#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	broad.mit.edu;bcgsc.ca	37	7	48319233	48319233	+	Silent	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:48319233A>G	ENST00000435803.1	+	18	8466	c.8442A>G	c.(8440-8442)aaA>aaG	p.K2814K		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2814					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AACTTGAAAAAGCAATCCATA	0.343																																					p.K2814K		.											.	ABCA13	521	0			c.A8442G						.						69.0	70.0	70.0					7																	48319233		1806	4079	5885	SO:0001819	synonymous_variant	154664	exon18			TGAAAAAGCAATC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8442A>G	7.37:g.48319233A>G		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	5.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.343	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ACCS	84680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	44096174	44096174	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr11:44096174A>C	ENST00000263776.8	+	5	866	c.432A>C	c.(430-432)gaA>gaC	p.E144D	CTD-2609K8.3_ENST00000531268.1_RNA|ACCS_ENST00000432284.2_Missense_Mutation_p.S121R|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	144					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						TCCGGGAGGAAGTGGCCAAGT	0.567																																					p.E144D	Esophageal Squamous(158;148 1889 8077 23160 41213)	.											.	ACCS	155	0			c.A432C						.						180.0	161.0	167.0					11																	44096174		2203	4300	6503	SO:0001583	missense	84680	exon5			GGAGGAAGTGGCC	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.432A>C	11.37:g.44096174A>C	ENSP00000263776:p.Glu144Asp	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	13.0	NM_032592	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	37	CCDS7907.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.64|16.64	3.178139|3.178139	0.57692|0.57692	.|.	.|.	ENSG00000110455|ENSG00000110455	ENST00000263776|ENST00000432284	T|T	0.22743|0.42131	1.94|0.98	5.78|5.78	5.78|5.78	0.91487|0.91487	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62405|0.62405	0.2425|0.2425	M|M	0.78456|0.78456	2.415|2.415	0.26504|0.26504	N|N	0.974715|0.974715	D;D|D	0.76494|0.61080	0.999;0.999|0.989	D;D|P	0.79108|0.58873	0.966;0.992|0.847	T|T	0.60915|0.60915	-0.7168|-0.7168	10|9	0.44086|0.87932	T|D	0.13|0	-13.5312|-13.5312	14.3393|14.3393	0.66614|0.66614	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	71;144|121	B4DYM9;Q96QU6|B4E219	.;1A1L1_HUMAN|.	D|R	144|121	ENSP00000263776:E144D|ENSP00000391775:S121R	ENSP00000263776:E144D|ENSP00000391775:S121R	E|S	+|+	3|1	2|0	ACCS|ACCS	44052750|44052750	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	1.719000|1.719000	0.38011|0.38011	2.205000|2.205000	0.71048|0.71048	0.533000|0.533000	0.62120|0.62120	GAA|AGT	.		0.567	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
ACPP	55	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	132061394	132061394	+	Splice_Site	SNP	A	A	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr3:132061394A>C	ENST00000336375.5	+	6	645		c.e6-1		ACPP_ENST00000351273.7_Splice_Site|ACPP_ENST00000475741.1_Splice_Site	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate						adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						TTTGTGTTTCAGGATTTTATA	0.383																																					.		.											.	ACPP	91	0			c.556-2A>C						.						122.0	128.0	126.0					3																	132061394		2203	4300	6503	SO:0001630	splice_region_variant	55	exon6			TGTTTCAGGATTT		CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.556-1A>C	3.37:g.132061394A>C		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	18.0	NM_001099	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Splice_Site	SNP	ENST00000336375.5	37	CCDS3073.1	.	.	.	.	.	.	.	.	.	.	A	19.70	3.875668	0.72180	.	.	ENSG00000014257	ENST00000336375;ENST00000495911;ENST00000475741;ENST00000351273	.	.	.	6.08	6.08	0.98989	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.043	0.58910	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACPP	133544084	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.412000	0.59787	2.333000	0.79357	0.482000	0.46254	.	.		0.383	ACPP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356699.2	NM_001099	Intron
