#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCC5	10057	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183655819	183655819	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:183655819G>A	ENST00000334444.6	-	26	3964	c.3724C>T	c.(3724-3726)Cgt>Tgt	p.R1242C	ABCC5_ENST00000265586.6_Missense_Mutation_p.R1199C	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1242	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	TCCACCAGACGGAAGAGGGCC	0.507																																					p.R1242C		.											.	ABCC5	137	0			c.C3724T						.						90.0	89.0	89.0					3																	183655819		2022	4196	6218	SO:0001583	missense	10057	exon26			CCAGACGGAAGAG	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3724C>T	3.37:g.183655819G>A	ENSP00000333926:p.Arg1242Cys	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	27.0	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	37	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516365	0.85495	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.92397	-3.03;-3.03	5.73	5.73	0.89815	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.054165	0.85682	D	0.000000	D	0.97021	0.9027	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97312	0.9938	10	0.87932	D	0	-12.7027	19.8948	0.96954	0.0:0.0:1.0:0.0	.	1199;1242	Q86UX3;O15440	.;MRP5_HUMAN	C	1242;1199	ENSP00000333926:R1242C;ENSP00000265586:R1199C	ENSP00000265586:R1199C	R	-	1	0	ABCC5	185138513	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	4.345000	0.59360	2.699000	0.92147	0.655000	0.94253	CGT	.		0.507	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
ACOT12	134526	hgsc.bcm.edu;bcgsc.ca	37	5	80655835	80655835	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:80655835A>G	ENST00000307624.3	-	5	411	c.383T>C	c.(382-384)cTt>cCt	p.L128P	ACOT12_ENST00000513751.1_Missense_Mutation_p.L128P	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	128					acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TTCAGTTAGAAGTGTGACTGG	0.313																																					p.L128P		.											.	ACOT12	92	0			c.T383C						.						102.0	103.0	103.0					5																	80655835		2203	4298	6501	SO:0001583	missense	134526	exon5			GTTAGAAGTGTGA	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.383T>C	5.37:g.80655835A>G	ENSP00000303246:p.Leu128Pro	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_130767	B3KVK9|Q5FWE9	Missense_Mutation	SNP	ENST00000307624.3	37	CCDS4055.1	.	.	.	.	.	.	.	.	.	.	A	5.472	0.272129	0.10349	.	.	ENSG00000172497	ENST00000307624;ENST00000513751	T;T	0.25749	1.78;1.78	5.04	3.88	0.44766	.	0.158933	0.43579	N	0.000556	T	0.17023	0.0409	N	0.26130	0.795	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.04900	-1.0919	10	0.30854	T	0.27	-4.5878	10.0132	0.41999	0.9184:0.0:0.0816:0.0	.	128;128	Q5FWE9;Q8WYK0	.;ACO12_HUMAN	P	128	ENSP00000303246:L128P;ENSP00000421628:L128P	ENSP00000303246:L128P	L	-	2	0	ACOT12	80691591	1.000000	0.71417	0.500000	0.27589	0.085000	0.17905	4.204000	0.58460	0.876000	0.35872	0.533000	0.62120	CTT	.		0.313	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	NM_130767	
ADAMTSL1	92949	hgsc.bcm.edu;bcgsc.ca	37	9	18636002	18636002	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:18636002T>C	ENST00000380548.4	+	6	1002	c.663T>C	c.(661-663)ggT>ggC	p.G221G	ADAMTSL1_ENST00000380566.4_Silent_p.G221G|ADAMTSL1_ENST00000327883.7_Silent_p.G221G|ADAMTSL1_ENST00000276935.6_Silent_p.G221G	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	221						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TCTTAAAAGGTCCTGATCACT	0.348																																					p.G221G		.											.	ADAMTSL1	230	0			c.T663C						.						213.0	200.0	204.0					9																	18636002		2203	4300	6503	SO:0001819	synonymous_variant	92949	exon6			AAAAGGTCCTGAT	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.663T>C	9.37:g.18636002T>C		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_052866	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	37	CCDS47954.1																																																																																			.		0.348	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
AFF1	4299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	88052964	88052964	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:88052964T>A	ENST00000307808.6	+	17	3520	c.3100T>A	c.(3100-3102)Tcc>Acc	p.S1034T	AFF1_ENST00000544085.1_Missense_Mutation_p.S672T|AFF1_ENST00000395146.4_Missense_Mutation_p.S1041T	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	1034					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GTCATTAAAATCCTTCTCAGA	0.308																																					p.S1041T		.											.	AFF1	289	0			c.T3121A						.						110.0	106.0	107.0					4																	88052964		2203	4300	6503	SO:0001583	missense	4299	exon18			TTAAAATCCTTCT	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.3100T>A	4.37:g.88052964T>A	ENSP00000305689:p.Ser1034Thr	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	19.0	NM_001166693	B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	37	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	T	0.509	-0.867598	0.02590	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	T;T;T	0.63913	-0.07;-0.07;-0.07	5.42	1.47	0.22746	.	0.646159	0.15139	N	0.278410	T	0.43523	0.1251	L	0.37850	1.14	0.24807	N	0.992668	B;B;B	0.21071	0.051;0.051;0.051	B;B;B	0.21151	0.033;0.033;0.033	T	0.19160	-1.0314	10	0.19147	T	0.46	-6.1251	3.4385	0.07454	0.2542:0.2297:0.0:0.5161	.	1041;1034;1034	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	T	1041;1034;672	ENSP00000378578:S1041T;ENSP00000305689:S1034T;ENSP00000440843:S672T	ENSP00000305689:S1034T	S	+	1	0	AFF1	88271988	0.997000	0.39634	0.997000	0.53966	0.046000	0.14306	0.140000	0.16056	0.374000	0.24650	-0.290000	0.09829	TCC	.		0.308	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
AGPAT4	56895	hgsc.bcm.edu;bcgsc.ca	37	6	161567572	161567572	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:161567572T>C	ENST00000320285.4	-	7	1039	c.827A>G	c.(826-828)aAg>aGg	p.K276R	AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000366911.5_3'UTR|AGPAT4_ENST00000457520.2_Missense_Mutation_p.K114R	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	276					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		CTGGTAGAGCTTGTGCAGCCA	0.602																																					p.K276R		.											.	AGPAT4	90	0			c.A827G						.						128.0	98.0	108.0					6																	161567572		2203	4300	6503	SO:0001583	missense	56895	exon7			TAGAGCTTGTGCA	AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.827A>G	6.37:g.161567572T>C	ENSP00000314036:p.Lys276Arg	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_020133	B4DSF9|Q5TEF0	Missense_Mutation	SNP	ENST00000320285.4	37	CCDS5280.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.89|15.89	2.966761|2.966761	0.53507|0.53507	.|.	.|.	ENSG00000026652|ENSG00000026652	ENST00000320285;ENST00000457520|ENST00000437165	D|.	0.93547|.	-3.24|.	4.95|4.95	2.55|2.55	0.30701|0.30701	.|.	0.049400|.	0.85682|.	D|.	0.000000|.	T|T	0.59742|0.59742	0.2216|0.2216	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	B;B|.	0.21606|.	0.058;0.032|.	B;B|.	0.20184|.	0.028;0.012|.	T|T	0.60063|0.60063	-0.7336|-0.7336	10|5	0.51188|.	T|.	0.08|.	-32.4046|-32.4046	7.8161|7.8161	0.29260|0.29260	0.0:0.1759:0.0:0.8241|0.0:0.1759:0.0:0.8241	.|.	114;276|.	B4DSF9;Q9NRZ5|.	.;PLCD_HUMAN|.	R|G	276;114|55	ENSP00000314036:K276R|.	ENSP00000314036:K276R|.	K|S	-|-	2|1	0|0	AGPAT4|AGPAT4	161487562|161487562	0.998000|0.998000	0.40836|0.40836	0.997000|0.997000	0.53966|0.53966	0.907000|0.907000	0.53573|0.53573	2.512000|2.512000	0.45485|0.45485	0.331000|0.331000	0.23511|0.23511	0.459000|0.459000	0.35465|0.35465	AAG|AGC	.		0.602	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133	
AGPAT6	137964	hgsc.bcm.edu;bcgsc.ca	37	8	41472557	41472557	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:41472557T>C	ENST00000396987.3	+	10	1970	c.1043T>C	c.(1042-1044)gTt>gCt	p.V348A	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	348					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			GTTTACCCTGTTGCTATCAAG	0.458																																					p.V348A		.											.	AGPAT6	90	0			c.T1043C						.						85.0	79.0	81.0					8																	41472557		2203	4300	6503	SO:0001583	missense	137964	exon10			ACCCTGTTGCTAT	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.1043T>C	8.37:g.41472557T>C	ENSP00000380184:p.Val348Ala	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	5.0	NM_178819	Q86V89	Missense_Mutation	SNP	ENST00000396987.3	37	CCDS6117.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.947797	0.92593	.	.	ENSG00000158669	ENST00000396987	D	0.96011	-3.88	5.03	5.03	0.67393	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.97158	0.9071	M	0.84082	2.675	0.80722	D	1	P	0.45902	0.868	P	0.57283	0.817	D	0.97454	1.0030	10	0.56958	D	0.05	.	14.0909	0.64990	0.0:0.0:0.0:1.0	.	348	Q86UL3	GPAT4_HUMAN	A	348	ENSP00000380184:V348A	ENSP00000380184:V348A	V	+	2	0	AGPAT6	41591714	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.868000	0.87116	2.120000	0.65058	0.533000	0.62120	GTT	.		0.458	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
AMPD2	271	hgsc.bcm.edu;bcgsc.ca	37	1	110173318	110173318	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:110173318A>G	ENST00000256578.3	+	17	2693	c.2333A>G	c.(2332-2334)gAg>gGg	p.E778G	AMPD2_ENST00000393688.3_Missense_Mutation_p.E659G|AMPD2_ENST00000528667.1_Missense_Mutation_p.E778G|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000358729.4_Missense_Mutation_p.E703G|AMPD2_ENST00000342115.4_Missense_Mutation_p.E697G|AMPD2_ENST00000528454.1_Missense_Mutation_p.E660G	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	778			E -> D (in PCH9). {ECO:0000269|PubMed:23911318}.		cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCGCTGATGGAGGAGTACAGC	0.647																																					p.E778G		.											.	AMPD2	292	0			c.A2333G						.						39.0	35.0	37.0					1																	110173318		2203	4299	6502	SO:0001583	missense	271	exon17			TGATGGAGGAGTA	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.2333A>G	1.37:g.110173318A>G	ENSP00000256578:p.Glu778Gly	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_004037	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	37	CCDS805.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.938647	0.92526	.	.	ENSG00000116337	ENST00000342115;ENST00000528667;ENST00000256578;ENST00000358729;ENST00000528454;ENST00000393688	D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	4.9	4.9	0.64082	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.92384	0.7583	M	0.90198	3.095	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.926;0.974;1.0;0.999	D	0.93847	0.7142	10	0.72032	D	0.01	-31.8313	14.3437	0.66646	1.0:0.0:0.0:0.0	.	703;659;778;697	Q01433-4;Q01433-3;Q01433;Q01433-2	.;.;AMPD2_HUMAN;.	G	697;778;778;703;660;659	ENSP00000345498:E697G;ENSP00000436541:E778G;ENSP00000256578:E778G;ENSP00000351573:E703G;ENSP00000437164:E660G;ENSP00000377292:E659G	ENSP00000256578:E778G	E	+	2	0	AMPD2	109974841	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.081000	0.94049	2.071000	0.62044	0.402000	0.26972	GAG	.		0.647	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
ANK3	288	hgsc.bcm.edu;bcgsc.ca	37	10	61843261	61843261	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:61843261A>G	ENST00000280772.2	-	33	4380	c.4189T>C	c.(4189-4191)Ttt>Ctt	p.F1397L	ANK3_ENST00000355288.2_Missense_Mutation_p.F531L|Y_RNA_ENST00000365320.1_RNA|ANK3_ENST00000373827.2_Missense_Mutation_p.F1391L|ANK3_ENST00000503366.1_Missense_Mutation_p.F1398L	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1397	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTGATGGAAAATGGCAGTCTA	0.289																																					p.F1398L		.											.	ANK3	107	0			c.T4192C						.						44.0	47.0	46.0					10																	61843261		2202	4294	6496	SO:0001583	missense	288	exon34			TGGAAAATGGCAG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4189T>C	10.37:g.61843261A>G	ENSP00000280772:p.Phe1397Leu	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_001204404	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924684	0.52653	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.9	5.9	0.94986	.	0.000000	0.40222	N	0.001149	T	0.41604	0.1166	L	0.55103	1.725	0.80722	D	1	B;D;B;D;B;P	0.69078	0.001;0.989;0.007;0.997;0.024;0.956	B;D;B;D;B;D	0.72338	0.004;0.977;0.011;0.97;0.029;0.931	T	0.26849	-1.0091	10	0.02654	T	1	.	16.3322	0.83039	1.0:0.0:0.0:0.0	.	1398;531;1391;1397;632;531	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;ANK3_HUMAN;.;.	L	1397;1391;531;531;1398;1377;632;1032;1032;530	ENSP00000280772:F1397L;ENSP00000362933:F1391L;ENSP00000347436:F531L;ENSP00000425236:F1398L	ENSP00000280772:F1397L	F	-	1	0	ANK3	61513267	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.511000	0.81718	2.251000	0.74343	0.528000	0.53228	TTT	.		0.289	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
ANKIB1	54467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92028083	92028083	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:92028083T>C	ENST00000265742.3	+	20	3466	c.3090T>C	c.(3088-3090)agT>agC	p.S1030S		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	1030							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCAGTGTCAGTGAAGGTAGAG	0.488																																					p.S1030S		.											.	ANKIB1	432	0			c.T3090C						.						54.0	54.0	54.0					7																	92028083		1916	4130	6046	SO:0001819	synonymous_variant	54467	exon20			TGTCAGTGAAGGT	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.3090T>C	7.37:g.92028083T>C		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	51.0	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Silent	SNP	ENST00000265742.3	37	CCDS47639.1																																																																																			.		0.488	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
ARAP2	116984	hgsc.bcm.edu;bcgsc.ca	37	4	36069848	36069848	+	Missense_Mutation	SNP	T	T	C	rs202134005		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:36069848T>C	ENST00000303965.4	-	33	5285	c.4796A>G	c.(4795-4797)gAg>gGg	p.E1599G		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1599					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GTCCACGGACTCTTTATCACA	0.458																																					p.E1599G		.											.	ARAP2	93	0			c.A4796G						.						78.0	82.0	81.0					4																	36069848		2203	4300	6503	SO:0001583	missense	116984	exon33			ACGGACTCTTTAT	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.4796A>G	4.37:g.36069848T>C	ENSP00000302895:p.Glu1599Gly	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	T	5.928	0.355203	0.11239	.	.	ENSG00000047365	ENST00000303965	T	0.10099	2.91	6.08	-0.583	0.11706	.	0.707951	0.14215	N	0.333783	T	0.05502	0.0145	L	0.29908	0.895	0.09310	N	1	P	0.36282	0.546	B	0.30401	0.115	T	0.30534	-0.9975	10	0.62326	D	0.03	.	1.3284	0.02130	0.133:0.2237:0.1386:0.5047	.	1599	Q8WZ64	ARAP2_HUMAN	G	1599	ENSP00000302895:E1599G	ENSP00000302895:E1599G	E	-	2	0	ARAP2	35746243	0.309000	0.24518	0.000000	0.03702	0.001000	0.01503	1.463000	0.35277	-0.270000	0.09285	-1.137000	0.01932	GAG	T|0.999;A|0.001		0.458	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
ARAP3	64411	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	141059772	141059772	+	Silent	SNP	G	G	A	rs146312944		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:141059772G>A	ENST00000239440.4	-	2	347	c.282C>T	c.(280-282)ccC>ccT	p.P94P	ARAP3_ENST00000508305.1_Silent_p.P16P	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	94	Pro-rich.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GCTTCGGCACGGGCTTAGGGG	0.652																																					p.P94P		.											.	ARAP3	291	0			c.C282T						.	G		0,4406		0,0,2203	48.0	58.0	54.0		282	-7.8	1.0	5	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ARAP3	NM_022481.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		94/1545	141059772	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64411	exon2			CGGCACGGGCTTA	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.282C>T	5.37:g.141059772G>A		Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	66.0	NM_022481	B4DIT1|D3DQE3	Silent	SNP	ENST00000239440.4	37	CCDS4266.1																																																																																			G|1.000;A|0.000		0.652	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
ARHGAP35	2909	hgsc.bcm.edu;bcgsc.ca	37	19	47424967	47424967	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:47424967T>C	ENST00000404338.3	+	1	3035	c.3035T>C	c.(3034-3036)cTc>cCc	p.L1012P		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1012					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CATTCTAAGCTCTCTATGGAA	0.438																																					p.L1012P		.											.	.	.	0			c.T3035C						.						73.0	69.0	71.0					19																	47424967		1893	4132	6025	SO:0001583	missense	2909	exon1			CTAAGCTCTCTAT	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3035T>C	19.37:g.47424967T>C	ENSP00000385720:p.Leu1012Pro	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	5.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709991	0.48517	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.08546	3.08	5.76	5.76	0.90799	.	0.233903	0.44097	D	0.000491	T	0.11879	0.0289	N	0.22421	0.69	0.58432	D	0.999996	D	0.54047	0.964	P	0.52066	0.689	T	0.07481	-1.0770	10	0.44086	T	0.13	-16.5649	15.0486	0.71846	0.0:0.0:0.0:1.0	.	1012	Q9NRY4-2	.	P	1012	ENSP00000385720:L1012P	ENSP00000324820:L1012P	L	+	2	0	ARHGAP35	52116807	0.949000	0.32298	0.982000	0.44146	0.919000	0.55068	2.300000	0.43620	2.200000	0.70718	0.533000	0.62120	CTC	.		0.438	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
ASAP2	8853	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	9533657	9533657	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:9533657C>A	ENST00000281419.3	+	24	2905	c.2565C>A	c.(2563-2565)agC>agA	p.S855R	ASAP2_ENST00000491413.1_3'UTR|ASAP2_ENST00000315273.4_Missense_Mutation_p.S810R	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	855	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AGACGCCCAGCGTAATGGAAG	0.701																																					p.S855R		.											.	ASAP2	90	0			c.C2565A						.						14.0	15.0	15.0					2																	9533657		2201	4298	6499	SO:0001583	missense	8853	exon24			GCCCAGCGTAATG	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2565C>A	2.37:g.9533657C>A	ENSP00000281419:p.Ser855Arg	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	12.0	NM_003887	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	37	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	C	5.440	0.266321	0.10294	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.59083	0.43;0.29	5.36	-6.75	0.01738	.	6.995770	0.00550	N	0.000258	T	0.42944	0.1225	L	0.34521	1.04	0.24168	N	0.995632	P;B	0.40794	0.729;0.123	B;B	0.42959	0.403;0.135	T	0.43261	-0.9402	10	0.28530	T	0.3	.	2.9644	0.05903	0.0926:0.3469:0.2278:0.3327	.	810;855	O43150-2;O43150	.;ASAP2_HUMAN	R	855;810	ENSP00000281419:S855R;ENSP00000316404:S810R	ENSP00000281419:S855R	S	+	3	2	ASAP2	9451108	0.041000	0.20044	0.000000	0.03702	0.011000	0.07611	-1.141000	0.03207	-1.110000	0.02992	0.462000	0.41574	AGC	.		0.701	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
ASCC3	10973	hgsc.bcm.edu;bcgsc.ca	37	6	101109765	101109765	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:101109765T>C	ENST00000369162.2	-	16	2964	c.2620A>G	c.(2620-2622)Agc>Ggc	p.S874G		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	874	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AGGTAATGGCTGAGTTTATCA	0.398																																					p.S874G		.											.	ASCC3	96	0			c.A2620G						.						194.0	187.0	190.0					6																	101109765		2203	4300	6503	SO:0001583	missense	10973	exon16			AATGGCTGAGTTT	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.2620A>G	6.37:g.101109765T>C	ENSP00000358159:p.Ser874Gly	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	5.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701149	0.68501	.	.	ENSG00000112249	ENST00000369162	D	0.91351	-2.83	5.76	5.76	0.90799	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83797	0.5332	L	0.42008	1.315	0.80722	D	1	P	0.51449	0.945	B	0.41466	0.358	D	0.85473	0.1174	10	0.45353	T	0.12	.	16.3786	0.83431	0.0:0.0:0.0:1.0	.	874	Q8N3C0	HELC1_HUMAN	G	874	ENSP00000358159:S874G	ENSP00000358159:S874G	S	-	1	0	ASCC3	101216486	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.043000	0.71004	2.323000	0.78572	0.528000	0.53228	AGC	.		0.398	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
ATM	472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	108138031	108138031	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:108138031G>C	ENST00000452508.2	+	18	2789	c.2600G>C	c.(2599-2601)aGt>aCt	p.S867T	ATM_ENST00000278616.4_Missense_Mutation_p.S867T|AP001925.1_ENST00000596081.1_5'Flank			Q13315	ATM_HUMAN	ATM serine/threonine kinase	867					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AGTAGTGTTAGTGATGCAAAC	0.353			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.S867T		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	3419	0			c.G2600C						.						109.0	102.0	104.0					11																	108138031		2201	4298	6499	SO:0001583	missense	472	exon17	Familial Cancer Database	AT, Louis-Bar syndrome	GTGTTAGTGATGC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2600G>C	11.37:g.108138031G>C	ENSP00000388058:p.Ser867Thr	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	31.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	3.064	-0.192659	0.06259	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.71934	-0.61;-0.61;-0.61	4.89	-2.89	0.05665	Armadillo-type fold (1);	0.765648	0.13145	N	0.410333	T	0.46405	0.1391	N	0.21448	0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20739	-1.0266	10	0.38643	T	0.18	.	2.0851	0.03644	0.3268:0.2348:0.3338:0.1046	.	867	Q13315	ATM_HUMAN	T	867	ENSP00000435747:S867T;ENSP00000278616:S867T;ENSP00000388058:S867T	ENSP00000278616:S867T	S	+	2	0	ATM	107643241	0.005000	0.15991	0.007000	0.13788	0.003000	0.03518	-0.306000	0.08178	-0.400000	0.07656	-0.469000	0.05056	AGT	.		0.353	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
BAG6	7917	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	31610072	31610072	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:31610072G>A	ENST00000375964.6	-	15	2375	c.2062C>T	c.(2062-2064)Cct>Tct	p.P688S	BAG6_ENST00000375976.4_Missense_Mutation_p.P682S|BAG6_ENST00000404765.2_Missense_Mutation_p.P718S|BAG6_ENST00000470875.1_5'UTR|BAG6_ENST00000211379.5_Missense_Mutation_p.P682S|BAG6_ENST00000362049.6_Missense_Mutation_p.P682S|BAG6_ENST00000439687.2_Missense_Mutation_p.P556S	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	688					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						AGGCCTCCAGGACTCCCTGCG	0.682																																					p.P688S		.											.	BAG6	154	0			c.C2062T						.						9.0	9.0	9.0					6																	31610072		1497	2694	4191	SO:0001583	missense	7917	exon15			CTCCAGGACTCCC	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.2062C>T	6.37:g.31610072G>A	ENSP00000365131:p.Pro688Ser	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	7.0	NM_004639	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	ENST00000375964.6	37	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626236	0.28978	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049;ENST00000437771	T;T;T;T;T;T;T	0.53206	1.52;1.51;1.52;1.51;0.63;1.49;0.82	5.75	4.83	0.62350	.	0.067860	0.56097	D	0.000030	T	0.19927	0.0479	N	0.19112	0.55	0.32818	D	0.502398	B;B;B;B	0.23185	0.043;0.073;0.081;0.056	B;B;B;B	0.25405	0.027;0.06;0.014;0.022	T	0.08249	-1.0731	10	0.42905	T	0.14	.	13.5612	0.61790	0.0:0.1562:0.8438:0.0	.	556;682;688;682	E7EMZ4;F8VXY4;P46379;P46379-2	.;.;BAG6_HUMAN;.	S	682;688;682;718;556;682;718	ENSP00000365143:P682S;ENSP00000365131:P688S;ENSP00000211379:P682S;ENSP00000384494:P718S;ENSP00000402856:P556S;ENSP00000354875:P682S;ENSP00000397978:P718S	ENSP00000211379:P682S	P	-	1	0	BAG6	31718051	0.965000	0.33210	0.998000	0.56505	0.984000	0.73092	1.762000	0.38451	2.731000	0.93534	0.650000	0.86243	CCT	.		0.682	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	
BAZ2B	29994	broad.mit.edu;mdanderson.org	37	2	160295184	160295184	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:160295184T>C	ENST00000392783.2	-	8	1418	c.923A>G	c.(922-924)gAc>gGc	p.D308G	BAZ2B_ENST00000392782.1_Missense_Mutation_p.D306G|BAZ2B_ENST00000355831.2_Missense_Mutation_p.D308G|BAZ2B_ENST00000343439.5_Missense_Mutation_p.D306G	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	308					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TGCTTTTGGGTCTGAAATACC	0.378																																					p.D308G		.											.	BAZ2B	94	0			c.A923G						.						164.0	160.0	161.0					2																	160295184		1822	4092	5914	SO:0001583	missense	29994	exon8			TTTGGGTCTGAAA	AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.923A>G	2.37:g.160295184T>C	ENSP00000376534:p.Asp308Gly	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	18.0	3.0	NM_013450	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	ENST00000392783.2	37	CCDS2209.2	.	.	.	.	.	.	.	.	.	.	T	15.90	2.970820	0.53614	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000546335	T;T;T;T	0.08720	3.06;3.06;3.06;3.06	4.84	4.84	0.62591	.	0.000000	0.39020	U	0.001491	T	0.22475	0.0542	L	0.51422	1.61	0.40826	D	0.983541	D;D;D;D;D	0.71674	0.998;0.998;0.99;0.99;0.982	D;D;P;P;P	0.78314	0.991;0.991;0.792;0.719;0.528	T	0.00797	-1.1562	10	0.62326	D	0.03	-12.2485	13.2962	0.60298	0.0:0.0:0.0:1.0	.	306;308;306;306;308	Q6MZK7;Q9UIF8-3;Q9UIF8-2;Q9UIF8-5;Q9UIF8	.;.;.;.;BAZ2B_HUMAN	G	306;308;308;306;245	ENSP00000376533:D306G;ENSP00000376534:D308G;ENSP00000348087:D308G;ENSP00000339670:D306G	ENSP00000339670:D306G	D	-	2	0	BAZ2B	160003430	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.419000	0.52728	1.924000	0.55735	0.528000	0.53228	GAC	.		0.378	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255037.2		
BCL11A	53335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	60687558	60687558	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:60687558T>G	ENST00000335712.6	-	4	2716	c.2489A>C	c.(2488-2490)aAt>aCt	p.N830T	BCL11A_ENST00000538214.1_Intron|BCL11A_ENST00000356842.4_Intron|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.N796T|BCL11A_ENST00000477659.1_5'UTR	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	830					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TTTTATATCATTATTCAACAC	0.443			T	IGH@	B-CLL																																p.N830T		.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A	1149	0			c.A2489C						.						97.0	101.0	100.0					2																	60687558		2203	4300	6503	SO:0001583	missense	53335	exon4			ATATCATTATTCA	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.2489A>C	2.37:g.60687558T>G	ENSP00000338774:p.Asn830Thr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	31.0	NM_022893	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	37	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	T	6.371	0.436556	0.12104	.	.	ENSG00000119866	ENST00000335712;ENST00000358510	T;T	0.06142	3.39;3.34	6.17	6.17	0.99709	.	0.191271	0.44688	D	0.000439	T	0.06600	0.0169	N	0.22421	0.69	0.80722	D	1	B;B	0.16166	0.002;0.016	B;B	0.16289	0.007;0.015	T	0.36696	-0.9737	10	0.41790	T	0.15	-2.1995	16.8222	0.85835	0.0:0.0:0.0:1.0	.	796;830	Q9H165-6;Q9H165	.;BC11A_HUMAN	T	830;796	ENSP00000338774:N830T;ENSP00000351307:N796T	ENSP00000338774:N830T	N	-	2	0	BCL11A	60541062	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.772000	0.55325	2.371000	0.80710	0.533000	0.62120	AAT	.		0.443	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
BBS5	129880	hgsc.bcm.edu;bcgsc.ca	37	2	170343593	170343593	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:170343593A>G	ENST00000295240.3	+	3	533	c.157A>G	c.(157-159)Aca>Gca	p.T53A	RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.T53A|BBS5_ENST00000554017.1_Missense_Mutation_p.T53A|BBS5_ENST00000392663.2_Missense_Mutation_p.T53A	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	53					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ACTCTTGGTAACAAATTTAAG	0.343									Bardet-Biedl syndrome																												p.T53A		.											.	BBS5	90	0			c.A157G						.						175.0	182.0	180.0					2																	170343593		2203	4300	6503	SO:0001583	missense	129880	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TTGGTAACAAATT	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.157A>G	2.37:g.170343593A>G	ENSP00000295240:p.Thr53Ala	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_152384	D3DPC3|Q6PKN0	Missense_Mutation	SNP	ENST00000295240.3	37	CCDS2233.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.734544	0.89482	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.91147	0.7212	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.985;0.996;0.998	D	0.92831	0.6280	10	0.87932	D	0	-16.5329	15.6945	0.77484	1.0:0.0:0.0:0.0	.	53;53;53	E9PBE3;Q8N3I7-2;Q8N3I7	.;.;BBS5_HUMAN	A	53	ENSP00000295240:T53A;ENSP00000452313:T53A;ENSP00000376431:T53A;ENSP00000424363:T53A	ENSP00000295240:T53A	T	+	1	0	BBS5;RP11-724O16.1	170051839	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.012000	0.93624	2.094000	0.63399	0.533000	0.62120	ACA	.		0.343	BBS5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255265.2	NM_152384	
BICD1	636	hgsc.bcm.edu;bcgsc.ca	37	12	32369322	32369322	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:32369322A>G	ENST00000281474.5	+	2	458	c.355A>G	c.(355-357)Agc>Ggc	p.S119G	BICD1_ENST00000548411.1_Missense_Mutation_p.S119G	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	119					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GCTGAAACAGAGCCGGGCTGT	0.502																																					p.S119G		.											.	BICD1	153	0			c.A355G						.						102.0	94.0	97.0					12																	32369322		2203	4300	6503	SO:0001583	missense	636	exon2			AAACAGAGCCGGG	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.355A>G	12.37:g.32369322A>G	ENSP00000281474:p.Ser119Gly	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	5.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.347499	0.82022	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.30714	1.52;1.52	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.36413	0.0966	M	0.65975	2.015	0.80722	D	1	B;B	0.31655	0.058;0.334	B;B	0.34038	0.055;0.174	T	0.12142	-1.0559	10	0.35671	T	0.21	.	15.9745	0.80049	1.0:0.0:0.0:0.0	.	119;119	F8W113;Q96G01	.;BICD1_HUMAN	G	119	ENSP00000446793:S119G;ENSP00000281474:S119G	ENSP00000281474:S119G	S	+	1	0	BICD1	32260589	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.310000	0.78947	2.168000	0.68352	0.533000	0.62120	AGC	.		0.502	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
BICD1	636	hgsc.bcm.edu;bcgsc.ca	37	12	32520657	32520657	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:32520657A>G	ENST00000281474.5	+	9	2921	c.2818A>G	c.(2818-2820)Agg>Ggg	p.R940G	BICD1_ENST00000548411.1_3'UTR	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	940					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ACTAGCCGGGAGGCAAGACTG	0.512																																					p.R940G		.											.	BICD1	153	0			c.A2818G						.						122.0	105.0	111.0					12																	32520657		2203	4300	6503	SO:0001583	missense	636	exon9			GCCGGGAGGCAAG	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2818A>G	12.37:g.32520657A>G	ENSP00000281474:p.Arg940Gly	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	37	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.857288	0.32791	.	.	ENSG00000151746	ENST00000281474	T	0.46063	0.88	5.25	4.1	0.47936	.	0.132974	0.34676	N	0.003777	T	0.18045	0.0433	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06250	-1.0837	10	0.11794	T	0.64	.	5.2631	0.15584	0.6824:0.1511:0.1665:0.0	.	940	Q96G01	BICD1_HUMAN	G	940	ENSP00000281474:R940G	ENSP00000281474:R940G	R	+	1	2	BICD1	32411924	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.404000	0.52623	0.830000	0.34757	0.482000	0.46254	AGG	.		0.512	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
BCL7A	605	hgsc.bcm.edu;bcgsc.ca	37	12	122492735	122492735	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:122492735A>G	ENST00000261822.4	+	5	670	c.464A>G	c.(463-465)cAg>cGg	p.Q155R	BCL7A_ENST00000538010.1_Missense_Mutation_p.Q155R	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	155					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CAGAATTCACAGTCCTCGATG	0.537			T	MYC	BNHL						OREG0022214	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q155R	GBM(17;197 467 16477 23242 44349)	.		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	.	BCL7A	685	0			c.A464G						.						129.0	136.0	134.0					12																	122492735		2203	4300	6503	SO:0001583	missense	605	exon5			ATTCACAGTCCTC	X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.464A>G	12.37:g.122492735A>G	ENSP00000261822:p.Gln155Arg	Somatic	68.0	0.0	1519	WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_020993	B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	ENST00000261822.4	37	CCDS53841.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.875805	0.33162	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.46451	0.87;0.9	6.07	4.91	0.64330	.	0.171731	0.52532	D	0.000080	T	0.30039	0.0752	N	0.19112	0.55	0.43342	D	0.995396	P;P	0.41848	0.651;0.763	B;B	0.42282	0.115;0.382	T	0.03095	-1.1073	10	0.18276	T	0.48	.	12.6969	0.57010	0.8763:0.0:0.0:0.1236	.	155;155	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	R	155	ENSP00000445868:Q155R;ENSP00000261822:Q155R	ENSP00000261822:Q155R	Q	+	2	0	BCL7A	120977118	1.000000	0.71417	0.976000	0.42696	0.819000	0.46315	4.651000	0.61447	1.093000	0.41377	-0.333000	0.08304	CAG	.		0.537	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
BRWD1	54014	hgsc.bcm.edu;bcgsc.ca	37	21	40590495	40590495	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr21:40590495A>G	ENST00000333229.2	-	30	3801	c.3474T>C	c.(3472-3474)ggT>ggC	p.G1158G	BRWD1-IT1_ENST00000435608.1_RNA|BRWD1_ENST00000380800.3_Silent_p.G1158G|BRWD1_ENST00000342449.3_Silent_p.G1158G	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1158					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TTGATTTCTGACCCCATTCAC	0.328																																					p.G1158G	Melanoma(170;988 1986 4794 16843 39731)	.											.	BRWD1	94	0			c.T3474C						.						136.0	121.0	126.0					21																	40590495		2203	4300	6503	SO:0001819	synonymous_variant	54014	exon30			TTTCTGACCCCAT	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3474T>C	21.37:g.40590495A>G		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	5.0	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	37	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	A	9.000	0.979959	0.18812	.	.	ENSG00000185658	ENST00000424441	.	.	.	5.36	-3.9	0.04181	.	.	.	.	.	T	0.37732	0.1014	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.36768	-0.9734	4	.	.	.	-8.878	1.3199	0.02114	0.2806:0.1085:0.3337:0.2773	.	.	.	.	P	144	.	.	S	-	1	0	BRWD1	39512365	0.000000	0.05858	0.989000	0.46669	0.996000	0.88848	-1.778000	0.01778	-0.539000	0.06273	0.460000	0.39030	TCA	.		0.328	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
BZRAP1	9256	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56388536	56388536	+	Silent	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:56388536C>A	ENST00000343736.4	-	19	3283	c.3120G>T	c.(3118-3120)ctG>ctT	p.L1040L	BZRAP1_ENST00000355701.3_Silent_p.L1040L|BZRAP1_ENST00000268893.6_Silent_p.L980L			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	1040	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ACAACTCCACCAGTACACTGC	0.652																																					p.L1040L		.											.	BZRAP1	229	0			c.G3120T						.						16.0	17.0	16.0					17																	56388536		2188	4284	6472	SO:0001819	synonymous_variant	9256	exon19			CTCCACCAGTACA	AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.3120G>T	17.37:g.56388536C>A		Somatic	109.0	1.0		WXS	Illumina HiSeq	Phase_I	115.0	84.0	NM_004758	O75111|Q8N5W3	Silent	SNP	ENST00000343736.4	37	CCDS11605.1																																																																																			.		0.652	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443980.1	NM_004758	
EDRF1	26098	hgsc.bcm.edu;bcgsc.ca	37	10	127431772	127431772	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:127431772A>G	ENST00000356792.4	+	18	2749	c.2517A>G	c.(2515-2517)agA>agG	p.R839R	RP11-383C5.7_ENST00000449436.1_RNA|RP11-383C5.7_ENST00000602030.1_RNA|C10orf137_ENST00000337623.3_Silent_p.R805R|RP11-383C5.7_ENST00000600784.1_RNA|RP11-383C5.7_ENST00000594025.1_RNA|RP11-383C5.7_ENST00000593871.1_RNA	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		839					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TATTAAAGAGAATGGGTAACA	0.358																																					p.R839R		.											.	C10orf137	590	0			c.A2517G						.						120.0	120.0	120.0					10																	127431772		2203	4300	6503	SO:0001819	synonymous_variant	26098	exon18			AAAGAGAATGGGT																												ENST00000356792.4:c.2517A>G	10.37:g.127431772A>G		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_001202438	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	37	CCDS55733.1																																																																																			.		0.358	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
ERICH3	127254	hgsc.bcm.edu;bcgsc.ca	37	1	75078418	75078418	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:75078418A>G	ENST00000326665.5	-	9	1294	c.1076T>C	c.(1075-1077)gTg>gCg	p.V359A	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Missense_Mutation_p.V162A	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		359										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TAACCTGTTCACCTGCATCCC	0.423																																					p.V359A		.											.	C1orf173	94	0			c.T1076C						.						99.0	96.0	97.0					1																	75078418		2203	4300	6503	SO:0001583	missense	127254	exon9			CTGTTCACCTGCA																												ENST00000326665.5:c.1076T>C	1.37:g.75078418A>G	ENSP00000322609:p.Val359Ala	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	5.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.872260	0.91587	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.21031	2.47;2.03	5.63	5.63	0.86233	.	.	.	.	.	T	0.29126	0.0724	L	0.52364	1.645	0.51233	D	0.999916	D;D	0.89917	0.997;1.0	D;D	0.74674	0.941;0.984	T	0.01496	-1.1340	9	0.29301	T	0.29	-21.4021	15.8025	0.78463	1.0:0.0:0.0:0.0	.	162;359	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	A	359;162	ENSP00000322609:V359A;ENSP00000398581:V162A	ENSP00000322609:V359A	V	-	2	0	C1orf173	74851006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.877000	0.92386	2.265000	0.75225	0.533000	0.62120	GTG	.		0.423	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
C5AR2	27202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47844736	47844736	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:47844736C>A	ENST00000595464.1	+	2	898	c.680C>A	c.(679-681)gCa>gAa	p.A227E	C5AR2_ENST00000257267.2_Missense_Mutation_p.A227E|C5AR2_ENST00000600626.1_Missense_Mutation_p.A227E	NM_001271749.1	NP_001258678.1	Q9P296	C5AR2_HUMAN	complement component 5a receptor 2	227					chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of interleukin-8 secretion (GO:2000482)	apical part of cell (GO:0045177)|basal plasma membrane (GO:0009925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)										CTGTGCTGGGCAGCCCGACGC	0.667																																					p.A227E		.											.	.	.	0			c.C680A						.						28.0	36.0	34.0					19																	47844736		2179	4260	6439	SO:0001583	missense	27202	exon2			GCTGGGCAGCCCG	AB038237	CCDS12699.1	19q13.33	2013-01-28	2013-01-28	2013-01-28		ENSG00000134830		"""GPCR / Class A : Complement component receptors"""	4527	protein-coding gene	gene with protein product		609949	"""G protein-coupled receptor 77"""	GPR77		11165367	Standard	NM_018485		Approved	C5L2	uc010ela.1	Q9P296		ENST00000595464.1:c.680C>A	19.37:g.47844736C>A	ENSP00000472620:p.Ala227Glu	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	16.0	NM_001271750	B2RA09	Missense_Mutation	SNP	ENST00000595464.1	37	CCDS12699.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.909012	0.52439	.	.	ENSG00000134830	ENST00000257267	T	0.38560	1.13	4.11	-6.76	0.01732	GPCR, rhodopsin-like superfamily (1);	0.952150	0.08746	U	0.899814	T	0.40347	0.1113	M	0.62723	1.935	0.09310	N	1	D	0.54601	0.967	P	0.58266	0.836	T	0.41556	-0.9502	10	0.12430	T	0.62	.	0.5786	0.00708	0.2218:0.1518:0.245:0.3814	.	227	Q9P296	C5ARL_HUMAN	E	227	ENSP00000257267:A227E	ENSP00000257267:A227E	A	+	2	0	GPR77	52536576	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-1.026000	0.03596	-0.867000	0.04063	0.313000	0.20887	GCA	.		0.667	C5AR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466926.1	NM_018485	
