#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACACA	31	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	35538246	35538246	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:35538246T>C	ENST00000394406.2	-	40	4907	c.4717A>G	c.(4717-4719)Atc>Gtc	p.I1573V	ACACA_ENST00000353139.5_Missense_Mutation_p.I1610V|ACACA_ENST00000360679.3_Missense_Mutation_p.I1515V|ACACA_ENST00000335166.5_Missense_Mutation_p.I1495V	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1573					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GGAGTATTGATTAACATTCCA	0.408																																					p.I1610V	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	.											.	ACACA	154	0			c.A4828G						.						204.0	187.0	193.0					17																	35538246		2203	4300	6503	SO:0001583	missense	31	exon40			TATTGATTAACAT	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.4717A>G	17.37:g.35538246T>C	ENSP00000377928:p.Ile1573Val	Somatic	345.0	0.0		WXS	Illumina HiSeq	Phase_I	224.0	112.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	37	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.777983	0.31502	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330	D;D;D;D	0.94497	-3.44;-3.43;-3.44;-3.43	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.88782	0.6530	L	0.31476	0.935	0.80722	D	1	B;P;B;B	0.39480	0.296;0.675;0.015;0.026	B;B;B;B	0.37601	0.101;0.254;0.016;0.035	D	0.87674	0.2543	10	0.02654	T	1	-15.0967	15.6571	0.77150	0.0:0.0:0.0:1.0	.	321;1610;1573;1515	F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;ACACA_HUMAN;.	V	1610;1515;1573;1597;1495;321	ENSP00000344789:I1610V;ENSP00000353898:I1515V;ENSP00000377928:I1573V;ENSP00000335323:I1495V	ENSP00000335323:I1495V	I	-	1	0	ACACA	32612359	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.993000	0.88291	2.161000	0.67846	0.528000	0.53228	ATC	.		0.408	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
AKAP6	9472	ucsc.edu;bcgsc.ca	37	14	33014861	33014861	+	Silent	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:33014861A>G	ENST00000280979.4	+	4	1172	c.1002A>G	c.(1000-1002)acA>acG	p.T334T	AKAP6_ENST00000557354.1_Silent_p.T334T|AKAP6_ENST00000557272.1_Silent_p.T334T	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	334					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AAGCTCTGACAAATGCTGCTC	0.488																																					p.T334T	Melanoma(49;821 1200 7288 13647 42351)	.											.	AKAP6	733	0			c.A1002G						.						74.0	65.0	68.0					14																	33014861		2203	4300	6503	SO:0001819	synonymous_variant	9472	exon4			TCTGACAAATGCT	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.1002A>G	14.37:g.33014861A>G		Somatic	87.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_004274	A7E242|A7E2D4|O15028	Silent	SNP	ENST00000280979.4	37	CCDS9644.1																																																																																			.		0.488	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276617.2	NM_004274	
RP11-93K22.13	0	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	129811029	129811029	+	lincRNA	SNP	C	C	A	rs191831656	byFrequency	TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:129811029C>A	ENST00000514010.1	-	0	157				ALG1L2_ENST00000507643.1_RNA																							TCTCCACGAGCGGCCAGCCCT	0.627																																					p.R73R		.											.	.	.	0			c.C217A						.						11.0	13.0	13.0					3																	129811029		691	1590	2281			644974	exon3			CACGAGCGGCCAG																													3.37:g.129811029C>A		Somatic	143.0	1.0		WXS	Illumina HiSeq	Phase_I	314.0	103.0	NM_001136152		Silent	SNP	ENST00000514010.1	37																																																																																				C|0.997;T|0.003		0.627	RP11-93K22.13-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000358040.1		
ALOX15B	247	hgsc.bcm.edu;broad.mit.edu	37	17	7950032	7950032	+	Frame_Shift_Del	DEL	C	C	-	rs140152561		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:7950032delC	ENST00000380183.4	+	9	1386	c.1247delC	c.(1246-1248)gccfs	p.A416fs	ALOX15B_ENST00000572022.1_Frame_Shift_Del_p.A416fs|ALOX15B_ENST00000380173.2_Intron|ALOX15B_ENST00000573359.1_Intron	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	416	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						AACACACTCGCCCGGGAGCTG	0.602																																					p.A416fs		.											.	ALOX15B	227	0			c.1247delC						.						66.0	55.0	59.0					17																	7950032		2203	4300	6503	SO:0001589	frameshift_variant	247	exon9			CACTCGCCCGGGA	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.1247delC	17.37:g.7950032delC	ENSP00000369530:p.Ala416fs	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	11.0	NM_001141	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Frame_Shift_Del	DEL	ENST00000380183.4	37	CCDS11128.1																																																																																			.		0.602	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226985.2		
AMPD1	270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115220086	115220086	+	Missense_Mutation	SNP	C	C	A	rs121912682	byFrequency	TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:115220086C>A	ENST00000520113.2	-	10	1388	c.1373G>T	c.(1372-1374)cGc>cTc	p.R458L	AMPD1_ENST00000369538.3_Missense_Mutation_p.R454L|AMPD1_ENST00000353928.6_Missense_Mutation_p.R425L			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	458			R -> H (in MMDD; loss of activity). {ECO:0000269|PubMed:11102975}.		IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GATGGACAGGCGGGGCTCAGC	0.572																																					p.R458L		.											.	AMPD1	293	0			c.G1373T	GRCh37	CM002933	AMPD1	M	rs121912682	.						98.0	84.0	89.0					1																	115220086		2203	4300	6503	SO:0001583	missense	270	exon10			GACAGGCGGGGCT	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1373G>T	1.37:g.115220086C>A	ENSP00000430075:p.Arg458Leu	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	21.0	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	CCDS876.2	.	.	.	.	.	.	.	.	.	.	C	36	5.636488	0.96693	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.82711	-1.64;-1.64;-1.64	5.85	5.85	0.93711	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.93996	0.8077	H	0.95365	3.66	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94872	0.8031	10	0.87932	D	0	-15.6719	20.1775	0.98187	0.0:1.0:0.0:0.0	.	454;425	Q5TF02;P23109	.;AMPD1_HUMAN	L	458;454;425	ENSP00000430075:R458L;ENSP00000358551:R454L;ENSP00000316520:R425L	ENSP00000316520:R425L	R	-	2	0	AMPD1	115021609	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.771000	0.95319	0.561000	0.74099	CGC	G|0.999;A|0.001		0.572	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
APOB	338	ucsc.edu;bcgsc.ca	37	2	21255391	21255391	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:21255391T>C	ENST00000233242.1	-	10	1314	c.1187A>G	c.(1186-1188)cAg>cGg	p.Q396R	APOB_ENST00000399256.4_Missense_Mutation_p.Q396R	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	396	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTCAGCCACTGGAGGATGTG	0.542																																					p.Q396R		.											.	APOB	175	0			c.A1187G						.						79.0	69.0	72.0					2																	21255391		2203	4300	6503	SO:0001583	missense	338	exon10			AGCCACTGGAGGA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1187A>G	2.37:g.21255391T>C	ENSP00000233242:p.Gln396Arg	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	51.0	5.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	8.934	0.964230	0.18583	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.41758	0.99;0.99	5.41	0.35	0.16037	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	0.359692	0.24247	N	0.040219	T	0.30262	0.0759	L	0.39467	1.215	0.33924	D	0.641205	B	0.13145	0.007	B	0.17722	0.019	T	0.29212	-1.0019	10	0.30078	T	0.28	.	10.0807	0.42388	0.0:0.2673:0.0:0.7327	.	396	P04114	APOB_HUMAN	R	396	ENSP00000233242:Q396R;ENSP00000382200:Q396R	ENSP00000233242:Q396R	Q	-	2	0	APOB	21108896	1.000000	0.71417	0.998000	0.56505	0.283000	0.27025	2.424000	0.44714	0.122000	0.18314	-1.098000	0.02139	CAG	.		0.542	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	27087894	27087898	+	Frame_Shift_Del	DEL	GCCAC	GCCAC	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	GCCAC	GCCAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:27087894_27087898delGCCAC	ENST00000324856.7	+	6	2552_2556	c.2181_2185delGCCAC	c.(2179-2187)cggccacccfs	p.PP728fs	RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000457599.2_Frame_Shift_Del_p.PP728fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.PP345fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	728					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.R727fs*12(1)|p.P728fs(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGCCACCTCGGCCACCCAGTGGCCA	0.522			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.727_729del		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	2	Deletion - Frameshift(1)|Complex(1)	ovary(1)|liver(1)	c.2181_2185del						.																																			SO:0001589	frameshift_variant	8289	exon6			ACCTCGGCCACCC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2181_2185delGCCAC	1.37:g.27087894_27087898delGCCAC	ENSP00000320485:p.Pro728fs	Somatic	325.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	70.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.522	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ARTN	9048	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	44402421	44402421	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:44402421G>T	ENST00000372359.5	+	5	1429	c.647G>T	c.(646-648)tGc>tTc	p.C216F	ARTN_ENST00000438616.3_Missense_Mutation_p.C233F|ARTN_ENST00000414809.3_Missense_Mutation_p.C224F|ARTN_ENST00000498139.2_Missense_Mutation_p.C224F|ARTN_ENST00000372354.3_Missense_Mutation_p.C216F	NM_057091.2	NP_476432.2	Q5T4W7	ARTN_HUMAN	artemin	216					axon guidance (GO:0007411)|induction of positive chemotaxis (GO:0050930)|lymphocyte migration into lymphoid organs (GO:0097021)|neuroblast proliferation (GO:0007405)|peripheral nervous system development (GO:0007422)|Peyer's patch morphogenesis (GO:0061146)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)					Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				GCCACCGCCTGCGGCTGCCTG	0.677																																					p.C224F		.											.	ARTN	90	0			c.G671T						.						11.0	12.0	11.0					1																	44402421		2127	4174	6301	SO:0001583	missense	9048	exon4			CCGCCTGCGGCTG	AF109401	CCDS501.1, CCDS502.1	1p33-p32	2014-01-30			ENSG00000117407	ENSG00000117407		"""Endogenous ligands"""	727	protein-coding gene	gene with protein product	"""neublastin"", ""neurotrophic factor"""	603886				9883723	Standard	NM_057090		Approved	NBN, EVN, ENOVIN	uc001ckt.3	Q5T4W7	OTTHUMG00000007705	ENST00000372359.5:c.647G>T	1.37:g.44402421G>T	ENSP00000361434:p.Cys216Phe	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	28.0	NM_001136215	D3DPY1|D3DPY3|O95441|O96030|Q6P6A3	Missense_Mutation	SNP	ENST00000372359.5	37	CCDS501.1	.	.	.	.	.	.	.	.	.	.	G	18.38	3.611251	0.66558	.	.	ENSG00000117407	ENST00000372359;ENST00000414809;ENST00000498139;ENST00000372354;ENST00000438616	D;D;D;D;D	0.99582	-6.22;-6.22;-6.22;-6.22;-6.22	4.33	4.33	0.51752	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99507	0.9824	M	0.71036	2.16	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	D	0.98198	1.0466	10	0.87932	D	0	-19.3201	16.4443	0.83913	0.0:0.0:1.0:0.0	.	233;224;216	Q5T4W7-2;Q5T4W7-3;Q5T4W7	.;.;ARTN_HUMAN	F	216;224;224;216;233	ENSP00000361434:C216F;ENSP00000387435:C224F;ENSP00000436727:C224F;ENSP00000361429:C216F;ENSP00000391998:C233F	ENSP00000361429:C216F	C	+	2	0	ARTN	44175008	1.000000	0.71417	1.000000	0.80357	0.373000	0.29922	9.232000	0.95325	1.980000	0.57719	0.478000	0.44815	TGC	.		0.677	ARTN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000020713.2	NM_057090	
ASAP1	50807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	131164981	131164981	+	Splice_Site	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:131164981C>T	ENST00000518721.1	-	13	1308		c.e13+1		ASAP1_ENST00000357668.1_Splice_Site	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1						cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						AACATACTTACTGTGGCATGT	0.413																																					.		.											.	ASAP1	95	0			c.1059+1G>A						.						226.0	198.0	207.0					8																	131164981		2203	4300	6503	SO:0001630	splice_region_variant	50807	exon15			TACTTACTGTGGC	AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1080+1G>A	8.37:g.131164981C>T		Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	364.0	61.0	NM_001247996	B2RNV3	Splice_Site	SNP	ENST00000518721.1	37	CCDS6362.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861874	0.51482	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000524124;ENST00000518721	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5795	0.84711	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASAP1	131234163	1.000000	0.71417	0.991000	0.47740	0.361000	0.29550	7.047000	0.76599	2.572000	0.86782	0.655000	0.94253	.	.		0.413	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380170.1	NM_018482	Intron
ASB15	142685	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123270025	123270025	+	Silent	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:123270025T>C	ENST00000451558.1	+	13	1967	c.1446T>C	c.(1444-1446)tgT>tgC	p.C482C	ASB15_ENST00000434204.1_Silent_p.C482C|ASB15_ENST00000451215.1_Silent_p.C482C|ASB15_ENST00000540573.1_Silent_p.C482C|ASB15_ENST00000275699.3_Silent_p.C482C			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	482					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						CTCAGTTCTGTGAGTTTATTA	0.308																																					p.C482C		.											.	ASB15	228	0			c.T1446C						.						115.0	116.0	116.0					7																	123270025		2203	4300	6503	SO:0001819	synonymous_variant	142685	exon9			GTTCTGTGAGTTT	AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.1446T>C	7.37:g.123270025T>C		Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	52.0	NM_080928	Q3ZCP3|Q3ZCP5|Q68D37	Silent	SNP	ENST00000451558.1	37	CCDS34742.1																																																																																			.		0.308	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347493.1		
ASB2	51676	broad.mit.edu;bcgsc.ca	37	14	94405769	94405769	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:94405769G>A	ENST00000315988.4	-	6	1646	c.1158C>T	c.(1156-1158)ggC>ggT	p.G386G	ASB2_ENST00000556337.1_5'UTR|ASB2_ENST00000555019.1_Silent_p.G434G|RP11-131H24.4_ENST00000557646.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	386					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		TGGGGTCGGCGCCGTGTTGCA	0.682																																					p.G434G		.											.	ASB2	228	0			c.C1302T						.						45.0	37.0	40.0					14																	94405769		2201	4299	6500	SO:0001819	synonymous_variant	51676	exon8			GTCGGCGCCGTGT	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1158C>T	14.37:g.94405769G>A		Somatic	33.0	1.0		WXS	Illumina HiSeq	Phase_I	60.0	8.0	NM_001202429	B2RDP9|B4E166|Q9NSU5|Q9Y567	Silent	SNP	ENST00000315988.4	37	CCDS9915.1																																																																																			.		0.682	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
ATP5B	506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	57038650	57038650	+	Missense_Mutation	SNP	T	T	C	rs11542649		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:57038650T>C	ENST00000262030.3	-	3	450	c.400A>G	c.(400-402)Att>Gtt	p.I134V	ATP5B_ENST00000552919.1_Missense_Mutation_p.I134V|SNORD59A_ENST00000384304.1_RNA|ATP5B_ENST00000550162.1_5'Flank	NM_001686.3	NP_001677.2	P06576	ATPB_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide	134					angiogenesis (GO:0001525)|ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|osteoblast differentiation (GO:0001649)|proton transport (GO:0015992)|regulation of intracellular pH (GO:0051453)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial nucleoid (GO:0042645)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase, catalytic core (GO:0005754)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCAACAGGAATTTTGATTGGT	0.428																																					p.I134V		.											.	ATP5B	91	0			c.A400G						.						124.0	114.0	117.0					12																	57038650		2203	4300	6503	SO:0001583	missense	506	exon3			CAGGAATTTTGAT	M27132	CCDS8924.1	12p13.3	2012-10-12			ENSG00000110955	ENSG00000110955	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	830	protein-coding gene	gene with protein product		102910		ATPSB		2687158	Standard	NM_001686		Approved		uc001slr.3	P06576	OTTHUMG00000170291	ENST00000262030.3:c.400A>G	12.37:g.57038650T>C	ENSP00000262030:p.Ile134Val	Somatic	381.0	0.0		WXS	Illumina HiSeq	Phase_I	562.0	161.0	NM_001686	A8K4X0|Q14283	Missense_Mutation	SNP	ENST00000262030.3	37	CCDS8924.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.80|12.80	2.047170|2.047170	0.36085|0.36085	.|.	.|.	ENSG00000110955|ENSG00000110955	ENST00000262030;ENST00000552919;ENST00000551020|ENST00000552959	T;T;T|.	0.79247|.	-1.25;-1.25;-1.25|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.35998|0.35998	0.0951|0.0951	N|N	0.04320|0.04320	-0.23|-0.23	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.08055|.	0.003|.	T|T	0.32824|0.32824	-0.9892|-0.9892	10|5	0.02654|.	T|.	1|.	-17.1497|-17.1497	15.0669|15.0669	0.72002|0.72002	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	rs11542649;rs11542649|rs11542649;rs11542649	134|.	P06576|.	ATPB_HUMAN|.	V|S	134;134;73|70	ENSP00000262030:I134V;ENSP00000450297:I134V;ENSP00000446677:I73V|.	ENSP00000262030:I134V|.	I|N	-|-	1|2	0|0	ATP5B|ATP5B	55324917|55324917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.549000|7.549000	0.82163|0.82163	2.248000|2.248000	0.74166|0.74166	0.460000|0.460000	0.39030|0.39030	ATT|AAT	T|1.000;|0.000		0.428	ATP5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408380.1	NM_001686	
ATP6V0D2	245972	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87162487	87162487	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:87162487C>A	ENST00000285393.3	+	6	928	c.786C>A	c.(784-786)gaC>gaA	p.D262E	CTD-3118D11.2_ENST00000522679.1_RNA	NM_152565.1	NP_689778.1	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2	262					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen ion transmembrane transporter activity (GO:0015078)			breast(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(9)|prostate(1)	27						AAGACTTTGACCAGATGAAGA	0.478																																					p.D262E		.											.	ATP6V0D2	90	0			c.C786A						.						115.0	103.0	107.0					8																	87162487		2203	4300	6503	SO:0001583	missense	245972	exon6			CTTTGACCAGATG	AY079172	CCDS6241.1	8q21.3	2014-01-28	2006-01-20	2002-05-24	ENSG00000147614	ENSG00000147614		"""ATPases / V-type"""	18266	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 38kD, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 2"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D2"""			12384298	Standard	NM_152565		Approved	FLJ38708, VMA6, ATP6D2	uc003ydp.1	Q8N8Y2	OTTHUMG00000163637	ENST00000285393.3:c.786C>A	8.37:g.87162487C>A	ENSP00000285393:p.Asp262Glu	Somatic	107.0	2.0		WXS	Illumina HiSeq	Phase_I	102.0	86.0	NM_152565		Missense_Mutation	SNP	ENST00000285393.3	37	CCDS6241.1	.	.	.	.	.	.	.	.	.	.	C	7.285	0.609977	0.14066	.	.	ENSG00000147614	ENST00000285393	T	0.28255	1.62	6.17	-6.91	0.01649	.	0.290209	0.37437	N	0.002083	T	0.07052	0.0179	N	0.04335	-0.225	0.39118	D	0.961609	B	0.02656	0.0	B	0.06405	0.002	T	0.38887	-0.9640	10	0.02654	T	1	-25.0561	4.1344	0.10164	0.1197:0.196:0.4653:0.219	.	262	Q8N8Y2	VA0D2_HUMAN	E	262	ENSP00000285393:D262E	ENSP00000285393:D262E	D	+	3	2	ATP6V0D2	87231603	0.971000	0.33674	0.827000	0.32855	0.971000	0.66376	0.034000	0.13776	-1.157000	0.02815	-0.126000	0.14955	GAC	.		0.478	ATP6V0D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374651.1	NM_152565	
BAI2	576	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32207068	32207068	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:32207068C>A	ENST00000373658.3	-	11	2041	c.1700G>T	c.(1699-1701)cGc>cTc	p.R567L	BAI2_ENST00000257070.4_Missense_Mutation_p.R567L|BAI2_ENST00000398542.1_Missense_Mutation_p.R500L|BAI2_ENST00000398556.3_Missense_Mutation_p.R515L|BAI2_ENST00000398547.1_Missense_Mutation_p.R500L|BAI2_ENST00000527361.1_Missense_Mutation_p.R567L|BAI2_ENST00000440175.2_Missense_Mutation_p.R209L|BAI2_ENST00000373655.2_Missense_Mutation_p.R567L|BAI2_ENST00000398538.1_Missense_Mutation_p.R555L	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	567					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GAGACAGCGGCGGCTGGCAGA	0.632																																					p.R567L		.											.	BAI2	526	0			c.G1700T						.						16.0	18.0	17.0					1																	32207068		2200	4295	6495	SO:0001583	missense	576	exon11			CAGCGGCGGCTGG	AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.1700G>T	1.37:g.32207068C>A	ENSP00000362762:p.Arg567Leu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	70.0	NM_001703	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Missense_Mutation	SNP	ENST00000373658.3	37	CCDS346.2	.	.	.	.	.	.	.	.	.	.	C	33	5.195741	0.94960	.	.	ENSG00000121753	ENST00000398556;ENST00000398547;ENST00000373658;ENST00000373655;ENST00000398542;ENST00000257070;ENST00000527361;ENST00000440175;ENST00000398538;ENST00000420125	T;T;T;T;T;T;T;T;T;T	0.69561	1.27;1.45;-0.41;-0.41;1.69;-0.41;-0.41;-0.41;-0.41;-0.41	5.38	5.38	0.77491	GPCR, family 2, extracellular hormone receptor domain (2);	0.000000	0.43579	D	0.000544	T	0.81245	0.4782	M	0.68317	2.08	0.58432	D	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;0.999;1.0	T	0.82623	-0.0366	10	0.87932	D	0	.	18.2761	0.90084	0.0:1.0:0.0:0.0	.	567;555;209;500;567;567	O60241-4;O60241-3;B4DKC3;A2A3C1;O60241-2;O60241	.;.;.;.;.;BAI2_HUMAN	L	515;500;567;567;500;567;567;209;555;505	ENSP00000381564:R515L;ENSP00000381555:R500L;ENSP00000362762:R567L;ENSP00000362759:R567L;ENSP00000381550:R500L;ENSP00000257070:R567L;ENSP00000435397:R567L;ENSP00000391071:R209L;ENSP00000381548:R555L;ENSP00000410921:R505L	ENSP00000257070:R567L	R	-	2	0	BAI2	31979655	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.645000	0.83430	2.694000	0.91930	0.555000	0.69702	CGC	.		0.632	BAI2-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000381838.1	NM_001703	
BTBD10	84280	broad.mit.edu;bcgsc.ca	37	11	13443366	13443366	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:13443366T>C	ENST00000278174.5	-	3	366	c.121A>G	c.(121-123)Aaa>Gaa	p.K41E	BTBD10_ENST00000528120.1_5'UTR|BTBD10_ENST00000530907.1_Missense_Mutation_p.K49E|BTBD10_ENST00000532261.1_5'UTR	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	41						nucleus (GO:0005634)		p.K41E(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		ACTCCTCCTTTAGCAATACGC	0.393																																					p.K41E		.											.	BTBD10	90	1	Substitution - Missense(1)	lung(1)	c.A121G						.						82.0	72.0	75.0					11																	13443366		2200	4294	6494	SO:0001583	missense	84280	exon3			CTCCTTTAGCAAT	AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.121A>G	11.37:g.13443366T>C	ENSP00000278174:p.Lys41Glu	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	5.0	NM_032320	B7Z228|Q86WG1	Missense_Mutation	SNP	ENST00000278174.5	37	CCDS7811.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.984255	0.53827	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000529708;ENST00000526841	T;T	0.33654	1.43;1.4	5.11	5.11	0.69529	.	0.066726	0.64402	D	0.000009	T	0.21631	0.0521	N	0.08118	0	0.80722	D	1	B;B;B	0.25809	0.073;0.135;0.013	B;B;B	0.22601	0.025;0.04;0.017	T	0.07009	-1.0795	10	0.49607	T	0.09	-7.205	14.7298	0.69372	0.0:0.0:0.0:1.0	.	10;49;41	B7Z2J1;B7Z228;Q9BSF8	.;.;BTBDA_HUMAN	E	41;49;41;41	ENSP00000278174:K41E;ENSP00000431186:K49E	ENSP00000278174:K41E	K	-	1	0	BTBD10	13399942	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	4.391000	0.59652	2.154000	0.67381	0.533000	0.62120	AAA	.		0.393	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386200.1	NM_032320	
C1QTNF4	114900	hgsc.bcm.edu;mdanderson.org	37	11	47611682	47611682	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:47611682G>A	ENST00000302514.3	-	2	1197	c.681C>T	c.(679-681)ggC>ggT	p.G227G		NM_031909.2	NP_114115.2	Q9BXJ3	C1QT4_HUMAN	C1q and tumor necrosis factor related protein 4	227	C1q 2. {ECO:0000255|PROSITE- ProRule:PRU00368}.					extracellular space (GO:0005615)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						AGAAGTAGGCGCCGGGCAGAC	0.647																																					p.G227G		.											.	C1QTNF4	90	0			c.C681T						.						11.0	15.0	13.0					11																	47611682		2161	4273	6434	SO:0001819	synonymous_variant	114900	exon2			GTAGGCGCCGGGC	AF329838	CCDS7942.1	11q11	2008-07-18				ENSG00000172247			14346	protein-coding gene	gene with protein product	"""complement-c1q tumor necrosis factor-related protein 4"""	614911				16094384	Standard	NM_031909		Approved	CTRP4, ZACRP4	uc001ngc.2	Q9BXJ3		ENST00000302514.3:c.681C>T	11.37:g.47611682G>A		Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	13.0	NM_031909	Q8IV25	Silent	SNP	ENST00000302514.3	37	CCDS7942.1																																																																																			.		0.647	C1QTNF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391772.1	NM_031909	
C6	729	ucsc.edu;bcgsc.ca	37	5	41158869	41158869	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:41158869A>C	ENST00000263413.3	-	13	2139	c.1875T>G	c.(1873-1875)aaT>aaG	p.N625K	C6_ENST00000337836.5_Missense_Mutation_p.N625K|C6_ENST00000475349.1_5'Flank	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	625	CCP 1.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CTTCGTCATCATTGATACATG	0.393																																					p.N625K		.											.	C6	95	0			c.T1875G						.						81.0	83.0	82.0					5																	41158869		2203	4300	6503	SO:0001583	missense	729	exon13			GTCATCATTGATA	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1875T>G	5.37:g.41158869A>C	ENSP00000263413:p.Asn625Lys	Somatic	135.0	1.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001115131		Missense_Mutation	SNP	ENST00000263413.3	37	CCDS3936.1	.	.	.	.	.	.	.	.	.	.	A	17.55	3.418289	0.62622	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.60171	0.21;0.21	6.16	1.25	0.21368	.	0.337852	0.38720	N	0.001584	T	0.51652	0.1687	L	0.34521	1.04	0.46222	D	0.998936	P	0.51147	0.942	P	0.51193	0.662	T	0.47898	-0.9081	10	0.51188	T	0.08	-5.5649	9.4424	0.38677	0.6729:0.0:0.3271:0.0	.	625	P13671	CO6_HUMAN	K	625	ENSP00000338861:N625K;ENSP00000263413:N625K	ENSP00000263413:N625K	N	-	3	2	C6	41194626	0.998000	0.40836	0.987000	0.45799	0.646000	0.38490	0.921000	0.28718	0.200000	0.20447	-0.280000	0.10049	AAT	.		0.393	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211592.1		
CADM1	23705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	115085443	115085443	+	Silent	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:115085443C>G	ENST00000452722.3	-	7	899	c.879G>C	c.(877-879)ctG>ctC	p.L293L	CADM1_ENST00000542447.2_Silent_p.L293L|CADM1_ENST00000537058.1_Silent_p.L293L|CADM1_ENST00000537140.1_5'UTR|CADM1_ENST00000536727.1_Silent_p.L293L|CADM1_ENST00000331581.6_Silent_p.L293L	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TGGGCCCAGACAGTACGGCGT	0.473																																					p.L293L		.											.	CADM1	92	0			c.G879C						.						259.0	222.0	234.0					11																	115085443		2201	4296	6497	SO:0001819	synonymous_variant	23705	exon7			CCCAGACAGTACG	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.879G>C	11.37:g.115085443C>G		Somatic	389.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	25.0	NM_014333		Silent	SNP	ENST00000452722.3	37	CCDS8373.1	.	.	.	.	.	.	.	.	.	.	C	7.913	0.736960	0.15574	.	.	ENSG00000182985	ENST00000545380	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	T	0.71333	0.3327	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69468	-0.5137	4	.	.	.	.	15.1897	0.73035	0.0:0.8597:0.1403:0.0	.	.	.	.	L	292	.	.	V	-	1	0	CADM1	114590653	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.578000	0.36525	2.660000	0.90430	0.655000	0.94253	GTC	.		0.473	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398753.2	NM_014333	
CCDC88A	55704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55582881	55582881	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:55582881T>C	ENST00000436346.1	-	8	1475	c.634A>G	c.(634-636)Ata>Gta	p.I212V	CCDC88A_ENST00000413716.2_Missense_Mutation_p.I212V|CCDC88A_ENST00000263630.8_Missense_Mutation_p.I212V|CCDC88A_ENST00000336838.6_Missense_Mutation_p.I212V	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	212					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GAGAGTTCTATGATAGTCTAG	0.423																																					p.I212V		.											.	CCDC88A	94	0			c.A634G						.						62.0	52.0	55.0					2																	55582881		2203	4300	6503	SO:0001583	missense	55704	exon8			GTTCTATGATAGT	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.634A>G	2.37:g.55582881T>C	ENSP00000410608:p.Ile212Val	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	30.0	NM_018084	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	ENST00000436346.1	37		.	.	.	.	.	.	.	.	.	.	T	2.571	-0.299616	0.05532	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716;ENST00000430086	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;2.34	5.05	-6.62	0.01813	.	0.490245	0.16762	N	0.200562	T	0.19087	0.0458	N	0.17082	0.46	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.42344	-0.9457	10	0.02654	T	1	-1.1238	15.1743	0.72899	0.0:0.567:0.0:0.4329	.	212;212;212	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	V	212;212;212;212;137	ENSP00000338728:I212V;ENSP00000263630:I212V;ENSP00000410608:I212V;ENSP00000404431:I212V;ENSP00000399237:I137V	ENSP00000263630:I212V	I	-	1	0	CCDC88A	55436385	0.000000	0.05858	0.028000	0.17463	0.985000	0.73830	-0.362000	0.07602	-1.480000	0.01865	0.482000	0.46254	ATA	.		0.423	CCDC88A-203	KNOWN	basic	protein_coding	protein_coding		NM_017571	
