#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACADVL	37	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7126517	7126517	+	Silent	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr17:7126517G>A	ENST00000356839.5	+	11	1322	c.1143G>A	c.(1141-1143)gaG>gaA	p.E381E	ACADVL_ENST00000543245.2_Silent_p.E404E|MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000350303.5_Silent_p.E359E	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	381	Catalytic.		Missing (in ACADVLD).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TGATCCAGGAGAAGCTGGCAC	0.557																																					p.E404E		.											.	ACADVL	93	0			c.G1212A						.						146.0	146.0	146.0					17																	7126517		2203	4300	6503	SO:0001819	synonymous_variant	37	exon12			CCAGGAGAAGCTG	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.1143G>A	17.37:g.7126517G>A		Somatic	105.0	1.0		WXS	Illumina HiSeq	Phase_I	90.0	66.0	NM_001270447	B4DEB6|F5H2A9|O76056|Q8WUL0	Silent	SNP	ENST00000356839.5	37	CCDS11090.1																																																																																			.		0.557	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018	
ADAM17	6868	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	9676045	9676045	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:9676045G>T	ENST00000310823.3	-	4	550	c.368C>A	c.(367-369)cCt>cAt	p.P123H	ADAM17_ENST00000497134.1_Missense_Mutation_p.P123H	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	123					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		CCTAGAGTCAGGCTCACCTTA	0.308																																					p.P123H		.											.	ADAM17	659	0			c.C368A						.						46.0	46.0	46.0					2																	9676045		2202	4298	6500	SO:0001583	missense	6868	exon4			GAGTCAGGCTCAC	U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.368C>A	2.37:g.9676045G>T	ENSP00000309968:p.Pro123His	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	8.0	NM_003183	O60226	Missense_Mutation	SNP	ENST00000310823.3	37	CCDS1665.1	.	.	.	.	.	.	.	.	.	.	G	8.093	0.775049	0.16051	.	.	ENSG00000151694	ENST00000310823;ENST00000497134;ENST00000538558	T;T	0.09630	2.96;2.96	5.33	4.33	0.51752	Peptidase M12B, propeptide (1);	0.224065	0.45867	D	0.000325	T	0.06234	0.0161	N	0.11201	0.11	0.28723	N	0.902895	B;B;B;B	0.22480	0.07;0.006;0.07;0.006	B;B;B;B	0.23419	0.046;0.013;0.046;0.013	T	0.17745	-1.0359	10	0.35671	T	0.21	.	10.7755	0.46348	0.0:0.0:0.6408:0.3592	.	123;123;123;123	A8K1B4;B2RNB2;Q6P5T8;P78536	.;.;.;ADA17_HUMAN	H	123	ENSP00000309968:P123H;ENSP00000418728:P123H	ENSP00000309968:P123H	P	-	2	0	ADAM17	9593496	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	4.259000	0.58828	2.642000	0.89623	0.557000	0.71058	CCT	.		0.308	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206857.1		
AGPAT1	10554	broad.mit.edu;bcgsc.ca	37	6	32138749	32138749	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr6:32138749A>G	ENST00000395499.1	-	3	878	c.299T>C	c.(298-300)gTt>gCt	p.V100A	AGPAT1_ENST00000336984.6_Missense_Mutation_p.V100A|AGPAT1_ENST00000490711.1_Intron|AGPAT1_ENST00000412465.2_Intron|AGPAT1_ENST00000395497.1_Missense_Mutation_p.V100A|AGPAT1_ENST00000375104.2_Missense_Mutation_p.V100A|AGPAT1_ENST00000395496.1_Missense_Mutation_p.V100A|PPT2-EGFL8_ENST00000422437.1_3'UTR|AGPAT1_ENST00000375107.3_Missense_Mutation_p.V100A			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	100					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						GTTGGAGACAACAACATAGGG	0.582																																					p.V100A		.											.	AGPAT1	90	0			c.T299C						.						103.0	105.0	105.0					6																	32138749		1507	2709	4216	SO:0001583	missense	10554	exon3			GAGACAACAACAT	U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.299T>C	6.37:g.32138749A>G	ENSP00000378877:p.Val100Ala	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_006411	A2BFI5|Q5BL03	Missense_Mutation	SNP	ENST00000395499.1	37	CCDS4744.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.798988	0.90538	.	.	ENSG00000204310	ENST00000395496;ENST00000375107;ENST00000395499;ENST00000375104;ENST00000395497;ENST00000336984	D;D;D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41;-3.41;-3.41	5.26	5.26	0.73747	Phospholipid/glycerol acyltransferase (2);1-acyl-sn-glycerol-3-phosphate acyltransferase (1);	0.170125	0.51477	D	0.000089	D	0.93184	0.7829	L	0.56124	1.755	0.80722	D	1	P;P	0.51240	0.943;0.939	P;P	0.57548	0.823;0.688	D	0.94025	0.7296	10	0.66056	D	0.02	-13.5764	13.1201	0.59321	1.0:0.0:0.0:0.0	.	64;100	B4DRH1;Q99943	.;PLCA_HUMAN	A	100	ENSP00000378874:V100A;ENSP00000364248:V100A;ENSP00000378877:V100A;ENSP00000364245:V100A;ENSP00000378875:V100A;ENSP00000337463:V100A	ENSP00000337463:V100A	V	-	2	0	AGPAT1	32246727	0.903000	0.30736	0.760000	0.31359	0.996000	0.88848	8.194000	0.89721	2.002000	0.58637	0.459000	0.35465	GTT	.		0.582	AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411	
AP3D1	8943	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2120931	2120931	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:2120931T>G	ENST00000345016.5	-	14	1642	c.1411A>C	c.(1411-1413)Agc>Cgc	p.S471R	AP3D1_ENST00000355272.6_Missense_Mutation_p.S471R|AP3D1_ENST00000350812.6_Missense_Mutation_p.S302R|AP3D1_ENST00000356926.4_Missense_Mutation_p.S380R|AP3D1_ENST00000590683.1_5'Flank	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	471					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGTGCTGCTGGCCAGCAGG	0.657																																					p.S471R		.											.	AP3D1	90	0			c.A1411C						.						43.0	48.0	47.0					19																	2120931		2180	4276	6456	SO:0001583	missense	8943	exon14			TGCTGCTGGCCAG	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1411A>C	19.37:g.2120931T>G	ENSP00000344055:p.Ser471Arg	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	24.0	NM_001261826	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Missense_Mutation	SNP	ENST00000345016.5	37	CCDS42459.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.968519	0.74131	.	.	ENSG00000065000	ENST00000356926;ENST00000345016;ENST00000355272;ENST00000343722;ENST00000350812	T;T;T;T	0.63255	2.16;-0.03;1.56;-0.03	4.67	4.67	0.58626	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.045388	0.85682	D	0.000000	T	0.72676	0.3490	M	0.68952	2.095	0.58432	D	0.999997	D;P;D	0.69078	0.958;0.629;0.997	P;B;D	0.64042	0.563;0.439;0.921	T	0.70135	-0.4955	10	0.21014	T	0.42	-28.7632	13.2693	0.60152	0.0:0.0:0.0:1.0	.	471;471;380	O14617-5;O14617;G5E988	.;AP3D1_HUMAN;.	R	380;471;471;471;302	ENSP00000349398:S380R;ENSP00000344055:S471R;ENSP00000347416:S471R;ENSP00000342321:S302R	ENSP00000341579:S471R	S	-	1	0	AP3D1	2071931	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	4.650000	0.61440	1.753000	0.51906	0.379000	0.24179	AGC	.		0.657	AP3D1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450912.1		
ARAP3	64411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	141036086	141036086	+	Silent	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr5:141036086C>A	ENST00000239440.4	-	27	3839	c.3774G>T	c.(3772-3774)ctG>ctT	p.L1258L	ARAP3_ENST00000513878.1_Silent_p.L920L|ARAP3_ENST00000508305.1_Silent_p.L1089L|ARAP3_ENST00000512390.1_5'UTR	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1258	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TCTCCTTGAGCAGCAGCAGGC	0.647																																					p.L1258L		.											.	ARAP3	291	0			c.G3774T						.						19.0	21.0	20.0					5																	141036086		2203	4300	6503	SO:0001819	synonymous_variant	64411	exon27			CTTGAGCAGCAGC	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3774G>T	5.37:g.141036086C>A		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	35.0	NM_022481	B4DIT1|D3DQE3	Silent	SNP	ENST00000239440.4	37	CCDS4266.1																																																																																			.		0.647	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
ARID1A	8289	hgsc.bcm.edu;broad.mit.edu	37	1	27107084	27107085	+	Frame_Shift_Ins	INS	-	-	GC	rs142878055		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:27107084_27107085insGC	ENST00000324856.7	+	20	7066_7067	c.6695_6696insGC	c.(6694-6699)cggcggfs	p.RR2232fs	ARID1A_ENST00000540690.1_Frame_Shift_Ins_p.RR560fs|ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.RR2015fs|ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.RR1849fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2232					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.M2231fs*32(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GACATGATGCGGCGGGCTGCCC	0.594			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.R2232fs		.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	584	1	Deletion - Frameshift(1)	liver(1)	c.6695_6696insGC						.																																			SO:0001589	frameshift_variant	8289	exon20			TGATGCGGCGGGC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6696_6697dupGC	1.37:g.27107085_27107086dupGC	ENSP00000320485:p.Arg2232fs	Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	13.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	ENST00000324856.7	37	CCDS285.1																																																																																			.		0.594	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
ASNS	440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	97498423	97498423	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr7:97498423C>G	ENST00000394309.3	-	3	517	c.46G>C	c.(46-48)Gtt>Ctt	p.V16L	ASNS_ENST00000175506.4_Missense_Mutation_p.V16L|ASNS_ENST00000455086.1_Intron|ASNS_ENST00000444334.1_Intron|ASNS_ENST00000394308.3_Missense_Mutation_p.V16L|ASNS_ENST00000437628.1_Intron|ASNS_ENST00000422745.1_Intron	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	16	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	AGACACTGAACAGAAAGGCAA	0.433																																					p.V16L	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	.											.	ASNS	91	0			c.G46C						.						75.0	65.0	68.0					7																	97498423		2203	4300	6503	SO:0001583	missense	440	exon3			ACTGAACAGAAAG	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.46G>C	7.37:g.97498423C>G	ENSP00000377846:p.Val16Leu	Somatic	221.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	55.0	NM_133436	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	37	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	C	10.23	1.291929	0.23564	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000394308;ENST00000442734;ENST00000437657;ENST00000448127;ENST00000451771;ENST00000414884	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	4.29	4.29	0.51040	Glutamine amidotransferase, type II (1);	0.222920	0.36778	N	0.002411	T	0.29093	0.0723	L	0.29908	0.895	0.53688	D	0.999972	B	0.25235	0.121	B	0.20767	0.031	T	0.07385	-1.0775	10	0.11182	T	0.66	-10.6197	14.6248	0.68614	0.0:1.0:0.0:0.0	.	16	P08243	ASNS_HUMAN	L	16	ENSP00000175506:V16L;ENSP00000377846:V16L;ENSP00000377845:V16L;ENSP00000400422:V16L	ENSP00000175506:V16L	V	-	1	0	ASNS	97336359	1.000000	0.71417	0.996000	0.52242	0.961000	0.63080	4.424000	0.59868	2.120000	0.65058	0.555000	0.69702	GTT	.		0.433	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
B3GAT2	135152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	71603895	71603895	+	Silent	SNP	G	G	A	rs371527631		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr6:71603895G>A	ENST00000230053.6	-	2	1280	c.672C>T	c.(670-672)aaC>aaT	p.N224N		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	224					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						CAACTTTGCCGTTTTCCACCA	0.572																																					p.N224N		.											.	B3GAT2	93	0			c.C672T						.						107.0	86.0	93.0					6																	71603895		2203	4300	6503	SO:0001819	synonymous_variant	135152	exon2			TTTGCCGTTTTCC	AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.672C>T	6.37:g.71603895G>A		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	18.0	NM_080742	Q5JS09|Q8TF38|Q96NK4	Silent	SNP	ENST00000230053.6	37	CCDS4974.1																																																																																			.		0.572	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742	
BBOX1	8424	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	27137031	27137031	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr11:27137031C>A	ENST00000529202.1	+	5	905	c.566C>A	c.(565-567)gCa>gAa	p.A189E	BBOX1_ENST00000528583.1_Missense_Mutation_p.A189E|RP11-1L12.3_ENST00000530430.1_RNA|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.A189E|BBOX1_ENST00000527505.1_3'UTR|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000263182.3_Missense_Mutation_p.A189E			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	189					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	AAAATCGATGCAAACAATGTG	0.413																																					p.A189E		.											.	BBOX1	515	0			c.C566A						.						142.0	122.0	129.0					11																	27137031		2202	4298	6500	SO:0001583	missense	8424	exon6			TCGATGCAAACAA	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.566C>A	11.37:g.27137031C>A	ENSP00000435781:p.Ala189Glu	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	24.0	NM_003986	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	ENST00000529202.1	37	CCDS7862.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573696	0.86542	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.90631	0.7062	M	0.82716	2.605	0.80722	D	1	D	0.76494	0.999	D	0.65323	0.934	D	0.89287	0.3616	10	0.28530	T	0.3	.	17.4422	0.87568	0.0:1.0:0.0:0.0	.	189	O75936	BODG_HUMAN	E	189	ENSP00000435781:A189E;ENSP00000263182:A189E;ENSP00000434918:A189E;ENSP00000433772:A189E	ENSP00000263182:A189E	A	+	2	0	BBOX1	27093607	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.173000	0.77612	2.457000	0.83068	0.655000	0.94253	GCA	.		0.413	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986	
BRPF1	7862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	9776191	9776191	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr3:9776191G>A	ENST00000457855.1	+	1	378	c.367G>A	c.(367-369)Gag>Aag	p.E123K	BRPF1_ENST00000302054.3_Missense_Mutation_p.E123K|BRPF1_ENST00000383829.2_Missense_Mutation_p.E123K|BRPF1_ENST00000433861.2_Missense_Mutation_p.E123K|BRPF1_ENST00000424362.1_Missense_Mutation_p.E123K			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	123	Interaction with KAT6A and KAT6B.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					GTCAGAGGATGAGGAAGCCCC	0.562																																					p.E123K		.											.	BRPF1	92	0			c.G367A						.						82.0	85.0	84.0					3																	9776191		2203	4300	6503	SO:0001583	missense	7862	exon2			GAGGATGAGGAAG	M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.367G>A	3.37:g.9776191G>A	ENSP00000410210:p.Glu123Lys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	72.0	NM_001003694	B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Missense_Mutation	SNP	ENST00000457855.1	37	CCDS2575.1	.	.	.	.	.	.	.	.	.	.	G	34	5.350093	0.95830	.	.	ENSG00000156983	ENST00000433861;ENST00000424362;ENST00000383829;ENST00000302054;ENST00000457855	T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8	5.73	5.73	0.89815	Enhancer of polycomb-like, N-terminal (1);	0.145914	0.64402	D	0.000007	T	0.61148	0.2324	L	0.48362	1.52	0.80722	D	1	P;B;B;P	0.48016	0.904;0.384;0.226;0.582	P;B;B;P	0.57548	0.823;0.419;0.343;0.7	T	0.60622	-0.7227	10	0.66056	D	0.02	.	19.4877	0.95037	0.0:0.0:1.0:0.0	.	123;123;123;123	P55201-4;P55201-3;P55201-2;P55201	.;.;.;BRPF1_HUMAN	K	123	ENSP00000402485:E123K;ENSP00000398863:E123K;ENSP00000373340:E123K;ENSP00000306297:E123K;ENSP00000410210:E123K	ENSP00000306297:E123K	E	+	1	0	BRPF1	9751191	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.476000	0.97823	2.709000	0.92574	0.563000	0.77884	GAG	.		0.562	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338485.1	NM_001003694	
STKLD1	169436	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	136269044	136269044	+	Splice_Site	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr9:136269044G>T	ENST00000371957.3	+	16	1711	c.1604G>T	c.(1603-1605)gGc>gTc	p.G535V	C9orf96_ENST00000371955.1_Splice_Site_p.G68V	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		535							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CTTTCTGCAGGCTGCATCAAG	0.667																																					p.G535V		.											.	C9orf96	334	0			c.G1604T						.						39.0	43.0	42.0					9																	136269044		2203	4300	6503	SO:0001630	splice_region_variant	169436	exon16			CTGCAGGCTGCAT																												ENST00000371957.3:c.1604-1G>T	9.37:g.136269044G>T		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_153710	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	37	CCDS35169.1	.	.	.	.	.	.	.	.	.	.	G	16.08	3.021670	0.54576	.	.	ENSG00000198870	ENST00000371957;ENST00000371955	T;T	0.51071	0.72;0.76	5.13	4.23	0.50019	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.63780	0.2540	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.63256	-0.6678	9	.	.	.	.	12.6603	0.56809	0.0803:0.0:0.9197:0.0	.	535	Q8NE28	SGK71_HUMAN	V	535;68	ENSP00000361025:G535V;ENSP00000361023:G68V	.	G	+	2	0	C9orf96	135258865	1.000000	0.71417	1.000000	0.80357	0.301000	0.27625	5.846000	0.69444	1.134000	0.42165	0.561000	0.74099	GGC	.		0.667	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1		Missense_Mutation
CCDC39	339829	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	180381668	180381668	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr3:180381668A>C	ENST00000442201.2	-	2	316	c.197T>G	c.(196-198)cTc>cGc	p.L66R	CCDC39_ENST00000273654.4_Missense_Mutation_p.L150R	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	66					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TGTAATTGAGAGCTCTTGCTT	0.343																																					p.L66R		.											.	CCDC39	72	0			c.T197G						.						138.0	129.0	131.0					3																	180381668		1842	4096	5938	SO:0001583	missense	339829	exon2			ATTGAGAGCTCTT	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.197T>G	3.37:g.180381668A>C	ENSP00000405708:p.Leu66Arg	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	13.0	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.100024	0.76983	.	.	ENSG00000145075	ENST00000273654;ENST00000442201;ENST00000471307	D	0.82167	-1.58	6.07	6.07	0.98685	.	0.303342	0.40064	N	0.001199	D	0.84492	0.5484	L	0.60455	1.87	0.34811	D	0.737735	P	0.40180	0.705	P	0.46172	0.506	D	0.89722	0.3920	10	0.59425	D	0.04	-3.9915	14.0082	0.64478	1.0:0.0:0.0:0.0	.	66	Q9UFE4	CCD39_HUMAN	R	150;66;48	ENSP00000418702:L48R	ENSP00000273654:L150R	L	-	2	0	CCDC39	181864362	0.976000	0.34144	0.122000	0.21767	0.954000	0.61252	6.156000	0.71840	2.330000	0.79161	0.477000	0.44152	CTC	.		0.343	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
CCDC8	83987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46914889	46914889	+	Silent	SNP	C	C	T	rs538950740		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:46914889C>T	ENST00000307522.3	-	1	1952	c.1179G>A	c.(1177-1179)gcG>gcA	p.A393A		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	393					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		CTGGGGCCTCCGCCCTCTGAT	0.582																																					p.A393A		.											.	CCDC8	93	0			c.G1179A						.						121.0	114.0	116.0					19																	46914889		2203	4300	6503	SO:0001819	synonymous_variant	83987	exon1			GGCCTCCGCCCTC	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1179G>A	19.37:g.46914889C>T		Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	325.0	141.0	NM_032040	Q8TB26	Silent	SNP	ENST00000307522.3	37	CCDS12685.1	.	.	.	.	.	.	.	.	.	.	C	4.719	0.133637	0.09032	.	.	ENSG00000169515	ENST00000540252	.	.	.	3.03	-0.331	0.12679	.	.	.	.	.	T	0.19485	0.0468	.	.	.	0.18873	N	0.999984	.	.	.	.	.	.	T	0.30736	-0.9968	5	0.16896	T	0.51	.	5.7112	0.17935	0.0:0.4164:0.0:0.5836	.	.	.	.	Q	240	.	ENSP00000441180:R240Q	R	-	2	0	CCDC8	51606729	0.000000	0.05858	0.009000	0.14445	0.012000	0.07955	-0.684000	0.05173	-0.134000	0.11516	-0.811000	0.03165	CGG	C|1.000;T|0.000		0.582	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
CCND2	894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	4383263	4383263	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr12:4383263C>A	ENST00000261254.3	+	1	326	c.57C>A	c.(55-57)aaC>aaA	p.N19K	RP11-264F23.4_ENST00000537370.1_RNA|RP11-264F23.3_ENST00000539135.1_RNA	NM_001759.3	NP_001750.1	P30279	CCND2_HUMAN	cyclin D2	19					cell cycle (GO:0007049)|cell division (GO:0051301)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of protein phosphorylation (GO:0001934)	chromatin (GO:0000785)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			GGGACCGCAACCTGCTCCGAG	0.677			T	IGL@	"""NHL,CLL"""																																p.N19K		.		Dom	yes		12	12p13	894	cyclin D2		L	.	CCND2	1271	0			c.C57A						.						51.0	43.0	45.0					12																	4383263		2203	4300	6503	SO:0001583	missense	894	exon1			CCGCAACCTGCTC	AF518005	CCDS8524.1	12p13	2008-08-04			ENSG00000118971	ENSG00000118971			1583	protein-coding gene	gene with protein product	"""G1/S-specific cyclin D2"""	123833				1386335	Standard	NM_001759		Approved		uc001qmo.3	P30279	OTTHUMG00000168123	ENST00000261254.3:c.57C>A	12.37:g.4383263C>A	ENSP00000261254:p.Asn19Lys	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	18.0	NM_001759	A8K531|Q13955|Q5U035	Missense_Mutation	SNP	ENST00000261254.3	37	CCDS8524.1	.	.	.	.	.	.	.	.	.	.	C	7.907	0.735734	0.15574	.	.	ENSG00000118971	ENST00000261254	T	0.07908	3.15	4.17	4.17	0.49024	Cyclin-like (1);	0.158028	0.56097	D	0.000038	T	0.10508	0.0257	M	0.81497	2.545	0.50813	D	0.999897	B	0.28713	0.22	B	0.21708	0.036	T	0.05194	-1.0900	10	0.07030	T	0.85	.	11.653	0.51301	0.0:0.8204:0.1796:0.0	.	19	P30279	CCND2_HUMAN	K	19	ENSP00000261254:N19K	ENSP00000261254:N19K	N	+	3	2	CCND2	4253524	1.000000	0.71417	1.000000	0.80357	0.603000	0.37013	1.240000	0.32731	2.127000	0.65507	0.491000	0.48974	AAC	.		0.677	CCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398287.1	NM_001759	
CDH26	60437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	58560154	58560154	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr20:58560154C>A	ENST00000244047.5	+	7	1118	c.807C>A	c.(805-807)aaC>aaA	p.N269K	CDH26_ENST00000348616.4_Missense_Mutation_p.N269K			Q8IXH8	CAD26_HUMAN	cadherin 26	269	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			AAGAAGGCAACAACCACAGGC	0.557																																					p.N269K		.											.	CDH26	93	0			c.C807A						.						60.0	53.0	55.0					20																	58560154		2203	4300	6503	SO:0001583	missense	60437	exon7			AGGCAACAACCAC	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.807C>A	20.37:g.58560154C>A	ENSP00000244047:p.Asn269Lys	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	20.0	NM_177980	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	ENST00000244047.5	37		.	.	.	.	.	.	.	.	.	.	C	11.55	1.672713	0.29693	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.75477	-0.94;-0.94	4.44	2.46	0.29980	.	0.103168	0.64402	D	0.000005	D	0.89269	0.6667	H	0.98005	4.125	0.23572	N	0.997382	D	0.89917	1.0	D	0.97110	1.0	T	0.80365	-0.1413	10	0.87932	D	0	.	7.0596	0.25119	0.0:0.7294:0.1739:0.0967	.	269	Q8IXH8-4	.	K	269	ENSP00000244047:N269K;ENSP00000339390:N269K	ENSP00000244047:N269K	N	+	3	2	CDH26	57993549	1.000000	0.71417	0.004000	0.12327	0.035000	0.12851	1.796000	0.38794	0.316000	0.23135	0.591000	0.81541	AAC	.		0.557	CDH26-201	KNOWN	basic	protein_coding	protein_coding		NM_177980	
