#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A2M	2	ucsc.edu;bcgsc.ca	37	12	9241795	9241795	+	Splice_Site	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:9241795C>A	ENST00000318602.7	-	22	3078		c.e22+1			NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin						blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	TTGACTCTTACCTGATGGACA	0.333																																					.		.											.	A2M	515	0			c.2770+1G>T						.						109.0	100.0	103.0					12																	9241795		1829	4075	5904	SO:0001630	splice_region_variant	2	exon23			CTCTTACCTGATG	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2770+1G>T	12.37:g.9241795C>A		Somatic	121.0	1.0		WXS	Illumina HiSeq	.	117.0	47.0	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Splice_Site	SNP	ENST00000318602.7	37	CCDS44827.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.249169	0.80024	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.039	0.89313	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	A2M	9133062	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.544000	0.73878	2.610000	0.88304	0.650000	0.86243	.	.		0.333	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	Intron
C15orf43	145645	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	45250636	45250636	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:45250636C>T	ENST00000340827.3	+	3	229	c.212C>T	c.(211-213)gCg>gTg	p.A71V		NM_152448.2	NP_689661.1	Q8NHR7	CO043_HUMAN	chromosome 15 open reading frame 43	71										NS(1)|breast(2)|large_intestine(1)|lung(2)|skin(2)	8		all_cancers(109;3.68e-08)|all_epithelial(112;1.05e-06)|Lung NSC(122;1.42e-05)|all_lung(180;0.000112)|Melanoma(134;0.0192)		all cancers(107;7.64e-17)|GBM - Glioblastoma multiforme(94;2.03e-06)		TATCTCTCTGCGGTAGCTAAT	0.383																																					p.A71V		.											.	C15orf43	90	0			c.C212T						.						95.0	95.0	95.0					15																	45250636		2196	4298	6494	SO:0001583	missense	145645	exon3			TCTCTGCGGTAGC	BC029537	CCDS10115.1	15q21.1	2006-02-03			ENSG00000167014	ENSG00000167014			28520	protein-coding gene	gene with protein product							Standard	NM_152448		Approved	MGC33951	uc001zuk.4	Q8NHR7	OTTHUMG00000131264	ENST00000340827.3:c.212C>T	15.37:g.45250636C>T	ENSP00000340644:p.Ala71Val	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	72.0	NM_152448		Missense_Mutation	SNP	ENST00000340827.3	37	CCDS10115.1	.	.	.	.	.	.	.	.	.	.	c	19.28	3.797020	0.70567	.	.	ENSG00000167014	ENST00000340827	T	0.48522	0.81	4.45	3.53	0.40419	.	0.000000	0.64402	D	0.000014	T	0.30039	0.0752	L	0.29908	0.895	0.34047	D	0.655732	D	0.56287	0.975	B	0.37422	0.249	T	0.50355	-0.8838	10	0.72032	D	0.01	.	8.2804	0.31898	0.0:0.8909:0.0:0.1091	.	71	Q8NHR7	CO043_HUMAN	V	71	ENSP00000340644:A71V	ENSP00000340644:A71V	A	+	2	0	C15orf43	43037928	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	2.048000	0.41278	1.231000	0.43661	0.643000	0.83706	GCG	.		0.383	C15orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254032.1	NM_152448	
AP3B2	8120	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	83331627	83331627	+	Silent	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr15:83331627C>A	ENST00000261722.3	-	22	2802	c.2595G>T	c.(2593-2595)cgG>cgT	p.R865R	RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_Silent_p.R833R|AP3B2_ENST00000535359.1_Silent_p.R884R	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	865					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CGCCAGCTACCCGGTGCAGCA	0.602																																					p.R865R		.											.	AP3B2	94	0			c.G2595T						.						26.0	32.0	30.0					15																	83331627		2038	4200	6238	SO:0001819	synonymous_variant	8120	exon22			AGCTACCCGGTGC	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2595G>T	15.37:g.83331627C>A		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	43.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	37	CCDS45331.1																																																																																			.		0.602	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
CACNA1B	774	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	140878654	140878654	+	Missense_Mutation	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:140878654T>A	ENST00000371372.1	+	13	1866	c.1721T>A	c.(1720-1722)aTc>aAc	p.I574N	CACNA1B_ENST00000277551.2_Missense_Mutation_p.I574N|CACNA1B_ENST00000371355.4_Missense_Mutation_p.I575N|CACNA1B_ENST00000371363.1_Missense_Mutation_p.I574N|CACNA1B_ENST00000371357.1_Missense_Mutation_p.I575N|CACNA1B_ENST00000277549.5_5'UTR	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	574					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TCCTTTGGGATCAGTGTGCTG	0.627																																					p.I574N		.											.	CACNA1B	138	0			c.T1721A						.						68.0	83.0	78.0					9																	140878654		2093	4218	6311	SO:0001583	missense	774	exon13			TTGGGATCAGTGT	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1721T>A	9.37:g.140878654T>A	ENSP00000360423:p.Ile574Asn	Somatic	283.0	1.0		WXS	Illumina HiSeq	Phase_I	234.0	102.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.518029	0.64634	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.98792	-5.14;-5.14;-5.14;-5.14;-5.14	4.5	4.5	0.54988	.	0.101398	0.64402	D	0.000002	D	0.99269	0.9745	M	0.92077	3.27	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98994	1.0809	10	0.87932	D	0	.	14.1601	0.65441	0.0:0.0:0.0:1.0	.	574;574	B1AQK4;B1AQK6	.;.	N	574;574;574;575;575	ENSP00000360423:I574N;ENSP00000277551:I574N;ENSP00000360414:I574N;ENSP00000360408:I575N;ENSP00000360406:I575N	ENSP00000277551:I574N	I	+	2	0	CACNA1B	139998475	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.793000	0.85851	1.788000	0.52465	0.454000	0.30748	ATC	.		0.627	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CADPS	8618	ucsc.edu;bcgsc.ca;mdanderson.org	37	3	62502268	62502268	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:62502268G>A	ENST00000383710.4	-	15	2793	c.2444C>T	c.(2443-2445)tCa>tTa	p.S815L	CADPS_ENST00000283269.9_Missense_Mutation_p.S815L|CADPS_ENST00000357948.3_Missense_Mutation_p.S798L	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	815	Interaction with DRD2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TTCCAAGAGTGAGAGAGTAGC	0.318																																					p.S815L		.											.	CADPS	281	0			c.C2444T						.						79.0	81.0	81.0					3																	62502268		2203	4300	6503	SO:0001583	missense	8618	exon15			AAGAGTGAGAGAG	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2444C>T	3.37:g.62502268G>A	ENSP00000373215:p.Ser815Leu	Somatic	271.0	0.0		WXS	Illumina HiSeq	.	266.0	91.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.1|26.1	4.707510|4.707510	0.89018|0.89018	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000468271|ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269	.|T;T;T	.|0.33654	.|1.4;1.4;1.4	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62368|0.62368	0.2422|0.2422	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.71674	.|0.998;0.992;0.651;0.975	.|D;D;B;P	.|0.71656	.|0.956;0.974;0.165;0.837	T|T	0.62647|0.62647	-0.6810|-0.6810	5|10	.|0.87932	.|D	.|0	.|.	20.3931|20.3931	0.98965|0.98965	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|798;815;815;815	.|Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4	.|.;.;CAPS1_HUMAN;.	Y|L	213|815;815;798;815	.|ENSP00000373215:S815L;ENSP00000350632:S798L;ENSP00000283269:S815L	.|ENSP00000283269:S815L	H|S	-|-	1|2	0|0	CADPS|CADPS	62477308|62477308	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.869000|9.869000	0.99810|0.99810	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	CAC|TCA	.		0.318	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
CAPN12	147968	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	39226821	39226821	+	Silent	SNP	C	C	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:39226821C>G	ENST00000328867.4	-	12	1820	c.1512G>C	c.(1510-1512)ccG>ccC	p.P504P	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Silent_p.P355P	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	504	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GGGCGGTGCTCGGCACCACCA	0.746																																					p.P504P		.											.	CAPN12	91	0			c.G1512C						.						5.0	6.0	6.0					19																	39226821		1557	2830	4387	SO:0001819	synonymous_variant	147968	exon12			GGTGCTCGGCACC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1512G>C	19.37:g.39226821C>G		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	15.0	NM_144691		Silent	SNP	ENST00000328867.4	37	CCDS12519.1																																																																																			.		0.746	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462151.1		
CEL	1056	hgsc.bcm.edu;bcgsc.ca	37	9	135944115	135944115	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:135944115G>T	ENST00000372080.4	+	8	977	c.961G>T	c.(961-963)Gct>Tct	p.A321S	CEL_ENST00000351304.7_Missense_Mutation_p.A318S	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	318					cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CTTCATCCCCGCTGACCCGAT	0.577																																					p.A321S		.											.	CEL	91	0			c.G961T						.						28.0	33.0	31.0					9																	135944115		1894	4088	5982	SO:0001583	missense	1056	exon8			ATCCCCGCTGACC	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.961G>T	9.37:g.135944115G>T	ENSP00000361151:p.Ala321Ser	Somatic	834.0	1.0		WXS	Illumina HiSeq	Phase_I	650.0	122.0	NM_001807	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	37	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	G	12.65	2.000645	0.35320	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.67171	-0.25;-0.25	5.46	2.58	0.30949	Carboxylesterase, type B (1);	0.095855	0.64402	D	0.000001	T	0.46600	0.1401	N	0.13272	0.32	0.09310	N	1	B	0.14438	0.01	B	0.20577	0.03	T	0.42413	-0.9453	10	0.87932	D	0	.	7.6018	0.28079	0.1456:0.0:0.7211:0.1332	.	318	P19835	CEL_HUMAN	S	321;318;321	ENSP00000361151:A321S;ENSP00000342217:A318S	ENSP00000304021:A321S	A	+	1	0	CEL	134933936	1.000000	0.71417	0.000000	0.03702	0.503000	0.33858	7.548000	0.82154	0.262000	0.21774	0.561000	0.74099	GCT	.		0.577	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1		
CKAP5	9793	ucsc.edu;bcgsc.ca	37	11	46829629	46829629	+	Silent	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:46829629G>A	ENST00000529230.1	-	8	976	c.930C>T	c.(928-930)ccC>ccT	p.P310P	CKAP5_ENST00000415402.1_Silent_p.P310P|CKAP5_ENST00000354558.3_Silent_p.P310P|CKAP5_ENST00000312055.5_Silent_p.P310P			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	310					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						CTTCCAGTTTGGGGTTTTTTA	0.393																																					p.P310P	Ovarian(4;85 273 2202 4844 13323)	.											.	CKAP5	92	0			c.C930T						.						247.0	258.0	254.0					11																	46829629		2201	4299	6500	SO:0001819	synonymous_variant	9793	exon8			CAGTTTGGGGTTT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.930C>T	11.37:g.46829629G>A		Somatic	199.0	1.0		WXS	Illumina HiSeq	.	225.0	97.0	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	37	CCDS31477.1																																																																																			.		0.393	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
COL6A6	131873	ucsc.edu;bcgsc.ca	37	3	130282159	130282159	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:130282159C>T	ENST00000358511.6	+	2	343	c.312C>T	c.(310-312)tcC>tcT	p.S104S	COL6A6_ENST00000453409.2_Silent_p.S104S	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	104	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TTGGCGGGTCCCTGCAGATAG	0.498																																					p.S104S		.											.	COL6A6	76	0			c.C312T						.						37.0	37.0	37.0					3																	130282159		1846	4078	5924	SO:0001819	synonymous_variant	131873	exon2			CGGGTCCCTGCAG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.312C>T	3.37:g.130282159C>T		Somatic	198.0	1.0		WXS	Illumina HiSeq	.	172.0	82.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	ENST00000358511.6	37	CCDS46911.1																																																																																			.		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CPT1A	1374	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68530124	68530124	+	Missense_Mutation	SNP	C	C	T	rs573452454		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:68530124C>T	ENST00000265641.5	-	15	2000	c.1846G>A	c.(1846-1848)Gtg>Atg	p.V616M	CPT1A_ENST00000540367.1_Missense_Mutation_p.V616M|CPT1A_ENST00000537756.2_5'UTR|CPT1A_ENST00000539743.1_Missense_Mutation_p.V616M|CPT1A_ENST00000376618.2_Missense_Mutation_p.V616M	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	616					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	ATGGCCCGCACGAAGTCGCAT	0.607													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18473	0.0		0.0	False		,,,				2504	0.0				p.V616M		.											.	CPT1A	149	0			c.G1846A						.						73.0	65.0	68.0					11																	68530124		2200	4294	6494	SO:0001583	missense	1374	exon15			CCCGCACGAAGTC	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1846G>A	11.37:g.68530124C>T	ENSP00000265641:p.Val616Met	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	34.0	NM_001876	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572108	0.86542	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78	5.57	5.57	0.84162	.	0.133714	0.50627	D	0.000102	D	0.94023	0.8085	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	0.994;1.0	D;D	0.68943	0.915;0.961	D	0.95158	0.8279	10	0.87932	D	0	.	19.912	0.97027	0.0:1.0:0.0:0.0	.	616;616	P50416;P50416-2	CPT1A_HUMAN;.	M	616	ENSP00000439084:V616M;ENSP00000365803:V616M;ENSP00000265641:V616M;ENSP00000446108:V616M	ENSP00000265641:V616M	V	-	1	0	CPT1A	68286700	1.000000	0.71417	0.967000	0.41034	0.444000	0.32077	7.354000	0.79424	2.783000	0.95769	0.655000	0.94253	GTG	.		0.607	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