TK1	7083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76183502	76183502	+	5'Flank	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr17:76183502G>A	ENST00000301634.7	-	0	0				AFMID_ENST00000409257.5_Silent_p.K17K|TK1_ENST00000588734.1_5'Flank|AFMID_ENST00000586731.1_De_novo_Start_InFrame|AFMID_ENST00000589256.1_Silent_p.K17K|AFMID_ENST00000327898.5_Silent_p.K17K|TK1_ENST00000590862.1_5'Flank|TK1_ENST00000590430.1_5'Flank|AFMID_ENST00000588800.1_Silent_p.K17K|AFMID_ENST00000591952.1_Silent_p.K17K|TK1_ENST00000405273.1_5'Flank	NM_003258.4	NP_003249.3	P04183	KITH_HUMAN	thymidine kinase 1, soluble						deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|digestive tract development (GO:0048565)|DNA replication (GO:0006260)|fetal process involved in parturition (GO:0060138)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|response to copper ion (GO:0046688)|response to cortisol (GO:0051414)|response to nutrient levels (GO:0031667)|response to toxic substance (GO:0009636)|skeletal muscle cell proliferation (GO:0014856)|small molecule metabolic process (GO:0044281)|thymidine metabolic process (GO:0046104)	cytosol (GO:0005829)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|nucleoside kinase activity (GO:0019206)|thymidine kinase activity (GO:0004797)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|urinary_tract(2)	4			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.0804)|Lung(188;0.23)		Trifluridine(DB00432)|Zidovudine(DB00495)	CTTGGAAGAAGATGTCTGCAG	0.527																																					p.K17K		.											.	AFMID	136	0			c.G51A						.						149.0	130.0	137.0					17																	76183502		2203	4300	6503	SO:0001631	upstream_gene_variant	125061	exon1			GAAGAAGATGTCT		CCDS11754.1	17q23.2-q25.3	2012-10-02			ENSG00000167900	ENSG00000167900	2.7.1.21		11830	protein-coding gene	gene with protein product		188300					Standard	NM_003258		Approved		uc002juw.2	P04183	OTTHUMG00000150674		17.37:g.76183502G>A	Exception_encountered	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	20.0	NM_001145526	B2RC58|Q969V0|Q9UMG9	Silent	SNP	ENST00000301634.7	37	CCDS11754.1																																																																																			.		0.527	TK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319577.1	NM_003258	
ALG6	29929	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	63876884	63876884	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:63876884C>A	ENST00000371108.4	+	8	867	c.562C>A	c.(562-564)Cta>Ata	p.L188I	ALG6_ENST00000263440.4_Missense_Mutation_p.L190I	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	188					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						CTGCGACCTCCTAGGGTCACT	0.368																																					p.L188I		.											.	ALG6	90	0			c.C562A						.						205.0	203.0	204.0					1																	63876884		2203	4300	6503	SO:0001583	missense	29929	exon8			GACCTCCTAGGGT	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.562C>A	1.37:g.63876884C>A	ENSP00000360149:p.Leu188Ile	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	10.0	NM_013339	B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	ENST00000371108.4	37	CCDS30735.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.166270	0.38217	.	.	ENSG00000088035	ENST00000371108;ENST00000263440	D;D	0.83992	-1.79;-1.79	5.46	4.54	0.55810	.	0.066389	0.64402	D	0.000008	T	0.71500	0.3347	L	0.46819	1.47	0.46586	D	0.999112	B	0.19935	0.04	B	0.35278	0.199	T	0.70400	-0.4882	10	0.37606	T	0.19	-4.4893	11.573	0.50845	0.0:0.8556:0.0:0.1444	.	190	A2A2G4	.	I	188;190	ENSP00000360149:L188I;ENSP00000263440:L190I	ENSP00000263440:L190I	L	+	1	2	ALG6	63649472	0.258000	0.24033	0.998000	0.56505	0.772000	0.43724	0.444000	0.21661	1.446000	0.47643	0.591000	0.81541	CTA	.		0.368	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000025330.2	NM_013339	