CDH15	1013	ucsc.edu;bcgsc.ca	37	16	89253841	89253841	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:89253841T>C	ENST00000289746.2	+	6	733	c.668T>C	c.(667-669)gTc>gCc	p.V223A		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	223	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCCCAGGTGGTCGCGGTGTAC	0.617																																					p.V223A		.											.	CDH15	523	0			c.T668C						.						72.0	49.0	57.0					16																	89253841		2196	4299	6495	SO:0001583	missense	1013	exon6			AGGTGGTCGCGGT	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.668T>C	16.37:g.89253841T>C	ENSP00000289746:p.Val223Ala	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_004933		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707695	0.68615	.	.	ENSG00000129910	ENST00000289746	T	0.51071	0.72	4.55	3.45	0.39498	Cadherin (4);Cadherin-like (1);	0.000000	0.46442	D	0.000297	T	0.49406	0.1555	L	0.38531	1.155	0.51482	D	0.999921	P	0.50943	0.94	P	0.61201	0.885	T	0.33979	-0.9847	10	0.17369	T	0.5	.	8.8479	0.35181	0.0:0.0921:0.0:0.9079	.	223	P55291	CAD15_HUMAN	A	223	ENSP00000289746:V223A	ENSP00000289746:V223A	V	+	2	0	CDH15	87781342	1.000000	0.71417	0.985000	0.45067	0.745000	0.42441	3.415000	0.52700	0.611000	0.30052	0.334000	0.21626	GTC	.		0.617	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
CDK5RAP2	55755	ucsc.edu;bcgsc.ca	37	9	123202153	123202153	+	Silent	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:123202153C>T	ENST00000349780.4	-	24	3425	c.3246G>A	c.(3244-3246)ctG>ctA	p.L1082L	CDK5RAP2_ENST00000359309.3_Silent_p.L1041L|CDK5RAP2_ENST00000360822.3_Silent_p.L1050L|CDK5RAP2_ENST00000360190.4_Silent_p.L1082L	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1082	Interaction with MAPRE1.				brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TCTTGGAACTCAGGTAAGTAG	0.438																																					p.L1082L		.											.	CDK5RAP2	229	0			c.G3246A						.						81.0	76.0	78.0					9																	123202153		2203	4300	6503	SO:0001819	synonymous_variant	55755	exon24			GGAACTCAGGTAA	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3246G>A	9.37:g.123202153C>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	37	CCDS6823.1																																																																																			.		0.438	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
CERCAM	51148	broad.mit.edu;mdanderson.org	37	9	131183275	131183275	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:131183275G>T	ENST00000372838.4	+	1	517	c.119G>T	c.(118-120)cGc>cTc	p.R40L	CERCAM_ENST00000493788.1_3'UTR|CERCAM_ENST00000372842.1_5'UTR	NM_016174.4	NP_057258.3	Q5T4B2	GT253_HUMAN	cerebral endothelial cell adhesion molecule	40					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|leukocyte cell-cell adhesion (GO:0007159)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				endometrium(2)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|pancreas(2)	20						ATCCTGGCCCGCAATGCCGAA	0.721																																					p.R40L		.											.	CERCAM	69	0			c.G119T						.						6.0	9.0	8.0					9																	131183275		685	1575	2260	SO:0001583	missense	51148	exon1			TGGCCCGCAATGC	AB040935	CCDS6901.2, CCDS69675.1	9q34.13	2008-02-05	2007-10-17	2007-10-17	ENSG00000167123	ENSG00000167123			23723	protein-coding gene	gene with protein product	"""glycosyltransferase 25 domain containing 3"""		"""cerebral cell adhesion molecule"""	CEECAM1		10608765	Standard	NM_016174		Approved	GLT25D3, CerCAM	uc004buz.4	Q5T4B2	OTTHUMG00000020747	ENST00000372838.4:c.119G>T	9.37:g.131183275G>T	ENSP00000361929:p.Arg40Leu	Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	10.0	NM_016174	A7MD00|C4AMA2|Q0VDF3|Q2VPJ4|Q4KMP2|Q5T4B1|Q8N107|Q96EZ5|Q9P226|Q9UMW5	Missense_Mutation	SNP	ENST00000372838.4	37	CCDS6901.2	.	.	.	.	.	.	.	.	.	.	G	36	5.639328	0.96693	.	.	ENSG00000167123	ENST00000372838;ENST00000413863	D	0.85411	-1.98	4.23	4.23	0.50019	.	0.073460	0.53938	D	0.000053	D	0.91872	0.7427	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93014	0.6434	10	0.87932	D	0	-5.2048	14.1385	0.65303	0.0:0.0:1.0:0.0	.	40	Q5T4B2	GT253_HUMAN	L	40	ENSP00000361929:R40L	ENSP00000361929:R40L	R	+	2	0	CERCAM	130223096	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.441000	0.90313	2.185000	0.69588	0.491000	0.48974	CGC	.		0.721	CERCAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054435.2	NM_016174	
CHST15	51363	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	125769678	125769678	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:125769678C>T	ENST00000346248.5	-	8	2315	c.1673G>A	c.(1672-1674)tGg>tAg	p.W558*	CHST15_ENST00000435907.1_Nonsense_Mutation_p.W558*	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	558					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						CGTCGTCTTCCACGCAAACGC	0.562																																					p.W558X		.											.	CHST15	91	0			c.G1673A						.						65.0	65.0	65.0					10																	125769678		2203	4300	6503	SO:0001587	stop_gained	51363	exon8			GTCTTCCACGCAA	AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.1673G>A	10.37:g.125769678C>T	ENSP00000333947:p.Trp558*	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	34.0	NM_001270764	O60338|O60474|Q86VM4	Nonsense_Mutation	SNP	ENST00000346248.5	37	CCDS7638.1	.	.	.	.	.	.	.	.	.	.	C	43	10.455762	0.99408	.	.	ENSG00000182022	ENST00000346248;ENST00000435907	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.112	19.2238	0.93810	0.0:1.0:0.0:0.0	.	.	.	.	X	558	.	ENSP00000333947:W558X	W	-	2	0	CHST15	125759668	1.000000	0.71417	0.997000	0.53966	0.875000	0.50365	6.984000	0.76186	2.543000	0.85770	0.563000	0.77884	TGG	.		0.562	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050856.1	NM_015892	
CNOT3	4849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54646892	54646892	+	Silent	SNP	C	C	T	rs149889819		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:54646892C>T	ENST00000406403.1	+	2	1666	c.63C>T	c.(61-63)ggC>ggT	p.G21G	CNOT3_ENST00000221232.5_Silent_p.G21G|CNOT3_ENST00000358389.3_5'UTR			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	21					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					TGTCCGAGGGCGTGGAGCAGT	0.557													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18732	0.0		0.0	False		,,,				2504	0.0				p.G21G		.											.	CNOT3	93	0			c.C63T						.						172.0	171.0	171.0					19																	54646892		2203	4300	6503	SO:0001819	synonymous_variant	4849	exon3			CGAGGGCGTGGAG	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.63C>T	19.37:g.54646892C>T		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	19.0	NM_014516	Q9NZN7|Q9UF76	Silent	SNP	ENST00000406403.1	37	CCDS12880.1																																																																																			C|0.999;T|0.000		0.557	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516	
COL9A1	1297	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	70993489	70993489	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:70993489G>T	ENST00000357250.6	-	6	889	c.731C>A	c.(730-732)cCc>cAc	p.P244H	COL9A1_ENST00000370496.3_Missense_Mutation_p.P244H|COL9A1_ENST00000370499.4_5'Flank|COL9A1_ENST00000320755.7_5'Flank	NM_001851.4	NP_001842.3	P20849	CO9A1_HUMAN	collagen, type IX, alpha 1	244	Laminin G-like.|Nonhelical region (NC4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|organ morphogenesis (GO:0009887)|tissue homeostasis (GO:0001894)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(44)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)	80						GGGCCGCAGGGGGTCACAATG	0.512																																					p.P244H		.											.	COL9A1	94	0			c.C731A						.						105.0	86.0	92.0					6																	70993489		2203	4300	6503	SO:0001583	missense	1297	exon6			CGCAGGGGGTCAC		CCDS4971.1, CCDS47447.1	6q13	2013-05-07			ENSG00000112280	ENSG00000112280		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2217	protein-coding gene	gene with protein product		120210				1429648	Standard	NM_001851		Approved		uc003pfg.4	P20849	OTTHUMG00000014988	ENST00000357250.6:c.731C>A	6.37:g.70993489G>T	ENSP00000349790:p.Pro244His	Somatic	140.0	1.0		WXS	Illumina HiSeq	Phase_I	236.0	64.0	NM_001851	Q13699|Q13700|Q5TF52|Q6P467|Q96BM8|Q99225|Q9H151|Q9H152|Q9Y6P2|Q9Y6P3	Missense_Mutation	SNP	ENST00000357250.6	37	CCDS4971.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204529	0.79127	.	.	ENSG00000112280	ENST00000357250;ENST00000370496	T;T	0.02525	4.26;4.26	5.56	5.56	0.83823	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.148765	0.47852	D	0.000213	T	0.14013	0.0339	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00804	-1.1559	10	0.87932	D	0	.	18.5065	0.90900	0.0:0.0:1.0:0.0	.	244	P20849	CO9A1_HUMAN	H	244	ENSP00000349790:P244H;ENSP00000359527:P244H	ENSP00000349790:P244H	P	-	2	0	COL9A1	71050210	1.000000	0.71417	0.992000	0.48379	0.861000	0.49209	7.215000	0.77966	2.633000	0.89246	0.655000	0.94253	CCC	.		0.512	COL9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041131.2		
CREBBP	1387	ucsc.edu;bcgsc.ca	37	16	3820965	3820965	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:3820965A>G	ENST00000262367.5	-	14	3295	c.2486T>C	c.(2485-2487)cTt>cCt	p.L829P	CREBBP_ENST00000382070.3_Missense_Mutation_p.L791P	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	829					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGGGTTAGGAAGAGCAGCACC	0.502			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.L829P		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.T2486C						.						82.0	86.0	85.0					16																	3820965		2197	4300	6497	SO:0001583	missense	1387	exon14			TTAGGAAGAGCAG	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2486T>C	16.37:g.3820965A>G	ENSP00000262367:p.Leu829Pro	Somatic	48.0	1.0		WXS	Illumina HiSeq	.	48.0	5.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	A	16.01	3.001639	0.54254	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.84442	-1.85;-1.77	5.45	5.45	0.79879	.	0.092947	0.44097	D	0.000487	D	0.89546	0.6746	L	0.55990	1.75	0.80722	D	1	P;D	0.69078	0.624;0.997	B;D	0.69824	0.336;0.966	D	0.87276	0.2289	10	0.23891	T	0.37	-12.3719	15.8205	0.78638	1.0:0.0:0.0:0.0	.	859;829	Q4LE28;Q92793	.;CBP_HUMAN	P	829;859;791	ENSP00000262367:L829P;ENSP00000371502:L791P	ENSP00000262367:L829P	L	-	2	0	CREBBP	3760966	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.361000	0.73070	2.201000	0.70794	0.533000	0.62120	CTT	.		0.502	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	113662479	113662479	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:113662479C>A	ENST00000297405.5	-	19	3348	c.3104G>T	c.(3103-3105)aGt>aTt	p.S1035I	CSMD3_ENST00000352409.3_Missense_Mutation_p.S1035I|CSMD3_ENST00000343508.3_Missense_Mutation_p.S995I|CSMD3_ENST00000455883.2_Missense_Mutation_p.S931I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1035	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGAATCACAACTAAATGAAAC	0.448										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1035I		.											.	CSMD3	1132	0			c.G3104T						.						145.0	142.0	143.0					8																	113662479		2203	4300	6503	SO:0001583	missense	114788	exon19			TCACAACTAAATG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3104G>T	8.37:g.113662479C>A	ENSP00000297405:p.Ser1035Ile	Somatic	287.0	0.0		WXS	Illumina HiSeq	Phase_I	567.0	50.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585164	0.86748	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22	5.88	5.88	0.94601	Complement control module (2);Sushi/SCR/CCP (3);	0.293249	0.33938	N	0.004411	T	0.80768	0.4686	M	0.73753	2.245	0.43798	D	0.99634	B;B;P	0.49090	0.257;0.146;0.919	B;B;P	0.57846	0.271;0.148;0.828	T	0.80665	-0.1281	10	0.59425	D	0.04	.	20.2228	0.98330	0.0:1.0:0.0:0.0	.	931;1035;995	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	995;1035;375;931;1035	ENSP00000345799:S995I;ENSP00000297405:S1035I;ENSP00000341558:S375I;ENSP00000412263:S931I;ENSP00000343124:S1035I	ENSP00000297405:S1035I	S	-	2	0	CSMD3	113731655	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.854000	0.62918	2.789000	0.95967	0.655000	0.94253	AGT	.		0.448	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTNNA2	1496	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	80782831	80782831	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:80782831G>C	ENST00000402739.4	+	11	1559	c.1554G>C	c.(1552-1554)ttG>ttC	p.L518F	CTNNA2_ENST00000361291.4_Missense_Mutation_p.L552F|CTNNA2_ENST00000540488.1_Missense_Mutation_p.L518F|CTNNA2_ENST00000343114.3_Missense_Mutation_p.L197F|CTNNA2_ENST00000496558.1_Missense_Mutation_p.L518F|CTNNA2_ENST00000541047.1_Missense_Mutation_p.L518F|CTNNA2_ENST00000466387.1_Missense_Mutation_p.L518F	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	518					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.E519E(1)|p.L518L(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						ATCACATCTTGGAGGATGTGA	0.473																																					p.L518F		.											.	CTNNA2	368	2	Substitution - coding silent(2)	lung(2)	c.G1554C						.						64.0	64.0	64.0					2																	80782831		1881	4109	5990	SO:0001583	missense	1496	exon12			CATCTTGGAGGAT		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1554G>C	2.37:g.80782831G>C	ENSP00000384638:p.Leu518Phe	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	12.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	37		.	.	.	.	.	.	.	.	.	.	G	18.56	3.651419	0.67472	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114;ENST00000409550	T;T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08	5.52	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.70011	0.3175	M	0.90019	3.08	0.58432	D	0.999998	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.79784	0.973;0.989;0.993;0.993	T	0.77384	-0.2608	9	.	.	.	.	14.7706	0.69675	0.0697:0.0:0.9303:0.0	.	150;518;518;518	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	F	518;518;552;518;518;518;197;183	ENSP00000418191:L518F;ENSP00000419295:L518F;ENSP00000355398:L552F;ENSP00000384638:L518F;ENSP00000444675:L518F;ENSP00000441705:L518F;ENSP00000341500:L197F;ENSP00000386587:L183F	.	L	+	3	2	CTNNA2	80636342	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.682000	0.37628	1.474000	0.48178	0.650000	0.86243	TTG	.		0.473	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
CYP39A1	51302	ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46607325	46607325	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:46607325G>A	ENST00000275016.2	-	3	597	c.394C>T	c.(394-396)Ctc>Ttc	p.L132F		NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	132					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)		EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						AACTGATGGAGATTGACAGTC	0.363																																					p.L132F		.											.	CYP39A1	91	0			c.C394T						.						127.0	116.0	120.0					6																	46607325		2203	4300	6503	SO:0001583	missense	51302	exon3			GATGGAGATTGAC	AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.394C>T	6.37:g.46607325G>A	ENSP00000275016:p.Leu132Phe	Somatic	396.0	2.0		WXS	Illumina HiSeq	.	350.0	64.0	NM_016593	Q5VTT0|Q96FW5	Missense_Mutation	SNP	ENST00000275016.2	37	CCDS4916.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295139	0.40594	.	.	ENSG00000146233	ENST00000275016	T	0.68624	-0.34	5.55	-0.889	0.10580	.	0.871350	0.10254	N	0.696809	T	0.58250	0.2109	L	0.58810	1.83	0.09310	N	1	D;D	0.63880	0.993;0.993	D;D	0.65773	0.938;0.938	T	0.52881	-0.8516	10	0.21014	T	0.42	-0.4422	8.2843	0.31920	0.0:0.3049:0.2081:0.487	.	112;132	B7Z786;Q9NYL5	.;CP39A_HUMAN	F	132	ENSP00000275016:L132F	ENSP00000275016:L132F	L	-	1	0	CYP39A1	46715284	0.000000	0.05858	0.017000	0.16124	0.534000	0.34807	-1.906000	0.01590	-0.057000	0.13199	0.585000	0.79938	CTC	.		0.363	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040787.1		
DBN1	1627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	176895871	176895871	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:176895871T>A	ENST00000309007.5	-	2	335	c.116A>T	c.(115-117)gAt>gTt	p.D39V	DBN1_ENST00000393565.1_Missense_Mutation_p.D39V|DBN1_ENST00000292385.5_Missense_Mutation_p.D41V	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	39	ADF-H. {ECO:0000255|PROSITE- ProRule:PRU00599}.				actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTTGAGGTCATCGGAGCCATC	0.607																																					p.D41V		.											.	DBN1	587	0			c.A122T						.						183.0	159.0	167.0					5																	176895871		2203	4300	6503	SO:0001583	missense	1627	exon3			AGGTCATCGGAGC		CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.116A>T	5.37:g.176895871T>A	ENSP00000308532:p.Asp39Val	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	23.0	NM_080881	A8MV58|B2RBG0|Q9UFZ5	Missense_Mutation	SNP	ENST00000309007.5	37	CCDS4420.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.098996	0.76870	.	.	ENSG00000113758	ENST00000309007;ENST00000292385;ENST00000393565;ENST00000477391;ENST00000514833	T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16	3.76	3.76	0.43208	Actin-binding, cofilin/tropomyosin type (3);	0.137801	0.47093	D	0.000241	T	0.56790	0.2009	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.987	T	0.62220	-0.6900	10	0.87932	D	0	-21.9146	12.4455	0.55649	0.0:0.0:0.0:1.0	.	39;41	Q16643;Q16643-2	DREB_HUMAN;.	V	39;41;39;39;39	ENSP00000308532:D39V;ENSP00000292385:D41V;ENSP00000377195:D39V;ENSP00000422854:D39V;ENSP00000421465:D39V	ENSP00000292385:D41V	D	-	2	0	DBN1	176828477	1.000000	0.71417	0.994000	0.49952	0.827000	0.46813	5.052000	0.64263	1.941000	0.56285	0.450000	0.29827	GAT	.		0.607	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253429.2	NM_080881	
DCLRE1A	9937	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	115609989	115609989	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:115609989T>C	ENST00000361384.2	-	2	1792	c.875A>G	c.(874-876)gAc>gGc	p.D292G	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.D292G	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	292					mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		GTCACTGAAGTCATTTTCTGG	0.368								Other identified genes with known or suspected DNA repair function																													p.D292G		.											.	DCLRE1A	228	0			c.A875G						.						123.0	116.0	119.0					10																	115609989		2203	4300	6503	SO:0001583	missense	9937	exon2			CTGAAGTCATTTT		CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.875A>G	10.37:g.115609989T>C	ENSP00000355185:p.Asp292Gly	Somatic	153.0	1.0		WXS	Illumina HiSeq	Phase_I	236.0	73.0	NM_014881	D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	ENST00000361384.2	37	CCDS7584.1	.	.	.	.	.	.	.	.	.	.	T	14.93	2.681545	0.47991	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.72051	-0.62;-0.62	5.8	4.64	0.57946	.	0.218930	0.43416	N	0.000580	T	0.63307	0.2500	L	0.49126	1.545	0.35438	D	0.794648	B	0.30664	0.289	B	0.28784	0.094	T	0.68861	-0.5297	10	0.52906	T	0.07	-5.9362	10.7508	0.46209	0.0:0.0727:0.0:0.9273	.	292	Q6PJP8	DCR1A_HUMAN	G	292	ENSP00000355185:D292G;ENSP00000358311:D292G	ENSP00000355185:D292G	D	-	2	0	DCLRE1A	115599979	0.986000	0.35501	0.844000	0.33320	0.989000	0.77384	1.943000	0.40253	0.980000	0.38523	0.528000	0.53228	GAC	.		0.368	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881	
DDX58	23586	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	32457157	32457157	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:32457157T>C	ENST00000379883.2	-	18	2898	c.2741A>G	c.(2740-2742)gAg>gGg	p.E914G	DDX58_ENST00000379868.1_Missense_Mutation_p.E711G|DDX58_ENST00000379882.1_Missense_Mutation_p.E869G|DDX58_ENST00000542096.1_Missense_Mutation_p.E843G	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	914	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TGGTATCTTCTCAAAATGAAA	0.378																																					p.E914G		.											.	DDX58	230	0			c.A2741G						.						79.0	74.0	75.0					9																	32457157		2203	4300	6503	SO:0001583	missense	23586	exon18			ATCTTCTCAAAAT	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2741A>G	9.37:g.32457157T>C	ENSP00000369213:p.Glu914Gly	Somatic	234.0	2.0		WXS	Illumina HiSeq	Phase_I	113.0	39.0	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	37	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	T	13.08	2.131545	0.37630	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	5.83	3.27	0.37495	C-terminal domain of RIG-I (1);	0.456648	0.22219	N	0.062991	T	0.33673	0.0871	L	0.60455	1.87	0.33357	D	0.571772	B;P	0.39094	0.261;0.659	B;B	0.29267	0.029;0.1	T	0.47058	-0.9146	10	0.30854	T	0.27	-9.2796	6.1373	0.20241	0.1925:0.0:0.2262:0.5813	.	843;914	B3KWW1;O95786	.;DDX58_HUMAN	G	869;914;711;843	ENSP00000369212:E869G;ENSP00000369213:E914G;ENSP00000369197:E711G;ENSP00000442160:E843G	ENSP00000369197:E711G	E	-	2	0	DDX58	32447157	0.064000	0.20934	0.847000	0.33407	0.925000	0.55904	1.272000	0.33109	2.227000	0.72691	0.528000	0.53228	GAG	.		0.378	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
DDX58	23586	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	32457172	32457178	+	Frame_Shift_Del	DEL	TTCCACT	TTCCACT	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	TTCCACT	TTCCACT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:32457172_32457178delTTCCACT	ENST00000379883.2	-	18	2877_2883	c.2720_2726delAGTGGAA	c.(2719-2727)aagtggaagfs	p.KWK907fs	DDX58_ENST00000379868.1_Frame_Shift_Del_p.KWK704fs|DDX58_ENST00000379882.1_Frame_Shift_Del_p.KWK862fs|DDX58_ENST00000542096.1_Frame_Shift_Del_p.KWK836fs	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	907	Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		ATGAAAGTCCTTCCACTTCGAGTACAG	0.391																																					p.907_909del		.											.	DDX58	230	0			c.2720_2726del						.																																			SO:0001589	frameshift_variant	23586	exon18			AAGTCCTTCCACT	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2720_2726delAGTGGAA	9.37:g.32457172_32457178delTTCCACT	ENSP00000369213:p.Lys907fs	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	0.0	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Frame_Shift_Del	DEL	ENST00000379883.2	37	CCDS6526.1																																																																																			.		0.391	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
DENND5B	160518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	31562239	31562239	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:31562239C>T	ENST00000389082.5	-	14	3025	c.2761G>A	c.(2761-2763)Gct>Act	p.A921T	DENND5B_ENST00000306833.6_Missense_Mutation_p.A956T|DENND5B_ENST00000536562.1_Missense_Mutation_p.A956T	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	921	RUN 1. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TAGTCCACAGCATTGAGAGAA	0.413																																					p.A921T		.											.	DENND5B	24	0			c.G2761A						.						62.0	62.0	62.0					12																	31562239		1865	4101	5966	SO:0001583	missense	160518	exon14			CCACAGCATTGAG	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2761G>A	12.37:g.31562239C>T	ENSP00000373734:p.Ala921Thr	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	41.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.935931	0.52972	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.35789	1.29;1.29;1.29	4.5	4.5	0.54988	RUN (3);	0.067075	0.64402	D	0.000014	T	0.36026	0.0952	L	0.52126	1.63	0.51767	D	0.999939	B;B	0.31730	0.2;0.337	B;B	0.33254	0.16;0.156	T	0.16837	-1.0389	10	0.30854	T	0.27	-21.1322	17.4537	0.87600	0.0:1.0:0.0:0.0	.	921;956	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	T	921;956;956	ENSP00000373734:A921T;ENSP00000306482:A956T;ENSP00000444889:A956T	ENSP00000306482:A956T	A	-	1	0	DENND5B	31453506	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.589000	0.61006	2.328000	0.79073	0.558000	0.71614	GCT	.		0.413	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
DHX37	57647	broad.mit.edu;ucsc.edu;mdanderson.org	37	12	125438447	125438447	+	Missense_Mutation	SNP	G	G	A	rs369049552		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:125438447G>A	ENST00000308736.2	-	20	2772	c.2674C>T	c.(2674-2676)Cgg>Tgg	p.R892W	DHX37_ENST00000544745.1_Missense_Mutation_p.R679W	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	892							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		AGCTGGCCCCGCAGGCGCCGG	0.647																																					p.R892W		.											.	DHX37	227	0			c.C2674T						.	G	TRP/ARG	0,4394		0,0,2197	16.0	16.0	16.0		2674	3.5	1.0	12		16	1,8579		0,1,4289	no	missense	DHX37	NM_032656.3	101	0,1,6486	AA,AG,GG		0.0117,0.0,0.0077	probably-damaging	892/1158	125438447	1,12973	2197	4290	6487	SO:0001583	missense	57647	exon20			GGCCCCGCAGGCG	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2674C>T	12.37:g.125438447G>A	ENSP00000311135:p.Arg892Trp	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	8.0	NM_032656	Q9BUI7|Q9P211	Missense_Mutation	SNP	ENST00000308736.2	37	CCDS9261.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096113	0.76870	0.0	1.17E-4	ENSG00000150990	ENST00000308736;ENST00000544745	T;T	0.03330	3.97;3.97	5.44	3.49	0.39957	.	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.49351	-0.8949	10	0.87932	D	0	-32.7186	13.3967	0.60858	0.0:0.0:0.5587:0.4413	.	892	Q8IY37	DHX37_HUMAN	W	892;679	ENSP00000311135:R892W;ENSP00000439009:R679W	ENSP00000311135:R892W	R	-	1	2	DHX37	124004400	0.934000	0.31675	1.000000	0.80357	0.985000	0.73830	0.934000	0.28910	1.284000	0.44531	0.462000	0.41574	CGG	.		0.647	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032656	
DNAH9	1770	broad.mit.edu;mdanderson.org	37	17	11738188	11738188	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:11738188G>A	ENST00000262442.4	+	49	9548	c.9480G>A	c.(9478-9480)gcG>gcA	p.A3160A	DNAH9_ENST00000454412.2_Silent_p.A3160A	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3160	Stalk. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TCACAGCAGCGCAGGCAGCTC	0.572																																					p.A3160A		.											.	DNAH9	168	0			c.G9480A						.						116.0	83.0	94.0					17																	11738188		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon49			AGCAGCGCAGGCA	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9480G>A	17.37:g.11738188G>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	8.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																			.		0.572	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
DYM	54808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	46860102	46860102	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr18:46860102G>A	ENST00000269445.6	-	7	1073	c.616C>T	c.(616-618)Cca>Tca	p.P206S	DYM_ENST00000442713.2_Intron|DYM_ENST00000578396.1_Missense_Mutation_p.P51S	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	206					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						ACATACCATGGACCTCGCATC	0.373																																					p.P206S		.											.	DYM	226	0			c.C616T						.						103.0	99.0	100.0					18																	46860102		2203	4300	6503	SO:0001583	missense	54808	exon7			ACCATGGACCTCG	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.616C>T	18.37:g.46860102G>A	ENSP00000269445:p.Pro206Ser	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	12.0	NM_017653	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Missense_Mutation	SNP	ENST00000269445.6	37	CCDS11937.1	.	.	.	.	.	.	.	.	.	.	G	12.64	1.997369	0.35226	.	.	ENSG00000141627	ENST00000269445	D	0.81499	-1.5	4.43	4.43	0.53597	.	0.260980	0.39475	N	0.001351	T	0.69949	0.3168	N	0.16790	0.44	0.44771	D	0.997773	B;B	0.10296	0.003;0.002	B;B	0.11329	0.006;0.006	T	0.66164	-0.5992	10	0.45353	T	0.12	.	18.0098	0.89219	0.0:0.0:1.0:0.0	.	28;206	Q9NXS9;Q7RTS9	.;DYM_HUMAN	S	206	ENSP00000269445:P206S	ENSP00000269445:P206S	P	-	1	0	DYM	45114100	1.000000	0.71417	0.999000	0.59377	0.670000	0.39368	6.997000	0.76270	2.424000	0.82194	0.454000	0.30748	CCA	.		0.373	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
EGFLAM	133584	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38370498	38370498	+	Missense_Mutation	SNP	G	G	T	rs369204325		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:38370498G>T	ENST00000354891.3	+	6	992	c.646G>T	c.(646-648)Gtg>Ttg	p.V216L	EGFLAM_ENST00000322350.5_Missense_Mutation_p.V216L	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	216	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					CCAGTTTGCCGTGAGGGCAAT	0.567																																					p.V216L	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.G646T						.						69.0	64.0	66.0					5																	38370498		2203	4300	6503	SO:0001583	missense	133584	exon6			TTTGCCGTGAGGG	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.646G>T	5.37:g.38370498G>T	ENSP00000346964:p.Val216Leu	Somatic	62.0	1.0		WXS	Illumina HiSeq	Phase_I	34.0	15.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	ENST00000354891.3	37	CCDS56363.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.597961	0.66332	.	.	ENSG00000164318	ENST00000354891;ENST00000322350	T;T	0.72282	-0.64;-0.64	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.058756	0.64402	D	0.000002	T	0.72087	0.3417	M	0.62723	1.935	0.80722	D	1	B;B	0.22909	0.077;0.063	B;B	0.26969	0.075;0.045	T	0.67749	-0.5590	10	0.49607	T	0.09	-0.1892	19.688	0.95987	0.0:0.0:1.0:0.0	.	216;216	Q63HQ2;Q63HQ2-2	EGFLA_HUMAN;.	L	216	ENSP00000346964:V216L;ENSP00000313084:V216L	ENSP00000313084:V216L	V	+	1	0	EGFLAM	38406255	1.000000	0.71417	0.950000	0.38849	0.988000	0.76386	3.223000	0.51231	2.756000	0.94617	0.561000	0.74099	GTG	.		0.567	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
EIF2AK3	9451	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	88874198	88874198	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:88874198G>A	ENST00000303236.3	-	13	3104	c.2803C>T	c.(2803-2805)Cac>Tac	p.H935Y	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.H784Y|EIF2AK3_ENST00000470706.1_5'UTR|AC104134.2_ENST00000413234.1_RNA	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	935	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						AGGTCCCTGTGCATCAGTCCT	0.493																																					p.H935Y	GBM(138;671 1851 16235 39058 45249)	.											.	EIF2AK3	361	0			c.C2803T						.						88.0	81.0	84.0					2																	88874198		2203	4300	6503	SO:0001583	missense	9451	exon13			CCCTGTGCATCAG	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.2803C>T	2.37:g.88874198G>A	ENSP00000307235:p.His935Tyr	Somatic	170.0	1.0		WXS	Illumina HiSeq	Phase_I	117.0	29.0	NM_004836	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	ENST00000303236.3	37	CCDS33241.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833273	0.91036	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.62788	-0.0;-0.0;-0.0	5.78	5.78	0.91487	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.84129	0.5404	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86527	0.1819	10	0.87932	D	0	-23.1652	20.0182	0.97486	0.0:0.0:1.0:0.0	.	935	Q9NZJ5	E2AK3_HUMAN	Y	784;935;784;814	ENSP00000408325:H784Y;ENSP00000307235:H935Y;ENSP00000412076:H814Y	ENSP00000307235:H935Y	H	-	1	0	EIF2AK3	88655313	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.869000	0.99810	2.738000	0.93877	0.655000	0.94253	CAC	.		0.493	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836	