CSMD1	64478	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	3216824	3216824	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:3216824C>A	ENST00000520002.1	-	22	3712	c.3157G>T	c.(3157-3159)Gcc>Tcc	p.A1053S	CSMD1_ENST00000602723.1_Missense_Mutation_p.A1053S|CSMD1_ENST00000542608.1_Missense_Mutation_p.A1052S|CSMD1_ENST00000602557.1_Missense_Mutation_p.A1053S|CSMD1_ENST00000539096.1_Missense_Mutation_p.A1052S|CSMD1_ENST00000400186.3_Missense_Mutation_p.A1053S|CSMD1_ENST00000537824.1_Missense_Mutation_p.A1052S			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1053	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CGGCTGAAGGCAGGGACTCCA	0.458																																					p.A1052S		.											.	CSMD1	86	0			c.G3154T						.						54.0	60.0	58.0					8																	3216824		2195	4299	6494	SO:0001583	missense	64478	exon21			TGAAGGCAGGGAC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.3157G>T	8.37:g.3216824C>A	ENSP00000430733:p.Ala1053Ser	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	71.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	15.00|15.00	2.704479|2.704479	0.48412|0.48412	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096|ENST00000335551	T;T;T;T;T|.	0.62788|.	0.0;0.0;0.0;0.0;0.0|.	5.24|5.24	5.24|5.24	0.73138|0.73138	Complement control module (2);Sushi/SCR/CCP (3);|.	0.000000|.	0.64402|.	U|.	0.000001|.	T|T	0.55465|0.55465	0.1922|0.1922	N|N	0.25245|0.25245	0.725|0.725	0.47407|0.47407	D|D	0.999414|0.999414	P;B;P|.	0.40681|.	0.727;0.132;0.564|.	B;B;P|.	0.45753|.	0.214;0.223;0.492|.	T|T	0.51100|0.51100	-0.8748|-0.8748	10|5	0.15952|.	T|.	0.53|.	.|.	18.8469|18.8469	0.92210|0.92210	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1053;1053;1053|.	E5RIG2;Q96PZ7;Q96PZ7-4|.	.;CSMD1_HUMAN;.|.	S|F	1053;1053;915;1052;1052;1052|532	ENSP00000383047:A1053S;ENSP00000430733:A1053S;ENSP00000441462:A1052S;ENSP00000446243:A1052S;ENSP00000441675:A1052S|.	ENSP00000320445:A915S|.	A|C	-|-	1|2	0|0	CSMD1|CSMD1	3204231|3204231	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	3.085000|3.085000	0.50151|0.50151	2.432000|2.432000	0.82394|0.82394	0.550000|0.550000	0.68814|0.68814	GCC|TGC	.		0.458	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ACKR3	57007	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	237489341	237489341	+	Missense_Mutation	SNP	A	A	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:237489341A>T	ENST00000272928.3	+	2	543	c.233A>T	c.(232-234)gAc>gTc	p.D78V		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	78					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)										ACAGGCTATGACACGCACTGC	0.542																																					p.D78V		.											.	CXCR7	1145	0			c.A233T						.						179.0	143.0	155.0					2																	237489341		2203	4300	6503	SO:0001583	missense	57007	exon2			GCTATGACACGCA	BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.233A>T	2.37:g.237489341A>T	ENSP00000272928:p.Asp78Val	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	79.0	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	37	CCDS2516.1	.	.	.	.	.	.	.	.	.	.	A	18.77	3.695508	0.68386	.	.	ENSG00000144476	ENST00000447924;ENST00000272928	T;T	0.34072	1.38;1.38	5.57	5.57	0.84162	GPCR, rhodopsin-like superfamily (1);	0.051051	0.85682	D	0.000000	T	0.12347	0.0300	N	0.00060	-2.335	0.80722	D	1	P	0.47484	0.896	P	0.46049	0.502	T	0.58549	-0.7617	10	0.54805	T	0.06	.	15.7428	0.77914	1.0:0.0:0.0:0.0	.	78	P25106	CXCR7_HUMAN	V	78	ENSP00000405945:D78V;ENSP00000272928:D78V	ENSP00000272928:D78V	D	+	2	0	CXCR7	237154080	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.283000	0.78640	2.117000	0.64856	0.460000	0.39030	GAC	.		0.542	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
DCAF12L2	340578	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	125299293	125299293	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:125299293G>T	ENST00000360028.2	-	1	641	c.615C>A	c.(613-615)gaC>gaA	p.D205E	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.D205E			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	205										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CAGCTACGGTGTCACTCAGCC	0.652																																					p.D205E		.											.	DCAF12L2	113	0			c.C615A						.						47.0	49.0	48.0					X																	125299293		2203	4299	6502	SO:0001583	missense	340578	exon1			TACGGTGTCACTC	AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.615C>A	X.37:g.125299293G>T	ENSP00000353128:p.Asp205Glu	Somatic	267.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	44.0	NM_001013628	B2RN42	Missense_Mutation	SNP	ENST00000360028.2	37	CCDS43991.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102377	0.37145	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.62788	0.0;0.0	3.87	2.05	0.26809	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.34959	N	0.003555	T	0.73737	0.3625	M	0.76170	2.325	0.35008	D	0.756662	D	0.89917	1.0	D	0.87578	0.998	T	0.77233	-0.2663	10	0.62326	D	0.03	.	7.1017	0.25340	0.244:0.0:0.756:0.0	.	205	Q5VW00	DC122_HUMAN	E	205	ENSP00000441489:D205E;ENSP00000353128:D205E	ENSP00000353128:D205E	D	-	3	2	DCAF12L2	125126974	1.000000	0.71417	0.908000	0.35775	0.044000	0.14063	1.602000	0.36783	0.409000	0.25649	0.544000	0.68410	GAC	.		0.652	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058181.1	NM_001013628	
DHX29	54505	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	54563641	54563641	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:54563641C>T	ENST00000251636.5	-	22	3452	c.3304G>A	c.(3304-3306)Gct>Act	p.A1102T	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	1102						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				ATAACTGCAGCTAGTGTTGCC	0.353																																					p.A1102T		.											.	DHX29	229	0			c.G3304A						.						103.0	88.0	93.0					5																	54563641		2203	4300	6503	SO:0001583	missense	54505	exon22			CTGCAGCTAGTGT	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.3304G>A	5.37:g.54563641C>T	ENSP00000251636:p.Ala1102Thr	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	32.0	NM_019030	O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	C	32	5.125601	0.94429	.	.	ENSG00000067248	ENST00000251636	T	0.02709	4.19	5.55	5.55	0.83447	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	T	0.17534	0.0421	M	0.81614	2.55	0.58432	D	0.999999	D	0.60575	0.988	D	0.68192	0.956	T	0.00074	-1.2123	10	0.87932	D	0	.	19.5112	0.95142	0.0:1.0:0.0:0.0	.	1102	Q7Z478	DHX29_HUMAN	T	1102	ENSP00000251636:A1102T	ENSP00000251636:A1102T	A	-	1	0	DHX29	54599398	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	7.456000	0.80751	2.626000	0.88956	0.557000	0.71058	GCT	.		0.353	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1	NM_019030	
DNAJC5G	285126	ucsc.edu;bcgsc.ca	37	2	27500670	27500670	+	Silent	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:27500670G>A	ENST00000296097.3	+	4	580	c.162G>A	c.(160-162)agG>agA	p.R54R	DNAJC5G_ENST00000404433.1_Splice_Site_p.R38R|DNAJC5G_ENST00000406962.1_Intron|SLC30A3_ENST00000447008.2_5'Flank|DNAJC5G_ENST00000402462.1_Silent_p.R54R	NM_173650.1	NP_775921.1	Q8N7S2	DNJ5G_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5 gamma	54	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.					membrane (GO:0016020)				cervix(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCTGGGTAGGAAACTGGCCT	0.493																																					p.R54R		.											.	DNAJC5G	226	0			c.G162A						.						106.0	102.0	103.0					2																	27500670		2203	4300	6503	SO:0001819	synonymous_variant	285126	exon4			GGGTAGGAAACTG	AF368277	CCDS1744.1	2p23	2011-09-02			ENSG00000163793	ENSG00000163793		"""Heat shock proteins / DNAJ (HSP40)"""	24844	protein-coding gene	gene with protein product		613946					Standard	NM_173650		Approved	FLJ40417, CSP-gamma	uc002rjl.1	Q8N7S2	OTTHUMG00000097079	ENST00000296097.3:c.162G>A	2.37:g.27500670G>A		Somatic	171.0	1.0		WXS	Illumina HiSeq	.	197.0	87.0	NM_173650	B4DY29|Q53SY5|Q8IYQ4|Q96RJ8	Silent	SNP	ENST00000296097.3	37	CCDS1744.1																																																																																			.		0.493	DNAJC5G-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214200.1	NM_173650	
DST	667	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56497659	56497659	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:56497659T>C	ENST00000361203.3	-	24	3172	c.3165A>G	c.(3163-3165)gcA>gcG	p.A1055A	DST_ENST00000312431.6_Silent_p.A1055A|DST_ENST00000370769.4_Silent_p.A1055A|DST_ENST00000518935.1_Silent_p.A729A|DST_ENST00000421834.2_Silent_p.A1055A|DST_ENST00000370765.6_Silent_p.A729A|DST_ENST00000446842.2_Silent_p.A729A|DST_ENST00000370788.2_Silent_p.A1055A|DST_ENST00000370754.5_Silent_p.A1233A|DST_ENST00000244364.6_Silent_p.A729A			Q03001	DYST_HUMAN	dystonin	1055					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TACCTCTTTCTGCAGATTTAA	0.378																																					p.A729A		.											.	DST	523	0			c.A2187G						.						93.0	95.0	94.0					6																	56497659		2203	4300	6503	SO:0001819	synonymous_variant	667	exon14			TCTTTCTGCAGAT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3165A>G	6.37:g.56497659T>C		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	46.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																				.		0.378	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
EPOR	2057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11491862	11491862	+	Silent	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:11491862G>T	ENST00000222139.6	-	5	713	c.609C>A	c.(607-609)acC>acA	p.T203T	EPOR_ENST00000592375.2_Silent_p.T203T	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	203	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	GCACACACTCGGTGCGGCCCT	0.677											OREG0025255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T203T		.											.	EPOR	523	0			c.C609A						.						3.0	4.0	4.0					19																	11491862		1948	3854	5802	SO:0001819	synonymous_variant	2057	exon5			ACACTCGGTGCGG	M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.609C>A	19.37:g.11491862G>T		Somatic	64.0	0.0	672	WXS	Illumina HiSeq	Phase_I	25.0	22.0	NM_000121	B2RCG4|Q15443|Q2M205	Silent	SNP	ENST00000222139.6	37	CCDS12260.1																																																																																			.		0.677	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458791.1		
FBLN2	2199	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	3	13612069	13612069	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:13612069G>C	ENST00000295760.7	+	2	283	c.214G>C	c.(214-216)Gac>Cac	p.D72H	FBLN2_ENST00000535798.1_Missense_Mutation_p.D98H|FBLN2_ENST00000492059.1_Missense_Mutation_p.D72H|FBLN2_ENST00000404922.3_Missense_Mutation_p.D72H	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	72	N.|Subdomain NA (Cys-rich).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCAGTACTATGACTGCCTACA	0.677																																					p.D72H		.											.	FBLN2	91	0			c.G214C						.						8.0	12.0	11.0					3																	13612069		2094	4210	6304	SO:0001583	missense	2199	exon2			TACTATGACTGCC	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.214G>C	3.37:g.13612069G>C	ENSP00000295760:p.Asp72His	Somatic	227.0	0.0		WXS	Illumina HiSeq	Phase_I	412.0	255.0	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Missense_Mutation	SNP	ENST00000295760.7	37	CCDS46762.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.554172	0.65425	.	.	ENSG00000163520	ENST00000535798;ENST00000404922;ENST00000295760;ENST00000465610;ENST00000492059	T;T;T;T;T	0.04275	3.66;3.66;3.66;3.66;3.66	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	L	0.58101	1.795	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.00290	-1.1843	10	0.87932	D	0	.	18.4591	0.90732	0.0:0.0:1.0:0.0	.	72;72;98	P98095;P98095-2;F5H1F3	FBLN2_HUMAN;.;.	H	98;72;72;72;72	ENSP00000445705:D98H;ENSP00000384169:D72H;ENSP00000295760:D72H;ENSP00000420164:D72H;ENSP00000420042:D72H	ENSP00000295760:D72H	D	+	1	0	FBLN2	13587069	1.000000	0.71417	1.000000	0.80357	0.173000	0.22820	7.746000	0.85057	2.357000	0.79964	0.558000	0.71614	GAC	.		0.677	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
FOXE1	2304	broad.mit.edu;mdanderson.org	37	9	100616350	100616350	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:100616350G>A	ENST00000375123.3	+	1	815	c.154G>A	c.(154-156)Ggg>Agg	p.G52R		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	52					anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				CCTGCAGCGCGGGAAGCCGCC	0.751																																					p.G52R		.											.	FOXE1	130	0			c.G154A						.						7.0	7.0	7.0					9																	100616350		2139	4227	6366	SO:0001583	missense	2304	exon1			CAGCGCGGGAAGC	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.154G>A	9.37:g.100616350G>A	ENSP00000364265:p.Gly52Arg	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	7.0	NM_004473	O75765|Q5T109|Q99526	Missense_Mutation	SNP	ENST00000375123.3	37	CCDS35078.1	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692491	0.68271	.	.	ENSG00000178919	ENST00000375123	D	0.93604	-3.25	2.95	2.95	0.34219	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (1);	0.333105	0.26567	U	0.023653	D	0.95592	0.8567	M	0.70275	2.135	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.95396	0.8486	10	0.66056	D	0.02	.	11.7148	0.51645	0.0:0.0:1.0:0.0	.	52	O00358	FOXE1_HUMAN	R	52	ENSP00000364265:G52R	ENSP00000364265:G52R	G	+	1	0	FOXE1	99656171	1.000000	0.71417	0.996000	0.52242	0.495000	0.33615	5.122000	0.64697	1.680000	0.50976	0.563000	0.77884	GGG	.		0.751	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053341.1		