C9orf41	138199	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	77614715	77614715	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:77614715A>G	ENST00000376834.3	-	4	814	c.662T>C	c.(661-663)cTa>cCa	p.L221P	C9orf41_ENST00000376837.3_Intron	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	221										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						AGCATAACCTAGCATAGCTAT	0.358																																					p.L221P		.											.	C9orf41	92	0			c.T662C						.						99.0	98.0	98.0					9																	77614715		2203	4300	6503	SO:0001583	missense	138199	exon4			TAACCTAGCATAG	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.662T>C	9.37:g.77614715A>G	ENSP00000366030:p.Leu221Pro	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	4.0	NM_152420	Q7Z383|Q8N7C5	Missense_Mutation	SNP	ENST00000376834.3	37	CCDS6649.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.557523	0.65425	.	.	ENSG00000156017	ENST00000376834;ENST00000451153	T;T	0.04502	3.61;3.61	6.07	6.07	0.98685	N2227-like (1);	0.067331	0.64402	D	0.000009	T	0.23926	0.0579	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.01725	-1.1287	10	0.38643	T	0.18	-8.7332	11.6865	0.51490	0.868:0.0:0.0:0.132	.	221	Q8N4J0	CI041_HUMAN	P	221;160	ENSP00000366030:L221P;ENSP00000396353:L160P	ENSP00000366030:L221P	L	-	2	0	C9orf41	76804535	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.840000	0.75369	2.326000	0.78906	0.533000	0.62120	CTA	.		0.358	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420	
CCAR1	55749	hgsc.bcm.edu;bcgsc.ca	37	10	70515291	70515291	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:70515291A>G	ENST00000265872.6	+	13	1742	c.1623A>G	c.(1621-1623)caA>caG	p.Q541Q	CCAR1_ENST00000535016.1_Silent_p.Q526Q|SNORD98_ENST00000408255.1_RNA|CCAR1_ENST00000483264.1_3'UTR|CCAR1_ENST00000543719.1_Silent_p.Q526Q	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	541					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TGTGCACACAATGGTAAGTAC	0.398																																					p.Q541Q		.											.	CCAR1	159	0			c.A1623G						.						191.0	184.0	187.0					10																	70515291		2203	4300	6503	SO:0001819	synonymous_variant	55749	exon13			CACACAATGGTAA	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1623A>G	10.37:g.70515291A>G		Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	4.0	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Silent	SNP	ENST00000265872.6	37	CCDS7282.1																																																																																			.		0.398	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
CCDC39	339829	hgsc.bcm.edu;bcgsc.ca	37	3	180361933	180361933	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:180361933A>G	ENST00000442201.2	-	12	1759	c.1640T>C	c.(1639-1641)cTt>cCt	p.L547P	CCDC39_ENST00000273654.4_Missense_Mutation_p.L631P	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	547					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.L631R(1)|p.L547R(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GGCTTTATCAAGTTCTTTCTC	0.308																																					p.L547P		.											.	CCDC39	72	2	Substitution - Missense(2)	large_intestine(2)	c.T1640C						.						160.0	145.0	150.0					3																	180361933		1488	3303	4791	SO:0001583	missense	339829	exon12			TTATCAAGTTCTT	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1640T>C	3.37:g.180361933A>G	ENSP00000405708:p.Leu547Pro	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	5.0	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	A	14.59	2.581707	0.46006	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.23552	1.9;1.9	5.56	5.56	0.83823	.	0.162313	0.41396	D	0.000899	T	0.53899	0.1825	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59295	-0.7481	10	0.72032	D	0.01	-5.8948	15.0019	0.71479	1.0:0.0:0.0:0.0	.	547	Q9UFE4	CCD39_HUMAN	P	631;547	ENSP00000273654:L631P;ENSP00000405708:L547P	ENSP00000273654:L631P	L	-	2	0	CCDC39	181844627	0.999000	0.42202	0.926000	0.36857	0.128000	0.20619	5.752000	0.68728	2.240000	0.73641	0.533000	0.62120	CTT	.		0.308	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
CCDC6	8030	hgsc.bcm.edu;bcgsc.ca	37	10	61612353	61612353	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:61612353T>C	ENST00000263102.6	-	2	642	c.411A>G	c.(409-411)gaA>gaG	p.E137E		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	137	5 X 29 AA tandem repeats.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GGAATTCTTCTTCTTTCTCAT	0.373			T	RET	NSCLC																																p.E137E		.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	.	CCDC6	686	0			c.A411G						.						118.0	122.0	120.0					10																	61612353		2203	4300	6503	SO:0001819	synonymous_variant	8030	exon2			TTCTTCTTCTTTC	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.411A>G	10.37:g.61612353T>C		Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_005436	Q15250|Q6GSG7	Silent	SNP	ENST00000263102.6	37	CCDS7257.1																																																																																			.		0.373	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
CCDC8	83987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	46915065	46915065	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:46915065G>C	ENST00000307522.3	-	1	1776	c.1003C>G	c.(1003-1005)Cag>Gag	p.Q335E		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	335					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		TCTTCCCTCTGATTATCTGCA	0.602																																					p.Q335E		.											.	CCDC8	93	0			c.C1003G						.						94.0	100.0	98.0					19																	46915065		2203	4300	6503	SO:0001583	missense	83987	exon1			CCCTCTGATTATC	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1003C>G	19.37:g.46915065G>C	ENSP00000303158:p.Gln335Glu	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	20.0	NM_032040	Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	37	CCDS12685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.69|12.69	2.013964|2.013964	0.35511|0.35511	.|.	.|.	ENSG00000169515|ENSG00000169515	ENST00000540252|ENST00000307522	.|T	.|0.13196	.|2.61	4.3|4.3	4.3|4.3	0.51218|0.51218	.|.	.|0.495473	.|0.15037	.|N	.|0.284089	T|T	0.18800|0.18800	0.0451|0.0451	M|M	0.65498|0.65498	2.005|2.005	0.09310|0.09310	N|N	1|1	.|P	.|0.50819	.|0.939	.|B	.|0.42851	.|0.4	T|T	0.15521|0.15521	-1.0434|-1.0434	6|10	0.35671|0.25751	T|T	0.21|0.34	-2.9829|-2.9829	15.0527|15.0527	0.71888|0.71888	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|335	.|Q9H0W5	.|CCDC8_HUMAN	M|E	181|335	.|ENSP00000303158:Q335E	ENSP00000441180:I181M|ENSP00000303158:Q335E	I|Q	-|-	3|1	3|0	CCDC8|CCDC8	51606905|51606905	0.004000|0.004000	0.15560|0.15560	0.140000|0.140000	0.22221|0.22221	0.039000|0.039000	0.13416|0.13416	1.446000|1.446000	0.35090|0.35090	2.317000|2.317000	0.78254|0.78254	0.561000|0.561000	0.74099|0.74099	ATC|CAG	.		0.602	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
CCDC88C	440193	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	91770230	91770230	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:91770230G>A	ENST00000389857.6	-	20	3536	c.3450C>T	c.(3448-3450)aaC>aaT	p.N1150N		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1150					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCAGGCTTTCGTTCTCCGTCT	0.657																																					p.N1150N		.											.	CCDC88C	25	0			c.C3450T						.						72.0	80.0	78.0					14																	91770230		2159	4255	6414	SO:0001819	synonymous_variant	440193	exon20			GCTTTCGTTCTCC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3450C>T	14.37:g.91770230G>A		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	5.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	37	CCDS45151.1																																																																																			.		0.657	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
CCK	885	hgsc.bcm.edu;bcgsc.ca	37	3	42305118	42305118	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:42305118T>C	ENST00000396169.2	-	4	910	c.5A>G	c.(4-6)aAc>aGc	p.N2S	CCK_ENST00000334681.5_Missense_Mutation_p.N2S|CCK_ENST00000434608.1_Missense_Mutation_p.N2S	NM_000729.4	NP_000720.1	P06307	CCKN_HUMAN	cholecystokinin	2					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axonogenesis (GO:0007409)|behavioral fear response (GO:0001662)|eating behavior (GO:0042755)|negative regulation of appetite (GO:0032099)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein oligomerization (GO:0032461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|release of cytochrome c from mitochondria (GO:0001836)|signal transduction (GO:0007165)	axon (GO:0030424)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|terminal bouton (GO:0043195)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6		Ovarian(412;0.0728)		KIRC - Kidney renal clear cell carcinoma(284;0.219)		CACGCCGCTGTTCATGGCTGT	0.692																																					p.N2S		.											.	CCK	514	0			c.A5G						.						7.0	8.0	8.0					3																	42305118		2133	4141	6274	SO:0001583	missense	885	exon4			CCGCTGTTCATGG		CCDS2696.1	3p22.1	2013-02-25			ENSG00000187094	ENSG00000187094		"""Endogenous ligands"""	1569	protein-coding gene	gene with protein product	"""prepro-cholecystokinin"", ""cholecystokinin triacontatriapeptide"""	118440				3856870	Standard	NM_001174138		Approved		uc021wwk.1	P06307	OTTHUMG00000131796	ENST00000396169.2:c.5A>G	3.37:g.42305118T>C	ENSP00000379472:p.Asn2Ser	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	4.0	NM_000729		Missense_Mutation	SNP	ENST00000396169.2	37	CCDS2696.1	.	.	.	.	.	.	.	.	.	.	T	5.712	0.315814	0.10789	.	.	ENSG00000187094	ENST00000396169;ENST00000334681;ENST00000434608	T;T;T	0.21543	2.0;2.0;2.0	5.26	5.26	0.73747	Gastrin/cholecystokinin peptide hormone (1);	0.313869	0.38720	N	0.001593	T	0.34337	0.0894	M	0.69185	2.1	0.27807	N	0.942295	D;P	0.56968	0.978;0.684	P;B	0.58077	0.832;0.272	T	0.30995	-0.9959	10	0.05833	T	0.94	-28.8149	14.6476	0.68772	0.0:0.0:0.0:1.0	.	2;2	B7Z6Q9;P06307	.;CCKN_HUMAN	S	2	ENSP00000379472:N2S;ENSP00000335657:N2S;ENSP00000409124:N2S	ENSP00000335657:N2S	N	-	2	0	CCK	42280122	1.000000	0.71417	0.944000	0.38274	0.152000	0.21847	4.459000	0.60102	2.116000	0.64780	0.533000	0.62120	AAC	.		0.692	CCK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343380.1	NM_000729	
CCZ1B	221960	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	6851599	6851599	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:6851599T>A	ENST00000316731.8	-	10	1510	c.938A>T	c.(937-939)cAt>cTt	p.H313L	CCZ1B_ENST00000538180.1_Missense_Mutation_p.H170L	NM_198097.3	NP_932765.1	P86790	CCZ1B_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog B (S. cerevisiae)	313						lysosome (GO:0005764)|membrane (GO:0016020)											AACGATTAAATGGAGCTCTTC	0.378																																					p.H313L		.											.	.	.	0			c.A938T						.						51.0	50.0	50.0					7																	6851599		2155	4286	6441	SO:0001583	missense	221960	exon10			ATTAAATGGAGCT	BC010130	CCDS5354.1	7p22.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000146574	ENSG00000146574			21717	protein-coding gene	gene with protein product	"""similar to CGI-43 protein"""		"""chromosome 7 open reading frame 28B"""	C7orf28B		12477932	Standard	NM_198097		Approved	DKFZP586I1023, H_NH0577018.2, MGC19819	uc003sqx.2	P86790	OTTHUMG00000152441	ENST00000316731.8:c.938A>T	7.37:g.6851599T>A	ENSP00000314544:p.His313Leu	Somatic	250.0	1.0		WXS	Illumina HiSeq	Phase_I	254.0	39.0	NM_198097	A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	ENST00000316731.8	37	CCDS5354.1	.	.	.	.	.	.	.	.	.	.	T	5.881	0.346738	0.11126	.	.	ENSG00000146574	ENST00000316731;ENST00000538180	.	.	.	2.6	2.6	0.31112	.	0.164731	0.53938	D	0.000050	T	0.39759	0.1090	.	.	.	0.53005	D	0.999969	.	.	.	.	.	.	T	0.08166	-1.0735	6	0.12103	T	0.63	-19.6483	8.7301	0.34494	0.0:0.0:0.0:1.0	.	.	.	.	L	313;170	.	ENSP00000314544:H313L	H	-	2	0	C7orf28B	6818124	1.000000	0.71417	0.996000	0.52242	0.145000	0.21501	7.014000	0.76380	1.198000	0.43158	0.155000	0.16302	CAT	.		0.378	CCZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246858.1	NM_198097	
CDC7	8317	hgsc.bcm.edu;bcgsc.ca	37	1	91978625	91978625	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:91978625G>A	ENST00000428239.1	+	7	842	c.583G>A	c.(583-585)Gta>Ata	p.V195I	CDC7_ENST00000430031.2_Missense_Mutation_p.V167I|CDC7_ENST00000234626.6_Missense_Mutation_p.V195I	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		GTATGCCTTGGTAGACTTTGG	0.363																																					p.V195I		.											.	CDC7	1125	0			c.G583A						.						54.0	57.0	56.0					1																	91978625		2203	4300	6503	SO:0001583	missense	8317	exon7			GCCTTGGTAGACT	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.583G>A	1.37:g.91978625G>A	ENSP00000393139:p.Val195Ile	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_001134419	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.826243	0.90955	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.05513	3.43;3.43;3.43	5.54	5.54	0.83059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.06600	0.0169	N	0.10916	0.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.58634	-0.7602	10	0.20519	T	0.43	-14.5766	19.4811	0.95009	0.0:0.0:1.0:0.0	.	167;195	B7Z5H7;O00311	.;CDC7_HUMAN	I	167;195;195	ENSP00000407477:V167I;ENSP00000234626:V195I;ENSP00000393139:V195I	ENSP00000234626:V195I	V	+	1	0	CDC7	91751213	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.439000	0.97543	2.580000	0.87095	0.563000	0.77884	GTA	.		0.363	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
CDC7	8317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	91978829	91978829	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:91978829G>T	ENST00000428239.1	+	7	1046	c.787G>T	c.(787-789)Gca>Tca	p.A263S	CDC7_ENST00000430031.2_Missense_Mutation_p.A235S|CDC7_ENST00000234626.6_Missense_Mutation_p.A263S	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		CTACACAAATGCACAAATTCA	0.393																																					p.A263S		.											.	CDC7	1125	0			c.G787T						.						83.0	87.0	85.0					1																	91978829		2203	4300	6503	SO:0001583	missense	8317	exon7			ACAAATGCACAAA	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.787G>T	1.37:g.91978829G>T	ENSP00000393139:p.Ala263Ser	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	20.0	NM_001134419	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	37	CCDS734.1	.	.	.	.	.	.	.	.	.	.	G	6.557	0.471144	0.12461	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.46063	0.88;1.04;1.04	5.89	0.572	0.17357	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.528279	0.20582	N	0.089503	T	0.03739	0.0106	N	0.03608	-0.345	0.25224	N	0.989889	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.41270	-0.9518	10	0.06494	T	0.89	-5.082	4.5672	0.12193	0.308:0.0:0.4429:0.2491	.	235;263	B7Z5H7;O00311	.;CDC7_HUMAN	S	235;263;263	ENSP00000407477:A235S;ENSP00000234626:A263S;ENSP00000393139:A263S	ENSP00000234626:A263S	A	+	1	0	CDC7	91751417	0.051000	0.20477	0.987000	0.45799	0.997000	0.91878	0.184000	0.16939	0.111000	0.17947	0.557000	0.71058	GCA	.		0.393	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
CDCP1	64866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45153758	45153758	+	Missense_Mutation	SNP	C	C	G	rs149422328	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:45153758C>G	ENST00000296129.1	-	3	606	c.472G>C	c.(472-474)Gga>Cga	p.G158R	CDCP1_ENST00000490471.1_5'Flank|CDCP1_ENST00000425231.2_Missense_Mutation_p.G158R	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	158						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TGAGTGACTCCGTCTGGGCAG	0.557																																					p.G158R		.											.	CDCP1	117	0			c.G472C						.						149.0	147.0	148.0					3																	45153758		2203	4300	6503	SO:0001583	missense	64866	exon3			TGACTCCGTCTGG	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.472G>C	3.37:g.45153758C>G	ENSP00000296129:p.Gly158Arg	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	28.0	NM_178181	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	ENST00000296129.1	37	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.448476	0.26074	.	.	ENSG00000163814	ENST00000296129;ENST00000425231	T;T	0.42900	1.98;0.96	5.42	4.46	0.54185	.	0.725192	0.14128	N	0.339564	T	0.46190	0.1380	L	0.57536	1.79	0.09310	N	1	D;D	0.60575	0.988;0.966	P;P	0.53450	0.659;0.726	T	0.29882	-0.9997	10	0.18276	T	0.48	.	7.5699	0.27900	0.3663:0.5146:0.1191:0.0	.	158;158	Q9H5V8-3;Q9H5V8	.;CDCP1_HUMAN	R	158	ENSP00000296129:G158R;ENSP00000399342:G158R	ENSP00000296129:G158R	G	-	1	0	CDCP1	45128762	0.001000	0.12720	0.117000	0.21633	0.206000	0.24218	1.015000	0.29963	2.537000	0.85549	0.563000	0.77884	GGA	C|1.000;T|0.000		0.557	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
CDH9	1007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	26906841	26906841	+	Silent	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:26906841C>A	ENST00000231021.4	-	4	802	c.630G>T	c.(628-630)gtG>gtT	p.V210V		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATTCTGGGTCCACTGAAAAAT	0.328																																					p.V210V	Melanoma(8;187 585 15745 40864 52829)	.											.	CDH9	99	0			c.G630T						.						106.0	96.0	99.0					5																	26906841		2203	4300	6503	SO:0001819	synonymous_variant	1007	exon4			TGGGTCCACTGAA	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.630G>T	5.37:g.26906841C>A		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	20.0	NM_016279	Q3B7I5	Silent	SNP	ENST00000231021.4	37	CCDS3893.1																																																																																			.		0.328	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
CENPW	387103	hgsc.bcm.edu;bcgsc.ca	37	6	126661441	126661441	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:126661441T>C	ENST00000368328.4	+	1	122	c.22T>C	c.(22-24)Tcc>Ccc	p.S8P	CENPW_ENST00000368326.1_Missense_Mutation_p.S8P|CENPW_ENST00000368325.1_Missense_Mutation_p.S8P			Q5EE01	CENPW_HUMAN	centromere protein W	8					CENP-A containing nucleosome assembly (GO:0034080)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|kinetochore (GO:0000776)|nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(2)|large_intestine(1)|lung(3)	6						GACCATAGTCTCCCAGAGGAA	0.552																																					p.S8P		.											.	CENPW	90	0			c.T22C						.						92.0	82.0	86.0					6																	126661441		2203	4300	6503	SO:0001583	missense	387103	exon1			ATAGTCTCCCAGA	BC039556	CCDS34529.1, CCDS69196.1, CCDS75516.1	6q22.32	2013-11-05	2010-04-16	2010-04-16	ENSG00000203760	ENSG00000203760			21488	protein-coding gene	gene with protein product	"""cancer-upregulated gene 2"""	611264	"""chromosome 6 open reading frame 173"""	C6orf173		17610844, 19070575	Standard	NM_001286524		Approved	CUG2	uc003qao.3	Q5EE01	OTTHUMG00000015518	ENST00000368328.4:c.22T>C	6.37:g.126661441T>C	ENSP00000357311:p.Ser8Pro	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_001012507	A6NIR0|A6NJC2	Missense_Mutation	SNP	ENST00000368328.4	37	CCDS34529.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.457897	0.43634	.	.	ENSG00000203760	ENST00000368326;ENST00000368325;ENST00000368328	.	.	.	5.52	-3.96	0.04106	.	0.613491	0.14700	N	0.303603	T	0.08891	0.0220	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.21586	-1.0241	8	0.59425	D	0.04	-2.9097	2.1334	0.03755	0.1209:0.2813:0.1235:0.4743	.	8	Q5EE01	CENPW_HUMAN	P	8	.	ENSP00000357308:S8P	S	+	1	0	CENPW	126703134	0.001000	0.12720	0.000000	0.03702	0.199000	0.23934	0.550000	0.23345	-0.302000	0.08869	-0.371000	0.07208	TCC	.		0.552	CENPW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042104.1		
CHD2	1106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	93489406	93489406	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:93489406G>C	ENST00000394196.4	+	12	2405	c.1337G>C	c.(1336-1338)aGt>aCt	p.S446T	CHD2_ENST00000536619.1_Missense_Mutation_p.S459T|CHD2_ENST00000557381.1_Missense_Mutation_p.S446T|CHD2_ENST00000420239.2_Missense_Mutation_p.S446T	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	446	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AGCTTCCACAGTAGGAACAAC	0.413																																					p.S446T		.											.	CHD2	229	0			c.G1337C						.						81.0	82.0	82.0					15																	93489406		2197	4298	6495	SO:0001583	missense	1106	exon12			TCCACAGTAGGAA	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1337G>C	15.37:g.93489406G>C	ENSP00000377747:p.Ser446Thr	Somatic	276.0	1.0		WXS	Illumina HiSeq	Phase_I	186.0	68.0	NM_001042572	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893022	0.33442	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000420239;ENST00000536619	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.57	3.33	0.38152	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.467569	0.15445	U	0.261968	T	0.58119	0.2100	N	0.14661	0.345	0.28055	N	0.933226	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.001	T	0.55995	-0.8052	10	0.54805	T	0.06	-7.073	11.5016	0.50441	0.2318:0.0:0.7682:0.0	.	459;446;446	B7Z3I4;O14647;O14647-2	.;CHD2_HUMAN;.	T	446;446;446;459	ENSP00000377747:S446T;ENSP00000451366:S446T;ENSP00000406581:S446T;ENSP00000443618:S459T	ENSP00000377747:S446T	S	+	2	0	CHD2	91290410	0.967000	0.33354	0.998000	0.56505	0.983000	0.72400	0.759000	0.26461	1.498000	0.48600	0.655000	0.94253	AGT	.		0.413	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
CHD2	1106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	93489423	93489423	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:93489423A>G	ENST00000394196.4	+	12	2422	c.1354A>G	c.(1354-1356)Acc>Gcc	p.T452A	CHD2_ENST00000536619.1_Missense_Mutation_p.T465A|CHD2_ENST00000557381.1_Missense_Mutation_p.T452A|CHD2_ENST00000420239.2_Missense_Mutation_p.T452A	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	452	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			CAACTCAAAAACCATCCCAAC	0.428																																					p.T452A		.											.	CHD2	229	0			c.A1354G						.						74.0	76.0	75.0					15																	93489423		2197	4298	6495	SO:0001583	missense	1106	exon12			TCAAAAACCATCC	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1354A>G	15.37:g.93489423A>G	ENSP00000377747:p.Thr452Ala	Somatic	288.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	76.0	NM_001042572	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	A	17.84	3.487357	0.63962	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000420239;ENST00000536619	D;D;T;T	0.93133	-3.17;-3.17;0.86;0.85	5.57	5.57	0.84162	Chromo domain/shadow (1);	0.000000	0.35096	U	0.003459	D	0.91399	0.7286	L	0.53729	1.69	0.53688	D	0.999978	B;B;P	0.35139	0.047;0.002;0.486	B;B;B	0.35550	0.065;0.035;0.205	D	0.90425	0.4420	10	0.37606	T	0.19	-30.4941	16.0216	0.80499	1.0:0.0:0.0:0.0	.	465;452;452	B7Z3I4;O14647;O14647-2	.;CHD2_HUMAN;.	A	452;452;452;465	ENSP00000377747:T452A;ENSP00000451366:T452A;ENSP00000406581:T452A;ENSP00000443618:T465A	ENSP00000377747:T452A	T	+	1	0	CHD2	91290427	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.088000	0.76901	2.242000	0.73789	0.533000	0.62120	ACC	.		0.428	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
CHD7	55636	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	61757511	61757511	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:61757511C>G	ENST00000423902.2	+	22	5418	c.4939C>G	c.(4939-4941)Ctg>Gtg	p.L1647V	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1647					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CAGAACCATCCTGGTGTACTG	0.483																																					p.L1647V		.											.	CHD7	141	0			c.C4939G						.						114.0	113.0	113.0					8																	61757511		1965	4162	6127	SO:0001583	missense	55636	exon22			ACCATCCTGGTGT	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4939C>G	8.37:g.61757511C>G	ENSP00000392028:p.Leu1647Val	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	5.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293511	0.60086	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.87334	-2.24	5.63	4.75	0.60458	.	0.000000	0.64402	D	0.000004	D	0.93530	0.7935	M	0.88906	2.99	0.80722	D	1	D	0.54964	0.969	P	0.60541	0.876	D	0.94686	0.7870	10	0.87932	D	0	-14.2895	15.1709	0.72872	0.0:0.9312:0.0:0.0688	.	1647	Q9P2D1	CHD7_HUMAN	V	1647	ENSP00000392028:L1647V	ENSP00000307304:L1647V	L	+	1	2	CHD7	61920065	1.000000	0.71417	0.996000	0.52242	0.535000	0.34838	2.073000	0.41519	1.487000	0.48415	0.655000	0.94253	CTG	.		0.483	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
CHRM3	1131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	240072218	240072218	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:240072218G>A	ENST00000255380.4	+	5	2246	c.1467G>A	c.(1465-1467)gcG>gcA	p.A489A		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	489					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AGAAGAAAGCGGCCCAGACCC	0.507																																					p.A489A		.											.	CHRM3	95	0			c.G1467A						.						139.0	131.0	134.0					1																	240072218		2203	4300	6503	SO:0001819	synonymous_variant	1131	exon5			GAAAGCGGCCCAG	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1467G>A	1.37:g.240072218G>A		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	36.0	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	ENST00000255380.4	37	CCDS1616.1																																																																																			.		0.507	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
CNOT2	4848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	70724192	70724192	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:70724192C>A	ENST00000418359.3	+	7	963	c.512C>A	c.(511-513)cCa>cAa	p.P171Q	CNOT2_ENST00000548230.1_3'UTR|CNOT2_ENST00000229195.3_Missense_Mutation_p.P171Q	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	171					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			AGAAGCTCGCCAAGCATAATA	0.443																																					p.P171Q		.											.	CNOT2	226	0			c.C512A						.						147.0	138.0	141.0					12																	70724192		2203	4300	6503	SO:0001583	missense	4848	exon7			GCTCGCCAAGCAT	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.512C>A	12.37:g.70724192C>A	ENSP00000412091:p.Pro171Gln	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	70.0	NM_001199302	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	37	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630056	0.67015	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550641;ENST00000548159;ENST00000549750;ENST00000551043;ENST00000551873;ENST00000550194	T;T;T;T	0.44083	0.93;0.93;0.94;0.93	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.39418	-0.9615	10	0.21014	T	0.42	-5.4664	19.8769	0.96880	0.0:1.0:0.0:0.0	.	171	Q9NZN8	CNOT2_HUMAN	Q	171;171;171;151;162;171;171;86;171	ENSP00000229195:P171Q;ENSP00000412091:P171Q;ENSP00000449659:P162Q;ENSP00000449260:P171Q	ENSP00000229195:P171Q	P	+	2	0	CNOT2	69010459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.767000	0.95098	0.557000	0.71058	CCA	.		0.443	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	125192079	125192079	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:125192079T>G	ENST00000431078.1	+	5	912	c.548T>G	c.(547-549)tTt>tGt	p.F183C		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	183	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GTTGCTGACTTTGATGGCCGA	0.423																																					p.F183C		.											.	CNTNAP5	524	0			c.T548G						.						124.0	113.0	117.0					2																	125192079		1921	4125	6046	SO:0001583	missense	129684	exon5			CTGACTTTGATGG	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.548T>G	2.37:g.125192079T>G	ENSP00000399013:p.Phe183Cys	Somatic	232.0	0.0		WXS	Illumina HiSeq	Phase_I	185.0	86.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.956074	0.73902	.	.	ENSG00000155052	ENST00000431078	D	0.90732	-2.72	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.48767	D	0.000162	D	0.95573	0.8561	M	0.91510	3.215	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	D	0.96444	0.9329	10	0.87932	D	0	.	14.7735	0.69699	0.0:0.0:0.0:1.0	.	183	Q8WYK1	CNTP5_HUMAN	C	183	ENSP00000399013:F183C	ENSP00000399013:F183C	F	+	2	0	CNTNAP5	124908549	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.896000	0.87350	2.084000	0.62774	0.533000	0.62120	TTT	.		0.423	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130098302	130098302	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:130098302C>A	ENST00000432398.2	+	4	1203	c.709C>A	c.(709-711)Ctc>Atc	p.L237I	COL6A5_ENST00000265379.6_Missense_Mutation_p.L237I	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	237	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						ACTCGCTGACCTCGTGTTCCT	0.463																																					p.L237I		.											.	.	.	0			c.C709A						.						65.0	55.0	58.0					3																	130098302		692	1591	2283	SO:0001583	missense	256076	exon4			GCTGACCTCGTGT	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.709C>A	3.37:g.130098302C>A	ENSP00000390895:p.Leu237Ile	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	90.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	C	4.968	0.179746	0.09443	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.81247	-1.47;-1.47	5.31	-2.66	0.06077	.	.	.	.	.	T	0.53012	0.1770	N	0.04373	-0.215	0.23050	N	0.998372	B	0.15719	0.014	B	0.16722	0.016	T	0.48364	-0.9042	9	0.02654	T	1	.	9.4981	0.38999	0.4544:0.1671:0.3785:0.0	.	237	A8TX70-2	.	I	237	ENSP00000390895:L237I;ENSP00000265379:L237I	ENSP00000265379:L237I	L	+	1	0	COL6A5	131580992	0.046000	0.20272	0.030000	0.17652	0.147000	0.21601	0.094000	0.15107	-0.321000	0.08627	-0.302000	0.09304	CTC	.		0.463	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CR1	1378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207679429	207679429	+	Splice_Site	SNP	G	G	A	rs199647026		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:207679429G>A	ENST00000367049.4	+	2	301		c.e2+1		CR1_ENST00000367052.1_Splice_Site|CR1_ENST00000367050.4_Splice_Site|CR1_ENST00000367053.1_Splice_Site|CR1_ENST00000400960.2_Splice_Site|CR1_ENST00000367051.1_Splice_Site	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)						complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AGGTGCAGACGTAAGTAACTC	0.418																																					.		.											.	CR1	93	0			c.301+1G>A						.						129.0	118.0	121.0					1																	207679429		1847	4088	5935	SO:0001630	splice_region_variant	1378	exon2			GCAGACGTAAGTA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.301+1G>A	1.37:g.207679429G>A		Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	30.0	NM_000573	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Splice_Site	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217183	0.39201	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049;ENST00000529814	.	.	.	4.13	4.13	0.48395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0894	0.53717	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CR1	205746052	0.999000	0.42202	0.990000	0.47175	0.546000	0.35178	2.336000	0.43938	2.303000	0.77524	0.591000	0.81541	.	.		0.418	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	Intron
TLN1	7094	hgsc.bcm.edu;bcgsc.ca	37	9	35733445	35733445	+	5'Flank	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:35733445A>G	ENST00000314888.9	-	0	0				CREB3_ENST00000486056.1_3'UTR|TLN1_ENST00000540444.1_5'Flank|CREB3_ENST00000353704.2_Missense_Mutation_p.E133G	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTGGAGAAGGAGGGGCTTATT	0.463																																					p.E133G		.											.	CREB3	90	0			c.A398G						.						101.0	91.0	95.0					9																	35733445		2203	4300	6503	SO:0001631	upstream_gene_variant	10488	exon4			AGAAGGAGGGGCT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874		9.37:g.35733445A>G	Exception_encountered	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_006368	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	37	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	A	31	5.083431	0.94050	.	.	ENSG00000107175	ENST00000353704	D	0.83075	-1.68	4.88	4.88	0.63580	Eukaryotic transcription factor, Skn-1-like, DNA-binding (1);	0.054574	0.64402	D	0.000001	D	0.90157	0.6924	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	D	0.91360	0.5111	10	0.87932	D	0	.	13.6285	0.62181	1.0:0.0:0.0:0.0	.	157;133	O43889;O43889-2	CREB3_HUMAN;.	G	133	ENSP00000342136:E133G	ENSP00000342136:E133G	E	+	2	0	CREB3	35723445	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.928000	0.63447	1.970000	0.57323	0.528000	0.53228	GAG	.		0.463	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
CYFIP2	26999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	156755023	156755023	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:156755023C>G	ENST00000521420.1	+	18	2135	c.2044C>G	c.(2044-2046)Cag>Gag	p.Q682E	CYFIP2_ENST00000541131.1_Missense_Mutation_p.Q633E|CYFIP2_ENST00000318218.6_Missense_Mutation_p.Q733E|CYFIP2_ENST00000377576.3_Missense_Mutation_p.Q708E|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000347377.6_Missense_Mutation_p.Q708E|CYFIP2_ENST00000435847.2_Missense_Mutation_p.Q407E|CYFIP2_ENST00000522463.1_Missense_Mutation_p.Q512E					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCTGGCAGACCAGATCTTTGC	0.473																																					p.Q708E		.											.	CYFIP2	22	0			c.C2122G						.						80.0	78.0	79.0					5																	156755023		1930	4147	6077	SO:0001583	missense	26999	exon19			GCAGACCAGATCT	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.2044C>G	5.37:g.156755023C>G	ENSP00000430904:p.Gln682Glu	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	21.0	NM_001037332		Missense_Mutation	SNP	ENST00000521420.1	37		.	.	.	.	.	.	.	.	.	.	C	23.8	4.464423	0.84425	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.48223	0.1488	M	0.75085	2.285	0.80722	D	1	P;P;D;P;P;B	0.54772	0.792;0.952;0.968;0.951;0.705;0.303	P;P;P;P;B;P	0.56960	0.519;0.81;0.764;0.6;0.343;0.471	T	0.28490	-1.0042	10	0.33141	T	0.24	-31.9868	19.8968	0.96969	0.0:1.0:0.0:0.0	.	572;512;682;708;708;733	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	E	733;512;682;708;708;633;407	ENSP00000325817:Q733E;ENSP00000428009:Q512E;ENSP00000430904:Q682E;ENSP00000313567:Q708E;ENSP00000366799:Q708E;ENSP00000444645:Q633E;ENSP00000403793:Q407E	ENSP00000325817:Q733E	Q	+	1	0	CYFIP2	156687601	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.691000	0.91804	0.655000	0.94253	CAG	.		0.473	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332	
DCHS2	54798	hgsc.bcm.edu;bcgsc.ca	37	4	155278418	155278418	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:155278418T>C	ENST00000357232.4	-	6	752	c.753A>G	c.(751-753)gaA>gaG	p.E251E	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	251	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		tgttcattacttccttgtctg	0.433																																					p.E251E		.											.	DCHS2	94	0			c.A753G						.						138.0	144.0	142.0					4																	155278418		2203	4300	6503	SO:0001819	synonymous_variant	54798	exon6			CATTACTTCCTTG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.753A>G	4.37:g.155278418T>C		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	4.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	37	CCDS3785.1																																																																																			.		0.433	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DDX60L	91351	hgsc.bcm.edu;bcgsc.ca	37	4	169282339	169282339	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:169282339T>C	ENST00000511577.1	-	37	5199	c.4952A>G	c.(4951-4953)aAg>aGg	p.K1651R	DDX60L_ENST00000260184.7_Missense_Mutation_p.K1651R			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1651							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTTCAAACACTTTAAAAGCTG	0.279																																					p.K1651R		.											.	DDX60L	69	0			c.A4952G						.						85.0	78.0	80.0					4																	169282339		1817	4084	5901	SO:0001583	missense	91351	exon37			AAACACTTTAAAA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.4952A>G	4.37:g.169282339T>C	ENSP00000422423:p.Lys1651Arg	Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		.	.	.	.	.	.	.	.	.	.	T	0.165	-1.077056	0.01903	.	.	ENSG00000181381	ENST00000260184;ENST00000511577	T;T	0.17054	2.3;2.3	2.06	-4.12	0.03916	.	.	.	.	.	T	0.05868	0.0153	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.24440	-1.0160	9	0.27785	T	0.31	.	0.815	0.01100	0.4195:0.2578:0.1442:0.1785	.	1651	Q5H9U9	DDX6L_HUMAN	R	1651	ENSP00000260184:K1651R;ENSP00000422423:K1651R	ENSP00000260184:K1651R	K	-	2	0	DDX60L	169518914	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.425000	0.00475	-2.886000	0.00317	-0.756000	0.03474	AAG	.		0.279	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
DDX60L	91351	hgsc.bcm.edu;bcgsc.ca	37	4	169317190	169317190	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:169317190T>C	ENST00000511577.1	-	27	3824	c.3577A>G	c.(3577-3579)Aag>Gag	p.K1193E	DDX60L_ENST00000260184.7_Missense_Mutation_p.K1193E|DDX60L_ENST00000505890.1_Missense_Mutation_p.K1194E			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1193							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TCCAGAATCTTCAGATTCTCC	0.338																																					p.K1193E		.											.	DDX60L	69	0			c.A3577G						.						77.0	70.0	72.0					4																	169317190		1799	4067	5866	SO:0001583	missense	91351	exon27			GAATCTTCAGATT	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.3577A>G	4.37:g.169317190T>C	ENSP00000422423:p.Lys1193Glu	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	6.0	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.222|3.222	-0.159294|-0.159294	0.06544|0.06544	.|.	.|.	ENSG00000181381|ENSG00000181381	ENST00000514580|ENST00000260184;ENST00000511577;ENST00000505890	.|T;T;T	.|0.41065	.|1.01;1.01;2.21	1.91|1.91	-0.84|-0.84	0.10755|0.10755	.|.	.|0.177811	.|0.25906	.|N	.|0.027530	T|T	0.15739|0.15739	0.0379|0.0379	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.10296	.|0.003;0.001;0.003	.|B;B;B	.|0.09377	.|0.004;0.003;0.004	T|T	0.22626|0.22626	-1.0211|-1.0211	5|10	.|0.11485	.|T	.|0.65	.|.	5.5504|5.5504	0.17087|0.17087	0.0:0.3043:0.0:0.6957|0.0:0.3043:0.0:0.6957	.|.	.|1193;1194;1193	.|E9PAP8;D6R906;Q5H9U9	.|.;.;DDX6L_HUMAN	G|E	80|1193;1193;1194	.|ENSP00000260184:K1193E;ENSP00000422423:K1193E;ENSP00000422202:K1194E	.|ENSP00000260184:K1193E	E|K	-|-	2|1	0|0	DDX60L|DDX60L	169553765|169553765	0.965000|0.965000	0.33210|0.33210	0.001000|0.001000	0.08648|0.08648	0.024000|0.024000	0.10985|0.10985	1.677000|1.677000	0.37576|0.37576	-0.190000|-0.190000	0.10465|0.10465	0.260000|0.260000	0.18958|0.18958	GAA|AAG	.		0.338	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	76503588	76503588	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:76503588C>G	ENST00000585328.1	-	28	4651	c.4527G>C	c.(4525-4527)caG>caC	p.Q1509H	DNAH17_ENST00000389840.5_Missense_Mutation_p.Q1508H	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1508	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CCCCCGGGAGCTGGGTGCGGA	0.597																																					p.Q1512H		.											.	DNAH17	142	0			c.G4536C						.						45.0	51.0	49.0					17																	76503588		2078	4244	6322	SO:0001583	missense	8632	exon28			CGGGAGCTGGGTG	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4527G>C	17.37:g.76503588C>G	ENSP00000465516:p.Gln1509His	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	30.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	C	19.19	3.779539	0.70107	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.64260	-0.09	4.97	3.78	0.43462	Dynein heavy chain, domain-2 (1);	.	.	.	.	D	0.86556	0.5961	H	0.98918	4.37	0.40204	D	0.977548	D	0.89917	1.0	D	0.91635	0.999	D	0.91547	0.5254	9	0.87932	D	0	.	13.2232	0.59901	0.0:0.859:0.0:0.141	.	1508	Q9UFH2	DYH17_HUMAN	H	1509;1508	ENSP00000374490:Q1508H	ENSP00000300671:Q1509H	Q	-	3	2	DNAH17	74015183	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.195000	0.51013	2.276000	0.75962	0.563000	0.77884	CAG	.		0.597	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