BCKDK	10295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	31121012	31121012	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr16:31121012delC	ENST00000394951.1	+	5	906	c.283delC	c.(283-285)cagfs	p.Q96fs	AC135050.1_ENST00000517000.2_RNA|BCKDK_ENST00000219794.6_Frame_Shift_Del_p.Q96fs|BCKDK_ENST00000287507.3_Frame_Shift_Del_p.Q96fs|BCKDK_ENST00000394950.3_Frame_Shift_Del_p.Q96fs			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	96					branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						TCGGTACCTGCAGCAAGAACT	0.552																																					p.Q95fs		.											.	BCKDK	765	0			c.283delC						.						76.0	72.0	73.0					16																	31121012		2197	4300	6497	SO:0001589	frameshift_variant	10295	exon4			TACCTGCAGCAAG	AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.283delC	16.37:g.31121012delC	ENSP00000378405:p.Gln96fs	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	20.0	NM_005881	A8MY43|Q6FGL4|Q96G95|Q96IN5	Frame_Shift_Del	DEL	ENST00000394951.1	37	CCDS10705.1																																																																																			.		0.552	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000108514.1	NM_005881	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	89352532	89352532	+	Silent	SNP	C	C	T	rs149525788		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr16:89352532C>T	ENST00000301030.4	-	8	1267	c.807G>A	c.(805-807)acG>acA	p.T269T	ANKRD11_ENST00000378330.2_Silent_p.T269T	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	269					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CTTTCAGCGGCGTCTCGCCTT	0.602																																					p.T269T		.											.	ANKRD11	139	0			c.G807A						.						161.0	152.0	155.0					16																	89352532		2198	4300	6498	SO:0001819	synonymous_variant	29123	exon8			CAGCGGCGTCTCG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.807G>A	16.37:g.89352532C>T		Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	10.0	NM_001256183	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																			C|1.000;G|0.000		0.602	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu	37	2	32640007	32640007	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:32640007G>T	ENST00000421745.2	+	10	1782	c.1648G>T	c.(1648-1650)Gaa>Taa	p.E550*		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	550					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CTCTAAGAGTGAAAAGACAAA	0.378																																					p.E550X	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.G1648T						.						59.0	61.0	61.0					2																	32640007		2203	4300	6503	SO:0001587	stop_gained	57448	exon10			AAGAGTGAAAAGA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1648G>T	2.37:g.32640007G>T	ENSP00000393596:p.Glu550*	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	5.0	NM_016252	Q9ULD1	Nonsense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	38	7.113143	0.98070	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.07	5.07	0.68467	.	0.123114	0.53938	D	0.000052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.8213	0.92099	0.0:0.0:1.0:0.0	.	.	.	.	X	550	.	ENSP00000393596:E550X	E	+	1	0	BIRC6	32493511	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.751000	0.98889	2.528000	0.85240	0.650000	0.86243	GAA	.		0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