CHAF1B	8208	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	37785409	37785409	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr21:37785409C>A	ENST00000314103.5	+	12	1440	c.1289C>A	c.(1288-1290)cCc>cAc	p.P430H		NM_005441.2	NP_005432.1	Q13112	CAF1B_HUMAN	chromatin assembly factor 1, subunit B (p60)	430					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(2)	20						CCCAGCAGCCCCGGCACGACT	0.632																																					p.P430H		.											.	CHAF1B	92	0			c.C1289A						.						36.0	38.0	38.0					21																	37785409		2203	4300	6503	SO:0001583	missense	8208	exon12			GCAGCCCCGGCAC	U20980	CCDS13644.1	21q22.2	2013-01-10			ENSG00000159259	ENSG00000159259		"""WD repeat domain containing"""	1911	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 7"", ""Chromatin assembly factor I, p60 subunit"", ""human chromatin assembly factor-I p60 subunit"""	601245				7600578, 8792829	Standard	NM_005441		Approved	CAF1P60, CAF-1, CAF1, CAF1A, MPP7, MPHOSPH7	uc002yvj.3	Q13112	OTTHUMG00000086606	ENST00000314103.5:c.1289C>A	21.37:g.37785409C>A	ENSP00000315700:p.Pro430His	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	20.0	NM_005441	Q99548	Missense_Mutation	SNP	ENST00000314103.5	37	CCDS13644.1	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789568	0.70337	.	.	ENSG00000159259	ENST00000314103	T	0.52295	0.67	5.19	5.19	0.71726	.	0.308479	0.35040	N	0.003500	T	0.46580	0.1400	L	0.29908	0.895	0.31766	N	0.632729	D	0.58620	0.983	P	0.51487	0.671	T	0.55392	-0.8148	10	0.46703	T	0.11	-22.6419	14.1135	0.65137	0.0:0.9251:0.0:0.0749	.	430	Q13112	CAF1B_HUMAN	H	430	ENSP00000315700:P430H	ENSP00000315700:P430H	P	+	2	0	CHAF1B	36707279	0.714000	0.27936	0.484000	0.27391	0.325000	0.28411	2.033000	0.41136	2.407000	0.81776	0.558000	0.71614	CCC	.		0.632	CHAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194616.2	NM_005441	
CHRNB4	1143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	78927919	78927919	+	Silent	SNP	G	G	C	rs552677379		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr15:78927919G>C	ENST00000261751.3	-	2	177	c.66C>G	c.(64-66)cgC>cgG	p.R22R	CHRNB4_ENST00000412074.2_Silent_p.R22R|CHRNB4_ENST00000560511.1_5'UTR	NM_000750.3	NP_000741.1	P30926	ACHB4_HUMAN	cholinergic receptor, nicotinic, beta 4 (neuronal)	22					action potential (GO:0001508)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|regulation of neurotransmitter secretion (GO:0046928)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			endometrium(7)|kidney(1)|lung(13)|prostate(1)	22					Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)	CATTGGCCACGCGGCAGTTCC	0.587																																					p.R22R		.											.	CHRNB4	90	0			c.C66G						.						247.0	234.0	239.0					15																	78927919		2196	4293	6489	SO:0001819	synonymous_variant	1143	exon2			GGCCACGCGGCAG	U48861	CCDS10306.1, CCDS58392.1	15q24	2012-02-11	2012-02-07		ENSG00000117971	ENSG00000117971		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1964	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 4 (neuronal)"""	118509	"""cholinergic receptor, nicotinic, beta polypeptide 4"""			2004777	Standard	NM_000750		Approved		uc002bed.1	P30926	OTTHUMG00000143860	ENST00000261751.3:c.66C>G	15.37:g.78927919G>C		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	108.0	NM_000750	A4FTX5|E9PHE8|Q16607|Q4VBA5|Q8WXC8|Q9BQR4	Silent	SNP	ENST00000261751.3	37	CCDS10306.1																																																																																			.		0.587	CHRNB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290108.1		
COL16A1	1307	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32121031	32121031	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:32121031C>T	ENST00000373672.3	-	67	4690	c.4174G>A	c.(4174-4176)Ggc>Agc	p.G1392S	RP11-73M7.6_ENST00000608246.1_RNA|RP11-73M7.6_ENST00000609338.1_RNA|COL16A1_ENST00000271069.6_Missense_Mutation_p.G1392S|RP11-73M7.6_ENST00000608332.1_RNA|COL16A1_ENST00000461217.1_5'UTR|RP11-73M7.6_ENST00000585660.1_RNA|RP11-73M7.6_ENST00000609373.1_RNA|RP11-73M7.6_ENST00000593188.1_RNA|RP11-73M7.6_ENST00000589462.1_RNA|RP11-73M7.6_ENST00000609625.1_RNA|RP11-73M7.6_ENST00000610216.1_RNA|RP11-73M7.6_ENST00000610043.1_RNA|RP11-73M7.6_ENST00000607926.1_RNA|RP11-73M7.6_ENST00000609549.1_RNA|RP11-73M7.6_ENST00000608888.1_RNA|RP11-73M7.6_ENST00000585413.1_RNA|RP11-73M7.6_ENST00000609033.1_RNA|RP11-73M7.6_ENST00000587445.1_RNA|RP11-73M7.6_ENST00000445166.1_RNA|RP11-73M7.6_ENST00000588288.1_RNA|RP11-73M7.6_ENST00000591592.1_RNA|RP11-73M7.6_ENST00000591929.1_RNA	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1392	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCACTCTTGCCAGGTCCACCA	0.642																																					p.G1392S	Colon(143;498 1786 21362 25193 36625)	.											.	COL16A1	98	0			c.G4174A						.						71.0	78.0	76.0					1																	32121031		1981	4146	6127	SO:0001583	missense	1307	exon67			TCTTGCCAGGTCC	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.4174G>A	1.37:g.32121031C>T	ENSP00000362776:p.Gly1392Ser	Somatic	177.0	1.0		WXS	Illumina HiSeq	Phase_I	204.0	84.0	NM_001856	Q16593|Q59F89|Q71RG9	Missense_Mutation	SNP	ENST00000373672.3	37	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.249465	0.80024	.	.	ENSG00000084636	ENST00000373672;ENST00000271069	D;D	0.99607	-6.27;-6.27	4.53	4.53	0.55603	.	0.224065	0.36034	N	0.002833	D	0.99785	0.9910	H	0.97440	4.005	0.49798	D	0.999827	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96834	0.9613	10	0.87932	D	0	.	16.5826	0.84718	0.0:1.0:0.0:0.0	.	1392;1390	Q07092;Q07092-2	COGA1_HUMAN;.	S	1392	ENSP00000362776:G1392S;ENSP00000271069:G1392S	ENSP00000271069:G1392S	G	-	1	0	COL16A1	31893618	0.984000	0.35163	0.942000	0.38095	0.963000	0.63663	5.015000	0.64035	2.548000	0.85928	0.561000	0.74099	GGC	.		0.642	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
CSMD3	114788	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113662399	113662399	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr8:113662399T>C	ENST00000297405.5	-	19	3428	c.3184A>G	c.(3184-3186)Acc>Gcc	p.T1062A	CSMD3_ENST00000455883.2_Missense_Mutation_p.T958A|CSMD3_ENST00000352409.3_Missense_Mutation_p.T1062A|CSMD3_ENST00000343508.3_Missense_Mutation_p.T1022A	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1062	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CCATCACAGGTTGGAAGTGGA	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.T1062A		.											.	CSMD3	1132	0			c.A3184G						.						99.0	97.0	97.0					8																	113662399		2203	4300	6503	SO:0001583	missense	114788	exon19			CACAGGTTGGAAG	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3184A>G	8.37:g.113662399T>C	ENSP00000297405:p.Thr1062Ala	Somatic	143.0	1.0		WXS	Illumina HiSeq	Phase_I	363.0	84.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	37	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.238031	0.39598	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.88	5.88	0.94601	Complement control module (2);Sushi/SCR/CCP (3);	0.068119	0.56097	D	0.000023	T	0.65481	0.2695	L	0.58810	1.83	0.29851	N	0.828449	P;P;B	0.39903	0.694;0.604;0.09	P;P;B	0.45712	0.452;0.491;0.096	T	0.63537	-0.6615	10	0.21540	T	0.41	.	16.2824	0.82697	0.0:0.0:0.0:1.0	.	958;1062;1022	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	A	1022;1062;402;958;1062	ENSP00000345799:T1022A;ENSP00000297405:T1062A;ENSP00000341558:T402A;ENSP00000412263:T958A;ENSP00000343124:T1062A	ENSP00000297405:T1062A	T	-	1	0	CSMD3	113731575	1.000000	0.71417	0.921000	0.36526	0.277000	0.26821	5.115000	0.64655	2.250000	0.74265	0.533000	0.62120	ACC	.		0.343	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CYLC1	1538	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	83128877	83128877	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chrX:83128877G>T	ENST00000329312.4	+	4	1198	c.1161G>T	c.(1159-1161)ttG>ttT	p.L387F		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	387					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						CAAGAAATTTGAAGAAAGCTT	0.353																																					p.L387F		.											.	CYLC1	112	0			c.G1161T						.						29.0	25.0	27.0					X																	83128877		2194	4287	6481	SO:0001583	missense	1538	exon4			AAATTTGAAGAAA	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1161G>T	X.37:g.83128877G>T	ENSP00000331556:p.Leu387Phe	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	102.0	NM_021118	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	g	0.989	-0.694703	0.03303	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.23348	1.91	3.43	-6.87	0.01671	.	.	.	.	.	T	0.09730	0.0239	N	0.08118	0	0.09310	N	1	B;B	0.18166	0.026;0.026	B;B	0.22753	0.041;0.041	T	0.31888	-0.9927	9	0.56958	D	0.05	.	2.736	0.05240	0.5957:0.1112:0.1291:0.164	.	387;387	P35663;F5H4V5	CYLC1_HUMAN;.	F	387	ENSP00000331556:L387F	ENSP00000331556:L387F	L	+	3	2	CYLC1	83015533	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.359000	0.02602	-1.457000	0.01919	-1.346000	0.01242	TTG	.		0.353	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
DDHD1	80821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	53540463	53540463	+	Silent	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr14:53540463A>G	ENST00000323669.5	-	5	1391	c.1392T>C	c.(1390-1392)gaT>gaC	p.D464D	DDHD1_ENST00000395606.1_Silent_p.D471D|DDHD1_ENST00000357758.3_Silent_p.D464D	NM_001160148.1	NP_001153620.1	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1	464					cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)	25	Breast(41;0.037)					ATATACCTCCATCAAGAGTAA	0.323																																					p.D471D		.											DDHD1,NS,carcinoma,-2	DDHD1	92	0			c.T1413C						.						63.0	66.0	65.0					14																	53540463		2203	4300	6503	SO:0001819	synonymous_variant	80821	exon6			ACCTCCATCAAGA	AB051492	CCDS9714.1, CCDS53895.1, CCDS53896.1	14q21	2012-11-23			ENSG00000100523	ENSG00000100523			19714	protein-coding gene	gene with protein product	"""phosphatidic acid-preferring phospholipase A1"""	614603	"""spastic paraplegia 28 (autosomal recessive)"""	SPG28		11214970, 20359546	Standard	NM_030637		Approved	KIAA1705, PA-PLA1	uc001xai.3	Q8NEL9	OTTHUMG00000140305	ENST00000323669.5:c.1392T>C	14.37:g.53540463A>G		Somatic	214.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	77.0	NM_001160147	G5E9D1|Q8WVH3|Q96LL2|Q9C0F8	Silent	SNP	ENST00000323669.5	37	CCDS53895.1																																																																																			.		0.323	DDHD1-003	KNOWN	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276901.1		
DNAJC4	3338	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63999389	63999389	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr11:63999389G>T	ENST00000321685.3	+	3	598	c.133G>T	c.(133-135)Gcc>Tcc	p.A45S	DNAJC4_ENST00000321460.5_Missense_Mutation_p.A45S|DNAJC4_ENST00000355040.4_Missense_Mutation_p.A45S|RP11-783K16.14_ENST00000534988.1_RNA|VEGFB_ENST00000309422.2_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA|VEGFB_ENST00000426086.2_5'Flank	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	45	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)			endometrium(1)|lung(1)|prostate(1)	3						GCATCCTGGTGCCAGCACTGA	0.557																																					p.A45S		.											.	DNAJC4	226	0			c.G133T						.						84.0	88.0	86.0					11																	63999389		1940	4136	6076	SO:0001583	missense	3338	exon3			CCTGGTGCCAGCA	AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.133G>T	11.37:g.63999389G>T	ENSP00000396896:p.Ala45Ser	Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	132.0	39.0	NM_005528	O14716	Missense_Mutation	SNP	ENST00000321685.3	37	CCDS41666.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.060672|4.060672	0.76074|0.76074	.|.	.|.	ENSG00000110011|ENSG00000110011	ENST00000321685;ENST00000355040;ENST00000321460|ENST00000535246	T;T;T|.	0.38722|.	1.12;1.12;1.12|.	5.32|5.32	5.32|5.32	0.75619|0.75619	Heat shock protein DnaJ, N-terminal (5);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62405|0.62405	0.2425|0.2425	L|L	0.48935|0.48935	1.535|1.535	0.54753|0.54753	D|D	0.999989|0.999989	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.998;0.999|.	T|T	0.58487|0.58487	-0.7628|-0.7628	10|5	0.51188|.	T|.	0.08|.	-12.2944|-12.2944	14.8668|14.8668	0.70422|0.70422	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	45;45|.	Q6PIN0;Q9NNZ3|.	.;DNJC4_HUMAN|.	S|F	45|9	ENSP00000396896:A45S;ENSP00000347145:A45S;ENSP00000320548:A45S|.	ENSP00000320548:A45S|.	A|C	+|+	1|2	0|0	DNAJC4|DNAJC4	63755965|63755965	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.997000|0.997000	0.91878|0.91878	5.661000|5.661000	0.68025|0.68025	2.648000|2.648000	0.89879|0.89879	0.561000|0.561000	0.74099|0.74099	GCC|TGC	.		0.557	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396305.1		
CRACR2A	84766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	3736844	3736844	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr12:3736844A>C	ENST00000440314.2	-	16	2237	c.1764T>G	c.(1762-1764)aaT>aaG	p.N588K		NM_001144958.1	NP_001138430.1	Q9BSW2	EFC4B_HUMAN		0					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			AGTTGTCCACATTCAACGTCT	0.597																																					p.N588K		.											.	EFCAB4B	92	0			c.T1764G						.						83.0	74.0	77.0					12																	3736844		692	1591	2283	SO:0001583	missense	84766	exon16			GTCCACATTCAAC																												ENST00000440314.2:c.1764T>G	12.37:g.3736844A>C	ENSP00000409382:p.Asn588Lys	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	15.0	NM_001144958	B4E1X0|B9EK63	Missense_Mutation	SNP	ENST00000440314.2	37	CCDS44803.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.701751	0.00725	.	.	ENSG00000130038	ENST00000440314	T	0.76060	-0.99	5.47	-10.7	0.00240	.	1.384710	0.03987	N	0.294258	T	0.46718	0.1407	.	.	.	0.53688	D	0.999979	B	0.06786	0.001	B	0.08055	0.003	T	0.13575	-1.0504	9	0.07644	T	0.81	.	8.7676	0.34713	0.2645:0.0:0.4938:0.2417	.	588	Q9BSW2-2	.	K	588	ENSP00000409382:N588K	ENSP00000409382:N588K	N	-	3	2	EFCAB4B	3607105	0.000000	0.05858	0.001000	0.08648	0.124000	0.20399	-3.893000	0.00340	-1.703000	0.01409	-0.924000	0.02725	AAT	.		0.597	EFCAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398640.2		
ELAC2	60528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12896302	12896302	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr17:12896302C>G	ENST00000338034.4	-	24	2553	c.2314G>C	c.(2314-2316)Gct>Cct	p.A772P	ELAC2_ENST00000426905.3_Missense_Mutation_p.A732P|RP11-597M12.1_ENST00000582915.1_RNA|ELAC2_ENST00000395962.2_Missense_Mutation_p.A753P	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	772					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						ATGTCGCCAGCAAACAGGGCT	0.602																																					p.A772P		.											.	ELAC2	90	0			c.G2314C						.						67.0	68.0	68.0					17																	12896302		2203	4300	6503	SO:0001583	missense	60528	exon24			CGCCAGCAAACAG	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.2314G>C	17.37:g.12896302C>G	ENSP00000337445:p.Ala772Pro	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	25.0	19.0	NM_018127	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Missense_Mutation	SNP	ENST00000338034.4	37	CCDS11164.1	.	.	.	.	.	.	.	.	.	.	C	16.22	3.060295	0.55432	.	.	ENSG00000006744	ENST00000426905;ENST00000338034;ENST00000395962	T;T;T	0.66099	0.25;-0.18;-0.19	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.78547	0.4300	M	0.69523	2.12	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D	0.87578	0.991;0.979;0.998;0.961;0.995;0.995;0.996;0.983	T	0.78823	-0.2052	10	0.51188	T	0.08	-22.3167	16.9478	0.86235	0.0:1.0:0.0:0.0	.	732;755;753;570;772;532;757;400	B4DPL9;E9PGJ0;G5E9D5;E7ES68;Q9BQ52;B3KSU9;B4DT15;Q9BQ52-3	.;.;.;.;RNZ2_HUMAN;.;.;.	P	732;772;753	ENSP00000405223:A732P;ENSP00000337445:A772P;ENSP00000379291:A753P	ENSP00000337445:A772P	A	-	1	0	ELAC2	12837027	1.000000	0.71417	0.991000	0.47740	0.866000	0.49608	7.138000	0.77305	2.593000	0.87608	0.655000	0.94253	GCT	.		0.602	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129934.5		
ELAVL3	1995	bcgsc.ca;mdanderson.org	37	19	11569052	11569052	+	Silent	SNP	G	G	A	rs114284954	byFrequency	TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:11569052G>A	ENST00000359227.3	-	5	961	c.537C>T	c.(535-537)gcC>gcT	p.A179A	ELAVL3_ENST00000438662.2_Silent_p.A179A	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	179	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						TAGCCTCTTCGGCCTCAATCC	0.592													G|||	24	0.00479233	0.0174	0.0014	5008	,	,		18122	0.0		0.0	False		,,,				2504	0.0				p.A179A		.											.	ELAVL3	92	0			c.C537T						.	G	,	51,4355	52.3+/-87.9	0,51,2152	73.0	65.0	67.0		537,537	-6.1	0.9	19	dbSNP_132	67	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ELAVL3	NM_001420.3,NM_032281.2	,	0,51,6452	AA,AG,GG		0.0,1.1575,0.3921	,	179/368,179/361	11569052	51,12955	2203	4300	6503	SO:0001819	synonymous_variant	1995	exon5			CTCTTCGGCCTCA		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.537C>T	19.37:g.11569052G>A		Somatic	56.0	1.0		WXS	Illumina HiSeq	Phase_1	84.0	30.0	NM_032281	Q16135|Q96CL8|Q96QS9	Silent	SNP	ENST00000359227.3	37	CCDS32912.1																																																																																			G|0.996;A|0.004		0.592	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
E2F4	1874	ucsc.edu;bcgsc.ca	37	16	67234641	67234641	+	IGR	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr16:67234641A>G	ENST00000379378.3	+	0	2096				MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000571638.1_3'UTR|ELMO3_ENST00000477898.1_Missense_Mutation_p.S86G|ELMO3_ENST00000360833.1_Missense_Mutation_p.S235G|ELMO3_ENST00000393997.2_Missense_Mutation_p.S252G	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TGTGACCTTGAGCAGCCCAGC	0.637																																					p.S252G		.											.	ELMO3	90	0			c.A754G						.						39.0	42.0	41.0					16																	67234641		2017	4164	6181	SO:0001628	intergenic_variant	79767	exon7			ACCTTGAGCAGCC	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67234641A>G		Somatic	35.0	1.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_024712	A6NGR8|B5BU56|Q12991|Q15328	Missense_Mutation	SNP	ENST00000379378.3	37	CCDS32464.1	.	.	.	.	.	.	.	.	.	.	A	18.41	3.618091	0.66787	.	.	ENSG00000102890	ENST00000360833;ENST00000393997	T;T	0.51817	0.69;0.69	4.62	4.62	0.57501	Armadillo-like helical (1);Armadillo-type fold (1);	0.136081	0.64402	D	0.000001	T	0.46580	0.1400	M	0.64997	1.995	0.80722	D	1	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.10450	0.001;0.004;0.005	T	0.49790	-0.8902	10	0.72032	D	0.01	-22.4851	13.0337	0.58859	1.0:0.0:0.0:0.0	.	199;235;252	Q96BJ8;F8W9E7;Q96BJ8-3	ELMO3_HUMAN;.;.	G	235;252	ENSP00000354077:S235G;ENSP00000377566:S252G	ENSP00000354077:S235G	S	+	1	0	ELMO3	65792142	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.887000	0.69751	1.953000	0.56701	0.459000	0.35465	AGC	.		0.637	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421565.1	NM_001950	
EPC1	80314	ucsc.edu;bcgsc.ca	37	10	32576204	32576204	+	Splice_Site	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:32576204T>C	ENST00000263062.8	-	7	1245		c.e7-2		EPC1_ENST00000375110.2_Splice_Site|EPC1_ENST00000319778.6_Splice_Site	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)						chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TTTATCTTGCTGCAACAAAGA	0.403																																					.		.											.	EPC1	93	0			c.976-2A>G						.						90.0	81.0	84.0					10																	32576204		2203	4300	6503	SO:0001630	splice_region_variant	80314	exon8			TCTTGCTGCAACA	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.976-2A>G	10.37:g.32576204T>C		Somatic	37.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_001272004	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Splice_Site	SNP	ENST00000263062.8	37	CCDS7172.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.000301	0.74818	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9668	0.79979	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	EPC1	32616210	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.173000	0.68751	0.455000	0.32223	.	.		0.403	EPC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000047484.1		Intron
EXOC6B	23233	ucsc.edu;bcgsc.ca	37	2	72606935	72606935	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:72606935A>G	ENST00000272427.6	-	19	2175	c.2045T>C	c.(2044-2046)cTt>cCt	p.L682P		NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	682					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						TTCCAACAAAAGTTGCATCAA	0.468																																					p.L682P		.											.	EXOC6B	68	0			c.T2045C						.						79.0	76.0	77.0					2																	72606935		2012	4177	6189	SO:0001583	missense	23233	exon19			AACAAAAGTTGCA	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.2045T>C	2.37:g.72606935A>G	ENSP00000272427:p.Leu682Pro	Somatic	30.0	1.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_015189	B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.028156	0.75390	.	.	ENSG00000144036	ENST00000272427	T	0.35973	1.28	4.73	4.73	0.59995	.	.	.	.	.	T	0.54902	0.1887	M	0.76328	2.33	0.80722	D	1	D	0.61697	0.99	P	0.59357	0.856	T	0.59941	-0.7359	9	0.59425	D	0.04	.	13.2382	0.59982	1.0:0.0:0.0:0.0	.	682	Q9Y2D4	EXC6B_HUMAN	P	682	ENSP00000272427:L682P	ENSP00000272427:L682P	L	-	2	0	EXOC6B	72460443	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.098000	0.76974	1.982000	0.57802	0.456000	0.33151	CTT	.		0.468	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570	
FAM13C	220965	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	61029860	61029860	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:61029860G>T	ENST00000373868.2	-	7	689	c.602C>A	c.(601-603)cCa>cAa	p.P201Q	FAM13C_ENST00000468840.2_Missense_Mutation_p.P118Q|FAM13C_ENST00000373867.3_Missense_Mutation_p.P118Q|FAM13C_ENST00000435852.2_Missense_Mutation_p.P201Q|FAM13C_ENST00000442566.3_Missense_Mutation_p.P222Q|FAM13C_ENST00000277705.6_Missense_Mutation_p.P222Q|FAM13C_ENST00000419214.2_Missense_Mutation_p.P201Q|FAM13C_ENST00000422313.2_Missense_Mutation_p.P201Q	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	201										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TTTGTGGACTGGTGAGGGGTC	0.473																																					p.P201Q		.											.	FAM13C	70	0			c.C602A						.						82.0	73.0	76.0					10																	61029860		2203	4300	6503	SO:0001583	missense	220965	exon7			TGGACTGGTGAGG	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.602C>A	10.37:g.61029860G>T	ENSP00000362975:p.Pro201Gln	Somatic	180.0	1.0		WXS	Illumina HiSeq	Phase_I	253.0	127.0	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	37	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089672	0.36855	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313	T;T;T;T;T;T;T;T	0.75477	-0.94;0.57;0.42;0.42;0.61;-0.94;0.54;0.55	5.53	4.62	0.57501	.	0.341800	0.28718	N	0.014371	T	0.74680	0.3748	M	0.79693	2.465	0.32576	N	0.529091	B;B;B;B;B	0.24317	0.101;0.033;0.101;0.081;0.042	B;B;B;B;B	0.28991	0.073;0.097;0.049;0.03;0.045	T	0.79438	-0.1803	10	0.66056	D	0.02	-1.7039	9.5608	0.39369	0.0739:0.0:0.7829:0.1432	.	201;118;201;201;201	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	Q	118;201;222;222;201;118;201;201	ENSP00000362974:P118Q;ENSP00000362975:P201Q;ENSP00000395661:P222Q;ENSP00000277705:P222Q;ENSP00000391993:P201Q;ENSP00000423896:P118Q;ENSP00000392302:P201Q;ENSP00000400241:P201Q	ENSP00000277705:P222Q	P	-	2	0	FAM13C	60699866	0.980000	0.34600	0.364000	0.25888	0.585000	0.36419	3.540000	0.53611	2.599000	0.87857	0.655000	0.94253	CCA	.		0.473	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