DNAH6	1768	hgsc.bcm.edu;bcgsc.ca	37	2	84924794	84924794	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:84924794A>G	ENST00000237449.6	+	46	7628	c.7620A>G	c.(7618-7620)ttA>ttG	p.L2540L	DNAH6_ENST00000389394.3_Silent_p.L2540L|DNAH6_ENST00000602588.1_Silent_p.L512L|DNAH6_ENST00000398278.2_Silent_p.L2491L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2540	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AGCAGGTTTTAGCGGCCACCA	0.423																																					p.L2540L		.											.	DNAH6	69	0			c.A7620G						.						127.0	119.0	121.0					2																	84924794		692	1591	2283	SO:0001819	synonymous_variant	1768	exon47			GGTTTTAGCGGCC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.7620A>G	2.37:g.84924794A>G		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	4.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.423	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DNAJC25	548645	hgsc.bcm.edu;bcgsc.ca	37	9	114411855	114411855	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:114411855A>G	ENST00000313525.3	+	3	668	c.612A>G	c.(610-612)aaA>aaG	p.K204K	DNAJC25-GNG10_ENST00000374294.3_Intron|DNAJC25_ENST00000556107.1_Intron	NM_001015882.2	NP_001015882.2	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	204						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|skin(4)	8						CCAAAGAAAAAGGCAAAAACA	0.403																																					p.K204K		.											.	DNAJC25	22	0			c.A612G						.						42.0	41.0	41.0					9																	114411855		1840	4090	5930	SO:0001819	synonymous_variant	548645	exon3			AGAAAAAGGCAAA		CCDS43862.1	9q31.3	2011-09-02			ENSG00000059769	ENSG00000059769		"""Heat shock proteins / DNAJ (HSP40)"""	34187	protein-coding gene	gene with protein product							Standard	NM_001015882		Approved	bA16L21.2.1	uc004bfl.3	Q9H1X3	OTTHUMG00000020491	ENST00000313525.3:c.612A>G	9.37:g.114411855A>G		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_001015882	Q5QTD8|Q96BN9	Silent	SNP	ENST00000313525.3	37	CCDS43862.1																																																																																			.		0.403	DNAJC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156218.3	NM_001015882	
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	116593811	116593811	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:116593811A>C	ENST00000410059.1	+	22	2509	c.2029A>C	c.(2029-2031)Atc>Ctc	p.I677L	DPP10_ENST00000409163.1_Missense_Mutation_p.I627L|DPP10_ENST00000393147.2_Missense_Mutation_p.I681L|DPP10_ENST00000310323.8_Missense_Mutation_p.I670L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	677						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GGTTGCACCTATCACAGACTT	0.348																																					p.I681L		.											.	DPP10	142	0			c.A2041C						.						88.0	85.0	86.0					2																	116593811		2203	4300	6503	SO:0001583	missense	57628	exon22			GCACCTATCACAG	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2029A>C	2.37:g.116593811A>C	ENSP00000386565:p.Ile677Leu	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	17.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.911273	0.72983	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.81	4.65	0.58169	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.117279	0.64402	D	0.000016	T	0.53786	0.1818	L	0.56396	1.775	0.42488	D	0.992886	B;B;B;B	0.25486	0.069;0.127;0.085;0.085	P;P;P;P	0.56751	0.705;0.522;0.751;0.805	T	0.57189	-0.7854	10	0.56958	D	0.05	-9.7773	11.201	0.48741	0.9283:0.0:0.0717:0.0	.	670;681;673;677	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	L	677;627;681;670	ENSP00000386565:I677L;ENSP00000387038:I627L;ENSP00000376855:I681L;ENSP00000309066:I670L	ENSP00000309066:I670L	I	+	1	0	DPP10	116310281	0.999000	0.42202	0.995000	0.50966	0.992000	0.81027	3.883000	0.56168	1.011000	0.39340	0.533000	0.62120	ATC	.		0.348	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
DSEL	92126	ucsc.edu;bcgsc.ca	37	18	65180906	65180906	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:65180906A>G	ENST00000310045.7	-	2	2443	c.970T>C	c.(970-972)Ttc>Ctc	p.F324L	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	314					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GCATAATAGAACCAAAAGTGC	0.388																																					p.F324L		.											.	DSEL	157	0			c.T970C						.						71.0	76.0	75.0					18																	65180906		2203	4300	6503	SO:0001583	missense	92126	exon2			AATAGAACCAAAA	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.970T>C	18.37:g.65180906A>G	ENSP00000310565:p.Phe324Leu	Somatic	84.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117518	0.77323	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.29397	1.57	4.76	4.76	0.60689	.	0.000000	0.85682	U	0.000000	T	0.56247	0.1972	M	0.78801	2.425	0.54753	D	0.999984	D	0.63880	0.993	D	0.72625	0.978	T	0.62751	-0.6788	10	0.87932	D	0	.	14.5941	0.68392	1.0:0.0:0.0:0.0	.	314	Q8IZU8	DSEL_HUMAN	L	324;314	ENSP00000310565:F324L	ENSP00000310565:F324L	F	-	1	0	DSEL	63331886	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.113000	0.94321	1.936000	0.56123	0.379000	0.24179	TTC	.		0.388	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
DST	667	bcgsc.ca;mdanderson.org	37	6	56418422	56418422	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:56418422A>G	ENST00000361203.3	-	57	14542	c.14535T>C	c.(14533-14535)tgT>tgC	p.C4845C	DST_ENST00000446842.2_Silent_p.C4521C|DST_ENST00000370788.2_Silent_p.C2759C|DST_ENST00000312431.6_3'UTR|DST_ENST00000370769.4_Silent_p.C4847C|DST_ENST00000370754.5_Silent_p.C5025C|DST_ENST00000421834.2_Silent_p.C2759C|DST_ENST00000244364.6_Silent_p.C2433C			Q03001	DYST_HUMAN	dystonin	4845					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GAGAGCTTGCACAGGCCGACT	0.343																																					p.C2433C		.											.	DST	523	0			c.T7299C						.						61.0	58.0	59.0					6																	56418422		1822	4098	5920	SO:0001819	synonymous_variant	667	exon42			GCTTGCACAGGCC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.14535T>C	6.37:g.56418422A>G		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_1	21.0	3.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	ENST00000361203.3	37																																																																																				.		0.343	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
DUS4L	11062	hgsc.bcm.edu;bcgsc.ca	37	7	107216859	107216859	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:107216859A>G	ENST00000265720.3	+	7	890	c.528A>G	c.(526-528)gaA>gaG	p.E176E	DUS4L_ENST00000402620.1_Silent_p.E55E	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	176							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						AAAAGGCTGAAGCAACAGGAG	0.348																																					p.E176E		.											.	DUS4L	90	0			c.A528G						.						82.0	76.0	78.0					7																	107216859		2203	4300	6503	SO:0001819	synonymous_variant	11062	exon7			GGCTGAAGCAACA	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.528A>G	7.37:g.107216859A>G		Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_001270419	B4DLX0|Q2NKK1	Silent	SNP	ENST00000265720.3	37	CCDS5745.1																																																																																			.		0.348	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
EFNA5	1946	hgsc.bcm.edu;broad.mit.edu	37	5	106763128	106763128	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:106763128G>T	ENST00000333274.6	-	2	489	c.208C>A	c.(208-210)Cca>Aca	p.P70T	EFNA5_ENST00000509503.1_Missense_Mutation_p.P70T	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	70	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)			large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		TTATCTTCTGGGACGGAGTCC	0.448																																					p.P70T		.											.	EFNA5	90	0			c.C208A						.						133.0	133.0	133.0					5																	106763128		2202	4300	6502	SO:0001583	missense	1946	exon2			CTTCTGGGACGGA	U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.208C>A	5.37:g.106763128G>T	ENSP00000328777:p.Pro70Thr	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	4.0	NM_001962		Missense_Mutation	SNP	ENST00000333274.6	37	CCDS4097.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245779	0.80024	.	.	ENSG00000184349	ENST00000333274;ENST00000509503	D;D	0.92647	-3.08;-3.08	6.06	6.06	0.98353	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.92838	0.7722	M	0.69185	2.1	0.80722	D	1	P;B	0.35011	0.48;0.13	B;B	0.41332	0.354;0.136	D	0.90068	0.4161	10	0.28530	T	0.3	-5.8591	20.6208	0.99490	0.0:0.0:1.0:0.0	.	70;70	D6RDV5;P52803	.;EFNA5_HUMAN	T	70	ENSP00000328777:P70T;ENSP00000426989:P70T	ENSP00000328777:P70T	P	-	1	0	EFNA5	106791027	1.000000	0.71417	0.965000	0.40720	0.993000	0.82548	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	CCA	.		0.448	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250652.1	NM_001962	
EGR3	1960	broad.mit.edu;ucsc.edu	37	8	22548280	22548280	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:22548280G>A	ENST00000317216.2	-	2	1227	c.870C>T	c.(868-870)gaC>gaT	p.D290D	EGR3_ENST00000524088.1_5'UTR|EGR3_ENST00000522910.1_Silent_p.D252D|EGR3_ENST00000519492.1_3'UTR|RP11-459E5.1_ENST00000523627.1_RNA	NM_001199881.1|NM_004430.2	NP_001186810.1|NP_004421.2	Q06889	EGR3_HUMAN	early growth response 3	290					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|circadian rhythm (GO:0007623)|endothelial cell chemotaxis (GO:0035767)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		Prostate(55;0.0421)|Breast(100;0.102)		Colorectal(74;0.0145)|BRCA - Breast invasive adenocarcinoma(99;0.053)|COAD - Colon adenocarcinoma(73;0.0608)		GGGTCAGCTCGTCCGAACGGC	0.692																																					p.D290D		.											.	EGR3	90	0			c.C870T						.						41.0	44.0	43.0					8																	22548280		2203	4298	6501	SO:0001819	synonymous_variant	1960	exon2			CAGCTCGTCCGAA	X63741	CCDS6033.1, CCDS56528.1	8p23-p21	2013-01-08			ENSG00000179388	ENSG00000179388		"""Zinc fingers, C2H2-type"""	3240	protein-coding gene	gene with protein product	"""zinc finger protein pilot"""	602419				1906159, 11909874	Standard	NM_004430		Approved	PILOT	uc003xcm.1	Q06889	OTTHUMG00000097825	ENST00000317216.2:c.870C>T	8.37:g.22548280G>A		Somatic	21.0	1.0		WXS	Illumina HiSeq	Phase_I	48.0	12.0	NM_004430	A8K8U9|B4DHJ5|E7EW38|Q2M3W2	Silent	SNP	ENST00000317216.2	37	CCDS6033.1																																																																																			.		0.692	EGR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215098.1	NM_004430	
EHD4	30844	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	42245961	42245961	+	Splice_Site	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:42245961C>A	ENST00000220325.4	-	2	497		c.e2+1			NM_139265.3	NP_644670.1	Q9H223	EHD4_HUMAN	EH-domain containing 4						cellular response to growth factor stimulus (GO:0071363)|endocytic recycling (GO:0032456)|pinocytosis (GO:0006907)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein homooligomerization (GO:0051260)|regulation of endocytosis (GO:0030100)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(7)|ovary(2)|stomach(1)|urinary_tract(1)	20		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		CTGGTCCTTACCGATTCAGGA	0.453																																					.		.											.	EHD4	92	0			c.413+1G>T						.						95.0	98.0	97.0					15																	42245961		2203	4299	6502	SO:0001630	splice_region_variant	30844	exon3			TCCTTACCGATTC	AF181265	CCDS10081.1	15q11.1	2013-01-10			ENSG00000103966	ENSG00000103966		"""EF-hand domain containing"""	3245	protein-coding gene	gene with protein product		605892		PAST4		10673336, 11533061	Standard	NM_139265		Approved		uc001zot.3	Q9H223	OTTHUMG00000130370	ENST00000220325.4:c.413+1G>T	15.37:g.42245961C>A		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	36.0	NM_139265	Q9HAR1|Q9NZN2	Splice_Site	SNP	ENST00000220325.4	37	CCDS10081.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.964340	0.92791	.	.	ENSG00000103966	ENST00000220325	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EHD4	40033253	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.826000	0.97356	0.655000	0.94253	.	.		0.453	EHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252737.2	NM_139265	Intron
EIF4G3	8672	hgsc.bcm.edu;bcgsc.ca	37	1	21221985	21221985	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:21221985T>C	ENST00000264211.8	-	11	2035	c.1841A>G	c.(1840-1842)aAg>aGg	p.K614R	EIF4G3_ENST00000537738.1_Missense_Mutation_p.K67R|EIF4G3_ENST00000374935.3_Missense_Mutation_p.K334R|EIF4G3_ENST00000602326.1_Missense_Mutation_p.K620R|EIF4G3_ENST00000374937.3_Missense_Mutation_p.K620R|EIF4G3_ENST00000400422.1_Missense_Mutation_p.K614R|EIF4G3_ENST00000544689.1_Missense_Mutation_p.K157R|EIF4G3_ENST00000536266.1_Missense_Mutation_p.K218R|EIF4G3_ENST00000374933.3_5'UTR	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	614					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		ATCAGTAGGCTTCCAGGATTC	0.438																																					p.K620R		.											.	EIF4G3	91	0			c.A1859G						.						94.0	96.0	95.0					1																	21221985		2203	4300	6503	SO:0001583	missense	8672	exon15			GTAGGCTTCCAGG	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1841A>G	1.37:g.21221985T>C	ENSP00000264211:p.Lys614Arg	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_001198802	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	37	CCDS214.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.716201	0.68844	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266;ENST00000374933;ENST00000544689	T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77	4.72	4.72	0.59763	.	0.232507	0.44902	D	0.000416	T	0.55768	0.1941	L	0.39147	1.195	0.80722	D	1	P;B;B;D;B	0.58268	0.93;0.209;0.268;0.982;0.369	P;B;B;D;B	0.67548	0.554;0.055;0.209;0.952;0.064	T	0.55685	-0.8102	10	0.48119	T	0.1	-17.0836	10.6392	0.45584	0.0:0.0:0.1608:0.8392	.	809;334;218;620;614	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	R	614;810;614;334;67;620;218;157;157	ENSP00000264211:K614R;ENSP00000383274:K614R;ENSP00000364071:K334R;ENSP00000442010:K67R;ENSP00000364073:K620R;ENSP00000444693:K218R;ENSP00000444401:K157R	ENSP00000264211:K614R	K	-	2	0	EIF4G3	21094572	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.913000	0.48790	1.887000	0.54652	0.377000	0.23210	AAG	.		0.438	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
EPHX1	2052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	226030103	226030103	+	Missense_Mutation	SNP	C	C	A	rs373882933		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:226030103C>A	ENST00000366837.4	+	7	1164	c.968C>A	c.(967-969)gCc>gAc	p.A323D	EPHX1_ENST00000272167.5_Missense_Mutation_p.A323D|RP11-285F7.2_ENST00000424332.1_RNA	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	323					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GGTCTGGCTGCCTATATTCTA	0.587																																					p.A323D		.											.	EPHX1	281	0			c.C968A						.						121.0	129.0	126.0					1																	226030103		2203	4300	6503	SO:0001583	missense	2052	exon7			TGGCTGCCTATAT	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.968C>A	1.37:g.226030103C>A	ENSP00000355802:p.Ala323Asp	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	53.0	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	37	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	C	33	5.238492	0.95240	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.15017	2.46;2.46	5.33	5.33	0.75918	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78698	-0.2103	10	0.87932	D	0	-4.0191	19.3842	0.94550	0.0:1.0:0.0:0.0	.	323	P07099	HYEP_HUMAN	D	323	ENSP00000272167:A323D;ENSP00000355802:A323D	ENSP00000272167:A323D	A	+	2	0	EPHX1	224096726	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	7.695000	0.84257	2.644000	0.89710	0.655000	0.94253	GCC	.		0.587	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
EPS8	2059	hgsc.bcm.edu;bcgsc.ca	37	12	15774278	15774278	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:15774278T>C	ENST00000281172.5	-	21	2878	c.2442A>G	c.(2440-2442)gaA>gaG	p.E814E	EPS8_ENST00000543612.1_Silent_p.E814E|EPS8_ENST00000543523.1_Silent_p.E814E|EPS8_ENST00000540613.1_Silent_p.E554E|EPS8_ENST00000542903.1_Silent_p.E554E	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	814	Effector region. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CATCAAAAGATTCCACTCCTG	0.378																																					p.E814E		.											.	EPS8	94	0			c.A2442G						.						91.0	84.0	87.0					12																	15774278		2202	4300	6502	SO:0001819	synonymous_variant	2059	exon21			AAAAGATTCCACT	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2442A>G	12.37:g.15774278T>C		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	6.0	NM_004447	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Silent	SNP	ENST00000281172.5	37	CCDS31753.1																																																																																			.		0.378	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
ESR1	2099	hgsc.bcm.edu;bcgsc.ca	37	6	152265434	152265434	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:152265434T>C	ENST00000206249.3	+	4	1249	c.887T>C	c.(886-888)cTc>cCc	p.L296P	ESR1_ENST00000338799.5_Missense_Mutation_p.L296P|ESR1_ENST00000443427.1_Missense_Mutation_p.L296P|ESR1_ENST00000456483.2_Intron|ESR1_ENST00000482101.1_3'UTR|ESR1_ENST00000440973.1_Missense_Mutation_p.L296P|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000427531.2_Missense_Mutation_p.L123P	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	296	Hinge.|Interaction with AKAP13.|Mediates interaction with DNTTIP2.|Self-association.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	CCAAGCCCGCTCATGATCAAA	0.562																																					p.L296P		.											.	ESR1	1042	0			c.T887C						.						114.0	112.0	113.0					6																	152265434		2203	4300	6503	SO:0001583	missense	2099	exon4			GCCCGCTCATGAT	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.887T>C	6.37:g.152265434T>C	ENSP00000206249:p.Leu296Pro	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	5.0	NM_000125	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	ENST00000206249.3	37	CCDS5234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.310|8.310	0.821943|0.821943	0.16678|0.16678	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394|ENST00000427531	D;D;D;D;D|.	0.93547|.	-3.14;-3.14;-3.14;-3.14;-3.24|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Nuclear hormone receptor, ligand-binding (1);|.	0.430373|.	0.24752|.	N|.	0.035893|.	T|T	0.55705|0.55705	0.1937|0.1937	M|M	0.68952|0.68952	2.095|2.095	0.43598|0.43598	D|D	0.995954|0.995954	P;B;D;B;P;P|.	0.59767|.	0.955;0.001;0.986;0.006;0.699;0.574|.	P;B;D;B;P;B|.	0.66351|.	0.616;0.011;0.943;0.006;0.474;0.282|.	T|T	0.59989|0.59989	-0.7350|-0.7350	10|5	0.34782|.	T|.	0.22|.	.|.	10.2659|10.2659	0.43455|0.43455	0.0:0.0738:0.0:0.9262|0.0:0.0738:0.0:0.9262	.|.	200;77;38;295;296;296|.	B0QYW6;E7EVR3;Q9Y2W8;A8KAF4;G4XH65;P03372|.	.;.;.;.;.;ESR1_HUMAN|.	P|P	296;296;77;296;296;224;123|201	ENSP00000405330:L296P;ENSP00000342630:L296P;ENSP00000387500:L296P;ENSP00000206249:L296P;ENSP00000445454:L123P|.	ENSP00000206249:L296P|.	L|S	+|+	2|1	0|0	ESR1|ESR1	152307127|152307127	0.761000|0.761000	0.28439|0.28439	0.078000|0.078000	0.20375|0.20375	0.458000|0.458000	0.32498|0.32498	2.704000|2.704000	0.47118|0.47118	2.164000|2.164000	0.68074|0.68074	0.533000|0.533000	0.62120|0.62120	CTC|TCA	.		0.562	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
ETAA1	54465	hgsc.bcm.edu;bcgsc.ca	37	2	67632242	67632242	+	Missense_Mutation	SNP	A	A	G	rs375345566		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:67632242A>G	ENST00000272342.5	+	5	2558	c.2428A>G	c.(2428-2430)Agc>Ggc	p.S810G	ETAA1_ENST00000462772.1_3'UTR	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	810						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TGAAGCTCAGAGCAACCTTAA	0.313																																					p.S810G		.											.	ETAA1	156	0			c.A2428G						.						56.0	57.0	56.0					2																	67632242		2202	4300	6502	SO:0001583	missense	54465	exon5			GCTCAGAGCAACC	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.2428A>G	2.37:g.67632242A>G	ENSP00000272342:p.Ser810Gly	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	5.0	NM_019002	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	37	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	A	10.32	1.318020	0.23994	.	.	ENSG00000143971	ENST00000272342	T	0.19532	2.14	5.39	0.0662	0.14360	.	0.825195	0.11209	N	0.587906	T	0.16811	0.0404	L	0.54323	1.7	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.29640	-1.0005	10	0.48119	T	0.1	-11.9774	2.8321	0.05503	0.5576:0.1269:0.0708:0.2447	.	810	Q9NY74	ETAA1_HUMAN	G	810	ENSP00000272342:S810G	ENSP00000272342:S810G	S	+	1	0	ETAA1	67485746	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.940000	0.28992	0.397000	0.25310	-0.313000	0.08912	AGC	.		0.313	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
EXOC6B	23233	hgsc.bcm.edu;bcgsc.ca	37	2	72707813	72707813	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:72707813T>C	ENST00000272427.6	-	17	1862	c.1732A>G	c.(1732-1734)Acc>Gcc	p.T578A	EXOC6B_ENST00000410104.1_Missense_Mutation_p.T578A	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	578					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						GTGATGTTGGTGATAAATTCT	0.383																																					p.T578A		.											.	EXOC6B	68	0			c.A1732G						.						86.0	88.0	87.0					2																	72707813		1887	4114	6001	SO:0001583	missense	23233	exon17			TGTTGGTGATAAA	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.1732A>G	2.37:g.72707813T>C	ENSP00000272427:p.Thr578Ala	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_015189	B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	37	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	T	14.34	2.505127	0.44558	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.28069	1.63;1.63	5.07	5.07	0.68467	.	0.069207	0.64402	D	0.000015	T	0.29817	0.0745	L	0.56769	1.78	0.49798	D	0.999821	B;B	0.33345	0.409;0.321	B;B	0.38755	0.172;0.281	T	0.06954	-1.0798	10	0.02654	T	1	.	12.7493	0.57300	0.0:0.0:0.0:1.0	.	578;578	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	A	578	ENSP00000272427:T578A;ENSP00000386698:T578A	ENSP00000272427:T578A	T	-	1	0	EXOC6B	72561321	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.197000	0.42696	1.906000	0.55180	0.496000	0.49642	ACC	.		0.383	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570	
FAM149A	25854	hgsc.bcm.edu;bcgsc.ca	37	4	187077241	187077241	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:187077241T>C	ENST00000356371.5	+	7	1344	c.1344T>C	c.(1342-1344)tgT>tgC	p.C448C	FAM149A_ENST00000502970.1_Silent_p.C157C|FAM149A_ENST00000389354.5_Silent_p.C157C|FAM149A_ENST00000514153.1_Silent_p.C157C|FAM149A_ENST00000227065.4_Silent_p.C157C|FAM149A_ENST00000514829.1_3'UTR|FAM149A_ENST00000503432.1_Silent_p.C157C			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	448										breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		CGCGTGACTGTGTCAAAGATG	0.448																																					p.C157C		.											.	FAM149A	90	0			c.T471C						.						128.0	116.0	120.0					4																	187077241		2203	4300	6503	SO:0001819	synonymous_variant	25854	exon6			TGACTGTGTCAAA	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1344T>C	4.37:g.187077241T>C		Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_001006655	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Silent	SNP	ENST00000356371.5	37																																																																																				.		0.448	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
BRINP2	57795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	177247856	177247856	+	Silent	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:177247856A>T	ENST00000361539.4	+	7	1482	c.1170A>T	c.(1168-1170)ctA>ctT	p.L390L	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	390			L -> V (in dbSNP:rs3176443).		cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											ATCGGATCCTACGCCGGCTCT	0.612																																					p.L390L		.											.	FAM5B	28	0			c.A1170T						.						82.0	86.0	85.0					1																	177247856		2203	4300	6503	SO:0001819	synonymous_variant	57795	exon7			GATCCTACGCCGG		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1170A>T	1.37:g.177247856A>T		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	49.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	37	CCDS1320.1																																																																																			.		0.612	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
FAM65C	140876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	49214133	49214133	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:49214133C>A	ENST00000327979.2	-	14	2173	c.1762G>T	c.(1762-1764)Ggc>Tgc	p.G588C	FAM65C_ENST00000045083.2_Missense_Mutation_p.G588C|FAM65C_ENST00000535356.1_Missense_Mutation_p.G592C			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	588										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCCTGGGAGCCCCCAAACAGG	0.652																																					p.G588C		.											.	FAM65C	92	0			c.G1762T						.						53.0	47.0	49.0					20																	49214133		2201	4300	6501	SO:0001583	missense	140876	exon14			GGGAGCCCCCAAA	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1762G>T	20.37:g.49214133C>A	ENSP00000332663:p.Gly588Cys	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	18.0	NM_080829	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	37	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339966	0.41398	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.15372	2.43;2.43;2.43	4.6	3.39	0.38822	.	0.087335	0.85682	D	0.000000	T	0.30696	0.0773	M	0.68317	2.08	0.47737	D	0.999507	D;D	0.76494	0.998;0.999	D;D	0.65443	0.927;0.935	T	0.05954	-1.0854	10	0.72032	D	0.01	-35.1959	4.0709	0.09882	0.0:0.6553:0.0:0.3447	.	592;588	F5H0X2;Q96MK2	.;FA65C_HUMAN	C	588;588;592	ENSP00000332663:G588C;ENSP00000045083:G588C;ENSP00000439802:G592C	ENSP00000045083:G588C	G	-	1	0	FAM65C	48647540	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	1.676000	0.37565	2.256000	0.74724	0.561000	0.74099	GGC	.		0.652	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
FAM81A	145773	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	59801108	59801108	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:59801108G>A	ENST00000288228.5	+	6	777	c.590G>A	c.(589-591)aGc>aAc	p.S197N		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	197										endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						TCAGAGCAGAGCACCAAACTG	0.353																																					p.S197N		.											.	FAM81A	91	0			c.G590A						.						79.0	73.0	75.0					15																	59801108		1824	4081	5905	SO:0001583	missense	145773	exon6			AGCAGAGCACCAA		CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.590G>A	15.37:g.59801108G>A	ENSP00000288228:p.Ser197Asn	Somatic	583.0	0.0		WXS	Illumina HiSeq	Phase_I	567.0	149.0	NM_152450		Missense_Mutation	SNP	ENST00000288228.5	37	CCDS45269.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208478	0.39003	.	.	ENSG00000157470	ENST00000288228	T	0.30182	1.54	5.73	5.73	0.89815	.	0.160367	0.49916	D	0.000121	T	0.28001	0.0690	L	0.33485	1.01	0.30256	N	0.793619	P	0.50528	0.936	P	0.47673	0.554	T	0.13818	-1.0495	10	0.30854	T	0.27	-11.2995	10.196	0.43054	0.0939:0.0:0.9061:0.0	.	197	Q8TBF8	FA81A_HUMAN	N	197	ENSP00000288228:S197N	ENSP00000288228:S197N	S	+	2	0	FAM81A	57588400	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.383000	0.59600	2.714000	0.92807	0.561000	0.74099	AGC	.		0.353	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415876.1	NM_152450	
FAM83B	222584	hgsc.bcm.edu;bcgsc.ca	37	6	54805894	54805894	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:54805894A>G	ENST00000306858.7	+	5	2241	c.2125A>G	c.(2125-2127)Agc>Ggc	p.S709G	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	709										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					AAGTTCTAAAAGCATGCACAA	0.403																																					p.S709G		.											.	FAM83B	96	0			c.A2125G						.						91.0	93.0	92.0					6																	54805894		2203	4300	6503	SO:0001583	missense	222584	exon5			TCTAAAAGCATGC	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2125A>G	6.37:g.54805894A>G	ENSP00000304078:p.Ser709Gly	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_001010872	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	37	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.005123	0.54254	.	.	ENSG00000168143	ENST00000306858	T	0.34859	1.34	5.55	5.55	0.83447	.	3.202220	0.00924	N	0.002632	T	0.56202	0.1969	M	0.69823	2.125	0.45962	D	0.998789	D	0.69078	0.997	D	0.75020	0.985	T	0.21999	-1.0229	10	0.45353	T	0.12	-21.4701	15.9896	0.80193	1.0:0.0:0.0:0.0	.	709	Q5T0W9	FA83B_HUMAN	G	709	ENSP00000304078:S709G	ENSP00000304078:S709G	S	+	1	0	FAM83B	54913853	1.000000	0.71417	0.995000	0.50966	0.583000	0.36354	6.540000	0.73861	2.238000	0.73509	0.533000	0.62120	AGC	.		0.403	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139	
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	150945475	150945475	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:150945475C>A	ENST00000261800.5	-	1	3030	c.3018G>T	c.(3016-3018)agG>agT	p.R1006S		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1006	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGCTAGGGGCCTCCCACCAT	0.607																																					p.R1006S		.											.	FAT2	96	0			c.G3018T						.						47.0	39.0	41.0					5																	150945475		2203	4300	6503	SO:0001583	missense	2196	exon1			TAGGGGCCTCCCA	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.3018G>T	5.37:g.150945475C>A	ENSP00000261800:p.Arg1006Ser	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	9.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546049	0.27652	.	.	ENSG00000086570	ENST00000261800	T	0.52295	0.67	5.29	2.37	0.29283	Cadherin (4);Cadherin-like (1);	0.469806	0.21212	N	0.078281	T	0.22666	0.0547	N	0.03029	-0.43	0.39950	D	0.974527	B	0.23540	0.087	B	0.34590	0.186	T	0.06534	-1.0821	10	0.10636	T	0.68	.	8.4861	0.33071	0.0:0.6866:0.0:0.3134	.	1006	Q9NYQ8	FAT2_HUMAN	S	1006	ENSP00000261800:R1006S	ENSP00000261800:R1006S	R	-	3	2	FAT2	150925668	0.042000	0.20092	0.998000	0.56505	0.986000	0.74619	-0.122000	0.10627	1.141000	0.42275	-0.345000	0.07892	AGG	.		0.607	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FER1L5	90342	hgsc.bcm.edu;bcgsc.ca	37	2	97365352	97365352	+	RNA	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:97365352A>G	ENST00000457909.1	+	0	4179							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						TATGACTTCGACCTATTTTCA	0.488																																					p.D1586G		.											.	FER1L5	23	0			c.A4757G						.						239.0	237.0	238.0					2																	97365352		1969	4146	6115			90342	exon42			ACTTCGACCTATT	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97365352A>G		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	5.0	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	A	14.38	2.517859	0.44763	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	5.29	5.29	0.74685	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.47455	U	0.000237	D	0.87912	0.6297	H	0.97390	3.995	.	.	.	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.92700	0.6174	8	0.87932	D	0	-24.998	14.2097	0.65756	1.0:0.0:0.0:0.0	.	303;1586;304	B7ZLI3;A0AVI2;A0AVI2-2	.;FR1L5_HUMAN;.	G	1586;1599;304	.	ENSP00000442027:D304G	D	+	2	0	FER1L5	96729079	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.097000	0.94193	2.006000	0.58801	0.528000	0.53228	GAC	.		0.488	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
FMO1	2326	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	171236701	171236701	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:171236701G>A	ENST00000354841.4	+	2	283	c.152G>A	c.(151-153)aGa>aAa	p.R51K	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Intron|FMO1_ENST00000367750.3_Missense_Mutation_p.R51K	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	51					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GAAGAAGGCAGAGCCAGTCTC	0.443																																					p.R51K		.											.	FMO1	515	0			c.G152A						.						167.0	145.0	152.0					1																	171236701		2203	4300	6503	SO:0001583	missense	2326	exon3			AAGGCAGAGCCAG	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.152G>A	1.37:g.171236701G>A	ENSP00000346901:p.Arg51Lys	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	46.0	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	37	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.130494	0.56828	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000354841	T;T;T	0.58358	0.34;0.34;0.34	5.38	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	L	0.55990	1.75	0.80722	D	1	B;D	0.69078	0.179;0.997	B;D	0.63381	0.348;0.914	T	0.52786	-0.8529	10	0.34782	T	0.22	1.9125	12.9846	0.58583	0.0795:0.0:0.9205:0.0	.	51;51	B2RCG5;Q01740	.;FMO1_HUMAN	K	51	ENSP00000356724:R51K;ENSP00000406982:R51K;ENSP00000346901:R51K	ENSP00000346901:R51K	R	+	2	0	FMO1	169503325	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.609000	0.61148	1.252000	0.44001	-0.136000	0.14681	AGA	.		0.443	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	79204044	79204044	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:79204044A>G	ENST00000325942.6	+	12	1618	c.1178A>G	c.(1177-1179)gAg>gGg	p.E393G	FRAS1_ENST00000264895.6_Missense_Mutation_p.E393G|FRAS1_ENST00000264899.6_Missense_Mutation_p.E393G	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	393	VWFC 6. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACTTGCTACGAGCCCTCTTGC	0.552																																					p.E393G		.											.	FRAS1	68	0			c.A1178G						.						82.0	88.0	86.0					4																	79204044		2017	4169	6186	SO:0001583	missense	80144	exon12			GCTACGAGCCCTC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.1178A>G	4.37:g.79204044A>G	ENSP00000326330:p.Glu393Gly	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	6.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	37	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.83|10.83	1.461386|1.461386	0.26248|0.26248	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000264899;ENST00000534913|ENST00000502446	T;T;T|.	0.55588|.	0.51;0.51;0.51|.	5.6|5.6	4.43|4.43	0.53597|0.53597	von Willebrand factor, type C (3);|.	0.378731|.	0.26944|.	N|.	0.021701|.	T|T	0.41465|0.41465	0.1160|0.1160	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	0.999999|0.999999	B;B;P;P|.	0.37914|.	0.088;0.228;0.611;0.61|.	B;B;B;B|.	0.36186|.	0.045;0.071;0.159;0.219|.	T|T	0.30387|0.30387	-0.9980|-0.9980	10|5	0.25751|.	T|.	0.34|.	.|.	6.7757|6.7757	0.23619|0.23619	0.6439:0.281:0.0751:0.0|0.6439:0.281:0.0751:0.0	.|.	393;393;393;393|.	E9PHH6;Q86XX4;E7EWM9;A2RRR8|.	.;FRAS1_HUMAN;.;.|.	G|G	393;393;393;133|322	ENSP00000326330:E393G;ENSP00000264895:E393G;ENSP00000264899:E393G|.	ENSP00000264895:E393G|.	E|S	+|+	2|1	0|0	FRAS1|FRAS1	79423068|79423068	0.986000|0.986000	0.35501|0.35501	0.938000|0.938000	0.37757|0.37757	0.180000|0.180000	0.23129|0.23129	1.302000|1.302000	0.33459|0.33459	2.127000|2.127000	0.65507|0.65507	0.460000|0.460000	0.39030|0.39030	GAG|AGC	.		0.552	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
FRK	2444	hgsc.bcm.edu;bcgsc.ca	37	6	116263618	116263618	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:116263618T>C	ENST00000606080.1	-	8	1923	c.1477A>G	c.(1477-1479)Aca>Gca	p.T493A	FRK_ENST00000538210.1_Missense_Mutation_p.T351A	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	493					cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	GAAGAGTCTGTTTCAAAATAG	0.348																																					p.T493A		.											.	FRK	948	0			c.A1477G						.						121.0	119.0	120.0					6																	116263618		2203	4300	6503	SO:0001583	missense	2444	exon8			AGTCTGTTTCAAA	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.1477A>G	6.37:g.116263618T>C	ENSP00000476145:p.Thr493Ala	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	5.0	NM_002031	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	37	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	T	9.235	1.036780	0.19669	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	T;T	0.73258	-0.73;-0.7	5.07	-2.3	0.06785	.	1.288910	0.05491	N	0.556561	T	0.22205	0.0535	N	0.04148	-0.265	0.23215	N	0.998102	B	0.02656	0.0	B	0.01281	0.0	T	0.15178	-1.0446	10	0.56958	D	0.05	.	3.1631	0.06527	0.1057:0.2662:0.0989:0.5292	.	493	P42685	FRK_HUMAN	A	493;351	ENSP00000357615:T493A;ENSP00000443075:T351A	ENSP00000357615:T493A	T	-	1	0	FRK	116370311	0.000000	0.05858	0.946000	0.38457	0.776000	0.43924	0.034000	0.13776	-0.144000	0.11314	0.482000	0.46254	ACA	.		0.348	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031	
FRY	10129	hgsc.bcm.edu;bcgsc.ca	37	13	32698997	32698997	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:32698997T>C	ENST00000380250.3	+	7	1197	c.701T>C	c.(700-702)gTg>gCg	p.V234A		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	234						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GTCATTGGAGTGTTGGCACAA	0.468																																					p.V234A		.											.	FRY	142	0			c.T701C						.						134.0	132.0	133.0					13																	32698997		1969	4160	6129	SO:0001583	missense	10129	exon7			TTGGAGTGTTGGC	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.701T>C	13.37:g.32698997T>C	ENSP00000369600:p.Val234Ala	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.9|25.9	4.684629|4.684629	0.88639|0.88639	.|.	.|.	ENSG00000073910|ENSG00000073910	ENST00000267067|ENST00000380250	.|T	.|0.25414	.|1.8	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46776|0.46776	0.1410|0.1410	M|M	0.74546|0.74546	2.27|2.27	0.80722|0.80722	D|D	1|1	.|P	.|0.45283	.|0.855	.|P	.|0.56916	.|0.809	T|T	0.34030|0.34030	-0.9845|-0.9845	6|10	0.87932|0.30854	D|T	0|0.27	.|.	15.5243|15.5243	0.75890|0.75890	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|234	.|Q5TBA9	.|FRY_HUMAN	R|A	161|234	.|ENSP00000369600:V234A	ENSP00000267067:C161R|ENSP00000369600:V234A	C|V	+|+	1|2	0|0	FRY|FRY	31596997|31596997	1.000000|1.000000	0.71417|0.71417	0.924000|0.924000	0.36721|0.36721	0.991000|0.991000	0.79684|0.79684	8.040000|8.040000	0.89188|0.89188	2.081000|2.081000	0.62600|0.62600	0.459000|0.459000	0.35465|0.35465	TGT|GTG	.		0.468	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
GJA1	2697	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	121768871	121768871	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:121768871G>A	ENST00000282561.3	+	2	1035	c.878G>A	c.(877-879)aGa>aAa	p.R293K		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	293					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	ACTGGCGACAGAAACAATTCT	0.493																																					p.R293K		.											.	GJA1	92	0			c.G878A						.						70.0	71.0	71.0					6																	121768871		2203	4300	6503	SO:0001583	missense	2697	exon2			GCGACAGAAACAA	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.878G>A	6.37:g.121768871G>A	ENSP00000282561:p.Arg293Lys	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	6.0	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	37	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	G	3.809	-0.040069	0.07497	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	T	0.81415	-1.49	5.18	5.18	0.71444	Gap junction alpha-1 protein (Cx43), C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51924	0.1703	N	0.14661	0.345	0.45403	D	0.998381	B	0.09022	0.002	B	0.19148	0.024	T	0.55630	-0.8111	10	0.07644	T	0.81	.	18.8905	0.92399	0.0:0.0:1.0:0.0	.	293	P17302	CXA1_HUMAN	K	277;293	ENSP00000282561:R293K	ENSP00000282561:R293K	R	+	2	0	GJA1	121810570	1.000000	0.71417	1.000000	0.80357	0.201000	0.24016	6.511000	0.73733	2.694000	0.91930	0.585000	0.79938	AGA	.		0.493	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