GJB4	127534	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	35227120	35227120	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:35227120C>A	ENST00000339480.1	+	2	635	c.265C>A	c.(265-267)Ctg>Atg	p.L89M	RP1-34M23.5_ENST00000542839.1_RNA	NM_153212.2	NP_694944.1	Q9NTQ9	CXB4_HUMAN	gap junction protein, beta 4, 30.3kDa	89					cell communication (GO:0007154)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	16		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GTGCCCCTCACTGCTCGTGGT	0.642																																					p.L89M		.											.	GJB4	92	0			c.C265A						.						109.0	83.0	92.0					1																	35227120		2203	4300	6503	SO:0001583	missense	127534	exon2			CCCTCACTGCTCG		CCDS383.1	1p35-p34	2008-05-14	2007-11-06		ENSG00000189433	ENSG00000189433		"""Ion channels / Gap junction proteins (connexins)"""	4286	protein-coding gene	gene with protein product	"""connexin 30.3"""	605425	"""gap junction protein, beta 4 (connexin 30.3)"", ""gap junction protein, beta 4"""				Standard	NM_153212		Approved	CX30.3	uc001bxv.1	Q9NTQ9	OTTHUMG00000004052	ENST00000339480.1:c.265C>A	1.37:g.35227120C>A	ENSP00000345868:p.Leu89Met	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	50.0	NM_153212	B3KQ82	Missense_Mutation	SNP	ENST00000339480.1	37	CCDS383.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005993	0.74932	.	.	ENSG00000189433	ENST00000339480	D	0.99277	-5.67	5.73	4.82	0.62117	Connexin, N-terminal (1);	0.081359	0.51477	D	0.000084	D	0.99378	0.9781	M	0.89414	3.03	0.32657	N	0.518609	D	0.60575	0.988	P	0.62740	0.906	D	0.99804	1.1037	10	0.72032	D	0.01	.	14.4153	0.67145	0.0:0.9285:0.0:0.0715	.	89	Q9NTQ9	CXB4_HUMAN	M	89	ENSP00000345868:L89M	ENSP00000345868:L89M	L	+	1	2	GJB4	34999707	0.990000	0.36364	0.954000	0.39281	0.978000	0.69477	2.982000	0.49337	1.440000	0.47531	0.655000	0.94253	CTG	.		0.642	GJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011560.1	NM_153212	
GPR84	53831	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54756956	54756956	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:54756956A>G	ENST00000551809.1	-	1	1315	c.680T>C	c.(679-681)gTg>gCg	p.V227A	RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Missense_Mutation_p.V227A			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						AGTCCTGGCCACATGGTTGGA	0.557																																					p.V227A		.											.	GPR84	523	0			c.T680C						.						177.0	162.0	167.0					12																	54756956		2203	4300	6503	SO:0001583	missense	53831	exon2			CTGGCCACATGGT	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.680T>C	12.37:g.54756956A>G	ENSP00000450310:p.Val227Ala	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	40.0	NM_020370	B6V9G7	Missense_Mutation	SNP	ENST00000551809.1	37	CCDS8878.1	.	.	.	.	.	.	.	.	.	.	A	11.55	1.672176	0.29693	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.60672	0.17;0.17	4.5	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.325101	0.22054	N	0.065272	T	0.44095	0.1277	L	0.40543	1.245	0.35004	D	0.756234	B	0.29909	0.261	B	0.29524	0.103	T	0.47971	-0.9075	10	0.07990	T	0.79	-11.5828	12.0877	0.53706	1.0:0.0:0.0:0.0	.	227	Q9NQS5	GPR84_HUMAN	A	227	ENSP00000267015:V227A;ENSP00000450310:V227A	ENSP00000267015:V227A	V	-	2	0	GPR84	53043223	0.923000	0.31300	0.971000	0.41717	0.664000	0.39144	1.456000	0.35201	2.023000	0.59567	0.459000	0.35465	GTG	.		0.557	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
HADH	3033	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	108940796	108940796	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:108940796C>T	ENST00000309522.3	+	4	669	c.520C>T	c.(520-522)Cca>Tca	p.P174S	HADH_ENST00000603302.1_Missense_Mutation_p.P174S|HADH_ENST00000454409.2_Missense_Mutation_p.P178S|HADH_ENST00000403312.1_Missense_Mutation_p.P233S|HADH_ENST00000505878.1_Missense_Mutation_p.P178S	NM_005327.4	NP_005318	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase	502					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	15		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000168)		TTTCTTCAACCCAGTGCCTGT	0.507																																					p.P174S		.											.	HADH	91	0			c.C520T						.						155.0	145.0	148.0					4																	108940796		2203	4300	6503	SO:0001583	missense	3033	exon4			TTCAACCCAGTGC	X96752	CCDS3678.1, CCDS54790.1	4q22-q26	2012-10-02	2010-04-30		ENSG00000138796	ENSG00000138796	1.1.1.35		4799	protein-coding gene	gene with protein product		601609	"""L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain"", ""hydroxyacyl-Coenzyme A dehydrogenase"""	HADHSC		975867, 16176262	Standard	NM_001184705		Approved	HADH1, SCHAD	uc010ilx.3	Q16836	OTTHUMG00000131810	ENST00000309522.3:c.520C>T	4.37:g.108940796C>T	ENSP00000312288:p.Pro174Ser	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	55.0	NM_005327	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	ENST00000309522.3	37	CCDS3678.1	.	.	.	.	.	.	.	.	.	.	C	31	5.090892	0.94149	.	.	ENSG00000138796	ENST00000403312;ENST00000309522;ENST00000505878;ENST00000454409	D;D;D	0.93604	-3.25;-3.25;-3.25	5.37	5.37	0.77165	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98488	0.9496	H	0.99475	4.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.99785	1.1029	10	0.87932	D	0	-12.7194	19.1228	0.93371	0.0:1.0:0.0:0.0	.	233;178;174	Q16836-2;E9PF18;Q16836	.;.;HCDH_HUMAN	S	174;174;178;178	ENSP00000312288:P174S;ENSP00000425952:P178S;ENSP00000395167:P178S	ENSP00000312288:P174S	P	+	1	0	HADH	109160245	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.818000	0.86416	2.505000	0.84491	0.655000	0.94253	CCA	.		0.507	HADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254750.2	NM_005327	
HSPG2	3339	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	22183660	22183660	+	Missense_Mutation	SNP	C	C	T	rs561392976	byFrequency	TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:22183660C>T	ENST00000374695.3	-	44	5502	c.5423G>A	c.(5422-5424)cGc>cAc	p.R1808H	HSPG2_ENST00000430507.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1808	Ig-like C2-type 3.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GTTGTGCAGGCGGGTCCACAC	0.607													C|||	3	0.000599042	0.0	0.0	5008	,	,		17559	0.002		0.0	False		,,,				2504	0.001				p.R1808H		.											.	HSPG2	141	0			c.G5423A						.						108.0	116.0	113.0					1																	22183660		2203	4300	6503	SO:0001583	missense	3339	exon44			TGCAGGCGGGTCC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5423G>A	1.37:g.22183660C>T	ENSP00000363827:p.Arg1808His	Somatic	235.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	88.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.974153	0.92919	.	.	ENSG00000142798	ENST00000374695	T	0.13420	2.59	4.85	4.85	0.62838	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37348	N	0.002122	T	0.32071	0.0817	L	0.49640	1.575	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01476	-1.1345	10	0.54805	T	0.06	.	15.8147	0.78592	0.0:1.0:0.0:0.0	.	1808	P98160	PGBM_HUMAN	H	1808	ENSP00000363827:R1808H	ENSP00000363827:R1808H	R	-	2	0	HSPG2	22056247	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	7.047000	0.76599	2.424000	0.82194	0.655000	0.94253	CGC	.		0.607	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
HTRA2	27429	broad.mit.edu;mdanderson.org	37	2	74757144	74757144	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:74757144C>T	ENST00000258080.3	+	1	641	c.11C>T	c.(10-12)cCg>cTg	p.P4L	AUP1_ENST00000377526.3_5'Flank|HTRA2_ENST00000467961.1_Intron|HTRA2_ENST00000352222.3_Missense_Mutation_p.P4L	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	4					adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						ATGGCTGCGCCGAGGGCGGGG	0.741																																					p.P4L		.											.	HTRA2	91	0			c.C11T						.						16.0	21.0	20.0					2																	74757144		1690	3646	5336	SO:0001583	missense	27429	exon1			CTGCGCCGAGGGC		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.11C>T	2.37:g.74757144C>T	ENSP00000258080:p.Pro4Leu	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	5.0	NM_013247	Q9HBZ4|Q9P0Y3|Q9P0Y4	Missense_Mutation	SNP	ENST00000258080.3	37	CCDS1951.1	.	.	.	.	.	.	.	.	.	.	c	1.721	-0.496680	0.04291	.	.	ENSG00000115317	ENST00000258080;ENST00000352222	T;T	0.77877	-1.13;-0.09	5.51	1.7	0.24286	.	0.428172	0.17413	N	0.175140	T	0.43433	0.1247	N	0.01874	-0.695	0.29834	N	0.829818	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.45101	-0.9284	10	0.02654	T	1	-4.2845	6.7183	0.23316	0.0:0.2578:0.0:0.7422	.	4;4;4;4	A8K7G2;O43464-3;O43464-2;O43464	.;.;.;HTRA2_HUMAN	L	4	ENSP00000258080:P4L;ENSP00000312893:P4L	ENSP00000258080:P4L	P	+	2	0	HTRA2	74610652	0.994000	0.37717	1.000000	0.80357	0.811000	0.45836	0.629000	0.24538	0.912000	0.36772	-0.711000	0.03637	CCG	.		0.741	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
ITIH5	80760	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	7608182	7608182	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:7608182C>A	ENST00000256861.6	-	13	2416	c.2338G>T	c.(2338-2340)Gtg>Ttg	p.V780L	ITIH5_ENST00000298441.6_Missense_Mutation_p.V566L|ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000446830.2_Missense_Mutation_p.V562L	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	780					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CTCCCCACCACCACACTCTGG	0.572																																					p.V780L		.											.	ITIH5	92	0			c.G2338T						.						90.0	68.0	76.0					10																	7608182		2203	4300	6503	SO:0001583	missense	80760	exon13			CCACCACCACACT			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2338G>T	10.37:g.7608182C>A	ENSP00000256861:p.Val780Leu	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	64.0	NM_030569	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	C	11.06	1.527890	0.27299	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.11712	2.75;2.75;2.75	5.84	4.94	0.65067	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.422460	0.28312	N	0.015802	T	0.09247	0.0228	.	.	.	0.18873	N	0.999983	P;P	0.43938	0.822;0.787	B;B	0.40702	0.338;0.228	T	0.22591	-1.0212	9	0.25751	T	0.34	-13.8082	10.7982	0.46472	0.0:0.8562:0.0:0.1438	.	780;566	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	L	780;566;562	ENSP00000256861:V780L;ENSP00000298441:V566L;ENSP00000387969:V562L	ENSP00000256861:V780L	V	-	1	0	ITIH5	7648188	0.000000	0.05858	0.136000	0.22124	0.912000	0.54170	0.579000	0.23788	1.462000	0.47948	0.655000	0.94253	GTG	.		0.572	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
IZUMO2	126123	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50666320	50666320	+	Silent	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:50666320G>A	ENST00000293405.3	-	1	132	c.132C>T	c.(130-132)ttC>ttT	p.F44F		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	44						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						GCTCCAACTGGAAGCGACTGG	0.701																																					p.F44F		.											.	IZUMO2	90	0			c.C132T						.						23.0	28.0	26.0					19																	50666320		1948	4132	6080	SO:0001819	synonymous_variant	126123	exon1			CAACTGGAAGCGA	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.132C>T	19.37:g.50666320G>A		Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	76.0	NM_152358	Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Silent	SNP	ENST00000293405.3	37	CCDS12792.2																																																																																			.		0.701	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358	
KDM6B	23135	broad.mit.edu;bcgsc.ca	37	17	7753448	7753448	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:7753448G>A	ENST00000448097.2	+	13	3957	c.3626G>A	c.(3625-3627)cGa>cAa	p.R1209Q	KDM6B_ENST00000254846.5_Missense_Mutation_p.R1209Q			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1209					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						ACAGACCCTCGAAATCCCATC	0.612																																					p.R1209Q		.											.	KDM6B	205	0			c.G3626A						.						64.0	57.0	59.0					17																	7753448		2202	4300	6502	SO:0001583	missense	23135	exon13			ACCCTCGAAATCC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.3626G>A	17.37:g.7753448G>A	ENSP00000412513:p.Arg1209Gln	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	5.0	NM_001080424	C9IZ40|Q96G33	Missense_Mutation	SNP	ENST00000448097.2	37		.	.	.	.	.	.	.	.	.	.	G	13.48	2.250048	0.39797	.	.	ENSG00000132510	ENST00000254846;ENST00000448097	T;T	0.71103	-0.54;-0.54	5.4	5.4	0.78164	.	0.067117	0.64402	D	0.000020	T	0.55162	0.1903	N	0.03608	-0.345	0.30650	N	0.755482	B;D	0.65815	0.058;0.995	B;P	0.51866	0.053;0.682	T	0.60692	-0.7213	10	0.66056	D	0.02	-8.1761	8.6814	0.34212	0.1631:0.0:0.8369:0.0	.	1209;1209	O15054;O15054-1	KDM6B_HUMAN;.	Q	1209	ENSP00000254846:R1209Q;ENSP00000412513:R1209Q	ENSP00000254846:R1209Q	R	+	2	0	KDM6B	7694173	1.000000	0.71417	0.942000	0.38095	0.976000	0.68499	6.962000	0.76048	2.722000	0.93159	0.655000	0.94253	CGA	.		0.612	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
