11.2425	6.068	0.19873	0.0:0.0853:0.1624:0.7523	.	50	P09211	GSTP1_HUMAN	H	50	ENSP00000381607:Y50H;ENSP00000381604:Y50H	ENSP00000381604:Y50H	Y	+	1	0	GSTP1	67108735	0.999000	0.42202	0.309000	0.25155	0.033000	0.12548	3.847000	0.55895	0.971000	0.38288	0.529000	0.55759	TAC	.		0.642	GSTP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268504.1	NM_000852	
GUCY2C	2984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	14840921	14840921	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:14840921G>T	ENST00000261170.3	-	2	430	c.294C>A	c.(292-294)agC>agA	p.S98R	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	98					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	CTTCACAGGTGCTACTCCGGC	0.483																																					p.S98R		.											.	GUCY2C	338	0			c.C294A						.						100.0	95.0	97.0					12																	14840921		2203	4300	6503	SO:0001583	missense	2984	exon2			ACAGGTGCTACTC		CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.294C>A	12.37:g.14840921G>T	ENSP00000261170:p.Ser98Arg	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	25.0	NM_004963	B2RMY6	Missense_Mutation	SNP	ENST00000261170.3	37	CCDS8664.1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.778838	0.70107	.	.	ENSG00000070019	ENST00000261170	T	0.75938	-0.98	5.48	1.53	0.23141	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.82107	0.4965	M	0.74881	2.28	0.43187	D	0.995011	D	0.89917	1.0	D	0.79784	0.993	T	0.80155	-0.1500	10	0.87932	D	0	.	7.3263	0.26557	0.3561:0.0:0.6439:0.0	.	98	P25092	GUC2C_HUMAN	R	98	ENSP00000261170:S98R	ENSP00000261170:S98R	S	-	3	2	GUCY2C	14732188	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	0.803000	0.27083	0.354000	0.24105	0.591000	0.81541	AGC	.		0.483	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400835.1		
HCN1	348980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	45303811	45303811	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:45303811A>G	ENST00000303230.4	-	6	1565	c.1508T>C	c.(1507-1509)aTa>aCa	p.I503T		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	503					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TCCTTCTCGTATGATATAATC	0.408																																					p.I503T		.											.	HCN1	91	0			c.T1508C						.						113.0	113.0	113.0					5																	45303811		2203	4300	6503	SO:0001583	missense	348980	exon6			TCTCGTATGATAT	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1508T>C	5.37:g.45303811A>G	ENSP00000307342:p.Ile503Thr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	55.0	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	37	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.537042	0.85812	.	.	ENSG00000164588	ENST00000303230	D	0.94092	-3.35	5.62	5.62	0.85841	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000001	D	0.97636	0.9225	H	0.94698	3.57	0.80722	D	1	D	0.69078	0.997	D	0.77557	0.99	D	0.98779	1.0731	10	0.87932	D	0	.	16.1172	0.81314	1.0:0.0:0.0:0.0	.	503	O60741	HCN1_HUMAN	T	503	ENSP00000307342:I503T	ENSP00000307342:I503T	I	-	2	0	HCN1	45339568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.266000	0.75297	0.533000	0.62120	ATA	.		0.408	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
HGF	3082	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	81358964	81358964	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:81358964A>G	ENST00000222390.5	-	8	1223	c.997T>C	c.(997-999)Tat>Cat	p.Y333H	HGF_ENST00000457544.2_Missense_Mutation_p.Y328H	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	333	Kringle 3. {ECO:0000255|PROSITE- ProRule:PRU00121}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						TCGTGAGGATACTGAGAATCC	0.438																																					p.Y333H		.											.	HGF	516	0			c.T997C						.						154.0	141.0	145.0					7																	81358964		2203	4300	6503	SO:0001583	missense	3082	exon8			GAGGATACTGAGA		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.997T>C	7.37:g.81358964A>G	ENSP00000222390:p.Tyr333His	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	5.0	NM_000601	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	ENST00000222390.5	37	CCDS5597.1	.	.	.	.	.	.	.	.	.	.	A	10.63	1.403435	0.25291	.	.	ENSG00000019991	ENST00000222390;ENST00000457544	T;T	0.62498	0.02;0.02	5.76	4.63	0.57726	Kringle (4);Kringle-like fold (1);	0.170349	0.52532	D	0.000073	T	0.38081	0.1027	N	0.12637	0.245	0.80722	D	1	B;B	0.15930	0.007;0.015	B;B	0.18561	0.013;0.022	T	0.24119	-1.0169	10	0.15952	T	0.53	.	7.0421	0.25025	0.7955:0.0:0.0714:0.1331	.	328;333	P14210-3;P14210	.;HGF_HUMAN	H	333;328	ENSP00000222390:Y333H;ENSP00000391238:Y328H	ENSP00000222390:Y333H	Y	-	1	0	HGF	81196900	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.894000	0.28350	2.182000	0.69389	0.533000	0.62120	TAT	.		0.438	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253315.2	NM_000601	
HIPK1	204851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114500750	114500750	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:114500750T>C	ENST00000369558.1	+	8	2050	c.1818T>C	c.(1816-1818)gaT>gaC	p.D606D	HIPK1_ENST00000369553.1_Silent_p.D212D|HIPK1_ENST00000340480.4_Silent_p.D232D|HIPK1_ENST00000406344.1_Silent_p.D212D|HIPK1_ENST00000369561.4_Silent_p.D572D|HIPK1_ENST00000369554.2_Silent_p.D606D|HIPK1_ENST00000426820.2_Silent_p.D606D|HIPK1_ENST00000369555.2_Silent_p.D606D|HIPK1_ENST00000369559.4_Silent_p.D606D			Q86Z02	HIPK1_HUMAN	homeodomain interacting protein kinase 1	606					anterior/posterior pattern specification (GO:0009952)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway (GO:0097191)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|neuron differentiation (GO:0030182)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|retina layer formation (GO:0010842)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|prostate(2)	39	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTAATTCAGATGTCTCACTAC	0.458																																					p.D606D		.											.	HIPK1	361	0			c.T1818C						.						134.0	132.0	133.0					1																	114500750		2203	4300	6503	SO:0001819	synonymous_variant	204851	exon8			TTCAGATGTCTCA	AB089957	CCDS867.1, CCDS868.1, CCDS869.1, CCDS41370.1	1p13.1	2008-02-05			ENSG00000163349	ENSG00000163349			19006	protein-coding gene	gene with protein product		608003					Standard	NM_198268		Approved	KIAA0630, Myak, MGC26642, Nbak2, MGC33446, MGC33548	uc001eem.3	Q86Z02	OTTHUMG00000011983	ENST00000369558.1:c.1818T>C	1.37:g.114500750T>C		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	50.0	NM_198268	A6NJ34|O75125|Q5SQL2|Q5SQL4|Q5SQL5|Q8IYD7|Q8NDN5|Q8NEB6|Q8TBZ1	Silent	SNP	ENST00000369558.1	37	CCDS867.1																																																																																			.		0.458	HIPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000033127.1	NM_198268	
HIPK3	10114	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	33308924	33308924	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:33308924G>T	ENST00000303296.4	+	2	1269	c.964G>T	c.(964-966)Gat>Tat	p.D322Y	HIPK3_ENST00000525975.1_Missense_Mutation_p.D322Y|HIPK3_ENST00000456517.1_Missense_Mutation_p.D322Y|HIPK3_ENST00000379016.3_Missense_Mutation_p.D322Y	NM_005734.3	NP_005725.3	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3	322	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|mRNA transcription (GO:0009299)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(3)|large_intestine(9)|liver(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	39						AATTCATGCTGATCTCAAGCC	0.413																																					p.D322Y		.											.	HIPK3	336	0			c.G964T						.						95.0	95.0	95.0					11																	33308924		2202	4298	6500	SO:0001583	missense	10114	exon2			CATGCTGATCTCA	AF004849	CCDS7884.1, CCDS41634.1	11p13	2008-07-18	2001-11-29		ENSG00000110422	ENSG00000110422			4915	protein-coding gene	gene with protein product		604424	"""homeodomain-interacting protein kinase 3"""			9373137, 9748262	Standard	NM_005734		Approved	PKY, DYRK6, YAK1, FIST3	uc031pzm.1	Q9H422	OTTHUMG00000132269	ENST00000303296.4:c.964G>T	11.37:g.33308924G>T	ENSP00000304226:p.Asp322Tyr	Somatic	113.0	1.0		WXS	Illumina HiSeq	Phase_I	98.0	43.0	NM_001048200	O14632|Q2PBG4|Q2PBG5|Q92632|Q9HAS2	Missense_Mutation	SNP	ENST00000303296.4	37	CCDS7884.1	.	.	.	.	.	.	.	.	.	.	G	19.81	3.897389	0.72639	.	.	ENSG00000110422	ENST00000525975;ENST00000303296;ENST00000379016;ENST00000456517	D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	D	0.97914	0.9314	H	0.95079	3.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98839	1.0754	10	0.87932	D	0	.	19.3879	0.94565	0.0:0.0:1.0:0.0	.	322;322	Q9H422-2;Q9H422	.;HIPK3_HUMAN	Y	322	ENSP00000431710:D322Y;ENSP00000304226:D322Y;ENSP00000368301:D322Y;ENSP00000398241:D322Y	ENSP00000304226:D322Y	D	+	1	0	HIPK3	33265500	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.869000	0.99810	2.592000	0.87571	0.467000	0.42956	GAT	.		0.413	HIPK3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255358.1	NM_005734	
HMGCR	3156	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	74645959	74645959	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:74645959T>G	ENST00000287936.4	+	7	805	c.649T>G	c.(649-651)Tcc>Gcc	p.S217A	HMGCR_ENST00000343975.5_Missense_Mutation_p.S217A|HMGCR_ENST00000511206.1_Missense_Mutation_p.S217A	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	217	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	AGCTTGTGTGTCCTTGGTATT	0.408																																					p.S217A		.											.	HMGCR	227	0			c.T649G						.						219.0	195.0	203.0					5																	74645959		2203	4300	6503	SO:0001583	missense	3156	exon7			TGTGTGTCCTTGG		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.649T>G	5.37:g.74645959T>G	ENSP00000287936:p.Ser217Ala	Somatic	156.0	1.0		WXS	Illumina HiSeq	Phase_I	200.0	72.0	NM_001130996	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	37	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.500502	0.85176	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	D;D;D	0.96011	-3.88;-3.88;-3.88	5.93	5.93	0.95920	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.96965	0.9009	M	0.61703	1.905	0.80722	D	1	P;D;D;P	0.89917	0.901;0.998;1.0;0.901	P;D;D;P	0.85130	0.677;0.996;0.997;0.605	D	0.96111	0.9077	10	0.28530	T	0.3	-15.4012	16.05	0.80749	0.0:0.0:0.0:1.0	.	217;217;217;217	B2R649;A8KA27;P04035-2;P04035	.;.;.;HMDH_HUMAN	A	217;148;217;217	ENSP00000426745:S217A;ENSP00000287936:S217A;ENSP00000340816:S217A	ENSP00000287936:S217A	S	+	1	0	HMGCR	74681715	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.843000	0.86859	2.263000	0.75096	0.533000	0.62120	TCC	.		0.408	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
HMX2	3167	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	124909334	124909334	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:124909334T>C	ENST00000339992.3	+	2	774	c.517T>C	c.(517-519)Tac>Cac	p.Y173H		NM_005519.1	NP_005510.1	A2RU54	HMX2_HUMAN	H6 family homeobox 2	173					brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|lung(4)|prostate(1)	7		all_neural(114;0.169)|Colorectal(57;0.207)|Glioma(114;0.222)		Colorectal(40;0.123)|COAD - Colon adenocarcinoma(40;0.141)		CATGAAGCGCTACCTGAGCAG	0.652																																					p.Y173H		.											.	HMX2	90	0			c.T517C						.						19.0	20.0	20.0					10																	124909334		2188	4261	6449	SO:0001583	missense	3167	exon2			AAGCGCTACCTGA		CCDS31305.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188816	ENSG00000188816		"""Homeoboxes / ANTP class : NKL subclass"""	5018	protein-coding gene	gene with protein product		600647	"""homeo box (H6 family) 2"""			7647458	Standard	XM_005269743		Approved	NKX5-2	uc001lhc.1	A2RU54	OTTHUMG00000019198	ENST00000339992.3:c.517T>C	10.37:g.124909334T>C	ENSP00000341108:p.Tyr173His	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	37.0	NM_005519	B2RNV5	Missense_Mutation	SNP	ENST00000339992.3	37	CCDS31305.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.722846	0.89298	.	.	ENSG00000188816	ENST00000339992	D	0.97328	-4.34	5.3	5.3	0.74995	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98645	0.9546	M	0.90252	3.1	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99787	1.1030	10	0.87932	D	0	.	15.4082	0.74897	0.0:0.0:0.0:1.0	.	173	A2RU54	HMX2_HUMAN	H	173	ENSP00000341108:Y173H	ENSP00000341108:Y173H	Y	+	1	0	HMX2	124899324	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.780000	0.85658	2.212000	0.71576	0.533000	0.62120	TAC	.		0.652	HMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050841.1	XM_370580	
HSPA1L	3305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31778417	31778417	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:31778417A>G	ENST00000375654.4	-	2	1522	c.1333T>C	c.(1333-1335)Tat>Cat	p.Y445H	HSPA1L_ENST00000417199.3_Missense_Mutation_p.Y445H	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	445					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						TCGCCCTCATACACCTGGATC	0.567																																					p.Y445H		.											.	HSPA1L	230	0			c.T1333C						.						140.0	136.0	137.0					6																	31778417		2203	4300	6503	SO:0001583	missense	3305	exon2			CCTCATACACCTG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1333T>C	6.37:g.31778417A>G	ENSP00000364805:p.Tyr445His	Somatic	239.0	0.0		WXS	Illumina HiSeq	Phase_I	365.0	118.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	37	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	A	11.72	1.724276	0.30593	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	T;T	0.07216	3.21;3.21	5.14	5.14	0.70334	.	0.000000	0.31734	N	0.007146	T	0.31451	0.0797	H	0.95645	3.7	0.45580	D	0.998523	D	0.65815	0.995	D	0.78314	0.991	T	0.46610	-0.9179	10	0.87932	D	0	-11.4216	12.941	0.58345	1.0:0.0:0.0:0.0	.	445	P34931	HS71L_HUMAN	H	445;445;390	ENSP00000364805:Y445H;ENSP00000387691:Y445H	ENSP00000364804:Y390H	Y	-	1	0	HSPA1L	31886396	1.000000	0.71417	0.114000	0.21550	0.001000	0.01503	9.139000	0.94554	2.156000	0.67533	0.477000	0.44152	TAT	.		0.567	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
HSPB2	3316	broad.mit.edu;bcgsc.ca	37	11	111784335	111784335	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:111784335A>G	ENST00000304298.3	+	2	853	c.265A>G	c.(265-267)Act>Gct	p.T89A	CRYAB_ENST00000533971.1_5'Flank|CRYAB_ENST00000525823.1_5'Flank|CRYAB_ENST00000227251.3_5'Flank|CRYAB_ENST00000531198.1_5'Flank|CRYAB_ENST00000533280.1_5'Flank|HSPB2_ENST00000537382.1_Missense_Mutation_p.T89A|CRYAB_ENST00000527950.1_Intron|HSPB2-C11orf52_ENST00000534100.1_Intron|CRYAB_ENST00000533475.1_5'UTR|CRYAB_ENST00000526180.1_5'Flank	NM_001541.3	NP_001532.1	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	89					positive regulation of catalytic activity (GO:0043085)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)			large_intestine(2)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)		AGACGAGGTGACTGTGAGGAC	0.632																																					p.T89A		.											.	HSPB2	659	0			c.A265G						.						90.0	84.0	86.0					11																	111784335		2201	4297	6498	SO:0001583	missense	3316	exon2			GAGGTGACTGTGA	U75898	CCDS8352.1	11q22-q23	2011-09-02	2002-08-29			ENSG00000170276		"""Heat shock proteins / HSPB"""	5247	protein-coding gene	gene with protein product		602179	"""heat shock 27kD protein 2"""			9344664, 9490724	Standard	NM_001541		Approved	Hs.78846, MKBP	uc001pmg.2	Q16082		ENST00000304298.3:c.265A>G	11.37:g.111784335A>G	ENSP00000302476:p.Thr89Ala	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	4.0	NM_001541	Q6I9U7	Missense_Mutation	SNP	ENST00000304298.3	37	CCDS8352.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341136	0.41498	.	.	ENSG00000170276	ENST00000304298;ENST00000537382	D;D	0.92397	-3.03;-3.03	4.84	3.69	0.42338	Heat shock protein Hsp20 (2);HSP20-like chaperone (1);	0.124902	0.48767	D	0.000170	D	0.87132	0.6101	L	0.49640	1.575	0.28857	N	0.895712	B	0.23377	0.084	B	0.18871	0.023	T	0.79431	-0.1806	10	0.44086	T	0.13	-22.0503	6.5046	0.22188	0.7843:0.0:0.0757:0.1399	.	89	Q16082	HSPB2_HUMAN	A	89	ENSP00000302476:T89A;ENSP00000445585:T89A	ENSP00000302476:T89A	T	+	1	0	HSPB2	111289545	0.998000	0.40836	0.994000	0.49952	0.969000	0.65631	3.183000	0.50918	0.962000	0.38057	0.528000	0.53228	ACT	.		0.632	HSPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391669.1		
IARS2	55699	hgsc.bcm.edu;bcgsc.ca	37	1	220276069	220276069	+	Silent	SNP	A	A	G	rs112842443		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:220276069A>G	ENST00000302637.5	+	7	1004	c.900A>G	c.(898-900)caA>caG	p.Q300Q	IARS2_ENST00000366922.1_Silent_p.Q228Q	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	300					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GGACCACACAACCTTGGACGA	0.343																																					p.Q300Q		.											.	IARS2	94	0			c.A900G						.						111.0	107.0	108.0					1																	220276069		2203	4300	6503	SO:0001819	synonymous_variant	55699	exon7			CACACAACCTTGG	AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.900A>G	1.37:g.220276069A>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_018060	B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Silent	SNP	ENST00000302637.5	37	CCDS1523.1																																																																																			A|0.500;G|0.500		0.343	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_018060	
IL12A	3592	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	159711260	159711260	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:159711260G>C	ENST00000305579.2	+	4	708	c.401G>C	c.(400-402)aGa>aCa	p.R134T	IL12A_ENST00000480787.1_Missense_Mutation_p.R96T|IL12A-AS1_ENST00000497452.1_RNA|IL12A_ENST00000466512.1_Intron	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	100					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CTAAATTCCAGAGAGACCTCT	0.308																																					p.R134T		.											.	IL12A	90	0			c.G401C						.						59.0	60.0	59.0					3																	159711260		2203	4300	6503	SO:0001583	missense	3592	exon4			ATTCCAGAGAGAC	M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.401G>C	3.37:g.159711260G>C	ENSP00000303231:p.Arg134Thr	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	45.0	NM_000882	Q96QZ1	Missense_Mutation	SNP	ENST00000305579.2	37	CCDS3187.1	.	.	.	.	.	.	.	.	.	.	G	1.493	-0.554082	0.03996	.	.	ENSG00000168811	ENST00000305579;ENST00000480787	.	.	.	3.8	0.996	0.19844	.	0.851921	0.10463	N	0.671752	T	0.48589	0.1508	L	0.55103	1.725	0.58432	D	0.999991	P	0.43231	0.801	B	0.43990	0.438	T	0.44205	-0.9343	9	0.51188	T	0.08	-0.4938	6.1096	0.20094	0.3345:0.0:0.6655:0.0	.	134	O60595	.	T	134;96	.	ENSP00000303231:R134T	R	+	2	0	IL12A	161193954	0.178000	0.23122	0.868000	0.34077	0.150000	0.21749	0.030000	0.13688	0.207000	0.20607	-0.142000	0.14014	AGA	.		0.308	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352602.2	NM_000882	
IL34	146433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70688456	70688456	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:70688456T>A	ENST00000288098.2	+	2	427	c.44T>A	c.(43-45)cTt>cAt	p.L15H	IL34_ENST00000429149.2_Missense_Mutation_p.L15H|IL34_ENST00000569641.1_Intron|IL34_ENST00000566361.1_5'UTR	NM_001172772.1	NP_001166243.1	Q6ZMJ4	IL34_HUMAN	interleukin 34	15					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	extracellular space (GO:0005615)	macrophage colony-stimulating factor receptor binding (GO:0005157)			breast(1)|central_nervous_system(1)|kidney(9)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(2)	17						GGGATCTTCCTTGGCGTGGCC	0.572											OREG0023916	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L15H		.											.	IL34	91	0			c.T44A						.						383.0	253.0	297.0					16																	70688456		2198	4300	6498	SO:0001583	missense	146433	exon3			TCTTCCTTGGCGT	BC029804	CCDS10895.1	16q22.1	2008-08-01	2008-06-04	2008-06-04	ENSG00000157368	ENSG00000157368		"""Interleukins and interleukin receptors"""	28529	protein-coding gene	gene with protein product		612081	"""chromosome 16 open reading frame 77"""	C16orf77		18467591	Standard	NM_152456		Approved	MGC34647, IL-34	uc002ezh.2	Q6ZMJ4	OTTHUMG00000137581	ENST00000288098.2:c.44T>A	16.37:g.70688456T>A	ENSP00000288098:p.Leu15His	Somatic	165.0	0.0	1124	WXS	Illumina HiSeq	Phase_I	190.0	68.0	NM_152456	B2RC28|B2Z4A8|B2ZC70|Q8N6L2	Missense_Mutation	SNP	ENST00000288098.2	37	CCDS10895.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759491	0.31137	.	.	ENSG00000157368	ENST00000429149;ENST00000288098	T;T	0.51071	0.72;0.72	4.89	4.89	0.63831	.	0.102151	0.39274	N	0.001412	T	0.62756	0.2454	M	0.75447	2.3	0.09310	N	0.999999	D;D	0.69078	0.997;0.997	D;D	0.63192	0.912;0.912	T	0.58578	-0.7612	10	0.87932	D	0	-6.13	8.871	0.35316	0.0:0.0:0.1888:0.8112	.	15;15	Q6ZMJ4-2;Q6ZMJ4	.;IL34_HUMAN	H	15	ENSP00000397863:L15H;ENSP00000288098:L15H	ENSP00000288098:L15H	L	+	2	0	IL34	69245957	1.000000	0.71417	0.889000	0.34880	0.017000	0.09413	2.881000	0.48538	1.835000	0.53391	0.379000	0.24179	CTT	.		0.572	IL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268971.3	NM_152456	
INCENP	3619	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	61906200	61906200	+	Silent	SNP	A	A	G	rs150865728|rs34042792		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:61906200A>G	ENST00000394818.3	+	6	1333	c.1131A>G	c.(1129-1131)gaA>gaG	p.E377E	INCENP_ENST00000278849.4_Silent_p.E377E	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	377					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGCAGAAGGAACCCCCCGAGG	0.627																																					p.E377E		.											.	INCENP	227	0			c.A1131G						.	A	,	1,4403	2.1+/-5.4	0,1,2201	50.0	54.0	52.0		1131,1131	-1.8	0.0	11	dbSNP_134	52	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	INCENP	NM_001040694.1,NM_020238.2	,	0,1,6500	GG,GA,AA		0.0,0.0227,0.0077	,	377/919,377/915	61906200	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	3619	exon6			GAAGGAACCCCCC	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.1131A>G	11.37:g.61906200A>G		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	4.0	NM_001040694	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	37	CCDS44624.1																																																																																			A|1.000;G|0.000		0.627	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000394723.2	NM_020238	
ING3	54556	hgsc.bcm.edu;bcgsc.ca	37	7	120607623	120607623	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:120607623T>C	ENST00000315870.5	+	7	625	c.477T>C	c.(475-477)gaT>gaC	p.D159D	ING3_ENST00000431467.1_Silent_p.D144D	NM_019071.2	NP_061944.2	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3	159					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|positive regulation of apoptotic process (GO:0043065)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	12	all_neural(327;0.117)					CGACAACAGATCATATTCCTG	0.299																																					p.D159D		.											.	ING3	515	0			c.T477C						.						73.0	75.0	75.0					7																	120607623		2203	4296	6499	SO:0001819	synonymous_variant	54556	exon7			AACAGATCATATT	AF074968	CCDS5778.1, CCDS35497.1	7q31	2013-01-28			ENSG00000071243	ENSG00000071243		"""Zinc fingers, PHD-type"""	14587	protein-coding gene	gene with protein product		607493				12080476	Standard	NM_019071		Approved	p47ING3, FLJ20089, Eaf4, MEAF4	uc003vjn.3	Q9NXR8	OTTHUMG00000141270	ENST00000315870.5:c.477T>C	7.37:g.120607623T>C		Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_019071	A8K790|O60394|Q567P3|Q6GMT3|Q7Z762|Q969G0|Q96DT4|Q9HC99|Q9P081	Silent	SNP	ENST00000315870.5	37	CCDS5778.1																																																																																			.		0.299	ING3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280453.2	NM_019071	
INPP5A	3632	hgsc.bcm.edu;bcgsc.ca	37	10	134523851	134523851	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:134523851delT	ENST00000368594.3	+	8	815	c.538delT	c.(538-540)ttgfs	p.L180fs	INPP5A_ENST00000487614.1_3'UTR|INPP5A_ENST00000368593.3_Frame_Shift_Del_p.L180fs	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	180					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)			cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		TGCCTTTGACTTGGTGAATAT	0.542																																					p.L180fs	Pancreas(63;823 1267 11107 20380 51626)	.											.	INPP5A	229	0			c.538delT						.						97.0	77.0	84.0					10																	134523851		2203	4300	6503	SO:0001589	frameshift_variant	3632	exon8			TTTGACTTGGTGA	X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.538delT	10.37:g.134523851delT	ENSP00000357583:p.Leu180fs	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	55.0	NM_005539	D3DXI3|Q14640|Q5JSF1	Frame_Shift_Del	DEL	ENST00000368594.3	37	CCDS7669.2																																																																																			.		0.542	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051085.1	NM_005539	