GJA5	2702	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	147230516	147230516	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:147230516T>C	ENST00000271348.2	-	2	992	c.831A>G	c.(829-831)ggA>ggG	p.G277G	RP11-433J22.2_ENST00000428911.1_RNA|GJA5_ENST00000369237.1_Silent_p.G277G	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	277					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			TGAAGAATTTTCCCCCAGGGC	0.542																																					p.G277G		.											.	GJA5	91	0			c.A831G						.						112.0	116.0	115.0					1																	147230516		2203	4300	6503	SO:0001819	synonymous_variant	2702	exon2			GAATTTTCCCCCA		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.831A>G	1.37:g.147230516T>C		Somatic	187.0	1.0		WXS	Illumina HiSeq	Phase_I	267.0	74.0	NM_005266	Q5T3B6|Q5U0N6	Silent	SNP	ENST00000271348.2	37	CCDS929.1																																																																																			.		0.542	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703	
HIST1H1E	3008	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26156843	26156843	+	Missense_Mutation	SNP	G	G	T	rs150948103	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:26156843G>T	ENST00000304218.3	+	1	285	c.225G>T	c.(223-225)aaG>aaT	p.K75N	HIST1H2BD_ENST00000289316.2_5'Flank|HIST1H2BD_ENST00000377777.4_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	75	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						ACGTGGAGAAGAACAACAGCC	0.592																																					p.K75N		.											.	HIST1H1E	154	0			c.G225T						.						43.0	47.0	45.0					6																	26156843		2203	4300	6503	SO:0001583	missense	3008	exon1			GGAGAAGAACAAC	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.225G>T	6.37:g.26156843G>T	ENSP00000307705:p.Lys75Asn	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	28.0	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	37	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	20.4	3.984303	0.74474	.	.	ENSG00000168298	ENST00000304218	T	0.12672	2.66	5.35	3.56	0.40772	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.099310	0.64402	D	0.000002	T	0.15782	0.0380	L	0.55990	1.75	0.58432	D	0.999993	P	0.38048	0.616	P	0.54460	0.753	T	0.00904	-1.1520	10	0.87932	D	0	-1.8185	10.4346	0.44428	0.2217:0.0:0.7783:0.0	.	75	P10412	H14_HUMAN	N	75	ENSP00000307705:K75N	ENSP00000307705:K75N	K	+	3	2	HIST1H1E	26264822	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.912000	0.39946	0.738000	0.32606	0.561000	0.74099	AAG	G|0.994;A|0.006		0.592	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
HKDC1	80201	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	71025391	71025391	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:71025391T>C	ENST00000354624.5	+	17	2556	c.2423T>C	c.(2422-2424)cTg>cCg	p.L808P	RP11-227H15.5_ENST00000413220.1_RNA	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	808	Hexokinase type-2 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CAGCTGGGCCTGGACAGCACG	0.667																																					p.L808P		.											.	HKDC1	95	0			c.T2423C						.						66.0	63.0	64.0					10																	71025391		2203	4299	6502	SO:0001583	missense	80201	exon17			TGGGCCTGGACAG		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.2423T>C	10.37:g.71025391T>C	ENSP00000346643:p.Leu808Pro	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	27.0	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.438870	0.83885	.	.	ENSG00000156510	ENST00000354624	D	0.97455	-4.39	4.76	4.76	0.60689	Hexokinase, C-terminal (1);	0.000000	0.64402	D	0.000001	D	0.98960	0.9646	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99395	1.0926	10	0.87932	D	0	-13.8423	14.7247	0.69336	0.0:0.0:0.0:1.0	.	808	Q2TB90	HKDC1_HUMAN	P	808	ENSP00000346643:L808P	ENSP00000346643:L808P	L	+	2	0	HKDC1	70695397	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.868000	0.87116	2.121000	0.65114	0.460000	0.39030	CTG	.		0.667	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
HMMR	3161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	162911119	162911119	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:162911119T>G	ENST00000358715.3	+	16	1863	c.1827T>G	c.(1825-1827)aaT>aaG	p.N609K	RP11-80G7.1_ENST00000514724.2_RNA|RP11-80G7.1_ENST00000521666.1_RNA|HMMR_ENST00000353866.3_Missense_Mutation_p.N594K|HMMR_ENST00000432118.2_Missense_Mutation_p.N523K|HMMR_ENST00000393915.4_Missense_Mutation_p.N610K			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	609					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	CATTGTTGAATGAACATGGTG	0.299																																					p.N610K		.											.	HMMR	90	0			c.T1830G						.						46.0	50.0	48.0					5																	162911119		2203	4298	6501	SO:0001583	missense	3161	exon16			GTTGAATGAACAT	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1827T>G	5.37:g.162911119T>G	ENSP00000351554:p.Asn609Lys	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	9.0	NM_001142556	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	37	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	T	18.93	3.726716	0.69074	.	.	ENSG00000072571	ENST00000416990;ENST00000353866;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94	5.45	5.45	0.79879	.	0.126941	0.64402	D	0.000001	T	0.18467	0.0443	M	0.75264	2.295	0.43399	D	0.99552	P;P;P;P	0.51791	0.825;0.948;0.911;0.911	B;B;P;P	0.46885	0.444;0.439;0.53;0.53	T	0.04635	-1.0937	10	0.22109	T	0.4	-12.7716	12.8745	0.57982	0.0:0.0:0.1355:0.8645	.	523;610;594;609	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	K	495;594;610;586;523;609	ENSP00000400527:N495K;ENSP00000185942:N594K;ENSP00000377492:N610K;ENSP00000402673:N523K;ENSP00000351554:N609K	ENSP00000185942:N594K	N	+	3	2	HMMR	162843697	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.327000	0.52045	2.189000	0.69895	0.528000	0.53228	AAT	.		0.299	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484	
IARS	3376	hgsc.bcm.edu;bcgsc.ca	37	9	95051645	95051645	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:95051645C>T	ENST00000375643.3	-	2	323	c.57G>A	c.(55-57)ttG>ttA	p.L19L	IARS_ENST00000447699.2_5'UTR|IARS_ENST00000443024.2_Silent_p.L19L|IARS_ENST00000375629.3_5'UTR	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	19					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	TCCAAAACTCCAAGATTTTCT	0.299																																					p.L19L		.											.	IARS	92	0			c.G57A						.						46.0	46.0	46.0					9																	95051645		2199	4294	6493	SO:0001819	synonymous_variant	3376	exon2			AAACTCCAAGATT	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.57G>A	9.37:g.95051645C>T		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	4.0	NM_013417	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Silent	SNP	ENST00000375643.3	37	CCDS6694.1																																																																																			.		0.299	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	
HSD17B3	3293	hgsc.bcm.edu;bcgsc.ca	37	9	99006632	99006632	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:99006632T>C	ENST00000375263.3	-	9	698	c.651A>G	c.(649-651)aaA>aaG	p.K217K	RP11-240L7.4_ENST00000448857.1_RNA|HSD17B3_ENST00000375262.2_Silent_p.K217K|HSD17B3_ENST00000464104.1_5'UTR	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	217					androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				CTTCTTTTGCTTTATATTCCT	0.552																																					p.K217K		.											.	HSD17B3	90	0			c.A651G						.						232.0	196.0	208.0					9																	99006632		2203	4300	6503	SO:0001819	synonymous_variant	3293	exon9			TTTTGCTTTATAT		CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.651A>G	9.37:g.99006632T>C		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_000197	Q5U0Q6	Silent	SNP	ENST00000375263.3	37	CCDS6716.1																																																																																			.		0.552	HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053259.1	NM_000197	
KAT7	11143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47874270	47874270	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:47874270G>T	ENST00000259021.4	+	3	602	c.322G>T	c.(322-324)Gtt>Ttt	p.V108F	KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000424009.2_Missense_Mutation_p.V108F|KAT7_ENST00000510819.1_Intron|KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000509773.1_Missense_Mutation_p.V108F|KAT7_ENST00000454930.2_Intron	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	108					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGAGCAAGTGGTTGATTTTTC	0.483																																					p.V108F		.											.	.	.	0			c.G322T						.						132.0	134.0	133.0					17																	47874270		2203	4300	6503	SO:0001583	missense	11143	exon3			CAAGTGGTTGATT	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.322G>T	17.37:g.47874270G>T	ENSP00000259021:p.Val108Phe	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	99.0	NM_007067	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	37	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741140	0.69304	.	.	ENSG00000136504	ENST00000259021;ENST00000509773;ENST00000424009	.	.	.	5.93	5.93	0.95920	.	0.136549	0.49305	D	0.000152	T	0.73202	0.3557	L	0.36672	1.1	0.80722	D	1	D;B;D	0.64830	0.99;0.054;0.994	D;B;D	0.73380	0.954;0.022;0.98	T	0.72037	-0.4411	9	0.51188	T	0.08	-12.3404	19.9388	0.97151	0.0:0.0:1.0:0.0	.	108;108;108	B4DFB4;O95251;G5E9K7	.;KAT7_HUMAN;.	F	108	.	ENSP00000259021:V108F	V	+	1	0	KAT7	45229269	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.836000	0.86788	2.815000	0.96918	0.561000	0.74099	GTT	.		0.483	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
KCNJ6	3763	hgsc.bcm.edu;bcgsc.ca	37	21	38997717	38997717	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr21:38997717A>G	ENST00000609713.1	-	4	1605	c.1016T>C	c.(1015-1017)gTc>gCc	p.V339A	KCNJ6_ENST00000288309.6_Missense_Mutation_p.V339A	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	339					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	CAGGGTCAGGACAGGTGTGAA	0.537																																					p.V339A	Pancreas(48;379 1118 2936 19024 28214)	.											.	KCNJ6	91	0			c.T1016C						.						91.0	98.0	95.0					21																	38997717		2048	4216	6264	SO:0001583	missense	3763	exon4			GTCAGGACAGGTG	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.1016T>C	21.37:g.38997717A>G	ENSP00000477437:p.Val339Ala	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_002240	Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	37	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.761425	0.89932	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.95412	-3.7;-3.7	5.88	5.88	0.94601	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.052029	0.85682	D	0.000000	D	0.97611	0.9217	M	0.80847	2.515	0.80722	D	1	D	0.64830	0.994	D	0.70227	0.968	D	0.98314	1.0525	10	0.87932	D	0	.	16.3009	0.82811	1.0:0.0:0.0:0.0	.	339	P48051	IRK6_HUMAN	A	339	ENSP00000383330:V339A;ENSP00000288309:V339A	ENSP00000288309:V339A	V	-	2	0	KCNJ6	37919587	1.000000	0.71417	0.993000	0.49108	0.918000	0.54935	8.962000	0.93254	2.246000	0.74042	0.533000	0.62120	GTC	.		0.537	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
KCNMA1	3778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	78669796	78669796	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:78669796T>C	ENST00000286628.8	-	25	3074	c.3075A>G	c.(3073-3075)gaA>gaG	p.E1025E	KCNMA1_ENST00000406533.3_Silent_p.E1029E|KCNMA1_ENST00000354353.5_Silent_p.E1028E|RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000286627.5_Silent_p.E967E|RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000372440.1_Silent_p.E967E|KCNMA1_ENST00000372443.1_Silent_p.E994E|KCNMA1_ENST00000404771.3_Silent_p.E1025E|KCNMA1_ENST00000404857.1_Silent_p.E1008E|RP11-443A13.5_ENST00000426234.1_RNA	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	1025					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.E967E(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TGAGGTACAGTTCTGTATCAG	0.473																																					p.E1025E		.											.	KCNMA1	93	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.A3075G						.						169.0	124.0	139.0					10																	78669796		2203	4300	6503	SO:0001819	synonymous_variant	3778	exon25			GTACAGTTCTGTA	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.3075A>G	10.37:g.78669796T>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	4.0	NM_001161352	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Silent	SNP	ENST00000286628.8	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.367|9.367	1.069505|1.069505	0.20147|0.20147	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372421;ENST00000434208	.|.	.|.	.|.	5.97|5.97	3.63|3.63	0.41609|0.41609	.|.	.|.	.|.	.|.	.|.	T|T	0.58366|0.58366	0.2117|0.2117	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.51841|0.51841	-0.8654|-0.8654	4|4	.|.	.|.	.|.	-13.6099|-13.6099	8.4362|8.4362	0.32789|0.32789	0.0:0.2154:0.0:0.7846|0.0:0.2154:0.0:0.7846	.|.	.|.	.|.	.|.	S|A	918|956;675	.|.	.|.	N|T	-|-	2|1	0|0	KCNMA1|KCNMA1	78339802|78339802	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	1.620000|1.620000	0.36976|0.36976	0.505000|0.505000	0.28104|0.28104	0.533000|0.533000	0.62120|0.62120	AAC|ACT	.		0.473	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
KDM4D	55693	hgsc.bcm.edu;bcgsc.ca	37	11	94731384	94731384	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:94731384T>C	ENST00000335080.5	+	3	1680	c.848T>C	c.(847-849)tTc>tCc	p.F283S	KDM4D_ENST00000536741.1_Missense_Mutation_p.F283S	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	283	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CATGCTGGCTTCAACCATGGT	0.512																																					p.F283S		.											.	KDM4D	226	0			c.T848C						.						67.0	71.0	70.0					11																	94731384		2201	4298	6499	SO:0001583	missense	55693	exon3			CTGGCTTCAACCA	AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.848T>C	11.37:g.94731384T>C	ENSP00000334181:p.Phe283Ser	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	5.0	NM_018039	B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	ENST00000335080.5	37	CCDS8302.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945705	0.53079	.	.	ENSG00000186280	ENST00000335080	T	0.74632	-0.86	3.73	3.73	0.42828	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.64402	U	0.000001	D	0.89248	0.6661	H	0.96365	3.81	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.91411	0.5151	10	0.87932	D	0	-19.0431	11.0593	0.47938	0.0:0.0:0.0:1.0	.	283	Q6B0I6	KDM4D_HUMAN	S	283	ENSP00000334181:F283S	ENSP00000334181:F283S	F	+	2	0	KDM4D	94371032	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	7.564000	0.82326	1.937000	0.56155	0.379000	0.24179	TTC	.		0.512	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396558.2	NM_018039	
KIAA0100	9703	hgsc.bcm.edu;bcgsc.ca	37	17	26946934	26946934	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:26946934G>A	ENST00000528896.2	-	30	5538	c.5464C>T	c.(5464-5466)Cgg>Tgg	p.R1822W	KIAA0100_ENST00000579924.2_5'Flank|SPAG5-AS1_ENST00000414744.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1679W|SPAG5-AS1_ENST00000424210.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1679W	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1822						extracellular region (GO:0005576)		p.R1822W(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					ACATGCTGCCGCACAGCCTCC	0.493																																					p.R1822W		.											.	KIAA0100	93	1	Substitution - Missense(1)	large_intestine(1)	c.C5464T						.						99.0	91.0	94.0					17																	26946934		2203	4300	6503	SO:0001583	missense	9703	exon30			GCTGCCGCACAGC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5464C>T	17.37:g.26946934G>A	ENSP00000436773:p.Arg1822Trp	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522641	0.64747	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.55413	0.52;0.52	5.53	3.24	0.37175	FMP27,  C-terminal (1);	0.051185	0.64402	D	0.000001	T	0.71929	0.3398	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77117	-0.2706	10	0.72032	D	0.01	.	13.3585	0.60642	0.0:0.0:0.5836:0.4164	.	1822	Q14667	K0100_HUMAN	W	1822;1792;1822;1679	ENSP00000436773:R1822W;ENSP00000446443:R1679W	ENSP00000005905:R1822W	R	-	1	2	KIAA0100	23971061	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.408000	0.34668	1.435000	0.47434	0.655000	0.94253	CGG	.		0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KIAA0391	9692	hgsc.bcm.edu;bcgsc.ca	37	14	35593210	35593210	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:35593210A>G	ENST00000557565.1	+	2	1140	c.759A>G	c.(757-759)ggA>ggG	p.G253G	KIAA0391_ENST00000603544.1_Silent_p.G253G|KIAA0391_ENST00000605870.1_Intron|PPP2R3C_ENST00000261475.5_5'Flank|KIAA0391_ENST00000250377.7_Silent_p.G158G|PPP2R3C_ENST00000555644.1_5'Flank|KIAA0391_ENST00000603588.1_Intron|KIAA0391_ENST00000321130.10_Silent_p.G253G|KIAA0391_ENST00000604948.1_Silent_p.G158G|KIAA0391_ENST00000534898.4_Silent_p.G253G	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	253					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		GTATCCAGGGAGCTCTCCTTC	0.358																																					p.G253G		.											.	KIAA0391	226	0			c.A759G						.						49.0	48.0	48.0					14																	35593210		2203	4300	6503	SO:0001819	synonymous_variant	9692	exon2			CCAGGGAGCTCTC	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.759A>G	14.37:g.35593210A>G		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_014672	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Silent	SNP	ENST00000557565.1	37	CCDS32063.1																																																																																			.		0.358	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672	
NWD2	57495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	37447599	37447599	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:37447599T>A	ENST00000309447.5	+	7	4837	c.3989T>A	c.(3988-3990)aTc>aAc	p.I1330N		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1330										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						AGAGGGGAAATCATTTACTCC	0.418																																					p.I1330N		.											.	.	.	0			c.T3989A						.						74.0	59.0	64.0					4																	37447599		692	1591	2283	SO:0001583	missense	57495	exon7			GGGAAATCATTTA																												ENST00000309447.5:c.3989T>A	4.37:g.37447599T>A	ENSP00000309501:p.Ile1330Asn	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	6.0	NM_001144990	A8MRU1	Missense_Mutation	SNP	ENST00000309447.5	37	CCDS47040.1	.	.	.	.	.	.	.	.	.	.	T	3.498	-0.102362	0.06967	.	.	ENSG00000174145	ENST00000309447	T	0.34667	1.35	6.17	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.287880	0.34156	N	0.004220	T	0.16385	0.0394	N	0.08118	0	0.33473	D	0.586408	B	0.28128	0.201	B	0.21360	0.034	T	0.15954	-1.0419	10	0.32370	T	0.25	.	7.0054	0.24833	0.1328:0.0687:0.0:0.7985	.	1330	Q9ULI1	K1239_HUMAN	N	1330	ENSP00000309501:I1330N	ENSP00000309501:I1330N	I	+	2	0	KIAA1239	37123994	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	3.877000	0.56123	2.371000	0.80710	0.533000	0.62120	ATC	.		0.418	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
KIF13A	63971	hgsc.bcm.edu;bcgsc.ca	37	6	17834225	17834225	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:17834225T>C	ENST00000259711.6	-	12	1338	c.1233A>G	c.(1231-1233)gaA>gaG	p.E411E	KIF13A_ENST00000378816.5_Silent_p.E411E|KIF13A_ENST00000378843.2_Silent_p.E411E|KIF13A_ENST00000378826.2_Silent_p.E411E|KIF13A_ENST00000378814.5_Silent_p.E411E	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	411					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TCAGCTTCTCTTCCCAAGTCA	0.373																																					p.E411E		.											.	KIF13A	137	0			c.A1233G						.						161.0	147.0	151.0					6																	17834225		1844	4086	5930	SO:0001819	synonymous_variant	63971	exon12			CTTCTCTTCCCAA	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1233A>G	6.37:g.17834225T>C		Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	5.0	NM_001105567	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Silent	SNP	ENST00000259711.6	37	CCDS47381.1																																																																																			.		0.373	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
KIF20B	9585	hgsc.bcm.edu;bcgsc.ca	37	10	91484863	91484863	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:91484863A>G	ENST00000371728.3	+	15	2014	c.1949A>G	c.(1948-1950)gAc>gGc	p.D650G	KIF20B_ENST00000394289.2_Missense_Mutation_p.D650G|KIF20B_ENST00000416354.1_Missense_Mutation_p.D650G|KIF20B_ENST00000260753.4_Missense_Mutation_p.D650G|KIF20B_ENST00000478929.1_3'UTR	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	650					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GGTAAATGTGACACTCGAGAA	0.368																																					p.D650G		.											.	KIF20B	93	0			c.A1949G						.						133.0	130.0	131.0					10																	91484863		2203	4300	6503	SO:0001583	missense	9585	exon15			AATGTGACACTCG	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1949A>G	10.37:g.91484863A>G	ENSP00000360793:p.Asp650Gly	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	9.689	1.151343	0.21371	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.49	3.2	0.36748	.	0.251074	0.28166	N	0.016359	T	0.11750	0.0286	L	0.60455	1.87	0.09310	N	1	P;B	0.39665	0.682;0.004	B;B	0.30401	0.115;0.006	T	0.18681	-1.0329	10	0.22706	T	0.39	-2.1015	4.6081	0.12387	0.5526:0.276:0.1714:0.0	.	650;650	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	G	650	ENSP00000260753:D650G;ENSP00000411545:D650G;ENSP00000377830:D650G;ENSP00000360793:D650G	ENSP00000260753:D650G	D	+	2	0	KIF20B	91474843	0.894000	0.30519	0.636000	0.29352	0.711000	0.40976	1.835000	0.39181	0.906000	0.36621	-0.250000	0.11733	GAC	.		0.368	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
KIRREL2	84063	hgsc.bcm.edu;bcgsc.ca	37	19	36353409	36353409	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:36353409G>A	ENST00000360202.5	+	12	1723	c.1525G>A	c.(1525-1527)Gtg>Atg	p.V509M	KIRREL2_ENST00000592409.1_Intron|KIRREL2_ENST00000262625.7_Missense_Mutation_p.V509M|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000347900.6_Missense_Mutation_p.V459M	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	509					cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTGCCCACTGTGCGGATAGT	0.622																																					p.V509M		.											.	KIRREL2	93	0			c.G1525A						.						116.0	118.0	117.0					19																	36353409		2203	4300	6503	SO:0001583	missense	84063	exon12			CCCACTGTGCGGA	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1525G>A	19.37:g.36353409G>A	ENSP00000353331:p.Val509Met	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	4.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	37	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447449	0.25987	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.68331	-0.32;-0.08;-0.3	4.37	0.797	0.18654	.	0.213928	0.23351	N	0.049124	T	0.58694	0.2140	M	0.61703	1.905	0.31070	N	0.713108	B;B;B;B	0.27765	0.061;0.062;0.188;0.17	B;B;B;B	0.30572	0.066;0.055;0.083;0.117	T	0.57888	-0.7733	10	0.52906	T	0.07	-5.2741	6.1253	0.20176	0.105:0.3683:0.5267:0.0	.	489;509;459;509	Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;KIRR2_HUMAN;.;.	M	509;459;509;489	ENSP00000262625:V509M;ENSP00000345067:V459M;ENSP00000353331:V509M	ENSP00000262625:V509M	V	+	1	0	KIRREL2	41045249	0.719000	0.27986	0.988000	0.46212	0.686000	0.39977	0.484000	0.22308	0.087000	0.17167	0.491000	0.48974	GTG	.		0.622	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
KLF10	7071	hgsc.bcm.edu;bcgsc.ca	37	8	103664250	103664250	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:103664250A>G	ENST00000285407.6	-	3	610	c.310T>C	c.(310-312)Tct>Cct	p.S104P	KLF10_ENST00000395884.3_Missense_Mutation_p.S93P	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	104					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			GACACTTGAGAGGGTTCAAAG	0.398											OREG0018913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S104P	Esophageal Squamous(16;495 519 2144 16528 44005)	.											.	KLF10	226	0			c.T310C						.						58.0	63.0	61.0					8																	103664250		2202	4300	6502	SO:0001583	missense	7071	exon3			CTTGAGAGGGTTC	U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.310T>C	8.37:g.103664250A>G	ENSP00000285407:p.Ser104Pro	Somatic	80.0	0.0	1375	WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_005655	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Missense_Mutation	SNP	ENST00000285407.6	37	CCDS6294.1	.	.	.	.	.	.	.	.	.	.	A	16.90	3.250118	0.59212	.	.	ENSG00000155090	ENST00000285407;ENST00000395884	T;T	0.19250	2.16;2.23	6.02	4.87	0.63330	.	0.073459	0.64402	D	0.000017	T	0.30603	0.0770	M	0.64997	1.995	0.39380	D	0.966241	P;P	0.51791	0.948;0.948	P;P	0.51487	0.671;0.671	T	0.11372	-1.0590	10	0.87932	D	0	.	7.9059	0.29761	0.7938:0.1377:0.0685:0.0	.	104;93	Q13118;O75411	KLF10_HUMAN;.	P	104;93	ENSP00000285407:S104P;ENSP00000379222:S93P	ENSP00000285407:S104P	S	-	1	0	KLF10	103733426	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	3.741000	0.55090	1.116000	0.41820	0.533000	0.62120	TCT	.		0.398	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379967.1		
KLHDC10	23008	hgsc.bcm.edu;bcgsc.ca	37	7	129762020	129762020	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:129762020T>C	ENST00000335420.5	+	5	891	c.757T>C	c.(757-759)Tcc>Ccc	p.S253P		NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	253						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						AAACAACCTATCCTGTGATCT	0.408																																					p.S253P		.											.	KLHDC10	90	0			c.T757C						.						150.0	119.0	130.0					7																	129762020		2203	4300	6503	SO:0001583	missense	23008	exon5			AACCTATCCTGTG		CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.757T>C	7.37:g.129762020T>C	ENSP00000334140:p.Ser253Pro	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	4.0	NM_014997	Q86Y99|Q92554	Missense_Mutation	SNP	ENST00000335420.5	37	CCDS5815.1	.	.	.	.	.	.	.	.	.	.	T	9.802	1.180775	0.21787	.	.	ENSG00000128607	ENST00000335420;ENST00000468226	T;T	0.11277	2.79;2.79	5.47	4.33	0.51752	Galactose oxidase, beta-propeller (1);	0.161589	0.56097	D	0.000025	T	0.03348	0.0097	N	0.01209	-0.955	0.41995	D	0.990864	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.42865	-0.9426	10	0.26408	T	0.33	-9.9164	7.5016	0.27522	0.0:0.1601:0.0:0.8399	.	102;110;253	Q96G43;Q6PID8-2;Q6PID8	.;.;KLD10_HUMAN	P	253;110	ENSP00000334140:S253P;ENSP00000420034:S110P	ENSP00000334140:S253P	S	+	1	0	KLHDC10	129549256	0.998000	0.40836	0.986000	0.45419	0.333000	0.28666	3.650000	0.54424	2.064000	0.61679	0.533000	0.62120	TCC	.		0.408	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349347.2		
KLHL11	55175	hgsc.bcm.edu;bcgsc.ca	37	17	40010298	40010298	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:40010298G>A	ENST00000319121.3	-	2	1881	c.1821C>T	c.(1819-1821)taC>taT	p.Y607Y	RP11-156E6.1_ENST00000560400.1_RNA	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	607										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				CATCATCTTTGTAATAGCAAA	0.428																																					p.Y607Y		.											.	KLHL11	90	0			c.C1821T						.						93.0	93.0	93.0					17																	40010298		2203	4300	6503	SO:0001819	synonymous_variant	55175	exon2			ATCTTTGTAATAG		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1821C>T	17.37:g.40010298G>A		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_018143		Silent	SNP	ENST00000319121.3	37	CCDS11411.1																																																																																			.		0.428	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
KLKB1	3818	hgsc.bcm.edu;bcgsc.ca	37	4	187175807	187175807	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:187175807A>G	ENST00000264690.6	+	12	1566	c.1379A>G	c.(1378-1380)gAt>gGt	p.D460G	KLKB1_ENST00000513864.1_Missense_Mutation_p.D460G	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	460	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		ATTACAAAAGATACACCTTTC	0.373																																					p.D460G		.											.	KLKB1	227	0			c.A1379G						.						110.0	110.0	110.0					4																	187175807		2203	4300	6503	SO:0001583	missense	3818	exon12			CAAAAGATACACC	M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.1379A>G	4.37:g.187175807A>G	ENSP00000264690:p.Asp460Gly	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_000892	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	ENST00000264690.6	37	CCDS34120.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.100|6.100	0.386632|0.386632	0.11524|0.11524	.|.	.|.	ENSG00000164344|ENSG00000164344	ENST00000264690;ENST00000513864;ENST00000418715|ENST00000511608	D;D|.	0.88201|.	-2.35;-2.35|.	5.8|5.8	4.58|4.58	0.56647|0.56647	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.588693|.	0.18084|.	N|.	0.152207|.	T|T	0.16257|0.16257	0.0391|0.0391	N|N	0.02213|0.02213	-0.635|-0.635	0.09310|0.09310	N|N	1|1	B;B;B|.	0.15473|.	0.013;0.0;0.013|.	B;B;B|.	0.24006|.	0.05;0.007;0.05|.	T|T	0.13308|0.13308	-1.0514|-1.0514	10|5	0.24483|.	T|.	0.36|.	.|.	11.9666|11.9666	0.53038|0.53038	0.7285:0.2715:0.0:0.0|0.7285:0.2715:0.0:0.0	.|.	422;460;460|.	E7EQA8;A8K9A9;P03952|.	.;.;KLKB1_HUMAN|.	G|V	460;460;422|508	ENSP00000264690:D460G;ENSP00000424469:D460G|.	ENSP00000264690:D460G|.	D|I	+|+	2|1	0|0	KLKB1|KLKB1	187412801|187412801	0.813000|0.813000	0.29090|0.29090	0.970000|0.970000	0.41538|0.41538	0.050000|0.050000	0.14768|0.14768	3.885000|3.885000	0.56182|0.56182	2.220000|2.220000	0.72140|0.72140	0.533000|0.533000	0.62120|0.62120	GAT|ATA	.		0.373	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892	
KRI1	65095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10671691	10671691	+	Silent	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:10671691G>C	ENST00000312962.6	-	8	688	c.669C>G	c.(667-669)tcC>tcG	p.S223S	KRI1_ENST00000361821.5_Silent_p.S219S|KRI1_ENST00000537964.1_5'UTR	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	217	Glu-rich.					nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GTTCCTTCAGGGAATCTGGGT	0.547																																					p.S223S		.											.	KRI1	69	0			c.C669G						.						113.0	85.0	95.0					19																	10671691		2203	4300	6503	SO:0001819	synonymous_variant	65095	exon8			CTTCAGGGAATCT		CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.669C>G	19.37:g.10671691G>C		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	26.0	NM_023008	Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Silent	SNP	ENST00000312962.6	37	CCDS12242.1	.	.	.	.	.	.	.	.	.	.	G	6.238	0.412061	0.11812	.	.	ENSG00000129347	ENST00000543682	.	.	.	4.56	-0.338	0.12651	.	.	.	.	.	T	0.21307	0.0513	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24657	-1.0154	4	.	.	.	-4.1918	2.6004	0.04865	0.1608:0.2642:0.4397:0.1353	.	.	.	.	R	161	.	.	P	-	2	0	KRI1	10532691	0.000000	0.05858	0.038000	0.18304	0.203000	0.24098	-0.275000	0.08525	0.156000	0.19299	-0.360000	0.07572	CCC	.		0.547	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317705.1	NM_023008	
KRIT1	889	hgsc.bcm.edu;bcgsc.ca	37	7	91851228	91851228	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:91851228T>C	ENST00000340022.2	-	14	2569	c.1551A>G	c.(1549-1551)gaA>gaG	p.E517E	KRIT1_ENST00000394505.2_Silent_p.E517E|KRIT1_ENST00000394507.1_Silent_p.E517E|KRIT1_ENST00000412043.2_Silent_p.E517E|KRIT1_ENST00000394503.2_Silent_p.E469E	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	517	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GTTTTTCAACTTCCAAGGGAA	0.373																																					p.E517E		.											.	KRIT1	132	0			c.A1551G						.						64.0	63.0	63.0					7																	91851228		2203	4300	6503	SO:0001819	synonymous_variant	889	exon15			TTCAACTTCCAAG	AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1551A>G	7.37:g.91851228T>C		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_194456	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Silent	SNP	ENST00000340022.2	37	CCDS5624.1																																																																																			.		0.373	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1		
LATS1	9113	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	150001056	150001058	+	In_Frame_Del	DEL	AGA	AGA	-	rs56382749	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:150001056_150001058delAGA	ENST00000543571.1	-	5	3093_3095	c.2546_2548delTCT	c.(2545-2550)ctctgc>cgc	p.849_850LC>R	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_In_Frame_Del_p.849_850LC>R	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AAGCCAGTGCAGAGGCCAAAGTC	0.3																																					p.849_850del		.											.	LATS1	992	0			c.2546_2548del						.																																			SO:0001651	inframe_deletion	9113	exon5			CAGTGCAGAGGCC	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2546_2548delTCT	6.37:g.150001056_150001058delAGA	ENSP00000437550:p.Leu849_Cys850delinsArg	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	116.0	NM_004690		In_Frame_Del	DEL	ENST00000543571.1	37	CCDS34551.1																																																																																			.		0.300	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
LGI4	163175	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35622722	35622722	+	Silent	SNP	C	C	T	rs191436645	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:35622722C>T	ENST00000310123.3	-	5	948	c.429G>A	c.(427-429)ctG>ctA	p.L143L	LGI4_ENST00000392225.3_Silent_p.L143L|LGI4_ENST00000591633.1_Silent_p.L143L|LGI4_ENST00000493050.1_5'UTR	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	143					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			GGCCTCGGAACAGGAATCTGG	0.607													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15041	0.0		0.0	False		,,,				2504	0.0				p.L143L		.											.	LGI4	91	0			c.G429A						.	C		0,4400		0,0,2200	48.0	47.0	48.0		429	-0.2	1.0	19		48	1,8595		0,1,4297	no	coding-synonymous	LGI4	NM_139284.2		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		143/538	35622722	1,12995	2200	4298	6498	SO:0001819	synonymous_variant	163175	exon5			TCGGAACAGGAAT	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.429G>A	19.37:g.35622722C>T		Somatic	190.0	1.0		WXS	Illumina HiSeq	Phase_I	147.0	77.0	NM_139284	B2RN53|B9EGS7|Q5M8T1	Silent	SNP	ENST00000310123.3	37	CCDS12444.1																																																																																			C|0.999;T|0.001		0.607	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
MACF1	23499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	39751339	39751339	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:39751339C>A	ENST00000372915.3	+	13	1519	c.1432C>A	c.(1432-1434)Cag>Aag	p.Q478K	MACF1_ENST00000317713.7_Missense_Mutation_p.Q478K|MACF1_ENST00000361689.2_Missense_Mutation_p.Q478K|MACF1_ENST00000545844.1_Missense_Mutation_p.Q478K|MACF1_ENST00000564288.1_Missense_Mutation_p.Q473K|MACF1_ENST00000539005.1_Missense_Mutation_p.Q478K|MACF1_ENST00000567887.1_Missense_Mutation_p.Q510K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	478					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TATGTACATTCAGGAGTGTGA	0.483																																					p.Q478K		.											.	MACF1	165	0			c.C1432A						.						110.0	98.0	102.0					1																	39751339		2203	4300	6503	SO:0001583	missense	23499	exon15			TACATTCAGGAGT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.1432C>A	1.37:g.39751339C>A	ENSP00000362006:p.Gln478Lys	Somatic	257.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	153.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	C	19.68	3.872429	0.72180	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18;-3.18;-3.18;-3.18	5.93	5.93	0.95920	.	.	.	.	.	D	0.92718	0.7685	M	0.65975	2.015	0.80722	D	1	B;P	0.44734	0.011;0.842	B;P	0.45276	0.022;0.475	D	0.89732	0.3927	9	0.02654	T	1	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	478;443	F8W8Q1;Q9UPN3-3	.;.	K	478;478;478;478;478;436;627;638	ENSP00000439537:Q478K;ENSP00000362006:Q478K;ENSP00000354573:Q478K;ENSP00000313438:Q478K;ENSP00000444364:Q478K;ENSP00000435070:Q436K;ENSP00000437059:Q627K	ENSP00000313438:Q478K	Q	+	1	0	MACF1	39523926	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.741000	0.68638	2.826000	0.97356	0.655000	0.94253	CAG	.		0.483	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
LMNA	4000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156108485	156108485	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:156108485C>T	ENST00000368300.4	+	11	2117	c.1905C>T	c.(1903-1905)ggC>ggT	p.G635G	LMNA_ENST00000368299.3_Intron|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000473598.2_Silent_p.G536G|LMNA_ENST00000448611.2_Silent_p.G523G|LMNA_ENST00000347559.2_Silent_p.G605G	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	635	Tail.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					GTGGGGGTGGCAGCTTCGGGG	0.642									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.G635G		.											.	LMNA	228	0			c.C1905T						.						23.0	24.0	23.0					1																	156108485		2203	4298	6501	SO:0001819	synonymous_variant	4000	exon11	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	GGGTGGCAGCTTC	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1905C>T	1.37:g.156108485C>T		Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	242.0	50.0	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	37	CCDS1129.1																																																																																			.		0.642	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
MDN1	23195	hgsc.bcm.edu;bcgsc.ca	37	6	90428856	90428856	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:90428856T>C	ENST00000369393.3	-	41	6171	c.6056A>G	c.(6055-6057)cAg>cGg	p.Q2019R	MDN1_ENST00000428876.1_Splice_Site_p.Q2019R			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2019					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCTCCTTACCTGAACATCATA	0.413																																					p.Q2019R		.											.	MDN1	100	0			c.A6056G						.						102.0	93.0	96.0					6																	90428856		2203	4300	6503	SO:0001630	splice_region_variant	23195	exon41			CTTACCTGAACAT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.6057+1A>G	6.37:g.90428856T>C		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.499108	0.44455	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03553	3.89;3.89	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.02807	0.0084	M	0.70275	2.135	0.58432	D	0.99999	B	0.16166	0.016	B	0.27076	0.076	T	0.32508	-0.9904	10	0.18276	T	0.48	.	14.3369	0.66598	0.0:0.0:0.0:1.0	.	2019	Q9NU22	MDN1_HUMAN	R	2019	ENSP00000358400:Q2019R;ENSP00000413970:Q2019R	ENSP00000358400:Q2019R	Q	-	2	0	MDN1	90485577	1.000000	0.71417	0.998000	0.56505	0.784000	0.44337	5.493000	0.66899	1.954000	0.56735	0.455000	0.32223	CAG	.		0.413	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		Missense_Mutation