RIC1	57589	ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5742878	5742878	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:5742878A>G	ENST00000414202.2	+	9	1102	c.911A>G	c.(910-912)aAt>aGt	p.N304S	KIAA1432_ENST00000418622.3_Missense_Mutation_p.N225S|KIAA1432_ENST00000381532.2_Missense_Mutation_p.N225S|KIAA1432_ENST00000449720.2_Missense_Mutation_p.N225S|KIAA1432_ENST00000251879.6_Missense_Mutation_p.N304S	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GACATTTGGAATAAAACAGGA	0.318																																					p.N304S		.											.	KIAA1432	90	0			c.A911G						.						101.0	104.0	103.0					9																	5742878		2203	4300	6503	SO:0001583	missense	57589	exon9			TTTGGAATAAAAC																												ENST00000414202.2:c.911A>G	9.37:g.5742878A>G	ENSP00000416696:p.Asn304Ser	Somatic	156.0	2.0		WXS	Illumina HiSeq	.	145.0	73.0	NM_001206557		Missense_Mutation	SNP	ENST00000414202.2	37	CCDS34982.2	.	.	.	.	.	.	.	.	.	.	A	13.18	2.159479	0.38119	.	.	ENSG00000107036	ENST00000251879;ENST00000414202;ENST00000381532;ENST00000418622;ENST00000449720	T;T;T;T;T	0.69806	1.63;1.63;-0.43;-0.43;-0.43	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.59376	0.2189	L	0.52364	1.645	0.58432	D	0.999999	B;B;B	0.29432	0.158;0.192;0.244	B;B;B	0.26202	0.046;0.042;0.067	T	0.56998	-0.7886	10	0.09590	T	0.72	-23.4083	16.6512	0.85203	1.0:0.0:0.0:0.0	.	225;304;304	B7ZM67;Q4ADV7;G5E932	.;RIC1_HUMAN;.	S	304;304;225;225;225	ENSP00000251879:N304S;ENSP00000416696:N304S;ENSP00000370943:N225S;ENSP00000402240:N225S;ENSP00000398823:N225S	ENSP00000251879:N304S	N	+	2	0	KIAA1432	5732878	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	8.888000	0.92464	2.333000	0.79357	0.482000	0.46254	AAT	.		0.318	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
KRT84	3890	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	12	52771877	52771877	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:52771877C>A	ENST00000257951.3	-	9	1810	c.1744G>T	c.(1744-1746)Ggc>Tgc	p.G582C	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	582	Tail.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GAGCTGCGGCCGCCGCTGCAG	0.677																																					p.G582C		.											.	KRT84	91	0			c.G1744T						.						12.0	14.0	13.0					12																	52771877		2182	4273	6455	SO:0001583	missense	3890	exon9			TGCGGCCGCCGCT	Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.1744G>T	12.37:g.52771877C>A	ENSP00000257951:p.Gly582Cys	Somatic	210.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	72.0	NM_033045	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	37	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524879	0.27299	.	.	ENSG00000161849	ENST00000257951	D	0.82984	-1.67	3.57	2.66	0.31614	.	0.230288	0.22348	N	0.061253	D	0.82710	0.5096	L	0.36672	1.1	0.09310	N	1	D	0.76494	0.999	D	0.64410	0.925	T	0.70923	-0.4740	10	0.87932	D	0	.	6.1951	0.20546	0.0:0.8602:0.0:0.1398	.	582	Q9NSB2	KRT84_HUMAN	C	582	ENSP00000257951:G582C	ENSP00000257951:G582C	G	-	1	0	KRT84	51058144	0.697000	0.27767	0.207000	0.23584	0.189000	0.23516	1.818000	0.39012	1.991000	0.58162	0.462000	0.41574	GGC	.		0.677	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
MAN2A1	4124	ucsc.edu;bcgsc.ca	37	5	109091087	109091087	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:109091087A>G	ENST00000261483.4	+	5	1817	c.765A>G	c.(763-765)gaA>gaG	p.E255E		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	255					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		TGCCTGATGAAGCTACTCCAC	0.333																																					p.E255E		.											.	MAN2A1	92	0			c.A765G						.						136.0	134.0	135.0					5																	109091087		2202	4300	6502	SO:0001819	synonymous_variant	4124	exon5			TGATGAAGCTACT		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.765A>G	5.37:g.109091087A>G		Somatic	150.0	2.0		WXS	Illumina HiSeq	.	143.0	68.0	NM_002372	Q16767	Silent	SNP	ENST00000261483.4	37	CCDS34209.1																																																																																			.		0.333	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
MED25	81857	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50333046	50333046	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr19:50333046G>A	ENST00000312865.6	+	6	582	c.529G>A	c.(529-531)Ggg>Agg	p.G177R	MED25_ENST00000538643.1_Intron	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	177	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		CCTACAGCGGGGGATCCACTT	0.662																																					p.G177R	GBM(51;894 1657 37868)	.											.	MED25	91	0			c.G529A						.						12.0	11.0	11.0					19																	50333046		2200	4293	6493	SO:0001583	missense	81857	exon6			CAGCGGGGGATCC	AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.529G>A	19.37:g.50333046G>A	ENSP00000326767:p.Gly177Arg	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	83.0	NM_030973	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	ENST00000312865.6	37	CCDS33075.1	.	.	.	.	.	.	.	.	.	.	G	36	5.913557	0.97099	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000542221;ENST00000544580	T	0.77750	-1.12	5.38	4.35	0.52113	.	0.054424	0.64402	D	0.000001	T	0.82217	0.4989	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	D	0.83705	0.0184	10	0.66056	D	0.02	.	12.8803	0.58014	0.0786:0.0:0.9214:0.0	.	177	Q71SY5	MED25_HUMAN	R	177	ENSP00000326767:G177R	ENSP00000326767:G177R	G	+	1	0	MED25	55024858	1.000000	0.71417	0.638000	0.29380	0.929000	0.56500	7.993000	0.88291	1.503000	0.48686	0.655000	0.94253	GGG	.		0.662	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1	NM_030973	
MFSD5	84975	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53646714	53646714	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr12:53646714C>T	ENST00000329548.4	+	2	286	c.95C>T	c.(94-96)gCc>gTc	p.A32V	MFSD5_ENST00000534842.1_Missense_Mutation_p.A139V	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	32					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CCTGGAAGGGCCTGCAGCAAT	0.577																																					p.A139V		.											.	MFSD5	93	0			c.C416T						.						104.0	111.0	108.0					12																	53646714		2203	4300	6503	SO:0001583	missense	84975	exon2			GAAGGGCCTGCAG	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.95C>T	12.37:g.53646714C>T	ENSP00000332624:p.Ala32Val	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	82.0	NM_001170790	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	ENST00000329548.4	37	CCDS8851.1	.	.	.	.	.	.	.	.	.	.	C	11.67	1.708820	0.30322	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	.	.	.	4.3	3.41	0.39046	.	0.000000	0.85682	D	0.000000	T	0.43590	0.1254	L	0.33339	1.005	0.49130	D	0.999753	B;B	0.29988	0.065;0.264	B;B	0.27715	0.033;0.082	T	0.33752	-0.9856	9	0.37606	T	0.19	-8.2227	10.7748	0.46343	0.0:0.9055:0.0:0.0945	.	32;139	Q6N075;G3V1N7	MFSD5_HUMAN;.	V	139;139;139;32	.	ENSP00000331231:A139V	A	+	2	0	MFSD5	51932981	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.012000	0.29924	1.037000	0.40024	0.561000	0.74099	GCC	.		0.577	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406896.1	NM_032889	
MSX1	4487	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	4864457	4864457	+	Missense_Mutation	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:4864457C>T	ENST00000382723.4	+	2	733	c.499C>T	c.(499-501)Cgc>Tgc	p.R167C	MSX1_ENST00000468421.1_3'UTR	NM_002448.3	NP_002439.2	P28360	MSX1_HUMAN	msh homeobox 1	167					activation of meiosis (GO:0090427)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway involved in heart development (GO:0061312)|bone morphogenesis (GO:0060349)|cartilage morphogenesis (GO:0060536)|cell morphogenesis (GO:0000902)|cellular response to nicotine (GO:0071316)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic nail plate morphogenesis (GO:0035880)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|mammary gland epithelium development (GO:0061180)|mesenchymal cell proliferation (GO:0010463)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pituitary gland development (GO:0021983)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902255)|positive regulation of mesenchymal cell apoptotic process (GO:2001055)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of odontogenesis (GO:0042481)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			endometrium(3)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	11				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CTGCACCCTCCGCAAACACAA	0.597																																					p.R167C		.											.	MSX1	90	0			c.C499T						.						61.0	78.0	72.0					4																	4864457		2191	4269	6460	SO:0001583	missense	4487	exon2			ACCCTCCGCAAAC	M97676	CCDS3378.2	4p16.2	2011-06-20	2006-11-21		ENSG00000163132	ENSG00000163132		"""Homeoboxes / ANTP class : NKL subclass"""	7391	protein-coding gene	gene with protein product		142983	"""msh (Drosophila) homeo box homolog 1 (formerly homeo box 7)"", ""msh homeobox homolog 1 (Drosophila)"""	HOX7		1685479, 1973146	Standard	NM_002448		Approved	HYD1, OFC5	uc003gif.3	P28360	OTTHUMG00000090335	ENST00000382723.4:c.499C>T	4.37:g.4864457C>T	ENSP00000372170:p.Arg167Cys	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	37.0	NM_002448	A0SZU5|A8K3M1|Q96NY4	Missense_Mutation	SNP	ENST00000382723.4	37	CCDS3378.2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129346	0.77549	.	.	ENSG00000163132	ENST00000382723	D	0.95171	-3.63	4.96	4.96	0.65561	Homeodomain-related (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97129	0.9062	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.97515	1.0069	10	0.87932	D	0	-10.6849	13.2139	0.59844	0.1593:0.8407:0.0:0.0	.	161	P28360	MSX1_HUMAN	C	167	ENSP00000372170:R167C	ENSP00000372170:R167C	R	+	1	0	MSX1	4915358	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	1.396000	0.34531	2.456000	0.83038	0.462000	0.41574	CGC	.		0.597	MSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206700.3		
MTF2	22823	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	93545089	93545089	+	Splice_Site	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:93545089G>T	ENST00000370298.4	+	1	294		c.e1+1		MTF2_ENST00000370303.4_Splice_Site|MTF2_ENST00000471953.1_Splice_Site|MTF2_ENST00000540243.1_Splice_Site|MTF2_ENST00000545708.1_Splice_Site	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2						chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		ACCGAATGAGGTGAGAGACCT	0.557																																					.		.											.	MTF2	92	0			c.5+1G>T						.						98.0	96.0	97.0					1																	93545089		2203	4300	6503	SO:0001630	splice_region_variant	22823	exon1			AATGAGGTGAGAG	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.5+1G>T	1.37:g.93545089G>T		Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	53.0	NM_001164392	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Splice_Site	SNP	ENST00000370298.4	37	CCDS742.1	.	.	.	.	.	.	.	.	.	.	g	14.22	2.470170	0.43839	.	.	ENSG00000143033	ENST00000370298;ENST00000370303	.	.	.	3.9	2.02	0.26589	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.2582	0.26189	0.0959:0.1707:0.7334:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTF2	93317677	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.299000	0.65716	0.625000	0.30304	-0.372000	0.07161	.	.		0.557	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358	Intron
MTTP	4547	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100532580	100532580	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:100532580C>T	ENST00000265517.5	+	14	2162	c.1959C>T	c.(1957-1959)taC>taT	p.Y653Y	RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000457717.1_Silent_p.Y653Y|MTTP_ENST00000511045.1_Silent_p.Y680Y			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	653	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TCTTTCAGTACATTGGGAAGG	0.428																																					p.Y653Y		.											.	MTTP	93	0			c.C1959T						.						170.0	155.0	160.0					4																	100532580		2203	4300	6503	SO:0001819	synonymous_variant	4547	exon15			TCAGTACATTGGG		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1959C>T	4.37:g.100532580C>T		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	68.0	NM_000253	A8K428|Q08AM4|Q6P5T3	Silent	SNP	ENST00000265517.5	37	CCDS3651.1																																																																																			.		0.428	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
MYH4	4622	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10354170	10354170	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:10354170G>T	ENST00000255381.2	-	29	4018	c.3908C>A	c.(3907-3909)tCt>tAt	p.S1303Y	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1303					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GGATAGCTGAGAAACCATAGC	0.378																																					p.S1303Y		.											.	MYH4	102	0			c.C3908A						.						161.0	147.0	152.0					17																	10354170		2203	4300	6503	SO:0001583	missense	4622	exon29			AGCTGAGAAACCA		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3908C>A	17.37:g.10354170G>T	ENSP00000255381:p.Ser1303Tyr	Somatic	250.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	122.0	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	37	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258015	0.80246	.	.	ENSG00000141048	ENST00000255381	T	0.79940	-1.32	5.71	5.71	0.89125	Myosin tail (1);	0.000000	0.37304	U	0.002144	D	0.92482	0.7613	M	0.93241	3.395	0.50632	D	0.999886	D	0.69078	0.997	D	0.71184	0.972	D	0.93703	0.7017	10	0.87932	D	0	.	18.9878	0.92779	0.0:0.0:1.0:0.0	.	1303	Q9Y623	MYH4_HUMAN	Y	1303	ENSP00000255381:S1303Y	ENSP00000255381:S1303Y	S	-	2	0	MYH4	10294895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.763000	0.68818	2.850000	0.98022	0.655000	0.94253	TCT	.		0.378	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