FAM155A	728215	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	108518800	108518800	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:108518800T>G	ENST00000375915.2	-	1	283	c.145A>C	c.(145-147)Aca>Cca	p.T49P		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	49						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						AGCAGGACTGTGAAAAACAAG	0.577																																					p.T49P		.											.	FAM155A	23	0			c.A145C						.						120.0	130.0	126.0					13																	108518800		2203	4300	6503	SO:0001583	missense	728215	exon1			GGACTGTGAAAAA	L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.145A>C	13.37:g.108518800T>G	ENSP00000365080:p.Thr49Pro	Somatic	54.0	1.0		WXS	Illumina HiSeq	Phase_I	129.0	29.0	NM_001080396	B2RUV1|B7Z334	Missense_Mutation	SNP	ENST00000375915.2	37	CCDS32006.1	.	.	.	.	.	.	.	.	.	.	T	19.43	3.825962	0.71143	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.70544	0.3236	L	0.50333	1.59	0.50632	D	0.999887	D	0.76494	0.999	D	0.83275	0.996	T	0.73783	-0.3874	9	0.87932	D	0	.	14.1318	0.65260	0.0:0.0:0.0:1.0	.	49	B1AL88	F155A_HUMAN	P	49	.	ENSP00000365080:T49P	T	-	1	0	FAM155A	107316801	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.657000	0.67996	1.936000	0.56123	0.528000	0.53228	ACA	.		0.577	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045736.2	NM_001080396	
FBN2	2201	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	127610344	127610344	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:127610344G>T	ENST00000508053.1	-	66	8600	c.7626C>A	c.(7624-7626)aaC>aaA	p.N2542K	FBN2_ENST00000262464.4_Missense_Mutation_p.N2542K			P35556	FBN2_HUMAN	fibrillin 2	2542	EGF-like 43; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGAACTGGCAGTTATGCTGCT	0.443																																					p.N2542K		.											.	FBN2	146	0			c.C7626A						.						95.0	93.0	94.0					5																	127610344		2203	4300	6503	SO:0001583	missense	2201	exon60			CTGGCAGTTATGC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7626C>A	5.37:g.127610344G>T	ENSP00000424571:p.Asn2542Lys	Somatic	111.0	2.0		WXS	Illumina HiSeq	Phase_I	64.0	14.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474156	0.63737	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.92299	-3.01;-3.01	4.92	0.725	0.18242	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000005	D	0.91653	0.7362	L	0.38733	1.17	0.43164	D	0.994955	D	0.69078	0.997	D	0.81914	0.995	D	0.87128	0.2195	10	0.27082	T	0.32	.	9.5598	0.39362	0.4386:0.0:0.5614:0.0	.	2542	P35556	FBN2_HUMAN	K	2542	ENSP00000262464:N2542K;ENSP00000424571:N2542K	ENSP00000262464:N2542K	N	-	3	2	FBN2	127638243	0.999000	0.42202	0.998000	0.56505	0.905000	0.53344	0.480000	0.22244	-0.001000	0.14495	-0.224000	0.12420	AAC	.		0.443	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
FBN3	84467	ucsc.edu;bcgsc.ca	37	19	8175981	8175981	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:8175981T>C	ENST00000600128.1	-	33	4585	c.4171A>G	c.(4171-4173)Atg>Gtg	p.M1391V	FBN3_ENST00000270509.2_Missense_Mutation_p.M1391V|FBN3_ENST00000601739.1_Missense_Mutation_p.M1391V			Q75N90	FBN3_HUMAN	fibrillin 3	1391	EGF-like 21; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TCAAAGCCCATCTCACATTCA	0.652																																					p.M1391V		.											.	FBN3	100	0			c.A4171G						.						74.0	67.0	69.0					19																	8175981		2203	4300	6503	SO:0001583	missense	84467	exon32			AGCCCATCTCACA		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.4171A>G	19.37:g.8175981T>C	ENSP00000470498:p.Met1391Val	Somatic	44.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	T	7.015	0.557572	0.13436	.	.	ENSG00000142449	ENST00000270509	D	0.91740	-2.9	3.67	1.37	0.22104	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	T	0.77811	0.4186	N	0.03050	-0.425	0.43250	D	0.995177	B	0.25563	0.129	B	0.26517	0.07	T	0.65878	-0.6061	10	0.51188	T	0.08	.	6.0011	0.19521	0.0:0.0911:0.1646:0.7443	.	1391	Q75N90	FBN3_HUMAN	V	1391	ENSP00000270509:M1391V	ENSP00000270509:M1391V	M	-	1	0	FBN3	8081981	1.000000	0.71417	0.095000	0.20976	0.027000	0.11550	3.720000	0.54933	-0.012000	0.14223	-0.464000	0.05259	ATG	.		0.652	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
FGD6	55785	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	95603522	95603522	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:95603522G>C	ENST00000343958.4	-	2	1761	c.1538C>G	c.(1537-1539)gCt>gGt	p.A513G	FGD6_ENST00000549499.1_Missense_Mutation_p.A513G|FGD6_ENST00000546711.1_Missense_Mutation_p.A513G|FGD6_ENST00000550368.1_5'Flank	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	513					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						CTCGGAGGCAGCCTTTTTAAG	0.393																																					p.A513G		.											.	FGD6	137	0			c.C1538G						.						68.0	75.0	73.0					12																	95603522		2198	4297	6495	SO:0001583	missense	55785	exon2			GAGGCAGCCTTTT	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1538C>G	12.37:g.95603522G>C	ENSP00000344446:p.Ala513Gly	Somatic	214.0	1.0		WXS	Illumina HiSeq	Phase_I	217.0	69.0	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	ENST00000343958.4	37	CCDS31878.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016558	0.75161	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.73469	-0.64;-0.75;-0.72	6.04	6.04	0.98038	.	0.000000	0.48767	D	0.000171	D	0.85075	0.5614	M	0.64997	1.995	0.46564	D	0.999101	D	0.76494	0.999	D	0.65443	0.935	D	0.84873	0.0826	10	0.72032	D	0.01	-16.7761	20.5792	0.99380	0.0:0.0:1.0:0.0	.	513	Q6ZV73	FGD6_HUMAN	G	513	ENSP00000344446:A513G;ENSP00000450342:A513G;ENSP00000449005:A513G	ENSP00000344446:A513G	A	-	2	0	FGD6	94127653	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.262000	0.65501	2.873000	0.98535	0.561000	0.74099	GCT	.		0.393	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
FGFRL1	53834	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	1015991	1015991	+	Splice_Site	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:1015991G>T	ENST00000398484.2	+	4	660	c.80G>T	c.(79-81)gGc>gTc	p.G27V	FGFRL1_ENST00000510644.1_Splice_Site_p.G27V|FGFRL1_ENST00000264748.6_Splice_Site_p.G27V|FGFRL1_ENST00000504138.1_Splice_Site_p.G27V			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	27					diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			CCACCCGCAGGCCCCCCAAAG	0.741																																					p.G27V		.											.	FGFRL1	90	0			c.G80T						.						5.0	6.0	5.0					4																	1015991		1971	3964	5935	SO:0001630	splice_region_variant	53834	exon3			CCGCAGGCCCCCC		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.80-1G>T	4.37:g.1015991G>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	20.0	NM_001004356	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	37	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	g	12.76	2.033972	0.35893	.	.	ENSG00000127418	ENST00000398484;ENST00000510644;ENST00000504138;ENST00000512174;ENST00000507339;ENST00000264748	T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.4;0.03;-0.67	4.62	3.71	0.42584	Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.62097	0.2400	L	0.49778	1.585	0.80722	D	1	B	0.27732	0.187	B	0.26969	0.075	T	0.59830	-0.7380	9	.	.	.	.	12.1552	0.54072	0.0:0.0:0.828:0.1719	.	27	Q8N441	FGRL1_HUMAN	V	27	ENSP00000381498:G27V;ENSP00000425025:G27V;ENSP00000423091:G27V;ENSP00000426740:G27V;ENSP00000424037:G27V;ENSP00000264748:G27V	.	G	+	2	0	FGFRL1	1005991	1.000000	0.71417	0.999000	0.59377	0.145000	0.21501	6.390000	0.73204	2.109000	0.64355	0.457000	0.33378	GGC	.		0.741	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239195.2	NM_021923	Missense_Mutation
FNDC3A	22862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	49710511	49710511	+	Silent	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:49710511A>G	ENST00000492622.2	+	6	839	c.534A>G	c.(532-534)cgA>cgG	p.R178R	FNDC3A_ENST00000541916.1_Silent_p.R178R|FNDC3A_ENST00000398316.3_Silent_p.R122R	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	178					fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		GAGATGAACGATCTAGTAAAA	0.378																																					p.R178R		.											.	FNDC3A	278	0			c.A534G						.						69.0	66.0	67.0					13																	49710511		2203	4300	6503	SO:0001819	synonymous_variant	22862	exon6			TGAACGATCTAGT	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.534A>G	13.37:g.49710511A>G		Somatic	241.0	1.0		WXS	Illumina HiSeq	Phase_I	133.0	59.0	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Silent	SNP	ENST00000492622.2	37	CCDS41886.1																																																																																			.		0.378	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
FOXG1	2290	broad.mit.edu;mdanderson.org	37	14	29237565	29237565	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:29237565C>A	ENST00000313071.4	+	1	1279	c.1080C>A	c.(1078-1080)aaC>aaA	p.N360K	FOXG1_ENST00000382535.3_Missense_Mutation_p.N360K	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	360					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N360K(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CCACCGCCAACGGCCTGAGCG	0.687																																					p.N360K		.											.	FOXG1	660	1	Substitution - Missense(1)	lung(1)	c.C1080A						.						85.0	77.0	80.0					14																	29237565		2203	4300	6503	SO:0001583	missense	2290	exon1			CGCCAACGGCCTG		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1080C>A	14.37:g.29237565C>A	ENSP00000339004:p.Asn360Lys	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	8.0	NM_005249	A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	37	CCDS9636.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.531742	0.27387	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93426	-3.22;-3.22	4.21	3.3	0.37823	.	0.123627	0.52532	U	0.000063	D	0.92364	0.7577	N	0.24115	0.695	0.50171	D	0.999851	D	0.69078	0.997	D	0.77004	0.989	D	0.91018	0.4855	10	0.45353	T	0.12	.	9.2736	0.37686	0.0:0.7606:0.0:0.2393	.	360	P55316	FOXG1_HUMAN	K	360	ENSP00000371975:N360K;ENSP00000339004:N360K	ENSP00000339004:N360K	N	+	3	2	FOXG1	28307316	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.961000	0.29267	2.042000	0.60477	0.491000	0.48974	AAC	.		0.687	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
FOXI1	2299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169535204	169535204	+	Missense_Mutation	SNP	C	C	A	rs35678180	byFrequency	TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:169535204C>A	ENST00000306268.6	+	2	787	c.726C>A	c.(724-726)agC>agA	p.S242R	FOXI1_ENST00000449804.2_Intron			Q12951	FOXI1_HUMAN	forkhead box I1	242					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGGTGGACAGCCCCAAGACCA	0.592									Pendred syndrome																												p.S242R		.											.	FOXI1	229	0			c.C726A						.						56.0	62.0	60.0					5																	169535204		2203	4300	6503	SO:0001583	missense	2299	exon2	Familial Cancer Database	Goiter-Deafness syndrome	GGACAGCCCCAAG	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.726C>A	5.37:g.169535204C>A	ENSP00000304286:p.Ser242Arg	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	25.0	NM_012188	Q14518|Q66SR7|Q8N6L8	Missense_Mutation	SNP	ENST00000306268.6	37	CCDS4372.1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.949135	0.34377	.	.	ENSG00000168269	ENST00000306268	D	0.94280	-3.39	4.91	3.01	0.34805	.	0.246213	0.41605	D	0.000858	D	0.94997	0.8381	M	0.81682	2.555	0.80722	D	1	D	0.59357	0.985	P	0.58077	0.832	D	0.93602	0.6931	10	0.41790	T	0.15	.	10.1849	0.42991	0.0:0.826:0.0:0.174	.	242	Q12951	FOXI1_HUMAN	R	242	ENSP00000304286:S242R	ENSP00000304286:S242R	S	+	3	2	FOXI1	169467782	1.000000	0.71417	0.997000	0.53966	0.015000	0.08874	1.094000	0.30951	0.987000	0.38709	0.455000	0.32223	AGC	C|0.995;T|0.005		0.592	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252827.2	NM_144769, NM_012188	
GAB1	2549	broad.mit.edu;mdanderson.org	37	4	144336701	144336701	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:144336701C>A	ENST00000262994.4	+	2	446	c.144C>A	c.(142-144)taC>taA	p.Y48*	GAB1_ENST00000262995.4_Nonsense_Mutation_p.Y48*|GAB1_ENST00000505913.1_5'UTR	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	48	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					TGGAATATTACAAAAATGATC	0.343																																					p.Y48X		.											.	GAB1	1146	0			c.C144A						.						96.0	86.0	90.0					4																	144336701		2203	4300	6503	SO:0001587	stop_gained	2549	exon2			ATATTACAAAAAT	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.144C>A	4.37:g.144336701C>A	ENSP00000262994:p.Tyr48*	Somatic	240.0	1.0		WXS	Illumina HiSeq	Phase_I	292.0	22.0	NM_207123	A8K152|Q4W5G2|Q6P1W2	Nonsense_Mutation	SNP	ENST00000262994.4	37	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	C	37	6.299481	0.97453	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000514639;ENST00000509992	.	.	.	5.85	4.11	0.48088	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0319	8.8879	0.35414	0.1266:0.7489:0.0:0.1245	.	.	.	.	X	48;48;48;27	.	ENSP00000262994:Y48X	Y	+	3	2	GAB1	144556151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.036000	0.57304	1.466000	0.48025	0.655000	0.94253	TAC	.		0.343	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
GABRR2	2570	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	89967516	89967516	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:89967516C>A	ENST00000402938.3	-	9	1404	c.1271G>T	c.(1270-1272)gGg>gTg	p.G424V	GABRR2_ENST00000602399.1_Missense_Mutation_p.G449V	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	424					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	CTTCAGAAGCCCCTTCTTTCT	0.488																																					p.G424V		.											.	GABRR2	68	0			c.G1271T						.						101.0	89.0	93.0					6																	89967516		2203	4300	6503	SO:0001583	missense	2570	exon9			AGAAGCCCCTTCT		CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.1271G>T	6.37:g.89967516C>A	ENSP00000386029:p.Gly424Val	Somatic	240.0	2.0		WXS	Illumina HiSeq	Phase_I	244.0	87.0	NM_002043	A2BDE4|Q9H153	Missense_Mutation	SNP	ENST00000402938.3	37	CCDS5020.3	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654514	0.47467	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.92	5.92	0.95590	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.339788	0.22724	N	0.056403	T	0.51618	0.1685	L	0.49350	1.555	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.46317	-0.9200	8	.	.	.	.	20.3343	0.98733	0.0:1.0:0.0:0.0	.	449	P28476	GBRR2_HUMAN	V	449	.	.	G	-	2	0	GABRR2	90024235	0.990000	0.36364	1.000000	0.80357	0.970000	0.65996	2.178000	0.42519	2.822000	0.97130	0.650000	0.86243	GGG	.		0.488	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041482.3		
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120580635	120580635	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:120580635G>A	ENST00000300648.6	-	43	5618	c.5606C>T	c.(5605-5607)tCc>tTc	p.S1869F		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1869					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACCTTGTTGGACTGGGCAGT	0.537																																					p.S1869F		.											.	GCN1L1	94	0			c.C5606T						.						141.0	145.0	143.0					12																	120580635		2060	4201	6261	SO:0001583	missense	10985	exon43			TTGTTGGACTGGG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5606C>T	12.37:g.120580635G>A	ENSP00000300648:p.Ser1869Phe	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	63.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.750913	0.89753	.	.	ENSG00000089154	ENST00000300648	T	0.50548	0.74	5.97	5.97	0.96955	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68476	0.3005	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.67110	-0.5753	10	0.59425	D	0.04	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	1869	Q92616	GCN1L_HUMAN	F	1869	ENSP00000300648:S1869F	ENSP00000300648:S1869F	S	-	2	0	GCN1L1	119065018	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.209000	0.95087	2.828000	0.97474	0.655000	0.94253	TCC	.		0.537	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
GFRAL	389400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	55263983	55263983	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:55263983C>A	ENST00000340465.2	+	7	1044	c.958C>A	c.(958-960)Cca>Aca	p.P320T		NM_207410.2	NP_997293.2	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like	320					negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|stress-activated protein kinase signaling cascade (GO:0031098)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|kidney(5)|large_intestine(2)|liver(1)|lung(31)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	48	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			TTCAGATTATCCAACCCTGTC	0.294																																					p.P320T		.											.	GFRAL	154	0			c.C958A						.						36.0	35.0	36.0					6																	55263983		2203	4289	6492	SO:0001583	missense	389400	exon7			GATTATCCAACCC	AY358198	CCDS4957.1	6p12.1	2007-06-22			ENSG00000187871	ENSG00000187871			32789	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 144"""	C6orf144		16086688	Standard	NM_207410		Approved	GRAL, UNQ9356, bA360D14.1	uc003pcm.1	Q6UXV0	OTTHUMG00000014900	ENST00000340465.2:c.958C>A	6.37:g.55263983C>A	ENSP00000343636:p.Pro320Thr	Somatic	648.0	1.0		WXS	Illumina HiSeq	Phase_I	489.0	149.0	NM_207410	Q5VTF6	Missense_Mutation	SNP	ENST00000340465.2	37	CCDS4957.1	.	.	.	.	.	.	.	.	.	.	C	3.374	-0.127832	0.06753	.	.	ENSG00000187871	ENST00000340465	T	0.30981	1.51	5.79	1.61	0.23674	.	1.656770	0.03636	N	0.238747	T	0.07279	0.0184	L	0.27053	0.805	0.09310	N	1	B	0.27625	0.183	B	0.22386	0.039	T	0.23154	-1.0196	10	0.25751	T	0.34	-0.8127	5.5127	0.16890	0.1501:0.5985:0.0:0.2513	.	320	Q6UXV0	GFRAL_HUMAN	T	320	ENSP00000343636:P320T	ENSP00000343636:P320T	P	+	1	0	GFRAL	55371942	0.112000	0.22096	0.208000	0.23602	0.032000	0.12392	0.767000	0.26575	0.378000	0.24764	-0.150000	0.13652	CCA	.		0.294	GFRAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040995.2	NM_207410	
GIMAP2	26157	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150390064	150390064	+	Silent	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:150390064G>T	ENST00000223293.5	+	3	784	c.690G>T	c.(688-690)gtG>gtT	p.V230V		NM_015660.2	NP_056475.1	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	230						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(8)|skin(2)|urinary_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTGGACCTGTGGGATCAGATG	0.398																																					p.V230V		.											.	GIMAP2	91	0			c.G690T						.						107.0	104.0	105.0					7																	150390064		2203	4300	6503	SO:0001819	synonymous_variant	26157	exon3			ACCTGTGGGATCA	AL110151	CCDS5905.1	7q36.1	2014-04-04			ENSG00000106560	ENSG00000106560		"""GTPases, IMAP"""	21789	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 12"""	608085				15474311	Standard	NM_015660		Approved	DKFZp586D0824, HIMAP2, IMAP2, IAN12	uc003who.3	Q9UG22	OTTHUMG00000157488	ENST00000223293.5:c.690G>T	7.37:g.150390064G>T		Somatic	153.0	1.0		WXS	Illumina HiSeq	Phase_I	134.0	29.0	NM_015660	Q96L25	Silent	SNP	ENST00000223293.5	37	CCDS5905.1																																																																																			.		0.398	GIMAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348948.1	NM_015660	
GMIP	51291	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	19740822	19740822	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:19740822C>T	ENST00000203556.4	-	21	3000	c.2863G>A	c.(2863-2865)Gcc>Acc	p.A955T	GMIP_ENST00000587238.1_Missense_Mutation_p.A929T|LPAR2_ENST00000586703.1_5'Flank|GMIP_ENST00000445806.2_Missense_Mutation_p.A926T|LPAR2_ENST00000407877.3_5'Flank|LPAR2_ENST00000589311.1_5'Flank|LPAR2_ENST00000542587.1_5'Flank	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	955					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						CAGCAGGTGGCCCTGGGCACA	0.627																																					p.A955T		.											.	GMIP	91	0			c.G2863A						.						17.0	17.0	17.0					19																	19740822		2203	4300	6503	SO:0001583	missense	51291	exon21			AGGTGGCCCTGGG	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.2863G>A	19.37:g.19740822C>T	ENSP00000203556:p.Ala955Thr	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	38.0	NM_016573	A0AVN9|B7ZLZ0	Missense_Mutation	SNP	ENST00000203556.4	37	CCDS12408.1	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863421	0.51482	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.21543	2.0;2.0	5.11	-1.89	0.07689	.	0.424132	0.17523	N	0.171189	T	0.09158	0.0226	N	0.17082	0.46	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.40308	-0.9570	10	0.08179	T	0.78	-7.6898	9.0822	0.36558	0.0:0.4364:0.0:0.5636	.	926;929;955	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	T	955;926	ENSP00000203556:A955T;ENSP00000397075:A926T	ENSP00000203556:A955T	A	-	1	0	GMIP	19601822	0.000000	0.05858	0.006000	0.13384	0.922000	0.55478	-0.356000	0.07661	-0.126000	0.11682	0.561000	0.74099	GCC	.		0.627	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573	
GNAI1	2770	broad.mit.edu;mdanderson.org	37	7	79764496	79764496	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:79764496C>T	ENST00000351004.3	+	1	393	c.20C>T	c.(19-21)gCc>gTc	p.A7V	GNAI1_ENST00000457358.2_5'Flank|GNAI1_ENST00000490206.1_3'UTR	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	7					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						ACGCTGAGCGCCGAGGACAAG	0.682																																					p.A7V		.											.	GNAI1	653	0			c.C20T						.						14.0	15.0	14.0					7																	79764496		2191	4284	6475	SO:0001583	missense	2770	exon1			TGAGCGCCGAGGA	AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.20C>T	7.37:g.79764496C>T	ENSP00000343027:p.Ala7Val	Somatic	35.0	1.0		WXS	Illumina HiSeq	Phase_I	68.0	13.0	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Missense_Mutation	SNP	ENST00000351004.3	37	CCDS5595.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695255	0.88830	.	.	ENSG00000127955	ENST00000442586;ENST00000351004	D	0.89050	-2.46	3.79	3.79	0.43588	.	0.058843	0.64402	U	0.000002	D	0.85775	0.5775	L	0.60904	1.88	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.82184	-0.0583	9	.	.	.	.	14.3507	0.66699	0.0:1.0:0.0:0.0	.	7	P63096	GNAI1_HUMAN	V	7	ENSP00000343027:A7V	.	A	+	2	0	GNAI1	79602432	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.066000	0.76734	1.945000	0.56424	0.453000	0.30009	GCC	.		0.682	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
GPR135	64582	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	59930780	59930780	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:59930780T>C	ENST00000395116.1	-	1	1280	c.1165A>G	c.(1165-1167)Atc>Gtc	p.I389V		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	389						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		GGATTGCGGATGGCGTAGATG	0.662																																					p.I389V		.											.	GPR135	90	0			c.A1165G						.						50.0	41.0	44.0					14																	59930780		2203	4296	6499	SO:0001583	missense	64582	exon1			TGCGGATGGCGTA	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.1165A>G	14.37:g.59930780T>C	ENSP00000378548:p.Ile389Val	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	11.0	NM_022571	Q7Z604|Q86SM3|Q8NH39	Missense_Mutation	SNP	ENST00000395116.1	37	CCDS9738.1	.	.	.	.	.	.	.	.	.	.	t	7.718	0.696679	0.15106	.	.	ENSG00000181619	ENST00000395116	T	0.37584	1.19	4.69	-1.97	0.07503	.	0.657430	0.14196	N	0.335015	T	0.14960	0.0361	N	0.04880	-0.145	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24693	-1.0153	10	0.12103	T	0.63	-3.5614	11.4701	0.50264	0.0:0.5252:0.0:0.4747	.	389	Q8IZ08	GP135_HUMAN	V	389	ENSP00000378548:I389V	ENSP00000378548:I389V	I	-	1	0	GPR135	59000533	0.395000	0.25254	0.996000	0.52242	0.997000	0.91878	-0.162000	0.10012	-0.224000	0.09928	0.529000	0.55759	ATC	.		0.662	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276941.1	NM_022571	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	89953983	89953983	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:89953983C>T	ENST00000405460.2	+	21	4736	c.4640C>T	c.(4639-4641)tCt>tTt	p.S1547F		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1547					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAACTAGTTTCTGTATATGGA	0.363																																					p.S1547F		.											.	GPR98	103	0			c.C4640T						.						99.0	100.0	99.0					5																	89953983		1825	4082	5907	SO:0001583	missense	84059	exon21			TAGTTTCTGTATA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4640C>T	5.37:g.89953983C>T	ENSP00000384582:p.Ser1547Phe	Somatic	214.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	30.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.646393	0.47258	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.30714	1.52	5.86	5.86	0.93980	.	0.099573	0.64402	D	0.000001	T	0.43765	0.1262	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.35226	-0.9797	10	0.87932	D	0	.	17.1393	0.86748	0.0:0.874:0.126:0.0	.	1547	Q8WXG9	GPR98_HUMAN	F	1547	ENSP00000384582:S1547F	ENSP00000296619:S1547F	S	+	2	0	GPR98	89989739	1.000000	0.71417	1.000000	0.80357	0.049000	0.14656	4.622000	0.61240	2.771000	0.95319	0.650000	0.86243	TCT	.		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GPRIN2	9721	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	46999457	46999457	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:46999457C>G	ENST00000374317.1	+	3	850	c.577C>G	c.(577-579)Cag>Gag	p.Q193E	GPRIN2_ENST00000374314.4_Missense_Mutation_p.Q193E	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	193										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GGGGGCGAGTCAGTTGTCAGT	0.622																																					p.Q193E		.											.	GPRIN2	90	0			c.C577G						.						42.0	41.0	41.0					10																	46999457		2203	4300	6503	SO:0001583	missense	9721	exon3			GCGAGTCAGTTGT	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.577C>G	10.37:g.46999457C>G	ENSP00000363436:p.Gln193Glu	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	7.0	NM_014696	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	.	.	.	.	.	.	.	.	.	.	C	5.291	0.239166	0.10023	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03860	3.78;3.78	5.28	4.37	0.52481	.	0.512051	0.16629	N	0.206133	T	0.05868	0.0153	L	0.51422	1.61	0.09310	N	1	B	0.20671	0.047	B	0.18561	0.022	T	0.37174	-0.9717	10	0.12766	T	0.61	-2.5144	12.3103	0.54925	0.0:0.8296:0.1704:0.0	.	193	O60269	GRIN2_HUMAN	E	193	ENSP00000363436:Q193E;ENSP00000363433:Q193E	ENSP00000363433:Q193E	Q	+	1	0	GPRIN2	46419463	0.247000	0.23920	0.499000	0.27577	0.057000	0.15508	1.339000	0.33885	1.358000	0.45922	0.555000	0.69702	CAG	.		0.622	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
GPRIN2	9721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	47000008	47000008	+	Silent	SNP	G	G	T	rs111800394		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:47000008G>T	ENST00000374317.1	+	3	1401	c.1128G>T	c.(1126-1128)ccG>ccT	p.P376P	GPRIN2_ENST00000374314.4_Silent_p.P376P	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	376										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						AGGAGGTGCCGTCCCCTGTGC	0.657																																					p.P376P		.											.	GPRIN2	90	0			c.G1128T						.						164.0	140.0	148.0					10																	47000008		2203	4300	6503	SO:0001819	synonymous_variant	9721	exon3			GGTGCCGTCCCCT	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1128G>T	10.37:g.47000008G>T		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	221.0	23.0	NM_014696	Q5SVF0	Silent	SNP	ENST00000374317.1	37	CCDS31192.1																																																																																			G|0.500;A|0.500		0.657	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
GPS2	2874	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7216697	7216697	+	Splice_Site	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:7216697A>G	ENST00000380728.2	-	8	1025		c.e8+1		GPS2_ENST00000391950.3_Splice_Site|RP11-542C16.2_ENST00000575474.1_Splice_Site|GPS2_ENST00000389167.5_Splice_Site			Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				GGATGTTATCACCTGTCTGAG	0.557											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	GPS2	93	0			c.724+2T>C						.						99.0	102.0	101.0					17																	7216697		2203	4300	6503	SO:0001630	splice_region_variant	2874	exon9			GTTATCACCTGTC	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.724+1T>C	17.37:g.7216697A>G		Somatic	97.0	0.0	640	WXS	Illumina HiSeq	Phase_I	98.0	51.0	NM_004489	B4DXA1|Q6FHM8	Splice_Site	SNP	ENST00000380728.2	37	CCDS11100.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044178	0.55110	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	.	.	.	3.67	3.67	0.42095	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6611	0.45702	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPS2	7157421	0.999000	0.42202	1.000000	0.80357	0.958000	0.62258	4.623000	0.61247	1.899000	0.54978	0.523000	0.50628	.	.		0.557	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489	Intron
HEATR6	63897	hgsc.bcm.edu;broad.mit.edu	37	17	58156056	58156056	+	Splice_Site	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:58156056C>T	ENST00000184956.6	-	1	236		c.e1+1		HEATR6_ENST00000585712.1_Splice_Site|CTD-2319I12.2_ENST00000589740.1_lincRNA|HEATR6_ENST00000585976.1_Splice_Site	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6								poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GCGCCGCCTACCTCCGGGGCC	0.711																																					.		.											.	HEATR6	227	0			c.219+1G>A						.						8.0	7.0	7.0					17																	58156056		2071	4060	6131	SO:0001630	splice_region_variant	63897	exon2			CGCCTACCTCCGG	BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.219+1G>A	17.37:g.58156056C>T		Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	14.0	NM_022070	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Splice_Site	SNP	ENST00000184956.6	37	CCDS11623.1	.	.	.	.	.	.	.	.	.	.	.	16.87	3.240773	0.58995	.	.	ENSG00000068097	ENST00000184956	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6658	0.62393	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HEATR6	55510838	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	4.277000	0.58939	2.479000	0.83701	0.558000	0.71614	.	.		0.711	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449165.1	NM_022070	Intron