KMT2E	55904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	104746372	104746372	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:104746372C>T	ENST00000311117.3	+	19	3063	c.2518C>T	c.(2518-2520)Caa>Taa	p.Q840*	KMT2E_ENST00000334877.4_Nonsense_Mutation_p.Q840*|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Nonsense_Mutation_p.Q840*|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	840					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TTCACCCTGTCAAGAAAGATC	0.348																																					p.Q840X		.											.	MLL5	93	0			c.C2518T						.						89.0	96.0	93.0					7																	104746372		2203	4300	6503	SO:0001587	stop_gained	55904	exon18			CCCTGTCAAGAAA	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2518C>T	7.37:g.104746372C>T	ENSP00000312379:p.Gln840*	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	24.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Nonsense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	C	42	9.739784	0.99252	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	.	.	.	5.81	5.81	0.92471	.	0.319059	0.29846	N	0.011058	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	20.0804	0.97772	0.0:1.0:0.0:0.0	.	.	.	.	X	840;840;840;760;840	.	ENSP00000257745:Q840X	Q	+	1	0	MLL5	104533608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.335000	0.65929	2.738000	0.93877	0.655000	0.94253	CAA	.		0.348	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
MS4A14	84689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	60184403	60184403	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:60184403G>A	ENST00000300187.6	+	5	2239	c.1962G>A	c.(1960-1962)tgG>tgA	p.W654*	MS4A14_ENST00000531783.1_Nonsense_Mutation_p.W687*|MS4A14_ENST00000395005.2_Nonsense_Mutation_p.W637*|MS4A14_ENST00000531787.1_Nonsense_Mutation_p.W542*	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	654	Gln-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						ACCAATTCTGGCAATTCCACA	0.463																																					p.W687X		.											.	MS4A14	90	0			c.G2061A						.						83.0	86.0	85.0					11																	60184403		2203	4300	6503	SO:0001587	stop_gained	84689	exon6			ATTCTGGCAATTC	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1962G>A	11.37:g.60184403G>A	ENSP00000300187:p.Trp654*	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	17.0	NM_001261828	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Nonsense_Mutation	SNP	ENST00000300187.6	37	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116769	0.77323	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	.	.	.	3.78	0.219	0.15274	.	7.817370	0.00166	N	0.000002	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	6.0394	0.19726	0.1041:0.0:0.5168:0.3791	.	.	.	.	X	542;654;637;687	.	ENSP00000300187:W654X	W	+	3	0	MS4A14	59940979	0.015000	0.18098	0.000000	0.03702	0.018000	0.09664	-0.108000	0.10857	-0.093000	0.12396	0.650000	0.86243	TGG	.		0.463	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		
MTRF1L	54516	hgsc.bcm.edu;bcgsc.ca	37	6	153313995	153313995	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:153313995T>C	ENST00000367233.5	-	5	801	c.802A>G	c.(802-804)Aca>Gca	p.T268A	MTRF1L_ENST00000367231.5_Missense_Mutation_p.T268A|MTRF1L_ENST00000367230.1_Missense_Mutation_p.T232A|MTRF1L_ENST00000464135.1_5'UTR	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	268						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		TACACACCTGTTGGAAGATGA	0.408																																					p.T268A		.											.	MTRF1L	90	0			c.A802G						.						90.0	89.0	89.0					6																	153313995		2203	4300	6503	SO:0001583	missense	54516	exon5			CACCTGTTGGAAG	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.802A>G	6.37:g.153313995T>C	ENSP00000356202:p.Thr268Ala	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_019041	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	ENST00000367233.5	37	CCDS5243.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.610409	0.87258	.	.	ENSG00000112031	ENST00000367233;ENST00000367231;ENST00000367230;ENST00000414771;ENST00000448966	T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81	5.02	5.02	0.67125	Peptide chain release factor class I/class II (1);	0.000000	0.85682	D	0.000000	T	0.55449	0.1921	H	0.95079	3.62	0.80722	D	1	P;P;D;P	0.60575	0.754;0.831;0.988;0.87	P;P;D;P	0.70935	0.518;0.459;0.971;0.484	T	0.71474	-0.4582	10	0.87932	D	0	.	14.7403	0.69448	0.0:0.0:0.0:1.0	.	232;268;232;268	B4DMX1;Q9UGC7-2;Q9UGC7-4;Q9UGC7	.;.;.;RF1ML_HUMAN	A	268;268;232;119;132	ENSP00000356202:T268A;ENSP00000356200:T268A;ENSP00000356199:T232A;ENSP00000414383:T119A;ENSP00000415113:T132A	ENSP00000356199:T232A	T	-	1	0	MTRF1L	153355688	1.000000	0.71417	0.980000	0.43619	0.871000	0.50021	8.008000	0.88588	1.901000	0.55032	0.528000	0.53228	ACA	.		0.408	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
MYH9	4627	hgsc.bcm.edu;bcgsc.ca	37	22	36696312	36696312	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr22:36696312T>C	ENST00000216181.5	-	23	3069		c.e23-2			NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle						actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTCAAGCTCCTGCCGGGGGCC	0.617			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												.		.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9	292	0			c.2839-2A>G						.						47.0	48.0	47.0					22																	36696312		2203	4300	6503	SO:0001630	splice_region_variant	4627	exon24	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	AGCTCCTGCCGGG		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2839-2A>G	22.37:g.36696312T>C		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Splice_Site	SNP	ENST00000216181.5	37	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.911790	0.72983	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2996	0.73936	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH9	35026258	1.000000	0.71417	0.883000	0.34634	0.822000	0.46500	8.002000	0.88514	2.073000	0.62155	0.533000	0.62120	.	.		0.617	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	Intron
MYOF	26509	hgsc.bcm.edu;bcgsc.ca	37	10	95109578	95109578	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:95109578A>G	ENST00000359263.4	-	36	4069	c.4070T>C	c.(4069-4071)cTc>cCc	p.L1357P	MYOF_ENST00000371501.4_Missense_Mutation_p.L1357P|MYOF_ENST00000358334.5_Missense_Mutation_p.L1344P|MYOF_ENST00000371502.4_Missense_Mutation_p.L1357P	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1357					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTTCATGAAGAGAACAGAACT	0.443																																					p.L1357P		.											.	MYOF	93	0			c.T4070C						.						103.0	102.0	102.0					10																	95109578		1910	4127	6037	SO:0001583	missense	26509	exon36			ATGAAGAGAACAG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4070T>C	10.37:g.95109578A>G	ENSP00000352208:p.Leu1357Pro	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268520	0.80469	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.53	5.53	0.82687	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.85435	0.5696	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88899	0.3351	10	0.87932	D	0	-16.8222	15.6595	0.77174	1.0:0.0:0.0:0.0	.	1344;1357	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	P	1344;1357;1357;1357	ENSP00000351094:L1344P;ENSP00000352208:L1357P;ENSP00000360556:L1357P;ENSP00000360557:L1357P	ENSP00000351094:L1344P	L	-	2	0	MYOF	95099568	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.273000	0.95719	2.102000	0.63906	0.459000	0.35465	CTC	.		0.443	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
NAA16	79612	hgsc.bcm.edu;bcgsc.ca	37	13	41891035	41891035	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:41891035T>C	ENST00000379406.3	+	2	432	c.108T>C	c.(106-108)atT>atC	p.I36I	NAA16_ENST00000379367.3_Silent_p.I36I|NAA16_ENST00000403412.3_Silent_p.I36I	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	36					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						GCAAGATGATTCTGTCGAACC	0.323																																					p.I36I		.											.	NAA16	90	0			c.T108C						.						110.0	114.0	113.0					13																	41891035		2203	4300	6503	SO:0001819	synonymous_variant	79612	exon2			GATGATTCTGTCG	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.108T>C	13.37:g.41891035T>C		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_001110798	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Silent	SNP	ENST00000379406.3	37	CCDS9379.1																																																																																			.		0.323	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
NAV3	89795	hgsc.bcm.edu;bcgsc.ca	37	12	78388596	78388596	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:78388596T>C	ENST00000397909.2	+	6	858	c.685T>C	c.(685-687)Tat>Cat	p.Y229H	NAV3_ENST00000228327.6_Missense_Mutation_p.Y229H|NAV3_ENST00000266692.7_Missense_Mutation_p.Y229H|NAV3_ENST00000536525.2_Missense_Mutation_p.Y229H			Q8IVL0	NAV3_HUMAN	neuron navigator 3	229						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GGCAGCCAGATATGCAACTCA	0.338										HNSCC(70;0.22)																											p.Y229H		.											.	NAV3	279	0			c.T685C						.						134.0	126.0	128.0					12																	78388596		1829	4106	5935	SO:0001583	missense	89795	exon6			GCCAGATATGCAA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.685T>C	12.37:g.78388596T>C	ENSP00000381007:p.Tyr229His	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	4.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	T	15.81	2.943815	0.53079	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.95	5.95	0.96441	.	0.465406	0.15758	U	0.246047	T	0.49338	0.1551	N	0.19112	0.55	0.80722	D	1	P;D	0.89917	0.664;1.0	B;D	0.85130	0.347;0.997	T	0.33523	-0.9865	10	0.15952	T	0.53	-16.1262	16.4237	0.83790	0.0:0.0:0.0:1.0	.	229;229	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	H	229	ENSP00000446628:Y229H;ENSP00000446132:Y229H;ENSP00000381007:Y229H;ENSP00000228327:Y229H;ENSP00000266692:Y229H	ENSP00000228327:Y229H	Y	+	1	0	NAV3	76912727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.347000	0.65998	2.279000	0.76181	0.533000	0.62120	TAT	.		0.338	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NBEA	26960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	35758164	35758164	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:35758164C>A	ENST00000400445.3	+	30	5417	c.4883C>A	c.(4882-4884)gCc>gAc	p.A1628D	NBEA_ENST00000540320.1_Missense_Mutation_p.A1628D|NBEA_ENST00000310336.4_Missense_Mutation_p.A1628D|NBEA_ENST00000379939.2_Missense_Mutation_p.A1625D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1628					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGATTCCTTGCCAAGTTAATT	0.403																																					p.A1628D		.											.	NBEA	144	0			c.C4883A						.						115.0	104.0	107.0					13																	35758164		1881	4118	5999	SO:0001583	missense	26960	exon30			TCCTTGCCAAGTT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4883C>A	13.37:g.35758164C>A	ENSP00000383295:p.Ala1628Asp	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	73.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966615	0.53507	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.82	5.82	0.92795	.	0.153376	0.46442	D	0.000282	T	0.48021	0.1477	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.44314	-0.9336	10	0.14656	T	0.56	.	18.2756	0.90081	0.0:1.0:0.0:0.0	.	1625	Q5T321	.	D	1628;1628;1625;1628	ENSP00000440951:A1628D;ENSP00000383295:A1628D;ENSP00000369271:A1625D;ENSP00000308534:A1628D	ENSP00000308534:A1628D	A	+	2	0	NBEA	34656164	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.770000	0.62309	2.753000	0.94483	0.467000	0.42956	GCC	.		0.403	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NFX1	4799	hgsc.bcm.edu;bcgsc.ca	37	9	33351736	33351736	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:33351736T>C	ENST00000379540.3	+	16	2665	c.2603T>C	c.(2602-2604)aTg>aCg	p.M868T	NFX1_ENST00000379521.4_Missense_Mutation_p.M868T|Y_RNA_ENST00000363674.1_RNA	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	868					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		CACCCGTGTATGGCACCCTGC	0.552																																					p.M868T		.											.	NFX1	91	0			c.T2603C						.						74.0	71.0	72.0					9																	33351736		2203	4300	6503	SO:0001583	missense	4799	exon16			CGTGTATGGCACC	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.2603T>C	9.37:g.33351736T>C	ENSP00000368856:p.Met868Thr	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_147133	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	37	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983493	0.35036	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000263220	T;T	0.38240	1.15;1.15	5.88	4.68	0.58851	Zinc finger, NF-X1-type (1);	0.337134	0.39146	N	0.001448	T	0.19087	0.0458	N	0.12831	0.26	0.80722	D	1	B;P	0.40476	0.003;0.718	B;B	0.38880	0.01;0.284	T	0.05305	-1.0893	10	0.12766	T	0.61	.	10.9663	0.47414	0.0:0.0:0.1564:0.8436	.	868;868	Q12986;Q12986-2	NFX1_HUMAN;.	T	868;868;65	ENSP00000368856:M868T;ENSP00000368836:M868T	ENSP00000263220:M65T	M	+	2	0	NFX1	33341736	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.795000	0.38784	2.246000	0.74042	0.533000	0.62120	ATG	.		0.552	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
NR5A2	2494	hgsc.bcm.edu;bcgsc.ca	37	1	199997033	199997033	+	Missense_Mutation	SNP	C	C	T	rs142187332		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:199997033C>T	ENST00000367362.3	+	1	304	c.58C>T	c.(58-60)Cct>Tct	p.P20S	NR5A2_ENST00000236914.3_Missense_Mutation_p.P20S	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	20					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					CGGACTTACACCTATTGGTAA	0.323																																					p.M20L	Melanoma(179;1138 2773 15678 26136)	.											.	NR5A2	227	0			c.A58T						.	C	SER/PRO,SER/PRO	1,4405	2.1+/-5.4	0,1,2202	119.0	121.0	120.0		58,58	2.7	0.9	1	dbSNP_134	120	0,8600		0,0,4300	no	missense,missense	NR5A2	NM_003822.3,NM_205860.1	74,74	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	20/496,20/542	199997033	1,13005	2203	4300	6503	SO:0001583	missense	2494	exon1			CTTACACCTATTG	U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.58C>T	1.37:g.199997033C>T	ENSP00000356331:p.Pro20Ser	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	4.0	NM_003822	B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	ENST00000367362.3	37	CCDS1401.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.870|4.870	0.161693|0.161693	0.09287|0.09287	2.27E-4|2.27E-4	0.0|0.0	ENSG00000116833|ENSG00000116833	ENST00000367362;ENST00000236914;ENST00000537715;ENST00000542116|ENST00000447034	D;D|.	0.94138|.	-3.33;-3.36|.	5.77|5.77	2.68|2.68	0.31781|0.31781	.|.	0.124523|.	0.37095|.	N|.	0.002260|.	T|T	0.23492|0.23492	0.0568|0.0568	N|N	0.08118|0.08118	0|0	0.53005|0.53005	D|D	0.999965|0.999965	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.03784|0.03784	-1.1004|-1.1004	9|5	.|.	.|.	.|.	.|.	3.04|3.04	0.06135|0.06135	0.1289:0.4521:0.2655:0.1534|0.1289:0.4521:0.2655:0.1534	.|.	20;20|.	F1D8R9;O00482|.	.;NR5A2_HUMAN|.	S|I	20|8	ENSP00000356331:P20S;ENSP00000236914:P20S|.	.|.	P|T	+|+	1|2	0|0	NR5A2|NR5A2	198263656|198263656	0.760000|0.760000	0.28428|0.28428	0.855000|0.855000	0.33649|0.33649	0.536000|0.536000	0.34869|0.34869	0.659000|0.659000	0.24994|0.24994	0.757000|0.757000	0.33036|0.33036	0.655000|0.655000	0.94253|0.94253	CCT|ACC	C|1.000;T|0.000		0.323	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086497.2		
OPN4	94233	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	88421086	88421086	+	Frame_Shift_Del	DEL	C	C	-	rs192913605	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:88421086delC	ENST00000241891.5	+	7	1181	c.1014delC	c.(1012-1014)atcfs	p.I338fs	OPN4_ENST00000372071.2_Frame_Shift_Del_p.I349fs	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	338					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						CAGCCGTCATCGCCAAGGCCT	0.587																																					p.I349fs		.											.	OPN4	69	0			c.1047delC						.						256.0	178.0	205.0					10																	88421086		2203	4300	6503	SO:0001589	frameshift_variant	94233	exon8			CGTCATCGCCAAG	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.1014delC	10.37:g.88421086delC	ENSP00000241891:p.Ile338fs	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	34.0	NM_001030015	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Frame_Shift_Del	DEL	ENST00000241891.5	37	CCDS7376.1																																																																																			.		0.587	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
OR10A7	121364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	55614885	55614885	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:55614885C>A	ENST00000326258.1	+	1	77	c.77C>A	c.(76-78)tCc>tAc	p.S26Y		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						ATGCAAGTTTCCCTCTTTATT	0.383																																					p.S26Y		.											.	OR10A7	72	0			c.C77A						.						221.0	227.0	225.0					12																	55614885		2203	4300	6503	SO:0001583	missense	121364	exon1			AAGTTTCCCTCTT	BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.77C>A	12.37:g.55614885C>A	ENSP00000326718:p.Ser26Tyr	Somatic	263.0	1.0		WXS	Illumina HiSeq	Phase_I	176.0	82.0	NM_001005280	Q6IFD5|Q96R19	Missense_Mutation	SNP	ENST00000326258.1	37	CCDS31815.1	.	.	.	.	.	.	.	.	.	.	c	7.565	0.665485	0.14710	.	.	ENSG00000179919	ENST00000326258	T	0.00433	7.43	2.91	2.01	0.26516	.	0.396182	0.18651	N	0.134993	T	0.00241	0.0007	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.38520	-0.9657	10	0.38643	T	0.18	.	6.4416	0.21853	0.0:0.6947:0.0:0.3053	.	26	Q8NGE5	O10A7_HUMAN	Y	26	ENSP00000326718:S26Y	ENSP00000326718:S26Y	S	+	2	0	OR10A7	53901152	0.000000	0.05858	0.079000	0.20413	0.961000	0.63080	-0.565000	0.05929	0.797000	0.33971	0.637000	0.83480	TCC	.		0.383	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1		
OR2K2	26248	hgsc.bcm.edu;bcgsc.ca	37	9	114089950	114089950	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:114089950A>G	ENST00000374428.1	-	1	850	c.851T>C	c.(850-852)cTc>cCc	p.L284P	OR2K2_ENST00000302681.1_Missense_Mutation_p.L255P			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						GTACATAGAGAGGGCAGCCCC	0.423																																					p.L255P		.											.	OR2K2	69	0			c.T764C						.						116.0	115.0	115.0					9																	114089950		2203	4300	6503	SO:0001583	missense	26248	exon1			ATAGAGAGGGCAG	X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.851T>C	9.37:g.114089950A>G	ENSP00000363550:p.Leu284Pro	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_205859	Q2TA61|Q5VYK4|Q6IFI5	Missense_Mutation	SNP	ENST00000374428.1	37		.	.	.	.	.	.	.	.	.	.	A	10.97	1.502956	0.26949	.	.	ENSG00000171133	ENST00000302681;ENST00000374428	T;T	0.47528	0.84;0.84	4.55	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35936	U	0.002900	T	0.72145	0.3424	M	0.93462	3.42	0.22531	N	0.999015	D	0.89917	1.0	D	0.97110	1.0	T	0.67106	-0.5754	10	0.87932	D	0	.	6.9177	0.24369	0.8983:0.0:0.1017:0.0	.	284	Q8NGT1	OR2K2_HUMAN	P	255;284	ENSP00000305055:L255P;ENSP00000363550:L284P	ENSP00000305055:L255P	L	-	2	0	OR2K2	113129771	0.000000	0.05858	0.188000	0.23233	0.440000	0.31957	0.816000	0.27267	2.047000	0.60756	0.482000	0.46254	CTC	.		0.423	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		NM_205859	
OR52B4	143496	hgsc.bcm.edu;bcgsc.ca	37	11	4389188	4389188	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:4389188T>C	ENST00000408920.2	-	1	428	c.338A>G	c.(337-339)gAg>gGg	p.E113G		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	113					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		GATCCCTGACTCAGAGATGAA	0.473																																					p.E113G		.											.	OR52B4	90	0			c.A338G						.						96.0	98.0	97.0					11																	4389188		2114	4244	6358	SO:0001583	missense	143496	exon1			CCTGACTCAGAGA	AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.338A>G	11.37:g.4389188T>C	ENSP00000386160:p.Glu113Gly	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_001005161	A6NP68|Q6IFK6	Missense_Mutation	SNP	ENST00000408920.2	37	CCDS41609.1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.273614	0.59649	.	.	ENSG00000221996	ENST00000408920	T	0.00388	7.59	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000016	T	0.01558	0.0050	H	0.95679	3.705	0.38208	D	0.940391	D	0.76494	0.999	D	0.69307	0.963	T	0.30707	-0.9969	10	0.87932	D	0	.	14.1695	0.65500	0.0:0.0:0.0:1.0	.	113	Q8NGK2	O52B4_HUMAN	G	113	ENSP00000386160:E113G	ENSP00000386160:E113G	E	-	2	0	OR52B4	4345764	0.998000	0.40836	1.000000	0.80357	0.363000	0.29612	2.257000	0.43240	2.220000	0.72140	0.528000	0.53228	GAG	.		0.473	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161	
OVOL2	58495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	18022310	18022310	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:18022310C>G	ENST00000278780.6	-	3	621	c.379G>C	c.(379-381)Ggc>Cgc	p.G127R	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	127					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						AGACGGAAGCCCTTGCCACAC	0.617																																					p.G127R		.											.	OVOL2	68	0			c.G379C						.						120.0	80.0	93.0					20																	18022310		2203	4300	6503	SO:0001583	missense	58495	exon3			GGAAGCCCTTGCC	AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.379G>C	20.37:g.18022310C>G	ENSP00000278780:p.Gly127Arg	Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	6.0	NM_021220	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Missense_Mutation	SNP	ENST00000278780.6	37	CCDS13132.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142366	0.57044	.	.	ENSG00000125850	ENST00000278780	T	0.75938	-0.98	5.57	0.66	0.17868	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.706306	0.14785	N	0.298588	T	0.61627	0.2362	L	0.27053	0.805	0.30601	N	0.760484	P	0.41366	0.747	B	0.43508	0.422	T	0.60712	-0.7209	10	0.72032	D	0.01	-13.263	6.295	0.21081	0.2774:0.6108:0.0:0.1117	.	127	Q9BRP0	OVOL2_HUMAN	R	127	ENSP00000278780:G127R	ENSP00000278780:G127R	G	-	1	0	OVOL2	17970310	0.292000	0.24362	0.990000	0.47175	0.998000	0.95712	0.629000	0.24538	-0.132000	0.11557	0.655000	0.94253	GGC	.		0.617	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078148.5	NM_021220	
OXCT1	5019	hgsc.bcm.edu;bcgsc.ca	37	5	41794835	41794835	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:41794835A>G	ENST00000196371.5	-	12	1276	c.1116T>C	c.(1114-1116)acT>acC	p.T372T	OXCT1_ENST00000512084.1_5'Flank|OXCT1_ENST00000513081.1_5'Flank|OXCT1_ENST00000510634.1_5'Flank|OXCT1_ENST00000509987.1_Silent_p.T186T	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	372					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	CTGGAAGAATAGTAACTGTTT	0.398																																					p.T372T		.											.	OXCT1	133	0			c.T1116C						.						65.0	63.0	64.0					5																	41794835		2203	4300	6503	SO:0001819	synonymous_variant	5019	exon12			AAGAATAGTAACT	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1116T>C	5.37:g.41794835A>G		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	4.0	NM_000436	B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	37	CCDS3937.1																																																																																			.		0.398	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436	
PAK3	5063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	110439078	110439078	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:110439078A>T	ENST00000372010.1	+	16	1606	c.1164A>T	c.(1162-1164)caA>caT	p.Q388H	PAK3_ENST00000425146.1_Missense_Mutation_p.Q373H|PAK3_ENST00000372007.5_Missense_Mutation_p.Q373H|PAK3_ENST00000262836.4_Missense_Mutation_p.Q388H|PAK3_ENST00000518291.1_Missense_Mutation_p.Q409H|PAK3_ENST00000360648.4_Missense_Mutation_p.Q409H|PAK3_ENST00000446737.1_Missense_Mutation_p.Q373H|PAK3_ENST00000417227.1_Missense_Mutation_p.Q394H|PAK3_ENST00000519681.1_Missense_Mutation_p.Q394H			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	388	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						AGTGCCTGCAAGCTTTGGATT	0.318										TSP Lung(19;0.15)																											p.Q409H		.											.	PAK3	1043	0			c.A1227T						.						106.0	103.0	104.0					X																	110439078		2203	4300	6503	SO:0001583	missense	5063	exon13			CCTGCAAGCTTTG	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1164A>T	X.37:g.110439078A>T	ENSP00000361080:p.Gln388His	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	49.0	NM_001128168	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	37	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.472376	0.63737	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.15	3.96	0.45880	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	L	0.35723	1.085	0.80722	D	1	D;P;D;P;D	0.58268	0.978;0.901;0.982;0.901;0.982	P;P;P;P;P	0.62491	0.843;0.56;0.903;0.69;0.903	T	0.70332	-0.4901	10	0.51188	T	0.08	.	10.6458	0.45619	0.9195:0.0:0.0805:0.0	.	394;409;388;373;388	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	H	373;373;388;394;373;409;409;394;388	ENSP00000410853:Q373H;ENSP00000401982:Q373H;ENSP00000361080:Q388H;ENSP00000429113:Q394H;ENSP00000361077:Q373H;ENSP00000428921:Q409H;ENSP00000353864:Q409H;ENSP00000389172:Q394H;ENSP00000262836:Q388H	ENSP00000262836:Q388H	Q	+	3	2	PAK3	110325734	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.052000	0.57420	1.823000	0.53134	0.486000	0.48141	CAA	.		0.318	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
PAQR5	54852	hgsc.bcm.edu;bcgsc.ca	37	15	69672244	69672244	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:69672244T>C	ENST00000340965.3	+	4	742	c.74T>C	c.(73-75)cTg>cCg	p.L25P	PAQR5_ENST00000561153.1_Missense_Mutation_p.L25P|PAQR5_ENST00000395407.2_Missense_Mutation_p.L25P|PAQR5_ENST00000561027.1_3'UTR	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	25					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						CAAGGCATCCTGTTCGGCTAC	0.537																																					p.L25P		.											.	PAQR5	70	0			c.T74C						.						266.0	240.0	249.0					15																	69672244		2200	4298	6498	SO:0001583	missense	54852	exon4			GCATCCTGTTCGG		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.74T>C	15.37:g.69672244T>C	ENSP00000343877:p.Leu25Pro	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_001104554	Q8IXU2	Missense_Mutation	SNP	ENST00000340965.3	37	CCDS10232.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.723899	0.89298	.	.	ENSG00000137819	ENST00000395407;ENST00000340965	T;T	0.29917	1.55;1.55	5.68	5.68	0.88126	.	0.052632	0.64402	D	0.000001	T	0.49029	0.1533	M	0.66939	2.045	0.80722	D	1	D	0.60160	0.987	P	0.58266	0.836	T	0.50906	-0.8772	10	0.62326	D	0.03	0.0445	13.865	0.63583	0.0:0.0:0.0:1.0	.	25	Q9NXK6	MPRG_HUMAN	P	25	ENSP00000378803:L25P;ENSP00000343877:L25P	ENSP00000343877:L25P	L	+	2	0	PAQR5	67459298	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.625000	0.83145	2.152000	0.67230	0.533000	0.62120	CTG	.		0.537	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416671.1	NM_017705	
PCDHB14	56122	hgsc.bcm.edu;broad.mit.edu	37	5	140605206	140605206	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:140605206C>T	ENST00000239449.4	+	1	2129	c.2129C>T	c.(2128-2130)gCg>gTg	p.A710V	PCDHB14_ENST00000515856.2_Missense_Mutation_p.A557V	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	710					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A710V(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTGGCGGTGCGGCTG	0.706																																					p.A710V	Ovarian(141;50 1831 27899 33809 37648)	.											.	PCDHB14	91	1	Substitution - Missense(1)	prostate(1)	c.C2129T						.						69.0	84.0	79.0					5																	140605206		2180	4234	6414	SO:0001583	missense	56122	exon1			TCGTGGCGGTGCG	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2129C>T	5.37:g.140605206C>T	ENSP00000239449:p.Ala710Val	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	37	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	15.77	2.930353	0.52866	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.15603	2.41;2.41	4.36	0.0913	0.14467	.	.	.	.	.	T	0.25344	0.0616	M	0.91561	3.22	0.09310	N	1	B	0.22541	0.071	B	0.17722	0.019	T	0.26189	-1.0110	9	0.45353	T	0.12	.	6.8613	0.24067	0.0:0.5331:0.2524:0.2145	.	710	Q9Y5E9	PCDBE_HUMAN	V	557;710	ENSP00000444518:A557V;ENSP00000239449:A710V	ENSP00000239449:A710V	A	+	2	0	PCDHB14	140585390	0.000000	0.05858	0.066000	0.19879	0.362000	0.29581	-0.294000	0.08309	0.027000	0.15297	-0.181000	0.13052	GCG	.		0.706	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
PDE10A	10846	hgsc.bcm.edu;bcgsc.ca	37	6	165863852	165863852	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:165863852T>C	ENST00000366882.1	-	5	350		c.e5-2		PDE10A_ENST00000539869.2_Splice_Site|PDE10A_ENST00000354448.4_Splice_Site			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	ATCTTGGTACTTTGGATTAAA	0.299																																					.	Esophageal Squamous(22;308 615 5753 12038 40624)	.											.	PDE10A	519	0			c.226-2A>G						.						92.0	85.0	88.0					6																	165863852		2203	4300	6503	SO:0001630	splice_region_variant	10846	exon5			TGGTACTTTGGAT	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.196-2A>G	6.37:g.165863852T>C		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	5.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Splice_Site	SNP	ENST00000366882.1	37		.	.	.	.	.	.	.	.	.	.	T	17.44	3.391248	0.62066	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3089	0.66403	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDE10A	165783842	1.000000	0.71417	0.711000	0.30485	0.532000	0.34746	7.708000	0.84633	1.843000	0.53566	0.460000	0.39030	.	.		0.299	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		Intron
PDE7A	5150	hgsc.bcm.edu;bcgsc.ca	37	8	66636575	66636575	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:66636575T>C	ENST00000401827.3	-	11	1520	c.1077A>G	c.(1075-1077)aaA>aaG	p.K359K	PDE7A_ENST00000379419.4_Silent_p.K333K|PDE7A_ENST00000518667.1_5'Flank|PDE7A_ENST00000396642.3_Silent_p.K359K	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	359	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	TATCAGCACATTTCAAAGCCA	0.363																																					p.K359K		.											.	PDE7A	90	0			c.A1077G						.						118.0	108.0	112.0					8																	66636575		2203	4300	6503	SO:0001819	synonymous_variant	5150	exon11			AGCACATTTCAAA	L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.1077A>G	8.37:g.66636575T>C		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	4.0	NM_001242318	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Silent	SNP	ENST00000401827.3	37	CCDS56538.1																																																																																			.		0.363	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378905.1		
PGM3	5238	hgsc.bcm.edu;bcgsc.ca	37	6	83889643	83889643	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:83889643T>C	ENST00000283977.4	-	6	714	c.588A>G	c.(586-588)ggA>ggG	p.G196G	PGM3_ENST00000506587.1_Silent_p.G305G|PGM3_ENST00000512866.1_Silent_p.G277G|PGM3_ENST00000513973.1_Silent_p.G277G					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		TGTCTGCATCTCCATCAAAAG	0.343																																					p.G305G		.											.	PGM3	90	0			c.A915G						.						147.0	124.0	132.0					6																	83889643		2203	4300	6503	SO:0001819	synonymous_variant	5238	exon8			TGCATCTCCATCA	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.588A>G	6.37:g.83889643T>C		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	5.0	NM_001199917		Silent	SNP	ENST00000283977.4	37																																																																																				.		0.343	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
PHYH	5264	hgsc.bcm.edu;bcgsc.ca	37	10	13333891	13333891	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:13333891A>G	ENST00000263038.4	-	5	494	c.436T>C	c.(436-438)Ttc>Ctc	p.F146L	PHYH_ENST00000396913.2_Missense_Mutation_p.F46L|PHYH_ENST00000396920.3_Missense_Mutation_p.F127L	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	146					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)			NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	GGTCCAGTGAAGCACTCCACA	0.338																																					p.F146L		.											.	PHYH	90	0			c.T436C						.						95.0	91.0	93.0					10																	13333891		2203	4300	6503	SO:0001583	missense	5264	exon5			CAGTGAAGCACTC		CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.436T>C	10.37:g.13333891A>G	ENSP00000263038:p.Phe146Leu	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	4.0	NM_006214	A8MTS8|B1ALH5	Missense_Mutation	SNP	ENST00000263038.4	37	CCDS7097.1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.319038	0.60524	.	.	ENSG00000107537	ENST00000396913;ENST00000263038;ENST00000396920;ENST00000453759;ENST00000479604	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.88097	0.6345	L	0.53561	1.675	0.80722	D	1	B;B	0.31581	0.175;0.329	B;P	0.51297	0.162;0.665	D	0.84332	0.0522	10	0.23891	T	0.37	-27.393	11.3912	0.49815	0.8647:0.0:0.0:0.1353	.	127;146	B1ALH6;O14832	.;PAHX_HUMAN	L	46;146;127;46;146	ENSP00000380121:F46L;ENSP00000263038:F146L;ENSP00000380126:F127L;ENSP00000412525:F46L;ENSP00000420117:F146L	ENSP00000263038:F146L	F	-	1	0	PHYH	13373897	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.182000	0.77689	2.145000	0.66743	0.533000	0.62120	TTC	.		0.338	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046845.2		
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu	37	7	47849144	47849144	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:47849144A>G	ENST00000289672.2	-	51	7663	c.7613T>C	c.(7612-7614)cTc>cCc	p.L2538P	C7orf69_ENST00000418326.2_Intron|PKD1L1_ENST00000462350.1_5'UTR|C7orf69_ENST00000258776.4_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2538					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TTGAACACAGAGGTGGATCAG	0.458																																					p.L2538P		.											.	PKD1L1	145	0			c.T7613C						.						56.0	50.0	52.0					7																	47849144		2203	4300	6503	SO:0001583	missense	168507	exon51			ACACAGAGGTGGA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7613T>C	7.37:g.47849144A>G	ENSP00000289672:p.Leu2538Pro	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	5.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	A	10.82	1.459366	0.26248	.	.	ENSG00000158683	ENST00000289672	T	0.71461	-0.57	5.19	4.03	0.46877	Polycystin cation channel, PKD1/PKD2 (1);	0.232977	0.26840	N	0.022235	T	0.76695	0.4023	L	0.50333	1.59	0.50632	D	0.999881	D	0.76494	0.999	D	0.77004	0.989	T	0.75575	-0.3270	10	0.66056	D	0.02	-12.1737	6.8389	0.23951	0.8166:0.0:0.1834:0.0	.	2538	Q8TDX9	PK1L1_HUMAN	P	2538	ENSP00000289672:L2538P	ENSP00000289672:L2538P	L	-	2	0	PKD1L1	47815669	0.102000	0.21896	0.011000	0.14972	0.021000	0.10359	2.223000	0.42936	0.812000	0.34326	0.460000	0.39030	CTC	.		0.458	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PKN3	29941	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	9	131469012	131469012	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:131469012T>C	ENST00000291906.4	+	4	825	c.432T>C	c.(430-432)gcT>gcC	p.A144A		NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	144					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TCCTGGCAGCTGCCCAGCAGA	0.657																																					p.A144A		.											.	PKN3	521	0			c.T432C						.						10.0	12.0	11.0					9																	131469012		2191	4280	6471	SO:0001819	synonymous_variant	29941	exon4			GGCAGCTGCCCAG	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.432T>C	9.37:g.131469012T>C		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	5.0	NM_013355	Q9UM03	Silent	SNP	ENST00000291906.4	37	CCDS6908.1																																																																																			.		0.657	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
PPARGC1A	10891	hgsc.bcm.edu;bcgsc.ca	37	4	23816124	23816124	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:23816124A>G	ENST00000264867.2	-	8	1101	c.982T>C	c.(982-984)Tca>Cca	p.S328P	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	328	Interaction with PPARG.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				GGCTTCTTTGATGGTGGTGGC	0.502																																					p.S328P	Esophageal Squamous(29;694 744 13796 34866 44181)	.											.	PPARGC1A	230	0			c.T982C						.						129.0	132.0	131.0					4																	23816124		2203	4300	6503	SO:0001583	missense	10891	exon8			TCTTTGATGGTGG	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.982T>C	4.37:g.23816124A>G	ENSP00000264867:p.Ser328Pro	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_013261	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	37	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.388839	0.25118	.	.	ENSG00000109819	ENST00000264867	T	0.26957	1.7	6.06	2.11	0.27256	.	0.444709	0.24156	N	0.041025	T	0.11707	0.0285	N	0.13003	0.285	0.80722	D	1	P	0.48764	0.915	B	0.37650	0.255	T	0.10613	-1.0622	10	0.36615	T	0.2	-0.055	7.3728	0.26810	0.5074:0.1224:0.0:0.3702	.	328	Q9UBK2	PRGC1_HUMAN	P	328	ENSP00000264867:S328P	ENSP00000264867:S328P	S	-	1	0	PPARGC1A	23425222	0.972000	0.33761	0.581000	0.28614	0.915000	0.54546	1.094000	0.30951	0.126000	0.18424	-0.336000	0.08194	TCA	.		0.502	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	
POU4F2	5458	hgsc.bcm.edu;bcgsc.ca	37	4	147561644	147561644	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:147561644T>C	ENST00000281321.3	+	2	1162	c.914T>C	c.(913-915)cTc>cCc	p.L305P	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	305	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					TTCGAGTCCCTCACACTGTCC	0.617																																					p.L305P		.											.	POU4F2	135	0			c.T914C						.						76.0	77.0	76.0					4																	147561644		2203	4300	6503	SO:0001583	missense	5458	exon2			AGTCCCTCACACT	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.914T>C	4.37:g.147561644T>C	ENSP00000281321:p.Leu305Pro	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	4.0	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	37	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.472386	0.63737	.	.	ENSG00000151615	ENST00000281321	D	0.86865	-2.18	5.37	5.37	0.77165	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.94925	0.8359	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96064	0.9041	10	0.87932	D	0	.	15.3779	0.74625	0.0:0.0:0.0:1.0	.	305	Q12837	PO4F2_HUMAN	P	305	ENSP00000281321:L305P	ENSP00000281321:L305P	L	+	2	0	POU4F2	147781094	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.018000	0.88722	2.045000	0.60652	0.459000	0.35465	CTC	.		0.617	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
PPIP5K2	23262	hgsc.bcm.edu;bcgsc.ca	37	5	102490644	102490644	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:102490644A>G	ENST00000358359.3	+	13	1909	c.1400A>G	c.(1399-1401)gAg>gGg	p.E467G	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.E467G|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.E467G	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	467					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						ACTGTATTAGAGATGTGAGTA	0.323																																					p.E467G		.											.	PPIP5K2	92	0			c.A1400G						.						72.0	72.0	72.0					5																	102490644		2203	4298	6501	SO:0001583	missense	23262	exon12			TATTAGAGATGTG	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.1400A>G	5.37:g.102490644A>G	ENSP00000351126:p.Glu467Gly	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	4.0	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	37		.	.	.	.	.	.	.	.	.	.	A	25.6	4.657462	0.88154	.	.	ENSG00000145725	ENST00000321521;ENST00000507921;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T;T	0.36520	1.25;1.25;1.25;1.25	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000003	T	0.63616	0.2526	M	0.82823	2.61	0.80722	D	1	D;P;D	0.89917	1.0;0.684;1.0	D;P;D	0.91635	0.995;0.703;0.999	T	0.70193	-0.4939	10	0.87932	D	0	-15.3301	15.1899	0.73035	1.0:0.0:0.0:0.0	.	389;467;467	D6RBU4;O43314-2;O43314	.;.;VIP2_HUMAN	G	467;389;467;467;467	ENSP00000313070:E467G;ENSP00000422525:E389G;ENSP00000351126:E467G;ENSP00000416016:E467G	ENSP00000313070:E467G	E	+	2	0	PPIP5K2	102518543	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.243000	0.95416	2.040000	0.60383	0.533000	0.62120	GAG	.		0.323	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