FAM182B	728882	bcgsc.ca;mdanderson.org	37	20	25755526	25755526	+	Missense_Mutation	SNP	C	C	T	rs112684378		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr20:25755526C>T	ENST00000376403.1	-	3	808	c.430G>A	c.(430-432)Ggg>Agg	p.G144R	FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	144										lung(1)	1						CCATGCTGCCCGCTGGTCAGC	0.711																																					.		.											.	.	.	0			.						.																																			SO:0001583	missense	728882	.			GCTGCCCGCTGGT			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.430G>A	20.37:g.25755526C>T	ENSP00000365585:p.Gly144Arg	Somatic	30.0	2.0		WXS	Illumina HiSeq	Phase_1	52.0	23.0	.	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.774	-0.483692	0.04383	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.26448	0.0646	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.31336	-0.9947	3	0.87932	D	0	.	.	.	.	.	.	.	.	R	144	.	ENSP00000365585:G144R	G	-	1	0	FAM182B	25703526	0.002000	0.14202	0.059000	0.19551	0.059000	0.15707	-2.655000	0.00854	-2.037000	0.00920	-2.088000	0.00374	GGG	C|0.500;T|0.500		0.711	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
FAM45B	55855	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	129629661	129629666	+	lincRNA	DEL	CTGATG	CTGATG	-			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	CTGATG	CTGATG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chrX:129629661_129629666delCTGATG	ENST00000458525.1	-	0	1015				FAM45B_ENST00000592932.1_RNA																							ACACACAGCACTGATGCTAAAGAAAA	0.495																																					.		.											.	FAM45B	63	0			.						.																																					55855	.			ACAGCACTGATGC																													X.37:g.129629661_129629666delCTGATG		Somatic	331.0	0.0		WXS	Illumina HiSeq	Phase_I	317.0	53.0	.		RNA	DEL	ENST00000458525.1	37																																																																																				.		0.495	RP1-274L7.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058271.1		
FANCA	2175	ucsc.edu;bcgsc.ca	37	16	89836314	89836314	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr16:89836314A>G	ENST00000389301.3	-	26	2465	c.2435T>C	c.(2434-2436)cTt>cCt	p.L812P	FANCA_ENST00000568369.1_Missense_Mutation_p.L812P|FANCA_ENST00000567284.2_5'Flank	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	812					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		AGGGACAGGAAGGCCAGCACC	0.612			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L812P		.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	1130	0			c.T2435C						.						93.0	68.0	77.0					16																	89836314		2198	4300	6498	SO:0001583	missense	2175	exon26	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	ACAGGAAGGCCAG	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.2435T>C	16.37:g.89836314A>G	ENSP00000373952:p.Leu812Pro	Somatic	54.0	1.0		WXS	Illumina HiSeq	.	44.0	5.0	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	A	15.38	2.816693	0.50633	.	.	ENSG00000187741	ENST00000389301	D	0.86097	-2.07	4.2	4.2	0.49525	.	0.263424	0.26665	N	0.023127	D	0.90314	0.6970	M	0.73962	2.25	0.41481	D	0.988163	D;D	0.89917	1.0;0.999	D;D	0.68192	0.956;0.921	D	0.90691	0.4613	10	0.59425	D	0.04	-20.9877	10.275	0.43504	1.0:0.0:0.0:0.0	.	812;812	B4DRI7;O15360	.;FANCA_HUMAN	P	812	ENSP00000373952:L812P	ENSP00000373952:L812P	L	-	2	0	FANCA	88363815	0.091000	0.21658	0.032000	0.17829	0.027000	0.11550	2.064000	0.41432	1.869000	0.54173	0.529000	0.55759	CTT	.		0.612	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
FANCG	2189	ucsc.edu;bcgsc.ca	37	9	35079184	35079184	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr9:35079184G>T	ENST00000378643.3	-	2	630	c.139C>A	c.(139-141)Ctg>Atg	p.L47M	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	47					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AGCCCTTCCAGTGCATCCTGA	0.572			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																													p.L47M		.	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	.	FANCG	724	0			c.C139A						.						42.0	35.0	38.0					9																	35079184		2202	4300	6502	SO:0001583	missense	2189	exon2			CTTCCAGTGCATC	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.139C>A	9.37:g.35079184G>T	ENSP00000367910:p.Leu47Met	Somatic	38.0	1.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_004629		Missense_Mutation	SNP	ENST00000378643.3	37	CCDS6574.1	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639934	0.47153	.	.	ENSG00000221829	ENST00000378643;ENST00000543657;ENST00000448890	T;T	0.79454	0.4;-1.27	4.96	2.07	0.26955	.	.	.	.	.	T	0.80628	0.4659	M	0.70595	2.14	0.22317	N	0.999205	D	0.58268	0.982	P	0.55785	0.784	T	0.67643	-0.5618	9	0.45353	T	0.12	-1.4592	5.1142	0.14825	0.1859:0.1707:0.6434:0.0	.	47	O15287	FANCG_HUMAN	M	47	ENSP00000367910:L47M;ENSP00000409607:L47M	ENSP00000367910:L47M	L	-	1	2	FANCG	35069184	0.897000	0.30589	0.375000	0.26029	0.621000	0.37620	1.233000	0.32648	0.355000	0.24131	-0.291000	0.09656	CTG	.		0.572	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052269.1	NM_004629	
FLT1	2321	ucsc.edu;bcgsc.ca	37	13	28942733	28942733	+	Intron	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr13:28942733T>C	ENST00000282397.4	-	15	2368				FLT1_ENST00000541932.1_Silent_p.S728S	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1						blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	atgatgatgatgacgatgatg	0.333																																					p.S728S		.											.	FLT1	1406	0			c.A2184G						.						296.0	304.0	302.0					13																	28942733		692	1591	2283	SO:0001627	intron_variant	2321	exon15			TGATGATGACGAT	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2117-10911A>G	13.37:g.28942733T>C		Somatic	58.0	0.0		WXS	Illumina HiSeq	.	62.0	6.0	NM_001160030	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	37	CCDS9330.1																																																																																			.		0.333	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
FRAS1	80144	ucsc.edu;bcgsc.ca	37	4	79284727	79284727	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr4:79284727T>C	ENST00000325942.6	+	21	2923	c.2483T>C	c.(2482-2484)cTc>cCc	p.L828P	FRAS1_ENST00000264895.6_Missense_Mutation_p.L828P	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	828					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGCATCTGCCTCAGGTGCCAG	0.572																																					p.L828P		.											.	FRAS1	68	0			c.T2483C						.						43.0	44.0	44.0					4																	79284727		2100	4233	6333	SO:0001583	missense	80144	exon21			TCTGCCTCAGGTG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.2483T>C	4.37:g.79284727T>C	ENSP00000326330:p.Leu828Pro	Somatic	82.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	T	17.28	3.350828	0.61183	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.35048	1.33;1.35	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000009	T	0.66906	0.2837	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.74957	-0.3487	10	0.66056	D	0.02	.	14.9263	0.70881	0.0:0.0:0.0:1.0	.	828;828	E9PHH6;A2RRR8	.;.	P	828	ENSP00000326330:L828P;ENSP00000264895:L828P	ENSP00000264895:L828P	L	+	2	0	FRAS1	79503751	1.000000	0.71417	0.870000	0.34147	0.385000	0.30292	7.264000	0.78432	1.939000	0.56221	0.477000	0.44152	CTC	.		0.572	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
FRMD7	90167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	131212315	131212315	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chrX:131212315G>A	ENST00000298542.4	-	12	1905	c.1730C>T	c.(1729-1731)gCa>gTa	p.A577V	FRMD7_ENST00000464296.1_Missense_Mutation_p.A562V|FRMD7_ENST00000370879.1_Missense_Mutation_p.A457V	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	577					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					ACATACAAATGCATCTTCCAA	0.423																																					p.A577V		.											.	FRMD7	228	0			c.C1730T						.						126.0	113.0	117.0					X																	131212315		2203	4300	6503	SO:0001583	missense	90167	exon12			ACAAATGCATCTT	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1730C>T	X.37:g.131212315G>A	ENSP00000298542:p.Ala577Val	Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	245.0	113.0	NM_194277	C0LLJ3|Q5JX99	Missense_Mutation	SNP	ENST00000298542.4	37	CCDS35397.1	.	.	.	.	.	.	.	.	.	.	G	3.190	-0.166006	0.06461	.	.	ENSG00000165694	ENST00000370879;ENST00000298542;ENST00000464296	D;D;D	0.87809	-2.3;-1.96;-2.06	5.26	2.15	0.27550	.	0.822948	0.10736	N	0.640041	T	0.78329	0.4266	L	0.31752	0.955	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.60255	-0.7299	10	0.21540	T	0.41	.	9.0464	0.36349	0.3562:0.0:0.6438:0.0	.	562;577	Q6ZUT3-2;Q6ZUT3	.;FRMD7_HUMAN	V	457;577;562	ENSP00000359916:A457V;ENSP00000298542:A577V;ENSP00000417996:A562V	ENSP00000298542:A577V	A	-	2	0	FRMD7	131039996	0.643000	0.27269	0.926000	0.36857	0.064000	0.16182	1.180000	0.32005	0.275000	0.22094	-0.197000	0.12766	GCA	.		0.423	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	NM_194277	
GABRA1	2554	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	161318012	161318012	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr5:161318012C>T	ENST00000428797.2	+	9	1167	c.812C>T	c.(811-813)tCc>tTc	p.S271F	GABRA1_ENST00000420560.1_Missense_Mutation_p.S271F|GABRA1_ENST00000437025.2_Missense_Mutation_p.S271F|GABRA1_ENST00000444819.1_Missense_Mutation_p.S271F|GABRA1_ENST00000023897.6_Missense_Mutation_p.S271F|GABRA1_ENST00000393943.4_Missense_Mutation_p.S271F	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	271					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCACAAGTCTCCTTCTGGCTC	0.413																																					p.S271F		.											.	GABRA1	93	0			c.C812T						.						131.0	126.0	127.0					5																	161318012		2203	4300	6503	SO:0001583	missense	2554	exon9			AAGTCTCCTTCTG		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.812C>T	5.37:g.161318012C>T	ENSP00000393097:p.Ser271Phe	Somatic	156.0	1.0		WXS	Illumina HiSeq	Phase_I	148.0	62.0	NM_001127643	D3DQK6|Q8N629	Missense_Mutation	SNP	ENST00000428797.2	37	CCDS4357.1	.	.	.	.	.	.	.	.	.	.	C	31	5.084478	0.94100	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	D;D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45;-2.45	5.52	5.52	0.82312	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.96451	0.8842	H	0.95402	3.665	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.97343	0.9958	10	0.87932	D	0	.	19.4464	0.94849	0.0:1.0:0.0:0.0	.	271	P14867	GBRA1_HUMAN	F	271	ENSP00000023897:S271F;ENSP00000393097:S271F;ENSP00000377517:S271F;ENSP00000415441:S271F;ENSP00000408041:S271F;ENSP00000414232:S271F	ENSP00000023897:S271F	S	+	2	0	GABRA1	161250590	1.000000	0.71417	0.990000	0.47175	0.887000	0.51463	7.684000	0.84104	2.603000	0.88011	0.650000	0.86243	TCC	.		0.413	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252702.2	NM_000806.5	
GALNT8	26290	broad.mit.edu;mdanderson.org	37	12	4848462	4848462	+	Nonsense_Mutation	SNP	G	G	T	rs111635477		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr12:4848462G>T	ENST00000252318.2	+	3	980	c.643G>T	c.(643-645)Gaa>Taa	p.E215*	RP11-234B24.6_ENST00000544741.2_3'UTR	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	215	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						ATTGTTGAAGGAAATCATCTT	0.428																																					p.E215X	Colon(108;631 1558 7270 20097 39846)	.											.	GALNT8	230	0			c.G643T						.						122.0	111.0	115.0					12																	4848462		2203	4300	6503	SO:0001587	stop_gained	26290	exon3			TTGAAGGAAATCA	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.643G>T	12.37:g.4848462G>T	ENSP00000252318:p.Glu215*	Somatic	58.0	1.0		WXS	Illumina HiSeq	Phase_I	66.0	32.0	NM_017417	B2RU02	Nonsense_Mutation	SNP	ENST00000252318.2	37	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	G	37	6.529094	0.97641	.	.	ENSG00000130035	ENST00000252318	.	.	.	4.6	3.7	0.42460	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.5379	0.39233	0.1055:0.0:0.8945:0.0	.	.	.	.	X	215	.	ENSP00000252318:E215X	E	+	1	0	GALNT8	4718723	1.000000	0.71417	0.977000	0.42913	0.485000	0.33311	6.777000	0.75028	1.134000	0.42165	0.561000	0.74099	GAA	G|0.500;A|0.500		0.428	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417	
GAS2L2	246176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	34072948	34072948	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr17:34072948G>A	ENST00000254466.6	-	6	1595	c.1568C>T	c.(1567-1569)aCa>aTa	p.T523I	GAS2L2_ENST00000587565.1_Missense_Mutation_p.T507I	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	523					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ACTTCCACTTGTAGCACCAGG	0.612																																					p.T523I		.											.	GAS2L2	227	0			c.C1568T						.						39.0	42.0	41.0					17																	34072948		2203	4300	6503	SO:0001583	missense	246176	exon6			CCACTTGTAGCAC	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1568C>T	17.37:g.34072948G>A	ENSP00000254466:p.Thr523Ile	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	9.0	NM_139285	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	G	9.843	1.191464	0.21954	.	.	ENSG00000132139	ENST00000254466	T	0.17854	2.25	5.19	0.539	0.17156	.	0.954354	0.08595	N	0.922406	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	B	0.18610	0.029	B	0.14023	0.01	T	0.36016	-0.9765	10	0.41790	T	0.15	0.014	2.5366	0.04716	0.0934:0.2048:0.4125:0.2893	.	523	Q8NHY3	GA2L2_HUMAN	I	523	ENSP00000254466:T523I	ENSP00000254466:T523I	T	-	2	0	GAS2L2	31097061	0.000000	0.05858	0.003000	0.11579	0.010000	0.07245	-1.180000	0.03088	0.313000	0.23062	0.655000	0.94253	ACA	.		0.612	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
GOLGA4	2803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	37366808	37366808	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr3:37366808A>G	ENST00000361924.2	+	14	3805	c.3431A>G	c.(3430-3432)aAt>aGt	p.N1144S	GOLGA4_ENST00000356847.4_Missense_Mutation_p.N1166S|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	1144	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GTTGACTTGAATAAGTCTCTG	0.398																																					p.N1166S		.											.	GOLGA4	93	0			c.A3497G						.						43.0	44.0	44.0					3																	37366808		2203	4298	6501	SO:0001583	missense	2803	exon15			ACTTGAATAAGTC	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.3431A>G	3.37:g.37366808A>G	ENSP00000354486:p.Asn1144Ser	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	225.0	123.0	NM_001172713	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	1.943	-0.443090	0.04604	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.25250	1.81;1.82;1.83	5.12	-4.11	0.03928	.	1.537750	0.04263	N	0.340658	T	0.14570	0.0352	N	0.25380	0.74	0.09310	N	1	B;B;B;B	0.15473	0.013;0.005;0.005;0.001	B;B;B;B	0.14578	0.011;0.007;0.007;0.002	T	0.25710	-1.0124	10	0.11485	T	0.65	.	6.3196	0.21211	0.2917:0.3749:0.3334:0.0	.	1144;1144;1166;1144	Q13439-3;Q13439-4;F8W8Q7;Q13439	.;.;.;GOGA4_HUMAN	S	1144;1166;1015	ENSP00000354486:N1144S;ENSP00000349305:N1166S;ENSP00000405842:N1015S	ENSP00000349305:N1166S	N	+	2	0	GOLGA4	37341812	0.050000	0.20438	0.005000	0.12908	0.432000	0.31715	0.397000	0.20883	-0.518000	0.06452	-0.290000	0.09829	AAT	.		0.398	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
GMPS	8833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	155643090	155643090	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr3:155643090A>T	ENST00000496455.2	+	12	1830	c.1495A>T	c.(1495-1497)Atg>Ttg	p.M499L	GMPS_ENST00000295920.7_Missense_Mutation_p.M400L	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	499					glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	GGAGAAGCTGATGCAAATTAC	0.408			T	MLL	AML																																p.M499L	Ovarian(153;896 1876 4149 15499 28134)	.		Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	.	GMPS	229	0			c.A1495T						.						111.0	111.0	111.0					3																	155643090		1913	4133	6046	SO:0001583	missense	8833	exon12			AAGCTGATGCAAA	U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1495A>T	3.37:g.155643090A>T	ENSP00000419851:p.Met499Leu	Somatic	643.0	1.0		WXS	Illumina HiSeq	Phase_I	1011.0	681.0	NM_003875	A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	ENST00000496455.2	37	CCDS46941.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.858086	0.32791	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.76	4.61	0.57282	GMP synthase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.27933	0.0688	N	0.05306	-0.075	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07616	-1.0763	9	0.09338	T	0.73	-17.9133	11.5552	0.50743	0.9307:0.0:0.0693:0.0	.	400;499	F8W720;P49915	.;GUAA_HUMAN	L	499;400;448;499	.	ENSP00000295920:M400L	M	+	1	0	GMPS	157125784	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.210000	0.95106	1.018000	0.39521	0.533000	0.62120	ATG	.		0.408	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351260.2		
GPR64	10149	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	19017392	19017392	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chrX:19017392C>A	ENST00000379869.3	-	26	2499	c.2336G>T	c.(2335-2337)tGg>tTg	p.W779L	GPR64_ENST00000356606.4_Missense_Mutation_p.W765L|GPR64_ENST00000340581.3_Missense_Mutation_p.W660L|GPR64_ENST00000357991.3_Missense_Mutation_p.W776L|GPR64_ENST00000357544.3_Missense_Mutation_p.W749L|GPR64_ENST00000360279.4_Missense_Mutation_p.W757L|GPR64_ENST00000379878.3_Missense_Mutation_p.W763L|GPR64_ENST00000354791.3_Missense_Mutation_p.W763L|GPR64_ENST00000379873.2_Missense_Mutation_p.W779L|GPR64_ENST00000379876.1_Missense_Mutation_p.W755L	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	779					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					GTTGTTGATCCAGCAGCTGGA	0.398																																					p.W779L		.											.	GPR64	130	0			c.G2336T						.						93.0	95.0	94.0					X																	19017392		2203	4300	6503	SO:0001583	missense	10149	exon26			TTGATCCAGCAGC	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.2336G>T	X.37:g.19017392C>A	ENSP00000369198:p.Trp779Leu	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	20.0	NM_001184834	B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	ENST00000379869.3	37	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654407	0.88056	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606;ENST00000340581	D;D;D;D;D;D;D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62;-1.62	5.88	5.88	0.94601	GPCR, family 2-like (1);	0.000000	0.52532	D	0.000079	D	0.94466	0.8219	H	0.96015	3.755	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	0.997;0.963;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;P;D;D;D;D;D;D;D;D;D	0.97110	0.992;0.8;0.999;0.998;0.998;1.0;0.999;1.0;1.0;0.999;1.0	D	0.95826	0.8854	10	0.87932	D	0	.	19.1599	0.93526	0.0:1.0:0.0:0.0	.	660;741;749;755;763;779;757;765;776;779;763	Q14CE0;Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;.;GPR64_HUMAN;.	L	779;763;763;755;749;779;757;776;765;660	ENSP00000369202:W779L;ENSP00000369207:W763L;ENSP00000346845:W763L;ENSP00000369205:W755L;ENSP00000350152:W749L;ENSP00000369198:W779L;ENSP00000353421:W757L;ENSP00000350680:W776L;ENSP00000349015:W765L;ENSP00000344972:W660L	ENSP00000344972:W660L	W	-	2	0	GPR64	18927313	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.407000	0.80029	2.475000	0.83589	0.594000	0.82650	TGG	.		0.398	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055970.2		
HDAC2	3066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	114264582	114264582	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr6:114264582A>T	ENST00000519065.1	-	12	1687	c.1311T>A	c.(1309-1311)gaT>gaA	p.D437E	HDAC2_ENST00000519108.1_Missense_Mutation_p.D407E|HDAC2_ENST00000368632.2_Missense_Mutation_p.D407E|HDAC2_ENST00000398283.2_Missense_Mutation_p.D531E			Q92769	HDAC2_HUMAN	histone deacetylase 2	437					ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|cardiac muscle cell development (GO:0055013)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|dendrite development (GO:0016358)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|hair follicle placode formation (GO:0060789)|hippocampus development (GO:0021766)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|maintenance of chromatin silencing (GO:0006344)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell cycle (GO:0045786)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of neuron projection development (GO:0010977)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of proteolysis (GO:0045862)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein deacetylation (GO:0090311)|regulation of protein kinase B signaling (GO:0051896)|regulation of sarcomere organization (GO:0060297)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|replication fork (GO:0005657)|Sin3 complex (GO:0016580)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|poly(A) RNA binding (GO:0044822)|protein deacetylase activity (GO:0033558)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			biliary_tract(1)|central_nervous_system(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Aminophylline(DB01223)|Lovastatin(DB00227)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Valproic Acid(DB00313)|Vorinostat(DB02546)	ctttcttATGATCAGCCACAT	0.378																																					p.D437E		.											.	HDAC2	660	0			c.T1311A						.						168.0	156.0	160.0					6																	114264582		1866	4104	5970	SO:0001583	missense	3066	exon12			CTTATGATCAGCC	U31814	CCDS43493.1, CCDS43493.2	6q21	2008-08-29			ENSG00000196591	ENSG00000196591			4853	protein-coding gene	gene with protein product		605164				9782097	Standard	NM_001527		Approved	RPD3, YAF1	uc003pwd.2	Q92769	OTTHUMG00000015411	ENST00000519065.1:c.1311T>A	6.37:g.114264582A>T	ENSP00000430432:p.Asp437Glu	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	71.0	NM_001527	B3KRS5|B4DL58|E1P561|Q5SRI8|Q5SZ86|Q8NEH4	Missense_Mutation	SNP	ENST00000519065.1	37	CCDS43493.2	.	.	.	.	.	.	.	.	.	.	A	14.99	2.700563	0.48307	.	.	ENSG00000196591	ENST00000519065;ENST00000398283;ENST00000519108;ENST00000368632	T;T;T;T	0.73047	-0.69;-0.71;-0.69;-0.69	6.16	3.79	0.43588	.	0.073236	0.56097	N	0.000032	T	0.30198	0.0757	N	0.16098	0.37	0.42098	D	0.99132	B;B	0.19583	0.0;0.037	B;B	0.18263	0.001;0.021	T	0.09773	-1.0659	10	0.14656	T	0.56	-45.4507	10.4506	0.44520	0.8697:0.0:0.1303:0.0	.	407;437	B3KRS5;Q92769	.;HDAC2_HUMAN	E	437;531;407;407	ENSP00000430432:D437E;ENSP00000381331:D531E;ENSP00000430008:D407E;ENSP00000357621:D407E	ENSP00000357621:D407E	D	-	3	2	HDAC2	114371275	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.696000	0.47052	0.567000	0.29293	-0.256000	0.11100	GAT	.		0.378	HDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041909.2		