C11orf80	79703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66568539	66568539	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr11:66568539A>G	ENST00000360962.4	+	8	818	c.811A>G	c.(811-813)Att>Gtt	p.I271V	C11orf80_ENST00000525449.2_Missense_Mutation_p.I116V|C11orf80_ENST00000527634.1_Missense_Mutation_p.I52V|C11orf80_ENST00000346672.4_Missense_Mutation_p.I116V|C11orf80_ENST00000532565.2_Missense_Mutation_p.I52V|C11orf80_ENST00000540737.1_Missense_Mutation_p.I105V	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	271										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						TGGGAATGGAATTGCTCTTTT	0.443																																					p.I271V		.											.	.	.	0			c.A811G						.						125.0	118.0	120.0					11																	66568539		1957	4159	6116	SO:0001583	missense	79703	exon8			AATGGAATTGCTC			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.811A>G	11.37:g.66568539A>G	ENSP00000354227:p.Ile271Val	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	16.0	NM_024650	Q9H677	Missense_Mutation	SNP	ENST00000360962.4	37	CCDS53664.1	.	.	.	.	.	.	.	.	.	.	A	14.48	2.549148	0.45383	.	.	ENSG00000173715	ENST00000524551;ENST00000525908;ENST00000360962;ENST00000346672;ENST00000527634;ENST00000528340;ENST00000540737;ENST00000525449	T;T	0.36878	1.37;1.23	4.98	1.29	0.21616	.	0.532611	0.17254	N	0.181021	T	0.22166	0.0534	L	0.27053	0.805	0.22389	N	0.999142	B;B;B	0.20052	0.015;0.015;0.041	B;B;B	0.19666	0.015;0.015;0.026	T	0.16512	-1.0400	10	0.35671	T	0.21	-1.6408	6.7445	0.23454	0.7164:0.0:0.2836:0.0	.	52;116;105	E9PKM2;Q8N6T0;E9PKZ8	.;CK080_HUMAN;.	V	52;222;271;116;52;105;105;116	ENSP00000432039:I222V;ENSP00000354227:I271V	ENSP00000317408:I116V	I	+	1	0	C11orf80	66325115	1.000000	0.71417	0.927000	0.36925	0.779000	0.44077	1.723000	0.38053	0.062000	0.16340	0.456000	0.33151	ATT	.		0.443	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
C1orf50	79078	ucsc.edu;bcgsc.ca	37	1	43240502	43240502	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:43240502A>G	ENST00000372525.5	+	4	420	c.377A>G	c.(376-378)gAg>gGg	p.E126G	C1orf50_ENST00000536543.1_5'UTR|RP5-994D16.9_ENST00000447572.1_RNA|C1orf50_ENST00000468913.2_3'UTR	NM_024097.3	NP_077002.2	Q9BV19	CA050_HUMAN	chromosome 1 open reading frame 50	126										large_intestine(2)|ovary(1)|pancreas(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TATAAACGGGAGAGTGGTCAG	0.393																																					p.E126G		.											.	C1orf50	91	0			c.A377G						.						118.0	119.0	119.0					1																	43240502		2203	4300	6503	SO:0001583	missense	79078	exon4			AACGGGAGAGTGG	BC001711	CCDS473.1	1p34.2	2012-06-25			ENSG00000164008	ENSG00000164008			28795	protein-coding gene	gene with protein product						12477932	Standard	NM_024097		Approved	MGC955	uc001cia.4	Q9BV19	OTTHUMG00000007568	ENST00000372525.5:c.377A>G	1.37:g.43240502A>G	ENSP00000361603:p.Glu126Gly	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_024097		Missense_Mutation	SNP	ENST00000372525.5	37	CCDS473.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.838630	0.71373	.	.	ENSG00000164008	ENST00000372525	T	0.48836	0.8	6.17	5.01	0.66863	.	0.208945	0.48767	D	0.000179	T	0.48786	0.1519	L	0.57536	1.79	0.21020	N	0.999805	P	0.46578	0.88	P	0.45712	0.491	T	0.64076	-0.6492	9	0.46703	T	0.11	.	11.967	0.53040	0.8557:0.1443:0.0:0.0	.	126	Q9BV19	CA050_HUMAN	G	126	ENSP00000361603:E126G	ENSP00000361603:E126G	E	+	2	0	C1orf50	43013089	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.632000	0.54287	2.371000	0.80710	0.533000	0.62120	GAG	.		0.393	C1orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020001.2	NM_024097	