NCF2	4688	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183532683	183532683	+	Missense_Mutation	SNP	T	T	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:183532683T>G	ENST00000367535.3	-	12	1315	c.1064A>C	c.(1063-1065)aAg>aCg	p.K355T	NCF2_ENST00000418089.1_Missense_Mutation_p.K274T|NCF2_ENST00000469280.1_5'UTR|NCF2_ENST00000413720.1_Missense_Mutation_p.K310T|NCF2_ENST00000367536.1_Missense_Mutation_p.K355T	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	355	OPR.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	GTAGTGCACCTTGAGTGTGTA	0.542																																					p.K355T		.											.	NCF2	93	0			c.A1064C						.						124.0	106.0	112.0					1																	183532683		2203	4300	6503	SO:0001583	missense	4688	exon13			TGCACCTTGAGTG	BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.1064A>C	1.37:g.183532683T>G	ENSP00000356505:p.Lys355Thr	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	301.0	57.0	NM_001127651	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	ENST00000367535.3	37	CCDS1356.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.218117	0.79464	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535;ENST00000420553;ENST00000419402	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78	5.74	4.61	0.57282	Phox/Bem1p (2);	0.000000	0.85682	D	0.000000	T	0.68137	0.2968	M	0.83483	2.645	0.52501	D	0.999954	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;0.999;1.0	T	0.69412	-0.5152	10	0.49607	T	0.09	-55.1311	10.1685	0.42895	0.0:0.0752:0.0:0.9248	.	274;310;355	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	T	355;427;310;274;355;6;94	ENSP00000356506:K355T;ENSP00000399294:K310T;ENSP00000407217:K274T;ENSP00000356505:K355T;ENSP00000397228:K6T;ENSP00000406198:K94T	ENSP00000356505:K355T	K	-	2	0	NCF2	181799306	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.266000	0.65525	1.020000	0.39573	0.529000	0.55759	AAG	.		0.542	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085483.1	NM_000433	
NDST2	8509	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	75566200	75566200	+	Silent	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr10:75566200A>G	ENST00000309979.6	-	6	1837	c.1281T>C	c.(1279-1281)gcT>gcC	p.A427A	RP11-574K11.31_ENST00000603027.1_Silent_p.A427A|NDST2_ENST00000299641.4_Silent_p.A304A			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	427	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					GGGGGGCCACAGCATACCCCA	0.602																																					p.A427A		.											.	NDST2	91	0			c.T1281C						.						39.0	39.0	39.0					10																	75566200		2203	4300	6503	SO:0001819	synonymous_variant	8509	exon6			GGCCACAGCATAC	U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.1281T>C	10.37:g.75566200A>G		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	28.0	NM_003635	Q2TB32|Q59H89	Silent	SNP	ENST00000309979.6	37	CCDS7335.1																																																																																			.		0.602	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048710.1	NM_003635	
NEK6	10783	hgsc.bcm.edu;bcgsc.ca	37	9	127101926	127101926	+	Silent	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:127101926G>T	ENST00000320246.5	+	8	844	c.699G>T	c.(697-699)ctG>ctT	p.L233L	NEK6_ENST00000545174.1_Silent_p.L233L|NEK6_ENST00000540326.1_Silent_p.L251L|NEK6_ENST00000546191.1_Silent_p.L233L|NEK6_ENST00000373603.1_Silent_p.L233L|NEK6_ENST00000373600.3_Silent_p.L267L|NEK6_ENST00000539416.1_Silent_p.L258L|NEK6_ENST00000394199.2_Silent_p.L267L	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						TCTGGTCCCTGGGCTGTCTGC	0.602																																					p.L267L	NSCLC(122;934 1785 18647 44295 45571)	.											.	NEK6	334	0			c.G801T						.						275.0	203.0	227.0					9																	127101926		2203	4300	6503	SO:0001819	synonymous_variant	10783	exon9			GTCCCTGGGCTGT	AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.699G>T	9.37:g.127101926G>T		Somatic	257.0	0.0		WXS	Illumina HiSeq	Phase_I	238.0	10.0	NM_001166171	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Silent	SNP	ENST00000320246.5	37	CCDS6854.1																																																																																			.		0.602	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054016.1	NM_014397	
NELFA	7469	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	1993397	1993397	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:1993397A>C	ENST00000411638.2	-	2	271	c.256T>G	c.(256-258)Tcg>Gcg	p.S86A	NELFA_ENST00000542778.1_Intron|NELFA_ENST00000382882.3_Missense_Mutation_p.S97A	NM_005663.4	NP_005654.3	Q9H3P2	NELFA_HUMAN	negative elongation factor complex member A	86					gene expression (GO:0010467)|multicellular organismal development (GO:0007275)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)										CAGGGGTCCGAGTCGAGGCTG	0.602																																					p.S97A		.											.	.	.	0			c.T289G						.						111.0	120.0	117.0					4																	1993397		2203	4300	6503	SO:0001583	missense	7469	exon2			GGTCCGAGTCGAG	AF101434	CCDS3358.2	4p16.3	2013-01-31	2013-01-31	2013-01-31	ENSG00000185049	ENSG00000185049			12768	protein-coding gene	gene with protein product		606026	"""Wolf-Hirschhorn syndrome candidate 2"""	WHSC2		10409432	Standard	NM_005663		Approved	NELF-A	uc003gem.3	Q9H3P2	OTTHUMG00000089967	ENST00000411638.2:c.256T>G	4.37:g.1993397A>C	ENSP00000399165:p.Ser86Ala	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	44.0	NM_005663	A2A2T1|O95392	Missense_Mutation	SNP	ENST00000411638.2	37		.	.	.	.	.	.	.	.	.	.	A	17.29	3.351947	0.61183	.	.	ENSG00000185049	ENST00000382882;ENST00000416258;ENST00000411638;ENST00000431323;ENST00000455762	T;T;T;T	0.49432	1.52;0.78;1.52;1.52	5.18	5.18	0.71444	.	0.061993	0.64402	D	0.000002	T	0.40694	0.1127	L	0.52126	1.63	0.80722	D	1	B	0.31817	0.341	B	0.28305	0.088	T	0.41502	-0.9505	10	0.62326	D	0.03	-23.6281	10.2797	0.43532	0.9223:0.0:0.0777:0.0	.	86	Q9H3P2	NELFA_HUMAN	A	97;90;86;102;16	ENSP00000372335:S97A;ENSP00000387647:S90A;ENSP00000399165:S86A;ENSP00000395761:S102A	ENSP00000372335:S97A	S	-	1	0	WHSC2	1963195	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.180000	0.65048	1.955000	0.56771	0.379000	0.24179	TCG	.		0.602	NELFA-015	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000473007.1	NM_005663	
NLGN4X	57502	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	6069292	6069292	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:6069292C>A	ENST00000381095.3	-	2	843	c.216G>T	c.(214-216)caG>caT	p.Q72H	NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381093.2_Missense_Mutation_p.Q72H|NLGN4X_ENST00000275857.6_Missense_Mutation_p.Q72H|NLGN4X_ENST00000538097.1_Missense_Mutation_p.Q72H|NLGN4X_ENST00000381092.1_Missense_Mutation_p.Q72H	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	72					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						CCCCTAAGTACTGCTCCACTG	0.542																																					p.Q72H		.											.	NLGN4X	195	0			c.G216T						.						96.0	83.0	88.0					X																	6069292		2203	4300	6503	SO:0001583	missense	57502	exon2			TAAGTACTGCTCC	AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.216G>T	X.37:g.6069292C>A	ENSP00000370485:p.Gln72His	Somatic	382.0	0.0		WXS	Illumina HiSeq	Phase_I	305.0	138.0	NM_181332	Q6UX10|Q9ULG0	Missense_Mutation	SNP	ENST00000381095.3	37	CCDS14126.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456250	0.63401	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34	4.2	-8.4	0.00965	Carboxylesterase, type B (1);	.	.	.	.	T	0.80757	0.4684	M	0.86268	2.805	0.48696	D	0.99969	D;D;D	0.89917	1.0;1.0;0.99	D;D;P	0.79784	0.984;0.993;0.795	D	0.87332	0.2325	9	0.62326	D	0.03	.	18.999	0.92826	0.0:0.7632:0.0:0.2368	.	72;72;72	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	H	72	ENSP00000370485:Q72H;ENSP00000370483:Q72H;ENSP00000275857:Q72H;ENSP00000370482:Q72H;ENSP00000439203:Q72H	ENSP00000275857:Q72H	Q	-	3	2	NLGN4X	6079292	0.044000	0.20184	0.773000	0.31616	0.903000	0.53119	-0.995000	0.03712	-2.273000	0.00681	-0.380000	0.06706	CAG	.		0.542	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055673.1	NM_020742	
NMBR	4829	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	142400004	142400004	+	Silent	SNP	C	C	T	rs149123905		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:142400004C>T	ENST00000258042.1	-	2	599	c.459G>A	c.(457-459)acG>acA	p.T153T	NMBR_ENST00000480652.1_5'Flank	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	153					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		ATGCCCCTGACGTCTGCATGT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		17023	0.0		0.0	False		,,,				2504	0.001				p.T153T		.											.	NMBR	946	0			c.G459A						.	C		1,4405	2.1+/-5.4	0,1,2202	71.0	59.0	63.0		459	-10.8	0.0	6	dbSNP_134	63	0,8600		0,0,4300	no	coding-synonymous	NMBR	NM_002511.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		153/391	142400004	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	4829	exon2			CCCTGACGTCTGC		CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.459G>A	6.37:g.142400004C>T		Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	162.0	20.0	NM_002511	E9KL38|Q5VUK8	Silent	SNP	ENST00000258042.1	37	CCDS5196.1																																																																																			C|1.000;T|0.000		0.493	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042479.1		
OR11G2	390439	ucsc.edu;bcgsc.ca	37	14	20666407	20666407	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr14:20666407G>C	ENST00000357366.3	+	1	913	c.913G>C	c.(913-915)Gaa>Caa	p.E305Q		NM_001005503.1	NP_001005503.1	Q8NGC1	O11G2_HUMAN	olfactory receptor, family 11, subfamily G, member 2	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(95;0.00108)		Epithelial(56;9.76e-07)|all cancers(55;5.61e-06)	GBM - Glioblastoma multiforme(265;0.0144)		atctaagaatgaagctggaaa	0.453																																					p.E305Q		.											.	OR11G2	70	0			c.G913C						.						133.0	128.0	129.0					14																	20666407		2203	4300	6503	SO:0001583	missense	390439	exon1			AAGAATGAAGCTG		CCDS32032.1	14q11.2	2013-09-24			ENSG00000196832	ENSG00000196832		"""GPCR / Class A : Olfactory receptors"""	15346	protein-coding gene	gene with protein product							Standard	NM_001005503		Approved		uc010tlb.2	Q8NGC1	OTTHUMG00000167700	ENST00000357366.3:c.913G>C	14.37:g.20666407G>C	ENSP00000349930:p.Glu305Gln	Somatic	240.0	2.0		WXS	Illumina HiSeq	.	217.0	115.0	NM_001005503	Q6IF09|Q96R33	Missense_Mutation	SNP	ENST00000357366.3	37	CCDS32032.1	.	.	.	.	.	.	.	.	.	.	g	4.185	0.032882	0.08101	.	.	ENSG00000196832	ENST00000357366	T	0.00107	8.72	4.94	4.05	0.47172	GPCR, rhodopsin-like superfamily (1);	1.291220	0.05443	N	0.548056	T	0.00144	0.0004	N	0.21324	0.655	0.20074	N	0.999931	B	0.19200	0.034	B	0.19666	0.026	T	0.42515	-0.9447	10	0.62326	D	0.03	.	8.3506	0.32299	0.0848:0.1559:0.7593:0.0	.	305	Q8NGC1	O11G2_HUMAN	Q	305	ENSP00000349930:E305Q	ENSP00000349930:E305Q	E	+	1	0	OR11G2	19736247	0.000000	0.05858	0.996000	0.52242	0.255000	0.26057	-0.462000	0.06704	1.311000	0.45024	-0.150000	0.13652	GAA	.		0.453	OR11G2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395722.1		
OR4C12	283093	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	50003747	50003747	+	Silent	SNP	A	A	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:50003747A>T	ENST00000335238.4	-	1	324	c.291T>A	c.(289-291)gcT>gcA	p.A97A		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						CATAGGCTTGAGCCATACACC	0.418																																					p.A97A		.											.	OR4C12	93	0			c.T291A						.						123.0	123.0	123.0					11																	50003747		2201	4296	6497	SO:0001819	synonymous_variant	283093	exon1			GGCTTGAGCCATA	BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.291T>A	11.37:g.50003747A>T		Somatic	226.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	99.0	NM_001005270	B2RNF0|Q6IF49	Silent	SNP	ENST00000335238.4	37	CCDS31496.1																																																																																			.		0.418	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270	
OR5V1	81696	ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29323162	29323162	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:29323162C>A	ENST00000377154.1	-	4	1110	c.811G>T	c.(811-813)Gat>Tat	p.D271Y	OR5V1_ENST00000543825.1_Missense_Mutation_p.D271Y			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ACCAACCTATCTTTCTTTAAT	0.408																																					p.D271Y	Ovarian(32;43 883 21137 32120 42650)	.											.	OR5V1	72	0			c.G811T						.						119.0	116.0	117.0					6																	29323162		2203	4299	6502	SO:0001583	missense	81696	exon1			ACCTATCTTTCTT		CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.811G>T	6.37:g.29323162C>A	ENSP00000366359:p.Asp271Tyr	Somatic	93.0	1.0		WXS	Illumina HiSeq	.	132.0	67.0	NM_030876	A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	ENST00000377154.1	37	CCDS4657.1	.	.	.	.	.	.	.	.	.	.	C	6.725	0.502533	0.12822	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.00256	8.42;8.42	4.53	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34484	N	0.003933	T	0.00144	0.0004	H	0.95079	3.62	0.09310	N	1	B	0.22746	0.074	B	0.26770	0.073	T	0.51505	-0.8697	10	0.72032	D	0.01	-32.6015	7.6869	0.28546	0.0:0.661:0.0:0.339	.	271	Q9UGF6	OR5V1_HUMAN	Y	271	ENSP00000366359:D271Y;ENSP00000443309:D271Y	ENSP00000366356:D271Y	D	-	1	0	OR5V1	29431141	0.000000	0.05858	0.009000	0.14445	0.572000	0.35998	-2.269000	0.01168	0.634000	0.30469	0.543000	0.68304	GAT	.		0.408	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076398.3		