HECW1	23072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	43484350	43484350	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr7:43484350T>A	ENST00000395891.2	+	11	2184	c.1579T>A	c.(1579-1581)Tcg>Acg	p.S527T	HECW1_ENST00000453890.1_Missense_Mutation_p.S527T	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	527					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GCTGCGGGCCTCGGTGAAGAG	0.652																																					p.S527T		.											.	HECW1	669	0			c.T1579A						.						26.0	34.0	31.0					7																	43484350		2132	4229	6361	SO:0001583	missense	23072	exon11			CGGGCCTCGGTGA	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1579T>A	7.37:g.43484350T>A	ENSP00000379228:p.Ser527Thr	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	20.0	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	T	2.333	-0.353009	0.05173	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.30448	1.53;1.54	5.32	4.15	0.48705	.	.	.	.	.	T	0.19644	0.0472	L	0.27053	0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20505	-1.0273	9	0.30854	T	0.27	.	5.9688	0.19340	0.2829:0.0:0.1247:0.5924	.	527;527	B4DH42;Q76N89	.;HECW1_HUMAN	T	527	ENSP00000379228:S527T;ENSP00000407774:S527T	ENSP00000265522:S527T	S	+	1	0	HECW1	43450875	0.002000	0.14202	0.029000	0.17559	0.126000	0.20510	0.651000	0.24873	0.838000	0.34948	0.533000	0.62120	TCG	.		0.652	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
HMX3	340784	broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	124896950	124896950	+	Silent	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:124896950C>T	ENST00000357878.5	+	2	866	c.777C>T	c.(775-777)ggC>ggT	p.G259G		NM_001105574.1	NP_001099044.1	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	259					brain development (GO:0007420)|cell differentiation (GO:0030154)|embryo implantation (GO:0007566)|inner ear morphogenesis (GO:0042472)|maternal process involved in female pregnancy (GO:0060135)|neuromuscular process controlling balance (GO:0050885)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(4)	4		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		AGCGAGCCGGCCTGGCCGCGT	0.647																																					p.G259G		.											.	HMX3	68	0			c.C777T						.						25.0	30.0	28.0					10																	124896950		2202	4300	6502	SO:0001819	synonymous_variant	340784	exon2			AGCCGGCCTGGCC		CCDS41575.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188620	ENSG00000188620		"""Homeoboxes / ANTP class : NKL subclass"""	5019	protein-coding gene	gene with protein product		613380	"""homeo box (H6 family) 3"""				Standard	NM_001105574		Approved	NKX5-1	uc010quc.2	A6NHT5	OTTHUMG00000019199	ENST00000357878.5:c.777C>T	10.37:g.124896950C>T		Somatic	49.0	1.0		WXS	Illumina HiSeq	Phase_I	85.0	33.0	NM_001105574	A8MU06	Silent	SNP	ENST00000357878.5	37	CCDS41575.1																																																																																			.		0.647	HMX3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050842.4	XM_291716	
HPS5	11234	broad.mit.edu;bcgsc.ca	37	11	18318512	18318512	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr11:18318512T>C	ENST00000349215.3	-	12	1620	c.1343A>G	c.(1342-1344)gAc>gGc	p.D448G	HPS5_ENST00000352460.3_5'Flank|HPS5_ENST00000438420.2_Missense_Mutation_p.D334G|HPS5_ENST00000531848.1_Missense_Mutation_p.D334G|HPS5_ENST00000396253.3_Missense_Mutation_p.D334G	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	448					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						AATACCAGAGTCCAAGATGCT	0.338									Hermansky-Pudlak syndrome																												p.D448G		.											.	HPS5	133	0			c.A1343G						.						61.0	59.0	60.0					11																	18318512		2199	4293	6492	SO:0001583	missense	11234	exon12	Familial Cancer Database	HPS, HPS1-8	CCAGAGTCCAAGA	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.1343A>G	11.37:g.18318512T>C	ENSP00000265967:p.Asp448Gly	Somatic	107.0	1.0		WXS	Illumina HiSeq	Phase_I	105.0	6.0	NM_181507	A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Missense_Mutation	SNP	ENST00000349215.3	37	CCDS7836.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.226546	0.79576	.	.	ENSG00000110756	ENST00000396253;ENST00000438420;ENST00000349215;ENST00000531848	T;T;T;T	0.64260	-0.09;-0.09;-0.06;1.14	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.78622	0.4312	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80910	-0.1171	10	0.72032	D	0.01	.	15.979	0.80091	0.0:0.0:0.0:1.0	.	448	Q9UPZ3	HPS5_HUMAN	G	334;334;448;334	ENSP00000379552:D334G;ENSP00000399590:D334G;ENSP00000265967:D448G;ENSP00000431758:D334G	ENSP00000265967:D448G	D	-	2	0	HPS5	18275088	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.182000	0.69389	0.460000	0.39030	GAC	.		0.338	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390808.1	NM_181507	
HUWE1	10075	broad.mit.edu;bcgsc.ca	37	X	53588743	53588743	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chrX:53588743T>C	ENST00000342160.3	-	54	7938	c.7481A>G	c.(7480-7482)gAg>gGg	p.E2494G	HUWE1_ENST00000262854.6_Missense_Mutation_p.E2494G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2494					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GTTGTCAAACTCAATGATGAG	0.468																																					p.E2494G		.											.	HUWE1	280	0			c.A7481G						.						114.0	88.0	97.0					X																	53588743		2203	4300	6503	SO:0001583	missense	10075	exon55			TCAAACTCAATGA	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7481A>G	X.37:g.53588743T>C	ENSP00000340648:p.Glu2494Gly	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	7.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.80|14.80	2.643940|2.643940	0.47258|0.47258	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.38240|.	1.15;1.15|.	5.6|5.6	4.44|4.44	0.53790|0.53790	.|.	0.066755|.	0.64402|.	D|.	0.000020|.	T|.	0.42471|.	0.1204|.	N|N	0.24115|0.24115	0.695|0.695	0.53688|0.53688	D|D	0.999971|0.999971	D;B|.	0.57899|.	0.981;0.0|.	D;B|.	0.65140|.	0.932;0.0|.	T|.	0.17837|.	-1.0356|.	10|.	0.49607|.	T|.	0.09|.	.|.	9.7124|9.7124	0.40254|0.40254	0.0:0.0843:0.0:0.9157|0.0:0.0843:0.0:0.9157	.|.	2494;2494|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	G|W	2494|1527	ENSP00000340648:E2494G;ENSP00000262854:E2494G|.	ENSP00000262854:E2494G|.	E|X	-|-	2|3	0|0	HUWE1|HUWE1	53605468|53605468	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.328000|7.328000	0.79160|0.79160	0.746000|0.746000	0.32786|0.32786	0.412000|0.412000	0.27726|0.27726	GAG|TGA	.		0.468	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
IL17REL	400935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50439551	50439551	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr22:50439551G>C	ENST00000389983.2	-	4	333	c.69C>G	c.(67-69)tgC>tgG	p.C23W	IL17REL_ENST00000341280.5_Missense_Mutation_p.C23W	NM_001001694.2	NP_001001694.2	Q6ZVW7	I17EL_HUMAN	interleukin 17 receptor E-like	23										endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GGAGCATCGCGCAGCCGTCAG	0.652																																					p.C23W		.											.	IL17REL	23	0			c.C69G						.						41.0	33.0	35.0					22																	50439551		2194	4295	6489	SO:0001583	missense	400935	exon4			CATCGCGCAGCCG	AK123987	CCDS33679.1	22q13.33	2009-01-13			ENSG00000188263	ENSG00000188263			33808	protein-coding gene	gene with protein product		613414					Standard	NM_001001694		Approved	FLJ41993	uc003bje.1	Q6ZVW7	OTTHUMG00000150242	ENST00000389983.2:c.69C>G	22.37:g.50439551G>C	ENSP00000374633:p.Cys23Trp	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	46.0	NM_001001694	A6NCN4|A6PVC1	Missense_Mutation	SNP	ENST00000389983.2	37	CCDS33679.1	.	.	.	.	.	.	.	.	.	.	g	12.74	2.028950	0.35797	.	.	ENSG00000188263	ENST00000389983;ENST00000341280	T;T	0.34072	1.38;1.38	3.16	-0.348	0.12613	.	0.155416	0.43747	U	0.000535	T	0.47432	0.1445	L	0.59436	1.845	0.09310	N	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.27157	-1.0082	10	0.87932	D	0	.	5.7491	0.18136	0.4071:0.0:0.5929:0.0	.	23	Q6ZVW7	I17EL_HUMAN	W	23	ENSP00000374633:C23W;ENSP00000342520:C23W	ENSP00000342520:C23W	C	-	3	2	IL17REL	48781678	0.022000	0.18835	0.020000	0.16555	0.006000	0.05464	-0.109000	0.10840	0.093000	0.17368	-0.144000	0.13903	TGC	.		0.652	IL17REL-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317011.1	NM_001001694	
IL21R	50615	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	27448870	27448870	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr16:27448870C>A	ENST00000337929.3	+	4	687	c.214C>A	c.(214-216)Cac>Aac	p.H72N	IL21R_ENST00000395755.1_Missense_Mutation_p.H72N|IL21R_ENST00000564089.1_Missense_Mutation_p.H72N|IL21R_ENST00000395754.4_Missense_Mutation_p.H72N	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	72	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CAGGTCGGCCCACAATGCCAC	0.557			T	BCL6	NHL																																p.H94N		.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	660	0			c.C280A						.						131.0	100.0	111.0					16																	27448870		2197	4300	6497	SO:0001583	missense	50615	exon5			TCGGCCCACAATG	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.214C>A	16.37:g.27448870C>A	ENSP00000338010:p.His72Asn	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	27.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	C	11.68	1.711849	0.30322	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	D;D;D	0.95885	-3.84;-3.84;-3.84	4.65	4.65	0.58169	Fibronectin, type III (1);	0.407180	0.21333	N	0.076263	D	0.93138	0.7815	M	0.66939	2.045	0.37177	D	0.903308	P	0.37276	0.589	B	0.35813	0.211	D	0.92638	0.6122	10	0.14656	T	0.56	-17.6511	13.3953	0.60849	0.0:1.0:0.0:0.0	.	72	Q9HBE5	IL21R_HUMAN	N	72	ENSP00000338010:H72N;ENSP00000379104:H72N;ENSP00000379103:H72N	ENSP00000338010:H72N	H	+	1	0	IL21R	27356371	0.045000	0.20229	0.811000	0.32455	0.038000	0.13279	0.197000	0.17197	2.271000	0.75665	0.650000	0.86243	CAC	.		0.557	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
IL6ST	3572	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	55260049	55260057	+	In_Frame_Del	DEL	CAATGTTGA	CAATGTTGA	-			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	CAATGTTGA	CAATGTTGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr5:55260049_55260057delCAATGTTGA	ENST00000381298.2	-	6	887_895	c.575_583delTCAACATTG	c.(574-585)gtcaacattgaa>gaa	p.VNI192del	IL6ST_ENST00000381294.3_In_Frame_Del_p.VNI192del|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000336909.5_In_Frame_Del_p.VNI192del|IL6ST_ENST00000577363.1_5'UTR|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000502326.3_In_Frame_Del_p.VNI192del|IL6ST_ENST00000536319.1_In_Frame_Del_p.VNI192del|IL6ST_ENST00000381287.4_In_Frame_Del_p.VNI192del|IL6ST_ENST00000522633.2_In_Frame_Del_p.VNI192del|IL6ST_ENST00000396816.1_In_Frame_Del_p.STL50del	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	192	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)	p.N193delN(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				ACCCAGACTTCAATGTTGACAAAATACAC	0.378			O		hepatocellular ca																																p.192_195del		.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	290	1	Deletion - In frame(1)	liver(1)	c.575_583del						.																																			SO:0001651	inframe_deletion	3572	exon6			AGACTTCAATGTT	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.575_583delTCAACATTG	5.37:g.55260049_55260057delCAATGTTGA	ENSP00000370698:p.Val192_Ile194del	Somatic	296.0	0.0		WXS	Illumina HiSeq	Phase_I	273.0	73.0	NM_175767	A0N0L4|Q5FC04|Q9UQ41	In_Frame_Del	DEL	ENST00000381298.2	37	CCDS3971.1																																																																																			.		0.378	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
INPP5B	3633	broad.mit.edu;bcgsc.ca	37	1	38339824	38339824	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:38339824A>G	ENST00000373026.1	-	17	2032	c.2032T>C	c.(2032-2034)Tgt>Cgt	p.C678R	INPP5B_ENST00000458109.2_3'UTR|INPP5B_ENST00000373027.1_Missense_Mutation_p.C434R|INPP5B_ENST00000373024.3_Missense_Mutation_p.C598R|INPP5B_ENST00000373023.2_Missense_Mutation_p.C678R			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	678	ASH. {ECO:0000250}.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TTCTGAAAACAGAACTGGGAA	0.453																																					p.C598R		.											.	INPP5B	227	0			c.T1792C						.						42.0	41.0	41.0					1																	38339824		1843	4080	5923	SO:0001583	missense	3633	exon18			GAAAACAGAACTG	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.2032T>C	1.37:g.38339824A>G	ENSP00000362117:p.Cys678Arg	Somatic	68.0	1.0		WXS	Illumina HiSeq	Phase_I	88.0	7.0	NM_005540	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	37		.	.	.	.	.	.	.	.	.	.	A	8.525	0.869567	0.17322	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024	D;D;D;D	0.92595	-3.07;-2.91;-2.91;-2.9	5.44	4.25	0.50352	.	0.451421	0.26895	N	0.021960	D	0.84306	0.5443	L	0.57536	1.79	0.80722	D	1	P;P	0.42941	0.794;0.7	B;B	0.33620	0.167;0.156	T	0.79524	-0.1768	10	0.10377	T	0.69	.	3.9817	0.09498	0.6796:0.0:0.1564:0.1641	.	678;598	P32019;P32019-2	I5P2_HUMAN;.	R	434;678;678;678;598	ENSP00000362118:C434R;ENSP00000362114:C678R;ENSP00000362117:C678R;ENSP00000362115:C598R	ENSP00000362114:C678R	C	-	1	0	INPP5B	38112411	0.351000	0.24887	1.000000	0.80357	0.988000	0.76386	0.820000	0.27323	2.071000	0.62044	0.533000	0.62120	TGT	.		0.453	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540	
ITGA2	3673	broad.mit.edu;bcgsc.ca	37	5	52379216	52379216	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr5:52379216A>G	ENST00000296585.5	+	27	3334	c.3191A>G	c.(3190-3192)gAc>gGc	p.D1064G		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	1064					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				TGGTTGAAAGACGTTCACATG	0.348																																					p.D1064G		.											.	ITGA2	226	0			c.A3191G						.						127.0	117.0	121.0					5																	52379216		2203	4300	6503	SO:0001583	missense	3673	exon27			TGAAAGACGTTCA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.3191A>G	5.37:g.52379216A>G	ENSP00000296585:p.Asp1064Gly	Somatic	123.0	1.0		WXS	Illumina HiSeq	Phase_I	197.0	11.0	NM_002203	Q14595	Missense_Mutation	SNP	ENST00000296585.5	37	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.169723	0.38315	.	.	ENSG00000164171	ENST00000296585	T	0.47869	0.83	5.95	4.79	0.61399	.	0.273852	0.41294	N	0.000920	T	0.29914	0.0748	N	0.19112	0.55	0.37034	D	0.896844	B	0.19073	0.033	B	0.23574	0.047	T	0.18147	-1.0346	10	0.17832	T	0.49	.	8.1341	0.31043	0.8449:0.0:0.1551:0.0	.	1064	P17301	ITA2_HUMAN	G	1064	ENSP00000296585:D1064G	ENSP00000296585:D1064G	D	+	2	0	ITGA2	52414973	1.000000	0.71417	0.995000	0.50966	0.943000	0.58893	4.069000	0.57541	1.081000	0.41110	0.528000	0.53228	GAC	.		0.348	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
IVL	3713	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152883162	152883162	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:152883162G>A	ENST00000368764.3	+	2	953	c.889G>A	c.(889-891)Gat>Aat	p.D297N	IVL_ENST00000392667.2_Missense_Mutation_p.D151N			P07476	INVO_HUMAN	involucrin	297	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAAGCACCTGGATCAGCAGGA	0.632																																					p.D297N		.											.	IVL	93	0			c.G889A						.						19.0	18.0	19.0					1																	152883162		2068	3995	6063	SO:0001583	missense	3713	exon2			CACCTGGATCAGC	BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.889G>A	1.37:g.152883162G>A	ENSP00000357753:p.Asp297Asn	Somatic	159.0	2.0		WXS	Illumina HiSeq	Phase_I	220.0	85.0	NM_005547	Q5T7P4	Missense_Mutation	SNP	ENST00000368764.3	37	CCDS1030.1	.	.	.	.	.	.	.	.	.	.	G	9.120	1.008805	0.19199	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.12465	3.01;2.68	3.56	1.51	0.23008	.	.	.	.	.	T	0.02156	0.0067	N	0.14661	0.345	0.09310	N	1	B	0.23128	0.08	B	0.22601	0.04	T	0.47182	-0.9137	9	0.26408	T	0.33	.	7.0612	0.25127	0.1132:0.1807:0.7061:0.0	.	297	P07476	INVO_HUMAN	N	297;151	ENSP00000357753:D297N;ENSP00000376435:D151N	ENSP00000357753:D297N	D	+	1	0	IVL	151149786	0.007000	0.16637	0.013000	0.15412	0.013000	0.08279	1.456000	0.35201	0.576000	0.29452	0.456000	0.33151	GAT	.		0.632	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034664.1	NM_005547	
JPH2	57158	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	20	42815335	42815335	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr20:42815335C>A	ENST00000372980.3	-	1	883	c.11G>T	c.(10-12)gGc>gTc	p.G4V	JPH2_ENST00000342272.3_Missense_Mutation_p.G4V	NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	4	Gly-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GTCGAAGCGGCCCCCACTCAT	0.662																																					p.G4V		.											.	JPH2	91	0			c.G11T						.						36.0	36.0	36.0					20																	42815335		2203	4300	6503	SO:0001583	missense	57158	exon1			AAGCGGCCCCCAC	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.11G>T	20.37:g.42815335C>A	ENSP00000362071:p.Gly4Val	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	11.0	NM_175913	E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	ENST00000372980.3	37	CCDS13325.1	.	.	.	.	.	.	.	.	.	.	c	18.13	3.555108	0.65425	.	.	ENSG00000149596	ENST00000372980;ENST00000342272	D;T	0.84442	-1.85;-0.44	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	D	0.96116	0.8734	H	0.99454	4.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.98667	1.0686	10	0.87932	D	0	.	17.4267	0.87528	0.0:1.0:0.0:0.0	.	4;4	Q9BR39-2;Q9BR39	.;JPH2_HUMAN	V	4	ENSP00000362071:G4V;ENSP00000344590:G4V	ENSP00000344590:G4V	G	-	2	0	JPH2	42248749	1.000000	0.71417	1.000000	0.80357	0.353000	0.29299	7.387000	0.79785	2.100000	0.63781	0.556000	0.70494	GGC	.		0.662	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1		
NWD2	57495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	37447823	37447823	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr4:37447823A>C	ENST00000309447.5	+	7	5061	c.4213A>C	c.(4213-4215)Att>Ctt	p.I1405L		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1405										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						TCAGCTGCTGATTACACACAA	0.498																																					p.I1405L		.											.	.	.	0			c.A4213C						.						45.0	41.0	42.0					4																	37447823		692	1591	2283	SO:0001583	missense	57495	exon7			CTGCTGATTACAC																												ENST00000309447.5:c.4213A>C	4.37:g.37447823A>C	ENSP00000309501:p.Ile1405Leu	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	21.0	NM_001144990	A8MRU1	Missense_Mutation	SNP	ENST00000309447.5	37	CCDS47040.1	.	.	.	.	.	.	.	.	.	.	A	14.33	2.503020	0.44558	.	.	ENSG00000174145	ENST00000309447	T	0.28666	1.6	6.17	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.057510	0.64402	D	0.000002	T	0.19248	0.0462	N	0.19112	0.55	0.54753	D	0.999985	B	0.12013	0.005	B	0.11329	0.006	T	0.06862	-1.0803	10	0.13470	T	0.59	.	13.2634	0.60120	0.868:0.132:0.0:0.0	.	1405	Q9ULI1	K1239_HUMAN	L	1405	ENSP00000309501:I1405L	ENSP00000309501:I1405L	I	+	1	0	KIAA1239	37124218	1.000000	0.71417	0.973000	0.42090	0.998000	0.95712	7.040000	0.76551	2.371000	0.80710	0.533000	0.62120	ATT	.		0.498	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
KY	339855	bcgsc.ca;mdanderson.org	37	3	134348537	134348537	+	Splice_Site	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr3:134348537C>A	ENST00000423778.2	-	4	324	c.263G>T	c.(262-264)gGg>gTg	p.G88V	KY_ENST00000503669.1_Splice_Site_p.G88V|KY_ENST00000508956.1_Splice_Site_p.G67V|KY_ENST00000508041.1_5'Flank	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	88					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						CAGTTGTGTCCCTACAAAGGA	0.443																																					p.G88V		.											.	KY	24	0			c.G263T						.						68.0	68.0	68.0					3																	134348537		1987	4200	6187	SO:0001630	splice_region_variant	339855	exon4			TGTGTCCCTACAA	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.263-1G>T	3.37:g.134348537C>A		Somatic	108.0	2.0		WXS	Illumina HiSeq	Phase_1	202.0	64.0	NM_178554	B7Z1S4|Q6ZT15	Missense_Mutation	SNP	ENST00000423778.2	37	CCDS46920.1	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129807	0.56721	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000503669;ENST00000310263	.	.	.	5.58	5.58	0.84498	.	0.069279	0.56097	D	0.000026	T	0.63486	0.2515	L	0.59436	1.845	0.80722	D	1	P;D;P;D	0.63046	0.947;0.972;0.867;0.992	P;P;B;P	0.51415	0.656;0.669;0.44;0.656	T	0.59526	-0.7438	9	0.25751	T	0.34	.	16.4916	0.84202	0.0:1.0:0.0:0.0	.	67;88;88;49	Q8NBH2-3;B4DGA7;Q8NBH2-4;Q8NBH2-2	.;.;.;.	V	67;88;88;88	.	ENSP00000309520:G88V	G	-	2	0	KY	135831227	1.000000	0.71417	0.998000	0.56505	0.406000	0.30931	4.312000	0.59154	2.622000	0.88805	0.557000	0.71058	GGG	.		0.443	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554	Missense_Mutation
LCE1E	353135	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	152759968	152759968	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:152759968delG	ENST00000368770.3	+	2	246	c.193delG	c.(193-195)gggfs	p.G66fs	LCE1E_ENST00000368771.1_Frame_Shift_Del_p.G66fs	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	66	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCAGCTCTGGGGGCTGCTG	0.657																																					p.G65fs		.											.	LCE1E	90	0			c.193delG						.						36.0	45.0	42.0					1																	152759968		2203	4299	6502	SO:0001589	frameshift_variant	353135	exon2			AGCTCTGGGGGCT	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.193delG	1.37:g.152759968delG	ENSP00000357759:p.Gly66fs	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	39.0	NM_178353	D3DV30	Frame_Shift_Del	DEL	ENST00000368770.3	37	CCDS1024.1																																																																																			.		0.657	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