ERICH3	127254	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	75038452	75038452	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:75038452G>A	ENST00000326665.5	-	14	3160	c.2942C>T	c.(2941-2943)gCc>gTc	p.A981V	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		981	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TCTCTCTTTGGCTGGTTCCTC	0.542																																					p.A981V		.											.	C1orf173	94	0			c.C2942T						.						127.0	114.0	119.0					1																	75038452		2203	4300	6503	SO:0001583	missense	127254	exon14			TCTTTGGCTGGTT																												ENST00000326665.5:c.2942C>T	1.37:g.75038452G>A	ENSP00000322609:p.Ala981Val	Somatic	135.0	2.0		WXS	Illumina HiSeq	Phase_I	158.0	54.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	37	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.629008	0.87560	.	.	ENSG00000178965	ENST00000326665	T	0.13420	2.59	4.87	-1.23	0.09465	.	.	.	.	.	T	0.02571	0.0078	L	0.36672	1.1	0.09310	N	1	B	0.24258	0.1	B	0.20955	0.032	T	0.44251	-0.9340	9	0.35671	T	0.21	-0.528	2.4701	0.04562	0.1544:0.1234:0.4698:0.2524	.	981	Q5RHP9	CA173_HUMAN	V	981	ENSP00000322609:A981V	ENSP00000322609:A981V	A	-	2	0	C1orf173	74811040	0.000000	0.05858	0.002000	0.10522	0.739000	0.42172	-0.948000	0.03897	0.075000	0.16796	0.462000	0.41574	GCC	.		0.542	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
C2orf71	388939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	29296015	29296015	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:29296015C>A	ENST00000331664.5	-	1	1112	c.1113G>T	c.(1111-1113)tgG>tgT	p.W371C		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	371					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GTGCAAGGTCCCAGCTGGTTT	0.582																																					p.W371C		.											.	C2orf71	91	0			c.G1113T						.						60.0	61.0	61.0					2																	29296015		2124	4249	6373	SO:0001583	missense	388939	exon1			AAGGTCCCAGCTG		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1113G>T	2.37:g.29296015C>A	ENSP00000332809:p.Trp371Cys	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	42.0	NM_001029883		Missense_Mutation	SNP	ENST00000331664.5	37	CCDS42669.1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.833224	0.32421	.	.	ENSG00000179270	ENST00000331664	T	0.21734	1.99	5.51	3.57	0.40892	.	0.646123	0.15732	N	0.247398	T	0.17152	0.0412	L	0.39633	1.23	0.49798	D	0.999821	B	0.14438	0.01	B	0.13407	0.009	T	0.03945	-1.0990	10	0.41790	T	0.15	-3.002	8.6972	0.34303	0.458:0.4217:0.1203:0.0	.	371	A6NGG8	CB071_HUMAN	C	371	ENSP00000332809:W371C	ENSP00000332809:W371C	W	-	3	0	C2orf71	29149519	0.993000	0.37304	1.000000	0.80357	0.637000	0.38172	0.257000	0.18369	1.291000	0.44653	0.561000	0.74099	TGG	.		0.582	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
C2orf57	165100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	232458647	232458647	+	Missense_Mutation	SNP	C	C	A	rs375509340		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:232458647C>A	ENST00000313965.2	+	1	1073	c.985C>A	c.(985-987)Cgc>Agc	p.R329S		NM_152614.2	NP_689827.2	Q53QW1	CB057_HUMAN	chromosome 2 open reading frame 57	329										endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	19		Renal(207;0.025)|all_hematologic(139;0.0735)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;1.33e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		GCCCAGCTTGCGCTCGGTCCC	0.667																																					p.R329S		.											.	C2orf57	91	0			c.C985A						.						44.0	47.0	46.0					2																	232458647		2203	4300	6503	SO:0001583	missense	165100	exon1			AGCTTGCGCTCGG	BC034405	CCDS2487.1	2q37.1	2008-02-05			ENSG00000177673	ENSG00000177673			28563	protein-coding gene	gene with protein product						12477932	Standard	NM_152614		Approved	MGC35154	uc002vrz.3	Q53QW1	OTTHUMG00000133226	ENST00000313965.2:c.985C>A	2.37:g.232458647C>A	ENSP00000315557:p.Arg329Ser	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	11.0	NM_152614	Q8N4F2	Missense_Mutation	SNP	ENST00000313965.2	37	CCDS2487.