PARP14	54625	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	122418450	122418450	+	Missense_Mutation	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr3:122418450G>A	ENST00000474629.2	+	6	1315	c.1049G>A	c.(1048-1050)cGt>cAt	p.R350H		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	350					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GAAATGAGGCGTTGTCACTGT	0.453																																					p.R350H		.											.	PARP14	525	0			c.G1049A						.						125.0	119.0	121.0					3																	122418450		2007	4183	6190	SO:0001583	missense	54625	exon6			TGAGGCGTTGTCA	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1049G>A	3.37:g.122418450G>A	ENSP00000418194:p.Arg350His	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	59.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	ENST00000474629.2	37	CCDS46894.1	.	.	.	.	.	.	.	.	.	.	G	3.512	-0.099552	0.07010	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.72615	-0.67	5.32	-7.96	0.01144	.	1.152660	0.06396	N	0.717941	T	0.49440	0.1557	L	0.27053	0.805	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.04013	0.0;0.001	T	0.34750	-0.9816	10	0.14656	T	0.56	.	9.3574	0.38175	0.3934:0.0:0.5036:0.103	.	350;350	Q460N5-4;Q460N5	.;PAR14_HUMAN	H	350;269	ENSP00000418194:R350H	ENSP00000381228:R269H	R	+	2	0	PARP14	123901140	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-2.098000	0.01347	-1.718000	0.01383	-0.302000	0.09304	CGT	.		0.453	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
PRKAG2	51422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	151372542	151372542	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:151372542T>C	ENST00000287878.4	-	4	1152	c.648A>G	c.(646-648)ccA>ccG	p.P216P	PRKAG2_ENST00000492843.1_Silent_p.P92P|PRKAG2_ENST00000392801.2_Silent_p.P172P|PRKAG2_ENST00000461529.1_5'Flank|PRKAG2_ENST00000433631.2_Silent_p.P92P	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	216					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	GTGATGCCAGTGGAGGCCTGG	0.617																																					p.P216P		.											.	PRKAG2	658	0			c.A648G						.						53.0	51.0	52.0					7																	151372542		2203	4300	6503	SO:0001819	synonymous_variant	51422	exon4			TGCCAGTGGAGGC	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.648A>G	7.37:g.151372542T>C		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	59.0	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Silent	SNP	ENST00000287878.4	37	CCDS5928.1																																																																																			.		0.617	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
CTC-497E21.3	0	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	13031942	13031942	+	lincRNA	SNP	G	G	T	rs375762962		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:13031942G>T	ENST00000533002.1	-	0	0																											TCAACTACGTGCAGGACACTT	0.682																																					p.V273V		.											.	.	.	0			c.G819T						.						16.0	19.0	18.0					11																	13031942		1899	3670	5569			644943	exon1			CTACGTGCAGGAC																													11.37:g.13031942G>T		Somatic	454.0	0.0		WXS	Illumina HiSeq	Phase_I	364.0	169.0	NM_001080521		Silent	SNP	ENST00000533002.1	37																																																																																				.		0.682	CTC-497E21.3-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000387000.1		
RAVER2	55225	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	65243382	65243382	+	Missense_Mutation	SNP	A	A	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:65243382A>C	ENST00000294428.3	+	3	471	c.393A>C	c.(391-393)aaA>aaC	p.K131N	RAVER2_ENST00000430964.2_5'Flank|RAVER2_ENST00000371072.4_Missense_Mutation_p.K131N			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	131	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						TTAGAGGAAAAGACTTAATAG	0.368																																					p.K131N		.											.	RAVER2	135	0			c.A393C						.						127.0	115.0	119.0					1																	65243382		1859	4098	5957	SO:0001583	missense	55225	exon3			AGGAAAAGACTTA	AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.393A>C	1.37:g.65243382A>C	ENSP00000294428:p.Lys131Asn	Somatic	170.0	0.0		WXS	Illumina HiSeq	.	163.0	79.0	NM_018211	Q6P141|Q9NPV7	Missense_Mutation	SNP	ENST00000294428.3	37		.	.	.	.	.	.	.	.	.	.	A	18.82	3.705260	0.68615	.	.	ENSG00000162437	ENST00000371072;ENST00000294428	T;T	0.09073	3.02;3.02	5.61	0.83	0.18854	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.118251	0.53938	D	0.000051	T	0.09069	0.0224	L	0.56769	1.78	0.80722	D	1	D;D	0.54772	0.968;0.96	P;P	0.56960	0.81;0.711	T	0.02958	-1.1089	10	0.87932	D	0	-0.5305	9.991	0.41872	0.6602:0.0:0.3398:0.0	.	131;131	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	N	131	ENSP00000360112:K131N;ENSP00000294428:K131N	ENSP00000294428:K131N	K	+	3	2	RAVER2	65015970	0.998000	0.40836	0.935000	0.37517	0.996000	0.88848	0.773000	0.26661	-0.099000	0.12263	0.533000	0.62120	AAA	.		0.368	RAVER2-201	KNOWN	basic	protein_coding	protein_coding		NM_018211	
RHBDF2	79651	hgsc.bcm.edu;bcgsc.ca	37	17	74473785	74473787	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	TCC	TCC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:74473785_74473787delTCC	ENST00000313080.4	-	7	1113_1115	c.840_842delGGA	c.(838-843)gaggat>gat	p.E280del	RHBDF2_ENST00000592378.1_5'Flank|RHBDF2_ENST00000591885.1_In_Frame_Del_p.E251del|RHBDF2_ENST00000389760.4_In_Frame_Del_p.E251del	NM_024599.5	NP_078875.4	Q6PJF5	RHDF2_HUMAN	rhomboid 5 homolog 2 (Drosophila)	280					negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(4)|skin(1)	27						ATCGACCACATCCTCCTCCAGGA	0.64																																					p.280_281del		.											.	RHBDF2	90	0			c.840_842del						.																																			SO:0001651	inframe_deletion	79651	exon7			ACCACATCCTCCT	BC016034	CCDS32743.1, CCDS32744.1	17q25.3	2014-09-17	2006-02-22	2006-02-22		ENSG00000129667			20788	protein-coding gene	gene with protein product		614404	"""rhomboid, veinlet-like 6 (Drosophila)"", ""tylosis with oesophageal cancer"""	RHBDL6, TOC		12838346, 22265016	Standard	NM_024599		Approved	FLJ22341, RHBDL5, TOCG	uc002jrq.2	Q6PJF5		ENST00000313080.4:c.840_842delGGA	17.37:g.74473791_74473793delTCC	ENSP00000322775:p.Glu280del	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	28.0	NM_024599	A6NEM3|A8K801|Q5U607|Q5YGQ8|Q9H6E9	In_Frame_Del	DEL	ENST00000313080.4	37	CCDS32743.1																																																																																			.		0.640	RHBDF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450134.1	NM_024599	
RP1L1	94137	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	10480350	10480350	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr8:10480350T>C	ENST00000382483.3	-	2	585	c.362A>G	c.(361-363)gAg>gGg	p.E121G	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	121					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGGGTTTCTCTCCTGTGGCCG	0.622																																					p.E121G		.											.	RP1L1	139	0			c.A362G						.						17.0	19.0	18.0					8																	10480350		1959	4125	6084	SO:0001583	missense	94137	exon2			TTTCTCTCCTGTG	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.362A>G	8.37:g.10480350T>C	ENSP00000371923:p.Glu121Gly	Somatic	63.0	1.0		WXS	Illumina HiSeq	Phase_I	26.0	4.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	t	3.128	-0.179005	0.06380	.	.	ENSG00000183638	ENST00000382483	T	0.04015	3.73	4.2	0.103	0.14526	.	.	.	.	.	T	0.01661	0.0053	N	0.01352	-0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.47315	-0.9127	9	0.30078	T	0.28	-8.0075	5.336	0.15957	0.0:0.4985:0.1462:0.3553	.	121	A6NKC6	.	G	121	ENSP00000371923:E121G	ENSP00000371923:E121G	E	-	2	0	RP1L1	10517760	0.000000	0.05858	0.001000	0.08648	0.038000	0.13279	-0.051000	0.11885	0.074000	0.16767	-0.237000	0.12165	GAG	.		0.622	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
RPS6KA3	6197	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	20194413	20194413	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:20194413C>A	ENST00000379565.3	-	13	1264	c.1057G>T	c.(1057-1059)Gat>Tat	p.D353Y	RPS6KA3_ENST00000379548.4_Missense_Mutation_p.D324Y|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.D325Y|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.D325Y	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	353	AGC-kinase C-terminal.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TAGAATGTATCTTCAGGCCTG	0.333																																					p.D353Y		.											.	RPS6KA3	1504	0			c.G1057T						.						80.0	77.0	78.0					X																	20194413		2203	4300	6503	SO:0001583	missense	6197	exon13			ATGTATCTTCAGG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1057G>T	X.37:g.20194413C>A	ENSP00000368884:p.Asp353Tyr	Somatic	317.0	0.0		WXS	Illumina HiSeq	Phase_I	356.0	146.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	37	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501688	0.85176	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.3	5.3	0.74995	Protein kinase, C-terminal (1);AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.91486	0.7312	H	0.95611	3.695	0.80722	D	1	P;D;B;D	0.76494	0.503;0.999;0.022;0.994	P;D;B;D	0.66847	0.803;0.947;0.097;0.927	D	0.94048	0.7315	10	0.72032	D	0.01	.	18.0569	0.89366	0.0:1.0:0.0:0.0	.	325;324;325;353	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	Y	353;325;324;325	ENSP00000368884:D353Y;ENSP00000440220:D325Y;ENSP00000368865:D324Y;ENSP00000444837:D325Y	ENSP00000368865:D324Y	D	-	1	0	RPS6KA3	20104334	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.346000	0.79347	2.198000	0.70561	0.513000	0.50165	GAT	.		0.333	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
SCN1A	6323	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	2	166854614	166854614	+	Silent	SNP	C	C	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr2:166854614C>T	ENST00000303395.4	-	23	4409	c.4410G>A	c.(4408-4410)ggG>ggA	p.G1470G	SCN1A_ENST00000409050.1_Silent_p.G1442G|SCN1A_ENST00000423058.2_Silent_p.G1470G|SCN1A_ENST00000375405.3_Silent_p.G1459G|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1470			G -> W (in EIEE6; dbSNP:rs121917924). {ECO:0000269|PubMed:17561957}.		adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGAAGAAGGACCCAAAGATGA	0.338																																					p.G1470G		.											.	SCN1A	147	0			c.G4410A						.						90.0	81.0	84.0					2																	166854614		2203	4292	6495	SO:0001819	synonymous_variant	6323	exon23			GAAGGACCCAAAG	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4410G>A	2.37:g.166854614C>T		Somatic	254.0	0.0		WXS	Illumina HiSeq	Phase_I	230.0	102.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																			.		0.338	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SEMA3E	9723	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	83029465	83029465	+	Silent	SNP	T	T	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr7:83029465T>G	ENST00000307792.3	-	11	1712	c.1245A>C	c.(1243-1245)atA>atC	p.I415I	SEMA3E_ENST00000427262.1_Silent_p.I355I	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	415	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				GGGCAGGTTTTATGGCCTGGT	0.423																																					p.I415I		.											.	SEMA3E	93	0			c.A1245C						.						204.0	185.0	191.0					7																	83029465		2203	4300	6503	SO:0001819	synonymous_variant	9723	exon11			AGGTTTTATGGCC	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1245A>C	7.37:g.83029465T>G		Somatic	403.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	157.0	NM_012431	B4E1P1|Q75M94|Q75M97	Silent	SNP	ENST00000307792.3	37	CCDS34674.1																																																																																			.		0.423	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
SIGLEC1	6614	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	20	3672111	3672111	+	Silent	SNP	G	G	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:3672111G>A	ENST00000344754.4	-	17	4466	c.4467C>T	c.(4465-4467)caC>caT	p.H1489H	SIGLEC1_ENST00000202578.4_Silent_p.H1489H	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1489	Ig-like C2-type 15.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CAGGCTCCGCGTGCAGCCGCC	0.672																																					p.H1489H		.											.	SIGLEC1	167	0			c.C4467T						.						66.0	67.0	66.0					20																	3672111		2203	4300	6503	SO:0001819	synonymous_variant	6614	exon17			CTCCGCGTGCAGC	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.4467C>T	20.37:g.3672111G>A		Somatic	364.0	0.0		WXS	Illumina HiSeq	Phase_I	359.0	172.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	G	0.074	-1.195928	0.01594	.	.	ENSG00000088827	ENST00000419548	.	.	.	5.34	-9.34	0.00636	.	.	.	.	.	T	0.14874	0.0359	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.18871	-1.0323	4	.	.	.	.	1.8855	0.03237	0.4812:0.1018:0.1642:0.2527	.	.	.	.	C	303	.	.	R	-	1	0	SIGLEC1	3620111	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.686000	0.01929	-1.228000	0.02568	-0.140000	0.14226	CGC	.		0.672	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