HHIPL2	79802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	222705320	222705320	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:222705320C>G	ENST00000343410.6	-	6	1769	c.1711G>C	c.(1711-1713)Gaa>Caa	p.E571Q		NM_024746.3	NP_079022.2	Q6UWX4	HIPL2_HUMAN	HHIP-like 2	571					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)			NS(2)|endometrium(8)|kidney(4)|large_intestine(7)|lung(28)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59				GBM - Glioblastoma multiforme(131;0.0185)		GCTTCATCTTCAGCAAAGGAG	0.433																																					p.E571Q		.											.	HHIPL2	69	0			c.G1711C						.						84.0	81.0	82.0					1																	222705320		2203	4300	6503	SO:0001583	missense	79802	exon6			CATCTTCAGCAAA	BC007638	CCDS1530.2	1q41	2008-02-05	2008-01-16	2008-01-16	ENSG00000143512	ENSG00000143512			25842	protein-coding gene	gene with protein product			"""KIAA1822-like"""	KIAA1822L		12975309	Standard	NM_024746		Approved	FLJ13840	uc001hnh.1	Q6UWX4	OTTHUMG00000037545	ENST00000343410.6:c.1711G>C	1.37:g.222705320C>G	ENSP00000342118:p.Glu571Gln	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	25.0	NM_024746	Q6GU65|Q96BT4|Q96BU5|Q9H8A0	Missense_Mutation	SNP	ENST00000343410.6	37	CCDS1530.2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999179	0.74818	.	.	ENSG00000143512	ENST00000343410	T	0.11169	2.8	5.0	4.09	0.47781	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.052062	0.64402	D	0.000001	T	0.23688	0.0573	L	0.43757	1.38	0.52099	D	0.999942	D	0.89917	1.0	D	0.97110	1.0	T	0.00581	-1.1660	10	0.39692	T	0.17	-18.8979	12.8232	0.57704	0.0:0.9204:0.0:0.0796	.	571	Q6UWX4	HIPL2_HUMAN	Q	571	ENSP00000342118:E571Q	ENSP00000342118:E571Q	E	-	1	0	HHIPL2	220771943	1.000000	0.71417	0.994000	0.49952	0.982000	0.71751	5.694000	0.68272	1.091000	0.41335	0.591000	0.81541	GAA	.		0.433	HHIPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091499.2	NM_024746	
HYDIN	54768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	70884513	70884513	+	Silent	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:70884513C>G	ENST00000393567.2	-	74	12639	c.12489G>C	c.(12487-12489)gtG>gtC	p.V4163V	RNU6ATAC25P_ENST00000408798.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4163					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				AATTAAAGTTCACATCTCCTT	0.428																																					p.V4163V		.											.	HYDIN	92	0			c.G12489C						.						75.0	65.0	68.0					16																	70884513		1856	4104	5960	SO:0001819	synonymous_variant	54768	exon74			AAAGTTCACATCT	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12489G>C	16.37:g.70884513C>G		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	34.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																			.		0.428	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
LMNTD1	160492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	25801457	25801457	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:25801457A>T	ENST00000445693.1	-	1	31	c.29T>A	c.(28-30)aTc>aAc	p.I10N		NM_001145727.2	NP_001139199.1	Q8N9Z9	LMTD1_HUMAN		0				R -> K (in Ref. 1; BAC04132). {ECO:0000305}.	cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|nuclear envelope (GO:0005635)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	22	all_lung(3;2.75e-22)|Lung NSC(3;1.77e-21)|all_hematologic(7;0.00656)|Colorectal(261;0.0847)					GGAAACACCGATGTCTCCTGC	0.488																																					p.I10N		.											.	IFLTD1	92	0			c.T29A						.						242.0	215.0	223.0					12																	25801457		692	1591	2283	SO:0001583	missense	160492	exon1			ACACCGATGTCTC																												ENST00000445693.1:c.29T>A	12.37:g.25801457A>T	ENSP00000407043:p.Ile10Asn	Somatic	255.0	0.0		WXS	Illumina HiSeq	Phase_I	228.0	78.0	NM_001145727	B4DL27|B4DY70|Q8IY38	Missense_Mutation	SNP	ENST00000445693.1	37	CCDS44847.1	.	.	.	.	.	.	.	.	.	.	A	9.613	1.131801	0.21041	.	.	ENSG00000152936	ENST00000445693	T	0.14266	2.52	3.84	-3.21	0.05140	.	.	.	.	.	T	0.08179	0.0204	.	.	.	0.09310	N	0.999996	P	0.39157	0.662	B	0.34242	0.178	T	0.22243	-1.0222	8	0.66056	D	0.02	.	5.5128	0.16890	0.3756:0.1724:0.452:0.0	.	10	Q8N9Z9-3	.	N	10	ENSP00000407043:I10N	ENSP00000407043:I10N	I	-	2	0	IFLTD1	25692724	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.532000	0.06164	-0.529000	0.06358	-0.323000	0.08544	ATC	.		0.488	IFLTD1-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402280.1		
IGSF3	3321	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	117122413	117122413	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:117122413G>A	ENST00000369486.3	-	10	3700	c.2935C>T	c.(2935-2937)Cgc>Tgc	p.R979C	IGSF3_ENST00000369483.1_Missense_Mutation_p.R999C|IGSF3_ENST00000318837.6_Missense_Mutation_p.R999C	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	979	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TGGCTGGAGCGGGACACGATG	0.592																																					p.R999C		.											.	IGSF3	92	0			c.C2995T						.						37.0	36.0	36.0					1																	117122413		2203	4300	6503	SO:0001583	missense	3321	exon11			TGGAGCGGGACAC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.2935C>T	1.37:g.117122413G>A	ENSP00000358498:p.Arg979Cys	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	56.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651009	0.88056	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.22539	1.95;1.95;1.95	4.67	4.67	0.58626	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.218972	0.42172	D	0.000759	T	0.26484	0.0647	L	0.50333	1.59	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	P;P	0.59288	0.791;0.855	T	0.01225	-1.1413	10	0.56958	D	0.05	-36.4972	15.1177	0.72416	0.0:0.0:1.0:0.0	.	979;999	O75054;A6NJZ6	IGSF3_HUMAN;.	C	979;999;999	ENSP00000358498:R979C;ENSP00000358495:R999C;ENSP00000321184:R999C	ENSP00000321184:R999C	R	-	1	0	IGSF3	116923936	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	8.151000	0.89636	2.421000	0.82119	0.462000	0.41574	CGC	.		0.592	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
IGSF9B	22997	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	133814256	133814256	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:133814256C>A	ENST00000321016.8	-	3	498	c.268G>T	c.(268-270)Gcc>Tcc	p.A90S	IGSF9B_ENST00000533871.2_Missense_Mutation_p.A90S			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	90	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TGAAGACTGGCCCGGCCTGGG	0.577																																					p.A90S		.											.	IGSF9B	68	0			c.G268T						.						52.0	55.0	54.0					11																	133814256		1991	4159	6150	SO:0001583	missense	22997	exon3			GACTGGCCCGGCC	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.268G>T	11.37:g.133814256C>A	ENSP00000317980:p.Ala90Ser	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	39.0	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	37		.	.	.	.	.	.	.	.	.	.	C	23.6	4.431127	0.83776	.	.	ENSG00000080854	ENST00000321016;ENST00000527648;ENST00000533160;ENST00000526663	T;T;T;T	0.27890	1.64;1.64;1.64;1.92	5.69	5.69	0.88448	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000008	T	0.38188	0.1031	N	0.25380	0.74	0.54753	D	0.999987	B	0.33318	0.408	P	0.46144	0.505	T	0.27020	-1.0086	10	0.66056	D	0.02	.	19.8208	0.96592	0.0:1.0:0.0:0.0	.	90	Q9UPX0	TUTLB_HUMAN	S	90;90;80;137	ENSP00000317980:A90S;ENSP00000436576:A90S;ENSP00000434026:A80S;ENSP00000435989:A137S	ENSP00000317980:A90S	A	-	1	0	IGSF9B	133319466	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	4.713000	0.61895	2.688000	0.91661	0.563000	0.77884	GCC	.		0.577	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
IMPDH1	3614	ucsc.edu;bcgsc.ca	37	7	128041169	128041169	+	Splice_Site	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:128041169T>C	ENST00000480861.1	-	3	226	c.149A>G	c.(148-150)gAc>gGc	p.D50G	IMPDH1_ENST00000419067.2_Splice_Site_p.D102G|IMPDH1_ENST00000354269.5_Splice_Site_p.D125G|IMPDH1_ENST00000343214.4_Splice_Site_p.D50G|IMPDH1_ENST00000378717.4_Splice_Site_p.D66G|IMPDH1_ENST00000338791.6_Splice_Site_p.D135G|IMPDH1_ENST00000348127.6_Splice_Site_p.D99G|IMPDH1_ENST00000470772.1_Splice_Site_p.D50G|IMPDH1_ENST00000496200.1_Splice_Site_p.D50G	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						TGAGGTCAGGTCCTGAGGATG	0.592																																					p.D135G		.											.	IMPDH1	230	0			c.A404G						.						70.0	54.0	59.0					7																	128041169		2203	4300	6503	SO:0001630	splice_region_variant	3614	exon6			GTCAGGTCCTGAG		CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.148-1A>G	7.37:g.128041169T>C		Somatic	46.0	0.0		WXS	Illumina HiSeq	.	70.0	6.0	NM_000883		Missense_Mutation	SNP	ENST00000480861.1	37	CCDS55161.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.482443	0.84747	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861;ENST00000497868;ENST00000489263	T;T;T;T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.31;-1.37	4.95	4.95	0.65309	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.094256	0.64402	D	0.000001	D	0.89413	0.6708	M	0.83774	2.66	0.80722	D	1	D;P;D;D;P;B;B;P	0.76494	0.999;0.944;0.979;0.961;0.885;0.021;0.026;0.912	D;P;D;P;P;B;B;P	0.79108	0.992;0.882;0.923;0.85;0.869;0.049;0.082;0.786	D	0.90731	0.4642	10	0.72032	D	0.01	-36.5559	12.6087	0.56538	0.0:0.0:0.0:1.0	.	102;50;50;66;125;99;135;50	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	G	102;135;50;125;66;99;50;50;50;66;66	ENSP00000399400:D102G;ENSP00000345096:D135G;ENSP00000420803:D50G;ENSP00000346219:D125G;ENSP00000367989:D66G;ENSP00000265385:D99G;ENSP00000342438:D50G;ENSP00000417296:D50G;ENSP00000420185:D50G;ENSP00000419609:D66G;ENSP00000418592:D66G	ENSP00000345096:D135G	D	-	2	0	IMPDH1	127828405	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.739000	0.84976	1.862000	0.54008	0.533000	0.62120	GAC	.		0.592	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000349462.1	NM_000883	Missense_Mutation
INPP4B	8821	ucsc.edu;bcgsc.ca;mdanderson.org	37	4	143043286	143043286	+	Silent	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:143043286T>C	ENST00000513000.1	-	22	2563	c.2130A>G	c.(2128-2130)ggA>ggG	p.G710G	INPP4B_ENST00000508116.1_Silent_p.G710G|INPP4B_ENST00000262992.4_Silent_p.G710G|INPP4B_ENST00000308502.4_Silent_p.G710G|INPP4B_ENST00000509777.1_Silent_p.G710G	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	710					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CTTACCGTCTTCCTGTTATAA	0.428																																					p.G710G		.											.	INPP4B	228	0			c.A2130G						.						139.0	123.0	128.0					4																	143043286		2203	4300	6503	SO:0001819	synonymous_variant	8821	exon22			CCGTCTTCCTGTT	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.2130A>G	4.37:g.143043286T>C		Somatic	178.0	2.0		WXS	Illumina HiSeq	.	76.0	19.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Silent	SNP	ENST00000513000.1	37	CCDS3757.1																																																																																			.		0.428	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
JARID2	3720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	15507624	15507624	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:15507624T>A	ENST00000341776.2	+	11	2952	c.2708T>A	c.(2707-2709)cTg>cAg	p.L903Q	JARID2_ENST00000474854.1_3'UTR|JARID2_ENST00000397311.3_Missense_Mutation_p.L731Q|JARID2_ENST00000541660.1_Missense_Mutation_p.L865Q	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	903	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GGGTCCATCCTGCGTCACCTC	0.587																																					p.L903Q		.											.	JARID2	228	0			c.T2708A						.						154.0	127.0	136.0					6																	15507624		2203	4300	6503	SO:0001583	missense	3720	exon11			CCATCCTGCGTCA	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2708T>A	6.37:g.15507624T>A	ENSP00000341280:p.Leu903Gln	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	155.0	47.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.945874	0.92593	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.57752	0.38;0.38;0.38	5.36	5.36	0.76844	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.76024	-0.3110	10	0.87932	D	0	-10.9955	15.3324	0.74223	0.0:0.0:0.0:1.0	.	865;903	F5H590;Q92833	.;JARD2_HUMAN	Q	903;731;865	ENSP00000341280:L903Q;ENSP00000380478:L731Q;ENSP00000444623:L865Q	ENSP00000341280:L903Q	L	+	2	0	JARID2	15615603	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.930000	0.87610	2.028000	0.59812	0.477000	0.44152	CTG	.		0.587	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
KCND2	3751	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	119914945	119914945	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:119914945C>A	ENST00000331113.4	+	1	1224	c.259C>A	c.(259-261)Cgt>Agt	p.R87S		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	87	Interaction with KCNIP1. {ECO:0000250}.				action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TTTCTTTGACCGTGACCCAGA	0.527																																					p.R87S		.											.	KCND2	517	0			c.C259A						.						134.0	137.0	136.0					7																	119914945		2203	4300	6503	SO:0001583	missense	3751	exon1			TTTGACCGTGACC	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.259C>A	7.37:g.119914945C>A	ENSP00000333496:p.Arg87Ser	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	65.0	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	37	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049908	0.75846	.	.	ENSG00000184408	ENST00000331113	D	0.90133	-2.62	5.51	5.51	0.81932	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.97235	0.9096	H	0.98646	4.29	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98281	1.0508	9	.	.	.	.	14.2875	0.66256	0.1486:0.8514:0.0:0.0	.	87	Q9NZV8	KCND2_HUMAN	S	87	ENSP00000333496:R87S	.	R	+	1	0	KCND2	119702181	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.930000	0.70104	2.603000	0.88011	0.655000	0.94253	CGT	.		0.527	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
KIAA0100	9703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26967658	26967658	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:26967658G>A	ENST00000528896.2	-	8	884	c.810C>T	c.(808-810)ttC>ttT	p.F270F	KIAA0100_ENST00000544884.1_Silent_p.F127F|KIAA0100_ENST00000389003.3_Silent_p.F127F	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	270						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GCTGGAGAAGGAATAGGCCAG	0.448																																					p.F270F		.											.	KIAA0100	93	0			c.C810T						.						128.0	120.0	123.0					17																	26967658		2203	4300	6503	SO:0001819	synonymous_variant	9703	exon8			GAGAAGGAATAGG	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.810C>T	17.37:g.26967658G>A		Somatic	251.0	0.0		WXS	Illumina HiSeq	Phase_I	372.0	127.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	ENST00000528896.2	37	CCDS32595.1																																																																																			.		0.448	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KIF14	9928	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200522769	200522769	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:200522769T>C	ENST00000367350.4	-	30	5132	c.4694A>G	c.(4693-4695)cAc>cGc	p.H1565R		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1565	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						GTGGACAATGTGAGTTACTCT	0.408																																					p.H1565R		.											.	KIF14	140	0			c.A4694G						.						104.0	98.0	100.0					1																	200522769		2203	4300	6503	SO:0001583	missense	9928	exon30			ACAATGTGAGTTA	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.4694A>G	1.37:g.200522769T>C	ENSP00000356319:p.His1565Arg	Somatic	352.0	2.0		WXS	Illumina HiSeq	Phase_I	316.0	36.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	ENST00000367350.4	37	CCDS30963.1	.	.	.	.	.	.	.	.	.	.	T	5.905	0.351015	0.11182	.	.	ENSG00000118193	ENST00000367350	T	0.71579	-0.58	5.21	-9.68	0.00528	.	3.230320	0.00664	N	0.000603	T	0.28400	0.0702	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	10	0.08179	T	0.78	.	1.0746	0.01629	0.2499:0.2698:0.3011:0.1792	.	1565	Q15058	KIF14_HUMAN	R	1565	ENSP00000356319:H1565R	ENSP00000356319:H1565R	H	-	2	0	KIF14	198789392	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.030000	0.00638	-1.276000	0.02414	-0.316000	0.08728	CAC	.		0.408	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
KIF20B	9585	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	91477208	91477209	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:91477208_91477209delAC	ENST00000371728.3	+	10	1145_1146	c.1080_1081delAC	c.(1078-1083)ttacagfs	p.Q361fs	KIF20B_ENST00000260753.4_Frame_Shift_Del_p.Q361fs|KIF20B_ENST00000416354.1_Frame_Shift_Del_p.Q361fs|KIF20B_ENST00000394289.2_Frame_Shift_Del_p.Q361fs	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	361	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TTAAAATATTACAGATTGAAGA	0.257																																					p.360_361del		.											.	KIF20B	93	0			c.1080_1081del						.																																			SO:0001589	frameshift_variant	9585	exon10			AATATTACAGATT	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1080_1081delAC	10.37:g.91477208_91477209delAC	ENSP00000360793:p.Gln361fs	Somatic	613.0	0.0		WXS	Illumina HiSeq	Phase_I	317.0	50.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Frame_Shift_Del	DEL	ENST00000371728.3	37																																																																																				.		0.257	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
KIF26B	55083	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	245772747	245772747	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:245772747C>G	ENST00000407071.2	+	8	2271	c.1831C>G	c.(1831-1833)Ctg>Gtg	p.L611V	KIF26B_ENST00000366518.4_Missense_Mutation_p.L230V	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	611	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCGGGACCTGCTGTCGGAGGT	0.637																																					p.L611V		.											.	KIF26B	25	0			c.C1831G						.						16.0	21.0	20.0					1																	245772747		1971	4134	6105	SO:0001583	missense	55083	exon8			GACCTGCTGTCGG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1831C>G	1.37:g.245772747C>G	ENSP00000385545:p.Leu611Val	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	23.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.917892	0.52546	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.87887	-2.31;-2.31	5.4	3.51	0.40186	Kinesin, motor domain (4);	.	.	.	.	D	0.93690	0.7984	M	0.90425	3.115	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.93431	0.6785	9	0.87932	D	0	.	10.4968	0.44783	0.0:0.7695:0.0:0.2305	.	230;611	B7WPD9;Q2KJY2	.;KI26B_HUMAN	V	611;230;227	ENSP00000385545:L611V;ENSP00000355475:L230V	ENSP00000355475:L230V	L	+	1	2	KIF26B	243839370	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	2.697000	0.47060	0.746000	0.32786	0.650000	0.86243	CTG	.		0.637	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
KYNU	8942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	143718192	143718192	+	Splice_Site	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:143718192G>A	ENST00000264170.4	+	8	840		c.e8-1		KYNU_ENST00000375773.2_Splice_Site|KYNU_ENST00000409512.1_Splice_Site	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		ACTTGATTTAGGGGGAAGAAA	0.363																																					.		.											.	KYNU	92	0			c.583-1G>A						.						82.0	83.0	82.0					2																	143718192		2203	4300	6503	SO:0001630	splice_region_variant	8942	exon9			GATTTAGGGGGAA	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.583-1G>A	2.37:g.143718192G>A		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	12.0	NM_001199241		Splice_Site	SNP	ENST00000264170.4	37	CCDS2183.1	.	.	.	.	.	.	.	.	.	.	G	18.77	3.695405	0.68386	.	.	ENSG00000115919	ENST00000264170;ENST00000375773;ENST00000409512	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0789	0.93173	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KYNU	143434662	1.000000	0.71417	0.999000	0.59377	0.683000	0.39861	9.360000	0.97119	2.668000	0.90789	0.644000	0.83932	.	.		0.363	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254772.1	NM_001032998	Intron
LEO1	123169	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	52258056	52258056	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr15:52258056G>C	ENST00000299601.5	-	2	764	c.704C>G	c.(703-705)cCa>cGa	p.P235R	LEO1_ENST00000315141.5_Missense_Mutation_p.P235R	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	235	Asp-rich.				endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		AGACAGCTGTGGTTGTTCTTC	0.423																																					p.P235R	Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)	.											.	LEO1	68	0			c.C704G						.						246.0	246.0	246.0					15																	52258056		2195	4293	6488	SO:0001583	missense	123169	exon2			AGCTGTGGTTGTT	AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.704C>G	15.37:g.52258056G>C	ENSP00000299601:p.Pro235Arg	Somatic	545.0	0.0		WXS	Illumina HiSeq	Phase_I	563.0	96.0	NM_138792	Q96N99	Missense_Mutation	SNP	ENST00000299601.5	37	CCDS10146.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003248	0.35320	.	.	ENSG00000166477	ENST00000299601;ENST00000315141	.	.	.	4.84	4.84	0.62591	.	0.261206	0.40818	N	0.001011	T	0.42517	0.1206	N	0.16478	0.41	0.80722	D	1	B;B	0.11235	0.004;0.001	B;B	0.09377	0.004;0.001	T	0.24835	-1.0149	9	0.18276	T	0.48	.	18.1449	0.89651	0.0:0.0:1.0:0.0	.	235;235	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	R	235	.	ENSP00000299601:P235R	P	-	2	0	LEO1	50045348	0.997000	0.39634	0.555000	0.28281	0.965000	0.64279	3.722000	0.54948	2.509000	0.84616	0.655000	0.94253	CCA	.		0.423	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254791.2	NM_138792	
LNX2	222484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	28143356	28143356	+	Silent	SNP	A	A	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:28143356A>C	ENST00000316334.3	-	3	594	c.465T>G	c.(463-465)acT>acG	p.T155T		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	155					protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		TCTCTGCTTGAGTTCTACTAG	0.463																																					p.T155T		.											.	LNX2	228	0			c.T465G						.						208.0	212.0	211.0					13																	28143356		2203	4300	6503	SO:0001819	synonymous_variant	222484	exon3			TGCTTGAGTTCTA	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.465T>G	13.37:g.28143356A>C		Somatic	290.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	68.0	NM_153371	Q5W0P0|Q6ZMH2|Q96SH4	Silent	SNP	ENST00000316334.3	37	CCDS9323.1																																																																																			.		0.463	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044302.2		
CCDC180	100499483	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	100057188	100057188	+	Silent	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:100057188C>G	ENST00000357054.1	+	14	1247	c.312C>G	c.(310-312)gtC>gtG	p.V104V	RP11-23J9.5_ENST00000375204.2_RNA|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375205.2_Silent_p.V144V|CCDC180_ENST00000375202.2_5'UTR|CCDC180_ENST00000395220.1_Silent_p.V104V|CCDC180_ENST00000411667.2_5'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	104						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CTGTGCTTGTCAGCTTTTGCC	0.502																																					.		.											.	.	.	0			.						.						165.0	128.0	140.0					9																	100057188		2203	4300	6503	SO:0001819	synonymous_variant	0	.			GCTTGTCAGCTTT	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.312C>G	9.37:g.100057188C>G		Somatic	134.0	1.0		WXS	Illumina HiSeq	Phase_I	109.0	59.0	.	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	RNA	SNP	ENST00000357054.1	37																																																																																				.		0.502	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
LPHN3	23284	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	4	62849309	62849309	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:62849309G>T	ENST00000514591.1	+	18	3349	c.3020G>T	c.(3019-3021)gGa>gTa	p.G1007V	LPHN3_ENST00000508693.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000506746.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000506700.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000509896.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000507625.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000507164.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000512091.2_Missense_Mutation_p.G1007V|LPHN3_ENST00000511324.1_Missense_Mutation_p.G1075V|LPHN3_ENST00000514157.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000514996.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000508946.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000545650.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000504896.1_Missense_Mutation_p.G1007V|LPHN3_ENST00000506720.1_Missense_Mutation_p.G1075V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	994					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						AGGAGTTATGGAACAGATAAA	0.383																																					p.G1007V		.											.	LPHN3	508	0			c.G3020T						.						179.0	172.0	174.0					4																	62849309		1865	4120	5985	SO:0001583	missense	23284	exon16			GTTATGGAACAGA	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3020G>T	4.37:g.62849309G>T	ENSP00000422533:p.Gly1007Val	Somatic	260.0	0.0		WXS	Illumina HiSeq	Phase_I	192.0	100.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.5|25.5	4.645391|4.645391	0.87859|0.87859	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996|ENST00000502815	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.47869|.	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83|.	5.82|5.82	5.82|5.82	0.92795|0.92795	GPCR, family 2-like (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84270|0.84270	0.5435|0.5435	M|M	0.86502|0.86502	2.82|2.82	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.85057|0.85057	0.0932|0.0932	10|5	0.87932|.	D|.	0|.	.|.	20.099|20.099	0.97865|0.97865	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1007;994;1007|.	E9PE04;Q9HAR2;Q9HAR2-2|.	.;LPHN3_HUMAN;.|.	V|C	1007;1007;1075;1075;1007;1007;994;1007;1075;1075;1075;1007;1007;1007;1075;1075;1007|464	ENSP00000423388:G1007V;ENSP00000422533:G1007V;ENSP00000423787:G1075V;ENSP00000425033:G1075V;ENSP00000424120:G1007V;ENSP00000439831:G1007V;ENSP00000421476:G1075V;ENSP00000424030:G1075V;ENSP00000421372:G1075V;ENSP00000425201:G1007V;ENSP00000423434:G1007V;ENSP00000421627:G1007V;ENSP00000420931:G1075V;ENSP00000425884:G1075V;ENSP00000424258:G1007V|.	ENSP00000280009:G1007V|.	G|W	+|+	2|3	0|0	LPHN3|LPHN3	62531904|62531904	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.869000|9.869000	0.99810|0.99810	2.752000|2.752000	0.94435|0.94435	0.655000|0.655000	0.94253|0.94253	GGA|TGG	.		0.383	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
LRP6	4040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	12291266	12291266	+	Silent	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:12291266T>C	ENST00000261349.4	-	16	3676	c.3600A>G	c.(3598-3600)caA>caG	p.Q1200Q	BCL2L14_ENST00000396369.1_Intron|LRP6_ENST00000543091.1_Silent_p.Q1200Q	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	1200	Beta-propeller 4.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				TACTGTATTCTTGAAGGTTCA	0.358																																					p.Q1200Q		.											.	LRP6	661	0			c.A3600G						.						177.0	162.0	167.0					12																	12291266		2203	4300	6503	SO:0001819	synonymous_variant	4040	exon16			GTATTCTTGAAGG	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.3600A>G	12.37:g.12291266T>C		Somatic	258.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	61.0	NM_002336	Q17RZ2	Silent	SNP	ENST00000261349.4	37	CCDS8647.1																																																																																			.		0.358	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400137.1		
LRP1	4035	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57571304	57571304	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:57571304G>T	ENST00000243077.3	+	26	4757	c.4291G>T	c.(4291-4293)Ggc>Tgc	p.G1431C		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1431					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCGGGAGACCGGCTCTGGGGG	0.667																																					p.G1431C		.											.	LRP1	596	0			c.G4291T						.						36.0	37.0	37.0					12																	57571304		2203	4300	6503	SO:0001583	missense	4035	exon26			GAGACCGGCTCTG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.4291G>T	12.37:g.57571304G>T	ENSP00000243077:p.Gly1431Cys	Somatic	73.0	1.0		WXS	Illumina HiSeq	Phase_I	180.0	57.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632881	0.67015	.	.	ENSG00000123384	ENST00000243077	D	0.93604	-3.25	4.71	4.71	0.59529	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000001	D	0.94291	0.8166	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94669	0.7855	10	0.56958	D	0.05	.	16.9684	0.86293	0.0:0.0:1.0:0.0	.	1431	Q07954	LRP1_HUMAN	C	1431	ENSP00000243077:G1431C	ENSP00000243077:G1431C	G	+	1	0	LRP1	55857571	1.000000	0.71417	0.928000	0.36995	0.670000	0.39368	7.715000	0.84713	2.631000	0.89168	0.462000	0.41574	GGC	.		0.667	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LTBP2	4053	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74995708	74995708	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:74995708C>A	ENST00000261978.4	-	11	2491	c.2105G>T	c.(2104-2106)gGc>gTc	p.G702V	LTBP2_ENST00000556690.1_Missense_Mutation_p.G702V	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	702	TB 2.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CCATGCTTTGCCCACGCGGCT	0.637																																					p.G702V		.											.	LTBP2	92	0			c.G2105T						.						32.0	26.0	28.0					14																	74995708		2201	4299	6500	SO:0001583	missense	4053	exon11			GCTTTGCCCACGC		CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.2105G>T	14.37:g.74995708C>A	ENSP00000261978:p.Gly702Val	Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	190.0	80.0	NM_000428	Q99907|Q9NS51	Missense_Mutation	SNP	ENST00000261978.4	37	CCDS9831.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.809856	0.90707	.	.	ENSG00000119681	ENST00000261978;ENST00000556690	D;D	0.96104	-3.91;-3.91	5.35	5.35	0.76521	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.42964	D	0.000637	D	0.98030	0.9351	M	0.91510	3.215	0.80722	D	1	D	0.67145	0.996	D	0.63597	0.916	D	0.98626	1.0669	10	0.72032	D	0.01	.	18.0607	0.89377	0.0:1.0:0.0:0.0	.	702	Q14767	LTBP2_HUMAN	V	702	ENSP00000261978:G702V;ENSP00000451477:G702V	ENSP00000261978:G702V	G	-	2	0	LTBP2	74065461	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.287000	0.65645	2.804000	0.96469	0.650000	0.86243	GGC	.		0.637	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413595.1	NM_000428	