ITGAL	3683	hgsc.bcm.edu;bcgsc.ca	37	16	30507878	30507878	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:30507878T>C	ENST00000356798.6	+	15	2003	c.1823T>C	c.(1822-1824)aTc>aCc	p.I608T	ITGAL_ENST00000358164.5_Missense_Mutation_p.I525T|RP11-297C4.1_ENST00000563751.1_RNA|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	608					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	AGCCAGATGATCGTGCTGAGG	0.468																																					p.I608T	NSCLC(110;1462 1641 3311 33990 49495)	.											.	ITGAL	994	0			c.T1823C						.						92.0	78.0	82.0					16																	30507878		2197	4300	6497	SO:0001583	missense	3683	exon15			AGATGATCGTGCT		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.1823T>C	16.37:g.30507878T>C	ENSP00000349252:p.Ile608Thr	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	6.0	NM_002209	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	37	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	T	12.81	2.048303	0.36181	.	.	ENSG00000005844	ENST00000356798;ENST00000358164	T;T	0.55052	0.54;0.54	5.94	5.94	0.96194	.	0.562934	0.17117	N	0.186415	T	0.50137	0.1598	L	0.56199	1.76	0.80722	D	1	B;B	0.26876	0.162;0.096	B;B	0.21546	0.035;0.024	T	0.50197	-0.8856	10	0.72032	D	0.01	.	13.9183	0.63914	0.0:0.0:0.0:1.0	.	525;608	Q96HB1;P20701	.;ITAL_HUMAN	T	608;525	ENSP00000349252:I608T;ENSP00000350886:I525T	ENSP00000349252:I608T	I	+	2	0	ITGAL	30415379	0.633000	0.27181	0.977000	0.42913	0.246000	0.25737	4.432000	0.59922	2.272000	0.75746	0.460000	0.39030	ATC	.		0.468	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
KCNB2	9312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	73849087	73849087	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:73849087G>A	ENST00000523207.1	+	3	2085	c.1497G>A	c.(1495-1497)ctG>ctA	p.L499L		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	499					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	GGAAGGCTCTGTCGGAAACAA	0.552																																					p.L499L		.											.	KCNB2	158	0			c.G1497A						.						106.0	114.0	112.0					8																	73849087		2203	4300	6503	SO:0001819	synonymous_variant	9312	exon3			GGCTCTGTCGGAA	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.1497G>A	8.37:g.73849087G>A		Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	12.0	NM_004770	Q7Z7D0|Q9BXD3	Silent	SNP	ENST00000523207.1	37	CCDS6209.1																																																																																			.		0.552	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
KCNK9	51305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	140631049	140631049	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:140631049A>G	ENST00000520439.1	-	2	640	c.577T>C	c.(577-579)Tgc>Cgc	p.C193R	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.C193R	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	193					cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GTGATGAAGCAGTAGTAGTAG	0.587																																					p.C193R		.											.	KCNK9	93	0			c.T577C						.						87.0	85.0	86.0					8																	140631049		2203	4300	6503	SO:0001583	missense	51305	exon2			TGAAGCAGTAGTA	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.577T>C	8.37:g.140631049A>G	ENSP00000430676:p.Cys193Arg	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	46.0	NM_016601	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	A	19.81	3.897449	0.72639	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.31769	1.48;1.48;1.48	5.85	5.85	0.93711	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.69441	0.3111	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.80819	-0.1212	10	0.87932	D	0	.	15.4187	0.74995	1.0:0.0:0.0:0.0	.	193	Q9NPC2	KCNK9_HUMAN	R	193	ENSP00000429847:C193R;ENSP00000302166:C193R;ENSP00000430676:C193R	ENSP00000302166:C193R	C	-	1	0	KCNK9	140700231	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.117000	0.94347	2.222000	0.72286	0.533000	0.62120	TGC	.		0.587	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378473.1	NM_016601	
KCNT2	343450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	196451495	196451495	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:196451495C>G	ENST00000294725.9	-	4	1205	c.290G>C	c.(289-291)tGg>tCg	p.W97S	KCNT2_ENST00000367431.4_Missense_Mutation_p.W97S|KCNT2_ENST00000367433.5_Missense_Mutation_p.W97S|KCNT2_ENST00000609185.1_Missense_Mutation_p.W97S|KCNT2_ENST00000451324.2_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	97					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCTGTTCACCCAAAAGATATG	0.274																																					p.W97S		.											.	KCNT2	159	0			c.G290C						.						50.0	47.0	48.0					1																	196451495		2202	4299	6501	SO:0001583	missense	343450	exon4			TTCACCCAAAAGA	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.290G>C	1.37:g.196451495C>G	ENSP00000294725:p.Trp97Ser	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	19.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	37	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.105261	0.77096	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.19532	2.14;2.19;2.38	5.44	5.44	0.79542	.	0.000000	0.56097	D	0.000028	T	0.54287	0.1849	M	0.86953	2.85	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.993;0.999;0.999;0.993	T	0.60712	-0.7209	10	0.72032	D	0.01	-10.332	18.4088	0.90543	0.0:1.0:0.0:0.0	.	97;97;97;97	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	S	97	ENSP00000356403:W97S;ENSP00000356401:W97S;ENSP00000294725:W97S	ENSP00000294725:W97S	W	-	2	0	KCNT2	194718118	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.374000	0.73132	2.703000	0.92315	0.655000	0.94253	TGG	.		0.274	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
KIAA1462	57608	hgsc.bcm.edu;ucsc.edu	37	10	30317392	30317392	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:30317392T>C	ENST00000375377.1	-	3	1786	c.1685A>G	c.(1684-1686)cAa>cGa	p.Q562R		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	562					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						AGTCCCAGTTTGGAACTTTTT	0.463																																					p.Q562R		.											.	KIAA1462	72	0			c.A1685G						.						99.0	100.0	100.0					10																	30317392		1873	4111	5984	SO:0001583	missense	57608	exon3			CCAGTTTGGAACT	AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1685A>G	10.37:g.30317392T>C	ENSP00000364526:p.Gln562Arg	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	4.0	NM_020848	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	ENST00000375377.1	37	CCDS41500.1	.	.	.	.	.	.	.	.	.	.	T	13.65	2.301727	0.40694	.	.	ENSG00000165757	ENST00000375377	T	0.11821	2.74	5.62	5.62	0.85841	.	0.161766	0.51477	D	0.000081	T	0.12008	0.0292	N	0.22421	0.69	0.30408	N	0.779399	B	0.19817	0.039	B	0.18871	0.023	T	0.05500	-1.0881	10	0.72032	D	0.01	-21.2059	15.806	0.78513	0.0:0.0:0.0:1.0	.	562	Q9P266	K1462_HUMAN	R	562	ENSP00000364526:Q562R	ENSP00000364526:Q562R	Q	-	2	0	KIAA1462	30357398	1.000000	0.71417	0.956000	0.39512	0.166000	0.22503	4.534000	0.60622	2.142000	0.66516	0.459000	0.35465	CAA	.		0.463	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047409.1	NM_020848	
KIF27	55582	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	86504072	86504072	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:86504072T>C	ENST00000297814.2	-	7	2049	c.1906A>G	c.(1906-1908)Aag>Gag	p.K636E	KIF27_ENST00000376347.1_Missense_Mutation_p.K27E|KIF27_ENST00000334204.2_Missense_Mutation_p.K636E|KIF27_ENST00000413982.1_Missense_Mutation_p.K636E	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	636					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						TGGAGGACCTTATCTTGTTCT	0.403																																					p.K636E		.											.	KIF27	523	0			c.A1906G						.						145.0	143.0	144.0					9																	86504072		2203	4300	6503	SO:0001583	missense	55582	exon7			GGACCTTATCTTG	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.1906A>G	9.37:g.86504072T>C	ENSP00000297814:p.Lys636Glu	Somatic	136.0	1.0		WXS	Illumina HiSeq	Phase_I	172.0	63.0	NM_017576	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	37	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	C	2.735	-0.263558	0.05754	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204;ENST00000376347	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	4.75	3.86	0.44501	.	0.000000	0.51477	N	0.000096	T	0.05960	0.0155	N	0.00162	-1.95	0.09310	N	0.999997	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38929	-0.9638	10	0.02654	T	1	.	10.4713	0.44638	0.0:0.7791:0.0:0.2209	.	636;636;636	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	E	636;636;636;27	ENSP00000297814:K636E;ENSP00000401688:K636E;ENSP00000333928:K636E;ENSP00000365525:K27E	ENSP00000297814:K636E	K	-	1	0	KIF27	85693892	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.471000	0.45127	0.555000	0.29079	-1.003000	0.02500	AAG	.		0.403	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576	
KIF2A	3796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	61669513	61669513	+	Splice_Site	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:61669513G>A	ENST00000401507.3	+	17	1957		c.e17-1		KIF2A_ENST00000381103.2_Splice_Site|KIF2A_ENST00000506857.1_Splice_Site|KIF2A_ENST00000407818.3_Splice_Site|KIF2A_ENST00000509663.2_Intron	NM_001243953.1|NM_004520.4	NP_001230882.1|NP_004511.2	O00139	KIF2A_HUMAN	kinesin heavy chain member 2A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|nervous system development (GO:0007399)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|skin(1)	15		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		TGTATTTATAGGGTCAAAGAA	0.388																																					.		.											.	KIF2A	228	0			c.1761-1G>A						.						94.0	87.0	89.0					5																	61669513		2203	4300	6503	SO:0001630	splice_region_variant	3796	exon18			TTTATAGGGTCAA	BC031828	CCDS3980.2, CCDS47216.1, CCDS58949.1	5q12-q13	2008-02-05	2006-09-26	2006-09-26	ENSG00000068796	ENSG00000068796		"""Kinesins"""	6318	protein-coding gene	gene with protein product		602591	"""kinesin heavy chain member 2"""	KIF2		9177777	Standard	NM_001098511		Approved	HK2	uc003jsz.4	O00139	OTTHUMG00000097755	ENST00000401507.3:c.1647-1G>A	5.37:g.61669513G>A		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	40.0	NM_001098511	A5YM42|A5YM54|B4DY54|D3DW97|E9PB70|Q7Z5I3|Q8N5Q7	Splice_Site	SNP	ENST00000401507.3	37	CCDS3980.2	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648587	0.29336	.	.	ENSG00000068796	ENST00000401507;ENST00000381103;ENST00000407818;ENST00000506857;ENST00000512006	.	.	.	6.17	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3488	0.60589	0.1269:0.0:0.8731:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIF2A	61705270	1.000000	0.71417	0.980000	0.43619	0.071000	0.16799	9.439000	0.97543	0.941000	0.37499	0.655000	0.94253	.	.		0.388	KIF2A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317989.1	NM_004520	Intron
KRTAP5-10	387273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71277087	71277087	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:71277087T>G	ENST00000398531.1	+	1	479	c.454T>G	c.(454-456)Tca>Gca	p.S152A	KRTAP5-10_ENST00000376536.4_Missense_Mutation_p.S104A	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	152	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						ctgctgctcctcaggctgtgg	0.632																																					p.S152A		.											.	KRTAP5-10	91	0			c.T454G						.						87.0	106.0	99.0					11																	71277087		2200	4293	6493	SO:0001583	missense	387273	exon1			TGCTCCTCAGGCT	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.454T>G	11.37:g.71277087T>G	ENSP00000381542:p.Ser152Ala	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	51.0	NM_001012710	B9EHA4	Missense_Mutation	SNP	ENST00000398531.1	37	CCDS41684.1	.	.	.	.	.	.	.	.	.	.	.	5.031	0.191477	0.09547	.	.	ENSG00000204572	ENST00000398531;ENST00000376536	T;T	0.01133	5.29;5.59	1.13	-0.0925	0.13656	.	.	.	.	.	T	0.01695	0.0054	M	0.69823	2.125	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.40270	-0.9572	9	0.48119	T	0.1	.	4.4099	0.11427	0.0:0.2215:0.0:0.7785	.	152	Q6L8G5	KR510_HUMAN	A	152;104	ENSP00000381542:S152A;ENSP00000365719:S104A	ENSP00000365719:S104A	S	+	1	0	KRTAP5-10	70954735	0.040000	0.19996	0.001000	0.08648	0.067000	0.16453	0.110000	0.15437	-0.020000	0.14032	0.260000	0.18958	TCA	.		0.632	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
KSR2	283455	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	117922348	117922348	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:117922348C>G	ENST00000339824.5	-	16	3050	c.2323G>C	c.(2323-2325)Ggc>Cgc	p.G775R	KSR2_ENST00000425217.1_Missense_Mutation_p.G746R|KSR2_ENST00000302438.5_3'UTR			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	775	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGAGGTAGCCCATGCCCTGC	0.502																																					p.G746R		.											.	KSR2	1449	0			c.G2236C						.						77.0	78.0	77.0					12																	117922348		2010	4167	6177	SO:0001583	missense	283455	exon16			GGTAGCCCATGCC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.2323G>C	12.37:g.117922348C>G	ENSP00000339952:p.Gly775Arg	Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	123.0	62.0	NM_173598	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	ENST00000339824.5	37		.	.	.	.	.	.	.	.	.	.	C	29.2	4.988074	0.93106	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	D;D	0.82167	-1.58;-1.58	5.55	5.55	0.83447	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88134	0.6355	L	0.38733	1.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89059	0.3461	10	0.87932	D	0	.	19.5084	0.95130	0.0:1.0:0.0:0.0	.	775	Q6VAB6	KSR2_HUMAN	R	746;775	ENSP00000389715:G746R;ENSP00000339952:G775R	ENSP00000339952:G775R	G	-	1	0	KSR2	116406731	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.794000	0.85869	2.612000	0.88384	0.655000	0.94253	GGC	.		0.502	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
LANCL2	55915	hgsc.bcm.edu;bcgsc.ca	37	7	55466298	55466298	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:55466298T>C	ENST00000254770.2	+	3	1083	c.505T>C	c.(505-507)Tgt>Cgt	p.C169R	LANCL2_ENST00000486376.1_3'UTR	NM_018697.3	NP_061167.1	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2 (bacterial)	169					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of abscisic acid-activated signaling pathway (GO:0009789)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|GTP binding (GO:0005525)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	25	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			CAGAAGTGACTGTGAGTCCCA	0.478																																					p.C169R		.											.	LANCL2	516	0			c.T505C						.						57.0	52.0	54.0					7																	55466298		2203	4300	6503	SO:0001583	missense	55915	exon3			AGTGACTGTGAGT	AJ278245	CCDS5517.1	7q31.1-q31.33	2008-07-18	2001-12-04		ENSG00000132434	ENSG00000132434			6509	protein-coding gene	gene with protein product	"""testis-specific adriamycin sensitivity protein"", ""G protein-coupled receptor 69B"""	612919	"""LanC (bacterial lantibiotic synthetase component C)-like 2"""	GPR69B		11762191	Standard	NM_018697		Approved	TASP	uc003tqp.3	Q9NS86	OTTHUMG00000023779	ENST00000254770.2:c.505T>C	7.37:g.55466298T>C	ENSP00000254770:p.Cys169Arg	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_018697	B2R8D4|Q6NSL4|Q8TCQ3|Q9BSR1	Missense_Mutation	SNP	ENST00000254770.2	37	CCDS5517.1	.	.	.	.	.	.	.	.	.	.	T	3.861	-0.029863	0.07543	.	.	ENSG00000132434	ENST00000254770	T	0.39229	1.09	5.54	-1.04	0.10068	Six-hairpin glycosidase-like (1);	0.534882	0.21667	N	0.070928	T	0.10465	0.0256	N	0.00729	-1.24	0.09310	N	0.999996	B	0.14012	0.009	B	0.15052	0.012	T	0.33777	-0.9855	10	0.19147	T	0.46	.	5.7589	0.18188	0.4958:0.0:0.2349:0.2693	.	169	Q9NS86	LANC2_HUMAN	R	169	ENSP00000254770:C169R	ENSP00000254770:C169R	C	+	1	0	LANCL2	55433792	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	0.483000	0.22292	0.068000	0.16574	0.459000	0.35465	TGT	.		0.478	LANCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251459.1	NM_018697	
LCN2	3934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130911936	130911936	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:130911936C>A	ENST00000373017.1	+	2	369	c.132C>A	c.(130-132)gaC>gaA	p.D44E	LCN2_ENST00000470902.1_3'UTR|LCN2_ENST00000373013.2_Missense_Mutation_p.D44E|LCN2_ENST00000372998.1_Missense_Mutation_p.D44E|LCN2_ENST00000277480.2_Missense_Mutation_p.D44E|LCN2_ENST00000540948.1_Missense_Mutation_p.D44E			P80188	NGAL_HUMAN	lipocalin 2	44					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|small molecule binding (GO:0036094)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	8						ACTTCCAGGACAACCAAGTAA	0.637																																					p.D44E		.											.	LCN2	90	0			c.C132A						.						61.0	62.0	62.0					9																	130911936		2203	4300	6503	SO:0001583	missense	3934	exon1			CCAGGACAACCAA		CCDS6892.1	9q34	2011-10-24	2007-12-18		ENSG00000148346	ENSG00000148346		"""Lipocalins"""	6526	protein-coding gene	gene with protein product	"""oncogene 24p3"", ""neutrophil gelatinase-associated lipocalin"", ""siderocalin"""	600181	"""lipocalin 2 (oncogene 24p3)"""			7683678	Standard	NM_005564		Approved	NGAL, 24p3	uc004bto.1	P80188	OTTHUMG00000020734	ENST00000373017.1:c.132C>A	9.37:g.130911936C>A	ENSP00000362108:p.Asp44Glu	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	29.0	NM_005564	A6NII8|B4DWV4|B7ZAA2|P30150|Q5SYV9|Q5SYW0|Q6FGL5|Q92683	Missense_Mutation	SNP	ENST00000373017.1	37	CCDS6892.1	.	.	.	.	.	.	.	.	.	.	C	9.271	1.045625	0.19748	.	.	ENSG00000148346	ENST00000373017;ENST00000277480;ENST00000373013;ENST00000540948;ENST00000372998	T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.02	3.45	-4.42	0.03579	Lipocalin conserved site (1);Calycin-like (1);Calycin (1);	1.755640	0.02919	N	0.137663	T	0.09598	0.0236	N	0.24115	0.695	0.09310	N	1	B;B;B	0.20261	0.043;0.025;0.025	B;B;B	0.18561	0.022;0.01;0.01	T	0.20806	-1.0264	10	0.02654	T	1	-3.6543	1.6794	0.02829	0.1697:0.4154:0.1722:0.2427	.	44;45;44	P80188-2;B2ZDQ1;P80188	.;.;NGAL_HUMAN	E	44	ENSP00000362108:D44E;ENSP00000277480:D44E;ENSP00000362104:D44E;ENSP00000441666:D44E;ENSP00000362089:D44E	ENSP00000277480:D44E	D	+	3	2	LCN2	129951757	0.000000	0.05858	0.000000	0.03702	0.602000	0.36980	-3.139000	0.00587	-0.919000	0.03803	0.456000	0.33151	GAC	.		0.637	LCN2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054375.1	NM_005564	
LDHA	3939	hgsc.bcm.edu;bcgsc.ca	37	11	18425285	18425285	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:18425285A>G	ENST00000422447.3	+	6	910	c.637A>G	c.(637-639)Act>Gct	p.T213A	LDHA_ENST00000379412.5_Missense_Mutation_p.T213A|AC084117.3_ENST00000496975.2_RNA|LDHA_ENST00000430553.2_Missense_Mutation_p.T155A|LDHA_ENST00000542179.1_Missense_Mutation_p.T213A|LDHA_ENST00000227157.4_Missense_Mutation_p.T213A|LDHA_ENST00000396222.2_Missense_Mutation_p.T213A|LDHA_ENST00000540430.1_Missense_Mutation_p.T242A	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	213					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)			central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						CTCTCTGAAGACTCTGCACCC	0.388																																					p.T242A		.											.	LDHA	650	0			c.A724G						.						147.0	141.0	143.0					11																	18425285		2199	4293	6492	SO:0001583	missense	3939	exon6			CTGAAGACTCTGC	X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.637A>G	11.37:g.18425285A>G	ENSP00000395337:p.Thr213Ala	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	5.0	NM_001165414	B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Missense_Mutation	SNP	ENST00000422447.3	37	CCDS7839.1	.	.	.	.	.	.	.	.	.	.	A	10.22	1.289613	0.23478	.	.	ENSG00000134333	ENST00000422447;ENST00000430553;ENST00000396222;ENST00000541620;ENST00000445376;ENST00000227157;ENST00000540430;ENST00000379412;ENST00000542179	T;T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01;0.01	5.34	2.93	0.34026	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.646731	0.16302	N	0.220393	T	0.39489	0.1080	N	0.25144	0.715	0.20926	N	0.999825	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.001;0.002;0.002;0.0;0.0	T	0.18053	-1.0349	10	0.29301	T	0.29	-0.0884	0.9978	0.01470	0.4256:0.1542:0.1021:0.318	.	242;155;186;213;213	B7Z5E3;B4DKQ2;B4DJI1;F8W819;P00338	.;.;.;.;LDHA_HUMAN	A	213;155;213;185;186;213;242;213;213	ENSP00000395337:T213A;ENSP00000406172:T155A;ENSP00000379524:T213A;ENSP00000227157:T213A;ENSP00000445175:T242A;ENSP00000368722:T213A;ENSP00000445331:T213A	ENSP00000227157:T213A	T	+	1	0	LDHA	18381861	0.508000	0.26154	0.998000	0.56505	0.986000	0.74619	1.005000	0.29834	0.371000	0.24564	0.477000	0.44152	ACT	.		0.388	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258172.2	NM_005566	
LDOC1L	84247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	44892949	44892949	+	Missense_Mutation	SNP	C	C	T	rs374819770		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:44892949C>T	ENST00000341255.3	-	2	997	c.488G>A	c.(487-489)cGc>cAc	p.R163H		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	163										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		ATAGTTGTTGCGCAAGGGGCT	0.607																																					p.R163H		.											.	LDOC1L	69	0			c.G488A						.	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	42.0	44.0	43.0		488	3.1	1.0	22		43	0,8600		0,0,4300	no	missense	LDOC1L	NM_032287.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	163/240	44892949	1,13005	2203	4300	6503	SO:0001583	missense	84247	exon2			TTGTTGCGCAAGG	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.488G>A	22.37:g.44892949C>T	ENSP00000340434:p.Arg163His	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	36.0	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	37	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587931	0.46110	2.27E-4	0.0	ENSG00000188636	ENST00000341255	T	0.18338	2.22	3.1	3.1	0.35709	.	0.187151	0.24070	N	0.041823	T	0.06142	0.0159	N	0.08118	0	0.30172	N	0.801228	P	0.37997	0.614	B	0.25987	0.065	T	0.17561	-1.0365	10	0.19147	T	0.46	-5.6274	9.9334	0.41537	0.0:1.0:0.0:0.0	.	163	Q6ICC9	LDOCL_HUMAN	H	163	ENSP00000340434:R163H	ENSP00000340434:R163H	R	-	2	0	LDOC1L	43271613	0.923000	0.31300	1.000000	0.80357	0.994000	0.84299	3.073000	0.50057	2.054000	0.61138	0.591000	0.81541	CGC	.		0.607	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
LMCD1	29995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	8607167	8607167	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:8607167A>T	ENST00000157600.3	+	5	1005	c.773A>T	c.(772-774)tAc>tTc	p.Y258F	LMCD1_ENST00000397386.3_Missense_Mutation_p.Y146F|LMCD1_ENST00000454244.1_Missense_Mutation_p.Y185F|LMCD1-AS1_ENST00000439407.1_RNA	NM_014583.2	NP_055398.1	Q9NZU5	LMCD1_HUMAN	LIM and cysteine-rich domains 1	258	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|regulation of cardiac muscle hypertrophy (GO:0010611)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)	16				OV - Ovarian serous cystadenocarcinoma(96;0.124)		CCCGTGGTCTACTCGGACAGG	0.602																																					p.Y258F		.											.	LMCD1	91	0			c.A773T						.						99.0	107.0	104.0					3																	8607167		2203	4300	6503	SO:0001583	missense	29995	exon5			TGGTCTACTCGGA	AF169284	CCDS33688.1, CCDS63533.1, CCDS63534.1	3p26-p24	2008-07-18			ENSG00000071282	ENSG00000071282			6633	protein-coding gene	gene with protein product	"""dyxin"""	604859				10662546	Standard	NM_001278233		Approved		uc003bqq.4	Q9NZU5	OTTHUMG00000154971	ENST00000157600.3:c.773A>T	3.37:g.8607167A>T	ENSP00000157600:p.Tyr258Phe	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	51.0	NM_014583	B4DG80	Missense_Mutation	SNP	ENST00000157600.3	37	CCDS33688.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.173647	0.78452	.	.	ENSG00000071282	ENST00000157600;ENST00000454244;ENST00000397386	T;T;T	0.49720	0.8;0.8;0.77	5.27	5.27	0.74061	Zinc finger, LIM-type (4);	0.000000	0.64402	D	0.000020	T	0.34513	0.0900	N	0.10629	0.01	0.54753	D	0.999984	P;P	0.49090	0.84;0.919	B;P	0.51974	0.405;0.686	T	0.22243	-1.0222	10	0.02654	T	1	-28.9704	14.0186	0.64539	1.0:0.0:0.0:0.0	.	146;258	B4DEY6;Q9NZU5	.;LMCD1_HUMAN	F	258;185;146	ENSP00000157600:Y258F;ENSP00000396515:Y185F;ENSP00000380542:Y146F	ENSP00000157600:Y258F	Y	+	2	0	LMCD1	8582167	1.000000	0.71417	0.960000	0.40013	0.967000	0.64934	7.111000	0.77077	1.996000	0.58369	0.482000	0.46254	TAC	.		0.602	LMCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337854.1	NM_014583	
LRP2	4036	hgsc.bcm.edu;bcgsc.ca	37	2	170048456	170048456	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:170048456T>C	ENST00000263816.3	-	48	9203	c.8918A>G	c.(8917-8919)gAt>gGt	p.D2973G		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2973	LDL-receptor class A 22. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACATCGCCATCACAGACCCA	0.478																																					p.D2973G		.											.	LRP2	175	0			c.A8918G						.						98.0	91.0	93.0					2																	170048456		2203	4300	6503	SO:0001583	missense	4036	exon48			TCGCCATCACAGA		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8918A>G	2.37:g.170048456T>C	ENSP00000263816:p.Asp2973Gly	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_004525	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.740147	0.89573	.	.	ENSG00000081479	ENST00000263816	D	0.98732	-5.1	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.99527	0.9831	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97869	1.0285	10	0.87932	D	0	.	16.0014	0.80294	0.0:0.0:0.0:1.0	.	2973	P98164	LRP2_HUMAN	G	2973	ENSP00000263816:D2973G	ENSP00000263816:D2973G	D	-	2	0	LRP2	169756702	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	7.841000	0.86834	2.181000	0.69327	0.528000	0.53228	GAT	.		0.478	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255231.2	NM_004525	