SLITRK4	139065	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	142717432	142717432	+	Missense_Mutation	SNP	A	A	G			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:142717432A>G	ENST00000381779.4	-	2	1718	c.1493T>C	c.(1492-1494)tTa>tCa	p.L498S	SLITRK4_ENST00000356928.1_Missense_Mutation_p.L498S|SLITRK4_ENST00000338017.4_Missense_Mutation_p.L498S	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	498						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					CAGTCTAGCTAAGGGTGCTCC	0.453																																					p.L498S		.											.	SLITRK4	193	0			c.T1493C						.						103.0	108.0	106.0					X																	142717432		2203	4300	6503	SO:0001583	missense	139065	exon2			CTAGCTAAGGGTG	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1493T>C	X.37:g.142717432A>G	ENSP00000371198:p.Leu498Ser	Somatic	274.0	0.0		WXS	Illumina HiSeq	Phase_I	245.0	114.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	37	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.914539	0.52546	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.80653	-1.4;-1.4;-1.4	5.38	5.38	0.77491	.	0.000000	0.64402	U	0.000004	D	0.91270	0.7248	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92915	0.6350	10	0.72032	D	0.01	-5.2205	13.372	0.60719	1.0:0.0:0.0:0.0	.	498	Q8IW52	SLIK4_HUMAN	S	498	ENSP00000371198:L498S;ENSP00000349400:L498S;ENSP00000336627:L498S	ENSP00000336627:L498S	L	-	2	0	SLITRK4	142545098	1.000000	0.71417	0.863000	0.33907	0.968000	0.65278	9.287000	0.95975	1.910000	0.55303	0.486000	0.48141	TTA	.		0.453	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
SOGA1	140710	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35437068	35437068	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:35437068G>T	ENST00000357779.3	-	8	2274	c.1948C>A	c.(1948-1950)Cag>Aag	p.Q650K	SOGA1_ENST00000456801.2_Missense_Mutation_p.Q491K|SOGA1_ENST00000279034.6_Missense_Mutation_p.Q650K|SOGA1_ENST00000237536.4_Missense_Mutation_p.Q888K			O94964	SOGA1_HUMAN	suppressor of glucose, autophagy associated 1	650					insulin receptor signaling pathway (GO:0008286)|negative regulation of gluconeogenesis (GO:0045721)|regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(5)|kidney(1)|lung(21)|urinary_tract(1)	28						CAGAATTTCTGCTCCAGCCTC	0.577											OREG0025909	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q888K		.											.	.	.	0			c.C2662A						.						36.0	39.0	38.0					20																	35437068		1923	4140	6063	SO:0001583	missense	140710	exon8			ATTTCTGCTCCAG	AK126630	CCDS46598.1, CCDS54459.1	20q11.23	2012-03-01	2012-02-27	2012-02-27	ENSG00000149639	ENSG00000149639			16111	protein-coding gene	gene with protein product	"""suppressor of glucose by autophagy"", ""suppressor of glucose from autophagy"""		"""chromosome 20 open reading frame 117"", ""KIAA0889"""	C20orf117, KIAA0889		20813965	Standard	NM_080627		Approved	dJ132F21.1, FLJ44670, SOGA	uc021wcx.1	O94964	OTTHUMG00000032395	ENST00000357779.3:c.1948C>A	20.37:g.35437068G>T	ENSP00000350424:p.Gln650Lys	Somatic	88.0	0.0	855	WXS	Illumina HiSeq	Phase_I	61.0	25.0	NM_080627	A6NK10|Q14DB2|Q5JW51|Q6ZTG8	Missense_Mutation	SNP	ENST00000357779.3	37		.	.	.	.	.	.	.	.	.	.	G	15.96	2.988168	0.53934	.	.	ENSG00000149639	ENST00000237536;ENST00000279034;ENST00000456801;ENST00000357779	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.32346	0.0826	L	0.36672	1.1	0.53688	D	0.999977	P	0.43412	0.806	B	0.35073	0.195	T	0.07177	-1.0786	10	0.23302	T	0.38	-43.3312	17.8379	0.88706	0.0:0.0:1.0:0.0	.	650	O94964-4	.	K	888;650;491;650	ENSP00000237536:Q888K;ENSP00000279034:Q650K;ENSP00000413886:Q491K;ENSP00000350424:Q650K	ENSP00000237536:Q888K	Q	-	1	0	KIAA0889	34870482	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.493000	0.60341	2.745000	0.94114	0.655000	0.94253	CAG	.		0.577	SOGA1-201	KNOWN	basic	protein_coding	protein_coding		NM_199181	
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16255127	16255127	+	Missense_Mutation	SNP	G	G	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:16255127G>C	ENST00000375759.3	+	11	2596	c.2392G>C	c.(2392-2394)Gat>Cat	p.D798H		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	798	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ACGAACTTTTGATCCGGAGAG	0.438																																					p.D798H		.											.	SPEN	298	0			c.G2392C						.						77.0	83.0	81.0					1																	16255127		2203	4300	6503	SO:0001583	missense	23013	exon11			ACTTTTGATCCGG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2392G>C	1.37:g.16255127G>C	ENSP00000364912:p.Asp798His	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	16.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695394	0.48202	.	.	ENSG00000065526	ENST00000375759	T	0.10763	2.84	4.89	4.89	0.63831	.	.	.	.	.	T	0.22399	0.0540	L	0.51422	1.61	0.46061	D	0.998847	D	0.60160	0.987	P	0.54460	0.753	T	0.00380	-1.1776	9	0.51188	T	0.08	-0.8309	18.2394	0.89961	0.0:0.0:1.0:0.0	.	798	Q96T58	MINT_HUMAN	H	798	ENSP00000364912:D798H	ENSP00000364912:D798H	D	+	1	0	SPEN	16127714	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	8.647000	0.91057	2.525000	0.85131	0.563000	0.77884	GAT	.		0.438	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SYNE1	23345	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152740820	152740820	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr6:152740820G>T	ENST00000367255.5	-	40	5906	c.5305C>A	c.(5305-5307)Caa>Aaa	p.Q1769K	SYNE1_ENST00000448038.1_Missense_Mutation_p.Q1776K|SYNE1_ENST00000423061.1_Missense_Mutation_p.Q1776K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q1806K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q1769K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1769					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCATCAAATTGCTGGTGTTCA	0.353										HNSCC(10;0.0054)																											p.Q1776K		.											.	SYNE1	607	0			c.C5326A						.						79.0	78.0	79.0					6																	152740820		2203	4300	6503	SO:0001583	missense	23345	exon40			CAAATTGCTGGTG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5305C>A	6.37:g.152740820G>T	ENSP00000356224:p.Gln1769Lys	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	247.0	79.0	NM_033071	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175436	0.38413	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000018	T	0.17916	0.0430	L	0.52364	1.645	0.80722	D	1	B;B;B;B	0.27013	0.067;0.166;0.166;0.029	B;B;B;B	0.19391	0.017;0.025;0.025;0.019	T	0.02942	-1.1091	10	0.21014	T	0.42	.	14.0245	0.64577	0.0:0.0:0.8488:0.1512	.	1752;1769;1769;1776	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	1769;1776;1769;1776;1806	ENSP00000356224:Q1769K;ENSP00000396024:Q1776K;ENSP00000265368:Q1769K;ENSP00000390975:Q1776K;ENSP00000341887:Q1806K	ENSP00000265368:Q1769K	Q	-	1	0	SYNE1	152782513	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.505000	0.53356	2.594000	0.87642	0.650000	0.86243	CAA	.		0.353	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TCEANC	170082	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	X	13681572	13681572	+	Silent	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:13681572T>A	ENST00000380600.1	+	2	1032	c.945T>A	c.(943-945)ctT>ctA	p.L315L	TCEANC_ENST00000545566.1_Silent_p.L315L|TCEANC_ENST00000544987.1_Silent_p.L315L|TCEANC_ENST00000490617.1_3'UTR|TCEANC_ENST00000314720.4_Silent_p.L345L			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	315					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						GAGGAACACTTTTCCTTCCCA	0.423																																					p.L345L		.											.	TCEANC	41	0			c.T1035A						.						50.0	41.0	44.0					X																	13681572		1913	4100	6013	SO:0001819	synonymous_variant	170082	exon4			AACACTTTTCCTT		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.945T>A	X.37:g.13681572T>A		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	72.0	NM_152634	A6NI06|B2RDM3	Silent	SNP	ENST00000380600.1	37																																																																																				.		0.423	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055796.1	NM_152634	
TMEM215	401498	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	32784212	32784212	+	Missense_Mutation	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr9:32784212G>T	ENST00000342743.5	+	2	396	c.31G>T	c.(31-33)Ggg>Tgg	p.G11W		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	11						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						CCCGAGGACTGGGCTGGTGGT	0.562																																					p.G11W		.											.	TMEM215	90	0			c.G31T						.						119.0	114.0	115.0					9																	32784212		2203	4300	6503	SO:0001583	missense	401498	exon2			AGGACTGGGCTGG		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.31G>T	9.37:g.32784212G>T	ENSP00000345468:p.Gly11Trp	Somatic	390.0	1.0		WXS	Illumina HiSeq	Phase_I	432.0	175.0	NM_212558	Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	37	CCDS6530.1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544356	0.45280	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.31	5.31	0.75309	.	0.000000	0.64402	D	0.000002	T	0.65954	0.2741	L	0.27053	0.805	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.69997	-0.4993	9	0.87932	D	0	-20.2017	16.4706	0.84111	0.0:0.0:1.0:0.0	.	11	Q68D42	TM215_HUMAN	W	11	.	ENSP00000345468:G11W	G	+	1	0	TMEM215	32774212	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.536000	0.82023	2.494000	0.84150	0.462000	0.41574	GGG	.		0.562	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	NM_212558	
TNR	7143	ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175360557	175360557	+	Silent	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:175360557C>A	ENST00000367674.2	-	7	2082	c.1374G>T	c.(1372-1374)gtG>gtT	p.V458V	TNR_ENST00000263525.2_Silent_p.V458V			Q92752	TENR_HUMAN	tenascin R	458	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CCTGAGCAATCACTCCCCCTT	0.483																																					p.V458V		.											.	TNR	324	0			c.G1374T						.						47.0	46.0	46.0					1																	175360557		2203	4300	6503	SO:0001819	synonymous_variant	7143	exon7			AGCAATCACTCCC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1374G>T	1.37:g.175360557C>A		Somatic	92.0	1.0		WXS	Illumina HiSeq	.	184.0	135.0	NM_003285	C9J563|Q15568|Q5R3G0	Silent	SNP	ENST00000367674.2	37	CCDS1318.1																																																																																			.		0.483	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
TP53	7157	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	17	7577565	7577565	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr17:7577565T>C	ENST00000269305.4	-	7	905	c.716A>G	c.(715-717)aAc>aGc	p.N239S	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.N239S|TP53_ENST00000445888.2_Missense_Mutation_p.N239S|TP53_ENST00000455263.2_Missense_Mutation_p.N239S|TP53_ENST00000413465.2_Missense_Mutation_p.N239S|TP53_ENST00000420246.2_Missense_Mutation_p.N239S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	239	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> D (in sporadic cancers; somatic mutation).|N -> H (in a sporadic cancer; somatic mutation).|N -> I (in a sporadic cancer; somatic mutation).|N -> K (in sporadic cancers; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> T (in sporadic cancers; somatic mutation).|N -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.N239S(28)|p.0?(8)|p.?(5)|p.N239T(4)|p.M237_N239delMCN(4)|p.N146S(3)|p.N239_C242delNSSC(3)|p.N239fs*25(2)|p.N239_S240delNS(2)|p.Y236_M243delYMCNSSCM(1)|p.N239fs*1(1)|p.N239_S240insN(1)|p.V225fs*23(1)|p.N239fs*6(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.M144_N146delMCN(1)|p.C238fs*21(1)|p.N239I(1)|p.H233fs*6(1)|p.N239*(1)|p.H233_C242del10(1)|p.N239_C242>S(1)|p.N239fs*>48(1)|p.N146fs*>10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGAACTGTTACACATGTA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.N239S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,-1	TP53	70225	76	Substitution - Missense(36)|Deletion - In frame(14)|Whole gene deletion(8)|Deletion - Frameshift(5)|Unknown(5)|Insertion - Frameshift(4)|Substitution - Nonsense(1)|Insertion - In frame(1)|Complex - frameshift(1)|Complex - deletion inframe(1)	biliary_tract(10)|urinary_tract(6)|lung(6)|ovary(6)|upper_aerodigestive_tract(5)|haematopoietic_and_lymphoid_tissue(5)|oesophagus(5)|breast(5)|bone(5)|central_nervous_system(4)|large_intestine(4)|endometrium(4)|kidney(4)|stomach(3)|thyroid(1)|soft_tissue(1)|liver(1)|pancreas(1)	c.A716G						.						135.0	105.0	115.0					17																	7577565		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GAACTGTTACACA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.716A>G	17.37:g.7577565T>C	ENSP00000269305:p.Asn239Ser	Somatic	266.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	96.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	24.7	4.565663	0.86439	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99760	-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66;-6.66	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	M	0.87381	2.88	0.58432	D	0.999991	D;B;D;D;D;D	0.89917	0.988;0.31;0.999;0.98;0.99;1.0	P;B;D;P;P;D	0.87578	0.826;0.104;0.981;0.815;0.891;0.998	D	0.97237	0.9888	10	0.87932	D	0	-35.9081	12.3101	0.54924	0.0:0.0:0.0:1.0	.	