LYZL6	57151	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	34266279	34266279	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:34266279C>T	ENST00000585556.1	-	2	416	c.82G>A	c.(82-84)Gcc>Acc	p.A28T	LYZL6_ENST00000492340.2_5'Flank|LYZL6_ENST00000293274.4_Missense_Mutation_p.A28T|LYZL6_ENST00000394523.3_Missense_Mutation_p.A28T			O75951	LYZL6_HUMAN	lysozyme-like 6	28					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			breast(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	12				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGCACCTGGGCCAAGTCACAG	0.562																																					p.A28T		.											.	LYZL6	90	0			c.G82A						.						107.0	100.0	103.0					17																	34266279		2203	4300	6503	SO:0001583	missense	57151	exon1			CCTGGGCCAAGTC	AF088219, AY742214	CCDS11302.1	17q11.2	2014-04-10			ENSG00000161572	ENSG00000275722			29614	protein-coding gene	gene with protein product		612751				10213461	Standard	NM_020426		Approved	LYC1, PRO1485, TKAL754	uc002hkj.2	O75951	OTTHUMG00000188400	ENST00000585556.1:c.82G>A	17.37:g.34266279C>T	ENSP00000468094:p.Ala28Thr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	28.0	NM_020426	Q6UW30	Missense_Mutation	SNP	ENST00000585556.1	37	CCDS11302.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396060	0.83011	.	.	ENSG00000161572	ENST00000293274;ENST00000394523	T;T	0.54675	0.56;0.56	5.29	5.29	0.74685	Lysozyme-like domain (1);	0.270354	0.30455	N	0.009588	T	0.72187	0.3429	M	0.81112	2.525	0.44807	D	0.997812	D	0.65815	0.995	D	0.65573	0.936	T	0.75786	-0.3195	10	0.72032	D	0.01	-7.5879	14.8301	0.70142	0.0:1.0:0.0:0.0	.	28	O75951	LYZL6_HUMAN	T	28	ENSP00000293274:A28T;ENSP00000378031:A28T	ENSP00000293274:A28T	A	-	1	0	LYZL6	31290392	0.996000	0.38824	0.959000	0.39883	0.729000	0.41735	2.433000	0.44793	2.646000	0.89796	0.655000	0.94253	GCC	.		0.562	LYZL6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256578.2	NM_020426	
MAP3K7CL	56911	broad.mit.edu;bcgsc.ca	37	21	30532281	30532281	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr21:30532281A>G	ENST00000399947.2	+	8	729	c.452A>G	c.(451-453)gAc>gGc	p.D151G	MAP3K7CL_ENST00000341618.4_Missense_Mutation_p.D151G|MAP3K7CL_ENST00000399928.1_Missense_Mutation_p.D51G|MAP3K7CL_ENST00000399926.1_Missense_Mutation_p.D51G|MAP3K7CL_ENST00000339024.4_Missense_Mutation_p.D51G|MAP3K7CL_ENST00000545939.1_Missense_Mutation_p.D45G|MAP3K7CL_ENST00000286791.5_3'UTR|MAP3K7CL_ENST00000399935.2_Missense_Mutation_p.D51G|MAP3K7CL_ENST00000399934.1_Missense_Mutation_p.D51G|MAP3K7CL_ENST00000399925.1_Missense_Mutation_p.D51G	NM_020152.2	NP_064537.1	P57077	M3KCL_HUMAN	MAP3K7 C-terminal like	151						cytosol (GO:0005829)|nucleus (GO:0005634)											CCTTGTCATGACTCCGAGGAA	0.428																																					p.D151G		.											.	.	.	0			c.A452G						.						144.0	135.0	138.0					21																	30532281		2203	4300	6503	SO:0001583	missense	56911	exon8			GTCATGACTCCGA	AF269161	CCDS13584.1, CCDS68182.1, CCDS74775.1	21q22.3	2013-02-22	2013-02-22	2013-02-22	ENSG00000156265	ENSG00000156265			16457	protein-coding gene	gene with protein product		611110	"""chromosome 21 open reading frame 7"""	C21orf7			Standard	NM_020152		Approved	TAKL, TAK1L, TAKL-1, TAKL-2, TAKL-4	uc002ynf.3	P57077	OTTHUMG00000078806	ENST00000399947.2:c.452A>G	21.37:g.30532281A>G	ENSP00000382828:p.Asp151Gly	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	5.0	NM_020152	D3DSE0|Q8TCL9	Missense_Mutation	SNP	ENST00000399947.2	37	CCDS13584.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.952572	0.34471	.	.	ENSG00000156265	ENST00000545939;ENST00000341618;ENST00000399935;ENST00000399934;ENST00000399947;ENST00000339024;ENST00000399928;ENST00000399926;ENST00000399925;ENST00000451489	T;T	0.49720	0.77;0.77	4.65	3.52	0.40303	.	0.292228	0.31636	N	0.007316	T	0.33059	0.0850	L	0.40543	1.245	0.35685	D	0.814353	B;B	0.33940	0.001;0.433	B;B	0.31686	0.003;0.134	T	0.42344	-0.9457	10	0.39692	T	0.17	-11.2354	6.4137	0.21705	0.7576:0.1602:0.0822:0.0	.	51;151	B0EVZ8;P57077	.;TAK1L_HUMAN	G	45;151;51;51;151;51;51;51;51;51	ENSP00000343212:D151G;ENSP00000382828:D151G	ENSP00000345777:D51G	D	+	2	0	C21orf7	29454152	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.936000	0.48971	2.018000	0.59344	0.533000	0.62120	GAC	.		0.428	MAP3K7CL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000171865.2	NM_020152	
MEOX2	4223	broad.mit.edu;bcgsc.ca	37	7	15725858	15725858	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:15725858T>C	ENST00000262041.5	-	1	579	c.170A>G	c.(169-171)gAg>gGg	p.E57G	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	57					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		AAACATGCCCTCTTCGTTGGG	0.567																																					p.E57G	Esophageal Squamous(140;197 1769 16409 18257 29929)	.											.	MEOX2	515	0			c.A170G						.						54.0	49.0	50.0					7																	15725858		2203	4300	6503	SO:0001583	missense	4223	exon1			ATGCCCTCTTCGT		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.170A>G	7.37:g.15725858T>C	ENSP00000262041:p.Glu57Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	9.0	NM_005924	B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	ENST00000262041.5	37	CCDS34605.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.625824	0.46840	.	.	ENSG00000106511	ENST00000262041	D	0.90504	-2.68	4.88	4.88	0.63580	.	0.164767	0.51477	D	0.000081	D	0.86686	0.5992	L	0.52573	1.65	0.58432	D	0.999998	B	0.31893	0.345	B	0.29942	0.109	D	0.83925	0.0303	10	0.17832	T	0.49	-19.5871	14.8483	0.70277	0.0:0.0:0.0:1.0	.	57	P50222	MEOX2_HUMAN	G	57	ENSP00000262041:E57G	ENSP00000262041:E57G	E	-	2	0	MEOX2	15692383	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.934000	0.75880	1.963000	0.57068	0.529000	0.55759	GAG	.		0.567	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
MTIF2	4528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	55470647	55470647	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:55470647delG	ENST00000263629.4	-	12	1784	c.1469delC	c.(1468-1470)tcafs	p.S490fs	MTIF2_ENST00000403721.1_Frame_Shift_Del_p.S490fs|MTIF2_ENST00000394600.3_Frame_Shift_Del_p.S490fs	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	490					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CCGTAGAATTGATCTCTTCTT	0.363																																					p.S490X		.											.	MTIF2	91	0			c.1469delC						.						174.0	171.0	172.0					2																	55470647		2203	4300	6503	SO:0001589	frameshift_variant	4528	exon12			AGAATTGATCTCT	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1469delC	2.37:g.55470647delG	ENSP00000263629:p.Ser490fs	Somatic	793.0	0.0		WXS	Illumina HiSeq	Phase_I	618.0	80.0	NM_002453	D6W5D0	Nonsense_Mutation	DEL	ENST00000263629.4	37	CCDS1853.1																																																																																			.		0.363	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
MUC16	94025	ucsc.edu;bcgsc.ca	37	19	9084989	9084989	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:9084989T>C	ENST00000397910.4	-	1	7029	c.6826A>G	c.(6826-6828)Acc>Gcc	p.T2276A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2276	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGAAATGGTTCTAAATGAA	0.463																																					p.T2276A		.											.	MUC16	566	0			c.A6826G						.						62.0	60.0	60.0					19																	9084989		1912	4139	6051	SO:0001583	missense	94025	exon1			AAATGGTTCTAAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6826A>G	19.37:g.9084989T>C	ENSP00000381008:p.Thr2276Ala	Somatic	136.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	1.393	-0.580270	0.03854	.	.	ENSG00000181143	ENST00000397910	T	0.02301	4.35	0.225	0.225	0.15325	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	.	.	.	P	0.49696	0.927	P	0.56563	0.801	T	0.48990	-0.8985	7	0.87932	D	0	.	.	.	.	.	2276	B5ME49	.	A	2276	ENSP00000381008:T2276A	ENSP00000381008:T2276A	T	-	1	0	MUC16	8945989	0.001000	0.12720	0.071000	0.20095	0.071000	0.16799	-0.366000	0.07563	0.257000	0.21650	0.254000	0.18369	ACC	.		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NAP1L3	4675	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	92927476	92927476	+	Silent	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chrX:92927476T>A	ENST00000373079.3	-	1	1091	c.828A>T	c.(826-828)gcA>gcT	p.A276A	FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_Silent_p.A269A|FAM133A_ENST00000538690.1_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	276					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.A276A(1)		haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TCTCTCTTACTGCAGCCCTTG	0.448																																					p.A276A		.											.	NAP1L3	131	1	Substitution - coding silent(1)	lung(1)	c.A828T						.						116.0	108.0	111.0					X																	92927476		2203	4300	6503	SO:0001819	synonymous_variant	4675	exon1			TCTTACTGCAGCC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.828A>T	X.37:g.92927476T>A		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	166.0	NM_004538	B2RCM0|O60788	Silent	SNP	ENST00000373079.3	37	CCDS14465.1																																																																																			.		0.448	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
NAT10	55226	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	34137375	34137375	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:34137375G>A	ENST00000257829.3	+	6	707	c.501G>A	c.(499-501)gtG>gtA	p.V167V	NAT10_ENST00000527971.1_Silent_p.V167V|NAT10_ENST00000531159.2_Silent_p.V95V	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	167						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				GTTAGGATGTGCATTCCAGGT	0.463																																					p.V167V		.											.	NAT10	92	0			c.G501A						.						191.0	191.0	191.0					11																	34137375		2202	4298	6500	SO:0001819	synonymous_variant	55226	exon6			GGATGTGCATTCC	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.501G>A	11.37:g.34137375G>A		Somatic	311.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	63.0	NM_024662	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Silent	SNP	ENST00000257829.3	37	CCDS7889.1																																																																																			.		0.463	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388693.1	NM_024662	
NLGN1	22871	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	173996955	173996955	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:173996955delC	ENST00000457714.1	+	6	1593	c.1164delC	c.(1162-1164)aacfs	p.N388fs	NLGN1_ENST00000545397.1_Frame_Shift_Del_p.N388fs|NLGN1_ENST00000401917.3_Frame_Shift_Del_p.N428fs|NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000361589.4_Frame_Shift_Del_p.N388fs	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	405					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TAGGAGTGAACCAAGGGGAAG	0.368																																					p.N388fs		.											.	NLGN1	231	0			c.1164delC						.						138.0	144.0	142.0					3																	173996955		2203	4300	6503	SO:0001589	frameshift_variant	22871	exon6			AGTGAACCAAGGG	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1164delC	3.37:g.173996955delC	ENSP00000392500:p.Asn388fs	Somatic	233.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	38.0	NM_014932	Q9UPT2	Frame_Shift_Del	DEL	ENST00000457714.1	37	CCDS3222.1																																																																																			.		0.368	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
NPHP3	27031	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132407637	132407637	+	Silent	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:132407637T>C	ENST00000337331.5	-	21	3068	c.2982A>G	c.(2980-2982)gtA>gtG	p.V994V	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	994					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACTGCACGTATACACTTGCTA	0.463																																					p.V994V		.											.	NPHP3	91	0			c.A2982G						.						139.0	132.0	134.0					3																	132407637		2203	4300	6503	SO:0001819	synonymous_variant	27031	exon21			CACGTATACACTT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.2982A>G	3.37:g.132407637T>C		Somatic	337.0	1.0		WXS	Illumina HiSeq	Phase_I	376.0	66.0	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Silent	SNP	ENST00000337331.5	37	CCDS3078.1																																																																																			.		0.463	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
OLFML2A	169611	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	127563918	127563918	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:127563918C>A	ENST00000373580.3	+	5	895	c.895C>A	c.(895-897)Cag>Aag	p.Q299K	OLFML2A_ENST00000288815.5_Missense_Mutation_p.Q85K	NM_182487.2	NP_872293.2	Q68BL7	OLM2A_HUMAN	olfactomedin-like 2A	299					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			endometrium(5)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	25						GGCAGGCAAGCAGGAGGTGAC	0.647																																					p.Q299K		.											.	OLFML2A	68	0			c.C895A						.						28.0	27.0	27.0					9																	127563918		2203	4299	6502	SO:0001583	missense	169611	exon5			GGCAAGCAGGAGG	AK092255	CCDS6857.2, CCDS65129.1	9q34.11	2008-02-05			ENSG00000185585	ENSG00000185585			27270	protein-coding gene	gene with protein product		615899				12477932	Standard	NM_001282715		Approved	FLJ00237	uc004bov.3	Q68BL7	OTTHUMG00000020663	ENST00000373580.3:c.895C>A	9.37:g.127563918C>A	ENSP00000362682:p.Gln299Lys	Somatic	96.0	2.0		WXS	Illumina HiSeq	Phase_I	116.0	59.0	NM_182487	Q5JTM5|Q5JTM6|Q6UXW1|Q7Z5V3	Missense_Mutation	SNP	ENST00000373580.3	37	CCDS6857.2	.	.	.	.	.	.	.	.	.	.	C	12.02	1.811468	0.32053	.	.	ENSG00000185585	ENST00000331715;ENST00000425732;ENST00000373580;ENST00000288815	T;T;D	0.87650	0.95;0.95;-2.28	6.07	1.81	0.25067	.	0.550558	0.20572	N	0.089706	T	0.73118	0.3546	N	0.11364	0.135	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.50329	-0.8841	10	0.11485	T	0.65	.	14.8125	0.70006	0.6162:0.3838:0.0:0.0	.	263;85;299	Q5JTM7;Q68BL7-3;Q68BL7	.;.;OLM2A_HUMAN	K	263;263;299;85	ENSP00000336425:Q263K;ENSP00000362682:Q299K;ENSP00000288815:Q85K	ENSP00000288815:Q85K	Q	+	1	0	OLFML2A	126603739	0.004000	0.15560	0.051000	0.19133	0.211000	0.24417	0.448000	0.21726	0.042000	0.15717	0.655000	0.94253	CAG	.		0.647	OLFML2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054046.2	NM_182487	
OLFM1	10439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	138011770	138011770	+	Missense_Mutation	SNP	G	G	A	rs1130517		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:138011770G>A	ENST00000371793.3	+	6	1455	c.1204G>A	c.(1204-1206)Gcc>Acc	p.A402T	OLFM1_ENST00000252854.4_Missense_Mutation_p.A384T|OLFM1_ENST00000371796.3_Missense_Mutation_p.A375T	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	402	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		CAAGCGCAGCGCCGGGGAGGC	0.617																																					p.A384T		.											.	OLFM1	70	0			c.G1150A						.						73.0	63.0	66.0					9																	138011770		2203	4300	6503	SO:0001583	missense	10439	exon6			CGCAGCGCCGGGG	AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1204G>A	9.37:g.138011770G>A	ENSP00000360858:p.Ala402Thr	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	32.0	NM_014279	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	ENST00000371793.3	37		.	.	.	.	.	.	.	.	.	.	G	31	5.084437	0.94100	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.90385	-2.66;-2.66;-2.66	4.7	4.7	0.59300	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	D	0.96043	0.8711	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.96926	0.9677	10	0.72032	D	0.01	.	17.6361	0.88122	0.0:0.0:1.0:0.0	.	402;384	Q99784;Q6IMJ8	NOE1_HUMAN;.	T	384;375;402	ENSP00000252854:A384T;ENSP00000360861:A375T;ENSP00000360858:A402T	ENSP00000252854:A384T	A	+	1	0	OLFM1	137151591	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.571000	0.98176	2.166000	0.68216	0.491000	0.48974	GCC	.		0.617	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000054974.1	NM_014279	
OR10A3	26496	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7960259	7960259	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:7960259G>C	ENST00000360759.3	-	1	882	c.809C>G	c.(808-810)aCc>aGc	p.T270S		NM_001003745.1	NP_001003745.1	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A, member 3	270					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)	21				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CAGTTTCTTGGTTTCGGGTGA	0.453																																					p.T270S		.											.	OR10A3	69	0			c.C809G						.						197.0	179.0	185.0					11																	7960259		2201	4296	6497	SO:0001583	missense	26496	exon1			TTCTTGGTTTCGG	BK004404	CCDS31421.1	11p15.4	2012-08-09			ENSG00000170683	ENSG00000170683		"""GPCR / Class A : Olfactory receptors"""	8162	protein-coding gene	gene with protein product						1370859	Standard	NM_001003745		Approved	HTPCRX12, HSHTPCRX12	uc010rbi.2	P58181	OTTHUMG00000165672	ENST00000360759.3:c.809C>G	11.37:g.7960259G>C	ENSP00000353988:p.Thr270Ser	Somatic	335.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	72.0	NM_001003745	B9EH39|Q6IF58|Q96R11	Missense_Mutation	SNP	ENST00000360759.3	37	CCDS31421.1	.	.	.	.	.	.	.	.	.	.	G	0.429	-0.904393	0.02453	.	.	ENSG00000170683	ENST00000360759	T	0.00054	8.8	4.65	1.46	0.22682	GPCR, rhodopsin-like superfamily (1);	0.370076	0.19214	N	0.119853	T	0.00073	0.0002	N	0.04018	-0.295	0.09310	N	1	B	0.09022	0.002	B	0.21708	0.036	T	0.02437	-1.1159	10	0.09084	T	0.74	.	8.9595	0.35838	0.0:0.4598:0.3828:0.1574	.	270	P58181	O10A3_HUMAN	S	270	ENSP00000353988:T270S	ENSP00000353988:T270S	T	-	2	0	OR10A3	7916835	0.000000	0.05858	0.998000	0.56505	0.501000	0.33797	0.019000	0.13444	0.671000	0.31185	-0.234000	0.12200	ACC	.		0.453	OR10A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385704.1	NM_001003745	
OR10J5	127385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159505721	159505721	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:159505721G>T	ENST00000334857.2	-	1	121	c.77C>A	c.(76-78)aCc>aAc	p.T26N		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					CACAAAGAGGGTTATCTGATG	0.388																																					p.T26N		.											.	OR10J5	71	0			c.C77A						.						96.0	92.0	93.0					1																	159505721		2203	4300	6503	SO:0001583	missense	127385	exon1			AAGAGGGTTATCT		CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.77C>A	1.37:g.159505721G>T	ENSP00000334441:p.Thr26Asn	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	31.0	NM_001004469	B9EH35|Q6IFH2	Missense_Mutation	SNP	ENST00000334857.2	37	CCDS30910.1	.	.	.	.	.	.	.	.	.	.	G	12.97	2.097148	0.37048	.	.	ENSG00000184155	ENST00000334857	T	0.00438	7.42	4.43	3.52	0.40303	.	.	.	.	.	T	0.00241	0.0007	M	0.75085	2.285	0.09310	N	1	P	0.52692	0.955	P	0.50231	0.635	T	0.46830	-0.9163	9	0.30078	T	0.28	.	6.9396	0.24486	0.2056:0.0:0.7944:0.0	.	26	Q8NHC4	O10J5_HUMAN	N	26	ENSP00000334441:T26N	ENSP00000334441:T26N	T	-	2	0	OR10J5	157772345	0.000000	0.05858	0.867000	0.34043	0.504000	0.33889	0.240000	0.18042	1.208000	0.43306	0.557000	0.71058	ACC	.		0.388	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059021.1	NM_001004469	
OR11A1	26531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29395051	29395051	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:29395051C>T	ENST00000377149.1	-	5	840	c.368G>A	c.(367-369)cGc>cAc	p.R123H	OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377147.2_Missense_Mutation_p.R123H|OR11A1_ENST00000377148.1_Missense_Mutation_p.R123H			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						TGCCAGGTAGCGGTCATATGC	0.537																																					p.R123H		.											.	OR11A1	23	0			c.G368A						.						64.0	70.0	68.0					6																	29395051		1510	2709	4219	SO:0001583	missense	26531	exon1			AGGTAGCGGTCAT		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.368G>A	6.37:g.29395051C>T	ENSP00000366354:p.Arg123His	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	34.0	NM_013937	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	ENST00000377149.1	37	CCDS34363.1	.	.	.	.	.	.	.	.	.	.	C	14.78	2.638066	0.47153	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.77489	-1.1;-1.1;-1.1	3.78	2.9	0.33743	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38436	N	0.001686	D	0.84969	0.5590	M	0.88906	2.99	0.35989	D	0.836566	D	0.89917	1.0	D	0.87578	0.998	D	0.86849	0.2022	10	0.87932	D	0	-20.52	10.1326	0.42687	0.0:0.8986:0.0:0.1014	.	123	Q9GZK7	O11A1_HUMAN	H	123	ENSP00000366353:R123H;ENSP00000366354:R123H;ENSP00000366352:R123H	ENSP00000366352:R123H	R	-	2	0	OR11A1	29503030	0.966000	0.33281	0.949000	0.38748	0.086000	0.17979	5.138000	0.64795	0.785000	0.33685	0.405000	0.27470	CGC	.		0.537	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193778.1		
OR4K14	122740	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20483095	20483095	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:20483095G>T	ENST00000305045.2	-	1	257	c.258C>A	c.(256-258)ttC>ttA	p.F86L		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GATCACTAAGGAAATCCCTGA	0.507																																					p.F86L		.											.	OR4K14	115	0			c.C258A						.						97.0	88.0	91.0					14																	20483095		2203	4300	6503	SO:0001583	missense	122740	exon1			ACTAAGGAAATCC		CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.258C>A	14.37:g.20483095G>T	ENSP00000305011:p.Phe86Leu	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	29.0	NM_001004712	Q6IEU1|Q96R71	Missense_Mutation	SNP	ENST00000305045.2	37	CCDS32027.1	.	.	.	.	.	.	.	.	.	.	.	9.728	1.161402	0.21538	.	.	ENSG00000169484	ENST00000305045	T	0.00912	5.55	4.04	-3.11	0.05299	GPCR, rhodopsin-like superfamily (1);	0.326573	0.22055	N	0.065245	T	0.00524	0.0017	N	0.10782	0.045	0.24601	N	0.993775	B	0.16802	0.019	B	0.17979	0.02	T	0.44817	-0.9303	10	0.02654	T	1	.	10.7225	0.46048	0.6162:0.0:0.3838:0.0	.	86	Q8NGD5	OR4KE_HUMAN	L	86	ENSP00000305011:F86L	ENSP00000305011:F86L	F	-	3	2	OR4K14	19552935	0.000000	0.05858	0.518000	0.27811	0.852000	0.48524	-2.379000	0.01067	-1.033000	0.03299	-0.438000	0.05819	TTC	.		0.507	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410343.1		
OR6C65	403282	hgsc.bcm.edu;bcgsc.ca	37	12	55794609	55794610	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:55794609_55794610insT	ENST00000379665.2	+	1	396_397	c.297_298insT	c.(298-300)tttfs	p.F100fs		NM_001005518.1	NP_001005518.1	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C, member 65	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L102fs*1(1)		cervix(1)|endometrium(2)|large_intestine(3)|lung(9)	15						TGGCCCAAGTATTTTTTTTAAT	0.356																																					p.V99fs		.											.	OR6C65	68	1	Deletion - Frameshift(1)	large_intestine(1)	c.297_298insT						.																																			SO:0001589	frameshift_variant	403282	exon1			CCAAGTATTTTTT		CCDS31821.1	12q13.2	2013-09-23			ENSG00000205328	ENSG00000205328		"""GPCR / Class A : Olfactory receptors"""	31295	protein-coding gene	gene with protein product							Standard	NM_001005518		Approved		uc010spl.2	A6NJZ3	OTTHUMG00000169955	ENST00000379665.2:c.305dupT	12.37:g.55794617_55794617dupT	ENSP00000368986:p.Phe100fs	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	45.0	NM_001005518	B2RNH9	Frame_Shift_Ins	INS	ENST00000379665.2	37	CCDS31821.1																																																																																			.		0.356	OR6C65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406674.1		
OR8K5	219453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	55927260	55927260	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:55927260G>T	ENST00000313447.1	-	1	533	c.534C>A	c.(532-534)taC>taA	p.Y178*		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CATCATCACAGTAAAAATGAC	0.358																																					p.Y178X		.											.	OR8K5	72	0			c.C534A						.						93.0	94.0	94.0					11																	55927260		2201	4296	6497	SO:0001587	stop_gained	219453	exon1			ATCACAGTAAAAA	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.534C>A	11.37:g.55927260G>T	ENSP00000323853:p.Tyr178*	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	28.0	NM_001004058	Q6IFB5	Nonsense_Mutation	SNP	ENST00000313447.1	37	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759194	0.49468	.	.	ENSG00000181752	ENST00000313447	.	.	.	4.18	1.08	0.20341	.	0.000000	0.51477	D	0.000095	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	8.6385	0.33964	0.2774:0.0:0.7226:0.0	.	.	.	.	X	178	.	ENSP00000323853:Y178X	Y	-	3	2	OR8K5	55683836	0.002000	0.14202	0.990000	0.47175	0.832000	0.47134	0.090000	0.15025	0.120000	0.18254	-0.254000	0.11334	TAC	.		0.358	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058	
OTUD7B	56957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	149916120	149916120	+	Missense_Mutation	SNP	C	C	A	rs376252200		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:149916120C>A	ENST00000369135.4	-	12	2462	c.2168G>T	c.(2167-2169)gGc>gTc	p.G723V		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	723					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TGGTGGTAGGCCCCCGACACA	0.652																																					p.G723V		.											.	OTUD7B	502	0			c.G2168T						.	C	VAL/GLY	0,3914		0,0,1957	28.0	32.0	31.0		2168	4.4	0.9	1		31	1,8265		0,1,4132	no	missense	OTUD7B	NM_020205.2	109	0,1,6089	AA,AC,CC		0.0121,0.0,0.0082	possibly-damaging	723/844	149916120	1,12179	1957	4133	6090	SO:0001583	missense	56957	exon12			GGTAGGCCCCCGA	AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.2168G>T	1.37:g.149916120C>A	ENSP00000358131:p.Gly723Val	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	22.0	NM_020205	B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Missense_Mutation	SNP	ENST00000369135.4	37	CCDS41389.1	.	.	.	.	.	.	.	.	.	.	C	10.67	1.414535	0.25465	0.0	1.21E-4	ENSG00000163113	ENST00000369135;ENST00000543330	T	0.32023	1.47	4.37	4.37	0.52481	.	0.306666	0.35151	N	0.003409	T	0.09598	0.0236	L	0.34521	1.04	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.09292	-1.0681	9	.	.	.	-31.7542	8.1151	0.30937	0.0:0.8922:0.0:0.1078	.	723	Q6GQQ9	OTU7B_HUMAN	V	723	ENSP00000358131:G723V	.	G	-	2	0	OTUD7B	148182744	0.434000	0.25570	0.918000	0.36340	0.688000	0.40055	1.197000	0.32211	2.272000	0.75746	0.455000	0.32223	GGC	.		0.652	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034146.3	NM_020205	
PAGE2	203569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	55117891	55117891	+	Splice_Site	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chrX:55117891G>A	ENST00000374968.4	+	4	423		c.e4+1		PAGE2_ENST00000374965.1_Splice_Site	NM_207339.2	NP_997222.1	Q7Z2X7	PAGE2_HUMAN	P antigen family, member 2 (prostate associated)											endometrium(1)|large_intestine(2)|lung(1)|ovary(2)	6						CTGGAAGCAGGTTTGTTATTC	0.383																																					.		.											.	PAGE2	92	0			c.319+1G>A						.						94.0	108.0	104.0					X																	55117891		2172	4296	6468	SO:0001630	splice_region_variant	203569	exon4			AAGCAGGTTTGTT	BC054022	CCDS14367.1	Xp11.22	2009-06-17			ENSG00000234068	ENSG00000234068			31804	protein-coding gene	gene with protein product		300738	"""G antigen, family C, 2"""	GAGEC2		9724777	Standard	NM_207339		Approved	MGC62094, PAGE-2, CT16.4		Q7Z2X7	OTTHUMG00000021648	ENST00000374968.4:c.319+1G>A	X.37:g.55117891G>A		Somatic	321.0	0.0		WXS	Illumina HiSeq	Phase_I	334.0	104.0	NM_207339	Q5JRK7|Q5JRK8	Splice_Site	SNP	ENST00000374968.4	37	CCDS14367.1	.	.	.	.	.	.	.	.	.	.	g	2.931	-0.221059	0.06061	.	.	ENSG00000234068	ENST00000374968;ENST00000374965	.	.	.	1.13	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.21473	N	0.999673	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.3082	0.15815	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PAGE2	55134616	0.973000	0.33851	0.014000	0.15608	0.012000	0.07955	1.535000	0.36061	0.862000	0.35528	0.287000	0.19450	.	.		0.383	PAGE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056857.1	NM_207339	Intron
PARP2	10038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20820469	20820469	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:20820469A>G	ENST00000250416.5	+	7	629	c.602A>G	c.(601-603)tAt>tGt	p.Y201C	PARP2_ENST00000527915.1_Missense_Mutation_p.Y201C|PARP2_ENST00000429687.3_Missense_Mutation_p.Y188C	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	201					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		CCTGGAAAATATGATATGCTA	0.343								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																													p.Y201C		.											.	PARP2	661	0			c.A602G						.						107.0	97.0	100.0					14																	20820469		1842	4097	5939	SO:0001583	missense	10038	exon7			GAAAATATGATAT	AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.602A>G	14.37:g.20820469A>G	ENSP00000250416:p.Tyr201Cys	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	27.0	NM_005484	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Missense_Mutation	SNP	ENST00000250416.5	37	CCDS41910.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.223462	0.79464	.	.	ENSG00000129484	ENST00000429687;ENST00000250416;ENST00000527915	T;T;T	0.33654	1.4;1.4;1.4	5.53	5.53	0.82687	WGR domain (1);	0.000000	0.85682	D	0.000000	T	0.59756	0.2217	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.63937	-0.6524	10	0.87932	D	0	-13.683	14.635	0.68682	1.0:0.0:0.0:0.0	.	188;201	Q9UGN5-2;Q9UGN5	.;PARP2_HUMAN	C	188;201;201	ENSP00000392972:Y188C;ENSP00000250416:Y201C;ENSP00000432283:Y201C	ENSP00000250416:Y201C	Y	+	2	0	PARP2	19890309	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.600000	0.82769	2.106000	0.64143	0.460000	0.39030	TAT	.		0.343	PARP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000387847.2		
PCBD2	84105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	134246024	134246024	+	Splice_Site	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:134246024G>C	ENST00000512783.1	+	2	104		c.e2-1		PCBD2_ENST00000510013.1_Splice_Site|PCBD2_ENST00000254908.6_Splice_Site			Q9H0N5	PHS2_HUMAN	pterin-4 alpha-carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2						positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein homotetramerization (GO:0051289)|tetrahydrobiopterin biosynthetic process (GO:0006729)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	4-alpha-hydroxytetrahydrobiopterin dehydratase activity (GO:0008124)|phenylalanine 4-monooxygenase activity (GO:0004505)			kidney(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCTCTTCATAGTCATCAGGTA	0.408																																					.		.											.	PCBD2	90	0			c.85-1G>C						.						109.0	102.0	104.0					5																	134246024		1929	4148	6077	SO:0001630	splice_region_variant	84105	exon2			TTCATAGTCATCA	AF499009	CCDS43364.1	5q31.1	2008-02-05	2006-01-10			ENSG00000132570			24474	protein-coding gene	gene with protein product		609836	"""6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2"""			15182178, 11980910	Standard	NM_032151		Approved	DCOHM, DCOH2	uc010jdz.3	Q9H0N5		ENST00000512783.1:c.85-1G>C	5.37:g.134246024G>C		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	23.0	NM_032151	Q8TD40	Splice_Site	SNP	ENST00000512783.1	37	CCDS43364.1	.	.	.	.	.	.	.	.	.	.	G	9.558	1.117736	0.20877	.	.	ENSG00000132570	ENST00000254908;ENST00000512783	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8022	0.88591	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PCBD2	134273923	1.000000	0.71417	0.175000	0.22980	0.033000	0.12548	6.318000	0.72866	2.710000	0.92621	0.563000	0.77884	.	.		0.408	PCBD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371578.1	NM_032151	Intron