LTN1	26046	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	30329699	30329699	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:30329699C>T	ENST00000361371.5	-	15	2926	c.2847G>A	c.(2845-2847)ccG>ccA	p.P949P	LTN1_ENST00000389194.2_Silent_p.P995P			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	949					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						CACTGTCGTTCGGCATTACAC	0.383																																					p.P995P		.											.	LTN1	530	0			c.G2985A						.						97.0	86.0	90.0					21																	30329699		2203	4300	6503	SO:0001819	synonymous_variant	26046	exon15			GTCGTTCGGCATT	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.2847G>A	21.37:g.30329699C>T		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Silent	SNP	ENST00000361371.5	37																																																																																				.		0.383	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
METTL6	131965	hgsc.bcm.edu;bcgsc.ca	37	3	15467900	15467900	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:15467900T>C	ENST00000443029.1	-	2	359	c.119A>G	c.(118-120)gAg>gGg	p.E40G	EAF1_ENST00000396842.2_5'Flank|EAF1_ENST00000432764.2_5'Flank|METTL6_ENST00000383789.5_Missense_Mutation_p.E40G|METTL6_ENST00000450816.2_Missense_Mutation_p.E40G|METTL6_ENST00000383790.3_Missense_Mutation_p.E40G			Q8TCB7	METL6_HUMAN	methyltransferase like 6	40							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(9)|lung(3)|prostate(1)	15						TTTCTGAGCCTCTTGTTCCAA	0.398																																					p.E40G		.											.	METTL6	90	0			c.A119G						.						127.0	118.0	121.0					3																	15467900		1824	4075	5899	SO:0001583	missense	131965	exon2			TGAGCCTCTTGTT	AK057791	CCDS43056.1	3p25.1	2005-11-02			ENSG00000206562	ENSG00000206562			28343	protein-coding gene	gene with protein product						12477932	Standard	NM_152396		Approved	MGC24132	uc003bzs.1	Q8TCB7	OTTHUMG00000156431	ENST00000443029.1:c.119A>G	3.37:g.15467900T>C	ENSP00000407613:p.Glu40Gly	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	5.0	NM_152396	Q96LU4	Missense_Mutation	SNP	ENST00000443029.1	37	CCDS43056.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083044	0.55861	.	.	ENSG00000206562	ENST00000383790;ENST00000450816;ENST00000383789	T;T;T	0.69306	-0.39;-0.39;-0.39	5.68	5.68	0.88126	.	0.092095	0.85682	D	0.000000	T	0.73590	0.3606	M	0.73598	2.24	0.58432	D	0.999999	P;P;B	0.38535	0.635;0.503;0.204	P;B;B	0.44811	0.461;0.43;0.126	T	0.77040	-0.2735	10	0.72032	D	0.01	-13.8455	15.6013	0.76628	0.0:0.0:0.0:1.0	.	40;40;40	B4DDX3;Q8TCB7-2;Q8TCB7	.;.;METL6_HUMAN	G	40	ENSP00000373300:E40G;ENSP00000410726:E40G;ENSP00000373299:E40G	ENSP00000373299:E40G	E	-	2	0	METTL6	15442904	1.000000	0.71417	1.000000	0.80357	0.427000	0.31564	8.040000	0.89188	2.164000	0.68074	0.528000	0.53228	GAG	.		0.398	METTL6-007	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346373.1	NM_152396	
MGA	23269	hgsc.bcm.edu;bcgsc.ca	37	15	42003112	42003112	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:42003112T>C	ENST00000570161.1	+	7	2649	c.2649T>C	c.(2647-2649)tcT>tcC	p.S883S	MGA_ENST00000219905.7_Silent_p.S883S|MGA_ENST00000545763.1_Silent_p.S883S|MGA_ENST00000566586.1_Silent_p.S883S|MGA_ENST00000389936.4_Silent_p.S883S			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTTCTACCTCTTATTCTTTGA	0.413																																					p.S883S		.											.	MGA	522	0			c.T2649C						.						137.0	132.0	134.0					15																	42003112		1852	4089	5941	SO:0001819	synonymous_variant	23269	exon8			TACCTCTTATTCT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.2649T>C	15.37:g.42003112T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	4.0	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	37	CCDS55959.1																																																																																			.		0.413	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MOGAT1	116255	hgsc.bcm.edu;bcgsc.ca	37	2	223559205	223559205	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:223559205T>C	ENST00000446656.3	+	4	603	c.603T>C	c.(601-603)acT>acC	p.T201T		NM_058165.2	NP_477513.2	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	201					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|cervix(1)|endometrium(1)|lung(5)|urinary_tract(1)	9		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		GAAAGTTCACTCTGTTCATCC	0.443																																					p.T201T	Ovarian(93;205 1446 2385 11581 25911)	.											.	MOGAT1	67	0			c.T603C						.						86.0	86.0	86.0					2																	223559205		1898	4123	6021	SO:0001819	synonymous_variant	116255	exon4			GTTCACTCTGTTC	AF384163	CCDS46524.1	2q36.2	2006-10-06	2004-05-28	2004-05-28	ENSG00000124003	ENSG00000124003			18210	protein-coding gene	gene with protein product		610268	"""diacylglycerol O-acyltransferase 2 like 1"""	DGAT2L1		14970677	Standard	NM_058165		Approved	DGAT2L, MGAT1	uc010fws.1	Q96PD6	OTTHUMG00000153394	ENST00000446656.3:c.603T>C	2.37:g.223559205T>C		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_058165	Q6IEE5	Silent	SNP	ENST00000446656.3	37	CCDS46524.1																																																																																			.		0.443	MOGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331010.3	NM_058165	
MROH1	727957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145255353	145255353	+	Silent	SNP	A	A	G	rs144186714	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:145255353A>G	ENST00000528919.1	+	11	1171	c.1050A>G	c.(1048-1050)ctA>ctG	p.L350L	MROH1_ENST00000423230.2_Silent_p.L350L|MROH1_ENST00000326134.5_Silent_p.L350L|MROH1_ENST00000527071.1_3'UTR|MROH1_ENST00000398656.4_Silent_p.L350L|MROH1_ENST00000534366.1_Silent_p.L350L	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1	350																	CTGACCGCCTACTGGCCTTCC	0.592													A|||	2	0.000399361	0.0015	0.0	5008	,	,		18795	0.0		0.0	False		,,,				2504	0.0				p.L350L		.											.	.	.	0			c.A1050G						.	A	,,	3,4047		0,3,2022	44.0	50.0	48.0		1050,1050,1050	1.2	1.0	8	dbSNP_134	48	0,8210		0,0,4105	no	coding-synonymous,coding-synonymous,coding-synonymous	HEATR7A	NM_001099280.1,NM_001099281.1,NM_032450.2	,,	0,3,6127	GG,GA,AA		0.0,0.0741,0.0245	,,	350/423,350/423,350/1642	145255353	3,12257	2025	4105	6130	SO:0001819	synonymous_variant	727957	exon12			CCGCCTACTGGCC		CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.1050A>G	8.37:g.145255353A>G		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	17.0	NM_001099280	C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Silent	SNP	ENST00000528919.1	37	CCDS47938.1																																																																																			A|0.999;G|0.001		0.592	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386183.1	NM_032450	
MTX1	4580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155180142	155180142	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:155180142T>C	ENST00000368376.3	+	2	640	c.534T>C	c.(532-534)taT>taC	p.Y178Y	THBS3_ENST00000457183.2_5'Flank|MTX1_ENST00000609421.1_Silent_p.Y29Y|THBS3_ENST00000486260.1_5'Flank|THBS3_ENST00000368378.3_5'Flank|THBS3_ENST00000541990.1_5'Flank|RP11-263K19.6_ENST00000455788.1_RNA|MTX1_ENST00000316721.4_Silent_p.Y178Y	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1	178					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGCAGACCTATGCCAGATTTA	0.502																																					p.Y178Y		.											.	MTX1	91	0			c.T534C						.						121.0	111.0	115.0					1																	155180142		2203	4300	6503	SO:0001819	synonymous_variant	4580	exon2			GACCTATGCCAGA		CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708	ENST00000368376.3:c.534T>C	1.37:g.155180142T>C		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	51.0	NM_198883	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	Silent	SNP	ENST00000368376.3	37	CCDS1100.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759243	0.31137	.	.	ENSG00000173171	ENST00000424959	.	.	.	5.87	3.58	0.41010	.	.	.	.	.	T	0.41949	0.1181	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38908	-0.9639	4	.	.	.	-29.5015	6.5199	0.22269	0.0:0.2489:0.0:0.7511	.	.	.	.	T	34	.	.	M	+	2	0	MTX1	153446766	0.994000	0.37717	1.000000	0.80357	0.927000	0.56198	0.182000	0.16900	1.166000	0.42689	0.533000	0.62120	ATG	.		0.502	MTX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086844.1	NM_198883	
MYH7B	57644	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	33575459	33575459	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:33575459A>T	ENST00000262873.7	+	15	1465	c.1373A>T	c.(1372-1374)aAg>aTg	p.K458M	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	416	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TACGTGACCAAGGGCCAGAGT	0.662																																					p.K458M		.											.	MYH7B	136	0			c.A1373T						.						97.0	106.0	103.0					20																	33575459		2071	4202	6273	SO:0001583	missense	57644	exon17			TGACCAAGGGCCA	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1373A>T	20.37:g.33575459A>T	ENSP00000262873:p.Lys458Met	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	32.0	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	37	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.221462	0.79464	.	.	ENSG00000078814	ENST00000262873	D	0.88741	-2.42	3.53	3.53	0.40419	Myosin head, motor domain (2);	0.000000	0.37623	N	0.002007	D	0.95755	0.8619	H	0.96633	3.855	0.58432	D	0.999994	D	0.58268	0.982	D	0.65233	0.933	D	0.96837	0.9615	10	0.87932	D	0	.	13.1334	0.59395	1.0:0.0:0.0:0.0	.	416	A7E2Y1	MYH7B_HUMAN	M	458	ENSP00000262873:K458M	ENSP00000262873:K458M	K	+	2	0	MYH7B	33039120	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.109000	0.94291	1.849000	0.53698	0.459000	0.35465	AAG	.		0.662	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
MYO3A	53904	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	26442791	26442791	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:26442791A>T	ENST00000265944.5	+	24	2814	c.2648A>T	c.(2647-2649)cAt>cTt	p.H883L	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	883	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AATCTGCCACATTCTAAAACT	0.294																																					p.H883L		.											.	MYO3A	1007	0			c.A2648T						.						33.0	36.0	35.0					10																	26442791		2196	4288	6484	SO:0001583	missense	53904	exon24			TGCCACATTCTAA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2648A>T	10.37:g.26442791A>T	ENSP00000265944:p.His883Leu	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	6.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	37	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	A	10.57	1.387816	0.25031	.	.	ENSG00000095777	ENST00000265944	T	0.70045	-0.45	5.46	3.11	0.35812	Myosin head, motor domain (2);	0.095322	0.64402	N	0.000001	T	0.49762	0.1576	L	0.41415	1.275	0.80722	D	1	B	0.06786	0.001	B	0.12837	0.008	T	0.24764	-1.0151	10	0.10902	T	0.67	.	6.5446	0.22398	0.7604:0.0:0.0776:0.162	.	883	Q8NEV4	MYO3A_HUMAN	L	883	ENSP00000265944:H883L	ENSP00000265944:H883L	H	+	2	0	MYO3A	26482797	1.000000	0.71417	0.986000	0.45419	0.812000	0.45895	2.348000	0.44045	0.370000	0.24538	0.377000	0.23210	CAT	.		0.294	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
NEFL	4747	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	24811079	24811079	+	RNA	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:24811079T>A	ENST00000221169.5	-	0	1994							P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GGGCTCATCCTTGGCTTCCTC	0.567																																					p.K467M		.											.	NEFL	24	0			c.A1400T						.						49.0	51.0	51.0					8																	24811079		1966	4155	6121			4747	exon3			TCATCCTTGGCTT		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24811079T>A		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	24.0	NM_006158	B9ZVN2|Q16154|Q8IU72	Missense_Mutation	SNP	ENST00000221169.5	37																																																																																				.		0.567	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	processed_transcript	OTTHUMT00000258943.4	NM_006158	
NFKB1	4790	hgsc.bcm.edu;bcgsc.ca	37	4	103531782	103531782	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:103531782T>C	ENST00000505458.1	+	20	2552	c.2275T>C	c.(2275-2277)Tct>Cct	p.S759P	NFKB1_ENST00000394820.4_Missense_Mutation_p.S759P|NFKB1_ENST00000600343.1_Missense_Mutation_p.S579P|NFKB1_ENST00000226574.4_Missense_Mutation_p.S760P			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	759	Interaction with CFLAR.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	CCTGGATGACTCTTGGGAAAA	0.512																																					p.S760P		.											.	NFKB1	912	0			c.T2278C						.						134.0	130.0	132.0					4																	103531782		2203	4300	6503	SO:0001583	missense	4790	exon20			GATGACTCTTGGG	M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.2275T>C	4.37:g.103531782T>C	ENSP00000424790:p.Ser759Pro	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	4.0	NM_003998	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	ENST00000505458.1	37	CCDS54783.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.926826	0.52759	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458	T;T;T	0.36878	1.23;1.23;1.23	4.62	3.44	0.39384	Ankyrin repeat-containing domain (2);	0.686712	0.13698	N	0.369051	T	0.24661	0.0598	L	0.34521	1.04	0.37283	D	0.907912	P;P;P	0.43633	0.536;0.722;0.813	B;B;B	0.41299	0.203;0.189;0.353	T	0.07731	-1.0757	10	0.24483	T	0.36	.	5.4659	0.16642	0.1337:0.0:0.2903:0.576	.	579;759;760	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	P	760;759;759	ENSP00000226574:S760P;ENSP00000378297:S759P;ENSP00000424790:S759P	ENSP00000226574:S760P	S	+	1	0	NFKB1	103750820	0.879000	0.30193	0.999000	0.59377	0.964000	0.63967	1.046000	0.30354	1.935000	0.56089	0.533000	0.62120	TCT	.		0.512	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363411.1		
NMI	9111	hgsc.bcm.edu;bcgsc.ca	37	2	152127280	152127280	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:152127280T>C	ENST00000243346.5	-	8	1321	c.851A>G	c.(850-852)aAg>aGg	p.K284R		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	284					inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		ACCTCCATTCTTTGCCCGTTG	0.393																																					p.K284R		.											.	NMI	90	0			c.A851G						.						182.0	171.0	175.0					2																	152127280		2203	4300	6503	SO:0001583	missense	9111	exon8			CCATTCTTTGCCC	U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.851A>G	2.37:g.152127280T>C	ENSP00000243346:p.Lys284Arg	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_004688	B5BU69|Q53TI8|Q9BVE5	Missense_Mutation	SNP	ENST00000243346.5	37	CCDS2192.1	.	.	.	.	.	.	.	.	.	.	T	9.898	1.206042	0.22205	.	.	ENSG00000123609	ENST00000243346	T	0.38240	1.15	5.26	1.42	0.22433	Nmi/IFP 35 (1);	0.373716	0.30126	N	0.010349	T	0.17492	0.0420	N	0.17312	0.475	0.09310	N	1	B	0.18741	0.03	B	0.20184	0.028	T	0.14755	-1.0461	10	0.20519	T	0.43	-11.8808	5.2342	0.15437	0.0:0.1:0.3929:0.5072	.	284	Q13287	NMI_HUMAN	R	284	ENSP00000243346:K284R	ENSP00000243346:K284R	K	-	2	0	NMI	151835526	0.163000	0.22920	0.951000	0.38953	0.907000	0.53573	0.194000	0.17135	0.818000	0.34468	0.482000	0.46254	AAG	.		0.393	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254817.2	NM_004688	
NRBP1	29959	hgsc.bcm.edu;bcgsc.ca	37	2	27656637	27656637	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:27656637A>G	ENST00000233557.3	+	4	1140	c.308A>G	c.(307-309)gAa>gGa	p.E103G	NRBP1_ENST00000379852.3_Missense_Mutation_p.E103G|NRBP1_ENST00000379863.3_Missense_Mutation_p.E103G			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	103	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					CAGTTCTCTGAACGCAAGAAC	0.483																																					p.E103G		.											.	NRBP1	334	0			c.A308G						.						116.0	113.0	114.0					2																	27656637		2203	4300	6503	SO:0001583	missense	29959	exon3			TCTCTGAACGCAA	AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.308A>G	2.37:g.27656637A>G	ENSP00000233557:p.Glu103Gly	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_013392	B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	ENST00000233557.3	37	CCDS1753.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.029826	0.93575	.	.	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863;ENST00000419281	T;T;T	0.67171	-0.25;-0.25;-0.25	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.77955	0.4208	M	0.64080	1.96	0.80722	D	1	D;D	0.60575	0.984;0.988	D;D	0.66716	0.91;0.946	T	0.78677	-0.2111	10	0.48119	T	0.1	-12.8784	13.9748	0.64265	1.0:0.0:0.0:0.0	.	103;103	F8W6G1;Q9UHY1	.;NRBP_HUMAN	G	103;83;103;103;103	ENSP00000233557:E103G;ENSP00000369181:E103G;ENSP00000369192:E103G	ENSP00000233557:E103G	E	+	2	0	NRBP1	27510141	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.847000	0.92166	1.988000	0.58038	0.459000	0.35465	GAA	.		0.483	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215033.1	NM_013392	
NMI	9111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152128184	152128184	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:152128184C>A	ENST00000243346.5	-	7	1167	c.697G>T	c.(697-699)Gtt>Ttt	p.V233F		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	233					inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		GAAACAGTAACTCTATGGCAG	0.343																																					p.V233F		.											.	NMI	90	0			c.G697T						.						148.0	161.0	156.0					2																	152128184		2203	4300	6503	SO:0001583	missense	9111	exon7			CAGTAACTCTATG	U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.697G>T	2.37:g.152128184C>A	ENSP00000243346:p.Val233Phe	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	14.0	NM_004688	B5BU69|Q53TI8|Q9BVE5	Missense_Mutation	SNP	ENST00000243346.5	37	CCDS2192.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041873	0.55003	.	.	ENSG00000123609	ENST00000243346	T	0.59906	0.23	5.92	5.92	0.95590	Nmi/IFP 35 (1);	0.114299	0.64402	D	0.000013	T	0.78654	0.4317	M	0.85542	2.76	0.38913	D	0.957577	D	0.89917	1.0	D	0.79784	0.993	T	0.82287	-0.0532	10	0.72032	D	0.01	-21.175	15.8301	0.78743	0.0:1.0:0.0:0.0	.	233	Q13287	NMI_HUMAN	F	233	ENSP00000243346:V233F	ENSP00000243346:V233F	V	-	1	0	NMI	151836430	0.883000	0.30277	0.199000	0.23439	0.361000	0.29550	2.276000	0.43408	2.810000	0.96702	0.585000	0.79938	GTT	.		0.343	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254817.2	NM_004688	
NSFL1C	55968	hgsc.bcm.edu;bcgsc.ca	37	20	1434946	1434946	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:1434946A>G	ENST00000216879.4	-	5	1316	c.449T>C	c.(448-450)tTt>tCt	p.F150S	NSFL1C_ENST00000476071.1_Missense_Mutation_p.F152S|NSFL1C_ENST00000381658.4_Missense_Mutation_p.F39S|NSFL1C_ENST00000353088.2_Intron|NSFL1C_ENST00000461211.1_5'UTR|NSFL1C_ENST00000350991.4_Missense_Mutation_p.F152S	NM_016143.4	NP_057227.2	Q9UNZ2	NSF1C_HUMAN	NSFL1 (p97) cofactor (p47)	150						chromosome (GO:0005694)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	16						ACCTCCTGCAAATGGCTATAA	0.473																																					p.F150S		.											.	NSFL1C	90	0			c.T449C						.						77.0	68.0	71.0					20																	1434946		2203	4300	6503	SO:0001583	missense	55968	exon5			CCTGCAAATGGCT	AF112211	CCDS13015.1, CCDS13016.1, CCDS56175.1	20p13	2011-06-28			ENSG00000088833	ENSG00000088833		"""UBX domain containing"""	15912	protein-coding gene	gene with protein product	"""SHP1 homolog (S. cerevisiae)"", ""UBX domain protein 2C"""	606610				11042152	Standard	NM_016143		Approved	dJ776F14.1, p47, UBXD10, UBX1, UBXN2C	uc002wfc.3	Q9UNZ2	OTTHUMG00000031665	ENST00000216879.4:c.449T>C	20.37:g.1434946A>G	ENSP00000216879:p.Phe150Ser	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	5.0	NM_016143	A2A2L1|B2RD74|Q5JXA4|Q5JXA5|Q7Z533|Q9H102|Q9NVL9|Q9UI06	Missense_Mutation	SNP	ENST00000216879.4	37	CCDS13015.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.712239	0.89112	.	.	ENSG00000088833	ENST00000476071;ENST00000216879;ENST00000381658;ENST00000350991	T;T;T;T	0.68479	-0.33;-0.33;0.13;-0.3	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.83751	0.5322	M	0.88775	2.98	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.75484	0.986;0.979	D	0.86937	0.2077	10	0.87932	D	0	-8.4678	14.1151	0.65149	1.0:0.0:0.0:0.0	.	39;150	Q9UNZ2-6;Q9UNZ2	.;NSF1C_HUMAN	S	152;150;39;152	ENSP00000418529:F152S;ENSP00000216879:F150S;ENSP00000371074:F39S;ENSP00000202584:F152S	ENSP00000216879:F150S	F	-	2	0	NSFL1C	1382946	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.180000	0.89694	2.317000	0.78254	0.460000	0.39030	TTT	.		0.473	NSFL1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077525.2	NM_016143	
OTOGL	283310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	80714407	80714407	+	Silent	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:80714407A>T	ENST00000547103.1	+	33	3987	c.3981A>T	c.(3979-3981)acA>acT	p.T1327T	OTOGL_ENST00000458043.2_Silent_p.T1327T			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1327					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TCATATTCACAGATTCTAGTG	0.373																																					p.T1327T		.											.	.	.	0			c.A3981T						.						56.0	53.0	54.0					12																	80714407		1844	4098	5942	SO:0001819	synonymous_variant	283310	exon33			ATTCACAGATTCT	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3981A>T	12.37:g.80714407A>T		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	52.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	ENST00000547103.1	37																																																																																				.		0.373	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
OTOGL	283310	hgsc.bcm.edu;bcgsc.ca	37	12	80747200	80747200	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:80747200T>C	ENST00000547103.1	+	45	5446	c.5440T>C	c.(5440-5442)Tgt>Cgt	p.C1814R	OTOGL_ENST00000546620.1_5'Flank|OTOGL_ENST00000458043.2_Missense_Mutation_p.C1826R			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1814					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						ACACACTTCCTGTTTGAATCT	0.473																																					p.C1826R		.											.	.	.	0			c.T5476C						.						72.0	70.0	70.0					12																	80747200		1943	4144	6087	SO:0001583	missense	283310	exon45			ACTTCCTGTTTGA	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.5440T>C	12.37:g.80747200T>C	ENSP00000447211:p.Cys1814Arg	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	6.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	37		.	.	.	.	.	.	.	.	.	.	T	14.18	2.458902	0.43634	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.81415	-1.49;-1.49	5.74	4.57	0.56435	.	.	.	.	.	D	0.89125	0.6626	M	0.92691	3.335	0.58432	D	0.999997	.	.	.	.	.	.	D	0.87798	0.2623	7	0.24483	T	0.36	.	12.1334	0.53957	0.1286:0.0:0.0:0.8714	.	.	.	.	R	1814;1826	ENSP00000447211:C1814R;ENSP00000400895:C1826R	ENSP00000400895:C1826R	C	+	1	0	OTOGL	79271331	1.000000	0.71417	0.399000	0.26333	0.218000	0.24690	5.600000	0.67599	0.982000	0.38575	0.533000	0.62120	TGT	.		0.473	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
PCDH9	5101	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	66879031	66879031	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:66879031G>A	ENST00000377865.2	-	4	3604	c.3470C>T	c.(3469-3471)cCt>cTt	p.P1157L	PCDH9_ENST00000544246.1_Missense_Mutation_p.P1157L|PCDH9_ENST00000456367.1_Missense_Mutation_p.P1123L|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.P1123L			Q9HC56	PCDH9_HUMAN	protocadherin 9	1157					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GGTTGAGAGAGGAGATTTGGG	0.502																																					p.P1157L		.											.	PCDH9	96	0			c.C3470T						.						151.0	128.0	136.0					13																	66879031		2203	4300	6503	SO:0001583	missense	5101	exon5			GAGAGAGGAGATT	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3470C>T	13.37:g.66879031G>A	ENSP00000367096:p.Pro1157Leu	Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	86.0	51.0	NM_203487	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	ENST00000377865.2	37	CCDS9444.1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.572117	0.65765	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.58358	0.35;0.35;0.34;0.34	6.05	6.05	0.98169	.	0.000000	0.64402	D	0.000009	T	0.48466	0.1501	L	0.34521	1.04	0.80722	D	1	B;B;B	0.10296	0.003;0.002;0.003	B;B;B	0.10450	0.002;0.005;0.003	T	0.36648	-0.9739	10	0.72032	D	0.01	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	1115;1123;1157	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	L	1157;1157;1123;1123	ENSP00000442186:P1157L;ENSP00000367096:P1157L;ENSP00000401699:P1123L;ENSP00000332060:P1123L	ENSP00000332060:P1123L	P	-	2	0	PCDH9	65777032	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	CCT	.		0.502	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276387.1	NM_203487	
PCDHGA11	56105	hgsc.bcm.edu;bcgsc.ca	37	5	140803211	140803211	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:140803211A>G	ENST00000398587.2	+	1	2450	c.2417A>G	c.(2416-2418)gAc>gGc	p.D806G	PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	806					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCAAATGTGACCCGACAAGT	0.443																																					p.D806G		.											.	.	.	0			c.A2417G						.						45.0	50.0	48.0					5																	140803211		2190	4299	6489	SO:0001583	missense	56105	exon1			AATGTGACCCGAC	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.2417A>G	5.37:g.140803211A>G	ENSP00000381589:p.Asp806Gly	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	5.0	NM_032091	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	37	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	a	16.92	3.254503	0.59212	.	.	ENSG00000253873	ENST00000398587	T	0.46451	0.87	5.42	4.26	0.50523	.	.	.	.	.	T	0.27489	0.0675	N	0.17800	0.525	0.80722	D	1	B;B	0.14012	0.001;0.009	B;B	0.17979	0.001;0.02	T	0.04509	-1.0946	9	0.29301	T	0.29	.	10.4744	0.44657	0.9218:0.0:0.0782:0.0	.	806;806	Q9Y5H2;Q9Y5H2-2	PCDGB_HUMAN;.	G	806	ENSP00000381589:D806G	ENSP00000381589:D806G	D	+	2	0	PCDHGA11	140783395	0.954000	0.32549	0.005000	0.12908	0.962000	0.63368	2.095000	0.41729	0.999000	0.39023	0.533000	0.62120	GAC	.		0.443	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