LAMB3	3914	broad.mit.edu;bcgsc.ca	37	1	209790903	209790903	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:209790903T>C	ENST00000356082.4	-	21	3214	c.3080A>G	c.(3079-3081)aAg>aGg	p.K1027R	LAMB3_ENST00000391911.1_Missense_Mutation_p.K1027R|LAMB3_ENST00000367030.3_Missense_Mutation_p.K1027R	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	1027	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TGTCACCAGCTTTTCTGCTGG	0.592																																					p.K1027R		.											.	LAMB3	156	0			c.A3080G						.						87.0	85.0	86.0					1																	209790903		2203	4300	6503	SO:0001583	missense	3914	exon21			ACCAGCTTTTCTG	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.3080A>G	1.37:g.209790903T>C	ENSP00000348384:p.Lys1027Arg	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	6.0	NM_000228	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	37	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	T	0.622	-0.820715	0.02755	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030;ENST00000455193	T;T;T;T	0.21734	1.99;1.99;1.99;2.61	5.53	-2.84	0.05751	.	0.518777	0.22648	N	0.057376	T	0.05044	0.0135	N	0.02247	-0.625	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37197	-0.9716	10	0.07813	T	0.8	.	5.5269	0.16962	0.0:0.2572:0.4032:0.3395	.	1027	Q13751	LAMB3_HUMAN	R	1027;1027;1027;96	ENSP00000375778:K1027R;ENSP00000348384:K1027R;ENSP00000355997:K1027R;ENSP00000398683:K96R	ENSP00000348384:K1027R	K	-	2	0	LAMB3	207857526	0.000000	0.05858	0.036000	0.18154	0.571000	0.35966	-0.372000	0.07504	-0.489000	0.06716	-0.474000	0.04947	AAG	.		0.592	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
LCN2	3934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	130912582	130912582	+	Silent	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr9:130912582G>A	ENST00000373017.1	+	3	441	c.204G>A	c.(202-204)ccG>ccA	p.P68P	LCN2_ENST00000470902.1_Intron|LCN2_ENST00000277480.2_Silent_p.P68P|LCN2_ENST00000373013.2_Silent_p.P68P|LCN2_ENST00000372998.1_Silent_p.P68P|LCN2_ENST00000540948.1_Silent_p.P68P			P80188	NGAL_HUMAN	lipocalin 2	68					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|small molecule binding (GO:0036094)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	8						ACAAAGACCCGCAAAAGATGT	0.512																																					p.P68P		.											.	LCN2	90	0			c.G204A						.						168.0	144.0	152.0					9																	130912582		2203	4300	6503	SO:0001819	synonymous_variant	3934	exon2			AGACCCGCAAAAG		CCDS6892.1	9q34	2011-10-24	2007-12-18		ENSG00000148346	ENSG00000148346		"""Lipocalins"""	6526	protein-coding gene	gene with protein product	"""oncogene 24p3"", ""neutrophil gelatinase-associated lipocalin"", ""siderocalin"""	600181	"""lipocalin 2 (oncogene 24p3)"""			7683678	Standard	NM_005564		Approved	NGAL, 24p3	uc004bto.1	P80188	OTTHUMG00000020734	ENST00000373017.1:c.204G>A	9.37:g.130912582G>A		Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	232.0	111.0	NM_005564	A6NII8|B4DWV4|B7ZAA2|P30150|Q5SYV9|Q5SYW0|Q6FGL5|Q92683	Silent	SNP	ENST00000373017.1	37	CCDS6892.1																																																																																			.		0.512	LCN2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054375.1	NM_005564	
LMAN1	3998	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	57026472	57026472	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr18:57026472G>A	ENST00000251047.5	-	1	722	c.5C>T	c.(4-6)gCg>gTg	p.A2V	RP11-27G24.1_ENST00000591331.1_lincRNA	NM_005570.3	NP_005561.1	P49257	LMAN1_HUMAN	lectin, mannose-binding, 1	2					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum organization (GO:0007029)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|sarcomere (GO:0030017)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Colorectal(73;0.0946)			Antihemophilic Factor(DB00025)	CCTGGATCCCGCCATCTTGGA	0.697																																					p.A2V		.											.	LMAN1	91	0			c.C5T						.						30.0	37.0	35.0					18																	57026472		2202	4300	6502	SO:0001583	missense	3998	exon1			GATCCCGCCATCT	X71661	CCDS11974.1	18q21.3-q22	2014-09-17	2002-08-30		ENSG00000074695	ENSG00000074695			6631	protein-coding gene	gene with protein product	"""endoplasmic reticulum-golgi intermediate compartment protein 53"""	601567	"""coagulation factor V-factor VIII combined deficiency"""	F5F8D		9546392, 8854877	Standard	NM_005570		Approved	MR60, ERGIC-53, ERGIC53, gp58, MCFD1, FMFD1	uc002lhz.3	P49257	OTTHUMG00000132758	ENST00000251047.5:c.5C>T	18.37:g.57026472G>A	ENSP00000251047:p.Ala2Val	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	27.0	NM_005570	Q12895|Q8N5I7|Q9UQG1|Q9UQG2|Q9UQG3|Q9UQG4|Q9UQG5|Q9UQG6|Q9UQG7|Q9UQG8|Q9UQG9|Q9UQH0|Q9UQH1|Q9UQH2	Missense_Mutation	SNP	ENST00000251047.5	37	CCDS11974.1	.	.	.	.	.	.	.	.	.	.	G	35	5.520706	0.96416	.	.	ENSG00000074695	ENST00000251047	T	0.58940	0.3	3.94	3.94	0.45596	.	0.152793	0.44483	D	0.000447	T	0.57504	0.2058	N	0.08118	0	0.43107	D	0.994802	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.67027	-0.5774	10	0.51188	T	0.08	-14.6621	16.1379	0.81502	0.0:0.0:1.0:0.0	.	2;2	B4DVV0;P49257	.;LMAN1_HUMAN	V	2	ENSP00000251047:A2V	ENSP00000251047:A2V	A	-	2	0	LMAN1	55177452	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.624000	0.74243	2.190000	0.69967	0.561000	0.74099	GCG	.		0.697	LMAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256129.2	NM_005570	
MCM3AP	8888	ucsc.edu;bcgsc.ca	37	21	47693478	47693478	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr21:47693478T>C	ENST00000397708.1	-	8	2274	c.2020A>G	c.(2020-2022)Aaa>Gaa	p.K674E	MCM3AP_ENST00000291688.1_Missense_Mutation_p.K674E			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	674	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CTGTACTCTTTCACAGCTGCT	0.602																																					p.K674E		.											.	MCM3AP	291	0			c.A2020G						.						47.0	43.0	44.0					21																	47693478		2203	4300	6503	SO:0001583	missense	8888	exon7			ACTCTTTCACAGC	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2020A>G	21.37:g.47693478T>C	ENSP00000380820:p.Lys674Glu	Somatic	25.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_003906	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.866902	0.91511	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.31510	1.49;1.49	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.69424	0.3109	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80271	-0.1452	10	0.87932	D	0	-40.8113	16.4237	0.83790	0.0:0.0:0.0:1.0	.	674	O60318	MCM3A_HUMAN	E	674	ENSP00000380820:K674E;ENSP00000291688:K674E	ENSP00000291688:K674E	K	-	1	0	MCM3AP	46517906	1.000000	0.71417	1.000000	0.80357	0.687000	0.40016	7.866000	0.87056	2.279000	0.76181	0.533000	0.62120	AAA	.		0.602	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207254.1	NM_003906	
METAP1	23173	ucsc.edu;bcgsc.ca	37	4	99955478	99955478	+	Silent	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr4:99955478A>G	ENST00000296411.6	+	3	398	c.264A>G	c.(262-264)agA>agG	p.R88R	METAP1_ENST00000544031.1_Silent_p.R38R|METAP1_ENST00000506548.1_3'UTR	NM_015143.2	NP_055958.2	P53582	MAP11_HUMAN	methionyl aminopeptidase 1	88					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|phototransduction, visible light (GO:0007603)|platelet aggregation (GO:0070527)|protein initiator methionine removal (GO:0070084)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of translation (GO:0006417)|rhodopsin mediated signaling pathway (GO:0016056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic ribosome (GO:0022626)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		GTAAACTCAGACCACATTATC	0.373																																					p.R88R		.											.	.	.	0			c.A264G						.						119.0	100.0	106.0					4																	99955478		692	1591	2283	SO:0001819	synonymous_variant	23173	exon3			ACTCAGACCACAT	D42084	CCDS47110.1	4q23	2010-08-20			ENSG00000164024	ENSG00000164024	3.4.11.18		15789	protein-coding gene	gene with protein product	"""Peptidase M"""	610151				7788527, 12144506	Standard	NM_015143		Approved	KIAA0094, MetAP1A, MAP1A	uc003huf.4	P53582	OTTHUMG00000161231	ENST00000296411.6:c.264A>G	4.37:g.99955478A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_015143	B4E2E6	Silent	SNP	ENST00000296411.6	37	CCDS47110.1																																																																																			.		0.373	METAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364237.1	NM_015143	
MVB12B	89853	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	129157873	129157873	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr9:129157873A>G	ENST00000361171.3	+	6	640	c.559A>G	c.(559-561)Atc>Gtc	p.I187V	MVB12B_ENST00000545391.1_Missense_Mutation_p.I187V|MVB12B_ENST00000436593.3_Missense_Mutation_p.I172V|MVB12B_ENST00000535766.1_Missense_Mutation_p.I180V	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B	187	MABP. {ECO:0000255|PROSITE- ProRule:PRU00831}.				protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										CAGCATGGGGATCTGGTATCG	0.473																																					p.I187V		.											.	.	.	0			c.A559G						.						174.0	153.0	160.0					9																	129157873		2203	4300	6503	SO:0001583	missense	89853	exon6			ATGGGGATCTGGT	AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.559A>G	9.37:g.129157873A>G	ENSP00000354772:p.Ile187Val	Somatic	139.0	2.0		WXS	Illumina HiSeq	Phase_I	166.0	57.0	NM_001011703	Q8N6S7	Missense_Mutation	SNP	ENST00000361171.3	37	CCDS35142.1	.	.	.	.	.	.	.	.	.	.	A	16.06	3.015306	0.54468	.	.	ENSG00000196814	ENST00000361171;ENST00000545391;ENST00000402437;ENST00000436593;ENST00000535766	T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58	5.69	5.69	0.88448	MABP domain (1);	0.000000	0.85682	D	0.000000	T	0.65719	0.2718	L	0.45352	1.415	0.80722	D	1	D;B;D;D	0.63880	0.993;0.374;0.993;0.958	D;B;D;D	0.76071	0.987;0.278;0.987;0.97	T	0.65249	-0.6214	10	0.45353	T	0.12	-2.6431	15.942	0.79763	1.0:0.0:0.0:0.0	.	180;172;56;187	B7Z4X0;B7Z1P9;Q9H7N7;Q9H7P6	.;.;.;F125B_HUMAN	V	187;187;172;172;180	ENSP00000354772:I187V;ENSP00000441988:I187V;ENSP00000384751:I172V;ENSP00000401379:I172V;ENSP00000442846:I180V	ENSP00000354772:I187V	I	+	1	0	FAM125B	128197694	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.559000	0.90708	2.162000	0.67917	0.533000	0.62120	ATC	.		0.473	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054110.1	XM_088525	
MYCN	4613	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	16082220	16082220	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:16082220A>G	ENST00000281043.3	+	2	331	c.34A>G	c.(34-36)Atg>Gtg	p.M12V	MYCNOS_ENST00000453400.1_RNA|MYCNOS_ENST00000439180.1_RNA|MYCNOS_ENST00000419083.1_RNA|MYCNOS_ENST00000448719.1_RNA|MYCNOS_ENST00000420452.1_RNA	NM_005378.4	NP_005369.2	P04198	MYCN_HUMAN	v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog	12					branching morphogenesis of an epithelial tube (GO:0048754)|cartilage condensation (GO:0001502)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|lung development (GO:0030324)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cell death (GO:0010942)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	31	all_cancers(1;1.35e-08)|all_neural(1;2.92e-24)|Lung SC(1;3.26e-07)|Medulloblastoma(1;6.9e-06)|all_lung(1;1.26e-05)|Glioma(3;0.135)|Acute lymphoblastic leukemia(172;0.155)|all_epithelial(1;0.169)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(3;0.000332)			CATGCCGGGCATGATCTGCAA	0.637			A		neuroblastoma																																p.M12V		.		Dom	yes		2	2p24.1	4613	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian)"""		O	.	MYCN	1271	0			c.A34G						.						51.0	52.0	51.0					2																	16082220		2203	4300	6503	SO:0001583	missense	4613	exon2			CCGGGCATGATCT	BC002712	CCDS1687.1	2p24.3	2013-08-14	2013-07-09		ENSG00000134323	ENSG00000134323		"""Basic helix-loop-helix proteins"""	7559	protein-coding gene	gene with protein product		164840		NMYC			Standard	XM_006711886		Approved	bHLHe37, N-myc, MYCNOT	uc002rci.3	P04198	OTTHUMG00000039579	ENST00000281043.3:c.34A>G	2.37:g.16082220A>G	ENSP00000281043:p.Met12Val	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	268.0	120.0	NM_005378	Q53XS5|Q6LDT9	Missense_Mutation	SNP	ENST00000281043.3	37	CCDS1687.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.875283	0.33162	.	.	ENSG00000134323	ENST00000281043;ENST00000426211	T	0.17854	2.25	3.38	1.96	0.26148	Transcription regulator Myc, N-terminal (1);	0.591738	0.18420	U	0.141775	T	0.15652	0.0377	L	0.57536	1.79	0.29984	N	0.817415	B	0.21225	0.053	B	0.27076	0.076	T	0.10567	-1.0624	10	0.54805	T	0.06	-13.8999	3.5969	0.08009	0.6554:0.0:0.1599:0.1847	.	12	P04198	MYCN_HUMAN	V	12	ENSP00000281043:M12V	ENSP00000281043:M12V	M	+	1	0	MYCN	15999671	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	3.202000	0.51067	1.313000	0.45069	0.459000	0.35465	ATG	.		0.637	MYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095469.2	NM_005378	
MYO1G	64005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	45005391	45005391	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr7:45005391C>T	ENST00000258787.7	-	17	2362	c.2226G>A	c.(2224-2226)tgG>tgA	p.W742*		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	742						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						GTCTCCGGAACCAGCGCATGA	0.672																																					p.W742X		.											.	MYO1G	137	0			c.G2226A						.						52.0	52.0	52.0					7																	45005391		2203	4300	6503	SO:0001587	stop_gained	64005	exon17			CCGGAACCAGCGC	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.2226G>A	7.37:g.45005391C>T	ENSP00000258787:p.Trp742*	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	14.0	NM_033054	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Nonsense_Mutation	SNP	ENST00000258787.7	37	CCDS34629.1	.	.	.	.	.	.	.	.	.	.	C	39	7.449687	0.98292	.	.	ENSG00000136286	ENST00000258787	.	.	.	3.96	0.357	0.16079	.	0.485344	0.15512	U	0.258512	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	14.1344	0.65276	0.0:0.2823:0.7177:0.0	.	.	.	.	X	742	.	ENSP00000258787:W742X	W	-	3	0	MYO1G	44971916	0.998000	0.40836	1.000000	0.80357	0.976000	0.68499	1.310000	0.33551	0.233000	0.21120	0.462000	0.41574	TGG	.		0.672	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341832.2		
MYO5B	4645	ucsc.edu;bcgsc.ca	37	18	47367793	47367793	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr18:47367793A>G	ENST00000285039.7	-	35	4942	c.4643T>C	c.(4642-4644)tTc>tCc	p.F1548S	MYO5B_ENST00000592688.1_Missense_Mutation_p.F118S|MYO5B_ENST00000324581.6_Missense_Mutation_p.F663S|SCARNA17_ENST00000589499.1_RNA	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1548	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GGATAACCAGAATGACGTCAT	0.517																																					p.F1548S		.											.	MYO5B	72	0			c.T4643C						.						163.0	164.0	164.0					18																	47367793		2037	4190	6227	SO:0001583	missense	4645	exon35			AACCAGAATGACG	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.4643T>C	18.37:g.47367793A>G	ENSP00000285039:p.Phe1548Ser	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	37	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.592314	0.86953	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.25749	1.78;1.78	4.78	4.78	0.61160	Dilute (1);	0.000000	0.85682	D	0.000000	T	0.56124	0.1964	M	0.87269	2.87	0.80722	D	1	B;D	0.89917	0.209;1.0	B;D	0.85130	0.141;0.997	T	0.65047	-0.6263	10	0.87932	D	0	.	14.4443	0.67340	1.0:0.0:0.0:0.0	.	1548;663	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	S	1548;663	ENSP00000285039:F1548S;ENSP00000315531:F663S	ENSP00000285039:F1548S	F	-	2	0	MYO5B	45621791	1.000000	0.71417	0.993000	0.49108	0.975000	0.68041	9.073000	0.93992	2.131000	0.65755	0.533000	0.62120	TTC	.		0.517	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
NLRP6	171389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	281055	281055	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr11:281055G>C	ENST00000312165.5	+	4	1321	c.1321G>C	c.(1321-1323)Gac>Cac	p.D441H	NLRP6_ENST00000534750.1_Missense_Mutation_p.D441H	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	441	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GTTGCAGGGCGACCTGCGCAA	0.657																																					p.D441H		.											.	NLRP6	583	0			c.G1321C						.						57.0	65.0	62.0					11																	281055		2202	4296	6498	SO:0001583	missense	171389	exon4			CAGGGCGACCTGC	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.1321G>C	11.37:g.281055G>C	ENSP00000309767:p.Asp441His	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	17.0	NM_138329	A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	37	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	G	1.891	-0.455583	0.04540	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.75154	-0.91;-0.9	3.26	1.21	0.21127	NACHT nucleoside triphosphatase (1);	0.195037	0.25338	N	0.031390	T	0.49525	0.1562	N	0.04508	-0.205	0.09310	N	1	B;P	0.45240	0.007;0.854	B;B	0.43274	0.002;0.414	T	0.46638	-0.9177	10	0.30854	T	0.27	.	7.304	0.26436	0.0:0.186:0.6225:0.1915	.	441;441	E9PJZ8;P59044	.;NALP6_HUMAN	H	441	ENSP00000433617:D441H;ENSP00000309767:D441H	ENSP00000309767:D441H	D	+	1	0	NLRP6	271055	0.000000	0.05858	0.068000	0.19968	0.563000	0.35712	0.153000	0.16323	0.327000	0.23409	0.455000	0.32223	GAC	.		0.657	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
NPHS1	4868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36339602	36339602	+	Silent	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:36339602C>T	ENST00000378910.5	-	9	1106	c.1107G>A	c.(1105-1107)cgG>cgA	p.R369R	NPHS1_ENST00000591817.1_5'Flank|NPHS1_ENST00000353632.6_Silent_p.R369R	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	369	Ig-like C2-type 4.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTAGCAGAACCCGCGGGCGAC	0.597																																					p.R369R		.											.	NPHS1	49	0			c.G1107A						.						55.0	51.0	53.0					19																	36339602		2203	4300	6503	SO:0001819	synonymous_variant	4868	exon9			CAGAACCCGCGGG		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.1107G>A	19.37:g.36339602C>T		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	50.0	NM_004646	A6NDH2|C3RX61	Silent	SNP	ENST00000378910.5	37	CCDS32996.1																																																																																			.		0.597	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
NTRK3	4916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	88472662	88472662	+	Silent	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr15:88472662G>T	ENST00000360948.2	-	16	2054	c.1893C>A	c.(1891-1893)gcC>gcA	p.A631A	NTRK3_ENST00000558676.1_Silent_p.A623A|NTRK3_ENST00000542733.2_Silent_p.A533A|NTRK3_ENST00000355254.2_Silent_p.A631A|NTRK3_ENST00000557856.1_Silent_p.A623A|NTRK3_ENST00000357724.2_Silent_p.A623A|NTRK3_ENST00000394480.2_Silent_p.A631A	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	631	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTGGCCCATGGGCCCTGCAAG	0.592			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.A631A		.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	3538	0			c.C1893A						.						38.0	37.0	37.0					15																	88472662		2201	4299	6500	SO:0001819	synonymous_variant	4916	exon17			CCCATGGGCCCTG	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1893C>A	15.37:g.88472662G>T		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	39.0	NM_001012338	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	37	CCDS32322.1																																																																																			.		0.592	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
OC90	729330	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	133053841	133053841	+	Missense_Mutation	SNP	C	C	A	rs372434452		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr8:133053841C>A	ENST00000443356.2	-	5	361	c.275G>T	c.(274-276)cGa>cTa	p.R92L	OC90_ENST00000254627.3_Missense_Mutation_p.R92L|OC90_ENST00000262283.5_Missense_Mutation_p.R288L|OC90_ENST00000603859.1_Missense_Mutation_p.R92L			Q02509	OC90_HUMAN	otoconin 90	92	Phospholipase A2-like 1.				lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			TTCAAAGTCTCGGGGGCAGAG	0.527																																					p.R92L		.											.	OC90	206	0			c.G275T						.						46.0	47.0	47.0					8																	133053841		1998	4165	6163	SO:0001583	missense	729330	exon5			AAGTCTCGGGGGC	Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.275G>T	8.37:g.133053841C>A	ENSP00000390050:p.Arg92Leu	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	270.0	84.0	NM_001080399	B4DNG8	Missense_Mutation	SNP	ENST00000443356.2	37		.	.	.	.	.	.	.	.	.	.	C	20.9	4.073290	0.76415	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.23552	1.9;1.9;1.9	5.88	4.9	0.64082	Phospholipase A2 (3);	0.204155	0.39909	N	0.001230	T	0.26011	0.0634	N	0.04880	-0.145	0.34035	D	0.654297	D;D	0.89917	1.0;1.0	D;D	0.78314	0.985;0.991	T	0.27331	-1.0077	10	0.35671	T	0.21	-24.1919	10.1278	0.42661	0.0:0.8788:0.0:0.1212	.	92;92	Q02509-2;Q02509	.;OC90_HUMAN	L	92;92;288	ENSP00000254627:R92L;ENSP00000390050:R92L;ENSP00000262283:R288L	ENSP00000254627:R92L	R	-	2	0	RP11-240B13.2;OC90	133123023	0.991000	0.36638	0.998000	0.56505	0.991000	0.79684	2.905000	0.48727	2.790000	0.95986	0.591000	0.81541	CGA	.		0.527	OC90-201	KNOWN	basic	protein_coding	protein_coding		NM_001080399	
OR1A2	26189	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	3101458	3101458	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr17:3101458T>C	ENST00000381951.1	+	1	646	c.646T>C	c.(646-648)Tcc>Ccc	p.S216P		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	216					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						CATCATTGTCTCCTATGTTCA	0.448																																					p.S216P		.											.	OR1A2	70	0			c.T646C						.						233.0	201.0	212.0					17																	3101458		2203	4300	6503	SO:0001583	missense	26189	exon1			ATTGTCTCCTATG	AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.646T>C	17.37:g.3101458T>C	ENSP00000371377:p.Ser216Pro	Somatic	620.0	0.0		WXS	Illumina HiSeq	Phase_I	354.0	32.0	NM_012352	Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	ENST00000381951.1	37	CCDS11021.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.686963	0.48097	.	.	ENSG00000172150	ENST00000381951	T	0.46819	0.86	4.09	4.09	0.47781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000159	T	0.77458	0.4133	H	0.96576	3.845	0.38894	D	0.957189	D	0.89917	1.0	D	0.91635	0.999	D	0.85604	0.1254	10	0.87932	D	0	.	12.3223	0.54991	0.0:0.0:0.0:1.0	.	216	Q9Y585	OR1A2_HUMAN	P	216	ENSP00000371377:S216P	ENSP00000371377:S216P	S	+	1	0	OR1A2	3048208	1.000000	0.71417	0.871000	0.34182	0.066000	0.16364	6.986000	0.76200	1.850000	0.53721	0.496000	0.49642	TCC	.		0.448	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207293.1	NM_012352	
OR4Q3	441669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	20215599	20215599	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr14:20215599C>G	ENST00000331723.1	+	1	13	c.13C>G	c.(13-15)Caa>Gaa	p.Q5E		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GAAAAAAGAACAAGATTCTAA	0.318																																					p.Q5E		.											.	OR4Q3	71	0			c.C13G						.						100.0	101.0	101.0					14																	20215599		2203	4300	6503	SO:0001583	missense	441669	exon1			AAAGAACAAGATT	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.13C>G	14.37:g.20215599C>G	ENSP00000330049:p.Gln5Glu	Somatic	868.0	0.0		WXS	Illumina HiSeq	Phase_I	821.0	172.0	NM_172194	Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	37	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	3.049	-0.195873	0.06259	.	.	ENSG00000182652	ENST00000331723	T	0.00573	6.48	4.32	3.17	0.36434	.	0.345098	0.20123	U	0.098754	T	0.00468	0.0015	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49303	-0.8954	10	0.87932	D	0	.	9.088	0.36592	0.8096:0.1903:0.0:0.0	.	5	Q8NH05	OR4Q3_HUMAN	E	5	ENSP00000330049:Q5E	ENSP00000330049:Q5E	Q	+	1	0	OR4Q3	19285439	0.980000	0.34600	0.060000	0.19600	0.276000	0.26787	0.927000	0.28818	0.695000	0.31675	-0.598000	0.04106	CAA	.		0.318	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2		