PPP1R12A	4659	hgsc.bcm.edu;bcgsc.ca	37	12	80191131	80191131	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:80191131T>C	ENST00000450142.2	-	16	2402	c.2136A>G	c.(2134-2136)ggA>ggG	p.G712G	PPP1R12A_ENST00000550107.1_Silent_p.G656G|PPP1R12A_ENST00000261207.5_Silent_p.G712G|PPP1R12A_ENST00000437004.2_Silent_p.G712G|PPP1R12A_ENST00000546369.1_Silent_p.G625G	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	712	Interaction with ROCK2.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						AACGACTTCTTCCTATTGTTT	0.343																																					p.G712G		.											.	PPP1R12A	273	0			c.A2136G						.						82.0	68.0	72.0					12																	80191131		1826	4083	5909	SO:0001819	synonymous_variant	4659	exon16			ACTTCTTCCTATT	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.2136A>G	12.37:g.80191131T>C		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	4.0	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Silent	SNP	ENST00000450142.2	37	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	T	9.648	1.140698	0.21205	.	.	ENSG00000058272	ENST00000553081	.	.	.	5.31	4.16	0.48862	.	.	.	.	.	T	0.47021	0.1423	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40664	-0.9551	4	.	.	.	.	3.2024	0.06653	0.1379:0.0752:0.1435:0.6435	.	.	.	.	G	304	.	.	E	-	2	0	PPP1R12A	78715262	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.393000	0.44442	0.850000	0.35239	0.482000	0.46254	GAA	.		0.343	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
PPP2R2C	5522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6377634	6377634	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:6377634A>T	ENST00000382599.4	-	4	575	c.359T>A	c.(358-360)aTt>aAt	p.I120N	PPP2R2C_ENST00000506140.1_Missense_Mutation_p.I113N|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.I103N|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.I120N|PPP2R2C_ENST00000314348.8_5'UTR|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.I113N			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	120					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						TCGTTCGGTAATCTTCCATAA	0.428																																					p.I120N		.											.	PPP2R2C	1084	0			c.T359A						.						118.0	119.0	119.0					4																	6377634		2203	4300	6503	SO:0001583	missense	5522	exon4			TCGGTAATCTTCC	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.359T>A	4.37:g.6377634A>T	ENSP00000372042:p.Ile120Asn	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	190.0	92.0	NM_181876	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	37		.	.	.	.	.	.	.	.	.	.	A	22.9	4.343812	0.82022	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	4.32	4.32	0.51571	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.182769	0.48767	D	0.000167	T	0.54415	0.1857	M	0.75447	2.3	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.87578	0.996;0.998;0.993;0.993;0.993	T	0.60239	-0.7302	10	0.87932	D	0	-24.9874	13.1313	0.59385	1.0:0.0:0.0:0.0	.	113;216;120;103;120	B7Z3Y1;Q59GC6;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;.;2ABG_HUMAN;.;.	N	120;113;103;120;113	ENSP00000335083:I120N;ENSP00000423649:I113N;ENSP00000422374:I103N;ENSP00000372042:I120N;ENSP00000425247:I113N	ENSP00000335083:I120N	I	-	2	0	PPP2R2C	6428535	1.000000	0.71417	0.911000	0.35937	0.984000	0.73092	8.404000	0.90210	1.937000	0.56155	0.459000	0.35465	ATT	.		0.428	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
PPP3CC	5533	hgsc.bcm.edu;bcgsc.ca	37	8	22333119	22333119	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:22333119A>G	ENST00000240139.5	+	3	681	c.354A>G	c.(352-354)agA>agG	p.R118R	PPP3CC_ENST00000518852.1_Silent_p.R118R|PPP3CC_ENST00000289963.8_Silent_p.R118R|PPP3CC_ENST00000397775.3_Silent_p.R118R	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	118					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		ATGTGGACAGAGGCTATTTCA	0.343																																					p.R118R		.											.	PPP3CC	227	0			c.A354G						.						99.0	94.0	95.0					8																	22333119		2202	4300	6502	SO:0001819	synonymous_variant	5533	exon3			GGACAGAGGCTAT		CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.354A>G	8.37:g.22333119A>G		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	4.0	NM_001243974	B4DRT5|Q9BSS6|Q9H4M5	Silent	SNP	ENST00000240139.5	37	CCDS34859.1																																																																																			.		0.343	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375652.1	NM_005605	
PRKD2	25865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	47207810	47207810	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:47207810C>G	ENST00000291281.4	-	4	833	c.608G>C	c.(607-609)aGt>aCt	p.S203T	PRKD2_ENST00000600194.1_Missense_Mutation_p.S46T|PRKD2_ENST00000433867.1_Missense_Mutation_p.S203T|PRKD2_ENST00000601806.1_Missense_Mutation_p.S46T|PRKD2_ENST00000595515.1_Missense_Mutation_p.S203T			Q9BZL6	KPCD2_HUMAN	protein kinase D2	203					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CGAGTGGCCACTGGCCAGAGA	0.662											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S203T		.											.	PRKD2	759	0			c.G608C						.						36.0	40.0	39.0					19																	47207810		2203	4300	6503	SO:0001583	missense	25865	exon4			TGGCCACTGGCCA	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.608G>C	19.37:g.47207810C>G	ENSP00000291281:p.Ser203Thr	Somatic	106.0	0.0	945	WXS	Illumina HiSeq	Phase_I	100.0	26.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	37	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	9.805	1.181466	0.21787	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.66280	-0.2;-0.2	5.26	5.26	0.73747	.	0.122405	0.51477	D	0.000092	T	0.48077	0.1480	L	0.36672	1.1	0.42933	D	0.994321	B;B	0.31931	0.024;0.347	B;B	0.30716	0.027;0.119	T	0.41963	-0.9479	10	0.12103	T	0.63	-21.2032	11.8621	0.52471	0.0:0.9147:0.0:0.0853	.	203;203	E7ER94;Q9BZL6	.;KPCD2_HUMAN	T	203	ENSP00000291281:S203T;ENSP00000393978:S203T	ENSP00000291281:S203T	S	-	2	0	PRKD2	51899650	0.999000	0.42202	1.000000	0.80357	0.302000	0.27658	2.251000	0.43187	2.447000	0.82792	0.313000	0.20887	AGT	.		0.662	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
PSMD1	5707	hgsc.bcm.edu;bcgsc.ca	37	2	232028362	232028362	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:232028362A>G	ENST00000308696.6	+	21	2564	c.2402A>G	c.(2401-2403)cAg>cGg	p.Q801R	PSMD1_ENST00000409643.1_Intron|PSMD1_ENST00000373635.4_Intron	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	801					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CCGAAAGTTCAGTATAAATCG	0.373																																					p.Q801R		.											.	PSMD1	92	0			c.A2402G						.						110.0	108.0	109.0					2																	232028362		2203	4300	6503	SO:0001583	missense	5707	exon21			AAGTTCAGTATAA	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.2402A>G	2.37:g.232028362A>G	ENSP00000309474:p.Gln801Arg	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	4.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	37	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297464	0.60086	.	.	ENSG00000173692	ENST00000308696	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.55305	0.1912	L	0.42686	1.345	0.80722	D	1	B	0.22211	0.066	B	0.22753	0.041	T	0.54589	-0.8271	9	0.44086	T	0.13	-12.0276	14.5377	0.67973	1.0:0.0:0.0:0.0	.	801	Q99460	PSMD1_HUMAN	R	801	.	ENSP00000309474:Q801R	Q	+	2	0	PSMD1	231736606	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.139000	0.94554	2.002000	0.58637	0.454000	0.30748	CAG	.		0.373	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
PTCHD1	139411	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	23411906	23411906	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:23411906A>T	ENST00000379361.4	+	3	3131	c.2271A>T	c.(2269-2271)ttA>ttT	p.L757F		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	757					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TGCTATGCTTAATTTATGGAA	0.388																																					p.L757F		.											.	PTCHD1	135	0			c.A2271T						.						141.0	124.0	130.0					X																	23411906		2203	4300	6503	SO:0001583	missense	139411	exon3			ATGCTTAATTTAT	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2271A>T	X.37:g.23411906A>T	ENSP00000368666:p.Leu757Phe	Somatic	69.0	1.0		WXS	Illumina HiSeq	Phase_I	86.0	75.0	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	37	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	A	13.56	2.273814	0.40194	.	.	ENSG00000165186	ENST00000379361	D	0.86432	-2.12	5.18	2.81	0.32909	.	0.000000	0.64402	D	0.000001	D	0.88775	0.6528	L	0.54323	1.7	0.44454	D	0.997383	D	0.65815	0.995	D	0.69654	0.965	D	0.86178	0.1604	10	0.66056	D	0.02	.	4.1649	0.10301	0.6128:0.0:0.2412:0.146	.	757	Q96NR3	PTHD1_HUMAN	F	757	ENSP00000368666:L757F	ENSP00000368666:L757F	L	+	3	2	PTCHD1	23321827	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.391000	0.52530	0.631000	0.30412	0.425000	0.28330	TTA	.		0.388	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
PTPRG	5793	hgsc.bcm.edu;bcgsc.ca	37	3	62180755	62180755	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:62180755T>C	ENST00000474889.1	+	10	1615	c.1238T>C	c.(1237-1239)gTc>gCc	p.V413A	PTPRG_ENST00000295874.10_Missense_Mutation_p.V413A	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	413	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		ATTAGCCATGTCTCACCCGAT	0.502																																					p.V413A		.											.	PTPRG	419	0			c.T1238C						.						149.0	135.0	139.0					3																	62180755		2203	4300	6503	SO:0001583	missense	5793	exon10			GCCATGTCTCACC	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1238T>C	3.37:g.62180755T>C	ENSP00000418112:p.Val413Ala	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	6.0	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	37	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.850405	0.71719	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.57436	0.4;0.4	5.81	5.81	0.92471	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.120930	0.56097	D	0.000031	T	0.51381	0.1671	L	0.32530	0.975	0.58432	D	0.999999	P;P	0.38597	0.604;0.639	B;B	0.44085	0.183;0.44	T	0.55860	-0.8074	10	0.87932	D	0	.	16.155	0.81657	0.0:0.0:0.0:1.0	.	413;413	P23470-2;P23470	.;PTPRG_HUMAN	A	413	ENSP00000418112:V413A;ENSP00000295874:V413A	ENSP00000295874:V413A	V	+	2	0	PTPRG	62155795	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	7.541000	0.82084	2.221000	0.72209	0.533000	0.62120	GTC	.		0.502	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
PTPRK	5796	hgsc.bcm.edu;bcgsc.ca	37	6	128388889	128388889	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:128388889T>C	ENST00000368215.3	-	12	1931	c.1932A>G	c.(1930-1932)agA>agG	p.R644R	PTPRK_ENST00000368207.3_Silent_p.R644R|PTPRK_ENST00000368226.4_Silent_p.R644R|PTPRK_ENST00000524481.1_5'UTR|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000532331.1_Silent_p.R644R|PTPRK_ENST00000368213.5_Silent_p.R644R|PTPRK_ENST00000368210.3_Silent_p.R644R|PTPRK_ENST00000368227.3_Silent_p.R644R			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	644	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.	Cleavage. {ECO:0000305}.			cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CTCCGGCTTCTCTCTTGGTTC	0.463																																					p.R644R		.											.	PTPRK	231	0			c.A1932G						.						74.0	79.0	78.0					6																	128388889		2203	4300	6503	SO:0001819	synonymous_variant	5796	exon12			GGCTTCTCTCTTG	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1932A>G	6.37:g.128388889T>C		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	ENST00000368215.3	37																																																																																				.		0.463	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
PZP	5858	hgsc.bcm.edu;bcgsc.ca	37	12	9334596	9334596	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:9334596T>C	ENST00000261336.2	-	14	1692	c.1664A>G	c.(1663-1665)gAg>gGg	p.E555G	PZP_ENST00000381997.2_Missense_Mutation_p.E424G	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	555					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S420_E426delSEKFEIE(1)|p.S551_E557delSEKFEIE(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GTTTTCAATCTCAAATTTTTC	0.388																																					p.E555G	Melanoma(125;1402 1695 4685 34487 38571)	.											.	PZP	157	2	Deletion - In frame(2)	prostate(2)	c.A1664G						.						55.0	57.0	57.0					12																	9334596		2203	4300	6503	SO:0001583	missense	5858	exon14			TCAATCTCAAATT	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1664A>G	12.37:g.9334596T>C	ENSP00000261336:p.Glu555Gly	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	6.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	37	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	11.04	1.522000	0.27211	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.64438	-0.1;-0.1	3.94	2.68	0.31781	Alpha-2-macroglobulin, N-terminal 2 (1);	0.302961	0.26207	U	0.025715	T	0.68979	0.3060	M	0.86805	2.84	0.09310	N	1	P;P	0.45768	0.866;0.866	P;P	0.48598	0.583;0.507	T	0.62859	-0.6765	10	0.54805	T	0.06	.	7.6612	0.28404	0.0:0.0:0.2127:0.7873	.	424;555	P20742-2;P20742	.;PZP_HUMAN	G	555;424	ENSP00000261336:E555G;ENSP00000371427:E424G	ENSP00000261336:E555G	E	-	2	0	PZP	9225863	0.302000	0.24454	0.109000	0.21407	0.020000	0.10135	3.846000	0.55888	1.580000	0.49851	0.383000	0.25322	GAG	.		0.388	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
QSOX1	5768	hgsc.bcm.edu;bcgsc.ca	37	1	180163522	180163522	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:180163522T>C	ENST00000367602.3	+	11	1537	c.1463T>C	c.(1462-1464)cTt>cCt	p.L488P	QSOX1_ENST00000367600.5_Missense_Mutation_p.L488P			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	488	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						AATGCTCGCCTTGCAGGTAAG	0.597																																					p.L488P		.											.	QSOX1	91	0			c.T1463C						.						63.0	52.0	56.0					1																	180163522		2203	4300	6503	SO:0001583	missense	5768	exon11			CTCGCCTTGCAGG	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1463T>C	1.37:g.180163522T>C	ENSP00000356574:p.Leu488Pro	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	5.0	NM_002826	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	37	CCDS1337.1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.994310	0.54041	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.71103	-0.54;-0.54	4.75	4.75	0.60458	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	0.073163	0.56097	D	0.000022	D	0.86932	0.6052	M	0.93106	3.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.986;1.0	D	0.89955	0.4082	10	0.87932	D	0	-25.514	13.2551	0.60074	0.0:0.0:0.0:1.0	.	488;488;488;488	A8K4C2;A8K477;O00391;O00391-2	.;.;QSOX1_HUMAN;.	P	488	ENSP00000356574:L488P;ENSP00000356572:L488P	ENSP00000356572:L488P	L	+	2	0	QSOX1	178430145	1.000000	0.71417	1.000000	0.80357	0.135000	0.20990	7.322000	0.79097	1.786000	0.52430	0.379000	0.24179	CTT	.		0.597	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826	
R3HCC1L	27291	hgsc.bcm.edu;bcgsc.ca	37	10	99991351	99991351	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:99991351T>C	ENST00000298999.3	+	6	2171	c.1868T>C	c.(1867-1869)cTc>cCc	p.L623P	R3HCC1L_ENST00000370586.2_Missense_Mutation_p.L29P|R3HCC1L_ENST00000314594.5_Missense_Mutation_p.L39P|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.L623P	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	637							nucleotide binding (GO:0000166)										GATATTGACCTCAGTGATTGT	0.398																																					p.L637P		.											.	.	.	0			c.T1910C						.						127.0	119.0	122.0					10																	99991351		2203	4300	6503	SO:0001583	missense	27291	exon7			TTGACCTCAGTGA	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1868T>C	10.37:g.99991351T>C	ENSP00000298999:p.Leu623Pro	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	5.0	NM_001256619	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	37	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341703	0.81911	.	.	ENSG00000166024	ENST00000370584;ENST00000298999;ENST00000370586;ENST00000314594;ENST00000544834	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.83	5.83	0.93111	.	0.065933	0.64402	D	0.000014	T	0.61375	0.2342	M	0.77820	2.39	0.80722	D	1	P;D;P	0.89917	0.937;1.0;0.708	P;D;B	0.80764	0.735;0.994;0.383	T	0.63625	-0.6595	9	.	.	.	-5.5482	15.1559	0.72743	0.0:0.0:0.0:1.0	.	29;637;623	Q7Z5L2-3;Q7Z5L2;Q7Z5L2-2	.;GIDRP_HUMAN;.	P	623;623;29;39;30	ENSP00000359616:L623P;ENSP00000298999:L623P;ENSP00000359618:L29P;ENSP00000314018:L39P	.	L	+	2	0	C10orf28	99981341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.328000	0.72915	2.214000	0.71695	0.533000	0.62120	CTC	.		0.398	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472	
RAD21	5885	hgsc.bcm.edu;bcgsc.ca	37	8	117870690	117870690	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:117870690C>A	ENST00000297338.2	-	5	669	c.382G>T	c.(382-384)Gat>Tat	p.D128Y	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	128					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TGGGCCACATCGATGTCACTT	0.318																																					p.D128Y		.											.	RAD21	227	0			c.G382T						.						120.0	116.0	117.0					8																	117870690		2203	4300	6503	SO:0001583	missense	5885	exon5			CCACATCGATGTC	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.382G>T	8.37:g.117870690C>A	ENSP00000297338:p.Asp128Tyr	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	4.0	NM_006265	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	37	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.844976	0.91197	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485	T;T;T	0.59772	0.24;1.32;1.32	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.79197	0.4405	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75830	-0.3179	10	0.26408	T	0.33	-0.1517	19.9542	0.97213	0.0:1.0:0.0:0.0	.	128	O60216	RAD21_HUMAN	Y	128	ENSP00000297338:D128Y;ENSP00000429342:D128Y;ENSP00000427923:D128Y	ENSP00000297338:D128Y	D	-	1	0	RAD21	117939871	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.728000	0.93425	0.650000	0.86243	GAT	.		0.318	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
RANBP9	10048	ucsc.edu;bcgsc.ca	37	6	13642747	13642747	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:13642747C>T	ENST00000011619.3	-	7	1247	c.1189G>A	c.(1189-1191)Gtt>Att	p.V397I	RANBP9_ENST00000539980.1_Missense_Mutation_p.V168I	NM_005493.2	NP_005484.2	Q96S59	RANB9_HUMAN	RAN binding protein 9	397	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.				axon guidance (GO:0007411)|microtubule nucleation (GO:0007020)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	16	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			TCTTCTAGAACGGTCTGGTCT	0.363																																					p.V397I		.											.	RANBP9	414	0			c.G1189A						.						100.0	94.0	96.0					6																	13642747		2203	4300	6503	SO:0001583	missense	10048	exon7			CTAGAACGGTCTG	AB008515	CCDS4529.1	6p23	2010-05-25			ENSG00000010017	ENSG00000010017			13727	protein-coding gene	gene with protein product	"""Ran Binding Protein in the Microtubule organizing center"""	603854				9817760	Standard	NM_005493		Approved	RanBPM	uc003nbb.3	Q96S59	OTTHUMG00000015642	ENST00000011619.3:c.1189G>A	6.37:g.13642747C>T	ENSP00000011619:p.Val397Ile	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_005493	A0PJA2|B2R8E1|O94764|Q6P3T7|Q7LBR2|Q7Z7F9	Missense_Mutation	SNP	ENST00000011619.3	37	CCDS4529.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.949787	0.34377	.	.	ENSG00000010017	ENST00000011619;ENST00000539980	T	0.76839	-1.05	5.75	4.87	0.63330	LisH dimerisation motif (2);	0.000000	0.85682	D	0.000000	T	0.34106	0.0886	N	0.04043	-0.29	0.58432	D	0.999994	P	0.47762	0.9	B	0.29716	0.106	T	0.50825	-0.8782	10	0.14656	T	0.56	-7.9464	15.1692	0.72858	0.0:0.9308:0.0:0.0692	.	397	Q96S59	RANB9_HUMAN	I	397;168	ENSP00000011619:V397I	ENSP00000011619:V397I	V	-	1	0	RANBP9	13750726	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.445000	0.80570	2.708000	0.92522	0.563000	0.77884	GTT	.		0.363	RANBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042373.1		
RBL2	5934	hgsc.bcm.edu;bcgsc.ca	37	16	53513864	53513864	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:53513864A>G	ENST00000262133.6	+	19	2979	c.2842A>G	c.(2842-2844)Agc>Ggc	p.S948G	RBL2_ENST00000544545.1_Intron|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	948	Domain B.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TGATAGCAGAAGCCATCAGAA	0.353																																					p.S948G		.											.	RBL2	841	0			c.A2842G						.						69.0	72.0	71.0					16																	53513864		2198	4300	6498	SO:0001583	missense	5934	exon19			AGCAGAAGCCATC	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2842A>G	16.37:g.53513864A>G	ENSP00000262133:p.Ser948Gly	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	4.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	A	12.81	2.048109	0.36085	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.90197	-2.63	5.59	5.59	0.84812	Retinoblastoma-associated protein, B-box (1);Cyclin-like (1);	0.148202	0.64402	D	0.000012	D	0.84800	0.5552	L	0.34521	1.04	0.80722	D	1	P;B	0.39424	0.673;0.126	B;B	0.37550	0.253;0.096	D	0.84786	0.0776	10	0.46703	T	0.11	-15.5902	10.8547	0.46792	0.8421:0.1579:0.0:0.0	.	658;948	E9PG04;Q08999	.;RBL2_HUMAN	G	948;658	ENSP00000262133:S948G	ENSP00000262133:S948G	S	+	1	0	RBL2	52071365	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.954000	0.56708	2.126000	0.65437	0.528000	0.53228	AGC	.		0.353	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
RC3H2	54542	hgsc.bcm.edu;bcgsc.ca	37	9	125613389	125613389	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:125613389T>C	ENST00000373670.1	-	19	3951	c.3351A>G	c.(3349-3351)aaA>aaG	p.K1117K	RC3H2_ENST00000357244.2_Silent_p.K1117K			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	1117					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						CTAAACTCTGTTTCTTCTGCT	0.388																																					p.K1117K		.											.	RC3H2	523	0			c.A3351G						.						215.0	207.0	210.0					9																	125613389		1952	4149	6101	SO:0001819	synonymous_variant	54542	exon20			ACTCTGTTTCTTC	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.3351A>G	9.37:g.125613389T>C		Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	5.0	NM_001100588	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Silent	SNP	ENST00000373670.1	37	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	T	9.320	1.057854	0.19987	.	.	ENSG00000056586	ENST00000454740	.	.	.	5.89	3.58	0.41010	.	.	.	.	.	T	0.58308	0.2113	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51741	-0.8667	4	.	.	.	-27.7648	8.4184	0.32685	0.0:0.1514:0.0:0.8486	.	.	.	.	S	176	.	.	N	-	2	0	RC3H2	124653210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.517000	0.45529	0.502000	0.28037	0.533000	0.62120	AAC	.		0.388	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	
RGS6	9628	hgsc.bcm.edu;bcgsc.ca	37	14	72945005	72945005	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:72945005A>G	ENST00000553530.1	+	12	1029	c.822A>G	c.(820-822)agA>agG	p.R274R	RGS6_ENST00000554782.1_Silent_p.R135R|RGS6_ENST00000404301.2_Silent_p.R274R|RGS6_ENST00000556437.1_Silent_p.R274R|RGS6_ENST00000402788.2_Silent_p.R274R|RGS6_ENST00000355512.6_Silent_p.R274R|RGS6_ENST00000343854.6_Silent_p.R274R|RGS6_ENST00000406236.4_Silent_p.R274R|RGS6_ENST00000553525.1_Silent_p.R274R|RGS6_ENST00000555571.1_Silent_p.R274R|RGS6_ENST00000407322.4_Silent_p.R274R|RGS6_ENST00000434263.2_Silent_p.R205R	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	274	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		AGATCGACAGACATTGTTTGA	0.338																																					p.R274R	Ovarian(143;1926 2468 21071 48641)	.											.	RGS6	227	0			c.A822G						.						128.0	125.0	126.0					14																	72945005		2203	4299	6502	SO:0001819	synonymous_variant	9628	exon12			CGACAGACATTGT	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.822A>G	14.37:g.72945005A>G		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	4.0	NM_001204424	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Silent	SNP	ENST00000553530.1	37	CCDS9808.1																																																																																			.		0.338	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
RICTOR	253260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	38958582	38958582	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:38958582A>T	ENST00000357387.3	-	24	2413	c.2383T>A	c.(2383-2385)Tcc>Acc	p.S795T	RICTOR_ENST00000296782.5_Missense_Mutation_p.S795T|RICTOR_ENST00000503698.1_5'UTR	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CCAAGGTGGGATAACGCTGGT	0.318																																					p.S795T		.											.	RICTOR	849	0			c.T2383A						.						89.0	96.0	94.0					5																	38958582		2203	4300	6503	SO:0001583	missense	253260	exon24			GGTGGGATAACGC		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2383T>A	5.37:g.38958582A>T	ENSP00000349959:p.Ser795Thr	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	217.0	93.0	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	37	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	A	9.671	1.146620	0.21288	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.43294	0.95;0.95	5.11	5.11	0.69529	Armadillo-type fold (1);	0.051792	0.85682	D	0.000000	T	0.29389	0.0732	N	0.19112	0.55	0.49915	D	0.999835	B;B	0.11235	0.004;0.002	B;B	0.15052	0.012;0.005	T	0.10567	-1.0624	10	0.87932	D	0	-7.6383	11.249	0.49015	0.9254:0.0:0.0746:0.0	.	795;795	Q6R327;Q6R327-3	RICTR_HUMAN;.	T	795	ENSP00000349959:S795T;ENSP00000296782:S795T	ENSP00000296782:S795T	S	-	1	0	RICTOR	38994339	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	5.423000	0.66458	2.059000	0.61396	0.460000	0.39030	TCC	.		0.318	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
RNF17	56163	hgsc.bcm.edu;bcgsc.ca	37	13	25399863	25399863	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:25399863G>A	ENST00000255324.5	+	16	2250	c.2198G>A	c.(2197-2199)tGt>tAt	p.C733Y	RNF17_ENST00000381921.1_Missense_Mutation_p.C733Y	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	733	Tudor 1. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GATCAAGCCTGTGTAGCTAAA	0.368																																					p.C733Y		.											.	RNF17	228	0			c.G2198A						.						105.0	101.0	103.0					13																	25399863		2203	4300	6503	SO:0001583	missense	56163	exon16			AAGCCTGTGTAGC	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2198G>A	13.37:g.25399863G>A	ENSP00000255324:p.Cys733Tyr	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	4.0	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095649	0.56075	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.16743	2.32;2.32;2.32	4.69	4.69	0.59074	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.269718	0.36703	N	0.002453	T	0.42720	0.1215	M	0.77820	2.39	0.80722	D	1	D;P	0.76494	0.999;0.843	D;P	0.87578	0.998;0.682	T	0.32640	-0.9899	10	0.45353	T	0.12	.	14.9002	0.70672	0.0:0.0:1.0:0.0	.	733;733	B7Z7S1;Q9BXT8	.;RNF17_HUMAN	Y	733;733;592;57	ENSP00000255324:C733Y;ENSP00000371346:C733Y;ENSP00000388892:C57Y	ENSP00000255324:C733Y	C	+	2	0	RNF17	24297863	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	5.781000	0.68964	2.312000	0.78011	0.491000	0.48974	TGT	.		0.368	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
ROR1	4919	hgsc.bcm.edu;bcgsc.ca	37	1	64605903	64605903	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:64605903T>C	ENST00000371079.1	+	6	1097	c.722T>C	c.(721-723)gTc>gCc	p.V241A	ROR1_ENST00000371080.1_Missense_Mutation_p.V241A|ROR1_ENST00000545203.1_5'UTR|ROR1_ENST00000482426.1_3'UTR|RP11-24J23.2_ENST00000424995.1_RNA	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	241	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						ACTTCATCCGTCCCAAAGCCC	0.463																																					p.V241A		.											.	ROR1	1536	0			c.T722C						.						132.0	114.0	120.0					1																	64605903		2203	4300	6503	SO:0001583	missense	4919	exon6			CATCCGTCCCAAA	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.722T>C	1.37:g.64605903T>C	ENSP00000360120:p.Val241Ala	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	5.0	NM_001083592	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	37	CCDS626.1	.	.	.	.	.	.	.	.	.	.	T	0.026	-1.371417	0.01225	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.74737	-0.87;-0.87	5.92	1.09	0.20402	Frizzled domain (2);Kringle (1);	0.607504	0.13432	N	0.388367	T	0.19525	0.0469	N	0.02315	-0.6	0.21220	N	0.99975	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.38499	-0.9658	10	0.06625	T	0.88	.	10.2088	0.43128	0.0:0.349:0.0:0.651	.	241;241	Q01973;Q66K77	ROR1_HUMAN;.	A	241;241;244	ENSP00000360121:V241A;ENSP00000360120:V241A	ENSP00000360120:V241A	V	+	2	0	ROR1	64378491	0.000000	0.05858	0.159000	0.22649	0.484000	0.33280	0.379000	0.20585	-0.050000	0.13356	-0.263000	0.10527	GTC	.		0.463	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
RP1	6101	hgsc.bcm.edu;bcgsc.ca	37	8	55542178	55542178	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:55542178T>C	ENST00000220676.1	+	4	5884	c.5736T>C	c.(5734-5736)gcT>gcC	p.A1912A		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1912					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AACTGTATGCTCTTTGTGGTC	0.388																																					p.A1912A	Colon(91;1014 1389 7634 14542 40420)	.											.	RP1	102	0			c.T5736C						.						93.0	92.0	93.0					8																	55542178		2203	4300	6503	SO:0001819	synonymous_variant	6101	exon4			GTATGCTCTTTGT	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5736T>C	8.37:g.55542178T>C		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	4.0	NM_006269		Silent	SNP	ENST00000220676.1	37	CCDS6160.1																																																																																			.		0.388	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
RPS6KA6	27330	hgsc.bcm.edu;bcgsc.ca	37	X	83389804	83389804	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:83389804T>C	ENST00000262752.2	-	8	639	c.632A>G	c.(631-633)cAt>cGt	p.H211R	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.H211R	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	211	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TAATTTGATATGTCCTATTTC	0.229																																					p.H211R		.											.	RPS6KA6	615	0			c.A632G						.						33.0	33.0	33.0					X																	83389804		2177	4237	6414	SO:0001583	missense	27330	exon8			TTGATATGTCCTA	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.632A>G	X.37:g.83389804T>C	ENSP00000262752:p.His211Arg	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	4.0	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	37	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.507262	0.64410	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.64618	-0.11;-0.11	4.4	4.4	0.53042	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052055	0.85682	D	0.000000	T	0.62672	0.2447	L	0.52011	1.625	0.80722	D	1	P;P	0.38827	0.649;0.649	P;P	0.44422	0.449;0.449	T	0.67043	-0.5770	10	0.87932	D	0	.	13.0112	0.58731	0.0:0.0:0.0:1.0	.	211;211	B7ZL90;Q9UK32	.;KS6A6_HUMAN	R	211	ENSP00000262752:H211R;ENSP00000440830:H211R	ENSP00000262752:H211R	H	-	2	0	RPS6KA6	83276460	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.331000	0.79192	1.437000	0.47472	0.425000	0.28330	CAT	.		0.229	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
SDAD1	55153	hgsc.bcm.edu;bcgsc.ca	37	4	76882410	76882410	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:76882410T>C	ENST00000356260.5	-	15	1351	c.1233A>G	c.(1231-1233)gaA>gaG	p.E411E	SDAD1_ENST00000395711.4_Silent_p.E374E|SDAD1_ENST00000513089.1_5'UTR	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	411					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GGAGAAGTTCTTCAGTCATGG	0.383																																					p.E411E		.											.	SDAD1	91	0			c.A1233G						.						147.0	133.0	138.0					4																	76882410		2203	4300	6503	SO:0001819	synonymous_variant	55153	exon15			AAGTTCTTCAGTC	AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.1233A>G	4.37:g.76882410T>C		Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	4.0	NM_018115	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Silent	SNP	ENST00000356260.5	37	CCDS3573.2																																																																																			.		0.383	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252418.3	NM_018115	
SEPN1	57190	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	26139198	26139198	+	Silent	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:26139198T>A	ENST00000374315.1	+	9	1238	c.1200T>A	c.(1198-1200)acT>acA	p.T400T	SEPN1_ENST00000361547.2_Silent_p.T434T|SEPN1_ENST00000354177.4_Silent_p.T400T|RP1-317E23.6_ENST00000527604.1_5'Flank	NM_206926.1	NP_996809.1	Q9NZV5	SELN_HUMAN	selenoprotein N, 1	434						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		TGCCGTTCACTGAGGCCTTCG	0.622																																					.		.											.	SEPN1	92	0			.						.						41.0	45.0	43.0					1																	26139198		2058	4187	6245	SO:0001819	synonymous_variant	57190	.			GTTCACTGAGGCC	AF166125	CCDS41282.1, CCDS41283.1	1p36.13	2014-09-17	2004-02-13		ENSG00000162430	ENSG00000162430		"""EF-hand domain containing"""	15999	protein-coding gene	gene with protein product		606210	"""rigid spine muscular dystrophy 1"""	RSMD1, MDRS1		10608886	Standard	NM_020451		Approved	selN, RSS	uc021ojl.1	Q9NZV5	OTTHUMG00000007375	ENST00000374315.1:c.1200T>A	1.37:g.26139198T>A		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	67.0	.	A6NJG8|A8MQ64|Q6PI70|Q969F6|Q9NUI6	Silent	SNP	ENST00000374315.1	37	CCDS41283.1																																																																																			.		0.622	SEPN1-002	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000019315.2	NM_020451	
SETDB1	9869	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	150933423	150933423	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:150933423C>G	ENST00000271640.5	+	16	3075	c.2885C>G	c.(2884-2886)tCa>tGa	p.S962*	SETDB1_ENST00000368969.4_Nonsense_Mutation_p.S962*	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	962	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTTCCTCCCTCAATCCCTGTA	0.547																																					p.S962X		.											.	SETDB1	228	0			c.C2885G						.						117.0	120.0	119.0					1																	150933423		2203	4300	6503	SO:0001587	stop_gained	9869	exon16			CTCCCTCAATCCC	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2885C>G	1.37:g.150933423C>G	ENSP00000271640:p.Ser962*	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	14.0	NM_012432	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Nonsense_Mutation	SNP	ENST00000271640.5	37	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	C	34	5.297677	0.95574	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	.	.	.	5.47	3.6	0.41247	.	1.371790	0.04323	N	0.351050	.	.	.	.	.	.	0.22975	N	0.998482	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	10.4496	0.44513	0.0:0.848:0.0:0.152	.	.	.	.	X	962	.	ENSP00000271640:S962X	S	+	2	0	SETDB1	149200047	0.000000	0.05858	0.002000	0.10522	0.483000	0.33249	0.430000	0.21428	0.670000	0.31165	0.462000	0.41574	TCA	.		0.547	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
SF1	7536	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	64534515	64534515	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:64534515G>A	ENST00000377390.3	-	12	1776	c.1439C>T	c.(1438-1440)cCg>cTg	p.P480L	SF1_ENST00000422298.2_Missense_Mutation_p.P365L|SF1_ENST00000433274.2_Missense_Mutation_p.P454L|SF1_ENST00000227503.9_Missense_Mutation_p.P480L|SF1_ENST00000377387.1_Missense_Mutation_p.P605L|SF1_ENST00000334944.5_Missense_Mutation_p.P480L|SF1_ENST00000377394.3_Silent_p.A481A|SF1_ENST00000489544.1_5'Flank	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	480	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						CGGCGGCGGCGGCGGCATCAT	0.692																																					p.P605L		.											.	SF1	227	0			c.C1814T						.						18.0	23.0	22.0					11																	64534515		2197	4285	6482	SO:0001583	missense	7536	exon12			GGCGGCGGCGGCA	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1439C>T	11.37:g.64534515G>A	ENSP00000366607:p.Pro480Leu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	14.0	NM_001178030	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	37	CCDS31599.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.54|13.54	2.266620|2.266620	0.40095|0.40095	.|.	.|.	ENSG00000168066|ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000334944;ENST00000422298;ENST00000443908;ENST00000433274|ENST00000413725	T;T;T;T;T;T;T|.	0.51817|.	0.75;0.76;0.76;0.74;0.69;0.85;0.77|.	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	0.311799|.	0.33895|.	N|.	0.004451|.	T|T	0.70954|0.70954	0.3283|0.3283	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.999;0.999;0.999;0.999;1.0|.	D;D;D;D;D|.	0.79108|.	0.913;0.96;0.982;0.992;0.992|.	T|T	0.70263|0.70263	-0.4920|-0.4920	9|4	0.66056|.	D|.	0.02|.	.|.	15.5846|15.5846	0.76473|0.76473	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	365;480;480;480;605|.	B4DX42;Q15637-4;Q15637;Q15637-2;Q15637-5|.	.;.;SF01_HUMAN;.;.|.	L|C	605;480;480;480;365;132;454|50	ENSP00000366604:P605L;ENSP00000366607:P480L;ENSP00000227503:P480L;ENSP00000334414:P480L;ENSP00000413084:P365L;ENSP00000391198:P132L;ENSP00000396793:P454L|.	ENSP00000227503:P480L|.	P|R	-|-	2|1	0|0	SF1|SF1	64291091|64291091	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.898000|0.898000	0.52572|0.52572	6.317000|6.317000	0.72862|0.72862	2.466000|2.466000	0.83321|0.83321	0.561000|0.561000	0.74099|0.74099	CCG|CGC	.		0.692	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630	
SFMBT1	51460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52962211	52962211	+	Silent	SNP	A	A	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:52962211A>C	ENST00000394752.3	-	9	1426	c.1044T>G	c.(1042-1044)ccT>ccG	p.P348P	SFMBT1_ENST00000394750.1_Silent_p.P348P|SFMBT1_ENST00000296295.6_Silent_p.P348P|SFMBT1_ENST00000358080.2_Silent_p.P348P	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	348					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GTGCACCTGGAGGGGGGCTGA	0.527																																					p.P348P		.											.	SFMBT1	91	0			c.T1044G						.						122.0	118.0	120.0					3																	52962211		2203	4300	6503	SO:0001819	synonymous_variant	51460	exon9			ACCTGGAGGGGGG	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.1044T>G	3.37:g.52962211A>C		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	12.0	NM_016329	Q402F7|Q96C73|Q9Y4Q9	Silent	SNP	ENST00000394752.3	37	CCDS2867.1																																																																																			.		0.527	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329	
SGCD	6444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	155935693	155935693	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:155935693A>T	ENST00000435422.3	+	3	759	c.272A>T	c.(271-273)aAa>aTa	p.K91I	SGCD_ENST00000447401.1_Missense_Mutation_p.K92I|SGCD_ENST00000337851.4_Missense_Mutation_p.K92I|SGCD_ENST00000517913.1_Missense_Mutation_p.K92I	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	91					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTCTACGCCAAAGAAATCCAG	0.428																																					p.K92I		.											.	.	.	0			c.A275T						.						91.0	82.0	85.0					5																	155935693		1852	4105	5957	SO:0001583	missense	6444	exon4			ACGCCAAAGAAAT	BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.272A>T	5.37:g.155935693A>T	ENSP00000403003:p.Lys91Ile	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	32.0	NM_000337	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	ENST00000435422.3	37	CCDS47327.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.683865	0.88639	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	5.49	5.49	0.81192	.	0.046978	0.85682	D	0.000000	D	0.96772	0.8946	M	0.75085	2.285	0.58432	D	0.999999	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.85130	0.995;0.991;0.997	D	0.96600	0.9444	10	0.46703	T	0.11	-7.3453	14.4502	0.67379	1.0:0.0:0.0:0.0	.	91;92;92	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	I	92;91;92;92	ENSP00000429378:K92I;ENSP00000403003:K91I;ENSP00000338343:K92I;ENSP00000408324:K92I	ENSP00000338343:K92I	K	+	2	0	SGCD	155868271	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.832000	0.92079	2.205000	0.71048	0.477000	0.44152	AAA	.		0.428	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000373469.3		