PCF11	51585	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	82872485	82872485	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:82872485G>A	ENST00000298281.4	+	2	761	c.309G>A	c.(307-309)gtG>gtA	p.V103V		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	103	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TTATTTGTGTGTTTGAAAAGG	0.308																																					p.V103V		.											.	PCF11	23	0			c.G309A						.						81.0	74.0	76.0					11																	82872485		1805	4067	5872	SO:0001819	synonymous_variant	51585	exon2			TTGTGTGTTTGAA	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.309G>A	11.37:g.82872485G>A		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	5.0	NM_015885	A6H8W7|O43671|Q6P0X8	Silent	SNP	ENST00000298281.4	37	CCDS44689.1																																																																																			.		0.308	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
PCNT	5116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	47783761	47783761	+	Missense_Mutation	SNP	C	C	T	rs578233518		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:47783761C>T	ENST00000359568.5	+	14	2628	c.2521C>T	c.(2521-2523)Cgg>Tgg	p.R841W	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	841					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CCAGTGTGGGCGGGAGCCGCC	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17809	0.0		0.0	False		,,,				2504	0.001				p.R841W		.											.	PCNT	141	0			c.C2521T						.						70.0	82.0	78.0					21																	47783761		2200	4285	6485	SO:0001583	missense	5116	exon14			TGTGGGCGGGAGC	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.2521C>T	21.37:g.47783761C>T	ENSP00000352572:p.Arg841Trp	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	41.0	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851286	0.51270	.	.	ENSG00000160299	ENST00000359568	T	0.26223	1.75	4.43	1.47	0.22746	.	1.622470	0.04257	N	0.339623	T	0.37210	0.0995	L	0.44542	1.39	0.25862	N	0.983816	D;D	0.76494	0.999;0.999	P;P	0.59546	0.859;0.824	T	0.12967	-1.0527	10	0.56958	D	0.05	.	5.1827	0.15169	0.1601:0.6588:0.0:0.1811	.	723;841	O95613-2;O95613	.;PCNT_HUMAN	W	841	ENSP00000352572:R841W	ENSP00000352572:R841W	R	+	1	2	PCNT	46608189	0.271000	0.24162	0.896000	0.35187	0.274000	0.26718	0.285000	0.18883	0.301000	0.22738	0.491000	0.48974	CGG	.		0.667	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
PDE4C	5143	hgsc.bcm.edu;bcgsc.ca	37	19	18333125	18333125	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:18333125A>G	ENST00000355502.3	-	6	1122	c.251T>C	c.(250-252)cTg>cCg	p.L84P	PDE4C_ENST00000447275.3_5'UTR|PDE4C_ENST00000598111.2_5'Flank|PDE4C_ENST00000594465.3_Missense_Mutation_p.L84P|PDE4C_ENST00000597297.1_5'Flank|PDE4C_ENST00000262805.12_Missense_Mutation_p.L52P|PDE4C_ENST00000594617.3_Missense_Mutation_p.L84P|AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000539010.1_5'Flank			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	84					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	CCCATTTTCCAGGTCAAAGCT	0.652																																					p.L84P		.											.	PDE4C	94	0			c.T251C						.						37.0	39.0	38.0					19																	18333125		2203	4300	6503	SO:0001583	missense	5143	exon3			TTTTCCAGGTCAA		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.251T>C	19.37:g.18333125A>G	ENSP00000347689:p.Leu84Pro	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_000923	B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Missense_Mutation	SNP	ENST00000355502.3	37	CCDS12373.1	.	.	.	.	.	.	.	.	.	.	A	19.38	3.816918	0.70912	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000543547	T;T	0.71817	0.95;-0.6	4.35	4.35	0.52113	.	1.648800	0.04170	N	0.324672	T	0.79131	0.4394	L	0.54323	1.7	0.80722	D	1	P;P;P	0.47962	0.903;0.712;0.886	P;P;P	0.52758	0.514;0.534;0.708	T	0.65948	-0.6044	10	0.87932	D	0	.	12.4205	0.55518	1.0:0.0:0.0:0.0	.	193;84;52	B7Z2S3;Q08493;Q08493-3	.;PDE4C_HUMAN;.	P	163;84;72;52;193	ENSP00000347689:L84P;ENSP00000262805:L52P	ENSP00000262805:L52P	L	-	2	0	PDE4C	18194125	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	6.979000	0.76154	1.615000	0.50252	0.254000	0.18369	CTG	.		0.652	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466295.1		
PHLPP1	23239	hgsc.bcm.edu;bcgsc.ca	37	18	60563017	60563017	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:60563017A>G	ENST00000262719.5	+	6	2451	c.2217A>G	c.(2215-2217)ttA>ttG	p.L739L	PHLPP1_ENST00000400316.4_Silent_p.L227L			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	739					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						CTAATAGCTTACAGACATTTT	0.328																																					p.L739L		.											.	.	.	0			c.A2217G						.						117.0	110.0	112.0					18																	60563017		1821	4072	5893	SO:0001819	synonymous_variant	23239	exon6			TAGCTTACAGACA	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2217A>G	18.37:g.60563017A>G		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Silent	SNP	ENST00000262719.5	37	CCDS45881.2																																																																																			.		0.328	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
PKD1L1	168507	hgsc.bcm.edu;bcgsc.ca	37	7	47873952	47873952	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:47873952T>C	ENST00000289672.2	-	40	6209	c.6159A>G	c.(6157-6159)gcA>gcG	p.A2053A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2053					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GTGGCTCCTGTGCGTCTGGTA	0.408																																					p.A2053A		.											.	PKD1L1	145	0			c.A6159G						.						132.0	118.0	123.0					7																	47873952		2203	4300	6503	SO:0001819	synonymous_variant	168507	exon40			CTCCTGTGCGTCT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6159A>G	7.37:g.47873952T>C		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																			.		0.408	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	110457871	110457871	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:110457871A>G	ENST00000378402.5	+	38	5877	c.5773A>G	c.(5773-5775)Aga>Gga	p.R1925G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1925	IPT/TIG 12.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATCCCAAGCAGAGGTACTCC	0.318										HNSCC(38;0.096)																											p.R1925G		.											.	PKHD1L1	145	0			c.A5773G						.						16.0	16.0	16.0					8																	110457871		1826	4089	5915	SO:0001583	missense	93035	exon38			CCAAGCAGAGGTA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5773A>G	8.37:g.110457871A>G	ENSP00000367655:p.Arg1925Gly	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	30.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	4.041	0.005151	0.07866	.	.	ENSG00000205038	ENST00000378402	T	0.77620	-1.11	6.03	4.85	0.62838	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.530979	0.19590	N	0.110642	T	0.69415	0.3108	L	0.40543	1.245	0.50171	D	0.999857	B	0.02656	0.0	B	0.12156	0.007	T	0.63161	-0.6699	10	0.41790	T	0.15	.	11.0488	0.47874	0.8612:0.0:0.0:0.1388	.	1925	Q86WI1	PKHL1_HUMAN	G	1925	ENSP00000367655:R1925G	ENSP00000367655:R1925G	R	+	1	2	PKHD1L1	110527047	0.141000	0.22595	0.175000	0.22980	0.011000	0.07611	1.002000	0.29796	1.065000	0.40693	0.533000	0.62120	AGA	.		0.318	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PKN2	5586	hgsc.bcm.edu;bcgsc.ca	37	1	89299097	89299097	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:89299097T>C	ENST00000370521.3	+	22	3280	c.2921T>C	c.(2920-2922)tTc>tCc	p.F974S	PKN2_ENST00000495119.1_3'UTR|PKN2_ENST00000544045.1_Missense_Mutation_p.F648S|PKN2_ENST00000370505.3_Missense_Mutation_p.F817S|PKN2_ENST00000370513.5_Missense_Mutation_p.F926S	NM_006256.2	NP_006247.1	Q16513	PKN2_HUMAN	protein kinase N2	974	AGC-kinase C-terminal.|Necessary for the catalytic activity.				apical junction assembly (GO:0043297)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|epithelial cell migration (GO:0010631)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic cell cycle (GO:0045931)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	apical junction complex (GO:0043296)|centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium (GO:0030027)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(1)	33		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		CAGGAAATGTTCAGAGATTTT	0.403																																					p.F974S		.											.	PKN2	522	0			c.T2921C						.						84.0	84.0	84.0					1																	89299097		1985	4158	6143	SO:0001583	missense	5586	exon22			AAATGTTCAGAGA	U33052	CCDS714.1	1p22	2014-04-23	2004-07-01	2004-07-01	ENSG00000065243	ENSG00000065243			9406	protein-coding gene	gene with protein product	"""cardiolipin-activated protein kinase Pak2"""	602549	"""protein kinase C-like 2"""	PRKCL2		7988719, 7851406	Standard	NM_006256		Approved	PRK2, Pak-2, STK7	uc001dmn.3	Q16513	OTTHUMG00000010074	ENST00000370521.3:c.2921T>C	1.37:g.89299097T>C	ENSP00000359552:p.Phe974Ser	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	4.0	NM_006256	B4DQ21|B4DTP5|B4DVG1|D3DT24|Q08AF4|Q9H1W4	Missense_Mutation	SNP	ENST00000370521.3	37	CCDS714.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.553933	0.86231	.	.	ENSG00000065243	ENST00000370521;ENST00000370505;ENST00000370513;ENST00000544045	D;D;D;D	0.91577	-2.87;-2.87;-2.87;-2.87	5.84	5.84	0.93424	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.47455	U	0.000226	D	0.97473	0.9173	H	0.99299	4.505	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99338	1.0911	10	0.87932	D	0	.	16.2055	0.82126	0.0:0.0:0.0:1.0	.	958;926;974	B4DTP5;E7ESL7;Q16513	.;.;PKN2_HUMAN	S	974;817;926;648	ENSP00000359552:F974S;ENSP00000359536:F817S;ENSP00000359544:F926S;ENSP00000439643:F648S	ENSP00000359536:F817S	F	+	2	0	PKN2	89071685	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.698000	0.84413	2.226000	0.72624	0.482000	0.46254	TTC	.		0.403	PKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027828.3	NM_006256	
PLA2R1	22925	hgsc.bcm.edu;bcgsc.ca	37	2	160879270	160879270	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:160879270A>G	ENST00000283243.7	-	7	1406	c.1200T>C	c.(1198-1200)caT>caC	p.H400H	PLA2R1_ENST00000392771.1_Silent_p.H400H	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	400	C-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GCAGAGCCTCATGCCAGGTCT	0.438																																					p.H400H		.											.	PLA2R1	93	0			c.T1200C						.						150.0	141.0	144.0					2																	160879270		2203	4300	6503	SO:0001819	synonymous_variant	22925	exon7			AGCCTCATGCCAG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.1200T>C	2.37:g.160879270A>G		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	37	CCDS33309.1																																																																																			.		0.438	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
PLAA	9373	hgsc.bcm.edu;bcgsc.ca	37	9	26905635	26905635	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:26905635A>G	ENST00000397292.3	-	14	2679	c.2262T>C	c.(2260-2262)agT>agC	p.S754S		NM_001031689.2	NP_001026859.1	Q9Y263	PLAP_HUMAN	phospholipase A2-activating protein	754	PUL. {ECO:0000255|PROSITE- ProRule:PRU00729}.				inflammatory response (GO:0006954)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	phospholipase A2 activator activity (GO:0016005)			breast(1)|endometrium(7)|kidney(2)|large_intestine(3)|lung(3)|prostate(1)	17		all_neural(3;3.53e-10)|Glioma(3;2.71e-09)		Lung(218;1.32e-05)|LUSC - Lung squamous cell carcinoma(38;0.00011)		TTGAATCATCACTGATAAGTG	0.373																																					p.S754S	Melanoma(175;2670 2735 14091 35526)	.											.	PLAA	514	0			c.T2262C						.						107.0	105.0	106.0					9																	26905635		2203	4300	6503	SO:0001819	synonymous_variant	9373	exon14			ATCATCACTGATA	AF083395	CCDS35000.1	9p21	2013-01-10			ENSG00000137055	ENSG00000137055		"""WD repeat domain containing"""	9043	protein-coding gene	gene with protein product	"""DOA1 homolog (S. cerevisiae)"""	603873				9931468, 10644453	Standard	NM_001031689		Approved	PLAP, PLA2P, FLJ11281, FLJ12699, DOA1	uc003zqd.3	Q9Y263	OTTHUMG00000019708	ENST00000397292.3:c.2262T>C	9.37:g.26905635A>G		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_001031689	Q53EU5|Q5VY33|Q9NUL8|Q9NVE9|Q9UF53|Q9Y5L1	Silent	SNP	ENST00000397292.3	37	CCDS35000.1																																																																																			.		0.373	PLAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051958.2	NM_001031689	
PLCB2	5330	hgsc.bcm.edu;bcgsc.ca	37	15	40584596	40584596	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:40584596A>G	ENST00000260402.3	-	22	2624	c.2375T>C	c.(2374-2376)aTg>aCg	p.M792T	PLCB2_ENST00000557821.1_Missense_Mutation_p.M788T|PLCB2_ENST00000456256.2_Missense_Mutation_p.M792T	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	792					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GAGCGCAGGCATGGTGAGGGG	0.607																																					p.M792T		.											.	PLCB2	275	0			c.T2375C						.						78.0	87.0	84.0					15																	40584596		2110	4232	6342	SO:0001583	missense	5330	exon22			GCAGGCATGGTGA		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.2375T>C	15.37:g.40584596A>G	ENSP00000260402:p.Met792Thr	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_004573	A8K6J2|B9EGH5	Missense_Mutation	SNP	ENST00000260402.3	37	CCDS42020.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.476398	0.63737	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.13307	2.6;2.6	5.1	5.1	0.69264	C2 calcium/lipid-binding domain, CaLB (1);	0.049953	0.85682	D	0.000000	T	0.21468	0.0517	L	0.39898	1.24	0.80722	D	1	D;P;P	0.60575	0.988;0.602;0.508	P;B;B	0.52957	0.714;0.055;0.129	T	0.00645	-1.1629	10	0.66056	D	0.02	.	15.0426	0.71803	1.0:0.0:0.0:0.0	.	792;788;792	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	T	792	ENSP00000260402:M792T;ENSP00000411991:M792T	ENSP00000260402:M792T	M	-	2	0	PLCB2	38371888	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.074000	0.93998	2.142000	0.66516	0.533000	0.62120	ATG	.		0.607	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
PLD1	5337	hgsc.bcm.edu;bcgsc.ca	37	3	171406587	171406587	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:171406587G>A	ENST00000351298.4	-	14	1544	c.1418C>T	c.(1417-1419)tCg>tTg	p.S473L	PLD1_ENST00000342215.6_Missense_Mutation_p.S473L|PLD1_ENST00000340989.4_Missense_Mutation_p.S473L|PLD1_ENST00000356327.5_Missense_Mutation_p.S473L	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	473	Catalytic.|PLD phosphodiesterase 1. {ECO:0000255|PROSITE-ProRule:PRU00153}.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	AAAGGCCACCGATTGGTCAAT	0.532																																					p.S473L	NSCLC(149;2174 3517 34058)	.											.	PLD1	660	0			c.C1418T						.						121.0	99.0	107.0					3																	171406587		2203	4300	6503	SO:0001583	missense	5337	exon14			GCCACCGATTGGT	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.1418C>T	3.37:g.171406587G>A	ENSP00000342793:p.Ser473Leu	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	37	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177091	0.57692	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.32515	3.35;3.34;1.45;3.2	5.3	4.42	0.53409	Phospholipase D/Transphosphatidylase (3);	0.078156	0.64402	D	0.000007	T	0.23727	0.0574	L	0.31157	0.91	0.80722	D	1	B;B	0.29481	0.245;0.065	B;B	0.28232	0.087;0.036	T	0.03503	-1.1030	10	0.31617	T	0.26	-11.1924	14.3925	0.66989	0.0717:0.0:0.9283:0.0	.	496;473	Q59EA4;Q13393	.;PLD1_HUMAN	L	473	ENSP00000348681:S473L;ENSP00000342793:S473L;ENSP00000339936:S473L;ENSP00000340326:S473L	ENSP00000340326:S473L	S	-	2	0	PLD1	172889281	1.000000	0.71417	0.824000	0.32777	0.355000	0.29361	9.781000	0.99029	1.364000	0.46038	0.655000	0.94253	TCG	.		0.532	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
PPP2R3C	55012	hgsc.bcm.edu;bcgsc.ca	37	14	35585916	35585916	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:35585916T>C	ENST00000261475.5	-	2	439	c.86A>G	c.(85-87)gAt>gGt	p.D29G	PPP2R3C_ENST00000555644.1_Missense_Mutation_p.D29G	NM_017917.2	NP_060387.2	Q969Q6	P2R3C_HUMAN	protein phosphatase 2, regulatory subunit B'', gamma	29					activation of protein kinase activity (GO:0032147)|B cell homeostasis (GO:0001782)|positive regulation of B cell differentiation (GO:0045579)|regulation of antimicrobial humoral response (GO:0002759)|regulation of mitochondrial depolarization (GO:0051900)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)	15	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;8.62e-06)|LUAD - Lung adenocarcinoma(48;1.42e-05)|Epithelial(34;0.0177)|all cancers(34;0.0491)	GBM - Glioblastoma multiforme(112;0.0803)		CATTTCTTCATCTTTTAATTC	0.303																																					p.D29G		.											.	PPP2R3C	227	0			c.A86G						.						64.0	66.0	66.0					14																	35585916		2202	4298	6500	SO:0001583	missense	55012	exon2			TCTTCATCTTTTA	AK000651	CCDS9654.1	14q13.2	2010-06-18	2010-06-18	2007-01-22	ENSG00000092020	ENSG00000092020		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	17485	protein-coding gene	gene with protein product		615902	"""chromosome 14 open reading frame 10"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', gamma"""	C14orf10		12167160, 16129705	Standard	NM_017917		Approved	FLJ20644, G4-1, G5PR	uc001wss.3	Q969Q6	OTTHUMG00000140224	ENST00000261475.5:c.86A>G	14.37:g.35585916T>C	ENSP00000261475:p.Asp29Gly	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_017917	B4DEN7|D3DS97|D3DS98|Q5GJ55|Q5GJ56|Q6P4G2|Q86TZ3|Q9NWR9	Missense_Mutation	SNP	ENST00000261475.5	37	CCDS9654.1	.	.	.	.	.	.	.	.	.	.	T	15.39	2.817984	0.50633	.	.	ENSG00000092020	ENST00000261475;ENST00000554361;ENST00000555644;ENST00000557278	T	0.49720	0.77	5.02	5.02	0.67125	.	0.154878	0.56097	D	0.000023	T	0.36138	0.0956	L	0.29908	0.895	0.40099	D	0.976348	B;P;B	0.34977	0.073;0.478;0.102	B;B;B	0.33960	0.059;0.173;0.049	T	0.20009	-1.0288	10	0.24483	T	0.36	-9.371	15.0444	0.71816	0.0:0.0:0.0:1.0	.	29;29;29	G3V2K1;Q86US5;Q969Q6	.;.;P2R3C_HUMAN	G	29	ENSP00000450716:D29G	ENSP00000261475:D29G	D	-	2	0	PPP2R3C	34655667	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.085000	0.64468	1.999000	0.58509	0.459000	0.35465	GAT	.		0.303	PPP2R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276687.1	NM_017917	
PROL1	58503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71275489	71275489	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:71275489C>T	ENST00000399575.2	+	3	618	c.444C>T	c.(442-444)acC>acT	p.T148T	PROL1_ENST00000514338.1_3'UTR	NM_021225.4	NP_067048.4	Q99935	PROL1_HUMAN	proline rich, lacrimal 1	148	Thr-rich.				negative regulation of endopeptidase activity (GO:0010951)|regulation of sensory perception of pain (GO:0051930)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	endopeptidase inhibitor activity (GO:0004866)|peptidase inhibitor activity (GO:0030414)	p.T148T(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	15		all_hematologic(202;0.196)				ACATCACCACCGCAGATACAA	0.448																																					p.T148T		.											.	PROL1	135	1	Substitution - coding silent(1)	kidney(1)	c.C444T						.						189.0	211.0	204.0					4																	71275489		1975	4164	6139	SO:0001819	synonymous_variant	58503	exon3			CACCACCGCAGAT	S83198	CCDS43235.1	4q13.3	2011-10-28	2005-02-07		ENSG00000171199	ENSG00000171199			17279	protein-coding gene	gene with protein product		608936	"""proline rich 1"""			8670737	Standard	NM_021225		Approved	BPLP, PRL1, opiorphin	uc003hfi.3	Q99935	OTTHUMG00000160845	ENST00000399575.2:c.444C>T	4.37:g.71275489C>T		Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	91.0	NM_021225	A8MZ07|P85047	Silent	SNP	ENST00000399575.2	37	CCDS43235.1																																																																																			.		0.448	PROL1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000362639.1	NM_021225	
PRR12	57479	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	50100971	50100971	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:50100971A>T	ENST00000418929.2	+	4	3391	c.3379A>T	c.(3379-3381)Agc>Tgc	p.S1127C		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCTGGTCTCCAGCTGCCGCTC	0.706																																					p.S1127C		.											.	PRR12	70	0			c.A3379T						.						8.0	12.0	11.0					19																	50100971		1960	4078	6038	SO:0001583	missense	57479	exon4			GTCTCCAGCTGCC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.3379A>T	19.37:g.50100971A>T	ENSP00000394510:p.Ser1127Cys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	43.0	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216213	0.39201	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.58	4.58	0.56647	.	0.000000	0.53938	D	0.000052	T	0.74696	0.3750	L	0.60455	1.87	0.52501	D	0.999954	D	0.89917	1.0	D	0.85130	0.997	T	0.77645	-0.2510	9	0.87932	D	0	-23.8701	13.0387	0.58887	1.0:0.0:0.0:0.0	.	1127	Q9ULL5-3	.	C	1127;307;307	.	ENSP00000246798:S307C	S	+	1	0	PRR12	54792783	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.411000	0.80078	1.917000	0.55516	0.402000	0.26972	AGC	.		0.706	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
PSD4	23550	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113950141	113950141	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:113950141G>A	ENST00000245796.6	+	6	2008	c.1813G>A	c.(1813-1815)Gaa>Aaa	p.E605K	PSD4_ENST00000441564.3_Missense_Mutation_p.E577K	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	605	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCGGAAGTCTGAAGTGGCTGC	0.597																																					p.E605K		.											.	PSD4	229	0			c.G1813A						.						71.0	74.0	73.0					2																	113950141		2203	4300	6503	SO:0001583	missense	23550	exon6			AAGTCTGAAGTGG	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1813G>A	2.37:g.113950141G>A	ENSP00000245796:p.Glu605Lys	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	20.0	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	37	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	g	26.9	4.781639	0.90282	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.51817	0.69;0.69	5.68	5.68	0.88126	SEC7-like (4);	0.161385	0.53938	D	0.000043	T	0.42921	0.1224	N	0.20483	0.58	0.80722	D	1	P;P;B	0.49783	0.766;0.928;0.333	P;P;P	0.49708	0.561;0.62;0.536	T	0.42932	-0.9422	10	0.87932	D	0	.	12.9495	0.58391	0.0:0.1627:0.8373:0.0	.	263;577;605	Q59HG0;Q8NDX1-2;Q8NDX1	.;.;PSD4_HUMAN	K	605;577	ENSP00000245796:E605K;ENSP00000413997:E577K	ENSP00000245796:E605K	E	+	1	0	PSD4	113666612	1.000000	0.71417	0.988000	0.46212	0.996000	0.88848	3.299000	0.51826	2.692000	0.91855	0.651000	0.88453	GAA	.		0.597	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
PSMC4	5704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40486011	40486011	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:40486011G>A	ENST00000157812.2	+	8	1074	c.876G>A	c.(874-876)ctG>ctA	p.L292L	PSMC4_ENST00000455878.2_Silent_p.L261L	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	292					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGCTGGAGCTGCTGAATCAGA	0.562																																					p.L292L	Colon(105;1478 1543 4034 6132 38638)	.											.	PSMC4	91	0			c.G876A						.						146.0	143.0	144.0					19																	40486011		2203	4300	6503	SO:0001819	synonymous_variant	5704	exon8			GGAGCTGCTGAAT	U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.876G>A	19.37:g.40486011G>A		Somatic	224.0	0.0		WXS	Illumina HiSeq	Phase_I	259.0	108.0	NM_006503	Q96FV5|Q9UBM3|Q9UEX3	Silent	SNP	ENST00000157812.2	37	CCDS12547.1																																																																																			.		0.562	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462485.1	NM_006503	
PSMG2	56984	hgsc.bcm.edu;bcgsc.ca	37	18	12718587	12718587	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:12718587T>C	ENST00000317615.6	+	4	1042	c.360T>C	c.(358-360)gtT>gtC	p.V120V	PSMG2_ENST00000590217.1_Silent_p.V120V|PSMG2_ENST00000585331.2_Silent_p.V89V	NM_020232.4	NP_064617.2			proteasome (prosome, macropain) assembly chaperone 2											lung(1)|prostate(2)|skin(1)	4						GAGTCATTGTTCTTTCAAGCA	0.378																																					p.V120V		.											.	PSMG2	68	0			c.T360C						.						143.0	133.0	136.0					18																	12718587		2203	4300	6503	SO:0001819	synonymous_variant	56984	exon4			CATTGTTCTTTCA	AF276707	CCDS11862.1, CCDS67440.1	18p11.21	2012-01-25	2007-10-23	2007-10-23	ENSG00000128789	ENSG00000128789			24929	protein-coding gene	gene with protein product	"""hepatocellular carcinoma susceptibility protein"", ""CD40 ligand-activated specific transcript 3"""	609702	"""tumor necrosis factor superfamily, member 5-induced protein 1"""	TNFSF5IP1		11854909, 12147697, 17189198	Standard	NM_147163		Approved	HCCA3, MDS003, MGC15092, CLAST3, HsT1707, PAC2	uc002krk.3	Q969U7	OTTHUMG00000131703	ENST00000317615.6:c.360T>C	18.37:g.12718587T>C		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_020232		Silent	SNP	ENST00000317615.6	37	CCDS11862.1																																																																																			.		0.378	PSMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254615.1	NM_020232	