OR4N5	390437	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20612767	20612767	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr14:20612767C>A	ENST00000333629.1	+	1	873	c.873C>A	c.(871-873)aaC>aaA	p.N291K	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	291						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CGCTTCGCAACCAGGAGGTGA	0.413																																					p.N291K		.											.	OR4N5	69	0			c.C873A						.						90.0	90.0	90.0					14																	20612767		2203	4300	6503	SO:0001583	missense	390437	exon1			TCGCAACCAGGAG		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.873C>A	14.37:g.20612767C>A	ENSP00000332110:p.Asn291Lys	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	65.0	NM_001004724	Q6IF11	Missense_Mutation	SNP	ENST00000333629.1	37	CCDS32031.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.836518	0.50951	.	.	ENSG00000184394	ENST00000333629	T	0.50001	0.76	4.0	-1.13	0.09775	.	0.000000	0.47852	D	0.000203	T	0.62768	0.2455	H	0.94542	3.55	0.27766	N	0.94364	D	0.60160	0.987	P	0.51742	0.678	T	0.62426	-0.6857	10	0.87932	D	0	.	8.5173	0.33253	0.0:0.5099:0.0:0.4901	.	291	Q8IXE1	OR4N5_HUMAN	K	291	ENSP00000332110:N291K	ENSP00000332110:N291K	N	+	3	2	OR4N5	19682607	0.000000	0.05858	0.996000	0.52242	0.990000	0.78478	-0.654000	0.05354	-0.121000	0.11787	0.655000	0.94253	AAC	.		0.413	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410347.1		
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	56106175	56106177	+	In_Frame_Del	DEL	CAT	CAT	-			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	CAT	CAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:56106175_56106177delCAT	ENST00000320301.6	-	6	936_938	c.542_544delATG	c.(541-546)gatgga>gga	p.D181del	PCDH15_ENST00000395438.1_In_Frame_Del_p.D181del|AC013737.1_ENST00000583830.1_RNA|PCDH15_ENST00000437009.1_In_Frame_Del_p.D181del|PCDH15_ENST00000414778.1_In_Frame_Del_p.D186del|PCDH15_ENST00000395432.2_In_Frame_Del_p.D181del|PCDH15_ENST00000395430.1_In_Frame_Del_p.D181del|PCDH15_ENST00000395442.1_In_Frame_Del_p.D181del|PCDH15_ENST00000373957.3_In_Frame_Del_p.D159del|PCDH15_ENST00000395445.1_In_Frame_Del_p.D181del|PCDH15_ENST00000395440.1_In_Frame_Del_p.D181del|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395433.1_In_Frame_Del_p.D159del|PCDH15_ENST00000395446.1_In_Frame_Del_p.D181del|PCDH15_ENST00000373965.2_In_Frame_Del_p.D181del|PCDH15_ENST00000373955.1_In_Frame_Del_p.D181del|PCDH15_ENST00000361849.3_In_Frame_Del_p.D181del	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	181	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CCATTTGGTCCATCATCTATATC	0.315										HNSCC(58;0.16)																											p.186_187del		.											.	PCDH15	193	0			c.557_559del						.																																			SO:0001651	inframe_deletion	65217	exon7			TTGGTCCATCATC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.542_544delATG	10.37:g.56106178_56106180delCAT	ENSP00000322604:p.Asp181del	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	62.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	In_Frame_Del	DEL	ENST00000320301.6	37	CCDS7248.1																																																																																			.		0.315	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
PCDHGB2	56103	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140741069	140741069	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr5:140741069C>T	ENST00000522605.1	+	1	1367	c.1367C>T	c.(1366-1368)tCc>tTc	p.S456F	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	456	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACAGACTTCCTACATGGTT	0.567																																					p.S456F		.											.	PCDHGB2	33	0			c.C1367T						.						99.0	101.0	101.0					5																	140741069		2054	4199	6253	SO:0001583	missense	56103	exon1			AGACTTCCTACAT	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1367C>T	5.37:g.140741069C>T	ENSP00000429018:p.Ser456Phe	Somatic	161.0	1.0		WXS	Illumina HiSeq	Phase_I	130.0	57.0	NM_018923	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	0.215	-1.033489	0.02029	.	.	ENSG00000253910	ENST00000522605	T	0.02709	4.19	5.41	0.288	0.15719	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.04407	0.0121	L	0.58810	1.83	0.09310	N	1	B;B	0.20368	0.023;0.044	B;B	0.25291	0.059;0.026	T	0.33343	-0.9872	9	0.62326	D	0.03	.	8.588	0.33670	0.0:0.6012:0.2085:0.1903	.	456;456	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	F	456	ENSP00000429018:S456F	ENSP00000429018:S456F	S	+	2	0	PCDHGB2	140721253	0.000000	0.05858	0.041000	0.18516	0.008000	0.06430	-0.249000	0.08842	-0.111000	0.12001	-1.255000	0.01485	TCC	.		0.567	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374741.1	NM_018923	
PLEKHG5	57449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	6530878	6530878	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:6530878G>A	ENST00000400915.3	-	15	1693	c.1627C>T	c.(1627-1629)Cgg>Tgg	p.R543W	PLEKHG5_ENST00000377728.3_Missense_Mutation_p.R487W|PLEKHG5_ENST00000537245.1_Missense_Mutation_p.R566W|PLEKHG5_ENST00000377725.1_Missense_Mutation_p.R487W|PLEKHG5_ENST00000544978.1_Missense_Mutation_p.R487W|PLEKHG5_ENST00000377740.3_Missense_Mutation_p.R564W|PLEKHG5_ENST00000377732.1_Missense_Mutation_p.R524W|PLEKHG5_ENST00000377748.1_Missense_Mutation_p.R564W|PLEKHG5_ENST00000400913.1_Missense_Mutation_p.R487W|PLEKHG5_ENST00000377737.2_Missense_Mutation_p.R487W|PLEKHG5_ENST00000340850.5_Missense_Mutation_p.R487W|PLEKHG5_ENST00000535355.1_Missense_Mutation_p.R556W	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	543	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		TTGGTGAGCCGCTGGTGGGGT	0.677																																					p.R566W		.											.	PLEKHG5	652	0			c.C1696T						.						17.0	15.0	16.0					1																	6530878		2200	4290	6490	SO:0001583	missense	57449	exon15			TGAGCCGCTGGTG	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.1627C>T	1.37:g.6530878G>A	ENSP00000383706:p.Arg543Trp	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	47.0	NM_001265592	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Missense_Mutation	SNP	ENST00000400915.3	37	CCDS41241.1	.	.	.	.	.	.	.	.	.	.	g	18.42	3.620802	0.66787	.	.	ENSG00000171680	ENST00000377748;ENST00000340850;ENST00000400913;ENST00000400915;ENST00000377740;ENST00000377732;ENST00000377728;ENST00000377725;ENST00000535355;ENST00000377737;ENST00000535966;ENST00000537245;ENST00000544978	D;D;D;D;D;D;D;D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34;-2.34;-2.34;-2.34;-2.34;-2.34;-2.34;-2.34	4.55	3.52	0.40303	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.95233	0.8454	H	0.96547	3.84	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.96472	0.9349	10	0.87932	D	0	-29.4198	13.9756	0.64271	0.0:0.0:0.8375:0.1625	.	556;487;564;564;543	F5GZ21;O94827-4;Q5SY18;O94827-2;O94827	.;.;.;.;PKHG5_HUMAN	W	564;487;487;543;564;524;487;487;556;487;393;566;487	ENSP00000366977:R564W;ENSP00000344570:R487W;ENSP00000383704:R487W;ENSP00000383706:R543W;ENSP00000366969:R564W;ENSP00000366961:R524W;ENSP00000366957:R487W;ENSP00000366954:R487W;ENSP00000441445:R556W;ENSP00000366966:R487W;ENSP00000439625:R566W;ENSP00000437710:R487W	ENSP00000344570:R487W	R	-	1	2	PLEKHG5	6453465	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.438000	0.52871	2.069000	0.61940	0.457000	0.33378	CGG	.		0.677	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000002631.1	NM_020631	
PLXNA4	91584	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	132192587	132192587	+	Missense_Mutation	SNP	G	G	A	rs200648753		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr7:132192587G>A	ENST00000359827.3	-	2	1828	c.866C>T	c.(865-867)gCc>gTc	p.A289V	PLXNA4_ENST00000378539.5_Missense_Mutation_p.A289V|PLXNA4_ENST00000423507.2_Missense_Mutation_p.A289V|PLXNA4_ENST00000321063.4_Missense_Mutation_p.A289V			Q9HCM2	PLXA4_HUMAN	plexin A4	289	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGAGTTGAAGGCTGTGTCCTC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		19745	0.001		0.0	False		,,,				2504	0.0				p.A289V		.											.	PLXNA4	91	0			c.C866T						.						69.0	49.0	56.0					7																	132192587		2203	4300	6503	SO:0001583	missense	91584	exon2			TTGAAGGCTGTGT	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.866C>T	7.37:g.132192587G>A	ENSP00000352882:p.Ala289Val	Somatic	62.0	1.0		WXS	Illumina HiSeq	Phase_I	81.0	36.0	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	23.6	4.437674	0.83885	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.10763	2.84;2.84;2.84;2.84	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.64402	U	0.000007	T	0.26122	0.0637	L	0.59436	1.845	0.80722	D	1	P;P;P	0.51057	0.928;0.941;0.853	P;P;P	0.55871	0.775;0.786;0.545	T	0.00115	-1.2038	10	0.30078	T	0.28	.	19.8868	0.96915	0.0:0.0:1.0:0.0	.	289;289;289	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	V	289	ENSP00000323194:A289V;ENSP00000352882:A289V;ENSP00000392772:A289V;ENSP00000367800:A289V	ENSP00000323194:A289V	A	-	2	0	PLXNA4	131843127	1.000000	0.71417	0.999000	0.59377	0.795000	0.44927	4.547000	0.60712	2.709000	0.92574	0.655000	0.94253	GCC	G|0.999;A|0.000		0.582	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
POMT2	29954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	77746417	77746417	+	Missense_Mutation	SNP	G	G	A	rs148466370		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr14:77746417G>A	ENST00000261534.4	-	17	1934	c.1732C>T	c.(1732-1734)Cgc>Tgc	p.R578C		NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	578						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CCTGAGAAGCGTAGGCCCTGT	0.597																																					p.R578C		.											.	POMT2	91	0			c.C1732T						.	G	CYS/ARG	0,4406		0,0,2203	118.0	97.0	104.0		1732	5.7	1.0	14	dbSNP_134	104	1,8599	1.2+/-3.3	0,1,4299	yes	missense	POMT2	NM_013382.5	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	578/751	77746417	1,13005	2203	4300	6503	SO:0001583	missense	29954	exon17			AGAAGCGTAGGCC	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.1732C>T	14.37:g.77746417G>A	ENSP00000261534:p.Arg578Cys	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	37.0	NM_013382	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	37	CCDS9857.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346254	0.82022	0.0	1.16E-4	ENSG00000009830	ENST00000261534	D	0.92397	-3.03	5.67	5.67	0.87782	.	0.051252	0.85682	D	0.000000	D	0.94837	0.8332	M	0.81942	2.565	0.80722	D	1	D	0.69078	0.997	P	0.53360	0.724	D	0.93847	0.7142	10	0.38643	T	0.18	-12.6745	19.7763	0.96395	0.0:0.0:1.0:0.0	.	578	Q9UKY4	POMT2_HUMAN	C	578	ENSP00000261534:R578C	ENSP00000261534:R578C	R	-	1	0	POMT2	76816170	1.000000	0.71417	1.000000	0.80357	0.745000	0.42441	7.115000	0.77110	2.687000	0.91594	0.563000	0.77884	CGC	G|1.000;A|0.000		0.597	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
POTEJ	653781	bcgsc.ca;mdanderson.org	37	2	131414998	131414998	+	Missense_Mutation	SNP	G	G	A	rs552963799		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:131414998G>A	ENST00000409602.1	+	15	2717	c.2665G>A	c.(2665-2667)Gag>Aag	p.E889K		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	889	Actin-like.				retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						CTTCGAGCAGGAGATGGCCAT	0.597													g|||	1	0.000199681	0.0008	0.0	5008	,	,		23081	0.0		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.																																			SO:0001583	missense	653781	.			GAGCAGGAGATGG		CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.2665G>A	2.37:g.131414998G>A	ENSP00000387176:p.Glu889Lys	Somatic	87.0	2.0		WXS	Illumina HiSeq	Phase_1	120.0	40.0	.		Missense_Mutation	SNP	ENST00000409602.1	37	CCDS59432.1	.	.	.	.	.	.	.	.	.	.	.	14.45	2.538046	0.45176	.	.	ENSG00000222038	ENST00000409602	T	0.11277	2.79	0.736	0.736	0.18307	.	.	.	.	.	T	0.33118	0.0852	H	0.95187	3.635	0.27230	N	0.959416	.	.	.	.	.	.	T	0.14559	-1.0468	7	0.87932	D	0	.	6.9195	0.24380	1.0E-4:0.0:0.9999:0.0	.	.	.	.	K	889	ENSP00000387176:E889K	ENSP00000387176:E889K	E	+	1	0	POTEJ	131131468	1.000000	0.71417	0.263000	0.24496	0.267000	0.26476	6.561000	0.73955	0.132000	0.18615	0.134000	0.15878	GAG	.		0.597	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000333665.1	XM_929706	
PRRT1	80863	broad.mit.edu;mdanderson.org	37	6	32118206	32118206	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr6:32118206G>T	ENST00000211413.5	-	2	621	c.497C>A	c.(496-498)cCc>cAc	p.P166H	PRRT1_ENST00000375150.2_Missense_Mutation_p.P85H|PRRT1_ENST00000375152.2_Missense_Mutation_p.P85H|PRRT1_ENST00000467780.1_5'Flank	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1	166					response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						GGGGTATCCGGGCGCTACGTA	0.721																																					p.P166H		.											.	PRRT1	153	0			c.C497A						.						25.0	23.0	24.0					6																	32118206		1505	2705	4210	SO:0001583	missense	80863	exon2			TATCCGGGCGCTA	AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.497C>A	6.37:g.32118206G>T	ENSP00000211413:p.Pro166His	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	6.0	NM_030651	A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	Missense_Mutation	SNP	ENST00000211413.5	37	CCDS4739.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923602	0.73213	.	.	ENSG00000204314	ENST00000211413;ENST00000375150;ENST00000375152	D;D;D	0.93488	-3.23;-3.22;-3.22	3.82	3.82	0.43975	.	.	.	.	.	D	0.91506	0.7318	N	0.24115	0.695	0.48762	D	0.999707	D;D	0.89917	0.999;1.0	P;D	0.68353	0.907;0.957	D	0.93089	0.6498	9	0.72032	D	0.01	.	13.2161	0.59861	0.0:0.0:1.0:0.0	.	166;85	Q99946;Q99946-2	PRRT1_HUMAN;.	H	166;85;85	ENSP00000211413:P166H;ENSP00000364292:P85H;ENSP00000364294:P85H	ENSP00000211413:P166H	P	-	2	0	PRRT1	32226184	1.000000	0.71417	0.749000	0.31150	0.969000	0.65631	8.359000	0.90093	1.691000	0.51100	0.491000	0.48974	CCC	.		0.721	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076255.2	NM_030651	
PSPC1	55269	broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	20277467	20277467	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr13:20277467G>T	ENST00000338910.4	-	9	1579	c.1420C>A	c.(1420-1422)Cag>Aag	p.Q474K		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	474	Gly-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		GAACCCATCTGAGATGGTGGT	0.458																																					p.Q474K		.											.	PSPC1	135	0			c.C1420A						.						25.0	28.0	27.0					13																	20277467		1837	4083	5920	SO:0001583	missense	55269	exon10			CCATCTGAGATGG	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.1420C>A	13.37:g.20277467G>T	ENSP00000343966:p.Gln474Lys	Somatic	655.0	0.0		WXS	Illumina HiSeq	Phase_I	606.0	42.0	NM_001042414	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Missense_Mutation	SNP	ENST00000338910.4	37	CCDS41870.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814283	0.32053	.	.	ENSG00000121390	ENST00000338910;ENST00000422828	T	0.14266	2.52	5.4	5.4	0.78164	.	0.067524	0.64402	D	0.000020	T	0.21631	0.0521	L	0.34521	1.04	0.51767	D	0.999939	P	0.40332	0.713	P	0.51742	0.678	T	0.02288	-1.1182	10	0.18276	T	0.48	-15.1979	19.1702	0.93574	0.0:0.0:1.0:0.0	.	474	Q8WXF1	PSPC1_HUMAN	K	474;414	ENSP00000343966:Q474K	ENSP00000343966:Q474K	Q	-	1	0	PSPC1	19175467	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.438000	0.80431	2.529000	0.85273	0.484000	0.47621	CAG	.		0.458	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2		
RAB40A	142684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	102755566	102755566	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chrX:102755566T>A	ENST00000372633.1	-	1	2237	c.119A>T	c.(118-120)gAg>gTg	p.E40V	RAB40A_ENST00000304236.1_Missense_Mutation_p.E40V|LL0XNC01-250H12.3_ENST00000445990.1_RNA			Q8WXH6	RB40A_HUMAN	RAB40A, member RAS oncogene family	40					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	12						GTACGGGGACTCAGCTGCACC	0.622																																					p.E40V		.											.	RAB40A	227	0			c.A119T						.						118.0	105.0	109.0					X																	102755566		2203	4300	6503	SO:0001583	missense	142684	exon3			GGGGACTCAGCTG	AF132748	CCDS35357.1	Xq22.1	2009-08-25			ENSG00000172476	ENSG00000172476		"""RAB, member RAS oncogene"""	18283	protein-coding gene	gene with protein product						11697911	Standard	NM_080879		Approved	RAR2A, Rar-2	uc004ekk.3	Q8WXH6	OTTHUMG00000022100	ENST00000372633.1:c.119A>T	X.37:g.102755566T>A	ENSP00000361716:p.Glu40Val	Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	281.0	104.0	NM_080879	O00407|Q17RQ5|Q6DK06|Q8TF06	Missense_Mutation	SNP	ENST00000372633.1	37	CCDS35357.1	.	.	.	.	.	.	.	.	.	.	.	16.52	3.146237	0.57044	.	.	ENSG00000172476	ENST00000372633;ENST00000304236	T;T	0.76968	-1.06;-1.06	1.53	1.53	0.23141	Small GTP-binding protein domain (1);	0.000000	0.47455	U	0.000231	T	0.55816	0.1944	N	0.17345	0.48	0.58432	D	0.999995	P	0.39352	0.669	B	0.34931	0.192	T	0.50110	-0.8866	10	0.39692	T	0.17	.	6.8887	0.24216	0.0:0.0:0.0:1.0	.	40	Q8WXH6	RB40A_HUMAN	V	40	ENSP00000361716:E40V;ENSP00000305648:E40V	ENSP00000305648:E40V	E	-	2	0	RAB40A	102642222	1.000000	0.71417	0.017000	0.16124	0.029000	0.11900	5.041000	0.64196	0.580000	0.29522	0.235000	0.17854	GAG	.		0.622	RAB40A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057714.1		
RASA1	5921	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	86637134	86637134	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr5:86637134A>T	ENST00000274376.6	+	6	1609	c.1045A>T	c.(1045-1047)Aaa>Taa	p.K349*	RASA1_ENST00000506290.1_Nonsense_Mutation_p.K183*|RASA1_ENST00000512763.1_Nonsense_Mutation_p.K182*|RASA1_ENST00000456692.2_Nonsense_Mutation_p.K172*	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	349					blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ACATGAAGGAAAAATGTGAGT	0.234																																					p.K349X		.											.	RASA1	661	0			c.A1045T						.						8.0	9.0	8.0					5																	86637134		1184	2214	3398	SO:0001587	stop_gained	5921	exon6			GAAGGAAAAATGT		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1045A>T	5.37:g.86637134A>T	ENSP00000274376:p.Lys349*	Somatic	167.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	49.0	NM_002890	B2R6W3|Q9UDI1	Nonsense_Mutation	SNP	ENST00000274376.6	37	CCDS34200.1	.	.	.	.	.	.	.	.	.	.	A	44	10.633254	0.99441	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	.	.	.	5.01	5.01	0.66863	.	0.045776	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6756	0.68978	1.0:0.0:0.0:0.0	.	.	.	.	X	349;382;172;182;183	.	ENSP00000274376:K349X	K	+	1	0	RASA1	86672890	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.121000	0.94375	2.016000	0.59253	0.533000	0.62120	AAA	.		0.234	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369729.1	NM_002890	
RFX1	5989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14092957	14092957	+	Silent	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:14092957G>A	ENST00000254325.4	-	5	831	c.597C>T	c.(595-597)acC>acT	p.T199T		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	199					immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			GCACCTGCTGGGTACCATGGA	0.642																																					p.T199T		.											.	RFX1	92	0			c.C597T						.						55.0	50.0	52.0					19																	14092957		2203	4300	6503	SO:0001819	synonymous_variant	5989	exon5			CTGCTGGGTACCA		CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.597C>T	19.37:g.14092957G>A		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	50.0	NM_002918		Silent	SNP	ENST00000254325.4	37	CCDS12301.1																																																																																			.		0.642	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458510.1	NM_002918	
RLIM	51132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	73811891	73811891	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chrX:73811891A>T	ENST00000332687.6	-	4	1477	c.1259T>A	c.(1258-1260)aTg>aAg	p.M420K	RLIM_ENST00000349225.2_Missense_Mutation_p.M420K	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	420					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ATCACTGTACATAAAATAGCT	0.428																																					p.M420K	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM	228	0			c.T1259A						.						97.0	90.0	93.0					X																	73811891		2203	4300	6503	SO:0001583	missense	51132	exon5			CTGTACATAAAAT	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1259T>A	X.37:g.73811891A>T	ENSP00000328059:p.Met420Lys	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	88.0	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	ENST00000332687.6	37	CCDS14427.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429224	0.43122	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.10477	2.87;2.87	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.34250	0.0891	M	0.79693	2.465	0.80722	D	1	D	0.60160	0.987	D	0.66196	0.942	T	0.15925	-1.0420	10	0.87932	D	0	-1.959	14.696	0.69121	1.0:0.0:0.0:0.0	.	420	Q9NVW2	RNF12_HUMAN	K	420	ENSP00000328059:M420K;ENSP00000253571:M420K	ENSP00000328059:M420K	M	-	2	0	RLIM	73728616	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	8.903000	0.92573	1.851000	0.53745	0.486000	0.48141	ATG	.		0.428	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RUSC1	23623	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	1	155290718	155290718	+	5'UTR	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:155290718C>A	ENST00000368352.5	+	0	1				RUSC1_ENST00000368354.3_5'UTR|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CTCTGTGCCCCGCCGGGCGGG	0.726																																					p.G188W		.											.	.	.	0			c.G562T						.						17.0	21.0	20.0					1																	155290718		1882	4080	5962	SO:0001623	5_prime_UTR_variant	284618	exon2			GTGCCCCGCCGGG	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.-151C>A	1.37:g.155290718C>A		Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	13.0	NM_001039517	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	37	CCDS41410.1																																																																																			.		0.726	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