PCNT	5116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	47850032	47850032	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr21:47850032C>T	ENST00000359568.5	+	36	7906	c.7799C>T	c.(7798-7800)gCg>gTg	p.A2600V	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2600					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AAGCTCCTGGCGGCGGAGCAG	0.562																																					p.A2600V		.											.	PCNT	141	0			c.C7799T						.						101.0	95.0	97.0					21																	47850032		2203	4300	6503	SO:0001583	missense	5116	exon36			TCCTGGCGGCGGA	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.7799C>T	21.37:g.47850032C>T	ENSP00000352572:p.Ala2600Val	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	315.0	55.0	NM_006031	O43152|Q7Z7C9	Missense_Mutation	SNP	ENST00000359568.5	37	CCDS33592.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.589419	0.00864	.	.	ENSG00000160299	ENST00000359568	T	0.01464	4.86	4.32	-2.5	0.06384	.	.	.	.	.	T	0.00724	0.0024	N	0.01576	-0.805	0.09310	N	1	B;B	0.17852	0.006;0.024	B;B	0.08055	0.003;0.003	T	0.47983	-0.9074	9	0.17832	T	0.49	.	6.886	0.24199	0.0:0.3494:0.1207:0.5299	.	2482;2600	O95613-2;O95613	.;PCNT_HUMAN	V	2600	ENSP00000352572:A2600V	ENSP00000352572:A2600V	A	+	2	0	PCNT	46674460	0.003000	0.15002	0.023000	0.16930	0.207000	0.24258	0.099000	0.15210	-0.578000	0.05959	0.462000	0.41574	GCG	.		0.562	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
PDCD6IP	10015	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	3	33840383	33840383	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:33840383G>A	ENST00000307296.3	+	1	540	c.163G>A	c.(163-165)Ggt>Agt	p.G55S	RP11-10C24.3_ENST00000604982.1_lincRNA|RP11-10C24.1_ENST00000605513.1_lincRNA|PDCD6IP_ENST00000457054.2_Missense_Mutation_p.G55S			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	55	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						CGCCGCAGTCGGTCGTCCGCT	0.701																																					p.G55S		.											.	PDCD6IP	228	0			c.G163A						.						6.0	8.0	8.0					3																	33840383		2064	4021	6085	SO:0001583	missense	10015	exon1			GCAGTCGGTCGTC	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.163G>A	3.37:g.33840383G>A	ENSP00000307387:p.Gly55Ser	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	26.0	NM_013374	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Missense_Mutation	SNP	ENST00000307296.3	37	CCDS2660.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128482	0.56721	.	.	ENSG00000170248	ENST00000307296;ENST00000457054;ENST00000413073	T;T;T	0.17213	2.29;2.29;2.29	5.65	4.78	0.61160	BRO1 domain (3);	0.000000	0.85682	D	0.000000	T	0.23886	0.0578	M	0.73372	2.23	0.80722	D	1	B;B;P	0.37997	0.004;0.0;0.614	B;B;B	0.41202	0.006;0.002;0.35	T	0.03335	-1.1047	10	0.17832	T	0.49	-2.2186	14.4391	0.67303	0.0718:0.0:0.9282:0.0	.	55;55;55	C5MQH7;E9PFU1;Q8WUM4	.;.;PDC6I_HUMAN	S	55	ENSP00000307387:G55S;ENSP00000411825:G55S;ENSP00000406693:G55S	ENSP00000307387:G55S	G	+	1	0	PDCD6IP	33815387	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.893000	0.75649	1.383000	0.46405	0.591000	0.81541	GGT	.		0.701	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
PDE4D	5144	ucsc.edu;bcgsc.ca	37	5	58511778	58511778	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:58511778C>T	ENST00000340635.6	-	2	647	c.472G>A	c.(472-474)Ggc>Agc	p.G158S	PDE4D_ENST00000502484.2_Missense_Mutation_p.G97S|PDE4D_ENST00000360047.5_Missense_Mutation_p.G22S|PDE4D_ENST00000502575.1_Missense_Mutation_p.G94S|PDE4D_ENST00000405755.2_Missense_Mutation_p.G36S|PDE4D_ENST00000503258.1_Missense_Mutation_p.G28S|PDE4D_ENST00000507116.1_Missense_Mutation_p.G94S|PDE4D_ENST00000546160.1_Missense_Mutation_p.G97S|PDE4D_ENST00000503947.1_5'UTR	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	158					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GCAGATGTGCCATTGTCCACA	0.463																																					p.G158S		.											.	PDE4D	226	0			c.G472A						.						47.0	47.0	47.0					5																	58511778		1883	4110	5993	SO:0001583	missense	5144	exon2			ATGTGCCATTGTC		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.472G>A	5.37:g.58511778C>T	ENSP00000345502:p.Gly158Ser	Somatic	58.0	0.0		WXS	Illumina HiSeq	.	31.0	4.0	NM_001104631	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000340635.6	37	CCDS47213.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045814	0.93685	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000502575	T;T;T;T;T;T;T;D	0.87256	-1.38;-1.14;-0.88;-1.27;-0.85;-0.88;-0.88;-2.23	4.94	4.05	0.47172	.	1.996540	0.02203	N	0.062452	D	0.94611	0.8263	M	0.78049	2.395	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D;D	0.97110	1.0;0.947;0.922;0.947;0.965;0.965;0.947	T	0.82573	-0.0390	10	0.87932	D	0	.	14.6635	0.68891	0.1467:0.8533:0.0:0.0	.	94;97;158;94;21;36;28	Q08499-12;Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10	.;.;PDE4D_HUMAN;.;.;.;.	S	158;27;22;94;28;36;97;97;94	ENSP00000345502:G158S;ENSP00000353152:G22S;ENSP00000424852:G94S;ENSP00000425605:G28S;ENSP00000384806:G36S;ENSP00000423094:G97S;ENSP00000442734:G97S;ENSP00000425917:G94S	ENSP00000308485:G94S	G	-	1	0	PDE4D	58547535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	1.156000	0.42514	0.591000	0.81541	GGC	.		0.463	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
PDE4D	5144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	58882174	58882174	+	Intron	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:58882174T>C	ENST00000340635.6	-	1	631				PDE4D_ENST00000502484.2_Intron|PDE4D_ENST00000360047.5_Missense_Mutation_p.R10G|PDE4D_ENST00000502575.1_Intron|PDE4D_ENST00000507116.1_Intron|PDE4D_ENST00000546160.1_Intron	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific						adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	GAATGCCTTCTAAAGGGAAAA	0.353																																					p.R10G		.											.	PDE4D	226	0			c.A28G						.						258.0	253.0	254.0					5																	58882174		1864	4103	5967	SO:0001627	intron_variant	5144	exon1			GCCTTCTAAAGGG		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.455+306820A>G	5.37:g.58882174T>C		Somatic	221.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	78.0	NM_006203	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	ENST00000340635.6	37	CCDS47213.1	.	.	.	.	.	.	.	.	.	.	T	9.961	1.222890	0.22457	.	.	ENSG00000113448	ENST00000360047	T	0.67865	-0.29	5.64	5.64	0.86602	.	.	.	.	.	T	0.73745	0.3626	.	.	.	0.80722	D	1	P	0.43662	0.814	P	0.51701	0.677	T	0.76119	-0.3076	8	0.62326	D	0.03	.	11.9443	0.52920	0.0:0.0:0.1448:0.8552	.	9	Q08499-2	.	G	10	ENSP00000353152:R10G	ENSP00000353152:R10G	R	-	1	2	PDE4D	58917931	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.288000	0.43514	2.367000	0.80283	0.528000	0.53228	AGA	.		0.353	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
PDGFRB	5159	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	149503839	149503839	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:149503839T>C	ENST00000261799.4	-	14	2466	c.1997A>G	c.(1996-1998)aAc>aGc	p.N666S		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	666	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCCCAACAGGTTGACCACGTT	0.637			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.N666S		.		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	PDGFRB	1499	0			c.A1997G						.						79.0	64.0	69.0					5																	149503839		2203	4300	6503	SO:0001583	missense	5159	exon14			AACAGGTTGACCA	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1997A>G	5.37:g.149503839T>C	ENSP00000261799:p.Asn666Ser	Somatic	118.0	1.0		WXS	Illumina HiSeq	Phase_I	235.0	10.0	NM_002609	B5A957|Q8N5L4	Missense_Mutation	SNP	ENST00000261799.4	37	CCDS4303.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.791849	0.90453	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	D	0.88818	-2.43	4.88	4.88	0.63580	Serine-threonine/tyrosine-protein kinase (1);Tyrosine-protein kinase, receptor class III, conserved site (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.56097	D	0.000029	D	0.89887	0.6845	N	0.20328	0.56	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.87578	0.988;0.998	D	0.91735	0.5399	10	0.87932	D	0	.	14.7793	0.69754	0.0:0.0:0.0:1.0	.	666;666	A8KAM8;P09619	.;PGFRB_HUMAN	S	666;336	ENSP00000261799:N666S	ENSP00000261799:N666S	N	-	2	0	PDGFRB	149484032	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.997000	0.88414	1.942000	0.56320	0.379000	0.24179	AAC	.		0.637	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
PDZD8	118987	ucsc.edu;bcgsc.ca	37	10	119078452	119078452	+	Silent	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr10:119078452T>C	ENST00000334464.5	-	3	1268	c.1029A>G	c.(1027-1029)gcA>gcG	p.A343A		NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	343					cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		AATGAACATTTGCCTCTCTGT	0.328																																					p.A343A		.											.	PDZD8	90	0			c.A1029G						.						110.0	108.0	109.0					10																	119078452		2203	4298	6501	SO:0001819	synonymous_variant	118987	exon3			AACATTTGCCTCT	AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.1029A>G	10.37:g.119078452T>C		Somatic	123.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_173791	Q86WE0|Q86WE5|Q9UFF1	Silent	SNP	ENST00000334464.5	37	CCDS7600.1																																																																																			.		0.328	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050565.1	NM_173791	
PELP1	27043	broad.mit.edu;bcgsc.ca	37	17	4594688	4594688	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:4594688C>A	ENST00000574876.1	-	2	316	c.299G>T	c.(298-300)aGt>aTt	p.S100I	PELP1_ENST00000269230.7_Missense_Mutation_p.S100I|PELP1_ENST00000436683.2_5'UTR|PELP1_ENST00000572293.1_Missense_Mutation_p.S150I|PELP1_ENST00000570823.1_5'UTR|PELP1_ENST00000301396.4_Missense_Mutation_p.S100I|AC091153.4_ENST00000441700.2_RNA			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	100					cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						TTTGATGGAACTGAGACGTGC	0.463																																					p.S100I		.											.	PELP1	24	0			c.G299T						.						109.0	104.0	106.0					17																	4594688		1897	4113	6010	SO:0001583	missense	27043	exon2			ATGGAACTGAGAC		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.299G>T	17.37:g.4594688C>A	ENSP00000461625:p.Ser100Ile	Somatic	100.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	6.0	NM_014389	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	ENST00000574876.1	37	CCDS58503.1	.	.	.	.	.	.	.	.	.	.	C	11.84	1.759273	0.31137	.	.	ENSG00000141456	ENST00000301396;ENST00000269230	T;T	0.69306	-0.39;-0.28	4.9	4.9	0.64082	.	0.408437	0.24176	N	0.040860	T	0.47340	0.1440	N	0.03608	-0.345	0.80722	D	1	B	0.20368	0.044	B	0.31390	0.129	T	0.48581	-0.9023	10	0.45353	T	0.12	-1.4287	13.4507	0.61169	0.0:1.0:0.0:0.0	.	100	Q8IZL8	PELP1_HUMAN	I	100	ENSP00000301396:S100I;ENSP00000269230:S100I	ENSP00000269230:S100I	S	-	2	0	AC091153.1	4541437	0.168000	0.22989	0.071000	0.20095	0.968000	0.65278	4.536000	0.60636	2.540000	0.85666	0.462000	0.41574	AGT	.		0.463	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000439140.2	NM_014389	
PER2	8864	bcgsc.ca;mdanderson.org	37	2	239167286	239167286	+	Splice_Site	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:239167286C>T	ENST00000254657.3	-	15	1907		c.e15-1		PER2_ENST00000254658.3_Splice_Site	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2						circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		GTTTGCATTTCTGAAGGAATG	0.478																																					.		.											.	PER2	154	0			c.1628-1G>A						.						42.0	43.0	43.0					2																	239167286		2203	4300	6503	SO:0001630	splice_region_variant	8864	exon16			GCATTTCTGAAGG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1628-1G>A	2.37:g.239167286C>T		Somatic	86.0	1.0		WXS	Illumina HiSeq	Phase_1	121.0	43.0	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Splice_Site	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	C	9.521	1.108223	0.20714	.	.	ENSG00000132326	ENST00000254657	.	.	.	4.79	4.79	0.61399	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7283	0.77780	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PER2	238832025	0.998000	0.40836	0.763000	0.31416	0.020000	0.10135	3.074000	0.50065	2.391000	0.81399	0.555000	0.69702	.	.		0.478	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	Intron
PIGQ	9091	broad.mit.edu;ucsc.edu	37	16	628459	628459	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:628459C>G	ENST00000026218.5	+	5	1111	c.1023C>G	c.(1021-1023)gaC>gaG	p.D341E	PIGQ_ENST00000321878.5_Missense_Mutation_p.D341E|PIGQ_ENST00000544860.1_3'UTR|PIGQ_ENST00000409527.2_Missense_Mutation_p.D341E	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	341	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				GTGCACTGGACCAGGTGCTGG	0.657																																					p.D341E		.											.	PIGQ	226	0			c.C1023G						.						55.0	48.0	51.0					16																	628459		2200	4299	6499	SO:0001583	missense	9091	exon5			ACTGGACCAGGTG	AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1023C>G	16.37:g.628459C>G	ENSP00000026218:p.Asp341Glu	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	7.0	NM_148920	A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	ENST00000026218.5	37	CCDS10411.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083970	0.76642	.	.	ENSG00000007541	ENST00000409527;ENST00000321878;ENST00000026218	T;T;T	0.43294	0.95;0.95;2.24	5.25	3.27	0.37495	.	0.000000	0.85682	D	0.000000	T	0.49643	0.1569	L	0.46157	1.445	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.997	D;D;D	0.70487	0.969;0.968;0.948	T	0.48031	-0.9070	10	0.52906	T	0.07	-26.487	5.2642	0.15589	0.0:0.6085:0.0:0.3915	.	355;341;341	E7ERP4;Q9BRB3;Q9BRB3-2	.;PIGQ_HUMAN;.	E	341	ENSP00000386760:D341E;ENSP00000326674:D341E;ENSP00000026218:D341E	ENSP00000026218:D341E	D	+	3	2	PIGQ	568460	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.705000	0.47127	1.201000	0.43203	0.591000	0.81541	GAC	.		0.657	PIGQ-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000239270.2	NM_004204	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51732778	51732778	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:51732778A>G	ENST00000371117.3	-	48	7891	c.7616T>C	c.(7615-7617)aTt>aCt	p.I2539T	PKHD1_ENST00000340994.4_Missense_Mutation_p.I2539T	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2539					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGAAGCAAGAATGTGACTTCT	0.428																																					p.I2539T		.											.	PKHD1	603	0			c.T7616C						.						91.0	84.0	86.0					6																	51732778		2203	4299	6502	SO:0001583	missense	5314	exon48			GCAAGAATGTGAC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.7616T>C	6.37:g.51732778A>G	ENSP00000360158:p.Ile2539Thr	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	39.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.145150	0.57044	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87334	-2.04;-2.24	5.67	5.67	0.87782	.	0.329660	0.29253	N	0.012689	D	0.83059	0.5172	L	0.54323	1.7	0.23620	N	0.997277	P;P;P	0.47545	0.799;0.897;0.651	B;P;B	0.47470	0.276;0.548;0.115	T	0.79914	-0.1602	10	0.72032	D	0.01	.	15.0934	0.72215	1.0:0.0:0.0:0.0	.	2539;2539;2539	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	T	2539	ENSP00000360158:I2539T;ENSP00000341097:I2539T	ENSP00000341097:I2539T	I	-	2	0	PKHD1	51840737	0.980000	0.34600	0.928000	0.36995	0.811000	0.45836	6.060000	0.71141	2.165000	0.68154	0.482000	0.46254	ATT	.		0.428	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
PKHD1L1	93035	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	110457487	110457487	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:110457487A>C	ENST00000378402.5	+	38	5493	c.5389A>C	c.(5389-5391)Aac>Cac	p.N1797H		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1797	IPT/TIG 10.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TAATGAAAACAACATCACTGC	0.433										HNSCC(38;0.096)																											p.N1797H		.											.	PKHD1L1	145	0			c.A5389C						.						124.0	119.0	120.0					8																	110457487		1958	4161	6119	SO:0001583	missense	93035	exon38			GAAAACAACATCA	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5389A>C	8.37:g.110457487A>C	ENSP00000367655:p.Asn1797His	Somatic	217.0	1.0		WXS	Illumina HiSeq	Phase_I	453.0	28.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	A	4.974	0.180893	0.09443	.	.	ENSG00000205038	ENST00000378402	T	0.76839	-1.05	6.03	3.64	0.41730	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.293747	0.36167	N	0.002757	T	0.72455	0.3462	M	0.65975	2.015	0.19945	N	0.999943	B	0.20459	0.045	B	0.27076	0.076	T	0.63492	-0.6625	10	0.45353	T	0.12	.	5.0247	0.14379	0.6875:0.1563:0.1562:0.0	.	1797	Q86WI1	PKHL1_HUMAN	H	1797	ENSP00000367655:N1797H	ENSP00000367655:N1797H	N	+	1	0	PKHD1L1	110526663	0.955000	0.32602	0.455000	0.27031	0.065000	0.16274	2.851000	0.48302	0.513000	0.28278	0.533000	0.62120	AAC	.		0.433	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PKHD1L1	93035	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	110460575	110460575	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:110460575G>C	ENST00000378402.5	+	39	6084	c.5980G>C	c.(5980-5982)Gta>Cta	p.V1994L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1994	IPT/TIG 12.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GTCCACAGTTGTATTTGAGTA	0.398										HNSCC(38;0.096)																											p.V1994L		.											.	PKHD1L1	145	0			c.G5980C						.						77.0	76.0	76.0					8																	110460575		1930	4153	6083	SO:0001583	missense	93035	exon39			ACAGTTGTATTTG	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5980G>C	8.37:g.110460575G>C	ENSP00000367655:p.Val1994Leu	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	232.0	13.0	NM_177531	Q567P2|Q9UF27	Missense_Mutation	SNP	ENST00000378402.5	37	CCDS47911.1	.	.	.	.	.	.	.	.	.	.	G	7.036	0.561583	0.13498	.	.	ENSG00000205038	ENST00000378402	T	0.75938	-0.98	5.63	2.85	0.33270	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.694656	0.13897	N	0.355149	T	0.66015	0.2747	M	0.68317	2.08	0.09310	N	1	B	0.18863	0.031	B	0.22880	0.042	T	0.50725	-0.8794	10	0.13108	T	0.6	.	4.6974	0.12811	0.2566:0.1591:0.5843:0.0	.	1994	Q86WI1	PKHL1_HUMAN	L	1994	ENSP00000367655:V1994L	ENSP00000367655:V1994L	V	+	1	0	PKHD1L1	110529751	0.000000	0.05858	0.012000	0.15200	0.290000	0.27261	0.347000	0.20014	0.734000	0.32515	0.585000	0.79938	GTA	.		0.398	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381017.1	NM_177531	
PLK4	10733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	128806961	128806961	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:128806961C>T	ENST00000270861.5	+	5	710	c.436C>T	c.(436-438)Cgt>Tgt	p.R146C	PLK4_ENST00000514379.1_Missense_Mutation_p.R105C|PLK4_ENST00000513090.1_Missense_Mutation_p.R114C|PLK4_ENST00000515069.1_Missense_Mutation_p.R146C|PLK4_ENST00000507249.1_Missense_Mutation_p.R146C	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> H (in dbSNP:rs35232579). {ECO:0000269|PubMed:17344846}.		centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						CCTACTGACTCGTAATATGAA	0.418																																					p.R146C	Colon(135;508 1718 19061 31832 42879)	.											.	PLK4	333	0			c.C436T						.						186.0	172.0	177.0					4																	128806961		2203	4300	6503	SO:0001583	missense	10733	exon5			CTGACTCGTAATA	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.436C>T	4.37:g.128806961C>T	ENSP00000270861:p.Arg146Cys	Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	327.0	114.0	NM_014264	B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Missense_Mutation	SNP	ENST00000270861.5	37	CCDS3735.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342200	0.61073	.	.	ENSG00000142731	ENST00000270861;ENST00000515069;ENST00000513090;ENST00000507249;ENST00000514379	T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23	6.03	3.23	0.37069	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.197045	0.51477	D	0.000093	T	0.67850	0.2937	L	0.51853	1.615	0.23440	N	0.997677	D;D	0.76494	0.999;0.999	P;P	0.58970	0.827;0.849	T	0.59241	-0.7491	10	0.72032	D	0.01	-7.3389	3.6812	0.08310	0.2627:0.437:0.2236:0.0768	.	114;146	O00444-2;O00444	.;PLK4_HUMAN	C	146;146;114;146;105	ENSP00000270861:R146C;ENSP00000421774:R146C;ENSP00000427554:R114C;ENSP00000423412:R146C;ENSP00000423582:R105C	ENSP00000270861:R146C	R	+	1	0	PLK4	129026411	1.000000	0.71417	0.023000	0.16930	0.988000	0.76386	4.517000	0.60503	0.865000	0.35603	0.655000	0.94253	CGT	.		0.418	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257095.3		
POSTN	10631	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	38158220	38158220	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:38158220C>T	ENST00000379747.4	-	9	1246	c.1129G>A	c.(1129-1131)Gct>Act	p.A377T	POSTN_ENST00000379742.4_Missense_Mutation_p.A377T|POSTN_ENST00000379749.4_Missense_Mutation_p.A377T|POSTN_ENST00000379743.4_Missense_Mutation_p.A377T|POSTN_ENST00000541179.1_Missense_Mutation_p.A377T|POSTN_ENST00000541481.1_Missense_Mutation_p.A377T	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	377	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TGTTTTCCAGCCAGCTCAATA	0.428																																					p.A377T		.											.	POSTN	516	0			c.G1129A						.						109.0	86.0	94.0					13																	38158220		2203	4300	6503	SO:0001583	missense	10631	exon9			TTCCAGCCAGCTC	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1129G>A	13.37:g.38158220C>T	ENSP00000369071:p.Ala377Thr	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	18.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	ENST00000379747.4	37	CCDS9364.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504838	0.85176	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481	D;D;D;D;D;D	0.91631	-2.86;-2.88;-2.88;-2.88;-2.88;-2.88	5.81	5.81	0.92471	FAS1 domain (2);	0.326694	0.36167	N	0.002744	D	0.93324	0.7872	L	0.52905	1.665	0.32023	N	0.600508	B;B;B;P;P;B;B	0.39920	0.425;0.411;0.136;0.695;0.51;0.38;0.136	B;B;B;P;B;B;B	0.51297	0.248;0.431;0.171;0.665;0.349;0.322;0.171	D	0.90345	0.4362	10	0.13853	T	0.58	-4.8705	20.0912	0.97820	0.0:1.0:0.0:0.0	.	377;377;377;377;377;377;377	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	T	377	ENSP00000437959:A377T;ENSP00000369073:A377T;ENSP00000369071:A377T;ENSP00000369067:A377T;ENSP00000369066:A377T;ENSP00000437953:A377T	ENSP00000369066:A377T	A	-	1	0	POSTN	37056220	0.999000	0.42202	1.000000	0.80357	0.970000	0.65996	1.325000	0.33724	2.746000	0.94184	0.591000	0.81541	GCT	.		0.428	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
POU6F2	11281	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	39504010	39504010	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:39504010G>T	ENST00000403058.1	+	11	1955	c.1801G>T	c.(1801-1803)Ggg>Tgg	p.G601W	POU6F2_ENST00000518318.2_Missense_Mutation_p.G565W|POU6F2_ENST00000559001.1_Missense_Mutation_p.G546W	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	601					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						CGAGTTTATCGGGAGTGAACC	0.572																																					p.G601W		.											.	POU6F2	90	0			c.G1801T						.						59.0	56.0	57.0					7																	39504010		2203	4300	6503	SO:0001583	missense	11281	exon11			TTTATCGGGAGTG	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1801G>T	7.37:g.39504010G>T	ENSP00000384004:p.Gly601Trp	Somatic	81.0	2.0		WXS	Illumina HiSeq	Phase_I	81.0	12.0	NM_007252	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	37	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	G	15.95	2.984736	0.53934	.	.	ENSG00000106536	ENST00000403058;ENST00000518318	D;D	0.88201	-2.24;-2.35	5.28	5.28	0.74379	Homeodomain-related (1);	0.044079	0.85682	D	0.000000	D	0.95166	0.8433	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95553	0.8622	10	0.87932	D	0	.	19.2786	0.94042	0.0:0.0:1.0:0.0	.	601	P78424	PO6F2_HUMAN	W	601;565	ENSP00000384004:G601W;ENSP00000430514:G565W	ENSP00000384004:G601W	G	+	1	0	POU6F2	39470535	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.813000	0.99286	2.623000	0.88846	0.655000	0.94253	GGG	.		0.572	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
PPM1H	57460	ucsc.edu;bcgsc.ca	37	12	63087751	63087751	+	Silent	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:63087751A>G	ENST00000228705.6	-	7	1402	c.1102T>C	c.(1102-1104)Ttg>Ctg	p.L368L	PPM1H_ENST00000551214.1_5'UTR	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	368	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		GGGAACTTCAAGTCCTCATCC	0.502																																					p.L368L		.											.	PPM1H	637	0			c.T1102C						.						69.0	73.0	72.0					12																	63087751		1939	4132	6071	SO:0001819	synonymous_variant	57460	exon7			ACTTCAAGTCCTC	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1102T>C	12.37:g.63087751A>G		Somatic	69.0	0.0		WXS	Illumina HiSeq	.	54.0	6.0	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Silent	SNP	ENST00000228705.6	37	CCDS44934.1																																																																																			.		0.502	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
PRKCH	5583	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	61997206	61997206	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:61997206G>T	ENST00000332981.5	+	12	2039	c.1654G>T	c.(1654-1656)Gcg>Tcg	p.A552S	RP11-47I22.4_ENST00000556347.1_Silent_p.T56T|PRKCH_ENST00000555082.1_Missense_Mutation_p.A391S	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	552	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		CTGTGGTCACGCGCCTTTTGA	0.552																																					p.A552S	Melanoma(135;863 1779 8064 14443 26348)	.											.	PRKCH	1063	0			c.G1654T						.						225.0	180.0	195.0					14																	61997206		2203	4300	6503	SO:0001583	missense	5583	exon12			GGTCACGCGCCTT	M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.1654G>T	14.37:g.61997206G>T	ENSP00000329127:p.Ala552Ser	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	26.0	NM_006255	B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	ENST00000332981.5	37	CCDS9752.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.588420	0.28357	.	.	ENSG00000027075	ENST00000555185;ENST00000332981;ENST00000555082	T;T;T	0.65549	-0.16;1.88;1.88	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.62877	0.2464	N	0.17345	0.48	0.80722	D	1	D	0.53312	0.959	D	0.67548	0.952	T	0.54364	-0.8305	10	0.02654	T	1	.	19.6972	0.96030	0.0:0.0:1.0:0.0	.	552	P24723	KPCL_HUMAN	S	120;552;391	ENSP00000451871:A120S;ENSP00000329127:A552S;ENSP00000450981:A391S	ENSP00000329127:A552S	A	+	1	0	PRKCH	61066959	1.000000	0.71417	0.268000	0.24571	0.241000	0.25554	4.418000	0.59828	2.663000	0.90544	0.650000	0.86243	GCG	.		0.552	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276974.2	NM_006255	
PTGIS	5740	ucsc.edu;bcgsc.ca	37	20	48140754	48140754	+	Silent	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr20:48140754A>G	ENST00000244043.4	-	6	725	c.696T>C	c.(694-696)agT>agC	p.S232S	PTGIS_ENST00000478971.1_5'UTR	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	232					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GACTTTTGACACTGCACATGT	0.612																																					p.S232S		.											.	PTGIS	93	0			c.T696C						.						78.0	76.0	77.0					20																	48140754		2203	4300	6503	SO:0001819	synonymous_variant	5740	exon6			TTTGACACTGCAC		CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.696T>C	20.37:g.48140754A>G		Somatic	37.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_000961	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Silent	SNP	ENST00000244043.4	37	CCDS13419.1																																																																																			.		0.612	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080496.2		
PTPRM	5797	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	8088802	8088802	+	Silent	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr18:8088802C>T	ENST00000332175.8	+	11	2846	c.1809C>T	c.(1807-1809)acC>acT	p.T603T	PTPRM_ENST00000578571.1_3'UTR|PTPRM_ENST00000400053.4_Silent_p.T541T|PTPRM_ENST00000444013.1_Silent_p.T390T|PTPRM_ENST00000400060.4_Silent_p.T603T|PTPRM_ENST00000580170.1_Silent_p.T603T	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	603	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.T603T(1)		breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CTGACAATACCGTGACAGTCA	0.463																																					p.T603T		.											.	PTPRM	228	1	Substitution - coding silent(1)	breast(1)	c.C1809T						.						123.0	108.0	113.0					18																	8088802		2203	4300	6503	SO:0001819	synonymous_variant	5797	exon11			CAATACCGTGACA	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.1809C>T	18.37:g.8088802C>T		Somatic	123.0	1.0		WXS	Illumina HiSeq	Phase_I	67.0	29.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Silent	SNP	ENST00000332175.8	37	CCDS11840.1																																																																																			.		0.463	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