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3007357	3007357	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr20:3007357A>T	ENST00000216877.6	+	17	2012	c.1612A>T	c.(1612-1614)Aat>Tat	p.N538Y	PTPRA_ENST00000380393.3_Missense_Mutation_p.N547Y|PTPRA_ENST00000358719.4_Missense_Mutation_p.N403Y|PTPRA_ENST00000425918.2_Missense_Mutation_p.N558Y|PTPRA_ENST00000399903.2_Missense_Mutation_p.N547Y|PTPRA_ENST00000318266.5_Missense_Mutation_p.N538Y|PTPRA_ENST00000356147.3_Missense_Mutation_p.N538Y	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	547	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						CAAAATCCAGAATGACAAGAT	0.458																																					p.N547Y		.											.	PTPRA	227	0			c.A1639T						.						92.0	72.0	79.0					20																	3007357		2203	4300	6503	SO:0001583	missense	5786	exon22			ATCCAGAATGACA		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1612A>T	20.37:g.3007357A>T	ENSP00000216877:p.Asn538Tyr	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	49.0	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	ENST00000216877.6	37	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	A	15.58	2.874915	0.51695	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T	0.03772	3.85;3.85;3.85;3.81;3.84;3.85;3.85	5.28	4.15	0.48705	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	U	0.000000	T	0.09335	0.0230	L	0.28504	0.86	0.80722	D	1	D;D;D	0.76494	0.977;0.999;0.993	P;D;D	0.85130	0.755;0.997;0.935	T	0.13282	-1.0515	10	0.05351	T	0.99	.	12.3806	0.55305	0.859:0.141:0.0:0.0	.	558;547;538	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	Y	547;538;547;403;157;558;538;538	ENSP00000369756:N547Y;ENSP00000216877:N538Y;ENSP00000382787:N547Y;ENSP00000351559:N403Y;ENSP00000393553:N558Y;ENSP00000314568:N538Y;ENSP00000348468:N538Y	ENSP00000216877:N538Y	N	+	1	0	PTPRA	2955357	1.000000	0.71417	1.000000	0.80357	0.174000	0.22865	9.287000	0.95975	0.909000	0.36697	0.459000	0.35465	AAT	.		0.458	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		
RASA1	5921	hgsc.bcm.edu;bcgsc.ca	37	5	86682657	86682657	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:86682657A>G	ENST00000274376.6	+	23	3426	c.2862A>G	c.(2860-2862)gaA>gaG	p.E954E	RASA1_ENST00000456692.2_Silent_p.E777E|RASA1_ENST00000506290.1_Silent_p.E788E|RASA1_ENST00000512763.1_Silent_p.E787E	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	954					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)	p.E777E(1)|p.E954E(1)		NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		CCTACATGGAAGGTGTCAATC	0.333																																					p.E954E		.											.	RASA1	661	2	Substitution - coding silent(2)	kidney(2)	c.A2862G						.						153.0	151.0	152.0					5																	86682657		2203	4300	6503	SO:0001819	synonymous_variant	5921	exon23			CATGGAAGGTGTC		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2862A>G	5.37:g.86682657A>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_002890	B2R6W3|Q9UDI1	Silent	SNP	ENST00000274376.6	37	CCDS34200.1																																																																																			.		0.333	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
RAVER2	55225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	65255125	65255125	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:65255125A>G	ENST00000294428.3	+	5	1111	c.1033A>G	c.(1033-1035)Aaa>Gaa	p.K345E	RAVER2_ENST00000430964.2_Missense_Mutation_p.K51E|RAVER2_ENST00000371072.4_Missense_Mutation_p.K345E			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	345						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						ACAAATTATGAAAAGTTTAAA	0.373																																					p.K345E		.											.	RAVER2	135	0			c.A1033G						.						99.0	91.0	94.0					1																	65255125		1849	4092	5941	SO:0001583	missense	55225	exon5			ATTATGAAAAGTT	AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.1033A>G	1.37:g.65255125A>G	ENSP00000294428:p.Lys345Glu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	27.0	NM_018211	Q6P141|Q9NPV7	Missense_Mutation	SNP	ENST00000294428.3	37		.	.	.	.	.	.	.	.	.	.	A	16.29	3.081993	0.55861	.	.	ENSG00000162437	ENST00000371072;ENST00000294428;ENST00000430964	T;T	0.32753	1.44;1.45	4.9	4.9	0.64082	.	0.204244	0.50627	D	0.000116	T	0.13713	0.0332	L	0.46157	1.445	0.27606	N	0.94882	P;P	0.50943	0.9;0.94	B;B	0.43754	0.248;0.43	T	0.06232	-1.0838	10	0.23302	T	0.38	-33.0872	10.399	0.44218	0.8359:0.1641:0.0:0.0	.	345;345	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	E	345;345;51	ENSP00000360112:K345E;ENSP00000294428:K345E	ENSP00000294428:K345E	K	+	1	0	RAVER2	65027713	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	5.683000	0.68189	1.835000	0.53391	0.482000	0.46254	AAA	.		0.373	RAVER2-201	KNOWN	basic	protein_coding	protein_coding		NM_018211	
RCBTB2	1102	hgsc.bcm.edu;bcgsc.ca	37	13	49073817	49073817	+	Missense_Mutation	SNP	G	G	A	rs529818415		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:49073817G>A	ENST00000344532.3	-	13	1747	c.1324C>T	c.(1324-1326)Cgg>Tgg	p.R442W	RCBTB2_ENST00000430805.2_Missense_Mutation_p.R447W|RCBTB2_ENST00000544492.1_Missense_Mutation_p.R168W	NM_001268.2	NP_001259.1	O95199	RCBT2_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2	442	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				positive regulation of Ran GTPase activity (GO:0032853)	acrosomal vesicle (GO:0001669)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(5)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(3)	31		all_cancers(8;4.86e-71)|all_epithelial(8;2.11e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;2.3e-10)|Lung NSC(96;1.07e-07)|Breast(56;1.53e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.00826)|Myeloproliferative disorder(33;0.0179)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(99;1.8e-09)|LUSC - Lung squamous cell carcinoma(3;0.116)		AGGAAGGCCCGGTAAACAGGA	0.408													G|||	0	0.0	0.0	0.0	5008	,	,		21051	0.0		0.0	False		,,,				2504	0.0				p.R442W		.											.	RCBTB2	418	0			c.C1324T						.						133.0	130.0	131.0					13																	49073817		2203	4300	6503	SO:0001583	missense	1102	exon13			AGGCCCGGTAAAC	AF060219	CCDS9411.1, CCDS73570.1, CCDS73571.1, CCDS73572.1	13q14.3	2013-01-08	2005-05-09	2005-05-09	ENSG00000136161	ENSG00000136161		"""BTB/POZ domain containing"""	1914	protein-coding gene	gene with protein product		603524	"""chromosome condensation 1-like"""	CHC1L		9806834	Standard	XM_005266242		Approved		uc001vch.3	O95199	OTTHUMG00000016902	ENST00000344532.3:c.1324C>T	13.37:g.49073817G>A	ENSP00000345144:p.Arg442Trp	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	5.0	NM_001268	B2RDW8	Missense_Mutation	SNP	ENST00000344532.3	37	CCDS9411.1	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455952	0.43634	.	.	ENSG00000136161	ENST00000344532;ENST00000450343;ENST00000452987;ENST00000430805;ENST00000544492	T;T;T	0.69175	-0.38;-0.38;-0.38	5.09	4.22	0.49857	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.79986	0.4541	M	0.66297	2.02	0.80722	D	1	B;D;D;B	0.89917	0.244;0.999;1.0;0.125	B;D;D;B	0.87578	0.117;0.953;0.998;0.117	T	0.82571	-0.0391	10	0.87932	D	0	.	15.1174	0.72413	0.0:0.0:0.8573:0.1427	.	168;447;394;442	B4E372;B4DWG0;B3KVB1;O95199	.;.;.;RCBT2_HUMAN	W	442;394;447;447;168	ENSP00000345144:R442W;ENSP00000389910:R447W;ENSP00000443862:R168W	ENSP00000345144:R442W	R	-	1	2	RCBTB2	47971818	1.000000	0.71417	0.988000	0.46212	0.987000	0.75469	4.023000	0.57211	1.237000	0.43756	0.478000	0.44815	CGG	.		0.408	RCBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044888.2	NM_001268	
RFC1	5981	hgsc.bcm.edu;bcgsc.ca	37	4	39352986	39352986	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr4:39352986T>C	ENST00000381897.1	-	2	247	c.114A>G	c.(112-114)aaA>aaG	p.K38K	RFC1_ENST00000418436.1_5'UTR|RFC1_ENST00000349703.2_Silent_p.K38K	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	38					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CCTTTATTCCTTTCTTTGCTT	0.259																																					p.K38K	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	.											.	RFC1	230	0			c.A114G						.						100.0	99.0	99.0					4																	39352986		2201	4298	6499	SO:0001819	synonymous_variant	5981	exon2			TATTCCTTTCTTT	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.114A>G	4.37:g.39352986T>C		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	4.0	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Silent	SNP	ENST00000381897.1	37	CCDS56329.1																																																																																			.		0.259	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
RGS7	6000	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	241262022	241262022	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr1:241262022C>T	ENST00000407727.1	-	2	118	c.119G>A	c.(118-120)gGa>gAa	p.G40E	RGS7_ENST00000348120.2_Missense_Mutation_p.G40E|RGS7_ENST00000366564.1_Missense_Mutation_p.G40E|RGS7_ENST00000331110.7_Missense_Mutation_p.G14E|RGS7_ENST00000366562.4_Missense_Mutation_p.G40E|RGS7_ENST00000401882.1_Missense_Mutation_p.G40E|RGS7_ENST00000446183.2_5'UTR|RGS7_ENST00000366565.1_Missense_Mutation_p.G40E|RGS7_ENST00000366563.1_Missense_Mutation_p.G40E			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	40	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			AATAGGAATTCCATTTTTTTC	0.348																																					p.G40E		.											.	RGS7	232	0			c.G119A						.						183.0	162.0	169.0					1																	241262022		2203	4300	6503	SO:0001583	missense	6000	exon3			GGAATTCCATTTT	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.119G>A	1.37:g.241262022C>T	ENSP00000384428:p.Gly40Glu	Somatic	44.0	1.0		WXS	Illumina HiSeq	Phase_I	41.0	18.0	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	ENST00000407727.1	37		.	.	.	.	.	.	.	.	.	.	C	26.5	4.739568	0.89573	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000348120;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.62672	0.2447	M	0.90082	3.085	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.998	T	0.70513	-0.4851	10	0.87932	D	0	-13.8865	14.5808	0.68288	0.0:1.0:0.0:0.0	.	14;40;40;40;40	B7Z257;P49802-4;P49802-2;P49802-5;P49802-3	.;.;.;.;.	E	14;40;40;40;40;40;40;40	ENSP00000331485:G14E;ENSP00000355523:G40E;ENSP00000355522:G40E;ENSP00000355521:G40E;ENSP00000341242:G40E;ENSP00000355520:G40E;ENSP00000384428:G40E;ENSP00000385508:G40E	ENSP00000331485:G14E	G	-	2	0	RGS7	239328645	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.591000	0.74090	2.572000	0.86782	0.655000	0.94253	GGA	.		0.348	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	
RIPK2	8767	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	90801575	90801575	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:90801575A>G	ENST00000220751.4	+	10	1464	c.1150A>G	c.(1150-1152)Aag>Gag	p.K384E	RIPK2_ENST00000540020.1_Missense_Mutation_p.K247E	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	384					activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			TTATTTTATGAAGCTGCATCA	0.403																																					p.K384E		.											.	RIPK2	523	0			c.A1150G						.						140.0	132.0	134.0					8																	90801575		2203	4300	6503	SO:0001583	missense	8767	exon10			TTTATGAAGCTGC	AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.1150A>G	8.37:g.90801575A>G	ENSP00000220751:p.Lys384Glu	Somatic	73.0	1.0		WXS	Illumina HiSeq	Phase_I	107.0	32.0	NM_003821	B7Z748|Q6UWF0	Missense_Mutation	SNP	ENST00000220751.4	37	CCDS6247.1	.	.	.	.	.	.	.	.	.	.	A	2.708	-0.269459	0.05716	.	.	ENSG00000104312	ENST00000220751;ENST00000540020	T;T	0.80824	-1.19;-1.42	5.89	-2.45	0.06481	.	2.123510	0.02477	N	0.088139	T	0.61451	0.2348	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.12837	0.008	T	0.57318	-0.7832	10	0.02654	T	1	4.052	7.657	0.28381	0.6214:0.1187:0.2599:0.0	.	384	O43353	RIPK2_HUMAN	E	384;247	ENSP00000220751:K384E;ENSP00000441623:K247E	ENSP00000220751:K384E	K	+	1	0	RIPK2	90870716	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.679000	0.05203	-0.304000	0.08843	0.533000	0.62120	AAG	.		0.403	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375686.1		
RLIM	51132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	73814206	73814206	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:73814206T>A	ENST00000332687.6	-	3	406	c.188A>T	c.(187-189)gAg>gTg	p.E63V	RLIM_ENST00000349225.2_Missense_Mutation_p.E63V	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	63					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCTCAGCAACTCTTCCTCAGT	0.423																																					p.E63V	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM	228	0			c.A188T						.						137.0	112.0	120.0					X																	73814206		2203	4300	6503	SO:0001583	missense	51132	exon4			AGCAACTCTTCCT	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.188A>T	X.37:g.73814206T>A	ENSP00000328059:p.Glu63Val	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	34.0	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	T	19.02	3.746403	0.69418	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.09073	3.02;3.02	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.79123	2.44	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.03597	-1.1021	10	0.87932	D	0	-5.8686	15.3627	0.74492	0.0:0.0:0.0:1.0	.	63	Q9NVW2	RNF12_HUMAN	V	63	ENSP00000328059:E63V;ENSP00000253571:E63V	ENSP00000328059:E63V	E	-	2	0	RLIM	73730931	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.499000	0.81566	2.011000	0.59026	0.481000	0.45027	GAG	.		0.423	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RMDN2	151393	hgsc.bcm.edu;bcgsc.ca	37	2	38218373	38218373	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:38218373A>G	ENST00000406384.1	+	7	1072	c.878A>G	c.(877-879)gAt>gGt	p.D293G	RMDN2_ENST00000234195.3_Missense_Mutation_p.D471G|RMDN2_ENST00000417700.2_Missense_Mutation_p.D148G|RMDN2_ENST00000354545.2_Missense_Mutation_p.D293G|RMDN2_ENST00000407257.1_Missense_Mutation_p.D471G|RMDN2-AS1_ENST00000414365.2_RNA	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	293						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											GAACATCTAGATATAGCAATC	0.343																																					p.D471G		.											.	.	.	0			c.A1412G						.						90.0	92.0	91.0					2																	38218373		2203	4300	6503	SO:0001583	missense	151393	exon7			ATCTAGATATAGC	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.878A>G	2.37:g.38218373A>G	ENSP00000386004:p.Asp293Gly	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_144713	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	ENST00000406384.1	37	CCDS54351.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.758402	0.49468	.	.	ENSG00000115841	ENST00000354545;ENST00000406384;ENST00000407257;ENST00000417700;ENST00000234195;ENST00000442857	T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59	5.63	4.4	0.53042	Tetratricopeptide-like helical (1);	0.347273	0.30455	N	0.009598	T	0.64057	0.2564	M	0.84082	2.675	0.44985	D	0.998004	B;P;P;P	0.50943	0.39;0.94;0.94;0.894	B;P;P;P	0.51742	0.341;0.678;0.678;0.678	T	0.69946	-0.5007	10	0.72032	D	0.01	.	10.0512	0.42216	0.8492:0.0:0.0:0.1508	.	471;148;293;148	Q96LZ7-2;Q96LZ7-4;Q96LZ7;Q96LZ7-3	.;.;RMD2_HUMAN;.	G	293;293;471;148;471;148	ENSP00000346549:D293G;ENSP00000386004:D293G;ENSP00000385049:D471G;ENSP00000392977:D148G;ENSP00000234195:D471G;ENSP00000416367:D148G	ENSP00000234195:D471G	D	+	2	0	FAM82A1	38071877	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.193000	0.58385	2.271000	0.75665	0.533000	0.62120	GAT	.		0.343	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325577.1	NM_144713	
RNF213	57674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78336932	78336932	+	Missense_Mutation	SNP	A	A	G	rs144458310	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:78336932A>G	ENST00000582970.1	+	40	11529	c.11386A>G	c.(11386-11388)Agg>Ggg	p.R3796G	RNF213_ENST00000508628.2_Missense_Mutation_p.R3845G|RNF213_ENST00000336301.6_Missense_Mutation_p.R1869G|CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	3796					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GTCCTGCACTAGGAAACTGAA	0.458																																					p.R3796G		.											.	RNF213	577	0			c.A11386G						.	A	GLY/ARG	0,4406		0,0,2203	48.0	53.0	51.0		11533	-10.9	0.0	17	dbSNP_134	51	2,8598	2.2+/-6.3	0,2,4298	yes	missense	RNF213	NM_020914.4	125	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	benign	3845/5257	78336932	2,13004	2203	4300	6503	SO:0001583	missense	57674	exon40			TGCACTAGGAAAC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.11386A>G	17.37:g.78336932A>G	ENSP00000464087:p.Arg3796Gly	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	23.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	7.849	0.723599	0.15439	0.0	2.33E-4	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301	T	0.22945	1.93	5.45	-10.9	0.00192	.	2.477650	0.00935	N	0.002778	T	0.09686	0.0238	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.14783	-1.0460	10	0.17832	T	0.49	.	4.5013	0.11865	0.0729:0.2245:0.3267:0.3758	.	3845;1869	C9JCP4;Q63HN8	.;RN213_HUMAN	G	3796;3845;1869	ENSP00000338218:R1869G	ENSP00000338218:R1869G	R	+	1	2	RNF213	75951527	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.877000	0.04197	-5.017000	0.00024	-1.421000	0.01109	AGG	A|1.000;G|0.000		0.458	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
RPP14	11102	hgsc.bcm.edu;bcgsc.ca	37	3	58302307	58302307	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:58302307A>G	ENST00000445193.3	+	4	639	c.228A>G	c.(226-228)agA>agG	p.R76R	RPP14_ENST00000528153.1_5'Flank|RPP14_ENST00000466547.1_Silent_p.R76R|RPP14_ENST00000477305.1_3'UTR|RPP14_ENST00000295959.5_Silent_p.R76R	NM_001098783.2	NP_001092253.1	O95059	RPP14_HUMAN	ribonuclease P/MRP 14kDa subunit	76					tRNA processing (GO:0008033)	nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)|RNA binding (GO:0003723)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.000187)|KIRC - Kidney renal clear cell carcinoma(10;0.0102)|Kidney(10;0.0118)|OV - Ovarian serous cystadenocarcinoma(275;0.191)		CCATCTTGAGAATATGTAGCA	0.413																																					p.R76R		.											.	RPP14	90	0			c.A228G						.						148.0	139.0	142.0					3																	58302307		2203	4300	6503	SO:0001819	synonymous_variant	11102	exon4			CTTGAGAATATGT	AF001175	CCDS2888.1	3p21.2	2012-05-21	2007-06-26		ENSG00000163684	ENSG00000163684			30327	protein-coding gene	gene with protein product		606112	"""ribonuclease P 14kDa subunit"""			10024167, 11929972	Standard	NM_001098783		Approved	P14	uc031sah.1	O95059	OTTHUMG00000159152	ENST00000445193.3:c.228A>G	3.37:g.58302307A>G		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	5.0	NM_007042	Q53X97	Silent	SNP	ENST00000445193.3	37	CCDS2888.1																																																																																			.		0.413	RPP14-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353527.2	NM_007042	
RTN4	57142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55254181	55254181	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:55254181T>C	ENST00000337526.6	-	3	1297	c.1054A>G	c.(1054-1056)Aaa>Gaa	p.K352E	RTN4_ENST00000404909.1_Missense_Mutation_p.K146E|RTN4_ENST00000394611.2_Missense_Mutation_p.K146E|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000317610.7_Intron|RTN4_ENST00000354474.6_Missense_Mutation_p.K120E|RTN4_ENST00000405240.1_Missense_Mutation_p.K146E|RTN4_ENST00000357376.3_Missense_Mutation_p.K146E	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	352					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TTAACCAATTTAGTAAGAGCT	0.348																																					p.K352E		.											.	RTN4	155	0			c.A1054G						.						109.0	111.0	110.0					2																	55254181		2203	4298	6501	SO:0001583	missense	57142	exon3			CCAATTTAGTAAG	AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1054A>G	2.37:g.55254181T>C	ENSP00000337838:p.Lys352Glu	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	30.0	NM_020532	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	ENST00000337526.6	37	CCDS42684.1	.	.	.	.	.	.	.	.	.	.	T	0.033	-1.319899	0.01320	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.18810	2.19;2.19;2.29;2.19;2.19;2.2	5.83	-6.08	0.02151	.	7739.210000	0.00166	N	0.000000	T	0.10165	0.0249	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.16600	-1.0397	10	0.18276	T	0.48	0.2994	3.1864	0.06602	0.0972:0.3614:0.193:0.3484	.	352	Q9NQC3	RTN4_HUMAN	E	146;146;352;146;146;120	ENSP00000384471:K146E;ENSP00000349944:K146E;ENSP00000337838:K352E;ENSP00000378109:K146E;ENSP00000385650:K146E;ENSP00000346465:K120E	ENSP00000337838:K352E	K	-	1	0	RTN4	55107685	0.000000	0.05858	0.000000	0.03702	0.183000	0.23260	-0.582000	0.05814	-1.296000	0.02353	0.528000	0.53228	AAA	.		0.348	RTN4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251484.1		
RYR3	6263	hgsc.bcm.edu;bcgsc.ca	37	15	33993260	33993260	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:33993260A>G	ENST00000389232.4	+	42	6532	c.6462A>G	c.(6460-6462)ttA>ttG	p.L2154L	RYR3_ENST00000415757.3_Silent_p.L2154L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2154	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGCTGAGCTTAGAGGAACCAG	0.582											OREG0023030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L2154L		.											.	RYR3	520	0			c.A6462G						.						60.0	64.0	63.0					15																	33993260		2003	4183	6186	SO:0001819	synonymous_variant	6263	exon42			GAGCTTAGAGGAA		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6462A>G	15.37:g.33993260A>G		Somatic	60.0	0.0	844	WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_001243996	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																			.		0.582	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SARDH	1757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	136578161	136578161	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr9:136578161T>C	ENST00000371872.4	-	9	1493	c.1236A>G	c.(1234-1236)gcA>gcG	p.A412A	SARDH_ENST00000422262.2_Splice_Site_p.A244A|SARDH_ENST00000439388.1_Splice_Site_p.A412A	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	412					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CGGACTCACCTGCGCTGTTGA	0.662																																					p.A412A		.											.	SARDH	90	0			c.A1236G						.						32.0	34.0	33.0					9																	136578161		2202	4300	6502	SO:0001630	splice_region_variant	1757	exon9			CTCACCTGCGCTG		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1237+1A>G	9.37:g.136578161T>C		Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	15.0	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Silent	SNP	ENST00000371872.4	37	CCDS6978.1																																																																																			.		0.662	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		Silent
SCN7A	6332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	167297978	167297978	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:167297978G>A	ENST00000409855.1	-	14	2211	c.2085C>T	c.(2083-2085)gaC>gaT	p.D695D		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	695					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCTCCATACAGTCCCACAAGG	0.433																																					p.D695D		.											.	SCN7A	67	0			c.C2085T						.						66.0	69.0	68.0					2																	167297978		2203	4300	6503	SO:0001819	synonymous_variant	6332	exon14			CATACAGTCCCAC	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2085C>T	2.37:g.167297978G>A		Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	57.0	NM_002976		Silent	SNP	ENST00000409855.1	37	CCDS46442.1																																																																																			.		0.433	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
SERPINB12	89777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	61232745	61232745	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr18:61232745T>C	ENST00000269491.1	+	6	713	c.713T>C	c.(712-714)gTg>gCg	p.V238A	SERPINB12_ENST00000382768.1_Missense_Mutation_p.V258A	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	238					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						ATAGAGGAGGTGAAGGCACAG	0.483																																					p.V238A		.											.	SERPINB12	227	0			c.T713C						.						158.0	139.0	146.0					18																	61232745		2203	4300	6503	SO:0001583	missense	89777	exon6			AGGAGGTGAAGGC	AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.713T>C	18.37:g.61232745T>C	ENSP00000269491:p.Val238Ala	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	6.0	NM_080474	Q3SYB4	Missense_Mutation	SNP	ENST00000269491.1	37	CCDS11984.1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.488975	0.26686	.	.	ENSG00000166634	ENST00000269491;ENST00000382768	D;D	0.82526	-1.62;-1.62	5.59	5.59	0.84812	Serpin domain (3);	0.704404	0.12673	N	0.448613	T	0.76807	0.4039	L	0.33245	0.995	0.24245	N	0.995344	B;B	0.30824	0.201;0.296	B;B	0.33846	0.171;0.109	T	0.66264	-0.5967	10	0.30854	T	0.27	.	12.3322	0.55046	0.1263:0.0:0.0:0.8737	.	258;238	Q3SYB4;Q96P63	.;SPB12_HUMAN	A	238;258	ENSP00000269491:V238A;ENSP00000372218:V258A	ENSP00000269491:V238A	V	+	2	0	SERPINB12	59383725	0.008000	0.16893	0.309000	0.25155	0.076000	0.17211	1.785000	0.38684	2.254000	0.74563	0.528000	0.53228	GTG	.		0.483	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256197.1	NM_080474	