239;239;146;239;239;239	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	239;239;239;239;239;239;228;146;107;146	ENSP00000410739:N239S;ENSP00000352610:N239S;ENSP00000269305:N239S;ENSP00000398846:N239S;ENSP00000391127:N239S;ENSP00000391478:N239S;ENSP00000425104:N107S;ENSP00000423862:N146S	ENSP00000269305:N239S	N	-	2	0	TP53	7518290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.074000	0.62210	0.379000	0.24179	AAC	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TTC22	55001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	55248004	55248004	+	Silent	SNP	G	G	A	rs576430473		TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:55248004G>A	ENST00000371276.4	-	6	1270	c.1167C>T	c.(1165-1167)atC>atT	p.I389I		NM_001114108.1	NP_001107580.1	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22	389										kidney(1)|large_intestine(1)|lung(7)|skin(1)	10						TTACCTGGCCGATGTCCAGGT	0.572													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21591	0.0		0.0	False		,,,				2504	0.0				p.I389I		.											.	TTC22	90	0			c.C1167T						.						54.0	52.0	53.0					1																	55248004		692	1591	2283	SO:0001819	synonymous_variant	55001	exon6			CTGGCCGATGTCC	AK000626	CCDS598.1, CCDS44152.1	1p32.3	2013-01-11			ENSG00000006555	ENSG00000006555		"""Tetratricopeptide (TTC) repeat domain containing"""	26067	protein-coding gene	gene with protein product							Standard	NM_017904		Approved	FLJ20619	uc009vzt.1	Q5TAA0	OTTHUMG00000009916	ENST00000371276.4:c.1167C>T	1.37:g.55248004G>A		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	24.0	NM_001114108	Q9NWT4	Silent	SNP	ENST00000371276.4	37	CCDS44152.1																																																																																			.		0.572	TTC22-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027438.1	NM_017904	
TTR	7276	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	29172906	29172906	+	Silent	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr18:29172906T>A	ENST00000237014.3	+	2	294	c.117T>A	c.(115-117)gcT>gcA	p.A39A		NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin	39					extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)			cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	TTCTAGATGCTGTCCGAGGCA	0.502																																					p.A39A		.											.	TTR	91	0			c.T117A						.						140.0	115.0	123.0					18																	29172906		2203	4300	6503	SO:0001819	synonymous_variant	7276	exon2			AGATGCTGTCCGA	M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.117T>A	18.37:g.29172906T>A		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	63.0	NM_000371	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Silent	SNP	ENST00000237014.3	37	CCDS11899.1																																																																																			.		0.502	TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254948.1	NM_000371	
USP33	23032	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	78183652	78183652	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr1:78183652T>C	ENST00000370793.1	-	18	2257	c.1911A>G	c.(1909-1911)ctA>ctG	p.L637L	USP33_ENST00000370792.3_Silent_p.L629L|USP33_ENST00000370794.3_Silent_p.L606L|USP33_ENST00000357428.1_Silent_p.L637L	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	637	USP.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						CCAAGCCTTCTAGCGGAAATG	0.368																																					p.L637L	Melanoma(152;72 1870 11110 26780 42647)	.											.	USP33	659	0			c.A1911G						.						124.0	130.0	128.0					1																	78183652		2203	4300	6503	SO:0001819	synonymous_variant	23032	exon18			GCCTTCTAGCGGA	AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.1911A>G	1.37:g.78183652T>C		Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	84.0	NM_015017	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Silent	SNP	ENST00000370793.1	37	CCDS678.1	.	.	.	.	.	.	.	.	.	.	T	2.483	-0.319298	0.05386	.	.	ENSG00000077254	ENST00000481579	.	.	.	4.7	-3.18	0.05186	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9442	0.35749	0.103:0.7222:0.0:0.1748	.	.	.	.	W	242	.	.	X	-	2	0	USP33	77956240	0.994000	0.37717	0.361000	0.25849	0.375000	0.29983	0.369000	0.20416	-0.751000	0.04734	-1.553000	0.00894	TAG	.		0.368	USP33-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000026923.2	NM_015017	
VSX1	30813	hgsc.bcm.edu;broad.mit.edu	37	20	25057157	25057157	+	Missense_Mutation	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr20:25057157T>C	ENST00000376709.4	-	5	1101	c.838A>G	c.(838-840)Agg>Ggg	p.R280G	VSX1_ENST00000451258.1_Intron|VSX1_ENST00000429762.3_Intron|VSX1_ENST00000444511.2_Intron|VSX1_ENST00000424574.1_Intron	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	280					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						CCTGGCTTCCTTATCATCCCC	0.368																																					p.R280G		.											.	VSX1	90	0			c.A838G						.						90.0	99.0	96.0					20																	25057157		2203	4300	6503	SO:0001583	missense	30813	exon5			GCTTCCTTATCAT	AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.838A>G	20.37:g.25057157T>C	ENSP00000365899:p.Arg280Gly	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	4.0	NM_014588	B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Missense_Mutation	SNP	ENST00000376709.4	37	CCDS13168.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.940829	0.34283	.	.	ENSG00000100987	ENST00000376709	D	0.92397	-3.03	3.77	3.77	0.43336	.	0.156351	0.56097	D	0.000026	D	0.88183	0.6368	L	0.55834	1.745	0.33126	D	0.542457	B	0.14438	0.01	B	0.06405	0.002	D	0.87015	0.2125	10	0.34782	T	0.22	.	9.9927	0.41881	0.0:0.0:0.0:1.0	.	280	Q9NZR4	VSX1_HUMAN	G	280	ENSP00000365899:R280G	ENSP00000365899:R280G	R	-	1	2	VSX1	25005157	0.847000	0.29606	0.942000	0.38095	0.937000	0.57800	1.913000	0.39956	1.576000	0.49790	0.533000	0.62120	AGG	.		0.368	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078384.3		
VWA5A	4013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124013240	124013240	+	Silent	SNP	T	T	C			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr11:124013240T>C	ENST00000456829.2	+	17	2366	c.2115T>C	c.(2113-2115)ggT>ggC	p.G705G	VWA5A_ENST00000360334.4_3'UTR|VWA5A_ENST00000392748.1_Silent_p.G705G	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	705										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						AGATCCTAGGTATGAGTTTGG	0.418																																					p.G705G		.											.	VWA5A	92	0			c.T2115C						.						115.0	107.0	110.0					11																	124013240		2201	4299	6500	SO:0001819	synonymous_variant	4013	exon16			CCTAGGTATGAGT	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.2115T>C	11.37:g.124013240T>C		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	40.0	NM_014622	Q6UN19|Q6UN20|Q9BVF8	Silent	SNP	ENST00000456829.2	37	CCDS8444.1																																																																																			.		0.418	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387273.1	NM_014622	
WDR44	54521	bcgsc.ca;mdanderson.org	37	X	117566745	117566745	+	Splice_Site	SNP	T	T	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chrX:117566745T>A	ENST00000254029.3	+	13	2134	c.1739T>A	c.(1738-1740)gTa>gAa	p.V580E	WDR44_ENST00000371825.3_Splice_Site_p.V580E|WDR44_ENST00000371822.5_Splice_Site_p.V555E	NM_019045.4	NP_061918.3	Q5JSH3	WDR44_HUMAN	WD repeat domain 44	580						endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	33						TCCAAATAGGTATGCAGTGGA	0.393																																					p.V580E		.											.	WDR44	133	0			c.T1739A						.						145.0	133.0	137.0					X																	117566745		2203	4300	6503	SO:0001630	splice_region_variant	54521	exon13			AATAGGTATGCAG	AK001978	CCDS14572.1, CCDS55482.1, CCDS55483.1	Xq24	2013-01-09			ENSG00000131725	ENSG00000131725		"""WD repeat domain containing"""	30512	protein-coding gene	gene with protein product						12477932	Standard	NM_019045		Approved	DKFZp686L20145, RPH11, RAB11BP	uc004eqn.3	Q5JSH3	OTTHUMG00000022254	ENST00000254029.3:c.1738-1T>A	X.37:g.117566745T>A		Somatic	295.0	0.0		WXS	Illumina HiSeq	Phase_1	305.0	18.0	NM_001184965	B4DSE9|F8W913|Q0JS52|Q0JTF3|Q5JSH2|Q6ZSC1|Q7Z365|Q7Z3P6|Q8NAU8|Q8NHU5|Q9NUV4	Missense_Mutation	SNP	ENST00000254029.3	37	CCDS14572.1	.	.	.	.	.	.	.	.	.	.	T	10.92	1.487922	0.26686	.	.	ENSG00000131725	ENST00000371822;ENST00000254029;ENST00000371825	T;T;T	0.75589	-0.95;-0.36;-0.22	5.44	5.44	0.79542	WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.308918	0.35903	N	0.002911	T	0.64940	0.2644	N	0.22421	0.69	0.54753	D	0.99998	B;B;B;B	0.33345	0.409;0.282;0.321;0.003	B;B;B;B	0.35688	0.187;0.103;0.208;0.004	T	0.68383	-0.5423	10	0.72032	D	0.01	-2.3606	14.6003	0.68435	0.0:0.0:0.0:1.0	.	555;580;580;580	F8W913;E9PCI7;Q5JSH3-2;Q5JSH3	.;.;.;WDR44_HUMAN	E	555;580;580	ENSP00000360887:V555E;ENSP00000254029:V580E;ENSP00000360890:V580E	ENSP00000254029:V580E	V	+	2	0	WDR44	117450773	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	3.662000	0.54510	1.829000	0.53265	0.478000	0.44815	GTA	.		0.393	WDR44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058001.1	NM_019045	Missense_Mutation
XYLT1	64131	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	16	17211555	17211555	+	Silent	SNP	G	G	T			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr16:17211555G>T	ENST00000261381.6	-	11	2589	c.2505C>A	c.(2503-2505)acC>acA	p.T835T		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	835					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CGAGGAATTTGGTCTCTGCAA	0.542																																					p.T835T		.											.	XYLT1	94	0			c.C2505A						.						84.0	81.0	82.0					16																	17211555		2197	4300	6497	SO:0001819	synonymous_variant	64131	exon11			GAATTTGGTCTCT	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2505C>A	16.37:g.17211555G>T		Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	106.0	NM_022166	Q9H1B6	Silent	SNP	ENST00000261381.6	37	CCDS10569.1																																																																																			.		0.542	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
ZFP42	132625	broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	188924586	188924586	+	Missense_Mutation	SNP	C	C	A			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr4:188924586C>A	ENST00000326866.4	+	4	1033	c.625C>A	c.(625-627)Ctc>Atc	p.L209I	ZFP42_ENST00000509524.1_Missense_Mutation_p.L209I	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	209					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		GAGAAAGCATCTCCTCATTCA	0.488																																					p.L209I		.											.	ZFP42	228	0			c.C625A						.						126.0	129.0	128.0					4																	188924586		2203	4300	6503	SO:0001583	missense	132625	exon4			AAGCATCTCCTCA	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.625C>A	4.37:g.188924586C>A	ENSP00000317686:p.Leu209Ile	Somatic	89.0	1.0		WXS	Illumina HiSeq	Phase_I	73.0	21.0	NM_174900	D3DP65|Q8WXE2	Missense_Mutation	SNP	ENST00000326866.4	37	CCDS3849.1	.	.	.	.	.	.	.	.	.	.	C	12.15	1.850513	0.32699	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	T;T	0.12879	2.64;2.64	4.39	-3.72	0.04411	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.172379	0.37053	N	0.002267	T	0.06325	0.0163	N	0.17312	0.475	0.09310	N	1	B	0.20550	0.046	B	0.33392	0.163	T	0.24512	-1.0158	10	0.51188	T	0.08	.	0.1571	0.00099	0.2482:0.1882:0.2283:0.3353	.	209	Q96MM3	ZFP42_HUMAN	I	209	ENSP00000317686:L209I;ENSP00000424662:L209I	ENSP00000317686:L209I	L	+	1	0	ZFP42	189161580	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.211000	0.09332	-0.864000	0.04078	-0.913000	0.02753	CTC	.		0.488	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359794.1	NM_174900	
TBC1D9B	23061	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	5	179331759	179331760	+	Missense_Mutation	DNP	GG	GG	AA			TCGA-BC-A3KG-01A-11D-A20W-10	TCGA-BC-A3KG-10A-01D-A20W-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3d178885-f113-42a2-b34d-d564960d9314	685e0c81-2971-413a-9a2e-de27a62de591	g.chr5:179331759_179331760GG>AA	ENST00000356834.3	-	2	208_209	c.171_172CC>TT	c.(169-174)gcCCct>gcTTct	p.P58S	TBC1D9B_ENST00000355235.3_Missense_Mutation_p.P58S	NM_198868.2	NP_942568.2	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	58						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	28	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATGCGGTAAGGGGCCACGCGGG	0.668																																					p.P58S		.											.	.	.	0			.						.																																			SO:0001583	missense	23061	.			GGTAAGGGGCCAC	AB014576	CCDS4450.1, CCDS43408.1	5q35.3	2013-01-10			ENSG00000197226	ENSG00000197226		"""EF-hand domain containing"""	29097	protein-coding gene	gene with protein product						9734811	Standard	NM_198868		Approved	KIAA0676	uc003mlh.3	Q66K14	OTTHUMG00000130911	ENST00000356834.3:c.171_172delinsAA	5.37:g.179331759_179331760delinsAA	ENSP00000349291:p.Pro58Ser	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	64.0	.	D3DWQ5|D3DWQ6|O75163|Q53EY0|Q6MZI2|Q96H49	Missense_Mutation	DNP	ENST00000356834.3	37	CCDS43408.1																																																																																			.		0.668	TBC1D9B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253501.3	NM_015043	