SGSM1	129049	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	22	25263061	25263061	+	Splice_Site	SNP	G	G	A	rs375323027		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr22:25263061G>A	ENST00000400359.4	+	10	935	c.928G>A	c.(928-930)Gtc>Atc	p.V310I	SGSM1_ENST00000400358.4_Splice_Site_p.V310I	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	310	Required for interaction with RAP family members.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CGCTTCCAGCGTCTACTGGGA	0.617																																					p.V310I		.											.	SGSM1	27	0			c.G928A						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4152		0,0,2076	39.0	43.0	42.0		928,928,928,928	3.2	1.0	22		42	1,8449		0,1,4224	no	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	SGSM1	NM_001039948.2,NM_001098497.1,NM_001098498.1,NM_133454.2	29,29,29,29	0,1,6300	AA,AG,GG		0.0118,0.0,0.0079	probably-damaging,probably-damaging,probably-damaging,probably-damaging	310/1149,310/1094,310/1033,310/1088	25263061	1,12601	2076	4225	6301	SO:0001630	splice_region_variant	129049	exon10			TCCAGCGTCTACT	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.927-1G>A	22.37:g.25263061G>A		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	8.0	NM_001098497	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	37	CCDS46674.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999133	0.54147	0.0	1.18E-4	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.31769	1.48;1.48	4.19	3.17	0.36434	.	0.301547	0.35772	N	0.002981	T	0.31295	0.0792	N	0.25485	0.75	0.80722	D	1	D;D;P;D	0.67145	0.996;0.963;0.865;0.984	P;B;P;P	0.56514	0.8;0.435;0.488;0.557	T	0.01998	-1.1232	10	0.21540	T	0.41	-5.2056	11.3382	0.49516	0.0896:0.0:0.9104:0.0	.	310;426;443;310	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	I	426;310;310	ENSP00000383211:V310I;ENSP00000383212:V310I	ENSP00000383211:V310I	V	+	1	0	SGSM1	23593061	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.453000	0.80700	0.913000	0.36797	0.555000	0.69702	GTC	.		0.617	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318	Missense_Mutation
SHISA5	51246	hgsc.bcm.edu;bcgsc.ca	37	3	48510952	48510952	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:48510952A>G	ENST00000296444.2	-	5	787	c.451T>C	c.(451-453)Tcc>Ccc	p.S151P	SHISA5_ENST00000426002.1_Missense_Mutation_p.S48P|SHISA5_ENST00000442747.1_Missense_Mutation_p.S120P|SHISA5_ENST00000444115.1_Missense_Mutation_p.S120P|SHISA5_ENST00000465449.1_5'UTR|SHISA5_ENST00000443308.2_Missense_Mutation_p.S144P	NM_001272065.1|NM_016479.3	NP_001258994.1|NP_057563.3	Q8N114	SHSA5_HUMAN	shisa family member 5	151	Poly-Thr.				intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			large_intestine(1)|lung(1)	2						ACAGTGGTGGATGTGGTGGTG	0.612																																					p.S151P		.											.	SHISA5	68	0			c.T451C						.						99.0	94.0	96.0					3																	48510952		2203	4300	6503	SO:0001583	missense	51246	exon5			TGGTGGATGTGGT	AF520698	CCDS2770.1, CCDS63621.1, CCDS63622.1, CCDS63623.1	3p21.31	2013-07-31	2013-07-31		ENSG00000164054	ENSG00000164054		"""Shisa homologs"""	30376	protein-coding gene	gene with protein product		607290	"""shisa homolog 5 (Xenopus laevis)"""			11042152, 12135983	Standard	NM_016479		Approved	SCOTIN, hShisa5	uc011bbk.1	Q8N114	OTTHUMG00000133529	ENST00000296444.2:c.451T>C	3.37:g.48510952A>G	ENSP00000296444:p.Ser151Pro	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	5.0	NM_016479	B3KW99|F8W9N8|Q69YY9|Q7Z433|Q8NHL9|Q96MW8|Q9BV58	Missense_Mutation	SNP	ENST00000296444.2	37	CCDS2770.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.240734	0.39598	.	.	ENSG00000164054	ENST00000296444;ENST00000444115;ENST00000426002;ENST00000442747;ENST00000443308	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	5.05	-7.29	0.01451	.	0.591742	0.16951	N	0.192888	T	0.31765	0.0807	L	0.29908	0.895	0.09310	N	0.999997	B;P;P;B	0.42123	0.13;0.729;0.771;0.039	B;B;B;B	0.43052	0.059;0.284;0.406;0.059	T	0.38045	-0.9679	10	0.52906	T	0.07	-15.2617	11.0558	0.47918	0.7015:0.223:0.0:0.0755	.	48;144;151;48	Q8N114-4;F8W9N8;Q8N114;Q8N114-3	.;.;SHSA5_HUMAN;.	P	151;120;48;120;144	ENSP00000296444:S151P;ENSP00000407957:S120P;ENSP00000390388:S48P;ENSP00000408223:S120P;ENSP00000395373:S144P	ENSP00000296444:S151P	S	-	1	0	SHISA5	48485956	0.000000	0.05858	0.012000	0.15200	0.933000	0.57130	-1.311000	0.02723	-1.218000	0.02601	-0.445000	0.05633	TCC	.		0.612	SHISA5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257504.3	NM_016479	
SHPRH	257218	hgsc.bcm.edu;bcgsc.ca	37	6	146243946	146243946	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:146243946A>G	ENST00000367505.2	-	19	3836	c.3572T>C	c.(3571-3573)tTc>tCc	p.F1191S	SHPRH_ENST00000275233.7_Missense_Mutation_p.F1191S|SHPRH_ENST00000438092.2_Missense_Mutation_p.F1195S|SHPRH_ENST00000367503.3_Missense_Mutation_p.F1195S			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1191					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TGTAAGTAAGAACTGAAGACC	0.403																																					p.F1195S		.											.	SHPRH	92	0			c.T3584C						.						93.0	87.0	89.0					6																	146243946		1888	4099	5987	SO:0001583	missense	257218	exon19			AGTAAGAACTGAA	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.3572T>C	6.37:g.146243946A>G	ENSP00000356475:p.Phe1191Ser	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	4.0	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	A	21.0	4.084493	0.76642	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	5.44	4.13	0.48395	.	0.142264	0.48767	D	0.000162	T	0.64962	0.2646	L	0.43152	1.355	0.46336	D	0.998993	P;D;D	0.63880	0.664;0.987;0.993	B;P;P	0.56916	0.143;0.649;0.809	T	0.63033	-0.6727	10	0.23891	T	0.37	-16.797	8.4383	0.32799	0.6169:0.0:0.0:0.3831	.	390;1191;1195	B3KX98;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	S	1191;1195;1195;1191	ENSP00000356475:F1191S;ENSP00000356473:F1195S;ENSP00000412797:F1195S;ENSP00000275233:F1191S	ENSP00000275233:F1191S	F	-	2	0	SHPRH	146285639	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.328000	0.65887	2.187000	0.69744	0.528000	0.53228	TTC	.		0.403	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
SHROOM4	57477	hgsc.bcm.edu;bcgsc.ca	37	X	50351123	50351123	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:50351123T>C	ENST00000289292.7	-	6	3302	c.3019A>G	c.(3019-3021)Aac>Gac	p.N1007D	SHROOM4_ENST00000376020.2_Missense_Mutation_p.N1007D|SHROOM4_ENST00000460112.3_Missense_Mutation_p.N891D			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1007					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					AGTGCTGGGTTCTCAAGGCAA	0.433																																					p.N1007D		.											.	SHROOM4	131	0			c.A3019G						.						51.0	48.0	49.0					X																	50351123		2203	4300	6503	SO:0001583	missense	57477	exon6			CTGGGTTCTCAAG	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3019A>G	X.37:g.50351123T>C	ENSP00000289292:p.Asn1007Asp	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	5.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.991725	0.54041	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.19250	2.58;2.58;2.16	5.51	5.51	0.81932	.	0.217639	0.36815	N	0.002395	T	0.34629	0.0904	L	0.34521	1.04	0.39593	D	0.969615	D	0.76494	0.999	D	0.78314	0.991	T	0.19877	-1.0292	10	0.87932	D	0	.	12.4646	0.55751	0.0:0.0:0.0:1.0	.	1007	Q9ULL8	SHRM4_HUMAN	D	1007;1007;891	ENSP00000289292:N1007D;ENSP00000365188:N1007D;ENSP00000421450:N891D	ENSP00000289292:N1007D	N	-	1	0	SHROOM4	50367863	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.916000	0.63362	1.849000	0.53698	0.486000	0.48141	AAC	.		0.433	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
SIPA1L1	26037	ucsc.edu;bcgsc.ca	37	14	72205030	72205030	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:72205030A>G	ENST00000555818.1	+	21	5607	c.5259A>G	c.(5257-5259)gaA>gaG	p.E1753E	SIPA1L1_ENST00000358550.2_Silent_p.E1731E|SIPA1L1_ENST00000537413.1_Silent_p.E1206E|SIPA1L1_ENST00000381232.3_Silent_p.E1732E|SIPA1L1_ENST00000554874.1_3'UTR	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1753					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		TGCTTCGGGAAGATTTGAAGA	0.423																																					p.E1753E		.											.	SIPA1L1	156	0			c.A5259G						.						117.0	100.0	106.0					14																	72205030		2203	4300	6503	SO:0001819	synonymous_variant	26037	exon21			TCGGGAAGATTTG	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.5259A>G	14.37:g.72205030A>G		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	24.0	4.0	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	CCDS9807.1																																																																																			.		0.423	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
SKIDA1	387640	hgsc.bcm.edu;bcgsc.ca	37	10	21806681	21806681	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:21806681T>C	ENST00000449193.2	-	4	2323	c.71A>G	c.(70-72)aAg>aGg	p.K24R	SKIDA1_ENST00000444772.3_Missense_Mutation_p.K24R|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	24						nucleus (GO:0005634)											AAACATTTGCTTCCCTTTAAT	0.507																																					p.K24R		.											.	.	.	0			c.A71G						.						51.0	52.0	52.0					10																	21806681		2001	4162	6163	SO:0001583	missense	387640	exon4			ATTTGCTTCCCTT	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.71A>G	10.37:g.21806681T>C	ENSP00000410041:p.Lys24Arg	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	6.0	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	37	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.346497	0.41599	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	D;D	0.82344	-1.6;-1.6	4.9	4.9	0.64082	DNA binding domain, putative (1);Transforming protein Ski (2);	0.135854	0.49916	D	0.000139	D	0.84270	0.5435	N	0.19112	0.55	0.39975	D	0.974847	D;D	0.76494	0.995;0.999	D;D	0.74674	0.926;0.984	D	0.87308	0.2310	10	0.66056	D	0.02	.	14.5119	0.67794	0.0:0.0:0.0:1.0	.	24;24	Q1XH10;E9PAX1	DLN1_HUMAN;.	R	24	ENSP00000410041:K24R;ENSP00000442432:K24R	ENSP00000442432:K24R	K	-	2	0	C10orf140	21846687	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.929000	0.63455	1.834000	0.53371	0.254000	0.18369	AAG	.		0.507	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
SLC24A4	123041	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	92790275	92790275	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:92790275G>A	ENST00000532405.1	+	1	327	c.101G>A	c.(100-102)tGc>tAc	p.C34Y	SLC24A4_ENST00000393265.2_Intron|SLC24A4_ENST00000351924.5_Missense_Mutation_p.C17Y|SLC24A4_ENST00000298877.1_Missense_Mutation_p.C17Y|SLC24A4_ENST00000531433.1_Missense_Mutation_p.C34Y			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	34					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GCCCTGGTGTGCTGTGCGTCC	0.697																																					p.C34Y	NSCLC(10;315 435 10383 28450 38798)	.											.	SLC24A4	93	0			c.G101A						.						49.0	49.0	49.0					14																	92790275		2203	4300	6503	SO:0001583	missense	123041	exon1			TGGTGTGCTGTGC	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.101G>A	14.37:g.92790275G>A	ENSP00000431840:p.Cys34Tyr	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	15.0	NM_153646	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	ENST00000532405.1	37	CCDS9903.2	.	.	.	.	.	.	.	.	.	.	G	8.678	0.904495	0.17760	.	.	ENSG00000140090	ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924	T;T;T;T	0.66815	0.18;0.18;-0.22;-0.23	4.61	4.61	0.57282	.	0.203246	0.46145	D	0.000309	T	0.46249	0.1383	N	0.08118	0	0.39520	D	0.968499	B;B	0.20988	0.05;0.022	B;B	0.23275	0.037;0.045	T	0.43180	-0.9407	10	0.22706	T	0.39	.	14.379	0.66900	0.0:0.0:1.0:0.0	.	34;34	Q8NFF2-3;Q8NFF2	.;NCKX4_HUMAN	Y	34;34;17;17	ENSP00000433302:C34Y;ENSP00000431840:C34Y;ENSP00000298877:C17Y;ENSP00000337789:C17Y	ENSP00000298877:C17Y	C	+	2	0	SLC24A4	91860028	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.422000	0.52749	2.120000	0.65058	0.462000	0.41574	TGC	.		0.697	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646	
SLC2A7	155184	hgsc.bcm.edu;ucsc.edu	37	1	9074919	9074919	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:9074919T>C	ENST00000400906.1	-	7	723	c.724A>G	c.(724-726)Agg>Ggg	p.R242G		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	242					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CCTCTCAGCCTCCTCAGAGCT	0.692																																					p.R242G		.											.	SLC2A7	514	0			c.A724G						.						13.0	15.0	14.0					1																	9074919		2197	4296	6493	SO:0001583	missense	155184	exon7			TCAGCCTCCTCAG	AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.724A>G	1.37:g.9074919T>C	ENSP00000383698:p.Arg242Gly	Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	4.0	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	T	11.26	1.585937	0.28268	.	.	ENSG00000197241	ENST00000400906	T	0.76186	-1.0	4.12	-1.16	0.09678	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.284899	0.31123	N	0.008214	T	0.77903	0.4200	M	0.93375	3.41	0.09310	N	1	B	0.30727	0.292	B	0.37731	0.257	T	0.71066	-0.4700	10	0.49607	T	0.09	.	5.9998	0.19515	0.0:0.2097:0.3487:0.4416	.	242	Q6PXP3	GTR7_HUMAN	G	242	ENSP00000383698:R242G	ENSP00000383698:R242G	R	-	1	2	SLC2A7	8997506	0.018000	0.18449	0.001000	0.08648	0.091000	0.18340	0.549000	0.23329	-0.108000	0.12066	0.402000	0.26972	AGG	.		0.692	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
SLC46A2	57864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	115652239	115652239	+	Silent	SNP	G	G	A	rs577863419		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:115652239G>A	ENST00000374228.4	-	1	954	c.723C>T	c.(721-723)ccC>ccT	p.P241P		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	241					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						TATCCACGGCGGGGAGCTCCT	0.602													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18617	0.0		0.0	False		,,,				2504	0.0				p.P241P		.											.	SLC46A2	90	0			c.C723T						.						70.0	63.0	65.0					9																	115652239		2203	4300	6503	SO:0001819	synonymous_variant	57864	exon1			CACGGCGGGGAGC	AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.723C>T	9.37:g.115652239G>A		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	51.0	NM_033051	B1ALK1|Q86VT0|Q96NE2	Silent	SNP	ENST00000374228.4	37	CCDS6786.1																																																																																			.		0.602	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053702.1	NM_033051	
SLCO1B1	10599	hgsc.bcm.edu;bcgsc.ca	37	12	21392086	21392086	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:21392086T>C	ENST00000256958.2	+	15	2135	c.2039T>C	c.(2038-2040)gTc>gCc	p.V680A		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	680					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	AAACATTTTGTCCCTTCTGCT	0.348																																					p.V680A		.											.	SLCO1B1	97	0			c.T2039C						.						64.0	71.0	69.0					12																	21392086		2203	4300	6503	SO:0001583	missense	10599	exon15			ATTTTGTCCCTTC		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.2039T>C	12.37:g.21392086T>C	ENSP00000256958:p.Val680Ala	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	4.0	NM_006446	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	37	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	T	4.563	0.104523	0.08731	.	.	ENSG00000134538	ENST00000256958	T	0.37584	1.19	2.81	1.65	0.23941	.	15.110800	0.00397	N	0.000042	T	0.32102	0.0818	L	0.58101	1.795	0.09310	N	1	B	0.20780	0.048	B	0.16289	0.015	T	0.13098	-1.0522	10	0.08837	T	0.75	.	4.577	0.12238	0.0:0.1577:0.0:0.8423	.	680	Q9Y6L6	SO1B1_HUMAN	A	680	ENSP00000256958:V680A	ENSP00000256958:V680A	V	+	2	0	SLCO1B1	21283353	0.000000	0.05858	0.001000	0.08648	0.096000	0.18686	0.006000	0.13152	0.482000	0.27582	0.260000	0.18958	GTC	.		0.348	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446	
SLCO1A2	6579	hgsc.bcm.edu;bcgsc.ca	37	12	21453353	21453353	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:21453353T>C	ENST00000307378.6	-	9	1559	c.839A>G	c.(838-840)gAc>gGc	p.D280G	SLCO1A2_ENST00000537524.1_Missense_Mutation_p.D148G|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.D148G|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.D278G|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.D280G	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	280					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	TTTAATGATGTCAGCATTAGT	0.343																																					p.D280G		.											.	SLCO1A2	157	0			c.A839G						.						102.0	100.0	101.0					12																	21453353		2203	4300	6503	SO:0001583	missense	6579	exon9			ATGATGTCAGCAT		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.839A>G	12.37:g.21453353T>C	ENSP00000305974:p.Asp280Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	4.0	NM_134431	Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.229734	0.39399	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.55	3.14	0.36123	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.575101	0.19124	N	0.122094	T	0.48390	0.1497	L	0.52573	1.65	0.09310	N	0.999999	B;B;B	0.13594	0.003;0.008;0.001	B;B;B	0.13407	0.009;0.009;0.008	T	0.34254	-0.9836	10	0.26408	T	0.33	.	10.3709	0.44053	0.0:0.1365:0.0:0.8635	.	260;278;280	Q8IV69;P46721-2;P46721	.;.;SO1A2_HUMAN	G	280;280;148;148;278	ENSP00000305974:D280G;ENSP00000393973:D280G;ENSP00000394854:D148G;ENSP00000439401:D148G;ENSP00000375088:D278G	ENSP00000305974:D280G	D	-	2	0	SLCO1A2	21344620	0.951000	0.32395	0.023000	0.16930	0.385000	0.30292	2.318000	0.43779	0.924000	0.37069	0.460000	0.39030	GAC	.		0.343	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
SLCO6A1	133482	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	101755554	101755554	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:101755554G>A	ENST00000506729.1	-	8	1619	c.1448C>T	c.(1447-1449)gCt>gTt	p.A483V	SLCO6A1_ENST00000514551.1_5'Flank|SLCO6A1_ENST00000379810.1_Intron|SLCO6A1_ENST00000389019.3_Missense_Mutation_p.A421V|SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.A483V			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	483						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ATTGATCCCAGCAAATTGCAC	0.313																																					p.A483V		.											.	SLCO6A1	96	0			c.C1448T						.						105.0	111.0	109.0					5																	101755554		2203	4300	6503	SO:0001583	missense	133482	exon8			ATCCCAGCAAATT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1448C>T	5.37:g.101755554G>A	ENSP00000421339:p.Ala483Val	Somatic	243.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	13.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	37	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670638	0.47781	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019	T;T;T	0.40225	1.04;1.04;1.04	4.99	4.13	0.48395	Major facilitator superfamily domain, general substrate transporter (1);	0.182863	0.36591	N	0.002520	T	0.66187	0.2764	M	0.87097	2.86	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.76575	0.988;0.873	T	0.71817	-0.4478	10	0.87932	D	0	.	10.8295	0.46652	0.0895:0.0:0.9105:0.0	.	421;483	Q86UG4-2;Q86UG4	.;SO6A1_HUMAN	V	483;483;421	ENSP00000421339:A483V;ENSP00000369135:A483V;ENSP00000373671:A421V	ENSP00000369135:A483V	A	-	2	0	SLCO6A1	101783453	1.000000	0.71417	0.997000	0.53966	0.041000	0.13682	3.794000	0.55492	1.473000	0.48159	0.655000	0.94253	GCT	.		0.313	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
SMARCA2	6595	hgsc.bcm.edu;bcgsc.ca	37	9	2029231	2029231	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:2029231T>C	ENST00000382203.1	+	2	418	c.209T>C	c.(208-210)aTg>aCg	p.M70T	SMARCA2_ENST00000349721.2_Missense_Mutation_p.M70T|SMARCA2_ENST00000357248.2_Missense_Mutation_p.M70T|SMARCA2_ENST00000382194.1_Missense_Mutation_p.M70T			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	70					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CAGGAAGGCATGCATCAAATG	0.498																																					p.M70T		.											.	SMARCA2	653	0			c.T209C						.						40.0	33.0	35.0					9																	2029231		2203	4300	6503	SO:0001583	missense	6595	exon2			AAGGCATGCATCA	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.209T>C	9.37:g.2029231T>C	ENSP00000371638:p.Met70Thr	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	4.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.755525	0.49362	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000439732;ENST00000382203;ENST00000382194	D;D;T;D;D	0.88046	-2.33;-2.31;0.58;-2.33;-2.31	5.61	5.61	0.85477	.	0.151372	0.56097	D	0.000024	D	0.83562	0.5281	L	0.43923	1.385	0.80722	D	1	B;B	0.20988	0.05;0.004	B;B	0.17979	0.02;0.006	T	0.79948	-0.1588	10	0.48119	T	0.1	-10.7341	15.7983	0.78428	0.0:0.0:0.0:1.0	.	70;70	P51531-2;P51531	.;SMCA2_HUMAN	T	70	ENSP00000265773:M70T;ENSP00000349788:M70T;ENSP00000392081:M70T;ENSP00000371638:M70T;ENSP00000371629:M70T	ENSP00000265773:M70T	M	+	2	0	SMARCA2	2019231	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.302000	0.72788	2.125000	0.65367	0.455000	0.32223	ATG	.		0.498	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
SPINT3	10816	hgsc.bcm.edu;bcgsc.ca	37	20	44144183	44144183	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:44144183T>C	ENST00000217428.6	-	1	81	c.66A>G	c.(64-66)gaA>gaG	p.E22E		NM_006652.1	NP_006643.1	P49223	SPIT3_HUMAN	serine peptidase inhibitor, Kunitz type, 3	22						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)	1						CTCGTGCTAGTTCTGATCGAA	0.562																																					p.E22E		.											.	.	.	0			c.A66G						.						86.0	74.0	77.0					20																	44144183		692	1591	2283	SO:0001819	synonymous_variant	10816	exon1			TGCTAGTTCTGAT	X77166	CCDS46608.1	20q12-q13.2	2012-08-20	2005-08-17		ENSG00000101446	ENSG00000101446			11248	protein-coding gene	gene with protein product		613941	"""serine protease inhibitor, Kunitz type, 3"""			21988899	Standard	NM_006652		Approved	HKIB9	uc010ghg.1	P49223	OTTHUMG00000032585	ENST00000217428.6:c.66A>G	20.37:g.44144183T>C		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	5.0	NM_006652	A6NCQ6|Q6UDR8|Q96KK2	Silent	SNP	ENST00000217428.6	37	CCDS46608.1																																																																																			.		0.562	SPINT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079464.5	NM_006652	
SPIRE1	56907	hgsc.bcm.edu;bcgsc.ca	37	18	12453092	12453092	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:12453092A>G	ENST00000409402.4	-	14	2089	c.1822T>C	c.(1822-1824)Tct>Cct	p.S608P	SPIRE1_ENST00000410092.3_Missense_Mutation_p.S594P|SPIRE1_ENST00000309836.5_Missense_Mutation_p.S397P|SPIRE1_ENST00000464481.1_5'UTR|SPIRE1_ENST00000383356.2_Missense_Mutation_p.S435P|SPIRE1_ENST00000453447.2_Missense_Mutation_p.S474P	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						CAGGTATAAGACCAAGTGAAG	0.323																																					p.S608P		.											.	SPIRE1	90	0			c.T1822C						.						61.0	63.0	62.0					18																	12453092		2203	4300	6503	SO:0001583	missense	56907	exon14			TATAAGACCAAGT	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.1822T>C	18.37:g.12453092A>G	ENSP00000387266:p.Ser608Pro	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	4.0	NM_001128626		Missense_Mutation	SNP	ENST00000409402.4	37	CCDS45829.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.532550	0.45073	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	5.95	4.8	0.61643	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	N	0.19112	0.55	0.58432	D	0.999999	B;B;B	0.32717	0.144;0.381;0.298	B;B;B	0.43155	0.156;0.23;0.41	T	0.64188	-0.6466	10	0.23302	T	0.38	-11.4703	11.9386	0.52888	0.9324:0.0:0.0676:0.0	.	594;397;608	Q08AE8-2;B4DWX0;Q08AE8	.;.;SPIR1_HUMAN	P	474;608;594;397;435	ENSP00000407050:S474P;ENSP00000387266:S608P;ENSP00000387226:S594P;ENSP00000309661:S397P;ENSP00000372847:S435P	ENSP00000309661:S397P	S	-	1	0	SPIRE1	12443092	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.654000	0.91092	1.076000	0.40961	0.528000	0.53228	TCT	.		0.323	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818	
SPTA1	6708	hgsc.bcm.edu;bcgsc.ca	37	1	158646052	158646052	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:158646052T>C	ENST00000368147.4	-	8	1171	c.991A>G	c.(991-993)Aca>Gca	p.T331A		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	331					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGGGAAAGTGTCAGCTTCTCT	0.483																																					p.T331A		.											.	SPTA1	142	0			c.A991G						.						211.0	199.0	203.0					1																	158646052		1928	4144	6072	SO:0001583	missense	6708	exon8			AAAGTGTCAGCTT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.991A>G	1.37:g.158646052T>C	ENSP00000357129:p.Thr331Ala	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	6.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.546629	0.00926	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.32515	1.45;1.45	5.24	-2.44	0.06502	.	1.172060	0.06713	N	0.773574	T	0.02727	0.0082	N	0.03209	-0.39	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40572	-0.9556	10	0.05721	T	0.95	.	7.9173	0.29825	0.0:0.1795:0.534:0.2865	.	331	P02549	SPTA1_HUMAN	A	331	ENSP00000357130:T331A;ENSP00000357129:T331A	ENSP00000357129:T331A	T	-	1	0	SPTA1	156912676	0.995000	0.38212	0.007000	0.13788	0.161000	0.22273	0.814000	0.27239	-0.211000	0.10124	-0.256000	0.11100	ACA	.		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
SPTBN2	6712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66472881	66472881	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:66472881G>C	ENST00000533211.1	-	15	2197	c.1866C>G	c.(1864-1866)agC>agG	p.S622R	SPTBN2_ENST00000529997.1_Missense_Mutation_p.S622R|SPTBN2_ENST00000309996.2_Missense_Mutation_p.S622R			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	622					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GTGCCTCATAGCTCTGCTCTA	0.642																																					p.S622R		.											.	SPTBN2	155	0			c.C1866G						.						30.0	34.0	33.0					11																	66472881		2194	4279	6473	SO:0001583	missense	6712	exon14			CTCATAGCTCTGC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1866C>G	11.37:g.66472881G>C	ENSP00000432568:p.Ser622Arg	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	73.0	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	37	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	G	7.848	0.723341	0.15439	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.43294	0.95;0.95;0.95	4.45	4.45	0.53987	.	0.119815	0.64402	D	0.000019	T	0.17874	0.0429	N	0.01473	-0.845	0.40405	D	0.979692	B	0.18013	0.025	B	0.15052	0.012	T	0.11567	-1.0582	10	0.14252	T	0.57	.	16.002	0.80301	0.0:0.0:1.0:0.0	.	622	O15020	SPTN2_HUMAN	R	622	ENSP00000432568:S622R;ENSP00000311489:S622R;ENSP00000433593:S622R	ENSP00000311489:S622R	S	-	3	2	SPTBN2	66229457	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	3.886000	0.56190	2.294000	0.77228	0.491000	0.48974	AGC	.		0.642	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
STXBP5L	9515	hgsc.bcm.edu;bcgsc.ca	37	3	120941989	120941989	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:120941989A>G	ENST00000273666.6	+	11	1367	c.1096A>G	c.(1096-1098)Acg>Gcg	p.T366A	STXBP5L_ENST00000472879.1_Missense_Mutation_p.T366A|STXBP5L_ENST00000497029.1_Missense_Mutation_p.T366A|STXBP5L_ENST00000471454.1_Missense_Mutation_p.T366A|STXBP5L_ENST00000492541.1_Missense_Mutation_p.T366A	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	366					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TTTATGTGAAACGCCCTATCC	0.294																																					p.T366A		.											.	STXBP5L	77	0			c.A1096G						.						113.0	106.0	108.0					3																	120941989		1842	4091	5933	SO:0001583	missense	9515	exon11			TGTGAAACGCCCT	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1096A>G	3.37:g.120941989A>G	ENSP00000273666:p.Thr366Ala	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	4.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	37	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.550852	0.65311	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.37752	1.87;1.87;1.67;1.18;1.67;1.88	4.5	4.5	0.54988	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	L	0.37800	1.135	0.80722	D	1	P;D	0.71674	0.693;0.998	B;D	0.80764	0.41;0.994	T	0.42050	-0.9474	10	0.39692	T	0.17	-19.3352	13.9784	0.64287	1.0:0.0:0.0:0.0	.	366;366	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	A	366	ENSP00000273666:T366A;ENSP00000420019:T366A;ENSP00000419627:T366A;ENSP00000420287:T366A;ENSP00000420666:T366A;ENSP00000420167:T366A	ENSP00000273666:T366A	T	+	1	0	STXBP5L	122424679	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.139000	0.94554	1.878000	0.54408	0.379000	0.24179	ACG	.		0.294	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
SYNE2	23224	hgsc.bcm.edu;bcgsc.ca	37	14	64519805	64519805	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:64519805T>C	ENST00000344113.4	+	48	9386	c.9174T>C	c.(9172-9174)atT>atC	p.I3058I	SYNE2_ENST00000358025.3_Silent_p.I3058I|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Silent_p.I3091I	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3058					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGAGAGCTATTGATTTGCAAA	0.348																																					p.I3058I		.											.	SYNE2	164	0			c.T9174C						.						54.0	54.0	54.0					14																	64519805		1824	4074	5898	SO:0001819	synonymous_variant	23224	exon48			AGCTATTGATTTG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.9174T>C	14.37:g.64519805T>C		Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	37	CCDS41963.1																																																																																			.		0.348	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SYTL5	94122	hgsc.bcm.edu;bcgsc.ca	37	X	37913595	37913595	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:37913595T>C	ENST00000357972.5	+	3	795	c.249T>C	c.(247-249)gcT>gcC	p.A83A	TM4SF2_ENST00000465127.1_Intron|SYTL5_ENST00000297875.2_Silent_p.A83A|SYTL5_ENST00000456733.2_Silent_p.A83A			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	83	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						CTTGTCAGGCTTGCTCACTGA	0.507																																					p.A83A		.											.	SYTL5	131	0			c.T249C						.						94.0	81.0	85.0					X																	37913595		2202	4300	6502	SO:0001819	synonymous_variant	94122	exon2			TCAGGCTTGCTCA		CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.249T>C	X.37:g.37913595T>C		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	4.0	NM_001163334	A2RRF2	Silent	SNP	ENST00000357972.5	37	CCDS14244.1																																																																																			.		0.507	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780	
SZT2	23334	hgsc.bcm.edu;bcgsc.ca	37	1	43890875	43890875	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:43890875A>G	ENST00000562955.1	+	18	2642	c.2642A>G	c.(2641-2643)gAc>gGc	p.D881G	SZT2_ENST00000372442.1_Missense_Mutation_p.D39G	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	881					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						TCCACCAAAGACAGGTGAGAC	0.567																																					p.D881G		.											.	SZT2	144	0			c.A2642G						.						92.0	70.0	77.0					1																	43890875		2203	4300	6503	SO:0001583	missense	23334	exon18			CCAAAGACAGGTG	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.2642A>G	1.37:g.43890875A>G	ENSP00000457168:p.Asp881Gly	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	5.0	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	A	33	5.228427	0.95173	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	L	0.42245	1.32	0.37764	D	0.926442	P;D	0.76494	0.844;0.999	B;D	0.65443	0.42;0.935	T	0.74337	-0.3698	9	0.72032	D	0.01	.	15.9527	0.79855	1.0:0.0:0.0:0.0	.	881;881	Q5T011-4;Q5T011-5	.;.	G	39	.	ENSP00000361519:D39G	D	+	2	0	SZT2	43663462	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.151000	0.94674	2.173000	0.68751	0.533000	0.62120	GAC	.		0.567	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
TAF2	6873	hgsc.bcm.edu;bcgsc.ca	37	8	120810035	120810035	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:120810035A>G	ENST00000378164.2	-	7	1142	c.844T>C	c.(844-846)Tca>Cca	p.S282P		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	282					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGAAGGTATGATGTGGTATGT	0.338																																					p.S282P		.											.	TAF2	274	0			c.T844C						.						89.0	87.0	87.0					8																	120810035		2203	4299	6502	SO:0001583	missense	6873	exon7			GGTATGATGTGGT	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.844T>C	8.37:g.120810035A>G	ENSP00000367406:p.Ser282Pro	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	4.0	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	37	CCDS34937.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.212616	0.79240	.	.	ENSG00000064313	ENST00000378164	T	0.02837	4.14	6.07	6.07	0.98685	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.065598	0.64402	D	0.000006	T	0.06508	0.0167	L	0.49126	1.545	0.58432	D	0.999996	P	0.45428	0.858	P	0.49387	0.609	T	0.47222	-0.9134	10	0.30854	T	0.27	-25.6241	12.4822	0.55850	0.8607:0.1393:0.0:0.0	.	282	Q6P1X5	TAF2_HUMAN	P	282	ENSP00000367406:S282P	ENSP00000367406:S282P	S	-	1	0	TAF2	120879216	1.000000	0.71417	0.897000	0.35233	0.989000	0.77384	7.269000	0.78482	2.326000	0.78906	0.533000	0.62120	TCA	.		0.338	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
TMBIM4	51643	hgsc.bcm.edu;bcgsc.ca	37	12	66531841	66531841	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:66531841A>G	ENST00000358230.3	-	7	736	c.616T>C	c.(616-618)Tca>Cca	p.S206P	TMBIM4_ENST00000556010.1_3'UTR|TMBIM4_ENST00000544599.1_Missense_Mutation_p.S29P|TMBIM4_ENST00000542724.1_Missense_Mutation_p.S175P|TMBIM4_ENST00000286424.7_Missense_Mutation_p.S253P|TMBIM4_ENST00000398033.4_3'UTR|TMBIM4_ENST00000539652.1_3'UTR	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	206					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		TCTTCAGGTGACAGTTTATGC	0.413																																					p.S206P		.											.	TMBIM4	515	0			c.T616C						.						123.0	120.0	121.0					12																	66531841		1946	4151	6097	SO:0001583	missense	51643	exon7			CAGGTGACAGTTT	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.616T>C	12.37:g.66531841A>G	ENSP00000350965:p.Ser206Pro	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	4.0	NM_016056	Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	37	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.928131	0.92389	.	.	ENSG00000155957	ENST00000358230;ENST00000544599;ENST00000286424;ENST00000539043;ENST00000539427;ENST00000542724	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.70245	0.3202	M	0.87097	2.86	0.80722	D	1	P;D;D	0.89917	0.746;1.0;1.0	P;D;D	0.97110	0.561;1.0;1.0	T	0.74515	-0.3640	9	.	.	.	-11.1003	16.8222	0.85835	1.0:0.0:0.0:0.0	.	253;175;206	G3XAA5;G3V1M2;Q9HC24	.;.;TMBI4_HUMAN	P	206;29;253;206;251;175	ENSP00000350965:S206P;ENSP00000444639:S29P;ENSP00000286424:S253P;ENSP00000441291:S175P	.	S	-	1	0	TMBIM4	64818108	1.000000	0.71417	0.943000	0.38184	0.988000	0.76386	8.222000	0.89777	2.371000	0.80710	0.533000	0.62120	TCA	.		0.413	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056	
TMEM132A	54972	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	60701185	60701185	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:60701185C>T	ENST00000453848.2	+	8	1686	c.1528C>T	c.(1528-1530)Cgc>Tgc	p.R510C	TMEM132A_ENST00000005286.4_Missense_Mutation_p.R511C			Q24JP5	T132A_HUMAN	transmembrane protein 132A	510						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CGAGCAGGTCCGCGGCTGGAG	0.706																																					p.R511C		.											.	TMEM132A	227	0			c.C1531T						.						12.0	11.0	12.0					11																	60701185		2187	4270	6457	SO:0001583	missense	54972	exon8			CAGGTCCGCGGCT	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1528C>T	11.37:g.60701185C>T	ENSP00000405823:p.Arg510Cys	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	38.0	NM_017870	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.000524|4.000524	0.74818|0.74818	.|.	.|.	ENSG00000006118|ENSG00000006118	ENST00000536409|ENST00000444690;ENST00000453848;ENST00000005286	.|T;T	.|0.15017	.|2.46;2.46	4.25|4.25	4.25|4.25	0.50352|0.50352	.|.	.|0.092054	.|0.48767	.|D	.|0.000172	T|T	0.35856|0.35856	0.0946|0.0946	L|L	0.50333|0.50333	1.59|1.59	0.51233|0.51233	D|D	0.999913|0.999913	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.77557	.|0.978;0.985;0.99	T|T	0.13388|0.13388	-1.0511|-1.0511	5|10	.|0.87932	.|D	.|0	.|.	15.3168|15.3168	0.74085|0.74085	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|261;510;511	.|Q24JP5-4;Q24JP5;Q24JP5-2	.|.;T132A_HUMAN;.	L|C	101|261;510;511	.|ENSP00000405823:R510C;ENSP00000005286:R511C	.|ENSP00000005286:R511C	P|R	+|+	2|1	0|0	TMEM132A|TMEM132A	60457761|60457761	0.993000|0.993000	0.37304|0.37304	0.995000|0.995000	0.50966|0.50966	0.956000|0.956000	0.61745|0.61745	1.374000|1.374000	0.34283|0.34283	2.285000|2.285000	0.76669|0.76669	0.555000|0.555000	0.69702|0.69702	CCG|CGC	.		0.706	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
TMEM209	84928	hgsc.bcm.edu;bcgsc.ca	37	7	129818251	129818251	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:129818251T>C	ENST00000397622.2	-	10	1359	c.1237A>G	c.(1237-1239)Agg>Ggg	p.R413G	RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000336804.8_Intron|TMEM209_ENST00000473456.1_Intron|TMEM209_ENST00000462753.1_Missense_Mutation_p.R412G	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	413						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					CCTTTGATCCTTTCAAACAAG	0.333																																					p.R413G		.											.	TMEM209	92	0			c.A1237G						.						48.0	44.0	45.0					7																	129818251		1806	4068	5874	SO:0001583	missense	84928	exon10			TGATCCTTTCAAA		CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.1237A>G	7.37:g.129818251T>C	ENSP00000380747:p.Arg413Gly	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	4.0	NM_032842	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	ENST00000397622.2	37	CCDS47712.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878794	0.72294	.	.	ENSG00000146842	ENST00000397622;ENST00000462753	T;T	0.68765	-0.35;-0.35	5.78	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.82056	0.4954	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83686	0.0174	10	0.87932	D	0	-22.8922	11.1495	0.48451	0.0:0.0:0.2951:0.7049	.	413	Q96SK2	TM209_HUMAN	G	413;412	ENSP00000380747:R413G;ENSP00000419697:R412G	ENSP00000380747:R413G	R	-	1	2	TMEM209	129605487	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.923000	0.48868	0.976000	0.38417	0.477000	0.44152	AGG	.		0.333	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349339.1	NM_032842	