SI	6476	hgsc.bcm.edu;bcgsc.ca	37	3	164764772	164764772	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:164764772T>C	ENST00000264382.3	-	16	1806	c.1744A>G	c.(1744-1746)Aga>Gga	p.R582G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	582	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATGAAGCTTCTCTTATTAGGA	0.313										HNSCC(35;0.089)																											p.R582G		.											.	SI	104	0			c.A1744G						.						53.0	52.0	52.0					3																	164764772		2203	4300	6503	SO:0001583	missense	6476	exon16			AGCTTCTCTTATT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1744A>G	3.37:g.164764772T>C	ENSP00000264382:p.Arg582Gly	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	6.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	T	16.86	3.238316	0.58886	.	.	ENSG00000090402	ENST00000264382	D	0.94330	-3.4	5.36	4.18	0.49190	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	H	0.99011	4.4	0.48511	D	0.999663	D	0.89917	1.0	D	0.97110	1.0	D	0.97757	1.0218	10	0.87932	D	0	.	11.6805	0.51455	0.0:0.0:0.1485:0.8515	.	582	P14410	SUIS_HUMAN	G	582	ENSP00000264382:R582G	ENSP00000264382:R582G	R	-	1	2	SI	166247466	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	1.665000	0.37449	0.856000	0.35383	0.383000	0.25322	AGA	.		0.313	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
SIGLEC5	8778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52130941	52130941	+	Silent	SNP	T	T	C	rs533765364		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:52130941T>C	ENST00000534261.2	-	7	1455	c.1056A>G	c.(1054-1056)agA>agG	p.R352R	SIGLEC5_ENST00000570106.2_Silent_p.R352R|SIGLEC5_ENST00000429354.3_Silent_p.R352R|SIGLEC5_ENST00000222107.4_Silent_p.R352R|SIGLEC5_ENST00000599649.1_Silent_p.R352R			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	352					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		GAAAGGAGCATCTGCAGTGCA	0.662													G|||	1	0.000199681	0.0	0.0014	5008	,	,		15181	0.0		0.0	False		,,,				2504	0.0				p.R352R		.											.	SIGLEC5	92	0			c.A1056G						.						11.0	14.0	13.0					19																	52130941		2189	4285	6474	SO:0001819	synonymous_variant	8778	exon6			GGAGCATCTGCAG	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1056A>G	19.37:g.52130941T>C		Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	13.0	NM_003830		Silent	SNP	ENST00000534261.2	37	CCDS33088.1																																																																																			.		0.662	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466897.2	NM_003830	
SLC35A5	55032	hgsc.bcm.edu;bcgsc.ca	37	3	112299917	112299917	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:112299917T>C	ENST00000492406.1	+	6	1236	c.953T>C	c.(952-954)cTt>cCt	p.L318P	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	318					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						TTCCAGGGCCTTTCAGTGGCT	0.428																																					p.L318P		.											.	SLC35A5	91	0			c.T953C						.						78.0	75.0	76.0					3																	112299917		2203	4299	6502	SO:0001583	missense	55032	exon6			AGGGCCTTTCAGT	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.953T>C	3.37:g.112299917T>C	ENSP00000417654:p.Leu318Pro	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_017945	D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Missense_Mutation	SNP	ENST00000492406.1	37	CCDS2967.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.169361	0.78339	.	.	ENSG00000138459	ENST00000492406	T	0.61040	0.14	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85399	0.1130	9	.	.	.	-19.211	16.2076	0.82138	0.0:0.0:0.0:1.0	.	318	Q9BS91	S35A5_HUMAN	P	318	ENSP00000417654:L318P	.	L	+	2	0	SLC35A5	113782607	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.554000	0.82212	2.285000	0.76669	0.477000	0.44152	CTT	.		0.428	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1	NM_017945	
SLC9A9	285195	hgsc.bcm.edu;bcgsc.ca	37	3	143550901	143550901	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:143550901T>C	ENST00000316549.6	-	2	546	c.338A>G	c.(337-339)cAc>cGc	p.H113R		NM_173653.3	NP_775924.1	Q8IVB4	SL9A9_HUMAN	solute carrier family 9, subfamily A (NHE9, cation proton antiporter 9), member 9	113					ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|recycling endosome (GO:0055037)	sodium:proton antiporter activity (GO:0015385)			breast(2)|endometrium(5)|kidney(2)|large_intestine(13)|lung(29)|ovary(2)|skin(3)|stomach(1)	57						ATTGATGTTGTGCTGACTTAT	0.303																																					p.H113R		.											.	SLC9A9	229	0			c.A338G						.						148.0	140.0	143.0					3																	143550901		2203	4299	6502	SO:0001583	missense	285195	exon2			ATGTTGTGCTGAC	AY254100	CCDS33872.1	3q23-q24	2014-01-28	2012-03-22		ENSG00000181804	ENSG00000181804		"""Solute carriers"""	20653	protein-coding gene	gene with protein product		608396	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 9"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 9"""			14569117	Standard	NM_173653		Approved	FLJ35613, NHE9	uc003evn.3	Q8IVB4	OTTHUMG00000159373	ENST00000316549.6:c.338A>G	3.37:g.143550901T>C	ENSP00000320246:p.His113Arg	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_173653	A6NMQ9|Q3LIC2|Q5JPI6|Q5WA58|Q8NAB9	Missense_Mutation	SNP	ENST00000316549.6	37	CCDS33872.1	.	.	.	.	.	.	.	.	.	.	T	10.76	1.441778	0.25900	.	.	ENSG00000181804	ENST00000316549;ENST00000474151	T;T	0.21932	1.98;1.98	5.14	5.14	0.70334	Cation/H+ exchanger (1);	0.144593	0.49305	D	0.000159	T	0.10680	0.0261	N	0.01048	-1.04	0.44899	D	0.997915	P	0.37914	0.611	P	0.48598	0.583	T	0.41592	-0.9500	10	0.16420	T	0.52	.	9.851	0.41057	0.0:0.0762:0.0:0.9238	.	113	Q8IVB4	SL9A9_HUMAN	R	113	ENSP00000320246:H113R;ENSP00000418627:H113R	ENSP00000320246:H113R	H	-	2	0	SLC9A9	145033591	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.570000	0.53834	2.285000	0.76669	0.533000	0.62120	CAC	.		0.303	SLC9A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354994.1	NM_173653	
SLCO1A2	6579	hgsc.bcm.edu;bcgsc.ca	37	12	21450445	21450445	+	Missense_Mutation	SNP	A	A	G	rs11568579	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:21450445A>G	ENST00000307378.6	-	10	1688	c.968T>C	c.(967-969)cTt>cCt	p.L323P	SLCO1A2_ENST00000390670.3_Missense_Mutation_p.L321P|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.L191P|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.L323P|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.L191P	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	323					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	CACACTTACAAGTATGAAAAG	0.338																																					p.L323P		.											.	SLCO1A2	157	0			c.T968C						.	A	PRO/LEU,PRO/LEU	1,4405	2.1+/-5.4	0,1,2202	100.0	93.0	95.0		968,968	5.2	0.6	12	dbSNP_126	95	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense	SLCO1A2	NM_021094.3,NM_134431.3	98,98	0,3,6500	GG,GA,AA		0.0233,0.0227,0.0231	benign,benign	323/671,323/671	21450445	3,13003	2203	4300	6503	SO:0001583	missense	6579	exon10			CTTACAAGTATGA		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.968T>C	12.37:g.21450445A>G	ENSP00000305974:p.Leu323Pro	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	4.0	NM_134431	Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	A	12.05	1.822229	0.32237	2.27E-4	2.33E-4	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11	5.23	5.23	0.72850	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.626120	0.16371	N	0.217319	T	0.66761	0.2822	M	0.84219	2.685	0.30372	N	0.78277	B;B;B	0.21821	0.024;0.061;0.029	B;B;B	0.27262	0.038;0.022;0.078	T	0.69079	-0.5240	10	0.72032	D	0.01	.	11.2594	0.49074	0.7705:0.2295:0.0:0.0	rs11568579;rs45457593;rs11568579	303;321;323	Q8IV69;P46721-2;P46721	.;.;SO1A2_HUMAN	P	323;323;191;191;321	ENSP00000305974:L323P;ENSP00000393973:L323P;ENSP00000394854:L191P;ENSP00000439401:L191P;ENSP00000375088:L321P	ENSP00000305974:L323P	L	-	2	0	SLCO1A2	21341712	1.000000	0.71417	0.586000	0.28679	0.952000	0.60782	4.857000	0.62939	2.108000	0.64289	0.533000	0.62120	CTT	A|1.000;G|0.000		0.338	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
SLFN12L	100506736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33807038	33807038	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:33807038C>A	ENST00000260908.7	-	2	308	c.191G>T	c.(190-192)cGa>cTa	p.R64L	RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000449046.1_Missense_Mutation_p.R95L|SLFN12L_ENST00000361112.4_Missense_Mutation_p.R93L	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	64						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)			breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						ACACACAGCTCGTGAGACATT	0.403																																					p.R64L		.											.	SLFN12L	23	0			c.G191T						.						90.0	75.0	79.0					17																	33807038		692	1591	2283	SO:0001583	missense	100506736	exon2			ACAGCTCGTGAGA	AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.191G>T	17.37:g.33807038C>A	ENSP00000437635:p.Arg64Leu	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	71.0	NM_001195790	F5H6G3	Missense_Mutation	SNP	ENST00000260908.7	37	CCDS56026.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995899	0.54147	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	T;T;T	0.03920	3.77;3.87;3.76	2.72	-5.44	0.02624	.	.	.	.	.	T	0.03564	0.0102	N	0.11560	0.145	0.09310	N	1	P	0.49696	0.927	P	0.49999	0.628	T	0.27157	-1.0082	9	0.46703	T	0.11	.	5.9558	0.19273	0.0:0.5432:0.1875:0.2692	.	93	Q6IEE8-2	.	L	64;93;95	ENSP00000437635:R64L;ENSP00000354412:R93L;ENSP00000389348:R95L	ENSP00000437635:R64L	R	-	2	0	SLFN12L	30831151	0.000000	0.05858	0.000000	0.03702	0.398000	0.30690	-2.933000	0.00687	-1.156000	0.02818	0.205000	0.17691	CGA	.		0.403	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395748.2	XM_496206	
SLITRK6	84189	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	86369191	86369191	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr13:86369191delT	ENST00000400286.2	-	2	2051	c.1453delA	c.(1453-1455)actfs	p.T485fs		NM_032229.2	NP_115605.2	Q9H5Y7	SLIK6_HUMAN	SLIT and NTRK-like family, member 6	485					adult locomotory behavior (GO:0008344)|auditory behavior (GO:0031223)|auditory receptor cell morphogenesis (GO:0002093)|axonogenesis (GO:0007409)|cochlea development (GO:0090102)|innervation (GO:0060384)|lens development in camera-type eye (GO:0002088)|linear vestibuloocular reflex (GO:0060007)|multicellular organism growth (GO:0035264)|sensory perception of sound (GO:0007605)|startle response (GO:0001964)|synapse assembly (GO:0007416)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(18)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		TTTACCTTAGTTAGAGGAACC	0.368																																					p.T485fs		.											.	SLITRK6	137	0			c.1453delA						.						80.0	80.0	80.0					13																	86369191		1807	4066	5873	SO:0001589	frameshift_variant	84189	exon2			CCTTAGTTAGAGG	AK026427	CCDS41903.1	13q31.1	2006-04-12			ENSG00000184564	ENSG00000184564			23503	protein-coding gene	gene with protein product		609681				14557068	Standard	NM_032229		Approved	FLJ22774	uc001vll.1	Q9H5Y7	OTTHUMG00000017157	ENST00000400286.2:c.1453delA	13.37:g.86369191delT	ENSP00000383143:p.Thr485fs	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	53.0	NM_032229	A8K9S8|Q495Q0|Q6AW93|Q9HAA8|Q9NT60	Frame_Shift_Del	DEL	ENST00000400286.2	37	CCDS41903.1																																																																																			.		0.368	SLITRK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045404.2	NM_032229	
SMC3	9126	hgsc.bcm.edu;bcgsc.ca	37	10	112338437	112338437	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr10:112338437T>C	ENST00000361804.4	+	7	528	c.402T>C	c.(400-402)aaT>aaC	p.N134N	snoU13_ENST00000458966.1_RNA|SMC3_ENST00000462899.1_3'UTR	NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	134					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		CTCGAAGCAATCCTTATTATA	0.303																																					p.N134N		.											.	SMC3	92	0			c.T402C						.						95.0	91.0	92.0					10																	112338437		2203	4300	6503	SO:0001819	synonymous_variant	9126	exon7			AAGCAATCCTTAT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.402T>C	10.37:g.112338437T>C		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_005445	A8K156|O60464|Q5T482	Silent	SNP	ENST00000361804.4	37	CCDS31285.1																																																																																			.		0.303	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
SMTN	6525	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	31485773	31485773	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:31485773T>G	ENST00000347557.2	+	7	778	c.560T>G	c.(559-561)gTg>gGg	p.V187G	SMTN_ENST00000333137.7_Missense_Mutation_p.V187G|SMTN_ENST00000358743.1_Missense_Mutation_p.V187G	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	187					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						GTGACCACAGTGACACTCCTG	0.622																																					p.V243G		.											.	SMTN	154	0			c.T728G						.						80.0	67.0	71.0					22																	31485773		2203	4300	6503	SO:0001583	missense	6525	exon6			CCACAGTGACACT	AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.560T>G	22.37:g.31485773T>G	ENSP00000328635:p.Val187Gly	Somatic	64.0	1.0		WXS	Illumina HiSeq	Phase_I	91.0	31.0	NM_001207018	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	ENST00000347557.2	37	CCDS13886.1	.	.	.	.	.	.	.	.	.	.	T	14.17	2.456714	0.43634	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	T;T;T	0.67865	0.13;-0.29;-0.29	5.06	5.06	0.68205	.	0.000000	0.34460	N	0.003957	T	0.65302	0.2678	N	0.17082	0.46	0.80722	D	1	D;D;D;D;D;D	0.62365	0.967;0.991;0.987;0.987;0.991;0.981	D;P;D;D;P;D	0.72625	0.95;0.816;0.966;0.966;0.762;0.978	T	0.60510	-0.7249	10	0.15952	T	0.53	-26.7119	11.7709	0.51958	0.0:0.0:0.0:1.0	.	243;241;179;187;187;187	E7ETT8;B4E229;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;SMTN_HUMAN;.	G	187;187;187;187;179	ENSP00000351593:V187G;ENSP00000328635:V187G;ENSP00000329532:V187G	ENSP00000329393:V187G	V	+	2	0	SMTN	29815773	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.470000	0.45119	2.211000	0.71520	0.460000	0.39030	GTG	.		0.622	SMTN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321766.1	NM_134270	
SNRK	54861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	43388906	43388906	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:43388906G>A	ENST00000296088.7	+	7	1459	c.1155G>A	c.(1153-1155)gcG>gcA	p.A385A	SNRK_ENST00000454177.1_Silent_p.A385A|SNRK-AS1_ENST00000422681.1_RNA|SNRK_ENST00000437827.1_Silent_p.A179A|RP11-188P20.3_ENST00000607513.1_RNA|SNRK_ENST00000429705.2_Silent_p.A385A	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		TGTCCCACGCGACTGTCCCTC	0.547																																					p.A385A		.											.	SNRK	815	0			c.G1155A						.						70.0	75.0	74.0					3																	43388906		2039	4193	6232	SO:0001819	synonymous_variant	54861	exon7			CCACGCGACTGTC	D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.1155G>A	3.37:g.43388906G>A		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	19.0	NM_017719		Silent	SNP	ENST00000296088.7	37	CCDS43075.1																																																																																			.		0.547	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344325.1	NM_017719	
SOX9	6662	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	70120374	70120374	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:70120374G>T	ENST00000245479.2	+	3	1748	c.1376G>T	c.(1375-1377)gGc>gTc	p.G459V		NM_000346.3	NP_000337.1	P48436	SOX9_HUMAN	SRY (sex determining region Y)-box 9	459					astrocyte fate commitment (GO:0060018)|branching involved in ureteric bud morphogenesis (GO:0001658)|cAMP-mediated signaling (GO:0019933)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cell fate specification (GO:0001708)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to heparin (GO:0071504)|cellular response to interleukin-1 (GO:0071347)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|chondrocyte hypertrophy (GO:0003415)|chromatin remodeling (GO:0006338)|cochlea morphogenesis (GO:0090103)|cytoskeleton organization (GO:0007010)|endocardial cushion morphogenesis (GO:0003203)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation involved in prostatic bud elongation (GO:0060517)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|heart valve development (GO:0003170)|heart valve formation (GO:0003188)|heart valve morphogenesis (GO:0003179)|intestinal epithelial structure maintenance (GO:0060729)|intrahepatic bile duct development (GO:0035622)|limb bud formation (GO:0060174)|lung epithelial cell differentiation (GO:0060487)|male germ-line sex determination (GO:0019100)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of bone mineralization (GO:0030502)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of immune system process (GO:0002683)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of ossification (GO:0030279)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|notochord development (GO:0030903)|nucleosome assembly (GO:0006334)|oligodendrocyte differentiation (GO:0048709)|ossification (GO:0001503)|otic vesicle formation (GO:0030916)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation involved in heart morphogenesis (GO:2000138)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of kidney development (GO:0090184)|positive regulation of male gonad development (GO:2000020)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein complex assembly (GO:0006461)|protein kinase B signaling (GO:0043491)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in lung morphogenesis (GO:0061046)|regulation of cell adhesion (GO:0030155)|regulation of cell cycle process (GO:0010564)|regulation of cell proliferation (GO:0042127)|regulation of cell proliferation involved in tissue homeostasis (GO:0060784)|regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000794)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|tissue homeostasis (GO:0001894)|transcription from RNA polymerase II promoter (GO:0006366)|ureter morphogenesis (GO:0072197)|ureter smooth muscle cell differentiation (GO:0072193)|ureter urothelium development (GO:0072190)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enhancer binding (GO:0035326)|enhancer sequence-specific DNA binding (GO:0001158)|pre-mRNA intronic binding (GO:0097157)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase activity (GO:0004672)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(5)|pancreas(1)|upper_aerodigestive_tract(2)	26		Colorectal(1115;0.245)	STAD - Stomach adenocarcinoma(260;0.119)			GCAGGCCAGGGCACCGGCCTC	0.647																																					p.G459V	Pancreas(42;83 1041 2320 35205 39456)	.											.	SOX9	514	0			c.G1376T						.						148.0	141.0	144.0					17																	70120374		2203	4300	6503	SO:0001583	missense	6662	exon3			GCCAGGGCACCGG	S74506	CCDS11689.1	17q24.3	2013-10-17	2008-07-31		ENSG00000125398	ENSG00000125398		"""SRY (sex determining region Y)-boxes"""	11204	protein-coding gene	gene with protein product		608160	"""campomelic dysplasia, autosomal sex-reversal"""	CMD1, CMPD1		8348155	Standard	NM_000346		Approved	SRA1	uc002jiw.3	P48436	OTTHUMG00000166300	ENST00000245479.2:c.1376G>T	17.37:g.70120374G>T	ENSP00000245479:p.Gly459Val	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	33.0	NM_000346	Q53Y80	Missense_Mutation	SNP	ENST00000245479.2	37	CCDS11689.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658077	0.47467	.	.	ENSG00000125398	ENST00000245479;ENST00000455872	T	0.75938	-0.98	4.27	3.27	0.37495	.	0.288040	0.38005	N	0.001847	T	0.58694	0.2140	L	0.34521	1.04	0.80722	D	1	B	0.32245	0.361	B	0.29440	0.102	T	0.54899	-0.8224	10	0.41790	T	0.15	.	7.0933	0.25295	0.0889:0.0:0.7391:0.1721	.	459	P48436	SOX9_HUMAN	V	459;395	ENSP00000245479:G459V	ENSP00000245479:G459V	G	+	2	0	SOX9	67631969	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	5.228000	0.65310	0.882000	0.36016	0.462000	0.41574	GGC	.		0.647	SOX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389032.1	NM_000346	
SRRD	402055	broad.mit.edu;ucsc.edu;mdanderson.org	37	22	26887637	26887637	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:26887637G>A	ENST00000215917.7	+	7	1033	c.1019G>A	c.(1018-1020)tGa>tAa	p.*340*	TFIP11_ENST00000407690.1_3'UTR	NM_001013694.2	NP_001013716.2	Q9UH36	SRR1L_HUMAN	SRR1 domain containing	0					rhythmic process (GO:0048511)					endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						GCTACTGACTGAACTCGTTGT	0.473																																					p.X340X		.											.	SRRD	22	0			c.G1019A						.						39.0	38.0	38.0					22																	26887637		1975	4159	6134	SO:0001819	synonymous_variant	402055	exon7			CTGACTGAACTCG	BC066962	CCDS42995.1	22q12.1	2008-10-31			ENSG00000100104	ENSG00000100104			33910	protein-coding gene	gene with protein product	"""hepatocellular carcinoma complicating hemochromatosis"""	602254					Standard	NM_001013694		Approved	HC/HCC, SRR1L	uc010gve.3	Q9UH36	OTTHUMG00000150885	ENST00000215917.7:c.1019G>A	22.37:g.26887637G>A		Somatic	13.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	11.0	NM_001013694	Q6NXP8	Silent	SNP	ENST00000215917.7	37	CCDS42995.1																																																																																			.		0.473	SRRD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320423.2	NM_001013694	
SRRM2	23524	ucsc.edu;bcgsc.ca	37	16	2811772	2811772	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:2811772T>C	ENST00000301740.8	+	11	1792	c.1243T>C	c.(1243-1245)Tct>Cct	p.S415P		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	415	Pro-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						ACTTCCCCAGTCTTCTTCCTC	0.577																																					p.S415P		.											.	SRRM2	93	0			c.T1243C						.						168.0	173.0	172.0					16																	2811772		2198	4300	6498	SO:0001583	missense	23524	exon11			CCCCAGTCTTCTT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1243T>C	16.37:g.2811772T>C	ENSP00000301740:p.Ser415Pro	Somatic	74.0	0.0		WXS	Illumina HiSeq	.	41.0	6.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	37	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	T	1.925	-0.447381	0.04572	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.35789	1.29	4.04	2.91	0.33838	.	0.120086	0.39083	N	0.001464	T	0.21718	0.0523	N	0.24115	0.695	0.33577	D	0.599328	B	0.32693	0.38	B	0.31869	0.137	T	0.22836	-1.0205	10	0.48119	T	0.1	-0.9033	6.6019	0.22705	0.2133:0.0:0.0:0.7867	.	415	Q9UQ35	SRRM2_HUMAN	P	415;415;380	ENSP00000301740:S415P	ENSP00000301740:S415P	S	+	1	0	SRRM2	2751773	0.825000	0.29262	0.316000	0.25252	0.421000	0.31385	2.360000	0.44151	0.401000	0.25424	-0.490000	0.04691	TCT	.		0.577	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
STAG1	10274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	136085882	136085882	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:136085882T>C	ENST00000383202.2	-	25	2844	c.2588A>G	c.(2587-2589)cAt>cGt	p.H863R	STAG1_ENST00000236698.5_Missense_Mutation_p.H863R|STAG1_ENST00000536929.1_Missense_Mutation_p.H447R|STAG1_ENST00000434713.2_Missense_Mutation_p.H637R	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	863					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CCTTCTTTTATGTAAGGCCTC	0.353																																					p.H863R		.											.	STAG1	228	0			c.A2588G						.						213.0	203.0	206.0					3																	136085882		2202	4299	6501	SO:0001583	missense	10274	exon25			CTTTTATGTAAGG	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.2588A>G	3.37:g.136085882T>C	ENSP00000372689:p.His863Arg	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	61.0	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	37	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517726	0.85495	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713;ENST00000536929	T;T;T;T	0.36340	1.69;1.7;1.83;1.26	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.67088	0.2856	M	0.88377	2.95	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.85130	0.997;0.957	T	0.74051	-0.3789	10	0.72032	D	0.01	.	16.1354	0.81481	0.0:0.0:0.0:1.0	.	863;863	Q6P275;Q8WVM7	.;STAG1_HUMAN	R	863;863;637;447	ENSP00000372689:H863R;ENSP00000236698:H863R;ENSP00000404396:H637R;ENSP00000445787:H447R	ENSP00000236698:H863R	H	-	2	0	STAG1	137568572	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	2.207000	0.71202	0.533000	0.62120	CAT	.		0.353	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
STAT3	6774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40500452	40500452	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr17:40500452A>T	ENST00000264657.5	-	2	395	c.83T>A	c.(82-84)aTg>aAg	p.M28K	STAT3_ENST00000389272.3_Intron|STAT3_ENST00000585517.1_Missense_Mutation_p.M28K|STAT3_ENST00000404395.3_Missense_Mutation_p.M28K|STAT3_ENST00000588969.1_Missense_Mutation_p.M28K	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	28					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CCGCAGCTCCATTGGGAAGCT	0.493									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.M28K		.											.	STAT3	1271	0			c.T83A						.						94.0	89.0	91.0					17																	40500452		2203	4300	6503	SO:0001583	missense	6774	exon2	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	AGCTCCATTGGGA	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.83T>A	17.37:g.40500452A>T	ENSP00000264657:p.Met28Lys	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	50.0	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	37	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.027571	0.93518	.	.	ENSG00000168610	ENST00000264657;ENST00000404395	T;T	0.54071	0.59;0.59	5.28	5.28	0.74379	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.72969	0.3527	M	0.81497	2.545	0.80722	D	1	D;P;P	0.53462	0.96;0.845;0.845	D;P;P	0.66979	0.948;0.899;0.899	T	0.76694	-0.2865	10	0.62326	D	0.03	-30.1868	15.3678	0.74538	1.0:0.0:0.0:0.0	.	28;28;28	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	K	28	ENSP00000264657:M28K;ENSP00000384943:M28K	ENSP00000264657:M28K	M	-	2	0	STAT3	37753978	1.000000	0.71417	0.996000	0.52242	0.949000	0.60115	8.972000	0.93424	2.219000	0.72066	0.533000	0.62120	ATG	.		0.493	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