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.762614	0.31228	.	.	ENSG00000177673	ENST00000313965	T	0.25912	1.77	5.15	5.15	0.70609	.	0.000000	0.34507	N	0.003919	T	0.35068	0.0919	L	0.29908	0.895	0.32051	N	0.596887	D	0.58970	0.984	P	0.61132	0.884	T	0.32955	-0.9887	10	0.59425	D	0.04	-6.4431	13.9928	0.64378	0.0:1.0:0.0:0.0	.	329	Q53QW1	CB057_HUMAN	S	329	ENSP00000315557:R329S	ENSP00000315557:R329S	R	+	1	0	C2orf57	232166891	0.703000	0.27826	0.939000	0.37840	0.033000	0.12548	1.954000	0.40362	2.683000	0.91414	0.557000	0.71058	CGC	.		0.667	C2orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256962.1	NM_152614	
TBC1D32	221322	ucsc.edu;bcgsc.ca	37	6	121642787	121642787	+	Silent	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr6:121642787T>C	ENST00000398212.2	-	2	358	c.309A>G	c.(307-309)gaA>gaG	p.E103E	TBC1D32_ENST00000275159.6_Silent_p.E103E	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	103					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										ACTCTTTAGATTCTTGAGTTC	0.403																																					p.E103E		.											.	C6orf170	92	0			c.A309G						.						245.0	228.0	233.0					6																	121642787		1904	4118	6022	SO:0001819	synonymous_variant	221322	exon2			TTTAGATTCTTGA	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.309A>G	6.37:g.121642787T>C		Somatic	187.0	2.0		WXS	Illumina HiSeq	.	180.0	63.0	NM_152730	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Silent	SNP	ENST00000398212.2	37	CCDS43501.1																																																																																			.		0.403	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
CAMTA1	23261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	7797423	7797423	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:7797423G>A	ENST00000303635.7	+	15	3658	c.3451G>A	c.(3451-3453)Gcc>Acc	p.A1151T	CAMTA1_ENST00000439411.2_Missense_Mutation_p.A1151T	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		TTTGGGAATTGCCAGGTCACG	0.582			T	WWTR1	epitheliod hemangioendothelioma																																p.A1151T		.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	520	0			c.G3451A						.						97.0	99.0	98.0					1																	7797423		2203	4300	6503	SO:0001583	missense	23261	exon15			GGAATTGCCAGGT	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3451G>A	1.37:g.7797423G>A	ENSP00000306522:p.Ala1151Thr	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	25.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	37	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	G	33	5.236368	0.95240	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	T;T	0.56103	0.48;0.48	5.91	5.91	0.95273	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.79713	0.4493	M	0.90425	3.115	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.91635	0.999;0.996;0.998;0.992	T	0.82680	-0.0337	10	0.87932	D	0	-24.0447	20.2985	0.98592	0.0:0.0:1.0:0.0	.	1151;238;107;1151	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	T	1151;1151;238;107	ENSP00000306522:A1151T;ENSP00000402561:A1151T	ENSP00000306522:A1151T	A	+	1	0	CAMTA1	7720010	1.000000	0.71417	0.989000	0.46669	0.990000	0.78478	9.807000	0.99171	2.793000	0.96121	0.655000	0.94253	GCC	.		0.582	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