TNN	63923	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	175067580	175067580	+	Silent	SNP	T	T	G	rs61747978	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:175067580T>G	ENST00000239462.4	+	9	2081	c.1968T>G	c.(1966-1968)tcT>tcG	p.S656S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	656	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCTACACCTCTGCTGGTGGAG	0.612																																					p.S656S		.											.	TNN	138	0			c.T1968G						.						96.0	92.0	93.0					1																	175067580		2203	4300	6503	SO:0001819	synonymous_variant	63923	exon9			CACCTCTGCTGGT	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1968T>G	1.37:g.175067580T>G		Somatic	277.0	0.0		WXS	Illumina HiSeq	Phase_I	656.0	57.0	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	37	CCDS30943.1																																																																																			T|0.981;C|0.019		0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R249S|TP53_ENST00000445888.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,mouth,carcinoma,0	TP53	70225	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	17.37:g.7577534C>A	ENSP00000269305:p.Arg249Ser	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	91.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	C|1.000;|0.000		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TPR	7175	hgsc.bcm.edu;bcgsc.ca	37	1	186340129	186340129	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:186340129A>G	ENST00000367478.4	-	3	599	c.303T>C	c.(301-303)atT>atC	p.I101I	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	101	Necessary for interaction with HSF1.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GATCCTGAGCAATTTCAAGTT	0.318			T	NTRK1	papillary thyroid																																p.I101I		.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	228	0			c.T303C						.						192.0	176.0	181.0					1																	186340129		1828	4087	5915	SO:0001819	synonymous_variant	7175	exon3			CTGAGCAATTTCA	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.303T>C	1.37:g.186340129A>G		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_003292	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	37	CCDS41446.1																																																																																			.		0.318	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
TRAK1	22906	broad.mit.edu;bcgsc.ca	37	3	42234621	42234660	+	Frame_Shift_Del	DEL	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	-	rs201576814	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:42234621_42234660delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	ENST00000327628.5	+	8	1224_1263	c.824_863delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	c.(823-864)gaagatgctgcccgccagcaagaggagatcacacacctgctafs	p.EDAARQQEEITHLL275fs	TRAK1_ENST00000396175.1_Frame_Shift_Del_p.EDAARQQEEITHLL217fs|TRAK1_ENST00000341421.3_Frame_Shift_Del_p.EDAARQQEEITHLL217fs|TRAK1_ENST00000449246.1_Frame_Shift_Del_p.EDAARQQEEITHLL201fs|TRAK1_ENST00000487159.1_3'UTR	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	275	HAP1 N-terminal.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						AAGAAGACGGAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCTATCGCAAATA	0.475																																					p.275_288del	GBM(44;195 884 22595 31865 41850)	.											.	TRAK1	91	0			c.824_863del						.																																			SO:0001589	frameshift_variant	22906	exon8			AGACGGAAGATGC		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.824_863delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	3.37:g.42234621_42234660delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	ENSP00000328998:p.Glu275fs	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	4.0	NM_001265608	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Frame_Shift_Del	DEL	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.475	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179648880	179648880	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:179648880C>T	ENST00000591111.1	-	16	2916	c.2692G>A	c.(2692-2694)Gtg>Atg	p.V898M	TTN_ENST00000359218.5_Missense_Mutation_p.V852M|TTN_ENST00000460472.2_Missense_Mutation_p.V852M|TTN_ENST00000342175.6_Missense_Mutation_p.V852M|TTN_ENST00000589042.1_Missense_Mutation_p.V898M|TTN_ENST00000342992.6_Missense_Mutation_p.V898M|TTN_ENST00000360870.5_Missense_Mutation_p.V898M			Q8WZ42	TITIN_HUMAN	titin	33935					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTTTTTCACCTCAACGCCA	0.552																																					p.V898M		.											.	TTN	636	0			c.G2692A						.						159.0	126.0	137.0					2																	179648880		2203	4300	6503	SO:0001583	missense	7273	exon16			TTTTCACCTCAAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2692G>A	2.37:g.179648880C>T	ENSP00000465570:p.Val898Met	Somatic	256.0	0.0		WXS	Illumina HiSeq	Phase_I	259.0	12.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	12.79	2.042797	0.36085	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.63580	-0.05;0.21;0.2;0.18;0.32	5.52	5.52	0.82312	Ribonuclease H-like (1);	.	.	.	.	T	0.62841	0.2461	L	0.29908	0.895	0.22468	N	0.999075	P;P;P;P;D	0.59357	0.868;0.868;0.868;0.868;0.985	B;B;B;B;P	0.58391	0.38;0.38;0.38;0.38;0.838	T	0.56721	-0.7932	9	0.87932	D	0	.	7.5186	0.27614	0.0:0.802:0.0:0.198	.	852;852;852;898;898	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	M	898;852;852;852;852;898	ENSP00000343764:V898M;ENSP00000434586:V852M;ENSP00000340554:V852M;ENSP00000352154:V852M;ENSP00000354117:V898M	ENSP00000340554:V852M	V	-	1	0	TTN	179357125	0.999000	0.42202	1.000000	0.80357	0.752000	0.42762	1.504000	0.35726	2.767000	0.95098	0.655000	0.94253	GTG	.		0.552	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TYW3	127253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	75199081	75199081	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:75199081C>T	ENST00000370867.3	+	1	242	c.153C>T	c.(151-153)ggC>ggT	p.G51G	CRYZ_ENST00000417775.1_5'UTR|TYW3_ENST00000457880.2_Silent_p.G51G|TYW3_ENST00000421739.2_Silent_p.G51G|CRYZ_ENST00000370872.3_5'Flank|TYW3_ENST00000479111.1_5'UTR|CRYZ_ENST00000340866.5_5'Flank|CRYZ_ENST00000370871.3_5'Flank	NM_138467.2	NP_612476.1	Q6IPR3	TYW3_HUMAN	tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)	51					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|ovary(2)|prostate(1)|skin(1)	15						CCTGCGCTGGCCGCATCCTAC	0.587																																					p.G51G		.											.	TYW3	70	0			c.C153T						.						89.0	77.0	81.0					1																	75199081		2203	4300	6503	SO:0001819	synonymous_variant	127253	exon1			CGCTGGCCGCATC	BX647591	CCDS666.1, CCDS53334.1	1p31.1	2008-02-05	2006-05-25	2006-05-25	ENSG00000162623	ENSG00000162623			24757	protein-coding gene	gene with protein product		611245	"""chromosome 1 open reading frame 171"""	C1orf171		17150819	Standard	NM_138467		Approved	FLJ40918	uc001dgn.3	Q6IPR3	OTTHUMG00000009641	ENST00000370867.3:c.153C>T	1.37:g.75199081C>T		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	5.0	NM_001162916	B4DSP9|E9PGR7|Q5HYJ0|Q8N7L1	Silent	SNP	ENST00000370867.3	37	CCDS666.1																																																																																			.		0.587	TYW3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026573.1	NM_138467	
UBOX5	22888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3102976	3102976	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:3102976G>A	ENST00000217173.2	-	3	780	c.309C>T	c.(307-309)ggC>ggT	p.G103G	UBOX5_ENST00000348031.2_Silent_p.G103G|UBOX5-AS1_ENST00000446537.1_RNA	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						GCTCAGCTGGGCCCAGGGTCC	0.557																																					p.G103G		.											.	UBOX5	227	0			c.C309T						.						59.0	59.0	59.0					20																	3102976		2203	4300	6503	SO:0001819	synonymous_variant	22888	exon3			AGCTGGGCCCAGG	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.309C>T	20.37:g.3102976G>A		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	47.0	NM_014948		Silent	SNP	ENST00000217173.2	37	CCDS13046.1																																																																																			.		0.557	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
UCP1	7350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	141484605	141484605	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:141484605C>T	ENST00000262999.3	-	3	468	c.393G>A	c.(391-393)ggG>ggA	p.G131G		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	131					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					CTGTGGGTTGCCCAATGAATA	0.433																																					p.G131G		.											.	UCP1	91	0			c.G393A						.						119.0	104.0	109.0					4																	141484605		2203	4300	6503	SO:0001819	synonymous_variant	7350	exon3			GGGTTGCCCAATG	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.393G>A	4.37:g.141484605C>T		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	32.0	NM_021833	Q13218|Q4KMZ3|Q68G66	Silent	SNP	ENST00000262999.3	37	CCDS3753.1																																																																																			.		0.433	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1		
UNC5D	137970	broad.mit.edu;bcgsc.ca	37	8	35647893	35647893	+	Missense_Mutation	SNP	G	G	T	rs374094705		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:35647893G>T	ENST00000404895.2	+	17	3002	c.2674G>T	c.(2674-2676)Gct>Tct	p.A892S	AC012215.1_ENST00000437887.1_5'Flank|UNC5D_ENST00000420357.1_Missense_Mutation_p.A825S|UNC5D_ENST00000287272.2_Missense_Mutation_p.A823S|UNC5D_ENST00000453357.2_Missense_Mutation_p.A887S|UNC5D_ENST00000416672.1_Missense_Mutation_p.A897S|UNC5D_ENST00000449677.1_Missense_Mutation_p.A468S	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	892	Death.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		ATCTTATTTCGCTACACAAAG	0.393																																					p.A892S		.											.	UNC5D	96	0			c.G2674T						.						114.0	101.0	106.0					8																	35647893		2203	4300	6503	SO:0001583	missense	137970	exon17			TATTTCGCTACAC	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2674G>T	8.37:g.35647893G>T	ENSP00000385143:p.Ala892Ser	Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	78.0	31.0	NM_080872	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370312	0.82573	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	D;D;D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95;-1.95	5.72	5.72	0.89469	Death (2);DEATH-like (2);	0.049286	0.85682	D	0.000000	D	0.91088	0.7195	M	0.64404	1.975	0.58432	D	0.999999	D;D;D	0.64830	0.994;0.992;0.994	D;P;P	0.63113	0.911;0.813;0.883	D	0.91365	0.5115	10	0.87932	D	0	-14.2436	19.873	0.96856	0.0:0.0:1.0:0.0	.	468;887;892	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	S	892;825;823;897;887;468	ENSP00000385143:A892S;ENSP00000392739:A825S;ENSP00000287272:A823S;ENSP00000412652:A897S;ENSP00000394303:A887S;ENSP00000397211:A468S	ENSP00000287272:A823S	A	+	1	0	UNC5D	35767435	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.497000	0.81536	2.705000	0.92388	0.557000	0.71058	GCT	.		0.393	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		
UNC80	285175	hgsc.bcm.edu;bcgsc.ca	37	2	210761117	210761117	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:210761117A>G	ENST00000439458.1	+	27	4443	c.4363A>G	c.(4363-4365)Aga>Gga	p.R1455G	UNC80_ENST00000272845.6_Missense_Mutation_p.R1450G	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1455					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GAATTACCACAGAAACATGTC	0.483																																					p.R1455G		.											.	UNC80	90	0			c.A4363G						.						120.0	114.0	116.0					2																	210761117		692	1591	2283	SO:0001583	missense	285175	exon27			TACCACAGAAACA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4363A>G	2.37:g.210761117A>G	ENSP00000391088:p.Arg1455Gly	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	5.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	16.05	3.012867	0.54468	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.32023	1.47;1.47	5.9	3.38	0.38709	.	0.054098	0.64402	D	0.000001	T	0.25644	0.0624	L	0.43152	1.355	0.80722	D	1	B	0.30281	0.275	B	0.24155	0.051	T	0.11131	-1.0600	10	0.72032	D	0.01	-19.3615	12.7213	0.57144	0.4978:0.5022:0.0:0.0	.	1455	Q8N2C7	UNC80_HUMAN	G	1455;1450	ENSP00000391088:R1455G;ENSP00000272845:R1450G	ENSP00000272845:R1450G	R	+	1	2	UNC80	210469362	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.131000	0.31406	1.047000	0.40274	-0.313000	0.08912	AGA	.		0.483	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
UROC1	131669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	126229602	126229602	+	Silent	SNP	C	C	T	rs557996880		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:126229602C>T	ENST00000290868.2	-	2	215	c.162G>A	c.(160-162)ccG>ccA	p.P54P	UROC1_ENST00000383579.3_Silent_p.P54P	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	54					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		CCTGGACATCCGGGGGGAAGT	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		17990	0.0		0.0	False		,,,				2504	0.001				p.P54P		.											.	UROC1	91	0			c.G162A						.						52.0	49.0	50.0					3																	126229602		2203	4300	6503	SO:0001819	synonymous_variant	131669	exon2			GACATCCGGGGGG	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.162G>A	3.37:g.126229602C>T		Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	9.0	NM_001165974	E9PE13|Q14C64|Q68CJ7	Silent	SNP	ENST00000290868.2	37	CCDS3038.1																																																																																			.		0.637	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639	
USH2A	7399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	216373462	216373462	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:216373462A>G	ENST00000307340.3	-	17	3704	c.3318T>C	c.(3316-3318)agT>agC	p.S1106S	USH2A_ENST00000366942.3_Splice_Site_p.S1106S|USH2A_ENST00000366943.2_Splice_Site_p.S1106S|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1106	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTATTGAATACCTGAAATGA	0.318										HNSCC(13;0.011)																											p.S1106S		.											.	USH2A	115	0			c.T3318C						.						37.0	37.0	37.0					1																	216373462		2199	4300	6499	SO:0001630	splice_region_variant	7399	exon17			TTGAATACCTGAA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3317-1T>C	1.37:g.216373462A>G		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	17.0	10.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.318	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	Silent
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61571021	61571021	+	Missense_Mutation	SNP	G	G	T	rs373411362	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:61571021G>T	ENST00000398571.2	-	16	2505	c.2429C>A	c.(2428-2430)gCg>gAg	p.A810E		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	810					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TGTCAGTTCCGCATGTGAATT	0.373																																					p.A810E		.											.	USP34	579	0			c.C2429A						.						156.0	144.0	148.0					2																	61571021		1915	4129	6044	SO:0001583	missense	9736	exon16			AGTTCCGCATGTG	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.2429C>A	2.37:g.61571021G>T	ENSP00000381577:p.Ala810Glu	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	112.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479739	0.84747	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.04194	3.68	5.67	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.07863	0.0197	L	0.40543	1.245	0.58432	D	0.999997	D	0.54397	0.966	P	0.46940	0.532	T	0.21177	-1.0253	10	0.46703	T	0.11	.	14.779	0.69751	0.0694:0.0:0.9306:0.0	.	810	Q70CQ2	UBP34_HUMAN	E	658;658;810	ENSP00000381577:A810E	ENSP00000263989:A658E	A	-	2	0	USP34	61424525	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.046000	0.89438	1.399000	0.46721	0.603000	0.83216	GCG	.		0.373	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
VAV3	10451	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	108292166	108292166	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:108292166T>A	ENST00000370056.4	-	14	1584	c.1310A>T	c.(1309-1311)gAt>gTt	p.D437V	VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.D437V|VAV3_ENST00000371846.4_Missense_Mutation_p.D372V	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	437	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TTCATAGTTATCACCTTTTCT	0.323																																					p.D437V		.											.	VAV3	1339	0			c.A1310T						.						151.0	135.0	141.0					1																	108292166		2202	4297	6499	SO:0001583	missense	10451	exon14			TAGTTATCACCTT	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1310A>T	1.37:g.108292166T>A	ENSP00000359073:p.Asp437Val	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	4.0	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.10|17.10	3.302722|3.302722	0.60195|0.60195	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000490388	D;D;D|.	0.88818|.	-2.43;-2.43;-2.43|.	5.83|5.83	5.83|5.83	0.93111|0.93111	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67627|0.67627	0.2913|0.2913	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	B;P;B;B|.	0.35456|.	0.001;0.502;0.01;0.263|.	B;P;B;P|.	0.49922|.	0.037;0.626;0.056;0.521|.	T|T	0.68318|0.68318	-0.5440|-0.5440	10|5	0.87932|.	D|.	0|.	.|.	16.2141|16.2141	0.82191|0.82191	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	437;437;372;437|.	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4|.	.;.;.;VAV3_HUMAN|.	V|L	437;437;372|432	ENSP00000359073:D437V;ENSP00000432540:D437V;ENSP00000360912:D372V|.	ENSP00000359073:D437V|.	D|I	-|-	2|1	0|0	VAV3|VAV3	108093689|108093689	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.698000|7.698000	0.84413|0.84413	2.224000|2.224000	0.72417|0.72417	0.528000|0.528000	0.53228|0.53228	GAT|ATA	.		0.323	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
VEZT	55591	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	12	95650962	95650962	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:95650962A>G	ENST00000436874.1	+	3	310	c.205A>G	c.(205-207)Agt>Ggt	p.S69G	VEZT_ENST00000356859.4_3'UTR|VEZT_ENST00000261219.6_Missense_Mutation_p.S21G	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	69					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						AACCATCAAAAGTTGGATTTT	0.348																																					p.S69G		.											.	VEZT	23	0			c.A205G						.						97.0	92.0	94.0					12																	95650962		1825	4073	5898	SO:0001583	missense	55591	exon3			ATCAAAAGTTGGA	AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.205A>G	12.37:g.95650962A>G	ENSP00000410083:p.Ser69Gly	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	4.0	NM_017599	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	ENST00000436874.1	37	CCDS44954.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.181072	0.57800	.	.	ENSG00000028203	ENST00000436874;ENST00000261219;ENST00000551472;ENST00000552821;ENST00000551311;ENST00000397792;ENST00000397796	T;T;T;T	0.46819	2.41;2.44;0.86;2.44	5.58	5.58	0.84498	.	0.322723	0.41294	D	0.000917	T	0.41328	0.1154	L	0.38175	1.15	0.36491	D	0.868436	B;B;B;B	0.30686	0.24;0.191;0.29;0.191	B;B;B;B	0.29785	0.067;0.049;0.107;0.03	T	0.51036	-0.8756	10	0.54805	T	0.06	-23.309	15.7537	0.78009	1.0:0.0:0.0:0.0	.	69;69;21;21	C9J154;Q9HBM0;F8W8C2;F2Z3A6	.;VEZA_HUMAN;.;.	G	69;21;88;60;21;21;69	ENSP00000410083:S69G;ENSP00000261219:S21G;ENSP00000449701:S88G;ENSP00000380894:S21G	ENSP00000261219:S21G	S	+	1	0	VEZT	94175093	1.000000	0.71417	0.997000	0.53966	0.836000	0.47400	6.326000	0.72905	2.126000	0.65437	0.383000	0.25322	AGT	.		0.348	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407804.2	NM_017599	
VPS13D	55187	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	12403094	12403094	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:12403094A>G	ENST00000358136.3	+	42	9001	c.8871A>G	c.(8869-8871)ggA>ggG	p.G2957G	VPS13D_ENST00000356315.4_Silent_p.G2932G	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AAGCAAGAGGAAAGTTAAGAC	0.368																																					p.G2957G		.											.	VPS13D	95	0			c.A8871G						.						83.0	78.0	80.0					1																	12403094		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon42			AAGAGGAAAGTTA	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8871A>G	1.37:g.12403094A>G		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	4.0	NM_015378		Silent	SNP	ENST00000358136.3	37	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	A	9.197	1.027583	0.19512	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.52	4.4	0.53042	.	.	.	.	.	T	0.58061	0.2096	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54289	-0.8316	4	.	.	.	.	7.6015	0.28079	0.7891:0.0:0.2109:0.0	.	.	.	.	G	1779	.	.	E	+	2	0	VPS13D	12325681	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.909000	0.48758	0.947000	0.37659	0.528000	0.53228	GAA	.		0.368	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
VPS35	55737	hgsc.bcm.edu;bcgsc.ca	37	16	46708512	46708512	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:46708512A>G	ENST00000299138.7	-	9	1033	c.975T>C	c.(973-975)ttT>ttC	p.F325F	VPS35_ENST00000568642.1_5'UTR	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	325					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AAAATATATCAAAAAGTTTAA	0.343																																					p.F325F		.											.	VPS35	90	0			c.T975C						.						38.0	38.0	38.0					16																	46708512		2203	4300	6503	SO:0001819	synonymous_variant	55737	exon9			TATATCAAAAAGT	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.975T>C	16.37:g.46708512A>G		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	4.0	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Silent	SNP	ENST00000299138.7	37	CCDS10721.1																																																																																			.		0.343	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
WDR87	83889	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	38383676	38383676	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:38383676C>G	ENST00000303868.5	-	4	2774	c.2550G>C	c.(2548-2550)atG>atC	p.M850I	WDR87_ENST00000447313.2_Missense_Mutation_p.M889I	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	850										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGGAAAGTCTCATTTCTAGGA	0.398																																					p.M850I		.											.	.	.	0			c.G2550C						.						149.0	117.0	127.0					19																	38383676		692	1591	2283	SO:0001583	missense	83889	exon4			AAGTCTCATTTCT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2550G>C	19.37:g.38383676C>G	ENSP00000368025:p.Met850Ile	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	7.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	37	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	C	2.080	-0.410868	0.04799	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.09538	2.97;2.97	5.1	-0.999	0.10208	.	1.399710	0.04479	N	0.377488	T	0.08846	0.0219	L	0.36672	1.1	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.09377	0.004;0.004	T	0.38156	-0.9674	10	0.30854	T	0.27	2.6908	4.8338	0.13454	0.0:0.4559:0.1557:0.3884	.	850;889	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	I	889;850	ENSP00000405012:M889I;ENSP00000368025:M850I	ENSP00000368025:M850I	M	-	3	0	WDR87	43075516	0.004000	0.15560	0.039000	0.18376	0.271000	0.26615	-0.369000	0.07533	-0.025000	0.13918	0.643000	0.83706	ATG	.		0.398	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
WNT9B	7484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	44953863	44953863	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:44953863G>T	ENST00000290015.2	+	4	906	c.853G>T	c.(853-855)Gag>Tag	p.E285*	WNT9B_ENST00000393461.2_Nonsense_Mutation_p.E285*	NM_003396.1	NP_003387.1	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family, member 9B	285					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to starvation (GO:0009267)|collecting duct development (GO:0072044)|cornea development in camera-type eye (GO:0061303)|embryonic cranial skeleton morphogenesis (GO:0048701)|establishment of planar polarity involved in nephron morphogenesis (GO:0072046)|in utero embryonic development (GO:0001701)|kidney rudiment formation (GO:0072003)|male genitalia development (GO:0030539)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesonephric duct formation (GO:0072181)|metanephric tubule formation (GO:0072174)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|positive regulation of catalytic activity (GO:0043085)|regulation of asymmetric cell division (GO:0009786)|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003339)|regulation of protein phosphorylation (GO:0001932)|regulation of tube size (GO:0035150)|response to retinoic acid (GO:0032526)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(2)|lung(8)	10			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GGTGTACATGGAGGACTCACC	0.677																																					p.E285X		.											.	WNT9B	522	0			c.G853T						.						46.0	50.0	48.0					17																	44953863		2201	4293	6494	SO:0001587	stop_gained	7484	exon4			TACATGGAGGACT	AF028703	CCDS11506.1	17q21	2008-01-07	2003-03-11	2003-03-14		ENSG00000158955		"""Wingless-type MMTV integration sites"""	12779	protein-coding gene	gene with protein product		602864	"""wingless-type MMTV integration site family, member 15"""	WNT15		9441749, 11713592	Standard	NM_003396		Approved	WNT14B	uc002ikw.1	O14905		ENST00000290015.2:c.853G>T	17.37:g.44953863G>T	ENSP00000290015:p.Glu285*	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	76.0	NM_003396	Q6UXT4|Q96Q09	Nonsense_Mutation	SNP	ENST00000290015.2	37	CCDS11506.1	.	.	.	.	.	.	.	.	.	.	G	32	5.162681	0.94727	.	.	ENSG00000158955	ENST00000376843;ENST00000393461;ENST00000290015	.	.	.	4.69	4.69	0.59074	.	0.051938	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.8129	0.88622	0.0:0.0:1.0:0.0	.	.	.	.	X	279;285;285	.	ENSP00000290015:E285X	E	+	1	0	WNT9B	42308862	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.653000	0.98506	2.434000	0.82447	0.561000	0.74099	GAG	.		0.677	WNT9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440433.1	NM_003396	
XIRP1	165904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	39226588	39226588	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:39226588A>G	ENST00000340369.3	-	2	4577	c.4349T>C	c.(4348-4350)aTg>aCg	p.M1450T	XIRP1_ENST00000421646.1_Missense_Mutation_p.M133T|XIRP1_ENST00000396251.1_3'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1450					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GGAACCTTCCATGGGCTGCTC	0.627																																					p.M1450T		.											.	XIRP1	158	0			c.T4349C						.						53.0	65.0	61.0					3																	39226588		2203	4300	6503	SO:0001583	missense	165904	exon2			CCTTCCATGGGCT	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4349T>C	3.37:g.39226588A>G	ENSP00000343140:p.Met1450Thr	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.300437	0.23650	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	T;T	0.20069	3.77;2.1	4.33	-8.67	0.00863	.	1.219840	0.05617	U	0.579108	T	0.08447	0.0210	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30794	-0.9966	10	0.13853	T	0.58	.	0.8619	0.01195	0.1928:0.2363:0.338:0.2329	.	1450	Q702N8	XIRP1_HUMAN	T	1450;133	ENSP00000343140:M1450T;ENSP00000391645:M133T	ENSP00000343140:M1450T	M	-	2	0	XIRP1	39201592	0.000000	0.05858	0.000000	0.03702	0.493000	0.33554	-0.032000	0.12266	-1.801000	0.01245	0.533000	0.62120	ATG	.		0.627	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
ZBTB1	22890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64989571	64989571	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:64989571G>T	ENST00000554015.1	+	4	1780	c.1349G>T	c.(1348-1350)tGt>tTt	p.C450F	RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000394712.2_Missense_Mutation_p.C450F|ZBTB1_ENST00000358738.3_Missense_Mutation_p.C450F			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	450					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		ATCTGTGCATGTGGTAAATGT	0.438																																					p.C450F		.											.	ZBTB1	91	0			c.G1349T						.						107.0	105.0	106.0					14																	64989571		2203	4300	6503	SO:0001583	missense	22890	exon2			GTGCATGTGGTAA	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1349G>T	14.37:g.64989571G>T	ENSP00000451000:p.Cys450Phe	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	44.0	NM_014950	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	37	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458707	0.63401	.	.	ENSG00000126804	ENST00000554015;ENST00000358738;ENST00000394712	T;T;T	0.18016	2.24;2.43;2.24	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000001	T	0.31231	0.0790	L	0.29908	0.895	0.80722	D	1	D;P	0.58268	0.982;0.948	P;P	0.60473	0.875;0.603	T	0.00961	-1.1499	10	0.87932	D	0	-18.564	20.5568	0.99304	0.0:0.0:1.0:0.0	.	450;450	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	F	450	ENSP00000451000:C450F;ENSP00000351587:C450F;ENSP00000378201:C450F	ENSP00000351587:C450F	C	+	2	0	ZBTB1	64059324	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	TGT	.		0.438	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
ZFP1	162239	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	75204019	75204019	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:75204019A>G	ENST00000393430.2	+	4	1135	c.1011A>G	c.(1009-1011)tcA>tcG	p.S337S	ZFP1_ENST00000332307.4_Silent_p.S304S|ZFP1_ENST00000570010.1_Silent_p.S337S|ZFP1_ENST00000568079.1_3'UTR|ZFP1_ENST00000464850.1_3'UTR			Q6P2D0	ZFP1_HUMAN	ZFP1 zinc finger protein	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	12						TCCAGAACTCACAGCTCATCA	0.418																																					p.S337S	NSCLC(187;1429 2122 10143 20357 42217)	.											.	ZFP1	92	0			c.A1011G						.						80.0	76.0	77.0					16																	75204019		2198	4300	6498	SO:0001819	synonymous_variant	162239	exon4			GAACTCACAGCTC	AK094761	CCDS10914.2	16q22.3	2013-01-08	2012-11-27		ENSG00000184517	ENSG00000184517		"""Zinc fingers, C2H2-type"", ""-"""	23328	protein-coding gene	gene with protein product			"""zinc finger protein 1 homolog (mouse)"", ""zinc finger protein 1"""			2574853	Standard	NM_153688		Approved	FLJ34243, ZNF475	uc002fdo.3	Q6P2D0	OTTHUMG00000137602	ENST00000393430.2:c.1011A>G	16.37:g.75204019A>G		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	4.0	NM_153688	A8K5Q7|B4DKG9|Q8N188|Q8N9F9	Silent	SNP	ENST00000393430.2	37	CCDS10914.2																																																																																			.		0.418	ZFP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269013.2	NM_153688	
ZFYVE26	23503	hgsc.bcm.edu;bcgsc.ca	37	14	68248209	68248209	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:68248209A>G	ENST00000347230.4	-	22	4548	c.4410T>C	c.(4408-4410)gaT>gaC	p.D1470D	ZFYVE26_ENST00000555452.1_Silent_p.D1470D	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1470					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCAGAGATGCATCCTTCACGG	0.522																																					p.D1470D		.											.	ZFYVE26	162	0			c.T4410C						.						111.0	107.0	108.0					14																	68248209		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon22			AGATGCATCCTTC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.4410T>C	14.37:g.68248209A>G		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	4.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	37	CCDS9788.1																																																																																			.		0.522	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22155053	22155053	+	Missense_Mutation	SNP	C	C	A	rs373937489		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:22155053C>A	ENST00000397126.4	-	4	2931	c.2783G>T	c.(2782-2784)tGg>tTg	p.W928L	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	928					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GACTGACAACCAGCTGAAGGC	0.393																																					p.W928L		.											.	ZNF208	7	0			c.G2783T						.						52.0	54.0	53.0					19																	22155053		2053	4210	6263	SO:0001583	missense	7757	exon4			GACAACCAGCTGA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2783G>T	19.37:g.22155053C>A	ENSP00000380315:p.Trp928Leu	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	13.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	1.440	-0.567797	0.03910	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.06142	3.34	3.07	-6.14	0.02111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04679	0.0127	.	.	.	0.09310	N	1	P	0.50066	0.931	P	0.51833	0.681	T	0.15407	-1.0438	8	0.11182	T	0.66	.	1.2557	0.01991	0.1471:0.2899:0.1456:0.4173	.	828	O43345	ZN208_HUMAN	L	928;828	ENSP00000380315:W928L	ENSP00000380315:W928L	W	-	2	0	ZNF208	21946893	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.300000	0.02751	-1.180000	0.02734	-0.385000	0.06624	TGG	.		0.393	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF345	25850	hgsc.bcm.edu;bcgsc.ca	37	19	37368330	37368330	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:37368330A>G	ENST00000529555.1	+	2	1386	c.598A>G	c.(598-600)Aaa>Gaa	p.K200E	ZNF345_ENST00000589046.1_Missense_Mutation_p.K200E|ZNF345_ENST00000420450.1_Missense_Mutation_p.K200E|ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000526123.1_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	200					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACAGGTGAGAAACCTTATGA	0.418																																					p.K200E		.											.	ZNF345	91	0			c.A598G						.						67.0	65.0	66.0					19																	37368330		2203	4300	6503	SO:0001583	missense	25850	exon4			GGTGAGAAACCTT	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.598A>G	19.37:g.37368330A>G	ENSP00000431202:p.Lys200Glu	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_001242476		Missense_Mutation	SNP	ENST00000529555.1	37	CCDS12497.1	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898255	0.72639	.	.	ENSG00000251247	ENST00000420450;ENST00000529555	T;T	0.27104	1.69;1.69	3.86	3.86	0.44501	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48390	0.1497	M	0.75085	2.285	0.30349	N	0.784943	D	0.89917	1.0	D	0.72075	0.976	T	0.49351	-0.8949	8	.	.	.	.	10.9193	0.47154	1.0:0.0:0.0:0.0	.	200	Q14585	ZN345_HUMAN	E	200	ENSP00000431216:K200E;ENSP00000431202:K200E	.	K	+	1	0	ZNF345	42060170	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.095000	0.64529	1.731000	0.51592	0.459000	0.35465	AAA	.		0.418	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1		
ZNF17	7565	hgsc.bcm.edu;bcgsc.ca	37	19	57932584	57932584	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:57932584T>C	ENST00000601808.1	+	3	1937	c.1724T>C	c.(1723-1725)gTt>gCt	p.V575A	AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000307658.7_Missense_Mutation_p.V577A	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	575					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		CACCAAAAAGTTCACACTAGG	0.408																																					p.V575A	Melanoma(149;1637 1853 29914 42869 44988)	.											.	ZNF17	90	0			c.T1724C						.						51.0	51.0	51.0					19																	57932584		2020	4211	6231	SO:0001583	missense	7565	exon3			AAAAAGTTCACAC	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.1724T>C	19.37:g.57932584T>C	ENSP00000471905:p.Val575Ala	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	4.0	NM_006959	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	ENST00000601808.1	37	CCDS42636.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685649	0.47991	.	.	ENSG00000186272	ENST00000307658	.	.	.	2.45	1.37	0.22104	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47377	0.1442	L	0.38531	1.155	0.09310	N	1	D;B	0.71674	0.998;0.129	D;B	0.67103	0.949;0.048	T	0.28138	-1.0053	8	0.87932	D	0	.	5.7423	0.18100	0.0:0.2658:0.0:0.7342	.	577;575	P17021-2;P17021	.;ZNF17_HUMAN	A	575	.	ENSP00000302455:V575A	V	+	2	0	ZNF17	62624396	0.001000	0.12720	0.011000	0.14972	0.697000	0.40408	1.101000	0.31037	0.166000	0.19597	0.383000	0.25322	GTT	.		0.408	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959	
ZNF749	388567	broad.mit.edu;bcgsc.ca	37	19	57954874	57954874	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:57954874C>A	ENST00000334181.4	+	3	608	c.358C>A	c.(358-360)Ctg>Atg	p.L120M	AC004076.9_ENST00000596831.1_Intron	NM_001023561.2	NP_001018855.2	O43361	ZN749_HUMAN	zinc finger protein 749	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|lung(3)|prostate(1)	13		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)|Lung(386;0.177)		AGAGCATGACCTGCACCAAAA	0.512																																					p.L120M		.											.	.	.	0			c.C358A						.						123.0	109.0	114.0					19																	57954874		2203	4300	6503	SO:0001583	missense	388567	exon3			CATGACCTGCACC	AK122740	CCDS33132.2	19q13.43	2013-01-08			ENSG00000186230	ENSG00000186230		"""Zinc fingers, C2H2-type"", ""-"""	32783	protein-coding gene	gene with protein product							Standard	NM_001023561		Approved	FLJ16360	uc002qoq.2	O43361	OTTHUMG00000150372	ENST00000334181.4:c.358C>A	19.37:g.57954874C>A	ENSP00000333980:p.Leu120Met	Somatic	144.0	1.0		WXS	Illumina HiSeq	Phase_I	145.0	8.0	NM_001023561		Missense_Mutation	SNP	ENST00000334181.4	37	CCDS33132.2	.	.	.	.	.	.	.	.	.	.	C	10.40	1.338412	0.24253	.	.	ENSG00000186230	ENST00000334181;ENST00000415248	T;T	0.25749	3.84;1.78	2.07	0.955	0.19602	.	.	.	.	.	T	0.21674	0.0522	L	0.32530	0.975	0.09310	N	1	D	0.56521	0.976	P	0.47528	0.549	T	0.13442	-1.0509	9	0.33940	T	0.23	.	7.877	0.29599	0.2462:0.7538:0.0:0.0	.	120	O43361	ZN749_HUMAN	M	120;33	ENSP00000333980:L120M;ENSP00000397745:L33M	ENSP00000333980:L120M	L	+	1	2	ZNF749	62646686	0.000000	0.05858	0.005000	0.12908	0.047000	0.14425	-1.708000	0.01891	0.392000	0.25172	0.313000	0.20887	CTG	.		0.512	ZNF749-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317879.1	NM_001023561	
ZNF549	256051	hgsc.bcm.edu;bcgsc.ca	37	19	58048846	58048846	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:58048846A>G	ENST00000376233.3	+	4	655	c.474A>G	c.(472-474)aaA>aaG	p.K158K	ZNF549_ENST00000594943.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000240719.3_Silent_p.K145K	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTGGAGAGAAACACATCAGAA	0.458																																					p.K158K		.											.	ZNF549	91	0			c.A474G						.						79.0	72.0	74.0					19																	58048846		2203	4300	6503	SO:0001819	synonymous_variant	256051	exon4			AGAGAAACACATC	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.474A>G	19.37:g.58048846A>G		Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	5.0	NM_001199295	B3KV91|O43336|Q8NAR4	Silent	SNP	ENST00000376233.3	37	CCDS56106.1																																																																																			.		0.458	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	
ZNF860	344787	hgsc.bcm.edu;bcgsc.ca	37	3	32030646	32030646	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:32030646T>C	ENST00000360311.4	+	2	624	c.75T>C	c.(73-75)acT>acC	p.T25T		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	25	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						GACACTTGACTTTTAGGGATG	0.478																																					p.T25T		.											.	ZNF860	1	0			c.T75C						.						48.0	44.0	45.0					3																	32030646		692	1591	2283	SO:0001819	synonymous_variant	344787	exon2			CTTGACTTTTAGG	AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.75T>C	3.37:g.32030646T>C		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	4.0	NM_001137674	B4DFA4	Silent	SNP	ENST00000360311.4	37	CCDS46784.1																																																																																			.		0.478	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1		
ICA1	3382	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	8198174	8198175	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	TG	TG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:8198174_8198175TG>CT	ENST00000402384.3	-	7	953_954	c.687_688CA>AG	c.(685-690)caCAtg>caAGtg	p.229_230HM>QV	ICA1_ENST00000406470.2_Missense_Mutation_p.229_230HM>QV|ICA1_ENST00000265577.7_Missense_Mutation_p.228_229HM>QV|ICA1_ENST00000396675.3_Missense_Mutation_p.229_230HM>QV|ICA1_ENST00000401396.1_Missense_Mutation_p.217_218HM>QV|ICA1_ENST00000407906.1_Missense_Mutation_p.229_230HM>QV|ICA1_ENST00000422063.2_Missense_Mutation_p.229_230HM>QV			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	229	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GTTGCTAGCATGTGAGACAAGA	0.371																																					p.HM229QV		.											.	.	.	0			.						.																																			SO:0001583	missense	3382	.			CTAGCATGTGAGA		CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.687_688delinsCT	7.37:g.8198174_8198175delinsCT	ENSP00000385570:p.H229_M230delinsQV	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	46.0	.	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Missense_Mutation	DNP	ENST00000402384.3	37	CCDS34602.1																																																																																			.		0.371	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324793.1	NM_004968	