RXRB	6257	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33165688	33165688	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr6:33165688C>A	ENST00000374680.3	-	4	882	c.671G>T	c.(670-672)gGt>gTt	p.G224V	RXRB_ENST00000544186.1_Missense_Mutation_p.G34V|RNY4P10_ENST00000365571.1_RNA|SLC39A7_ENST00000374675.3_5'Flank|RXRB_ENST00000374685.4_Missense_Mutation_p.G224V|SLC39A7_ENST00000374677.3_5'Flank|RXRB_ENST00000413614.2_Missense_Mutation_p.G128V	NM_001270401.1|NM_021976.4	NP_001257330.1|NP_068811.1	P28702	RXRB_HUMAN	retinoid X receptor, beta	224					cardiac muscle cell proliferation (GO:0060038)|cellular response to retinoic acid (GO:0071300)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(1)|skin(2)	15					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Tazarotene(DB00799)|Tretinoin(DB00755)	GCCCTTGCAACCCTCACAGCT	0.512																																					p.G224V		.											.	RXRB	189	0			c.G671T						.						74.0	59.0	64.0					6																	33165688		1511	2709	4220	SO:0001583	missense	6257	exon4			TTGCAACCCTCAC	M84820	CCDS4768.1, CCDS59007.1	6p21.3	2013-01-16			ENSG00000204231	ENSG00000204231		"""Nuclear hormone receptors"""	10478	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 2"""	180246				8257090	Standard	NM_021976		Approved	NR2B2, H-2RIIBP, RCoR-1	uc003odc.4	P28702	OTTHUMG00000031298	ENST00000374680.3:c.671G>T	6.37:g.33165688C>A	ENSP00000363812:p.Gly224Val	Somatic	117.0	2.0		WXS	Illumina HiSeq	Phase_I	201.0	43.0	NM_021976	P28703|Q59G65|Q5JP92|Q5STQ1	Missense_Mutation	SNP	ENST00000374680.3	37	CCDS4768.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.683420	0.68157	.	.	ENSG00000204231	ENST00000374685;ENST00000374680;ENST00000544186;ENST00000413614	D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28	4.67	4.67	0.58626	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.99067	0.9680	H	0.97940	4.11	0.80722	D	1	D;D;D;D;D;P;P;P	0.89917	1.0;0.997;0.994;0.986;0.99;0.827;0.906;0.827	D;D;D;D;D;P;P;P	0.97110	1.0;0.946;0.99;0.955;0.967;0.521;0.773;0.521	D	0.99075	1.0835	10	0.87932	D	0	.	15.1286	0.72503	0.0:1.0:0.0:0.0	.	128;224;107;34;224;224;264;224	B7Z3E4;B7Z6J2;B7Z6X3;E9PK95;Q5STQ1;Q5STP9;Q59G65;P28702	.;.;.;.;.;.;.;RXRB_HUMAN	V	224;224;34;128	ENSP00000363817:G224V;ENSP00000363812:G224V;ENSP00000439222:G34V;ENSP00000415561:G128V	ENSP00000363812:G224V	G	-	2	0	RXRB	33273666	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.644000	0.83416	2.428000	0.82296	0.448000	0.29417	GGT	.		0.512	RXRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076642.2	NM_021976	
SCN1A	6323	broad.mit.edu;bcgsc.ca	37	2	166897747	166897747	+	Silent	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:166897747T>C	ENST00000303395.4	-	13	2408	c.2409A>G	c.(2407-2409)ggA>ggG	p.G803G	AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA|SCN1A_ENST00000375405.3_Silent_p.G792G|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000423058.2_Silent_p.G803G|SCN1A_ENST00000409050.1_Silent_p.G775G			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	803					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTACCAAGTTTCCTACTGTAA	0.363																																					p.G803G		.											.	SCN1A	147	0			c.A2409G						.						72.0	65.0	68.0					2																	166897747		2203	4300	6503	SO:0001819	synonymous_variant	6323	exon13			CAAGTTTCCTACT	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2409A>G	2.37:g.166897747T>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	6.0	NM_001165963	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Silent	SNP	ENST00000303395.4	37	CCDS54413.1																																																																																			.		0.363	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102661.1	NM_006920	
SHF	90525	ucsc.edu;bcgsc.ca	37	15	45465913	45465913	+	Splice_Site	SNP	A	A	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr15:45465913A>G	ENST00000290894.8	-	5	1148	c.654T>C	c.(652-654)gtT>gtC	p.V218V	SHF_ENST00000458022.2_Intron|SHF_ENST00000560734.1_Intron|SHF_ENST00000318390.6_Intron|SHF_ENST00000561091.1_5'Flank|SHF_ENST00000560540.1_Intron|RP11-519G16.2_ENST00000560034.1_RNA|SHF_ENST00000560471.1_Splice_Site_p.V283V	NM_138356.2	NP_612365			Src homology 2 domain containing F											endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(2)	12		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		CCTTAATGTCAACTGGAGCCA	0.557																																					p.V218V		.											.	SHF	69	0			c.T654C						.						24.0	20.0	21.0					15																	45465913		2011	3908	5919	SO:0001630	splice_region_variant	90525	exon5			AATGTCAACTGGA	BC007586	CCDS10120.2, CCDS73721.1	15q21.1	2013-02-14			ENSG00000138606	ENSG00000138606		"""SH2 domain containing"""	25116	protein-coding gene	gene with protein product						11095946	Standard	NM_138356		Approved		uc001zuy.3	Q7M4L6	OTTHUMG00000131353	ENST00000290894.8:c.653-1T>C	15.37:g.45465913A>G		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_138356		Silent	SNP	ENST00000290894.8	37	CCDS10120.2																																																																																			.		0.557	SHF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254141.2	NM_138356	Silent
SLC34A3	142680	broad.mit.edu;bcgsc.ca	37	9	140127320	140127320	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr9:140127320C>T	ENST00000538474.1	+	5	613	c.389C>T	c.(388-390)gCc>gTc	p.A130V	SLC34A3_ENST00000361134.2_Missense_Mutation_p.A130V	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	130					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CTGGTCACAGCCCTGGTGCAG	0.632																																					p.A130V		.											.	SLC34A3	90	0			c.C389T						.						85.0	63.0	71.0					9																	140127320		2201	4296	6497	SO:0001583	missense	142680	exon5			TCACAGCCCTGGT	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.389C>T	9.37:g.140127320C>T	ENSP00000442397:p.Ala130Val	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	5.0	NM_001177317	A2BFA1	Missense_Mutation	SNP	ENST00000538474.1	37	CCDS7038.1	.	.	.	.	.	.	.	.	.	.	c	3.056	-0.194361	0.06259	.	.	ENSG00000198569	ENST00000538474;ENST00000361134	D;D	0.87103	-2.21;-2.21	3.65	2.51	0.30379	.	0.124935	0.33477	N	0.004873	T	0.66607	0.2806	N	0.05330	-0.07	0.23232	N	0.998079	B	0.02656	0.0	B	0.04013	0.001	T	0.53063	-0.8491	10	0.02654	T	1	-26.1718	6.7262	0.23359	0.0:0.1227:0.0:0.8773	.	130	Q8N130	NPT2C_HUMAN	V	130	ENSP00000442397:A130V;ENSP00000355353:A130V	ENSP00000355353:A130V	A	+	2	0	SLC34A3	139247141	1.000000	0.71417	0.440000	0.26846	0.942000	0.58702	3.220000	0.51207	0.597000	0.29811	-0.413000	0.06143	GCC	.		0.632	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254712.1	NM_080877	
SPPL2B	56928	broad.mit.edu;bcgsc.ca	37	19	2345304	2345304	+	RNA	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:2345304G>A	ENST00000452401.2	+	0	1407							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCCTCCAGGGTATACTTCGT	0.652																																					.		.											.	.	.	0			.						.						80.0	87.0	85.0					19																	2345304		2005	4161	6166			56928	.			TCCAGGGTATACT		CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2345304G>A		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	145.0	6.0	.	D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	RNA	SNP	ENST00000452401.2	37		.	.	.	.	.	.	.	.	.	.	G	0.558	-0.846684	0.02671	.	.	ENSG00000005206	ENST00000452401	.	.	.	4.02	1.78	0.24846	.	0.275088	0.34652	N	0.003784	T	0.27798	0.0684	.	.	.	0.21878	N	0.999497	B;B	0.15930	0.015;0.004	B;B	0.21360	0.034;0.023	T	0.23940	-1.0174	7	0.17832	T	0.49	-28.0561	6.6854	0.23142	0.3243:0.0:0.6757:0.0	.	444;443	Q8TCT7;C9JFE6	PSL1_HUMAN;.	I	443	.	ENSP00000404539:V443I	V	+	1	0	AC004410.1	2296304	1.000000	0.71417	0.139000	0.22197	0.446000	0.32137	1.266000	0.33039	0.162000	0.19483	0.401000	0.26515	GTA	.		0.652	SPPL2B-202	KNOWN	basic	processed_transcript	processed_transcript		NM_020172	
SRCAP	10847	broad.mit.edu;bcgsc.ca	37	16	30721368	30721368	+	Silent	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr16:30721368T>C	ENST00000262518.4	+	8	1438	c.1053T>C	c.(1051-1053)tcT>tcC	p.S351S	SRCAP_ENST00000344771.4_Silent_p.S351S|SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000395059.2_Silent_p.S351S	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	351	Glu-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCAGCCCCTCTCAAACCCCCT	0.582																																					p.S351S		.											.	SRCAP	94	0			c.T1053C						.						57.0	52.0	53.0					16																	30721368		2197	4300	6497	SO:0001819	synonymous_variant	10847	exon8			CCCCTCTCAAACC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1053T>C	16.37:g.30721368T>C		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	5.0	NM_006662	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	ENST00000262518.4	37	CCDS10689.2																																																																																			.		0.582	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255523.1	NM_006662	
ST6GALNAC5	81849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	77333366	77333366	+	Silent	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr1:77333366G>A	ENST00000477717.1	+	1	241	c.6G>A	c.(4-6)aaG>aaA	p.K2K	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	2					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						CCAAAATGAAGACCCTGATGG	0.617																																					p.K2K		.											.	ST6GALNAC5	92	0			c.G6A						.						78.0	83.0	81.0					1																	77333366		2203	4300	6503	SO:0001819	synonymous_variant	81849	exon1			AATGAAGACCCTG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.6G>A	1.37:g.77333366G>A		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	52.0	NM_030965	B1AK82	Silent	SNP	ENST00000477717.1	37	CCDS673.1																																																																																			.		0.617	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
STRADA	92335	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	61784645	61784645	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr17:61784645T>C	ENST00000336174.6	-	9	827	c.715A>G	c.(715-717)Aag>Gag	p.K239E	STRADA_ENST00000375840.4_Missense_Mutation_p.K181E|STRADA_ENST00000580039.1_5'UTR|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000392950.4_Missense_Mutation_p.K202E|STRADA_ENST00000579340.1_Intron|STRADA_ENST00000582137.1_Missense_Mutation_p.K210E|STRADA_ENST00000245865.5_Missense_Mutation_p.K181E|STRADA_ENST00000447001.3_Missense_Mutation_p.K195E	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	239	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						GGCAGAACCTTGACACTGTAC	0.592																																					p.K239E		.											.	STRADA	547	0			c.A715G						.						103.0	93.0	96.0					17																	61784645		2203	4300	6503	SO:0001583	missense	92335	exon9			GAACCTTGACACT	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.715A>G	17.37:g.61784645T>C	ENSP00000336655:p.Lys239Glu	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	48.0	NM_001003787	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	37	CCDS32703.1	.	.	.	.	.	.	.	.	.	.	t	15.82	2.946124	0.53079	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000447001;ENST00000392950;ENST00000245865	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.13	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.041428	0.85682	D	0.000000	T	0.73321	0.3572	L	0.45051	1.395	0.80722	D	1	P;P;P;B;P;P;P	0.47302	0.893;0.838;0.801;0.043;0.763;0.873;0.837	P;B;B;B;B;B;P	0.46389	0.478;0.222;0.266;0.024;0.242;0.306;0.515	T	0.76405	-0.2971	10	0.59425	D	0.04	.	15.8442	0.78874	0.0:0.0:0.0:1.0	.	210;195;181;181;202;202;239	B4DW17;B4DDE3;Q5JPI2;Q86YC8;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;.;.;.;STRAA_HUMAN	E	239;181;195;202;201	ENSP00000336655:K239E;ENSP00000365000:K181E;ENSP00000398841:K195E;ENSP00000376677:K202E	ENSP00000245865:K201E	K	-	1	0	STRADA	59138377	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	7.652000	0.83633	2.197000	0.70478	0.454000	0.30748	AAG	.		0.592	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1		
STX16	8675	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57246217	57246217	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr20:57246217C>A	ENST00000371141.4	+	7	1380	c.656C>A	c.(655-657)aCa>aAa	p.T219K	STX16_ENST00000359617.4_Missense_Mutation_p.T166K|STX16_ENST00000371132.4_Missense_Mutation_p.T198K|STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.T219K|STX16_ENST00000358029.4_Missense_Mutation_p.T215K|STX16_ENST00000355957.5_Missense_Mutation_p.T202K|STX16_ENST00000361830.3_Missense_Mutation_p.T219K|STX16_ENST00000361770.5_Missense_Mutation_p.T202K|STX16_ENST00000496003.1_Intron	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	219					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			TAGGGTTTTACAGAGGACCAG	0.418																																					p.T219K		.											.	STX16	91	0			c.C656A						.						100.0	96.0	98.0					20																	57246217		2203	4300	6503	SO:0001583	missense	8675	exon7			GTTTTACAGAGGA	AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.656C>A	20.37:g.57246217C>A	ENSP00000360183:p.Thr219Lys	Somatic	106.0	1.0		WXS	Illumina HiSeq	Phase_I	129.0	34.0	NM_001001433	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	ENST00000371141.4	37	CCDS13468.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254460	0.80135	.	.	ENSG00000124222	ENST00000355957;ENST00000361770;ENST00000312283;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000435446	T;T;T;T;T;T;T;T	0.42900	1.96;1.96;0.96;1.96;1.96;1.96;1.96;1.96	5.69	5.69	0.88448	t-SNARE (1);	0.000000	0.85682	U	0.000000	T	0.61986	0.2391	M	0.74881	2.28	0.80722	D	1	D;P;P;P	0.58970	0.984;0.929;0.894;0.76	P;P;P;B	0.59221	0.854;0.614;0.517;0.443	T	0.58662	-0.7597	10	0.34782	T	0.22	.	18.8116	0.92059	0.0:1.0:0.0:0.0	.	215;202;198;219	Q6GMS8;O14662-4;O14662-2;O14662	.;.;.;STX16_HUMAN	K	202;202;166;166;219;166;198;215;219;33	ENSP00000348229:T202K;ENSP00000355408:T202K;ENSP00000312086:T166K;ENSP00000352634:T166K;ENSP00000360183:T219K;ENSP00000360173:T198K;ENSP00000350723:T215K;ENSP00000354445:T219K	ENSP00000360180:T166K	T	+	2	0	STX16	56679623	1.000000	0.71417	0.248000	0.24265	0.477000	0.33069	7.487000	0.81328	2.674000	0.91012	0.650000	0.86243	ACA	.		0.418	STX16-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080517.2	NM_001001433	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64520042	64520042	+	Silent	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr14:64520042C>T	ENST00000344113.4	+	48	9623	c.9411C>T	c.(9409-9411)ctC>ctT	p.L3137L	SYNE2_ENST00000358025.3_Silent_p.L3137L|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Silent_p.L3170L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3137					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACAAAGTTCTCCAAAACATGG	0.294																																					p.L3137L		.											.	SYNE2	164	0			c.C9411T						.						42.0	42.0	42.0					14																	64520042		1818	4066	5884	SO:0001819	synonymous_variant	23224	exon48			AGTTCTCCAAAAC	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.9411C>T	14.37:g.64520042C>T		Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	68.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																			.		0.294	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
TMTC2	160335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	83250808	83250808	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr12:83250808C>T	ENST00000321196.3	+	2	810	c.103C>T	c.(103-105)Cag>Tag	p.Q35*	TMTC2_ENST00000549919.1_Nonsense_Mutation_p.Q29*|TMTC2_ENST00000548305.1_Nonsense_Mutation_p.Q35*	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	35					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						CAAGACTAATCAGGACCTTCT	0.393																																					p.Q35X		.											.	TMTC2	92	0			c.C103T						.						108.0	118.0	115.0					12																	83250808		2203	4300	6503	SO:0001587	stop_gained	160335	exon2			ACTAATCAGGACC	AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.103C>T	12.37:g.83250808C>T	ENSP00000322300:p.Gln35*	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	57.0	NM_152588	B2RCU7|Q8N2K8	Nonsense_Mutation	SNP	ENST00000321196.3	37	CCDS9025.1	.	.	.	.	.	.	.	.	.	.	C	43	10.100441	0.99337	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.393	19.0404	0.92997	0.0:1.0:0.0:0.0	.	.	.	.	X	35;35;29	.	ENSP00000322300:Q35X	Q	+	1	0	TMTC2	81774939	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	CAG	.		0.393	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405663.1	NM_152588	
TPO	7173	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	1497607	1497607	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:1497607C>A	ENST00000345913.4	+	11	1893	c.1802C>A	c.(1801-1803)cCt>cAt	p.P601H	TPO_ENST00000382198.1_Missense_Mutation_p.P428H|TPO_ENST00000382201.3_Missense_Mutation_p.P544H|TPO_ENST00000346956.3_Missense_Mutation_p.P601H|TPO_ENST00000349624.3_Missense_Mutation_p.P428H|TPO_ENST00000329066.4_Missense_Mutation_p.P601H|TPO_ENST00000497517.2_3'UTR|TPO_ENST00000337415.3_Missense_Mutation_p.P601H	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	601					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	TGCGGCCTGCCTCGCCTGGAG	0.572																																					p.P601H		.											.	TPO	332	0			c.C1802A						.						53.0	49.0	50.0					2																	1497607		2203	4300	6503	SO:0001583	missense	7173	exon11			GCCTGCCTCGCCT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1802C>A	2.37:g.1497607C>A	ENSP00000318820:p.Pro601His	Somatic	63.0	1.0		WXS	Illumina HiSeq	Phase_I	107.0	46.0	NM_001206744	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.11|11.11	1.542287|1.542287	0.27563|0.27563	.|.	.|.	ENSG00000115705|ENSG00000115705	ENST00000446278|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464;ENST00000469607	.|T;T;T;T;T;T;T;T;T	.|0.69435	.|-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	4.84|4.84	0.334|0.334	0.15948|0.15948	.|.	.|0.964866	.|0.08705	.|N	.|0.905723	T|T	0.77994|0.77994	0.4214|0.4214	M|M	0.81112|0.81112	2.525|2.525	0.09310|0.09310	N|N	1|1	.|P;D;P;P	.|0.57571	.|0.941;0.98;0.941;0.952	.|P;P;P;P	.|0.57776	.|0.735;0.804;0.735;0.827	T|T	0.66015|0.66015	-0.6028|-0.6028	5|10	.|0.87932	.|D	.|0	-9.514|-9.514	10.2455|10.2455	0.43339|0.43339	0.2471:0.5131:0.2398:0.0|0.2471:0.5131:0.2398:0.0	.|.	.|601;428;544;601	.|P07202-4;P07202-5;P07202-2;P07202	.|.;.;.;PERT_HUMAN	I|H	76|601;601;601;428;601;544;428;530;75	.|ENSP00000337263:P601H;ENSP00000318820:P601H;ENSP00000263886:P601H;ENSP00000332044:P428H;ENSP00000329869:P601H;ENSP00000371636:P544H;ENSP00000371633:P428H;ENSP00000405788:P530H;ENSP00000419461:P75H	.|ENSP00000329869:P601H	L|P	+|+	1|2	0|0	TPO|TPO	1476614|1476614	0.003000|0.003000	0.15002|0.15002	0.000000|0.000000	0.03702|0.03702	0.070000|0.070000	0.16714|0.16714	0.521000|0.521000	0.22893|0.22893	0.129000|0.129000	0.18514|0.18514	0.561000|0.561000	0.74099|0.74099	CTC|CCT	.		0.572	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TRABD2A	129293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	85066338	85066338	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:85066338C>G	ENST00000409520.2	-	4	968	c.926G>C	c.(925-927)gGg>gCg	p.G309A	TRABD2A_ENST00000409133.1_Missense_Mutation_p.G309A|TRABD2A_ENST00000335459.5_Missense_Mutation_p.G260A	NM_001277053.1	NP_001263982.1	Q86V40	TIKI1_HUMAN	TraB domain containing 2A	309					head development (GO:0060322)|metabolic process (GO:0008152)|negative regulation of Wnt signaling pathway (GO:0030178)|protein oxidation (GO:0018158)|Wnt signaling pathway (GO:0016055)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|Wnt-protein binding (GO:0017147)	p.G260E(1)									CACCCGCTTCCCTATTCTCTC	0.512																																					p.Y260S		.											.	.	.	1	Substitution - Missense(1)	skin(1)	c.A779C						.						89.0	90.0	89.0					2																	85066338		1899	4122	6021	SO:0001583	missense	129293	exon3			CGCTTCCCTATTC	BC049209	CCDS46349.1, CCDS62946.1	2p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000186854	ENSG00000186854			27013	protein-coding gene	gene with protein product		614912	"""chromosome 2 open reading frame 89"""	C2orf89		12477932	Standard	NM_001080824		Approved		uc010ysl.3	Q86V40	OTTHUMG00000152922	ENST00000409520.2:c.926G>C	2.37:g.85066338C>G	ENSP00000387075:p.Gly309Ala	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	23.0	NM_001080824	B4DKK8|I6UMB9	Missense_Mutation	SNP	ENST00000409520.2	37		.	.	.	.	.	.	.	.	.	.	C	7.394	0.631466	0.14322	.	.	ENSG00000186854	ENST00000335459;ENST00000409520;ENST00000409133	T;T;T	0.27402	2.06;1.67;1.67	3.75	2.87	0.33458	.	0.180079	0.35466	N	0.003197	T	0.15349	0.0370	.	.	.	0.41223	D	0.986528	P;B;P	0.43542	0.81;0.08;0.783	B;B;B	0.42030	0.303;0.083;0.373	T	0.12041	-1.0563	9	0.02654	T	1	.	8.9389	0.35718	0.0:0.887:0.0:0.113	.	309;309;260	Q86V40;C9IYB5;Q86V40-2	CB089_HUMAN;.;.	A	260;309;309	ENSP00000335004:G260A;ENSP00000387075:G309A;ENSP00000387183:G309A	ENSP00000335004:G260A	G	-	2	0	C2orf89	84919849	0.992000	0.36948	0.801000	0.32222	0.790000	0.44656	2.910000	0.48766	0.797000	0.33971	0.563000	0.77884	GGG	.		0.512	TRABD2A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001080824	
TRIM66	9866	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	8662439	8662439	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr11:8662439G>T	ENST00000299550.6	-	9	1242	c.1048C>A	c.(1048-1050)Ccc>Acc	p.P350T	TRIM66_ENST00000402157.2_Missense_Mutation_p.P348T	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	350						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						ATCTCAGGGGGCTGCCTGAAG	0.647																																					p.P350T		.											.	TRIM66	68	0			c.C1048A						.						18.0	22.0	21.0					11																	8662439		692	1591	2283	SO:0001583	missense	9866	exon9			CAGGGGGCTGCCT	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.1048C>A	11.37:g.8662439G>T	ENSP00000299550:p.Pro350Thr	Somatic	49.0	1.0		WXS	Illumina HiSeq	Phase_I	71.0	21.0	NM_014818	Q9BQQ4	Missense_Mutation	SNP	ENST00000299550.6	37		.	.	.	.	.	.	.	.	.	.	G	14.41	2.528472	0.44969	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	T;T	0.17213	2.29;2.29	5.02	2.01	0.26516	.	0.291831	0.24856	N	0.035057	T	0.34832	0.0911	M	0.71581	2.175	0.23314	N	0.997922	D	0.89917	1.0	D	0.87578	0.998	T	0.09509	-1.0671	10	0.35671	T	0.21	-6.3717	8.5865	0.33662	0.0723:0.0:0.6548:0.2729	.	350	O15016	TRI66_HUMAN	T	350;348	ENSP00000299550:P350T;ENSP00000384876:P348T	ENSP00000299550:P350T	P	-	1	0	TRIM66	8619015	0.992000	0.36948	0.902000	0.35471	0.640000	0.38277	1.878000	0.39608	0.121000	0.18284	-0.516000	0.04426	CCC	.		0.647	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_084529	
TRPS1	7227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	116616801	116616801	+	Silent	SNP	T	T	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr8:116616801T>A	ENST00000220888.5	-	3	1515	c.1356A>T	c.(1354-1356)ctA>ctT	p.L452L	TRPS1_ENST00000395715.3_Silent_p.L465L|TRPS1_ENST00000520276.1_Silent_p.L456L|TRPS1_ENST00000519674.1_Silent_p.L452L|TRPS1_ENST00000519076.1_Intron			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	452					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CATAATGTTCTAGCAGTTTAA	0.448									Langer-Giedion syndrome																												p.L465L		.											.	TRPS1	229	0			c.A1395T						.						55.0	53.0	54.0					8																	116616801		1942	4147	6089	SO:0001819	synonymous_variant	7227	exon4	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	ATGTTCTAGCAGT	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1356A>T	8.37:g.116616801T>A		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	238.0	63.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Silent	SNP	ENST00000220888.5	37																																																																																				.		0.448	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