RBM34	23029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235318339	235318339	+	Missense_Mutation	SNP	C	C	A	rs200657743		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:235318339C>A	ENST00000408888.3	-	4	684	c.454G>T	c.(454-456)Gta>Tta	p.V152L	RBM34_ENST00000366606.3_Missense_Mutation_p.V147L			P42696	RBM34_HUMAN	RNA binding motif protein 34	152						nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CTATCTGCTACTTTAACACCA	0.368																																					p.V152L		.											.	RBM34	46	0			c.G454T						.						188.0	159.0	168.0					1																	235318339		1819	4089	5908	SO:0001583	missense	23029	exon4			CTGCTACTTTAAC		CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.454G>T	1.37:g.235318339C>A	ENSP00000386226:p.Val152Leu	Somatic	662.0	1.0		WXS	Illumina HiSeq	Phase_I	694.0	308.0	NM_001161533	A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	ENST00000408888.3	37	CCDS41477.2	.	.	.	.	.	.	.	.	.	.	C	1.089	-0.664488	0.03428	.	.	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000400947;ENST00000447801;ENST00000429912	T;T;T	0.14391	2.51;2.51;2.63	5.67	0.267	0.15622	.	1.363850	0.04381	N	0.360761	T	0.15003	0.0362	M	0.64997	1.995	0.09310	N	1	B;B	0.33171	0.4;0.01	B;B	0.26969	0.075;0.005	T	0.35201	-0.9798	10	0.27785	T	0.31	-1.4571	8.9883	0.36008	0.0:0.5752:0.0:0.4248	.	152;152	P42696-2;P42696	.;RBM34_HUMAN	L	152;147;181;150;181	ENSP00000386226:V152L;ENSP00000355565:V147L;ENSP00000400000:V150L	ENSP00000355565:V147L	V	-	1	0	RBM34	233384962	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-0.038000	0.12144	0.091000	0.17302	0.655000	0.94253	GTA	.		0.368	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100146.1	NM_015014	
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	111678241	111678241	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:111678241T>A	ENST00000358835.3	-	19	7614	c.7160A>T	c.(7159-7161)cAt>cTt	p.H2387L	REV3L_ENST00000368805.1_Missense_Mutation_p.H2387L|REV3L_ENST00000368802.3_Missense_Mutation_p.H2387L|REV3L_ENST00000435970.1_Missense_Mutation_p.H2309L			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2387					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TGCAATTTCATGAAAAAGTGC	0.323								DNA polymerases (catalytic subunits)																													p.H2387L		.											.	REV3L	294	0			c.A7160T						.						90.0	99.0	96.0					6																	111678241		2203	4300	6503	SO:0001583	missense	5980	exon18			ATTTCATGAAAAA	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7160A>T	6.37:g.111678241T>A	ENSP00000351697:p.His2387Leu	Somatic	260.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	52.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	T	16.23	3.065852	0.55539	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970;ENST00000543871	T;T;T;T	0.08720	3.06;3.06;3.06;3.06	5.93	5.93	0.95920	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.188610	0.47455	D	0.000229	T	0.01800	0.0057	N	0.02247	-0.625	0.39361	D	0.965926	B	0.06786	0.001	B	0.01281	0.0	T	0.49312	-0.8953	10	0.44086	T	0.13	-0.8613	16.3766	0.83401	0.0:0.0:0.0:1.0	.	2387	O60673	DPOLZ_HUMAN	L	2387;2387;2387;2309;460	ENSP00000357792:H2387L;ENSP00000357795:H2387L;ENSP00000351697:H2387L;ENSP00000402003:H2309L	ENSP00000351697:H2387L	H	-	2	0	REV3L	111784934	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.213000	0.77950	2.263000	0.75096	0.533000	0.62120	CAT	.		0.323	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
RFWD2	64326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	175956209	175956209	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:175956209T>C	ENST00000367669.3	-	18	2517	c.2003A>G	c.(2002-2004)tAt>tGt	p.Y668C	RFWD2_ENST00000308769.8_Missense_Mutation_p.Y644C	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	668					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AAGTCCTTTATAGTACAGGTA	0.299																																					p.Y668C	Ovarian(134;1413 1765 5706 35534 51541)	.											.	RFWD2	659	0			c.A2003G						.						59.0	59.0	59.0					1																	175956209		2203	4300	6503	SO:0001583	missense	64326	exon18			CCTTTATAGTACA	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.2003A>G	1.37:g.175956209T>C	ENSP00000356641:p.Tyr668Cys	Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	202.0	45.0	NM_022457	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	37	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.962913	0.53507	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	T;T;T	0.70399	-0.48;-0.48;-0.48	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85969	0.5821	M	0.87269	2.87	0.80722	D	1	B;D;B;D;D	0.76494	0.067;0.98;0.169;0.999;0.98	B;D;B;D;D	0.77557	0.114;0.941;0.091;0.99;0.941	D	0.88357	0.2985	10	0.72032	D	0.01	-15.7895	15.8017	0.78456	0.0:0.0:0.0:1.0	.	443;428;644;668;668	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	C	443;668;503;644	ENSP00000356641:Y668C;ENSP00000356638:Y503C;ENSP00000310943:Y644C	ENSP00000310943:Y644C	Y	-	2	0	RFWD2	174222832	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.268000	0.78473	2.261000	0.74972	0.533000	0.62120	TAT	.		0.299	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084672.2	NM_022457	
RHOBTB3	22836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	95091309	95091309	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr5:95091309A>G	ENST00000379982.3	+	6	1400	c.892A>G	c.(892-894)Atc>Gtc	p.I298V	GLRX_ENST00000508780.1_Intron	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	298	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		GGATTCCAGTATCATCCGAAC	0.448																																					p.I298V		.											.	RHOBTB3	228	0			c.A892G						.						104.0	94.0	98.0					5																	95091309		2203	4300	6503	SO:0001583	missense	22836	exon6			TCCAGTATCATCC	AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.892A>G	5.37:g.95091309A>G	ENSP00000369318:p.Ile298Val	Somatic	271.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	28.0	NM_014899	A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	ENST00000379982.3	37	CCDS4077.1	.	.	.	.	.	.	.	.	.	.	A	6.328	0.428644	0.11987	.	.	ENSG00000164292	ENST00000379982	T	0.62498	0.02	6.08	4.95	0.65309	BTB/POZ-like (2);BTB/POZ (1);	0.249082	0.42172	D	0.000751	T	0.35219	0.0924	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25710	-1.0124	10	0.10111	T	0.7	-27.8358	7.9112	0.29791	0.8235:0.0:0.1765:0.0	.	298	O94955	RHBT3_HUMAN	V	298	ENSP00000369318:I298V	ENSP00000369318:I298V	I	+	1	0	RHOBTB3	95117065	0.085000	0.21516	0.977000	0.42913	0.886000	0.51366	0.966000	0.29331	2.333000	0.79357	0.482000	0.46254	ATC	.		0.448	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241658.1	NM_014899	
RIMBP2	23504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130927134	130927134	+	Silent	SNP	G	G	T	rs549158714		TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:130927134G>T	ENST00000261655.4	-	8	875	c.712C>A	c.(712-714)Cgg>Agg	p.R238R	RIMBP2_ENST00000536002.1_Silent_p.R146R|RIMBP2_ENST00000535703.1_Silent_p.R146R	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	238					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CTTGCCAACCGCGACTCGTTG	0.587																																					p.R238R		.											RIMBP2,brain,glioma,+1	RIMBP2	142	0			c.C712A						.						130.0	129.0	129.0					12																	130927134		2203	4300	6503	SO:0001819	synonymous_variant	23504	exon8			CCAACCGCGACTC	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.712C>A	12.37:g.130927134G>T		Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	428.0	151.0	NM_015347	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			.		0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
RXRA	6256	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	137320977	137320977	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr9:137320977T>G	ENST00000481739.1	+	7	986	c.934T>G	c.(934-936)Tcc>Gcc	p.S312A	RXRA_ENST00000540193.1_Missense_Mutation_p.S215A|RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	312	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GCTCATCGCCTCCTTCTCCCA	0.697																																					p.S312A		.											.	RXRA	188	0			c.T934G						.						86.0	81.0	83.0					9																	137320977		2203	4300	6503	SO:0001583	missense	6256	exon7			ATCGCCTCCTTCT	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.934T>G	9.37:g.137320977T>G	ENSP00000419692:p.Ser312Ala	Somatic	161.0	2.0		WXS	Illumina HiSeq	Phase_I	259.0	131.0	NM_002957	B3KY83|Q2NL52|Q2V504	Missense_Mutation	SNP	ENST00000481739.1	37	CCDS35172.1	.	.	.	.	.	.	.	.	.	.	T	13.99	2.402051	0.42613	.	.	ENSG00000186350	ENST00000481739;ENST00000540193	D;D	0.96365	-3.99;-3.99	4.26	4.26	0.50523	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.90113	0.6911	N	0.05467	-0.045	0.58432	D	0.999999	B	0.17852	0.024	B	0.26310	0.068	D	0.85848	0.1402	10	0.16896	T	0.51	.	13.6644	0.62387	0.0:0.0:0.0:1.0	.	312	P19793	RXRA_HUMAN	A	312;215	ENSP00000419692:S312A;ENSP00000442123:S215A	ENSP00000419692:S312A	S	+	1	0	RXRA	136460798	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.672000	0.83956	1.696000	0.51158	0.402000	0.26972	TCC	.		0.697	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
SAMD15	161394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77844990	77844990	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr14:77844990C>T	ENST00000216471.4	+	1	1515	c.1229C>T	c.(1228-1230)aCc>aTc	p.T410I	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	410										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CCAGATGAAACCAAACCAAGG	0.438																																					p.T410I		.											.	SAMD15	90	0			c.C1229T						.						78.0	75.0	76.0					14																	77844990		2203	4300	6503	SO:0001583	missense	161394	exon1			ATGAAACCAAACC	AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1229C>T	14.37:g.77844990C>T	ENSP00000216471:p.Thr410Ile	Somatic	295.0	0.0		WXS	Illumina HiSeq	Phase_I	417.0	84.0	NM_001010860	Q2M3P3	Missense_Mutation	SNP	ENST00000216471.4	37	CCDS32126.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.877404	0.33162	.	.	ENSG00000100583	ENST00000216471	T	0.18810	2.19	5.6	1.71	0.24356	.	1.066930	0.07477	N	0.903237	T	0.10895	0.0266	N	0.12182	0.205	0.09310	N	1	B	0.32245	0.361	B	0.29942	0.109	T	0.31752	-0.9932	10	0.39692	T	0.17	2.4634	4.0072	0.09607	0.1648:0.5723:0.0:0.2628	.	410	Q9P1V8	SAM15_HUMAN	I	410	ENSP00000216471:T410I	ENSP00000216471:T410I	T	+	2	0	SAMD15	76914743	0.000000	0.05858	0.001000	0.08648	0.304000	0.27724	0.083000	0.14871	0.045000	0.15804	0.555000	0.69702	ACC	.		0.438	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394587.2	NM_001010860	
SCN2A	6326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	166211045	166211045	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:166211045A>G	ENST00000375437.2	+	17	3553	c.3263A>G	c.(3262-3264)gAt>gGt	p.D1088G	SCN2A_ENST00000357398.3_Missense_Mutation_p.D1088G|SCN2A_ENST00000375427.2_Missense_Mutation_p.D1088G|SCN2A_ENST00000283256.6_Missense_Mutation_p.D1088G	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1088					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TATGTCGTGGATGAAAGTGAT	0.373																																					p.D1088G		.											.	SCN2A	142	0			c.A3263G						.						113.0	111.0	112.0					2																	166211045		2203	4300	6503	SO:0001583	missense	6326	exon16			TCGTGGATGAAAG	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3263A>G	2.37:g.166211045A>G	ENSP00000364586:p.Asp1088Gly	Somatic	309.0	0.0		WXS	Illumina HiSeq	Phase_I	305.0	95.0	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	37	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	A	13.29	2.193601	0.38707	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79	5.26	5.26	0.73747	Sodium ion transport-associated (1);	0.172626	0.41001	D	0.000972	D	0.88239	0.6383	M	0.77616	2.38	0.34725	D	0.729149	B;P	0.47545	0.01;0.897	B;P	0.53760	0.015;0.734	D	0.91929	0.5553	10	0.40728	T	0.16	.	15.1655	0.72821	1.0:0.0:0.0:0.0	.	1088;1088	Q99250-2;Q99250	.;SCN2A_HUMAN	G	1088	ENSP00000364586:D1088G;ENSP00000349973:D1088G;ENSP00000283256:D1088G;ENSP00000364576:D1088G	ENSP00000283256:D1088G	D	+	2	0	SCN2A	165919291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.903000	0.56318	1.981000	0.57761	0.482000	0.46254	GAT	.		0.373	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
SDK2	54549	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	71503642	71503642	+	Silent	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:71503642G>A	ENST00000392650.3	-	2	159	c.159C>T	c.(157-159)agC>agT	p.S53S	SDK2_ENST00000388726.3_Silent_p.S53S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	53	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CCAGTGGCCAGCTGCCCTCGG	0.582																																					p.S53S		.											.	SDK2	24	0			c.C159T						.						97.0	95.0	95.0					17																	71503642		692	1591	2283	SO:0001819	synonymous_variant	54549	exon2			TGGCCAGCTGCCC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.159C>T	17.37:g.71503642G>A		Somatic	99.0	1.0		WXS	Illumina HiSeq	Phase_I	139.0	61.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	CCDS45769.1																																																																																			.		0.582	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SHANK2	22941	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70507758	70507758	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:70507758C>A	ENST00000423696.2	-	6	778	c.742G>T	c.(742-744)Gtg>Ttg	p.V248L	SHANK2_ENST00000449833.2_Missense_Mutation_p.V39L|SHANK2_ENST00000409530.1_Missense_Mutation_p.V38L|SHANK2_ENST00000409161.1_Missense_Mutation_p.V38L|SHANK2_ENST00000338508.4_Missense_Mutation_p.V628L|SHANK2_ENST00000357171.3_Missense_Mutation_p.V39L|SHANK2_ENST00000449116.2_Missense_Mutation_p.V39L			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	248	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TGCAGGACCACCGTCTTCTCC	0.542																																					p.V39L		.											.	SHANK2	94	0			c.G115T						.						180.0	164.0	169.0					11																	70507758		2200	4294	6494	SO:0001583	missense	22941	exon1			GGACCACCGTCTT	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.742G>T	11.37:g.70507758C>A	ENSP00000394536:p.Val248Leu	Somatic	152.0	1.0		WXS	Illumina HiSeq	Phase_I	304.0	86.0	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	ENST00000423696.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	33|33	5.244871|5.244871	0.95272|0.95272	.|.	.|.	ENSG00000162105|ENSG00000162105	ENST00000412252|ENST00000449833;ENST00000409161;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018;ENST00000409530;ENST00000449116;ENST00000357171	.|T;T;T;T;T;T;T;T	.|0.27890	.|1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64	4.76|4.76	4.76|4.76	0.60689|0.60689	.|PDZ/DHR/GLGF (3);	.|0.290166	.|0.31760	.|N	.|0.007118	T|T	0.52141|0.52141	0.1716|0.1716	L|L	0.55481|0.55481	1.735|1.735	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D	.|0.67145	.|0.984;0.989;0.996;0.967	.|P;P;D;P	.|0.76575	.|0.773;0.907;0.988;0.887	T|T	0.55528|0.55528	-0.8127|-0.8127	5|10	.|0.66056	.|D	.|0.02	.|.	17.7826|17.7826	0.88528|0.88528	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|39;248;627;39	.|B7ZKU9;Q9UPX8;Q9UPX8-3;Q9UPX8-4	.|.;SHAN2_HUMAN;.;.	V|L	37|39;38;628;248;262;258;38;39;39	.|ENSP00000399423:V39L;ENSP00000386491:V38L;ENSP00000345193:V628L;ENSP00000394536:V248L;ENSP00000294018:V258L;ENSP00000387324:V38L;ENSP00000394939:V39L;ENSP00000349694:V39L	.|ENSP00000294018:V258L	G|V	-|-	2|1	0|0	SHANK2|SHANK2	70185406|70185406	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.978000|0.978000	0.69477|0.69477	7.049000|7.049000	0.76613|0.76613	2.189000|2.189000	0.69895|0.69895	0.491000|0.491000	0.48974|0.48974	GGT|GTG	.		0.542	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
SLC12A3	6559	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	56920341	56920341	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:56920341delC	ENST00000563236.1	+	16	2016	c.1991delC	c.(1990-1992)accfs	p.T664fs	SLC12A3_ENST00000566786.1_Frame_Shift_Del_p.T663fs|SLC12A3_ENST00000262502.5_Frame_Shift_Del_p.T663fs|SLC12A3_ENST00000438926.2_Frame_Shift_Del_p.T664fs			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	664					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	TTTGTGGGCACCTTCACCCGG	0.657																																					p.T664fs		.											.	SLC12A3	155	0			c.1991delC						.						55.0	55.0	55.0					16																	56920341		2198	4300	6498	SO:0001589	frameshift_variant	6559	exon16			TGGGCACCTTCAC		CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1991delC	16.37:g.56920341delC	ENSP00000456149:p.Thr664fs	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	38.0	NM_001126108	A8MSJ2|C9JNN9	Frame_Shift_Del	DEL	ENST00000563236.1	37	CCDS58464.1																																																																																			.		0.657	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432337.1		
SLC5A7	60482	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	108622601	108622601	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:108622601G>A	ENST00000264047.2	+	7	1114	c.838G>A	c.(838-840)Ggg>Agg	p.G280R	SLC5A7_ENST00000540517.1_Missense_Mutation_p.G175R|SLC5A7_ENST00000409059.1_Missense_Mutation_p.G280R	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	280					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	GGCAGCTTTCGGGTGCCTGGT	0.522																																					p.G280R		.											.	SLC5A7	93	0			c.G838A						.						109.0	94.0	99.0					2																	108622601		2203	4300	6503	SO:0001583	missense	60482	exon7			GCTTTCGGGTGCC	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.838G>A	2.37:g.108622601G>A	ENSP00000264047:p.Gly280Arg	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	59.0	NM_021815	Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	37	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	33	5.207259	0.95033	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.88201	-2.35;-2.35;-2.35	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.95934	0.8676	M	0.91872	3.25	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.96084	0.9056	10	0.66056	D	0.02	-14.1517	19.8703	0.96847	0.0:0.0:1.0:0.0	.	280	Q9GZV3	SC5A7_HUMAN	R	280;175;280	ENSP00000387346:G280R;ENSP00000445351:G175R;ENSP00000264047:G280R	ENSP00000264047:G280R	G	+	1	0	SLC5A7	107989033	1.000000	0.71417	0.993000	0.49108	0.896000	0.52359	9.810000	0.99221	2.770000	0.95276	0.650000	0.86243	GGG	.		0.522	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
SNX10	29887	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	26412162	26412162	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:26412162T>A	ENST00000338523.4	+	7	763	c.576T>A	c.(574-576)tgT>tgA	p.C192*	AC004540.4_ENST00000451264.1_RNA|SNX10_ENST00000462993.1_3'UTR|SNX10_ENST00000396376.1_Nonsense_Mutation_p.C192*|SNX10_ENST00000409838.1_Nonsense_Mutation_p.C108*|AC004540.4_ENST00000451368.1_RNA|SNX10_ENST00000409367.1_Nonsense_Mutation_p.C152*|SNX10_ENST00000446848.2_Nonsense_Mutation_p.C218*	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10	192					cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)			endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						CACATGGATGTAAAGTAAATA	0.368																																					p.C192X		.											.	SNX10	226	0			c.T576A						.						147.0	157.0	153.0					7																	26412162		2203	4299	6502	SO:0001587	stop_gained	29887	exon7			TGGATGTAAAGTA	AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	ENST00000338523.4:c.576T>A	7.37:g.26412162T>A	ENSP00000343709:p.Cys192*	Somatic	321.0	1.0		WXS	Illumina HiSeq	Phase_I	377.0	114.0	NM_001199835	E9PFH5|Q8IYT5	Nonsense_Mutation	SNP	ENST00000338523.4	37	CCDS5399.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175542	0.78564	.	.	ENSG00000086300	ENST00000338523;ENST00000446848;ENST00000396376;ENST00000409367;ENST00000409838	.	.	.	5.33	5.33	0.75918	.	0.337730	0.36555	N	0.002524	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	9.7761	0.40621	0.0:0.0771:0.0:0.9229	.	.	.	.	X	192;218;192;152;108	.	ENSP00000343709:C192X	C	+	3	2	SNX10	26378687	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.865000	0.39479	1.999000	0.58509	0.528000	0.53228	TGT	.		0.368	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214120.1		
SPRY2	10253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	80911451	80911451	+	Silent	SNP	G	G	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr13:80911451G>C	ENST00000377102.1	-	2	1367	c.390C>G	c.(388-390)tcC>tcG	p.S130S	SPRY2_ENST00000540649.1_Silent_p.S130S|SPRY2_ENST00000377104.3_Silent_p.S130S			O43597	SPY2_HUMAN	sprouty homolog 2 (Drosophila)	130	Poly-Ser.				bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of mitotic spindle orientation (GO:0000132)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inner ear morphogenesis (GO:0042472)|lung growth (GO:0060437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|sensory perception of sound (GO:0007605)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase inhibitor activity (GO:0030291)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	12	Medulloblastoma(90;0.18)	Acute lymphoblastic leukemia(28;0.218)|Breast(118;0.244)		GBM - Glioblastoma multiforme(99;0.0318)		TCTGTTCAGAGGAGCTGCTGC	0.567																																					p.S130S		.											.	SPRY2	659	0			c.C390G						.						109.0	99.0	102.0					13																	80911451		2203	4300	6503	SO:0001819	synonymous_variant	10253	exon2			TTCAGAGGAGCTG	AF039843	CCDS9463.1	13q31.1	2008-05-14	2001-11-28		ENSG00000136158	ENSG00000136158			11270	protein-coding gene	gene with protein product		602466	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005842		Approved	hSPRY2	uc001vlj.3	O43597	OTTHUMG00000017140	ENST00000377102.1:c.390C>G	13.37:g.80911451G>C		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	26.0	NM_005842	B2R9J9|Q5T6Z7	Silent	SNP	ENST00000377102.1	37	CCDS9463.1																																																																																			.		0.567	SPRY2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045387.1		
SRSF7	6432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	38976737	38976737	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:38976737T>C	ENST00000313117.6	-	3	557	c.320A>G	c.(319-321)tAt>tGt	p.Y107C	SRSF7_ENST00000446327.2_Missense_Mutation_p.Y107C|SRSF7_ENST00000409276.1_Missense_Mutation_p.Y107C|GEMIN6_ENST00000409011.1_5'Flank	NM_001031684.2|NM_001195446.1	NP_001026854.1|NP_001182375.1	Q16629	SRSF7_HUMAN	serine/arginine-rich splicing factor 7	107					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						GCCACACTCATAGCATCTATC	0.458																																					p.Y107C		.											.	SRSF7	226	0			c.A320G						.						149.0	141.0	144.0					2																	38976737		2203	4300	6503	SO:0001583	missense	6432	exon3			CACTCATAGCATC	L41887	CCDS33183.1, CCDS56115.1	2p22.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000115875	ENSG00000115875		"""Zinc fingers, CCHC domain containing"", ""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10789	protein-coding gene	gene with protein product	"""SR splicing factor 7"""	600572	"""splicing factor, arginine/serine-rich 7 (35kD)"", ""splicing factor, arginine/serine-rich 7, 35kDa"""	SFRS7		8013463, 20516191	Standard	NM_001031684		Approved	9G8, ZCRB2, HSSG1, AAG3, RBM37, ZCCHC20	uc002rqz.3	Q16629	OTTHUMG00000102076	ENST00000313117.6:c.320A>G	2.37:g.38976737T>C	ENSP00000325905:p.Tyr107Cys	Somatic	282.0	1.0		WXS	Illumina HiSeq	Phase_I	528.0	188.0	NM_001195446	B4DLU6|G5E9M3|Q564D3	Missense_Mutation	SNP	ENST00000313117.6	37	CCDS33183.1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.621157	0.66787	.	.	ENSG00000115875	ENST00000313117;ENST00000446327;ENST00000409276	T;T;T	0.78003	-1.14;-1.14;-1.14	5.93	4.75	0.60458	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (2);	0.000000	0.64402	D	0.000004	D	0.89047	0.6604	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90120	0.4198	10	0.87932	D	0	.	12.3223	0.54991	0.1269:0.0:0.0:0.8731	.	107;107	G5E9M3;Q16629	.;SRSF7_HUMAN	C	107	ENSP00000325905:Y107C;ENSP00000402264:Y107C;ENSP00000386806:Y107C	ENSP00000325905:Y107C	Y	-	2	0	SRSF7	38830241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.677000	0.84024	1.024000	0.39682	0.533000	0.62120	TAT	.		0.458	SRSF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219889.2	NM_001031684	
SYVN1	84447	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64900941	64900941	+	Splice_Site	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr11:64900941T>C	ENST00000377190.3	-	2	226	c.132A>G	c.(130-132)gcA>gcG	p.A44A	SYVN1_ENST00000294256.8_Splice_Site_p.A44A|SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000526060.1_Splice_Site_p.A44A|SYVN1_ENST00000307289.6_Splice_Site_p.A44A	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	44					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CTGAACTCACTGCCATGCTGG	0.627																																					p.A44A		.											.	SYVN1	91	0			c.A132G						.						73.0	70.0	71.0					11																	64900941		2201	4297	6498	SO:0001630	splice_region_variant	84447	exon2			ACTCACTGCCATG	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.132+1A>G	11.37:g.64900941T>C		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	28.0	NM_172230	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Silent	SNP	ENST00000377190.3	37	CCDS31605.1																																																																																			.		0.627	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	Silent
TDRD5	163589	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	179623394	179623394	+	Intron	SNP	T	T	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:179623394T>G	ENST00000367614.1	+	13	2519				TDRD5_ENST00000444136.1_Nonsense_Mutation_p.L740*|TDRD5_ENST00000294848.8_Intron	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5						DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AAGGAGCCATTAAAGGATTCT	0.313																																					p.L740X		.											.	TDRD5	94	0			c.T2219G						.																																			SO:0001627	intron_variant	163589	exon14			AGCCATTAAAGGA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2160+2062T>G	1.37:g.179623394T>G		Somatic	283.0	0.0		WXS	Illumina HiSeq	Phase_I	264.0	24.0	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Nonsense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	T	18.82	3.704245	0.68615	.	.	ENSG00000162782	ENST00000444136;ENST00000417329	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-21.2831	11.498	0.50419	0.0:0.0:0.0:1.0	.	.	.	.	X	740;196	.	ENSP00000410744:L196X	L	+	2	0	TDRD5	177890017	0.998000	0.40836	0.973000	0.42090	0.440000	0.31957	1.936000	0.40183	2.036000	0.60181	0.533000	0.62120	TTA	.		0.313	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
TGFB1	7040	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	19	41850671	41850671	+	Silent	SNP	C	C	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:41850671C>A	ENST00000221930.5	-	3	1481	c.615G>T	c.(613-615)cgG>cgT	p.R205R		NM_000660.4	NP_000651.3	P01137	TGFB1_HUMAN	transforming growth factor, beta 1	205	Arm domain. {ECO:0000250}.				active induction of host immune response by virus (GO:0046732)|adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains (GO:0002460)|aging (GO:0007568)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|branch elongation involved in mammary gland duct branching (GO:0060751)|cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|cellular calcium ion homeostasis (GO:0006874)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation (GO:0002062)|common-partner SMAD protein phosphorylation (GO:0007182)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|defense response to fungus, incompatible interaction (GO:0009817)|digestive tract development (GO:0048565)|embryo development (GO:0009790)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|evasion or tolerance of host defenses by virus (GO:0019049)|extracellular matrix assembly (GO:0085029)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|germ cell migration (GO:0008354)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymph node development (GO:0048535)|macrophage derived foam cell differentiation (GO:0010742)|mammary gland branching involved in thelarche (GO:0060744)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|modulation by virus of host morphology or physiology (GO:0019048)|mononuclear cell proliferation (GO:0032943)|myelination (GO:0042552)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA replication (GO:0008156)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of ossification (GO:0030279)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|ossification involved in bone remodeling (GO:0043932)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|phosphate-containing compound metabolic process (GO:0006796)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NAD+ ADP-ribosyltransferase activity (GO:1901666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of odontogenesis (GO:0042482)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein export from nucleus (GO:0006611)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|receptor catabolic process (GO:0032801)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of binding (GO:0051098)|regulation of blood vessel remodeling (GO:0060312)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of cartilage development (GO:0061035)|regulation of cell migration (GO:0030334)|regulation of DNA binding (GO:0051101)|regulation of miRNA metabolic process (GO:2000628)|regulation of protein import into nucleus (GO:0042306)|regulation of sodium ion transport (GO:0002028)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulatory T cell differentiation (GO:0045066)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|response to radiation (GO:0009314)|response to vitamin D (GO:0033280)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|T cell homeostasis (GO:0043029)|tolerance induction to self antigen (GO:0002513)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|viral life cycle (GO:0019058)	axon (GO:0030424)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	antigen binding (GO:0003823)|cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)	8					Hyaluronidase(DB00070)	TCAACCACTGCCGCACAACTC	0.557																																					p.R205R		.											.	TGFB1	522	0			c.G615T						.						117.0	81.0	93.0					19																	41850671		2203	4300	6503	SO:0001819	synonymous_variant	7040	exon3			CCACTGCCGCACA	X02812	CCDS33031.1	19q13.1	2014-01-30	2007-02-16			ENSG00000105329		"""Endogenous ligands"""	11766	protein-coding gene	gene with protein product	"""Camurati-Engelmann disease"", ""prepro-transforming growth factor beta-1"""	190180		TGFB, DPD1		10631145, 10843814	Standard	NM_000660		Approved	CED, TGFbeta	uc002oqh.2	P01137		ENST00000221930.5:c.615G>T	19.37:g.41850671C>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	19.0	NM_000660	A8K792|Q9UCG4	Silent	SNP	ENST00000221930.5	37	CCDS33031.1																																																																																			.		0.557	TGFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463500.2		