STT3A	3703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	125474114	125474114	+	Silent	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:125474114A>T	ENST00000529196.1	+	7	686	c.480A>T	c.(478-480)cgA>cgT	p.R160R	STT3A_ENST00000392708.4_Silent_p.R160R|STT3A_ENST00000531491.1_Silent_p.R68R			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	160					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)	p.R160R(1)		NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		ATATCTCCCGATCTGTGGCTG	0.423																																					p.R160R		.											.	STT3A	90	1	Substitution - coding silent(1)	endometrium(1)	c.A480T						.						125.0	117.0	119.0					11																	125474114		2201	4299	6500	SO:0001819	synonymous_variant	3703	exon6			CTCCCGATCTGTG	BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.480A>T	11.37:g.125474114A>T		Somatic	144.0	1.0		WXS	Illumina HiSeq	Phase_I	92.0	68.0	NM_152713	B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Silent	SNP	ENST00000529196.1	37	CCDS8458.1																																																																																			.		0.423	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386691.1	NM_152713	
TBPL1	9519	hgsc.bcm.edu;broad.mit.edu	37	6	134305776	134305776	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:134305776C>T	ENST00000237264.4	+	6	723	c.448C>T	c.(448-450)Cag>Tag	p.Q150*	TBPL1_ENST00000367871.1_Nonsense_Mutation_p.Q150*|TBPL1_ENST00000477527.1_Intron	NM_001253676.1|NM_004865.3	NP_001240605.1|NP_004856.1	P62380	TBPL1_HUMAN	TBP-like 1	150					acrosome assembly (GO:0001675)|DNA-templated transcription, initiation (GO:0006352)|dTTP biosynthetic process (GO:0006235)|regulation of transcription, DNA-templated (GO:0006355)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	6	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00591)|OV - Ovarian serous cystadenocarcinoma(155;0.00848)		AGCTACATTACAGATTTTTTC	0.323																																					p.Q150X		.											.	TBPL1	90	0			c.C448T						.						47.0	47.0	47.0					6																	134305776		2203	4298	6501	SO:0001587	stop_gained	9519	exon6			ACATTACAGATTT	AB020881	CCDS5168.1	6q22.1-q22.3	2008-05-23			ENSG00000028839	ENSG00000028839			11589	protein-coding gene	gene with protein product		605521				10082669, 10220372, 15767669	Standard	NM_001253676		Approved	TLP, STUD, TRF2, TLF	uc010kgg.3	P62380	OTTHUMG00000015609	ENST00000237264.4:c.448C>T	6.37:g.134305776C>T	ENSP00000237264:p.Gln150*	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_004865	A8K8F5|O95753|Q9BWD5|Q9Z2Z0	Nonsense_Mutation	SNP	ENST00000237264.4	37	CCDS5168.1	.	.	.	.	.	.	.	.	.	.	C	37	6.448344	0.97577	.	.	ENSG00000028839	ENST00000367871;ENST00000237264	.	.	.	5.83	5.83	0.93111	.	0.049220	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-7.5705	19.1704	0.93575	0.0:1.0:0.0:0.0	.	.	.	.	X	150	.	ENSP00000237264:Q150X	Q	+	1	0	TBPL1	134347469	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.712000	0.68407	2.771000	0.95319	0.650000	0.86243	CAG	.		0.323	TBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042294.2		
TBP	6908	broad.mit.edu;mdanderson.org	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000230354.6_Silent_p.Q60Q|TBP_ENST00000540980.1_Silent_p.Q40Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP	91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		Somatic	67.0	1.0		WXS	Illumina HiSeq	Phase_I	61.0	10.0	NM_003194	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TCTN2	79867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124158356	124158356	+	Splice_Site	SNP	A	A	T	rs111689585		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:124158356A>T	ENST00000303372.5	+	4	590	c.462A>T	c.(460-462)tcA>tcT	p.S154S	TCTN2_ENST00000426174.2_Splice_Site_p.S153S	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	154					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		ATAATGCCTCAGGCAAGTGAA	0.443																																					p.S154S		.											.	TCTN2	91	0			c.A462T						.						173.0	169.0	170.0					12																	124158356		2203	4300	6503	SO:0001630	splice_region_variant	79867	exon4			TGCCTCAGGCAAG	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.463+1A>T	12.37:g.124158356A>T		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	118.0	NM_024809	A8K7Y8|B3KPW5|Q9H966	Silent	SNP	ENST00000303372.5	37	CCDS9253.1																																																																																			A|0.500;G|0.500		0.443	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809	Silent
TECPR1	25851	hgsc.bcm.edu;bcgsc.ca	37	7	97873966	97873966	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:97873966T>C	ENST00000447648.2	-	5	747	c.448A>G	c.(448-450)Aaa>Gaa	p.K150E	TECPR1_ENST00000542604.1_Missense_Mutation_p.K71E|TECPR1_ENST00000379795.3_Missense_Mutation_p.K150E			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	150					autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTCTTGTCTTTCGTGTAGGTG	0.567																																					p.K150E		.											.	TECPR1	91	0			c.A448G						.						99.0	102.0	101.0					7																	97873966		1948	4130	6078	SO:0001583	missense	25851	exon5			TGTCTTTCGTGTA		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.448A>G	7.37:g.97873966T>C	ENSP00000404923:p.Lys150Glu	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_015395	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	ENST00000447648.2	37	CCDS47648.1	.	.	.	.	.	.	.	.	.	.	T	8.419	0.845965	0.16963	.	.	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	D;D;T	0.94046	-3.34;-3.34;1.46	5.2	2.8	0.32819	Ferlin/Peroxisome membrane (1);	0.088931	0.85682	D	0.000000	D	0.89663	0.6780	L	0.61036	1.89	0.26140	N	0.980298	P;B	0.40834	0.73;0.444	B;B	0.42959	0.318;0.403	T	0.79017	-0.1975	10	0.06891	T	0.86	-13.4199	7.1024	0.25344	0.0:0.0787:0.1611:0.7602	.	71;150	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	E	150;150;71	ENSP00000404923:K150E;ENSP00000369121:K150E;ENSP00000441121:K71E	ENSP00000369121:K150E	K	-	1	0	TECPR1	97711902	0.964000	0.33143	0.275000	0.24674	0.674000	0.39518	3.330000	0.52068	0.306000	0.22856	-0.406000	0.06334	AAA	.		0.567	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334661.1	NM_015395	
TM7SF3	51768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	27128524	27128524	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr12:27128524G>A	ENST00000343028.4	-	11	1580	c.1355C>T	c.(1354-1356)tCc>tTc	p.S452F	RP11-421F16.3_ENST00000500632.1_RNA	NM_016551.2	NP_057635.1	Q9NS93	TM7S3_HUMAN	transmembrane 7 superfamily member 3	452						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	18	Colorectal(261;0.0847)					AAGGCTTGTGGACCAGTAACT	0.443																																					p.S452F		.											.	TM7SF3	92	0			c.C1355T						.						126.0	111.0	116.0					12																	27128524		2203	4300	6503	SO:0001583	missense	51768	exon11			CTTGTGGACCAGT	AB032470	CCDS8710.1	12q11-q12	2012-08-10			ENSG00000064115	ENSG00000064115			23049	protein-coding gene	gene with protein product		605181				10828615	Standard	NM_016551		Approved		uc010sjl.2	Q9NS93	OTTHUMG00000169243	ENST00000343028.4:c.1355C>T	12.37:g.27128524G>A	ENSP00000342322:p.Ser452Phe	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	73.0	NM_016551	B3KMZ3|Q9NUS4	Missense_Mutation	SNP	ENST00000343028.4	37	CCDS8710.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347733	0.24426	.	.	ENSG00000064115	ENST00000343028;ENST00000545344;ENST00000537406	T	0.30448	1.53	5.52	-0.586	0.11694	.	0.248069	0.42548	N	0.000699	T	0.08537	0.0212	N	0.02011	-0.69	0.27910	N	0.93865	B	0.02656	0.0	B	0.04013	0.001	T	0.34254	-0.9836	10	0.11182	T	0.66	-3.8215	6.6569	0.22992	0.3947:0.0:0.2307:0.3746	.	452	Q9NS93	TM7S3_HUMAN	F	452;166;70	ENSP00000342322:S452F	ENSP00000342322:S452F	S	-	2	0	TM7SF3	27019791	1.000000	0.71417	0.740000	0.30986	0.902000	0.53008	2.500000	0.45381	-0.256000	0.09473	-0.271000	0.10264	TCC	.		0.443	TM7SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403033.1	NM_016551	
TMEM130	222865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98460878	98460878	+	Silent	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:98460878G>T	ENST00000416379.2	-	2	235	c.231C>A	c.(229-231)acC>acA	p.T77T	TMEM130_ENST00000339375.4_Silent_p.T77T|TMEM130_ENST00000450876.1_5'UTR|TMEM130_ENST00000546258.1_Silent_p.T58T|TMEM130_ENST00000345589.4_Intron			Q8N3G9	TM130_HUMAN	transmembrane protein 130	77						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	25	all_cancers(62;4.05e-09)|all_epithelial(64;2.62e-09)|Lung NSC(181;0.01)|all_lung(186;0.0115)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCACCAGCGGGGTGTGGATCC	0.657																																					p.T77T		.											.	TMEM130	91	0			c.C231A						.						60.0	58.0	59.0					7																	98460878		2203	4300	6503	SO:0001819	synonymous_variant	222865	exon2			CAGCGGGGTGTGG		CCDS5658.1, CCDS47649.1, CCDS47650.1	7q22.1	2006-03-09			ENSG00000166448	ENSG00000166448			25429	protein-coding gene	gene with protein product						12975309	Standard	NM_152913		Approved	DKFZp761L1417, FLJ42643	uc003upo.3	Q8N3G9	OTTHUMG00000154419	ENST00000416379.2:c.231C>A	7.37:g.98460878G>T		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	39.0	NM_152913	A4D266|B7Z364|Q8IY46|Q8N0W9|Q8N3R2	Silent	SNP	ENST00000416379.2	37	CCDS47650.1																																																																																			.		0.657	TMEM130-008	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000380713.1	NM_152913	
TMEM150B	284417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55832397	55832397	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:55832397C>A	ENST00000326652.4	-	3	190	c.8G>T	c.(7-9)gGc>gTc	p.G3V	TMEM150B_ENST00000438693.1_Missense_Mutation_p.G3V	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	3						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3						CGACAGGTAGCCCCACATGCC	0.602																																					p.G3V		.											.	TMEM150B	68	0			c.G8T						.						50.0	52.0	51.0					19																	55832397		2084	4215	6299	SO:0001583	missense	284417	exon3			AGGTAGCCCCACA	BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.8G>T	19.37:g.55832397C>A	ENSP00000320757:p.Gly3Val	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	78.0	NM_001085488	B7ZW71	Missense_Mutation	SNP	ENST00000326652.4	37	CCDS42629.1	.	.	.	.	.	.	.	.	.	.	C	6.308	0.424854	0.11987	.	.	ENSG00000180061	ENST00000326652;ENST00000438693	T;T	0.45276	0.9;0.9	4.26	3.22	0.36961	.	0.819449	0.10486	N	0.668948	T	0.33498	0.0865	L	0.50333	1.59	0.37809	D	0.927986	B	0.33694	0.421	B	0.32393	0.145	T	0.10382	-1.0632	10	0.16896	T	0.51	-9.8093	7.6425	0.28303	0.0:0.8748:0.0:0.1252	.	3	A6NC51	T150B_HUMAN	V	3	ENSP00000320757:G3V;ENSP00000412658:G3V	ENSP00000320757:G3V	G	-	2	0	TMEM150B	60524209	0.977000	0.34250	0.998000	0.56505	0.055000	0.15305	0.634000	0.24614	0.906000	0.36621	0.456000	0.33151	GGC	.		0.602	TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452685.1	NM_001085488	
TNRC18	84629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	5355649	5355649	+	Missense_Mutation	SNP	C	C	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr7:5355649C>G	ENST00000430969.1	-	25	7148	c.6800G>C	c.(6799-6801)gGa>gCa	p.G2267A	TNRC18_ENST00000399537.4_Missense_Mutation_p.G2267A	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2267							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCCGTGTCTCCGTCGTCAAA	0.602																																					p.G2267A		.											.	TNRC18	46	0			c.G6800C						.						56.0	51.0	52.0					7																	5355649		1568	3582	5150	SO:0001583	missense	84629	exon25			GTGTCTCCGTCGT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.6800G>C	7.37:g.5355649C>G	ENSP00000395538:p.Gly2267Ala	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	27.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	c	17.92	3.506922	0.64410	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.58652	0.32;0.32	4.46	4.46	0.54185	.	.	.	.	.	T	0.74665	0.3746	M	0.72353	2.195	0.47341	D	0.999393	D	0.89917	1.0	D	0.87578	0.998	T	0.76460	-0.2951	9	0.45353	T	0.12	.	16.6933	0.85327	0.0:1.0:0.0:0.0	.	2267	O15417	TNC18_HUMAN	A	2267	ENSP00000382452:G2267A;ENSP00000395538:G2267A	ENSP00000382452:G2267A	G	-	2	0	TNRC18	5322175	1.000000	0.71417	0.838000	0.33150	0.286000	0.27126	7.420000	0.80191	2.010000	0.58986	0.511000	0.50034	GGA	.		0.602	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TOP2B	7155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	25670532	25670532	+	Silent	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:25670532A>T	ENST00000264331.4	-	14	1793	c.1794T>A	c.(1792-1794)atT>atA	p.I598I	TOP2B_ENST00000435706.2_Silent_p.I593I	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	598					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	GTACCTTTACAATAGGAGTAA	0.294																																					p.I593I		.											.	TOP2B	273	0			c.T1779A						.						95.0	90.0	92.0					3																	25670532		1796	4060	5856	SO:0001819	synonymous_variant	7155	exon14			CTTTACAATAGGA	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1794T>A	3.37:g.25670532A>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	23.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Silent	SNP	ENST00000264331.4	37																																																																																				.		0.294	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
TREML2	79865	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41162310	41162310	+	Missense_Mutation	SNP	G	G	A	rs147159415		TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:41162310G>A	ENST00000483722.1	-	3	823	c.638C>T	c.(637-639)gCg>gTg	p.A213V		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	213					T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCTGGGAGACGCGGTCACTGT	0.632													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16958	0.0		0.0	False		,,,				2504	0.0				p.A213V		.											.	TREML2	91	0			c.C638T						.	G	VAL/ALA	3,4403	6.2+/-15.9	0,3,2200	111.0	97.0	102.0		638	-1.9	0.0	6	dbSNP_134	102	0,8600		0,0,4300	yes	missense	TREML2	NM_024807.2	64	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	benign	213/322	41162310	3,13003	2203	4300	6503	SO:0001583	missense	79865	exon3			GGAGACGCGGTCA	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.638C>T	6.37:g.41162310G>A	ENSP00000418767:p.Ala213Val	Somatic	128.0	2.0		WXS	Illumina HiSeq	Phase_I	225.0	59.0	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	37	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	G	8.008	0.756786	0.15846	6.81E-4	0.0	ENSG00000112195	ENST00000483722	T	0.05382	3.45	4.28	-1.9	0.07665	.	1.706880	0.03415	N	0.205334	T	0.00608	0.0020	N	0.11106	0.095	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32798	-0.9893	10	0.02654	T	1	-0.0155	0.6584	0.00838	0.4223:0.1514:0.2336:0.1927	.	213	Q5T2D2	TRML2_HUMAN	V	213	ENSP00000418767:A213V	ENSP00000418767:A213V	A	-	2	0	TREML2	41270288	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.448000	0.06820	-0.219000	0.10003	0.643000	0.83706	GCG	G|1.000;A|0.000		0.632	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
TRERF1	55809	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca|broad.mit.edu;bcgsc.ca	37	6	42227243	42227244	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr6:42227243_42227244GG>TT	ENST00000372922.4	-	9	2664_2665	c.2102_2103CC>AA	c.(2101-2103)cCC>cAA	p.P701Q	TRERF1_ENST00000340840.2_Missense_Mutation_p.P618Q|TRERF1_ENST00000372917.4_Missense_Mutation_p.P618Q|TRERF1_ENST00000541110.1_Missense_Mutation_p.P721Q|TRERF1_ENST00000354325.2_Missense_Mutation_p.P618Q	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	701	Interacts with CREBBP.|Pro-rich.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GCTCGTGGGTGGGGTCCAGGAG	0.708																																					p.P701P|p.P701H		.											.	TRERF1	230	0			c.C2103A|c.C2102A						.																																			SO:0001583	missense	55809	exon9			GTGGGTGGGGTCC|TGGGTGGGGTCCA	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2102_2103delinsTT	6.37:g.42227243_42227244delinsTT	ENSP00000362013:p.Pro701Gln	Somatic	61.0|60.0	0.0|1.0		WXS	Illumina HiSeq	Phase_I	158.0	60.0|59.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent|Missense_Mutation	SNP	ENST00000372922.4	37	CCDS4867.1																																																																																			.		0.708	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
TRIM28	10155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	59061183	59061183	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr19:59061183G>T	ENST00000253024.5	+	14	2351	c.2062G>T	c.(2062-2064)Gac>Tac	p.D688Y	TRIM28_ENST00000341753.6_Missense_Mutation_p.D606Y	NM_005762.2	NP_005753.1	Q13263	TIF1B_HUMAN	tripartite motif containing 28	688					convergent extension involved in axis elongation (GO:0060028)|DNA repair (GO:0006281)|embryonic placenta morphogenesis (GO:0060669)|epithelial to mesenchymal transition (GO:0001837)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|Krueppel-associated box domain binding (GO:0035851)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GGATGGTGCAGACAGCACTGG	0.602																																					p.D688Y		.											.	TRIM28	870	0			c.G2062T						.						86.0	79.0	81.0					19																	59061183		2203	4300	6503	SO:0001583	missense	10155	exon14			GGTGCAGACAGCA		CCDS12985.1	19q13.4	2014-06-13	2011-01-25			ENSG00000130726		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	16384	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 157"""	601742	"""tripartite motif-containing 28"""			11331580, 11226167	Standard	NM_005762		Approved	TIF1B, KAP1, TF1B, RNF96, PPP1R157	uc002qtg.1	Q13263		ENST00000253024.5:c.2062G>T	19.37:g.59061183G>T	ENSP00000253024:p.Asp688Tyr	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	33.0	NM_005762	O00677|Q7Z632|Q93040|Q96IM1	Missense_Mutation	SNP	ENST00000253024.5	37	CCDS12985.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658806	0.47467	.	.	ENSG00000130726	ENST00000253024;ENST00000341753	T;T	0.68624	-0.14;-0.34	4.75	1.25	0.21368	.	0.657402	0.14773	N	0.299295	T	0.48660	0.1512	N	0.08118	0	0.09310	N	1	P;P;P	0.47545	0.897;0.478;0.834	P;B;B	0.50192	0.634;0.092;0.334	T	0.34750	-0.9816	10	0.54805	T	0.06	-27.267	3.7431	0.08537	0.2032:0.0:0.6035:0.1934	.	606;688;688	Q13263-2;B2R8R5;Q13263	.;.;TIF1B_HUMAN	Y	688;606	ENSP00000253024:D688Y;ENSP00000342232:D606Y	ENSP00000253024:D688Y	D	+	1	0	TRIM28	63752995	0.765000	0.28485	0.034000	0.17996	0.916000	0.54674	2.107000	0.41844	0.730000	0.32425	0.443000	0.29094	GAC	.		0.602	TRIM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467074.1	NM_005762	
TRPM1	4308	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	31355371	31355371	+	Silent	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr15:31355371T>C	ENST00000256552.6	-	8	1062	c.915A>G	c.(913-915)ggA>ggG	p.G305G	TRPM1_ENST00000542188.1_Silent_p.G322G|TRPM1_ENST00000397795.2_Silent_p.G283G|MIR211_ENST00000384969.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CCGAGGCACGTCCGCTGCCAT	0.577																																					p.G322G		.											.	TRPM1	94	0			c.A966G						.						61.0	66.0	64.0					15																	31355371		2052	4210	6262	SO:0001819	synonymous_variant	4308	exon7			GGCACGTCCGCTG	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.915A>G	15.37:g.31355371T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	36.0	NM_001252020		Silent	SNP	ENST00000256552.6	37	CCDS58346.1																																																																																			.		0.577	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
TRPS1	7227	hgsc.bcm.edu;bcgsc.ca	37	8	116430680	116430680	+	Splice_Site	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:116430680T>C	ENST00000220888.5	-	5	2821	c.2662A>G	c.(2662-2664)Agg>Ggg	p.R888G	TRPS1_ENST00000520276.1_Splice_Site_p.R892G|TRPS1_ENST00000519076.1_Splice_Site_p.R642G|TRPS1_ENST00000395715.3_Splice_Site_p.R901G			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	888					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CCTCTACGCCTCTGAAACAGG	0.468									Langer-Giedion syndrome																												p.R901G		.											.	TRPS1	229	0			c.A2701G						.						84.0	86.0	86.0					8																	116430680		1905	4119	6024	SO:0001630	splice_region_variant	7227	exon6	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	TACGCCTCTGAAA	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2662-1A>G	8.37:g.116430680T>C		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	5.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.53|16.53	3.149075|3.149075	0.57151|0.57151	.|.	.|.	ENSG00000104447|ENSG00000104447	ENST00000518018|ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	.|D;D;D;D	.|0.99671	.|-6.35;-6.35;-6.35;-6.35	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99199|0.99199	0.9722|0.9722	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;0.999;1.0	.|D;D;D	.|0.83275	.|0.996;0.991;0.996	D|D	0.99890|0.99890	1.1132|1.1132	5|10	.|0.72032	.|D	.|0.01	.|.	16.1671|16.1671	0.81777|0.81777	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|892;888;901	.|Q9UHF7-3;Q9UHF7;Q9UHF7-2	.|.;TRPS1_HUMAN;.	G|G	12|901;888;642;892	.|ENSP00000379065:R901G;ENSP00000220888:R888G;ENSP00000428910:R642G;ENSP00000428680:R892G	.|ENSP00000220888:R888G	E|R	-|-	2|1	0|2	TRPS1|TRPS1	116499856|116499856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.116000|6.116000	0.71571|0.71571	2.224000|2.224000	0.72417|0.72417	0.528000|0.528000	0.53228|0.53228	GAG|AGG	.		0.468	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	Missense_Mutation
TSC2	7249	broad.mit.edu;bcgsc.ca	37	16	2136835	2136854	+	Frame_Shift_Del	DEL	ATGACTCCGGTGAGGACTTC	ATGACTCCGGTGAGGACTTC	-	rs45517382|rs45517383|rs45517384|rs137854272|rs397515159|rs137854181|rs35688748|rs182327684	byFrequency	TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	ATGACTCCGGTGAGGACTTC	ATGACTCCGGTGAGGACTTC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:2136835_2136854delATGACTCCGGTGAGGACTTC	ENST00000219476.3	+	38	5582_5601	c.4952_4971delATGACTCCGGTGAGGACTTC	c.(4951-4971)aatgactccggtgaggacttcfs	p.NDSGEDF1651fs	TSC2_ENST00000439673.2_Frame_Shift_Del_p.NDSGEDF1548fs|TSC2_ENST00000350773.4_Frame_Shift_Del_p.NDSGEDF1628fs|TSC2_ENST00000401874.2_Frame_Shift_Del_p.NDSGEDF1584fs|TSC2_ENST00000353929.4_Frame_Shift_Del_p.NDSGEDF1608fs|TSC2_ENST00000568454.1_Frame_Shift_Del_p.NDSGEDF1595fs|TSC2_ENST00000382538.6_Frame_Shift_Del_p.NDSGEDF1536fs	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1651	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.		N -> S (in TSC2; greatly reduces the ability to enhance the RHEB GTPase activity). {ECO:0000269|PubMed:15024740, ECO:0000269|PubMed:9302281}.		acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)	p.N1651S(1)		NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				ATTGTCTACAATGACTCCGGTGAGGACTTCAAGCTTGGCA	0.618			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.1651_1657del		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	TSC2_ENST00000219476,NS,carcinoid-endocrine_tumour,0	TSC2	1908	1	Substitution - Missense(1)	pancreas(1)	c.4952_4971del	GRCh37	CD071405|CM040809|CM971530	TSC2	D|M	rs137854181|rs45517382|rs45517383	.																																			SO:0001589	frameshift_variant	7249	exon38	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TCTACAATGACTC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4952_4971delATGACTCCGGTGAGGACTTC	16.37:g.2136835_2136854delATGACTCCGGTGAGGACTTC	ENSP00000219476:p.Asn1651fs	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	8.0	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Del	DEL	ENST00000219476.3	37	CCDS10458.1																																																																																			.		0.618	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179577610	179577610	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:179577610A>T	ENST00000591111.1	-	92	26415	c.26191T>A	c.(26191-26193)Ttc>Atc	p.F8731I	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.F7804I|TTN_ENST00000589042.1_Missense_Mutation_p.F9048I|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	12884	Ig-like 70.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTAACACTGAAAGGAGGTGTT	0.428																																					p.F9048I		.											.	TTN	636	0			c.T27142A						.						59.0	55.0	56.0					2																	179577610		1929	4130	6059	SO:0001583	missense	7273	exon94			CACTGAAAGGAGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.26191T>A	2.37:g.179577610A>T	ENSP00000465570:p.Phe8731Ile	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	35.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	13.09	2.132850	0.37630	.	.	ENSG00000155657	ENST00000342992	T	0.65916	-0.18	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50548	0.1622	L	0.31065	0.9	0.80722	D	1	B	0.21071	0.051	B	0.17433	0.018	T	0.51482	-0.8700	9	0.87932	D	0	.	11.7623	0.51910	0.9291:0.0:0.0709:0.0	.	8731	Q8WZ42	TITIN_HUMAN	I	7804	ENSP00000343764:F7804I	ENSP00000343764:F7804I	F	-	1	0	TTN	179285855	0.816000	0.29132	0.998000	0.56505	0.996000	0.88848	1.358000	0.34102	2.198000	0.70561	0.533000	0.62120	TTC	.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBE2L3	7332	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	21922044	21922044	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr22:21922044G>T	ENST00000342192.4	+	1	209	c.11G>T	c.(10-12)aGc>aTc	p.S4I	UBE2L3_ENST00000458578.2_Intron|UBE2L3_ENST00000545681.1_Missense_Mutation_p.S4I	NM_003347.3	NP_003338.1	P68036	UB2L3_HUMAN	ubiquitin-conjugating enzyme E2L 3	4					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein K11-linked ubiquitination (GO:0070979)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)|ubiquitin-protein transferase activity (GO:0004842)		UBE2L3/KRAS(2)	large_intestine(4)	4	Colorectal(54;0.105)					ATGGCGGCCAGCAGGAGGCTG	0.706																																					p.S4I		.											.	UBE2L3	414	0			c.G11T						.						16.0	18.0	17.0					22																	21922044		2173	4259	6432	SO:0001583	missense	7332	exon1			CGGCCAGCAGGAG	AJ000519	CCDS13790.1, CCDS58795.1, CCDS58796.1	22q11.2	2007-02-05			ENSG00000185651	ENSG00000185651		"""Ubiquitin-conjugating enzymes E2"""	12488	protein-coding gene	gene with protein product		603721				8672131, 9693040	Standard	NM_001256356		Approved	UBCH7	uc031rxe.1	P68036	OTTHUMG00000150823	ENST00000342192.4:c.11G>T	22.37:g.21922044G>T	ENSP00000344259:p.Ser4Ile	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	57.0	NM_003347	B2R4A7|B4DDG1|B4DSZ4|E7EWS7|P51966|P70653|Q9HAV1	Missense_Mutation	SNP	ENST00000342192.4	37	CCDS13790.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879892	0.51801	.	.	ENSG00000185651	ENST00000342192;ENST00000545681	T;T	0.71579	-0.58;1.52	4.53	3.48	0.39840	Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	L	0.60904	1.88	0.22199	N	0.999299	B;B;B	0.19817	0.013;0.039;0.039	B;B;B	0.29598	0.015;0.104;0.104	T	0.55153	-0.8185	10	0.37606	T	0.19	.	8.7098	0.34376	0.1084:0.0:0.8916:0.0	.	4;4;4	B4DDG1;P68036;A8K4W8	.;UB2L3_HUMAN;.	I	4	ENSP00000344259:S4I;ENSP00000445931:S4I	ENSP00000344259:S4I	S	+	2	0	UBE2L3	20252044	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.180000	0.58296	2.344000	0.79699	0.558000	0.71614	AGC	.		0.706	UBE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320219.1	NM_198157	