CFAP46	54777	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134663787	134663787	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:134663787G>T	ENST00000368586.5	-	41	6013	c.5913C>A	c.(5911-5913)gaC>gaA	p.D1971E	TTC40_ENST00000263170.5_Missense_Mutation_p.D132E	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGTGCACAGGGTCAGCTTGCA	0.672																																					p.D1971E		.											.	.	.	0			c.C5913A						.						20.0	21.0	21.0					10																	134663787		2080	4116	6196	SO:0001583	missense	54777	exon41			CACAGGGTCAGCT																												ENST00000368586.5:c.5913C>A	10.37:g.134663787G>T	ENSP00000357575:p.Asp1971Glu	Somatic	64.0	1.0		WXS	Illumina HiSeq	Phase_I	128.0	37.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	G	12.76	2.033286	0.35893	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.18810	2.38;2.19	4.14	3.21	0.36854	.	0.000000	0.50627	D	0.000102	T	0.27027	0.0662	L	0.52573	1.65	0.80722	D	1	D	0.56035	0.974	P	0.53861	0.736	T	0.01604	-1.1314	10	0.36615	T	0.2	.	7.3418	0.26641	0.1284:0.0:0.8716:0.0	.	132	Q8IYW2	CJ092_HUMAN	E	1971;132	ENSP00000357575:D1971E;ENSP00000263170:D132E	ENSP00000263170:D132E	D	-	3	2	C10orf93	134513777	0.995000	0.38212	0.380000	0.26093	0.013000	0.08279	1.317000	0.33631	0.838000	0.34948	0.655000	0.94253	GAC	.		0.672	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179472788	179472788	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr2:179472788G>A	ENST00000591111.1	-	226	48027	c.47803C>T	c.(47803-47805)Cca>Tca	p.P15935S	TTN_ENST00000589042.1_Missense_Mutation_p.P17576S|TTN_ENST00000359218.5_Missense_Mutation_p.P8636S|TTN_ENST00000460472.2_Missense_Mutation_p.P8511S|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P8703S|TTN_ENST00000342992.6_Missense_Mutation_p.P15008S|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15935	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGACTCTTGGGATAGGTGGC	0.423																																					p.P17576S		.											.	TTN	636	0			c.C52726T						.						70.0	69.0	70.0					2																	179472788		1857	4095	5952	SO:0001583	missense	7273	exon276			CTCTTGGGATAGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.47803C>T	2.37:g.179472788G>A	ENSP00000465570:p.Pro15935Ser	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	78.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	12.88	2.070362	0.36566	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	6.17	6.17	0.99709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79644	0.4481	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.63046	0.984;0.984;0.984;0.992	P;P;P;D	0.63283	0.85;0.85;0.85;0.913	T	0.82882	-0.0237	9	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	8511;8636;8703;15935	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	15008;8511;8703;8636;8511	ENSP00000343764:P15008S;ENSP00000434586:P8511S;ENSP00000340554:P8703S;ENSP00000352154:P8636S	ENSP00000340554:P8703S	P	-	1	0	TTN	179181033	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.134000	0.57990	2.941000	0.99782	0.655000	0.94253	CCA	.		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TUBB8	347688	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	94784	94784	+	Silent	SNP	C	C	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:94784C>A	ENST00000309812.4	-	2	188	c.126G>T	c.(124-126)ctG>ctT	p.L42L	TUBB8_ENST00000332708.5_Intron|TUBB8_ENST00000447903.2_5'UTR|TUBB8_ENST00000413237.3_5'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	42					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GCTCCAGCTGCAGGTGGCTGT	0.647																																					p.L42L	Pancreas(192;2041 3010 9013 18103)	.											.	TUBB8	69	0			c.G126T						.						30.0	27.0	28.0					10																	94784		2199	4298	6497	SO:0001819	synonymous_variant	347688	exon2			CAGCTGCAGGTGG	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.126G>T	10.37:g.94784C>A		Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	30.0	NM_177987	Q5SQX9|Q8WZ78	Silent	SNP	ENST00000309812.4	37	CCDS7051.1	.	.	.	.	.	.	.	.	.	.	C	2.674	-0.276995	0.05679	.	.	ENSG00000173876	ENST00000272035	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	T	0.59459	0.2195	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59193	-0.7500	5	0.87932	D	0	.	5.9913	0.19465	0.0:0.9994:0.0:6.0E-4	.	.	.	.	F	17	.	ENSP00000272035:C17F	C	-	2	0	RP11-631M21.2	84784	1.000000	0.71417	0.021000	0.16686	0.021000	0.10359	0.879000	0.28146	0.181000	0.19994	0.184000	0.17185	TGC	.		0.647	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467795.1	NM_177987	
USP54	159195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	75277370	75277370	+	Silent	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:75277370T>C	ENST00000339859.4	-	19	2914	c.2814A>G	c.(2812-2814)ccA>ccG	p.P938P	RP11-137L10.6_ENST00000600206.1_RNA|USP54_ENST00000394811.2_Silent_p.P26P|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000408019.1_Silent_p.P938P|RP11-137L10.6_ENST00000597958.1_RNA|RP11-137L10.6_ENST00000593790.1_RNA|USP54_ENST00000422491.2_Silent_p.P120P|RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000428547.1_Silent_p.P788P			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	938					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					CAGATGACTCTGGAGATAGTG	0.517																																					p.P938P	Colon(195;880 2046 8854 25025 38456)	.											.	USP54	721	0			c.A2814G						.						77.0	71.0	73.0					10																	75277370		2203	4300	6503	SO:0001819	synonymous_variant	159195	exon18			TGACTCTGGAGAT	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.2814A>G	10.37:g.75277370T>C		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	137.0	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Silent	SNP	ENST00000339859.4	37	CCDS7329.2																																																																																			.		0.517	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
VWA8	23078	ucsc.edu;bcgsc.ca	37	13	42301352	42301352	+	Silent	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr13:42301352G>A	ENST00000379310.3	-	24	2804	c.2736C>T	c.(2734-2736)ggC>ggT	p.G912G	VWA8_ENST00000281496.6_Silent_p.G912G	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	912						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										AGAAATCATTGCCTAGGAAAG	0.343																																					p.G912G		.											.	.	.	0			c.C2736T						.						75.0	70.0	72.0					13																	42301352		2128	4111	6239	SO:0001819	synonymous_variant	23078	exon24			ATCATTGCCTAGG	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.2736C>T	13.37:g.42301352G>A		Somatic	51.0	0.0		WXS	Illumina HiSeq	.	30.0	4.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	37	CCDS41881.1																																																																																			.		0.343	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	49982649	49982649	+	Silent	SNP	C	C	T	rs115706447	byFrequency	TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr10:49982649C>T	ENST00000325239.5	+	13	2727	c.2700C>T	c.(2698-2700)ccC>ccT	p.P900P	WDFY4_ENST00000413659.2_Silent_p.P900P	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	900						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GTGGCAGCCCCCTCCACTCAC	0.592													C|||	50	0.00998403	0.0348	0.0058	5008	,	,		19330	0.0		0.0	False		,,,				2504	0.0				p.P900P		.											.	WDFY4	22	0			c.C2700T						.	C		35,1349		0,35,657	31.0	42.0	39.0		2700	-6.4	0.0	10	dbSNP_132	39	1,3181		0,1,1590	no	coding-synonymous	WDFY4	NM_020945.1		0,36,2247	TT,TC,CC		0.0314,2.5289,0.7884		900/3185	49982649	36,4530	692	1591	2283	SO:0001819	synonymous_variant	57705	exon14			CAGCCCCCTCCAC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2700C>T	10.37:g.49982649C>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	34.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1																																																																																			C|0.993;T|0.007		0.592	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
YIPF2	78992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11034659	11034659	+	Silent	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:11034659G>A	ENST00000586748.1	-	7	673	c.501C>T	c.(499-501)atC>atT	p.I167I	YIPF2_ENST00000590329.1_Silent_p.I128I|YIPF2_ENST00000253031.2_Silent_p.I167I			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2	167						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						AGTAGATGCTGATGCCTGCCA	0.677																																					p.I167I		.											.	YIPF2	90	0			c.C501T						.						35.0	37.0	37.0					19																	11034659		2203	4297	6500	SO:0001819	synonymous_variant	78992	exon7			GATGCTGATGCCT	BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.501C>T	19.37:g.11034659G>A		Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	10.0	NM_024029		Silent	SNP	ENST00000586748.1	37	CCDS12251.1																																																																																			.		0.677	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453045.1	NM_024029	
WDR87	83889	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	38378503	38378503	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:38378503C>G	ENST00000303868.5	-	6	5915	c.5691G>C	c.(5689-5691)caG>caC	p.Q1897H	WDR87_ENST00000447313.2_Missense_Mutation_p.Q1936H	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1897	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TCTCCTTTTCCTGTGTCAGCT	0.408																																					p.Q1897H		.											.	.	.	0			c.G5691C						.						205.0	148.0	165.0					19																	38378503		692	1591	2283	SO:0001583	missense	83889	exon6			CTTTTCCTGTGTC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5691G>C	19.37:g.38378503C>G	ENSP00000368025:p.Gln1897His	Somatic	302.0	0.0		WXS	Illumina HiSeq	Phase_I	451.0	122.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	C	5.730	0.319206	0.10845	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.22945	1.93;1.93	5.07	1.65	0.23941	.	.	.	.	.	T	0.17619	0.0423	L	0.27053	0.805	0.09310	N	1	P;P	0.39964	0.697;0.697	B;B	0.38500	0.275;0.275	T	0.10177	-1.0641	9	0.49607	T	0.09	.	8.5847	0.33651	0.0:0.7277:0.0:0.2723	.	1897;1936	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	H	1936;1897	ENSP00000405012:Q1936H;ENSP00000368025:Q1897H	ENSP00000368025:Q1897H	Q	-	3	2	WDR87	43070343	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-0.168000	0.09925	0.216000	0.20781	0.637000	0.83480	CAG	.		0.408	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
ZC3HC1	51530	ucsc.edu;bcgsc.ca	37	7	129664107	129664107	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr7:129664107T>C	ENST00000358303.4	-	7	1100	c.1016A>G	c.(1015-1017)gAg>gGg	p.E339G	RP11-306G20.1_ENST00000587038.1_RNA|RP11-306G20.1_ENST00000480018.1_RNA|ZC3HC1_ENST00000311873.5_Missense_Mutation_p.E318G|ZC3HC1_ENST00000360708.5_Missense_Mutation_p.E339G|ZC3HC1_ENST00000481503.1_Missense_Mutation_p.E296G	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	339					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					GAATACCTGCTCTGAGCCTGG	0.493																																					p.E339G	Melanoma(115;540 1606 16325 28853 48167)	.											.	ZC3HC1	90	0			c.A1016G						.						64.0	69.0	68.0					7																	129664107		2203	4300	6503	SO:0001583	missense	51530	exon7			ACCTGCTCTGAGC	AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.1016A>G	7.37:g.129664107T>C	ENSP00000351052:p.Glu339Gly	Somatic	23.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_016478	A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Missense_Mutation	SNP	ENST00000358303.4	37	CCDS34753.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447632	0.43429	.	.	ENSG00000091732	ENST00000358303;ENST00000360708;ENST00000311873;ENST00000481503	T;T;T;T	0.53423	1.16;0.92;1.18;0.62	5.48	5.48	0.80851	.	0.060173	0.64402	D	0.000004	T	0.61677	0.2366	M	0.67953	2.075	0.49582	D	0.999809	D;D;D	0.61697	0.99;0.983;0.964	P;P;P	0.59595	0.86;0.846;0.457	T	0.60047	-0.7339	10	0.30854	T	0.27	-7.7865	14.4045	0.67073	0.0:0.0:0.0:1.0	.	339;339;296	Q86WB0-3;Q86WB0;C9J0I9	.;NIPA_HUMAN;.	G	339;339;318;296	ENSP00000351052:E339G;ENSP00000353933:E339G;ENSP00000309301:E318G;ENSP00000418533:E296G	ENSP00000309301:E318G	E	-	2	0	ZC3HC1	129451343	1.000000	0.71417	0.985000	0.45067	0.115000	0.19883	5.623000	0.67757	2.089000	0.63090	0.460000	0.39030	GAG	.		0.493	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349316.1	NM_016478	
ZCWPW2	152098	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	28566047	28566047	+	Silent	SNP	A	A	T			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr3:28566047A>T	ENST00000383768.2	+	10	1127	c.939A>T	c.(937-939)gcA>gcT	p.A313A	ZCWPW2_ENST00000421010.1_Silent_p.A313A			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	313							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						AAGCTCCTGCAGGCAGTCTGT	0.323																																					p.A313A		.											.	ZCWPW2	24	0			c.A939T						.						123.0	137.0	132.0					3																	28566047		2202	4298	6500	SO:0001819	synonymous_variant	152098	exon9			TCCTGCAGGCAGT	BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.939A>T	3.37:g.28566047A>T		Somatic	323.0	0.0		WXS	Illumina HiSeq	Phase_I	326.0	79.0	NM_001040432		Silent	SNP	ENST00000383768.2	37	CCDS33723.1	.	.	.	.	.	.	.	.	.	.	A	0.886	-0.727137	0.03158	.	.	ENSG00000206559	ENST00000419130	.	.	.	6.03	2.3	0.28687	.	.	.	.	.	T	0.26774	0.0655	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22173	-1.0224	4	.	.	.	-0.4976	5.1998	0.15258	0.7241:0.0:0.1444:0.1315	.	.	.	.	W	198	.	.	R	+	1	2	ZCWPW2	28541051	0.424000	0.25490	0.000000	0.03702	0.150000	0.21749	0.679000	0.25291	0.153000	0.19213	-0.290000	0.09829	AGG	.		0.323	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341318.1	XM_087384	
ZDHHC1	29800	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67432171	67432171	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr16:67432171C>G	ENST00000348579.2	-	8	1212	c.871G>C	c.(871-873)Gcc>Ccc	p.A291P	ZDHHC1_ENST00000566075.1_5'Flank	NM_013304.2	NP_037436.1	Q8WTX9	ZDHC1_HUMAN	zinc finger, DHHC-type containing 1	291					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|urinary_tract(1)	10		Ovarian(137;0.223)		UCEC - Uterine corpus endometrioid carcinoma (183;0.0178)|all cancers(182;5.71e-53)|Epithelial(162;4.73e-52)|OV - Ovarian serous cystadenocarcinoma(108;1.53e-29)|Kidney(780;4.37e-05)|BRCA - Breast invasive adenocarcinoma(181;5.8e-05)|GBM - Glioblastoma multiforme(240;0.0022)		ACCCCCTTGGCCTCCTGTGGT	0.637																																					p.A291P		.											.	ZDHHC1	90	0			c.G871C						.						121.0	106.0	111.0					16																	67432171		2198	4300	6498	SO:0001583	missense	29800	exon8			CCTTGGCCTCCTG	U90653	CCDS10836.1	16q22.1	2010-03-25	2003-01-27		ENSG00000159714	ENSG00000159714		"""Zinc fingers, DHHC-type"""	17916	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 1"""	C16orf1		10395086	Standard	NM_013304		Approved	HSU90653, ZNF377	uc010vjm.2	Q8WTX9	OTTHUMG00000137522	ENST00000348579.2:c.871G>C	16.37:g.67432171C>G	ENSP00000340299:p.Ala291Pro	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	74.0	NM_013304	O15461	Missense_Mutation	SNP	ENST00000348579.2	37	CCDS10836.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529073	0.44969	.	.	ENSG00000159714	ENST00000348579	T	0.37752	1.18	5.46	4.49	0.54785	.	1.706460	0.02790	N	0.121901	T	0.28632	0.0709	L	0.27053	0.805	0.32577	N	0.528965	B	0.15473	0.013	B	0.12156	0.007	T	0.30297	-0.9983	10	0.30078	T	0.28	.	5.4746	0.16688	0.1477:0.6332:0.1425:0.0765	.	291	Q8WTX9	ZDHC1_HUMAN	P	291	ENSP00000340299:A291P	ENSP00000340299:A291P	A	-	1	0	ZDHHC1	65989672	0.994000	0.37717	1.000000	0.80357	0.861000	0.49209	0.541000	0.23207	1.260000	0.44134	0.407000	0.27541	GCC	.		0.637	ZDHHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268845.1	NM_013304	
ZNF234	10780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44661606	44661606	+	Silent	SNP	C	C	G	rs182811010	byFrequency	TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr19:44661606C>G	ENST00000426739.2	+	6	1695	c.1437C>G	c.(1435-1437)acC>acG	p.T479T	ZNF234_ENST00000592437.1_Silent_p.T479T	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TGATCCATACCGGTGAGAAAC	0.433																																					p.T479T		.											.	.	.	0			c.C1437G						.						82.0	83.0	82.0					19																	44661606		2045	4225	6270	SO:0001819	synonymous_variant	10780	exon6			CCATACCGGTGAG	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1437C>G	19.37:g.44661606C>G		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	42.0	NM_006630	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Silent	SNP	ENST00000426739.2	37	CCDS46101.1																																																																																			C|0.999;T|0.001		0.433	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460586.2		
ZNF335	63925	broad.mit.edu;bcgsc.ca	37	20	44592119	44592119	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr20:44592119G>A	ENST00000322927.2	-	9	1626	c.1526C>T	c.(1525-1527)tCg>tTg	p.S509L	ZNF335_ENST00000426788.1_Missense_Mutation_p.S354L	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	509					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CACCTTGAGCGAGGACCAGCG	0.622																																					p.S509L		.											.	ZNF335	94	0			c.C1526T						.						44.0	48.0	47.0					20																	44592119		2203	4300	6503	SO:0001583	missense	63925	exon9			TTGAGCGAGGACC	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1526C>T	20.37:g.44592119G>A	ENSP00000325326:p.Ser509Leu	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	6.0	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	37	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658791	0.88154	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.19532	2.14;2.14	5.16	5.16	0.70880	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.43411	0.1246	L	0.56280	1.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.13602	-1.0503	10	0.49607	T	0.09	-11.2448	17.8161	0.88634	0.0:0.0:1.0:0.0	.	354;509	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	L	509;286;354	ENSP00000325326:S509L;ENSP00000397098:S354L	ENSP00000243961:S286L	S	-	2	0	ZNF335	44025526	1.000000	0.71417	0.956000	0.39512	0.597000	0.36814	8.908000	0.92640	2.676000	0.91093	0.655000	0.94253	TCG	.		0.622	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
ZNF800	168850	ucsc.edu;bcgsc.ca;mdanderson.org	37	7	127013575	127013575	+	Silent	SNP	G	G	T	rs76411607	byFrequency	TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr7:127013575G>T	ENST00000393313.1	-	5	2406	c.1815C>A	c.(1813-1815)gtC>gtA	p.V605V	ZNF800_ENST00000485577.1_5'UTR|ZNF800_ENST00000393312.1_Silent_p.V605V|ZNF800_ENST00000265827.3_Silent_p.V605V			Q2TB10	ZN800_HUMAN	zinc finger protein 800	605					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						CTTCAATACCGACGTCAGCTA	0.368																																					p.V605V		.											.	ZNF800	23	0			c.C1815A						.						156.0	153.0	154.0					7																	127013575		2203	4300	6503	SO:0001819	synonymous_variant	168850	exon5			AATACCGACGTCA	AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.1815C>A	7.37:g.127013575G>T		Somatic	327.0	2.0		WXS	Illumina HiSeq	.	248.0	85.0	NM_176814	Q9HBN0	Silent	SNP	ENST00000393313.1	37	CCDS5795.1																																																																																			G|0.982;A|0.018		0.368	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141823.1	NM_176814	
ZNF777	27153	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149152476	149152476	+	Missense_Mutation	SNP	G	G	A	rs201407206		TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr7:149152476G>A	ENST00000247930.4	-	2	961	c.638C>T	c.(637-639)aCg>aTg	p.T213M		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	213					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			ATTTGTCCCCGTCCTGCCTTC	0.607																																					p.T213M		.											.	ZNF777	136	0			c.C638T						.	G	MET/THR	0,4404		0,0,2202	74.0	83.0	80.0		638	4.9	1.0	7		80	2,8598	2.2+/-6.3	0,2,4298	no	missense	ZNF777	NM_015694.2	81	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	213/832	149152476	2,13002	2202	4300	6502	SO:0001583	missense	27153	exon2			GTCCCCGTCCTGC	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.638C>T	7.37:g.149152476G>A	ENSP00000247930:p.Thr213Met	Somatic	167.0	1.0		WXS	Illumina HiSeq	Phase_I	161.0	61.0	NM_015694	Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	37	CCDS43675.1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566637	0.65651	0.0	2.33E-4	ENSG00000196453	ENST00000247930	T	0.25749	1.78	4.93	4.93	0.64822	.	0.000000	0.45867	D	0.000321	T	0.43122	0.1233	L	0.57536	1.79	0.33513	D	0.591425	D	0.76494	0.999	P	0.60886	0.88	T	0.59112	-0.7515	10	0.87932	D	0	-12.5233	13.6684	0.62409	0.0:0.0:1.0:0.0	.	213	Q9ULD5-2	.	M	213	ENSP00000247930:T213M	ENSP00000247930:T213M	T	-	2	0	ZNF777	148783409	0.004000	0.15560	0.953000	0.39169	0.971000	0.66376	0.633000	0.24598	2.286000	0.76751	0.655000	0.94253	ACG	G|0.999;A|0.001		0.607	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
MICAL3	57553	broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	18385513	18385514	+	Splice_Site	DNP	CC	CC	AA			TCGA-CC-A123-01A-11D-A12Z-10	TCGA-CC-A123-10A-01D-A12Z-10	CC	CC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b962e0d4-7df3-46f3-82a3-9a9a6bf09d4b	69282336-dc29-494e-a63e-b8aef9c80bed	g.chr22:18385513_18385514CC>AA	ENST00000441493.2	-	4	825	c.473_473GG>TT	c.(472-474)aGGg>aTTgg	p.R158I	MICAL3_ENST00000585038.1_Splice_Site_p.R158I|MICAL3_ENST00000444520.1_Splice_Site_p.R158I|MICAL3_ENST00000383094.3_Splice_Site_p.R158I|MICAL3_ENST00000414725.2_Splice_Site_p.R158I|MICAL3_ENST00000400561.2_Splice_Site_p.R158I|MICAL3_ENST00000429452.1_Splice_Site_p.R158I|MICAL3_ENST00000207726.7_Splice_Site_p.R158I	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	158	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		CTGACGGATACCTGGGAGAATA	0.52																																					.		.											.	.	.	0			.						.																																			SO:0001630	splice_region_variant	57553	.			CGGATACCTGGGA	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.473_473delinsAA	22.37:g.18385513_18385514delinsAA		Somatic	123.0	2.0		WXS	Illumina GAIIx	Phase_I	120.0	59.0	.	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Splice_Site	DNP	ENST00000441493.2	37	CCDS46659.1																																																																																			.		0.520	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		Missense_Mutation