TGM7	116179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43571883	43571883	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr15:43571883C>T	ENST00000452443.2	-	10	1622	c.1618G>A	c.(1618-1620)Ggt>Agt	p.G540S		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	540					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	TGGGTACCACCCCCATGCAGC	0.642																																					p.G540S		.											.	TGM7	92	0			c.G1618A						.						93.0	94.0	94.0					15																	43571883		2202	4299	6501	SO:0001583	missense	116179	exon10			TACCACCCCCATG	AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.1618G>A	15.37:g.43571883C>T	ENSP00000389466:p.Gly540Ser	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	21.0	NM_052955		Missense_Mutation	SNP	ENST00000452443.2	37	CCDS32213.1	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607287	0.46527	.	.	ENSG00000159495	ENST00000452443	T	0.68331	-0.32	4.69	4.69	0.59074	Transglutaminase, C-terminal (1);Immunoglobulin-like fold (1);	0.121727	0.56097	D	0.000026	T	0.71702	0.3371	M	0.78801	2.425	0.19300	N	0.999973	D	0.59767	0.986	P	0.48304	0.573	T	0.69323	-0.5175	10	0.59425	D	0.04	-12.9329	13.0102	0.58727	0.0:1.0:0.0:0.0	.	540	Q96PF1	TGM7_HUMAN	S	540	ENSP00000389466:G540S	ENSP00000389466:G540S	G	-	1	0	TGM7	41359175	0.137000	0.22531	0.076000	0.20297	0.693000	0.40251	1.492000	0.35594	2.427000	0.82271	0.655000	0.94253	GGT	.		0.642	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432489.1	NM_052955	
TLR9	54106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	52255499	52255499	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:52255499C>T	ENST00000360658.2	-	2	3466	c.2833G>A	c.(2833-2835)Ggt>Agt	p.G945S	TLR9_ENST00000597542.1_Missense_Mutation_p.G969S|TLR9_ENST00000494383.1_Nonsense_Mutation_p.W1098*	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	945	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CGCAAGAGACCACTGACCCGG	0.662																																					p.G945S		.											.	TLR9	587	0			c.G2833A						.						38.0	42.0	40.0					3																	52255499		2201	4298	6499	SO:0001583	missense	54106	exon2			AGAGACCACTGAC	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2833G>A	3.37:g.52255499C>T	ENSP00000353874:p.Gly945Ser	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	15.0	NM_017442	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.248815|4.248815	0.80024|0.80024	.|.	.|.	ENSG00000239732|ENSG00000173366	ENST00000360658|ENST00000494383	T|.	0.07216|.	3.21|.	5.81|5.81	4.0|4.0	0.46444|0.46444	Toll/interleukin-1 receptor homology (TIR) domain (3);|.	0.000000|.	0.42172|.	D|.	0.000750|.	T|.	0.62011|.	0.2393|.	L|L	0.61036|0.61036	1.89|1.89	0.52099|0.52099	D|D	0.999945|0.999945	P;D|.	0.89917|.	0.889;1.0|.	B;D|.	0.97110|.	0.435;1.0|.	T|.	0.58329|.	-0.7655|.	10|.	0.66056|.	D|.	0.02|.	.|.	9.2959|9.2959	0.37815|0.37815	0.1441:0.7797:0.0:0.0763|0.1441:0.7797:0.0:0.0763	.|.	1042;945|.	B4E0A1;Q9NR96|.	.;TLR9_HUMAN|.	S|X	945|1098	ENSP00000353874:G945S|.	ENSP00000353874:G945S|.	G|W	-|-	1|2	0|0	TLR9|RP11-330H6.5	52230539|52230539	0.994000|0.994000	0.37717|0.37717	0.241000|0.241000	0.24154|0.24154	0.835000|0.835000	0.47333|0.47333	3.218000|3.218000	0.51192|0.51192	0.783000|0.783000	0.33636|0.33636	0.591000|0.591000	0.81541|0.81541	GGT|TGG	.		0.662	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7577150	7577150	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr17:7577150delT	ENST00000269305.4	-	8	977	c.788delA	c.(787-789)aatfs	p.N263fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.N263fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.N263fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.N263fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.N263fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	263	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		GN -> PD (in a sporadic cancer; somatic mutation).|N -> D (in sporadic cancers; somatic mutation).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.N263I(2)|p.G262_S269delGNLLGRNS(2)|p.N263fs*5(1)|p.E258fs*71(1)|p.S261_L264>R(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCCAGTAGATTACCACTACT	0.517		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.N263fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,colon,carcinoma,0	TP53	70225	21	Whole gene deletion(8)|Deletion - In frame(4)|Unknown(3)|Deletion - Frameshift(3)|Substitution - Missense(2)|Complex - deletion inframe(1)	bone(4)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|lung(2)|ovary(2)|eye(1)|urinary_tract(1)|stomach(1)	c.788delA						.						43.0	39.0	40.0					17																	7577150		2203	4299	6502	SO:0001589	frameshift_variant	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGTAGATTACCAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.788delA	17.37:g.7577150delT	ENSP00000269305:p.Asn263fs	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	33.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.517	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRIOBP	11078	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	22	38119347	38119347	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr22:38119347G>A	ENST00000406386.3	+	7	1039	c.784G>A	c.(784-786)Gcc>Acc	p.A262T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	262					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCTTCTCCTGCCCAAAGGGA	0.607																																					p.A262T		.											.	TRIOBP	136	0			c.G784A						.						70.0	81.0	77.0					22																	38119347		2122	4238	6360	SO:0001583	missense	11078	exon7			TCTCCTGCCCAAA	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.784G>A	22.37:g.38119347G>A	ENSP00000384312:p.Ala262Thr	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	30.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.255830	0.39896	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.27720	1.65	3.91	-2.33	0.06724	.	.	.	.	.	T	0.13200	0.0320	N	0.08118	0	0.18873	N	0.999984	B	0.18013	0.025	B	0.13407	0.009	T	0.27088	-1.0084	9	0.33141	T	0.24	.	6.9194	0.24378	0.1743:0.4047:0.421:0.0	.	262	Q9H2D6	TARA_HUMAN	T	262	ENSP00000384312:A262T	ENSP00000384312:A262T	A	+	1	0	TRIOBP	36449293	0.000000	0.05858	0.510000	0.27712	0.006000	0.05464	0.005000	0.13129	-0.146000	0.11274	-0.370000	0.07254	GCC	.		0.607	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
TRPA1	8989	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	72948615	72948615	+	Silent	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:72948615G>T	ENST00000262209.4	-	21	2670	c.2463C>A	c.(2461-2463)ccC>ccA	p.P821P	RP11-383H13.1_ENST00000524152.1_Intron|TRPA1_ENST00000519720.1_5'UTR|RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000457356.4_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	821					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CAACAAACAAGGGCAGCACAA	0.343																																					p.P821P		.											.	TRPA1	230	0			c.C2463A						.						65.0	65.0	65.0					8																	72948615		2203	4300	6503	SO:0001819	synonymous_variant	8989	exon21			AAACAAGGGCAGC	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2463C>A	8.37:g.72948615G>T		Somatic	294.0	2.0		WXS	Illumina HiSeq	Phase_I	316.0	49.0	NM_007332	A6NIN6	Silent	SNP	ENST00000262209.4	37	CCDS34908.1																																																																																			.		0.343	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
TTC30A	92104	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	178483360	178483360	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr2:178483360C>G	ENST00000355689.5	-	1	334	c.70G>C	c.(70-72)Gat>Cat	p.D24H	AC073834.3_ENST00000357045.4_RNA	NM_152275.3	NP_689488.3	Q86WT1	TT30A_HUMAN	tetratricopeptide repeat domain 30A	24					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)	cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				autonomic_ganglia(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(117;0.000423)|Epithelial(96;0.00373)|all cancers(119;0.0169)			TAGCGGGCATCGCGGATGAGC	0.672																																					p.D24H		.											.	TTC30A	90	0			c.G70C						.						11.0	13.0	12.0					2																	178483360		2132	4238	6370	SO:0001583	missense	92104	exon1			GGGCATCGCGGAT	AK024008	CCDS2276.1	2q31.2	2013-01-11			ENSG00000197557	ENSG00000197557		"""Tetratricopeptide (TTC) repeat domain containing"""	25853	protein-coding gene	gene with protein product						12477932	Standard	NM_152275		Approved	FLJ13946	uc002ulo.3	Q86WT1	OTTHUMG00000132528	ENST00000355689.5:c.70G>C	2.37:g.178483360C>G	ENSP00000347915:p.Asp24His	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	9.0	NM_152275	A8K8N0|Q8IVP2	Missense_Mutation	SNP	ENST00000355689.5	37	CCDS2276.1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619288	0.66787	.	.	ENSG00000197557	ENST00000355689	T	0.78595	-1.19	6.03	6.03	0.97812	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.170365	0.56097	D	0.000029	T	0.81536	0.4843	M	0.64404	1.975	0.31108	N	0.710314	D	0.56968	0.978	P	0.51866	0.682	D	0.83886	0.0282	10	0.87932	D	0	.	13.9212	0.63933	0.0:0.9284:0.0:0.0716	.	24	Q86WT1	TT30A_HUMAN	H	24	ENSP00000347915:D24H	ENSP00000347915:D24H	D	-	1	0	TTC30A	178191606	0.532000	0.26346	0.751000	0.31187	0.852000	0.48524	1.754000	0.38369	2.868000	0.98415	0.555000	0.69702	GAT	.		0.672	TTC30A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255728.2	NM_152275	
TTLL13	440307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90799374	90799374	+	Splice_Site	SNP	T	T	A			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr15:90799374T>A	ENST00000339615.5	+	6	840	c.550T>A	c.(550-552)Tat>Aat	p.Y184N	TTLL13_ENST00000438251.1_Splice_Site_p.Y184N|RP11-697E2.6_ENST00000561573.1_Intron	NM_001029964.2	NP_001025135.2			tubulin tyrosine ligase-like family, member 13											NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	16	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			TGCACATAGCTATGGGGACTT	0.547																																					p.Y184N		.											.	TTLL13	44	0			c.T550A						.						80.0	77.0	78.0					15																	90799374		2199	4298	6497	SO:0001630	splice_region_variant	440307	exon6			CATAGCTATGGGG	BC036668		15q26.1	2013-02-14				ENSG00000213471		"""Tubulin tyrosine ligase-like family"""	32484	protein-coding gene	gene with protein product						15890843	Standard	NR_104604		Approved	FLJ46079, MGC33417	uc002bpd.1	A6NNM8		ENST00000339615.5:c.549-1T>A	15.37:g.90799374T>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	29.0	NM_001029964		Missense_Mutation	SNP	ENST00000339615.5	37	CCDS32328.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.172795	0.57584	.	.	ENSG00000213471	ENST00000438251;ENST00000339615	T;T	0.06142	3.34;3.34	5.18	5.18	0.71444	.	0.369213	0.26586	N	0.023546	T	0.22975	0.0555	M	0.83603	2.65	0.80722	D	1	P	0.45594	0.862	P	0.55455	0.776	T	0.00478	-1.1715	10	0.56958	D	0.05	.	14.3636	0.66789	0.0:0.0:0.0:1.0	.	184	A6NNM8-2	.	N	184	ENSP00000413362:Y184N;ENSP00000345294:Y184N	ENSP00000345294:Y184N	Y	+	1	0	TTLL13	88600378	1.000000	0.71417	0.963000	0.40424	0.267000	0.26476	5.619000	0.67729	2.184000	0.69523	0.459000	0.35465	TAT	.		0.547	TTLL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435854.1	NM_001029964	Missense_Mutation
TTPA	7274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	63973866	63973866	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr8:63973866T>C	ENST00000260116.4	-	5	813	c.782A>G	c.(781-783)aAt>aGt	p.N261S	TTPA_ENST00000521138.1_Intron	NM_000370.3	NP_000361.1	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	261					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)	15	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	CATTATAAAATTTGTCCATTC	0.373																																					p.N261S		.											.	TTPA	90	0			c.A782G						.						79.0	79.0	79.0					8																	63973866		2203	4300	6503	SO:0001583	missense	7274	exon5			ATAAAATTTGTCC	BC058000	CCDS6178.1	8q12.3	2007-07-18	2007-07-16			ENSG00000137561			12404	protein-coding gene	gene with protein product		600415	"""ataxia (Friedreich-like) with vitamin E deficiency"""	AVED		7719340, 7887897	Standard	NM_000370		Approved		uc003xux.2	P49638		ENST00000260116.4:c.782A>G	8.37:g.63973866T>C	ENSP00000260116:p.Asn261Ser	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	357.0	69.0	NM_000370	Q71V64	Missense_Mutation	SNP	ENST00000260116.4	37	CCDS6178.1	.	.	.	.	.	.	.	.	.	.	T	9.479	1.097706	0.20552	.	.	ENSG00000137561	ENST00000260116	D	0.84070	-1.8	5.86	5.86	0.93980	Cellular retinaldehyde-binding/triple function, C-terminal (2);	0.361985	0.34223	N	0.004144	T	0.70945	0.3282	N	0.25647	0.755	0.30101	N	0.807391	B	0.10296	0.003	B	0.04013	0.001	T	0.59789	-0.7388	10	0.10111	T	0.7	.	12.4132	0.55480	0.0:0.0:0.1399:0.8601	.	261	P49638	TTPA_HUMAN	S	261	ENSP00000260116:N261S	ENSP00000260116:N261S	N	-	2	0	TTPA	64136420	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.218000	0.58554	2.367000	0.80283	0.528000	0.53228	AAT	.		0.373	TTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378460.1	NM_000370	
TYW1	55253	broad.mit.edu;bcgsc.ca	37	7	66582604	66582604	+	Splice_Site	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:66582604A>G	ENST00000359626.5	+	13	1861	c.1697A>G	c.(1696-1698)aAg>aGg	p.K566R		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	566					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				TTGGCAGTCAAGGTAAGAATT	0.393																																					p.K566R		.											.	TYW1	91	0			c.A1697G						.						52.0	52.0	52.0					7																	66582604		2203	4300	6503	SO:0001630	splice_region_variant	55253	exon13			CAGTCAAGGTAAG	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.1698+1A>G	7.37:g.66582604A>G		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	6.0	NM_018264	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	37	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	A	17.65	3.442147	0.63067	.	.	ENSG00000198874	ENST00000359626	T	0.80653	-1.4	3.54	3.54	0.40534	Radical SAM (1);	0.195029	0.26126	U	0.026199	T	0.81669	0.4871	M	0.63208	1.945	0.58432	D	0.999999	P	0.38048	0.616	P	0.47430	0.547	T	0.80079	-0.1532	10	0.40728	T	0.16	.	10.3283	0.43807	1.0:0.0:0.0:0.0	.	566	Q9NV66	TYW1_HUMAN	R	566	ENSP00000352645:K566R	ENSP00000352645:K566R	K	+	2	0	TYW1	66220039	1.000000	0.71417	0.999000	0.59377	0.952000	0.60782	8.509000	0.90529	1.365000	0.46057	0.332000	0.21555	AAG	.		0.393	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	Missense_Mutation
UGT2A1	10941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	70455333	70455333	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr4:70455333G>T	ENST00000503640.1	-	6	1396	c.1341C>A	c.(1339-1341)caC>caA	p.H447Q	UGT2A1_ENST00000512704.1_Missense_Mutation_p.H403Q|UGT2A1_ENST00000502343.1_5'UTR|UGT2A2_ENST00000457664.2_Missense_Mutation_p.H456Q|UGT2A1_ENST00000514019.1_Missense_Mutation_p.H613Q|UGT2A1_ENST00000286604.4_Missense_Mutation_p.H447Q	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus	447					cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						GTTGATCATGGTGAATTCTTG	0.398																																					p.H613Q		.											.	UGT2A1	92	0			c.C1839A						.						99.0	104.0	103.0					4																	70455333		2203	4300	6503	SO:0001583	missense	10941	exon7			ATCATGGTGAATT	AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.1341C>A	4.37:g.70455333G>T	ENSP00000424478:p.His447Gln	Somatic	328.0	1.0		WXS	Illumina HiSeq	Phase_I	289.0	139.0	NM_001252274	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Missense_Mutation	SNP	ENST00000503640.1	37	CCDS3529.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009498	0.54361	.	.	ENSG00000173610	ENST00000457664;ENST00000503640;ENST00000512704;ENST00000514019;ENST00000286604	T;T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57;-0.57	4.65	-2.05	0.07321	.	0.050572	0.85682	N	0.000000	T	0.75953	0.3920	M	0.69358	2.11	.	.	.	P;D;D;D;B	0.89917	0.476;0.988;1.0;0.999;0.134	B;P;D;D;B	0.87578	0.159;0.863;0.998;0.994;0.112	T	0.74645	-0.3596	9	0.49607	T	0.09	.	5.8441	0.18652	0.5368:0.0:0.3295:0.1337	.	613;613;403;456;447	E9PDM7;B4E2F4;D6RFW5;Q9Y4X1-2;Q9Y4X1	.;.;.;.;UD2A1_HUMAN	Q	456;447;403;613;447	ENSP00000387888:H456Q;ENSP00000424478:H447Q;ENSP00000421432:H403Q;ENSP00000425497:H613Q;ENSP00000286604:H447Q	ENSP00000286604:H447Q	H	-	3	2	UGT2A1	70489922	0.999000	0.42202	0.946000	0.38457	0.956000	0.61745	0.520000	0.22878	-0.616000	0.05671	0.579000	0.79373	CAC	.		0.398	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251554.3	NM_006798	
UTRN	7402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	144758707	144758707	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr6:144758707A>G	ENST00000367545.3	+	10	1066	c.1066A>G	c.(1066-1068)Atg>Gtg	p.M356V		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	356	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CTAGGCTTTTATGATGGAACT	0.423																																					p.M356V		.											.	UTRN	95	0			c.A1066G						.						60.0	59.0	60.0					6																	144758707		2203	4300	6503	SO:0001583	missense	7402	exon10			GCTTTTATGATGG	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.1066A>G	6.37:g.144758707A>G	ENSP00000356515:p.Met356Val	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	22.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.188889	0.78789	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	T	0.48522	0.81	5.45	5.45	0.79879	.	0.000000	0.64402	D	0.000010	T	0.64438	0.2598	M	0.80508	2.5	0.80722	D	1	D	0.65815	0.995	D	0.77004	0.989	T	0.70846	-0.4761	10	0.72032	D	0.01	.	15.5234	0.75881	1.0:0.0:0.0:0.0	.	356	P46939	UTRO_HUMAN	V	356	ENSP00000356515:M356V	ENSP00000356499:M356V	M	+	1	0	UTRN	144800400	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.339000	0.96797	2.072000	0.62099	0.533000	0.62120	ATG	.		0.423	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
VAMP1	6843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	6575091	6575091	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr12:6575091C>G	ENST00000396308.3	-	3	350	c.205G>C	c.(205-207)Gct>Cct	p.A69P	VAMP1_ENST00000361716.3_Missense_Mutation_p.A69P|VAMP1_ENST00000400911.3_Missense_Mutation_p.A69P|VAMP1_ENST00000535180.1_Missense_Mutation_p.A69P|TAPBPL_ENST00000545700.1_3'UTR|VAMP1_ENST00000544432.1_5'UTR	NM_014231.3|NM_199245.1	NP_055046.1|NP_954740.1	P23763	VAMP1_HUMAN	vesicle-associated membrane protein 1 (synaptobrevin 1)	69	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				neurotransmitter secretion (GO:0007269)|SNARE complex assembly (GO:0035493)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuron projection (GO:0043005)|synapse (GO:0045202)				endometrium(1)|large_intestine(1)|prostate(1)	3					Botulinum Toxin Type B(DB00042)	AAGGCATCAGCTCGGTCATCC	0.512											OREG0021627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A69P		.											.	VAMP1	90	0			c.G205C						.						132.0	108.0	116.0					12																	6575091		2203	4300	6503	SO:0001583	missense	6843	exon3			CATCAGCTCGGTC		CCDS31731.1, CCDS41740.1, CCDS44809.1, CCDS73422.1	12p	2013-02-13			ENSG00000139190	ENSG00000139190		"""Vesicle-associated membrane proteins"""	12642	protein-coding gene	gene with protein product		185880		SYB1		1976629	Standard	XM_006719011		Approved	VAMP-1	uc001qok.3	P23763	OTTHUMG00000168269	ENST00000396308.3:c.205G>C	12.37:g.6575091C>G	ENSP00000379602:p.Ala69Pro	Somatic	124.0	0.0	635	WXS	Illumina HiSeq	Phase_I	240.0	90.0	NM_014231	A8MVP3|D3DUR3|O75468|Q15857|Q6FG94|Q8IVC9	Missense_Mutation	SNP	ENST00000396308.3	37	CCDS41740.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609022	0.87258	.	.	ENSG00000139190	ENST00000400911;ENST00000361716;ENST00000535180;ENST00000355479;ENST00000396308;ENST00000396943;ENST00000539047	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.77	5.77	0.91146	Synaptobrevin (4);	0.000000	0.85682	D	0.000000	T	0.73513	0.3596	H	0.94771	3.58	0.80722	D	1	B;B;B	0.31100	0.2;0.238;0.308	B;B;P	0.44946	0.317;0.445;0.465	T	0.77175	-0.2684	10	0.87932	D	0	.	19.9983	0.97395	0.0:1.0:0.0:0.0	.	69;69;69	P23763-3;P23763;P23763-2	.;VAMP1_HUMAN;.	P	69	ENSP00000383702:A69P;ENSP00000355122:A69P;ENSP00000444181:A69P;ENSP00000379602:A69P	ENSP00000347664:A69P	A	-	1	0	VAMP1	6445352	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.747000	0.85070	2.724000	0.93272	0.561000	0.74099	GCT	.		0.512	VAMP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399078.1		
VWDE	221806	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	12384011	12384011	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr7:12384011T>G	ENST00000275358.3	-	20	4159	c.3971A>C	c.(3970-3972)aAc>aCc	p.N1324T		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1324	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						AGTTTGGCAGTTAGAACCAAT	0.328																																					p.N1324T		.											.	VWDE	68	0			c.A3971C						.						95.0	81.0	85.0					7																	12384011		692	1591	2283	SO:0001583	missense	221806	exon20			TGGCAGTTAGAAC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3971A>C	7.37:g.12384011T>G	ENSP00000275358:p.Asn1324Thr	Somatic	297.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	33.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	T	15.16	2.750909	0.49257	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	T	0.66638	-0.22	3.52	3.52	0.40303	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.405411	0.26467	N	0.024202	T	0.53965	0.1829	L	0.45285	1.41	0.22639	N	0.99891	P	0.48589	0.912	B	0.40741	0.339	T	0.49254	-0.8959	10	0.33940	T	0.23	.	8.7135	0.34397	0.0:0.0939:0.0:0.9061	.	1324	Q8N2E2	VWDE_HUMAN	T	1324;778	ENSP00000275358:N1324T	ENSP00000275358:N1324T	N	-	2	0	VWDE	12350536	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.075000	0.30716	1.844000	0.53588	0.477000	0.44152	AAC	.		0.328	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
ZFYVE9	9372	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	52705203	52705203	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr1:52705203G>T	ENST00000371591.1	+	3	2245	c.2114G>T	c.(2113-2115)tGc>tTc	p.C705F	ZFYVE9_ENST00000357206.2_Missense_Mutation_p.C705F|ZFYVE9_ENST00000287727.3_Missense_Mutation_p.C705F	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	705					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						GCTCCAAATTGCATGAAATGT	0.488																																					p.C705F		.											.	ZFYVE9	230	0			c.G2114T						.						63.0	61.0	62.0					1																	52705203		2203	4300	6503	SO:0001583	missense	9372	exon4			CAAATTGCATGAA	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.2114G>T	1.37:g.52705203G>T	ENSP00000360647:p.Cys705Phe	Somatic	135.0	2.0		WXS	Illumina HiSeq	Phase_I	87.0	15.0	NM_007323	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	37	CCDS563.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229131	0.58777	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	D;D;D;D	0.97831	-4.56;-4.56;-4.56;-4.56	4.7	4.7	0.59300	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.99423	0.9796	H	0.99650	4.68	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.97882	1.0292	10	0.87932	D	0	.	18.2001	0.89836	0.0:0.0:1.0:0.0	.	705;705;705	O95405-2;O95405;O95405-3	.;ZFYV9_HUMAN;.	F	705	ENSP00000349737:C705F;ENSP00000355358:C705F;ENSP00000287727:C705F;ENSP00000360647:C705F	ENSP00000287727:C705F	C	+	2	0	ZFYVE9	52477791	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.259000	0.95561	2.597000	0.87782	0.462000	0.41574	TGC	.		0.488	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
ZNF276	92822	broad.mit.edu;bcgsc.ca	37	16	89804389	89804389	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr16:89804389A>G	ENST00000443381.2	+	11	1677	c.1580A>G	c.(1579-1581)gAg>gGg	p.E527G	ZNF276_ENST00000446326.2_Missense_Mutation_p.E313G|ZNF276_ENST00000289816.5_Missense_Mutation_p.E452G|FANCA_ENST00000389301.3_3'UTR|ZNF276_ENST00000568064.1_3'UTR	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CCCAGGTGTGAGGTCTGTGGG	0.592																																					p.E527G		.											.	ZNF276	90	0			c.A1580G						.						71.0	65.0	67.0					16																	89804389		2198	4300	6498	SO:0001583	missense	92822	exon11			GGTGTGAGGTCTG	AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.1580A>G	16.37:g.89804389A>G	ENSP00000415836:p.Glu527Gly	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	6.0	NM_001113525	Q0VGA1|Q2TBE8|Q3B7H7	Missense_Mutation	SNP	ENST00000443381.2	37	CCDS45554.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.838564	0.91117	.	.	ENSG00000158805	ENST00000446326;ENST00000289816;ENST00000443381	T;T;T	0.76839	-1.05;-1.05;0.17	5.74	5.74	0.90152	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.84124	0.5403	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.979;0.998;0.979	D	0.85616	0.1261	10	0.72032	D	0.01	-28.8588	15.2199	0.73303	1.0:0.0:0.0:0.0	.	365;527;313	B4DIT3;Q8N554;A8K186	.;ZN276_HUMAN;.	G	313;452;527	ENSP00000415999:E313G;ENSP00000289816:E452G;ENSP00000415836:E527G	ENSP00000289816:E452G	E	+	2	0	ZNF276	88331890	1.000000	0.71417	0.984000	0.44739	0.960000	0.62799	9.098000	0.94202	2.188000	0.69820	0.454000	0.30748	GAG	.		0.592	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422517.1	NM_152287	
ZNF99	7652	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	22942280	22942281	+	Frame_Shift_Ins	INS	-	-	T	rs564678369	byFrequency	TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:22942280_22942281insT	ENST00000596209.1	-	4	520_521	c.430_431insA	c.(430-432)atafs	p.I144fs	ZNF99_ENST00000397104.3_Frame_Shift_Ins_p.I165fs	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	144					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I165V(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ACACTGAAATATTTTTCCCTGG	0.282																																					p.I144fs		.											.	ZNF99	24	1	Substitution - Missense(1)	ovary(1)	c.431_432insA						.																																			SO:0001589	frameshift_variant	7652	exon4			TGAAATATTTTTC	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.431dupA	19.37:g.22942285_22942285dupT	ENSP00000472969:p.Ile144fs	Somatic	320.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	51.0	NM_001080409	M0R335	Frame_Shift_Ins	INS	ENST00000596209.1	37	CCDS59369.1																																																																																			.		0.282	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
ZNF681	148213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23927076	23927076	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:23927076T>C	ENST00000402377.3	-	4	1417	c.1276A>G	c.(1276-1278)Aaa>Gaa	p.K426E	ZNF681_ENST00000395385.3_Missense_Mutation_p.K357E	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTGCCACATTTTTCACACTGG	0.378																																					p.K426E		.											.	.	.	0			c.A1276G						.						74.0	78.0	77.0					19																	23927076		2203	4300	6503	SO:0001583	missense	148213	exon4			CACATTTTTCACA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1276A>G	19.37:g.23927076T>C	ENSP00000384000:p.Lys426Glu	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	47.0	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.293486	0.00019	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.07444	3.19;3.19	1.51	-3.01	0.05463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01730	0.0055	N	0.00894	-1.105	0.09310	N	1	B	0.14805	0.011	B	0.08055	0.003	T	0.45731	-0.9241	9	0.02654	T	1	.	4.3373	0.11092	0.0:0.5774:0.2273:0.1952	.	426	Q96N22	ZN681_HUMAN	E	426;357	ENSP00000384000:K426E;ENSP00000378783:K357E	ENSP00000378783:K357E	K	-	1	0	ZNF681	23718916	0.000000	0.05858	0.262000	0.24481	0.016000	0.09150	-1.519000	0.02243	-0.127000	0.11661	-0.736000	0.03550	AAA	.		0.378	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
ZNF677	342926	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53747099	53747099	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr19:53747099C>G	ENST00000598513.1	-	4	217	c.67G>C	c.(67-69)Gag>Cag	p.E23Q	ZNF677_ENST00000599012.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000601828.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000594681.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000598806.1_Missense_Mutation_p.E23Q|CTD-2245F17.6_ENST00000596041.1_RNA|ZNF677_ENST00000601413.1_Missense_Mutation_p.E23Q|ZNF677_ENST00000333952.4_Missense_Mutation_p.E23Q	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	23	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		TCCAGGCACTCCCACTCCTCT	0.468																																					p.E23Q		.											.	ZNF677	91	0			c.G67C						.						101.0	94.0	97.0					19																	53747099		2203	4300	6503	SO:0001583	missense	342926	exon4			GGCACTCCCACTC	BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.67G>C	19.37:g.53747099C>G	ENSP00000469391:p.Glu23Gln	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	45.0	NM_182609		Missense_Mutation	SNP	ENST00000598513.1	37	CCDS12861.1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941521	0.53079	.	.	ENSG00000197928	ENST00000416063;ENST00000333952	T	0.01918	4.56	2.02	2.02	0.26589	Krueppel-associated box (4);	0.225060	0.22744	N	0.056176	T	0.07052	0.0179	L	0.53780	1.695	0.25115	N	0.990686	D	0.76494	0.999	D	0.87578	0.998	T	0.26710	-1.0095	10	0.21014	T	0.42	.	10.0974	0.42484	0.0:1.0:0.0:0.0	.	23	Q86XU0	ZN677_HUMAN	Q	23	ENSP00000334394:E23Q	ENSP00000334394:E23Q	E	-	1	0	ZNF677	58438911	0.169000	0.23002	0.941000	0.38009	0.871000	0.50021	0.249000	0.18216	1.449000	0.47699	0.561000	0.74099	GAG	.		0.468	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464189.1	NM_182609	
CNTN6	27255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	1371531	1371532	+	Missense_Mutation	DNP	GA	GA	AT			TCGA-CC-5258-01A-01D-A12Z-10	TCGA-CC-5258-10A-01D-A12Z-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53feb92e-977d-4591-aaa1-7172f3e42965	04203961-a51c-4ee4-af73-8007d37a0113	g.chr3:1371531_1371532GA>AT	ENST00000446702.2	+	11	1903_1904	c.1276_1277GA>AT	c.(1276-1278)GAt>ATt	p.D426I	CNTN6_ENST00000539053.1_Missense_Mutation_p.D354I|CNTN6_ENST00000350110.2_Missense_Mutation_p.D426I			Q9UQ52	CNTN6_HUMAN	contactin 6	426	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.D426N(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AGTTGGTGGGGATATTGTTATC	0.371																																					p.D426I		.											.	.	.	1	Substitution - Missense(1)	large_intestine(1)	.						.																																			SO:0001583	missense	27255	.			GGTGGGGATATTG	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	Exception_encountered	3.37:g.1371531_1371532delinsAT	ENSP00000407822:p.Asp426Ile	Somatic	518.0	1.0		WXS	Illumina HiSeq	Phase_I	177.0	63.0	.	Q2KHM2	Missense_Mutation	DNP	ENST00000446702.2	37	CCDS2557.1																																																																																			.		0.371	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