UBR5	51366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	103300480	103300480	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr8:103300480C>T	ENST00000520539.1	-	36	5334	c.4728G>A	c.(4726-4728)gaG>gaA	p.E1576E	UBR5_ENST00000220959.4_Silent_p.E1576E|UBR5_ENST00000519528.1_5'UTR|UBR5_ENST00000521922.1_Silent_p.E1570E	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	1576					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CAGCCACACCCTCCACCACCT	0.413																																					p.E1576E	Ovarian(131;96 1741 5634 7352 27489)	.											.	UBR5	761	0			c.G4728A						.						158.0	139.0	145.0					8																	103300480		2203	4300	6503	SO:0001819	synonymous_variant	51366	exon36			CACACCCTCCACC	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.4728G>A	8.37:g.103300480C>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	35.0	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Silent	SNP	ENST00000520539.1	37	CCDS34933.1																																																																																			.		0.413	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	
USP25	29761	hgsc.bcm.edu;broad.mit.edu	37	21	17163836	17163836	+	Silent	SNP	C	C	T			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr21:17163836C>T	ENST00000285679.6	+	5	777	c.408C>T	c.(406-408)agC>agT	p.S136S	USP25_ENST00000351097.5_Silent_p.S136S|USP25_ENST00000400183.2_Silent_p.S136S|USP25_ENST00000547201.1_3'UTR|USP25_ENST00000285681.2_Silent_p.S136S	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	136					cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TTGAAGCCAGCATAGCAGAGA	0.378																																					p.S136S		.											.	USP25	663	0			c.C408T						.						113.0	115.0	114.0					21																	17163836		2202	4300	6502	SO:0001819	synonymous_variant	29761	exon5			AGCCAGCATAGCA	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.408C>T	21.37:g.17163836C>T		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_013396	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	ENST00000285679.6	37	CCDS33515.1																																																																																			.		0.378	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157964.1		
USP31	57478	hgsc.bcm.edu;bcgsc.ca	37	16	23117594	23117594	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:23117594T>C	ENST00000219689.7	-	4	892	c.893A>G	c.(892-894)cAg>cGg	p.Q298R		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	229	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		AGTGTTGCTCTGTTTCTGACA	0.363																																					p.Q298R		.											.	USP31	663	0			c.A893G						.						106.0	106.0	106.0					16																	23117594		2197	4300	6497	SO:0001583	missense	57478	exon4			TTGCTCTGTTTCT	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.893A>G	16.37:g.23117594T>C	ENSP00000219689:p.Gln298Arg	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	5.0	NM_020718	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000219689.7	37	CCDS10607.1	.	.	.	.	.	.	.	.	.	.	T	25.6	4.653026	0.88056	.	.	ENSG00000103404	ENST00000219689	T	0.29655	1.56	5.82	5.82	0.92795	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.172968	0.43579	D	0.000558	T	0.44603	0.1301	L	0.38838	1.175	0.80722	D	1	D	0.64830	0.994	D	0.76575	0.988	T	0.17048	-1.0382	10	0.23302	T	0.38	-14.6144	15.3651	0.74516	0.0:0.0:0.0:1.0	.	298	Q70CQ4	UBP31_HUMAN	R	298	ENSP00000219689:Q298R	ENSP00000219689:Q298R	Q	-	2	0	USP31	23025095	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.649000	0.83500	2.222000	0.72286	0.533000	0.62120	CAG	.		0.363	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
VPS8	23355	hgsc.bcm.edu;bcgsc.ca	37	3	184646287	184646287	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:184646287A>G	ENST00000437079.3	+	32	2851	c.2680A>G	c.(2680-2682)Agt>Ggt	p.S894G	VPS8_ENST00000446204.2_Missense_Mutation_p.S802G|VPS8_ENST00000287546.4_Missense_Mutation_p.S894G|VPS8_ENST00000436792.2_Missense_Mutation_p.S892G|VPS8_ENST00000463687.1_3'UTR	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	894							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			ATTTGAAGAGAGTCGACTCAT	0.333																																					p.S894G		.											.	VPS8	91	0			c.A2680G						.						124.0	117.0	119.0					3																	184646287		1837	4101	5938	SO:0001583	missense	23355	exon31			GAAGAGAGTCGAC	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2680A>G	3.37:g.184646287A>G	ENSP00000397879:p.Ser894Gly	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	4.0	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	37	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	A	12.07	1.828382	0.32329	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.79	5.79	0.91817	Quinonprotein alcohol dehydrogenase-like (1);	0.394966	0.33916	N	0.004421	T	0.11665	0.0284	N	0.12182	0.205	0.34986	D	0.754568	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.15870	0.001;0.014;0.002	T	0.15780	-1.0425	10	0.32370	T	0.25	-8.2684	15.8033	0.78473	1.0:0.0:0.0:0.0	.	894;802;892	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	G	894;894;892;802	ENSP00000287546:S894G;ENSP00000397879:S894G;ENSP00000404704:S892G;ENSP00000405483:S802G	ENSP00000287546:S894G	S	+	1	0	VPS8	186128981	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.496000	0.73670	2.213000	0.71641	0.455000	0.32223	AGT	.		0.333	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
WDHD1	11169	hgsc.bcm.edu;bcgsc.ca	37	14	55408356	55408356	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:55408356T>C	ENST00000360586.3	-	26	3307	c.3242A>G	c.(3241-3243)aAg>aGg	p.K1081R	WDHD1_ENST00000420358.2_Missense_Mutation_p.K958R|WDHD1_ENST00000359167.4_Missense_Mutation_p.K599R|WDHD1_ENST00000421192.1_Missense_Mutation_p.K958R	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	1081					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						TTTTCGCTTCTTTGCTTCAGT	0.373																																					p.K1081R		.											.	WDHD1	91	0			c.A3242G						.						147.0	151.0	150.0					14																	55408356		2202	4300	6502	SO:0001583	missense	11169	exon26			CGCTTCTTTGCTT	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.3242A>G	14.37:g.55408356T>C	ENSP00000353793:p.Lys1081Arg	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_007086	C9JW18|F6W0U7	Missense_Mutation	SNP	ENST00000360586.3	37	CCDS9721.1	.	.	.	.	.	.	.	.	.	.	T	18.79	3.698135	0.68386	.	.	ENSG00000198554	ENST00000360586;ENST00000359167;ENST00000421192	T;T;T	0.65364	0.21;0.66;-0.15	5.68	5.68	0.88126	High mobility group, HMG1/HMG2 (2);	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	M	0.76002	2.32	0.53688	D	0.999971	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.79135	-0.1928	10	0.48119	T	0.1	.	14.1504	0.65381	0.0:0.0:0.0:1.0	.	599;1081	F8W7P7;O75717	.;WDHD1_HUMAN	R	1081;599;958	ENSP00000353793:K1081R;ENSP00000352085:K599R;ENSP00000391049:K958R	ENSP00000352085:K599R	K	-	2	0	WDHD1	54478106	1.000000	0.71417	1.000000	0.80357	0.376000	0.30014	4.985000	0.63845	2.166000	0.68216	0.533000	0.62120	AAG	.		0.373	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276897.2	NM_007086	
WDR20	91833	hgsc.bcm.edu;bcgsc.ca	37	14	102676047	102676047	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr14:102676047T>C	ENST00000342702.3	+	3	1571	c.1540T>C	c.(1540-1542)Tgt>Cgt	p.C514R	WDR20_ENST00000499851.2_Missense_Mutation_p.C257R|WDR20_ENST00000322340.5_Intron|WDR20_ENST00000299135.6_3'UTR|WDR20_ENST00000556807.1_Missense_Mutation_p.C453R|WDR20_ENST00000556511.2_Missense_Mutation_p.C453R|WDR20_ENST00000424963.2_Missense_Mutation_p.C390R|WDR20_ENST00000454394.2_Missense_Mutation_p.C545R|WDR20_ENST00000335263.5_Missense_Mutation_p.C514R|WDR20_ENST00000545563.1_Missense_Mutation_p.C341R	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20	514										breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						AACGCCCCTGTGTCCTCGAAT	0.418											OREG0022939	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C545R		.											.	WDR20	90	0			c.T1633C						.						96.0	93.0	94.0					14																	102676047		2203	4300	6503	SO:0001583	missense	91833	exon4			CCCCTGTGTCCTC	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3		ENST00000342702.3:c.1540T>C	14.37:g.102676047T>C	ENSP00000341037:p.Cys514Arg	Somatic	103.0	0.0	1368	WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_001242417	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	ENST00000342702.3	37	CCDS9969.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.12|17.12	3.308261|3.308261	0.60305|0.60305	.|.	.|.	ENSG00000140153|ENSG00000140153	ENST00000335263;ENST00000299135;ENST00000424963;ENST00000342702;ENST00000556807;ENST00000499851;ENST00000454394;ENST00000401892;ENST00000545563|ENST00000556511	D;D;D;D;D;D;D|.	0.92199|.	-2.99;-2.99;-2.99;-2.99;-2.99;-2.99;-2.99|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78622|0.78622	0.4312|0.4312	M|M	0.82716|0.82716	2.605|2.605	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;0.992;1.0|.	D;D;D;D;D;D;D|.	0.97110|.	0.999;0.999;0.998;1.0;1.0;0.982;0.999|.	T|T	0.80358|0.80358	-0.1416|-0.1416	10|5	0.72032|.	D|.	0.01|.	.|.	16.2159|16.2159	0.82217|0.82217	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	545;526;453;514;453;390;514|.	E7EUY8;Q5JPH5;G3V2F8;Q8TBZ3-2;F8W9S4;B3KR43;Q8TBZ3|.	.;.;.;.;.;.;WDR20_HUMAN|.	R|A	514;453;390;514;453;257;545;444;341|444	ENSP00000335434:C514R;ENSP00000395793:C390R;ENSP00000341037:C514R;ENSP00000450636:C453R;ENSP00000443641:C257R;ENSP00000406084:C545R;ENSP00000437927:C341R|.	ENSP00000299135:C453R|.	C|V	+|+	1|2	0|0	WDR20|WDR20	101745800|101745800	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.691000|7.691000	0.84191|0.84191	2.243000|2.243000	0.73865|0.73865	0.533000|0.533000	0.62120|0.62120	TGT|GTG	.		0.418	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
WDR90	197335	hgsc.bcm.edu;bcgsc.ca	37	16	699822	699822	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr16:699822T>C	ENST00000293879.4	+	2	70	c.70T>C	c.(70-72)Tcc>Ccc	p.S24P	AL022341.3_ENST00000455294.1_RNA|WDR90_ENST00000549091.1_Missense_Mutation_p.S24P			Q96KV7	WDR90_HUMAN	WD repeat domain 90	24										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GTGGAAGCGCTCCGCCAAGCA	0.751																																					p.S24P		.											.	WDR90	92	0			c.T70C						.						5.0	7.0	6.0					16																	699822		1828	3983	5811	SO:0001583	missense	197335	exon2			AAGCGCTCCGCCA	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.70T>C	16.37:g.699822T>C	ENSP00000293879:p.Ser24Pro	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	4.0	NM_145294	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	ENST00000293879.4	37	CCDS42092.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685818	0.47991	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.44083	0.93;0.93	4.33	4.33	0.51752	.	0.000000	0.28052	U	0.016793	T	0.60235	0.2253	M	0.65975	2.015	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.995	D;D;P	0.71184	0.952;0.972;0.885	T	0.64093	-0.6488	10	0.66056	D	0.02	.	12.6356	0.56681	0.0:0.0:0.0:1.0	.	24;24;24	Q96KV7;C9JMK1;Q96KV7-3	WDR90_HUMAN;.;.	P	24	ENSP00000448122:S24P;ENSP00000293879:S24P	ENSP00000293879:S24P	S	+	1	0	WDR90	639823	0.999000	0.42202	0.864000	0.33941	0.151000	0.21798	3.170000	0.50816	1.734000	0.51633	0.496000	0.49642	TCC	.		0.751	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404335.1	NM_145294	
WEE1	7465	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	9597791	9597791	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:9597791A>G	ENST00000450114.2	+	3	1050	c.797A>G	c.(796-798)gAc>gGc	p.D266G	snoU13_ENST00000458785.1_RNA|WEE1_ENST00000299613.6_Missense_Mutation_p.D52G	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	266					blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		tgtggtgaagacatggaagcc	0.294																																					p.D266G		.											.	WEE1	1404	0			c.A797G						.						59.0	70.0	66.0					11																	9597791		1327	2308	3635	SO:0001583	missense	7465	exon3			GTGAAGACATGGA	X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.797A>G	11.37:g.9597791A>G	ENSP00000402084:p.Asp266Gly	Somatic	55.0	1.0		WXS	Illumina HiSeq	Phase_I	49.0	5.0	NM_003390	B3KVE1|D3DQV0	Missense_Mutation	SNP	ENST00000450114.2	37	CCDS7800.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.133014	0.37630	.	.	ENSG00000166483	ENST00000450114;ENST00000299613	T;T	0.23348	1.91;1.91	4.8	4.8	0.61643	.	0.095353	0.64402	D	0.000001	T	0.31606	0.0802	M	0.76328	2.33	0.80722	D	1	B;B	0.22683	0.073;0.055	B;B	0.22601	0.04;0.033	T	0.09574	-1.0668	10	0.37606	T	0.19	-0.9648	14.3202	0.66482	1.0:0.0:0.0:0.0	.	74;266	Q6MZL0;P30291	.;WEE1_HUMAN	G	266;52	ENSP00000402084:D266G;ENSP00000299613:D52G	ENSP00000299613:D52G	D	+	2	0	WEE1	9554367	1.000000	0.71417	1.000000	0.80357	0.535000	0.34838	4.851000	0.62896	1.771000	0.52183	0.459000	0.35465	GAC	.		0.294	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386757.1	NM_003390	
WNT7A	7476	hgsc.bcm.edu;bcgsc.ca	37	3	13896149	13896149	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:13896149A>G	ENST00000285018.4	-	3	754	c.450T>C	c.(448-450)ggT>ggC	p.G150G		NM_004625.3	NP_004616.2	O00755	WNT7A_HUMAN	wingless-type MMTV integration site family, member 7A	150					asymmetric protein localization (GO:0008105)|canonical Wnt signaling pathway (GO:0060070)|cartilage condensation (GO:0001502)|cell fate commitment (GO:0045165)|cell proliferation in forebrain (GO:0021846)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system vasculogenesis (GO:0022009)|cerebellar granule cell differentiation (GO:0021707)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment of cell polarity (GO:0030010)|lens fiber cell development (GO:0070307)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neurogenesis (GO:0050768)|neuron differentiation (GO:0030182)|neurotransmitter secretion (GO:0007269)|non-canonical Wnt signaling pathway (GO:0035567)|oviduct development (GO:0060066)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of axon diameter (GO:0031133)|response to estradiol (GO:0032355)|sex differentiation (GO:0007548)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|stem cell development (GO:0048864)|synapse organization (GO:0050808)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway involved in wound healing, spreading of epidermal cells (GO:0035659)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	24						CAGAGCAGCCACCCCACTTCC	0.607																																					p.G150G		.											.	WNT7A	948	0			c.T450C						.						115.0	109.0	111.0					3																	13896149		2203	4300	6503	SO:0001819	synonymous_variant	7476	exon3			GCAGCCACCCCAC	D83175	CCDS2616.1	3p25	2008-07-18			ENSG00000154764	ENSG00000154764		"""Wingless-type MMTV integration sites"""	12786	protein-coding gene	gene with protein product	"""proto-oncogene Wnt7a protein"""	601570				8893824, 9161407	Standard	NM_004625		Approved		uc003bye.1	O00755	OTTHUMG00000129803	ENST00000285018.4:c.450T>C	3.37:g.13896149A>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	5.0	NM_004625	Q96H90|Q9Y560	Silent	SNP	ENST00000285018.4	37	CCDS2616.1																																																																																			.		0.607	WNT7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252031.2	NM_004625	
YTHDC2	64848	hgsc.bcm.edu;bcgsc.ca	37	5	112874844	112874844	+	Silent	SNP	A	A	G			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr5:112874844A>G	ENST00000161863.4	+	8	1389	c.1176A>G	c.(1174-1176)aaA>aaG	p.K392K	YTHDC2_ENST00000515883.1_Silent_p.K392K	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	392					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		ATACAAACAAAGAAATGTTAA	0.229																																					p.K392K		.											.	YTHDC2	92	0			c.A1176G						.						13.0	15.0	14.0					5																	112874844		2033	4170	6203	SO:0001819	synonymous_variant	64848	exon8			AAACAAAGAAATG	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.1176A>G	5.37:g.112874844A>G		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_022828	B2RP66	Silent	SNP	ENST00000161863.4	37	CCDS4113.1																																																																																			.		0.229	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
YY2	404281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	21875262	21875262	+	Silent	SNP	T	T	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chrX:21875262T>A	ENST00000429584.2	+	1	1158	c.660T>A	c.(658-660)ccT>ccA	p.P220P	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Intron|MBTPS2_ENST00000379484.5_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						AGAAACTTCCTCCTGGGGGGT	0.488																																					p.P220P		.											.	YY2	193	0			c.T660A						.						130.0	144.0	139.0					X																	21875262		2203	4300	6503	SO:0001819	synonymous_variant	404281	exon1			ACTTCCTCCTGGG	AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.660T>A	X.37:g.21875262T>A		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	46.0	NM_206923	B2RP10|Q6Q1S4	Silent	SNP	ENST00000429584.2	37	CCDS14202.1																																																																																			.		0.488	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923	
ZDBF2	57683	hgsc.bcm.edu;bcgsc.ca	37	2	207174473	207174473	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr2:207174473T>C	ENST00000374423.3	+	5	5607	c.5221T>C	c.(5221-5223)Tgt>Cgt	p.C1741R		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1741							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGAAGTGAGCTGTGAACCGGA	0.433																																					p.C1741R		.											.	ZDBF2	3	0			c.T5221C						.						71.0	71.0	71.0					2																	207174473		1867	4099	5966	SO:0001583	missense	57683	exon5			GTGAGCTGTGAAC	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5221T>C	2.37:g.207174473T>C	ENSP00000363545:p.Cys1741Arg	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_020923	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	ENST00000374423.3	37	CCDS46501.1	.	.	.	.	.	.	.	.	.	.	T	5.271	0.235353	0.10023	.	.	ENSG00000204186	ENST00000374423	T	0.49720	0.77	4.11	-2.77	0.05877	.	.	.	.	.	T	0.22704	0.0548	N	0.16478	0.41	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.15492	-1.0435	9	0.29301	T	0.29	.	0.8665	0.01205	0.1567:0.1963:0.322:0.325	.	1741	Q9HCK1	ZDBF2_HUMAN	R	1741	ENSP00000363545:C1741R	ENSP00000363545:C1741R	C	+	1	0	ZDBF2	206882718	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.076000	0.14712	-0.486000	0.06744	-0.280000	0.10049	TGT	.		0.433	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
ZIC1	7545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	147128660	147128660	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:147128660C>A	ENST00000282928.4	+	1	1490	c.761C>A	c.(760-762)aCg>aAg	p.T254K		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	254					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						GAGCTAGTTACGCACGTCACC	0.557																																					p.T254K		.											.	ZIC1	91	0			c.C761A						.						103.0	95.0	98.0					3																	147128660		2203	4300	6503	SO:0001583	missense	7545	exon1			TAGTTACGCACGT	D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.761C>A	3.37:g.147128660C>A	ENSP00000282928:p.Thr254Lys	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	69.0	NM_003412	Q2M3N1	Missense_Mutation	SNP	ENST00000282928.4	37	CCDS3136.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253887	0.80135	.	.	ENSG00000152977	ENST00000282928	D	0.91124	-2.79	4.01	4.01	0.46588	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	D	0.95076	0.8405	M	0.81179	2.53	0.80722	D	1	D	0.65815	0.995	D	0.71184	0.972	D	0.95992	0.8986	10	0.87932	D	0	.	16.467	0.84081	0.0:1.0:0.0:0.0	.	254	Q15915	ZIC1_HUMAN	K	254	ENSP00000282928:T254K	ENSP00000282928:T254K	T	+	2	0	ZIC1	148611350	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.870000	0.69620	1.930000	0.55929	0.561000	0.74099	ACG	.		0.557	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355497.1	NM_003412	
ZNF639	51193	broad.mit.edu;bcgsc.ca	37	3	179051081	179051081	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr3:179051081G>A	ENST00000326361.3	+	7	774	c.329G>A	c.(328-330)tGt>tAt	p.C110Y	ZNF639_ENST00000496856.1_Missense_Mutation_p.C110Y|ZNF639_ENST00000484866.1_Missense_Mutation_p.C110Y|ZNF639_ENST00000466663.1_3'UTR	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	110					negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			ATTGTAATTTGTGATGAAGAG	0.338																																					p.C110Y		.											.	ZNF639	90	0			c.G329A						.						40.0	40.0	40.0					3																	179051081		2203	4300	6503	SO:0001583	missense	51193	exon7			TAATTTGTGATGA	BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.329G>A	3.37:g.179051081G>A	ENSP00000325634:p.Cys110Tyr	Somatic	104.0	2.0		WXS	Illumina HiSeq	Phase_I	124.0	5.0	NM_016331	A9X3Z9|D3DNR3	Missense_Mutation	SNP	ENST00000326361.3	37	CCDS3227.1	.	.	.	.	.	.	.	.	.	.	G	9.285	1.049254	0.19827	.	.	ENSG00000121864	ENST00000496856;ENST00000491818;ENST00000481587;ENST00000326361;ENST00000466264;ENST00000484866;ENST00000494234	T;T;T;T	0.03717	3.83;3.83;4.46;3.83	5.87	4.97	0.65823	.	0.389943	0.28098	N	0.016602	T	0.03651	0.0104	L	0.32530	0.975	0.32077	N	0.593676	B	0.06786	0.001	B	0.04013	0.001	T	0.04693	-1.0933	10	0.87932	D	0	.	7.257	0.26181	0.0809:0.0:0.6318:0.2873	.	110	Q9UID6	ZN639_HUMAN	Y	110	ENSP00000417740:C110Y;ENSP00000325634:C110Y;ENSP00000419650:C110Y;ENSP00000418766:C110Y	ENSP00000325634:C110Y	C	+	2	0	ZNF639	180533775	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.096000	0.41738	1.538000	0.49270	0.655000	0.94253	TGT	.		0.338	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348855.1	NM_016331	
OR5L1	219437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	55579735	55579736	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-BC-A3KF-01A-11D-A20W-10	TCGA-BC-A3KF-10A-01D-A20W-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5df8ad51-b7d4-46a0-a522-f6c9a38067ff	90e68f39-b72a-45ea-85ff-92e633f5c29c	g.chr11:55579735_55579736GG>TT	ENST00000333973.2	+	1	882_883	c.793_794GG>TT	c.(793-795)GGc>TTc	p.G265F		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				GCCCAGTTCAGGCAATAGTGGA	0.485																																					p.G265F		.											.	.	.	0			.						.																																			SO:0001583	missense	219437	.			AGTTCAGGCAATA	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	Exception_encountered	11.37:g.55579735_55579736delinsTT	ENSP00000335529:p.Gly265Phe	Somatic	59.0	1.0		WXS	Illumina HiSeq	Phase_I	82.0	34.0	.	B2RNK6|Q6IFD0	Missense_Mutation	DNP	ENST00000333973.2	37	CCDS31509.1																																																																																			.		0.485	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