CAP2	10486	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	17514129	17514129	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr6:17514129G>C	ENST00000229922.2	+	7	1112	c.580G>C	c.(580-582)Gaa>Caa	p.E194Q	CAP2_ENST00000465994.1_Intron|CAP2_ENST00000493172.1_Intron|CAP2_ENST00000378990.2_Missense_Mutation_p.E168Q|CAP2_ENST00000489374.1_Intron	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	194					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			CATTTGGAGTGAACTTCAAGC	0.428																																					p.E194Q		.											.	CAP2	91	0			c.G580C						.						120.0	100.0	107.0					6																	17514129		2203	4300	6503	SO:0001583	missense	10486	exon7			TGGAGTGAACTTC	BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.580G>C	6.37:g.17514129G>C	ENSP00000229922:p.Glu194Gln	Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	70.0	23.0	NM_006366	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Missense_Mutation	SNP	ENST00000229922.2	37	CCDS4539.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.385067	0.82792	.	.	ENSG00000112186	ENST00000229922;ENST00000378990	T;T	0.14391	2.51;2.51	6.08	6.08	0.98989	Adenylate cyclase-associated CAP, N-terminal (2);	0.098299	0.64402	D	0.000001	T	0.19208	0.0461	M	0.71296	2.17	0.80722	D	1	B;B	0.20550	0.046;0.017	B;B	0.37943	0.261;0.104	T	0.01853	-1.1260	10	0.66056	D	0.02	-21.8157	20.2598	0.98436	0.0:0.0:1.0:0.0	.	168;194	E9PDI2;P40123	.;CAP2_HUMAN	Q	194;168	ENSP00000229922:E194Q;ENSP00000368275:E168Q	ENSP00000229922:E194Q	E	+	1	0	CAP2	17622108	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	8.016000	0.88706	2.890000	0.99128	0.655000	0.94253	GAA	.		0.428	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039952.2		
CCDC163P	126661	ucsc.edu;bcgsc.ca	37	1	45962277	45962277	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:45962277A>G	ENST00000432082.1	-	4	645	c.281T>C	c.(280-282)cTg>cCg	p.L94P	CCDC163P_ENST00000490551.3_Missense_Mutation_p.L94P|CCDC163P_ENST00000502793.2_5'UTR|CCDC163P_ENST00000488405.2_Missense_Mutation_p.L94P					coiled-coil domain containing 163, pseudogene											cervix(1)|endometrium(1)	2						CTGTTTCAGCAGCAGCTCCTG	0.547																																					.		.											.	.	.	0			.						.						52.0	58.0	56.0					1																	45962277		1990	4171	6161	SO:0001583	missense	126661	.			TTCAGCAGCAGCT	BC047421		1p34.1	2010-06-14	2009-12-17	2009-12-17	ENSG00000236624	ENSG00000236624			27003	pseudogene	pseudogene			"""chromosome 1 open reading frame 231"""	C1orf231		18672041	Standard	NR_033296		Approved	LOC126661	uc001cnw.3		OTTHUMG00000007741	ENST00000432082.1:c.281T>C	1.37:g.45962277A>G	ENSP00000435596:p.Leu94Pro	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	42.0	5.0	.		RNA	SNP	ENST00000432082.1	37		.	.	.	.	.	.	.	.	.	.	A	14.72	2.620152	0.46736	.	.	ENSG00000236624	ENST00000490551;ENST00000432082;ENST00000488405	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	T	0.76550	0.4003	.	.	.	0.52501	D	0.999954	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.77593	-0.2530	7	0.49607	T	0.09	.	11.2218	0.48860	1.0:0.0:0.0:0.0	.	94;94	E9PLD6;F2Z3K3	.;.	P	94	.	ENSP00000431736:L94P	L	-	2	0	CCDC163P	45734864	0.999000	0.42202	1.000000	0.80357	0.283000	0.27025	3.774000	0.55341	2.209000	0.71365	0.519000	0.50382	CTG	.		0.547	CCDC163P-006	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000349850.4	NM_001102601	
CAPZA1	829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	113192075	113192075	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:113192075A>T	ENST00000263168.3	+	3	811	c.139A>T	c.(139-141)Agg>Tgg	p.R47W	CAPZA1_ENST00000476936.1_3'UTR	NM_006135.2	NP_006126.1	P52907	CAZA1_HUMAN	capping protein (actin filament) muscle Z-line, alpha 1	47					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)	actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|WASH complex (GO:0071203)	actin binding (GO:0003779)			breast(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAATCTCCTCAGGGAAGGGGC	0.368																																					p.R47W		.											.	CAPZA1	514	0			c.A139T						.						107.0	103.0	104.0					1																	113192075		2203	4300	6503	SO:0001583	missense	829	exon3			CTCCTCAGGGAAG	U56637	CCDS30805.1	1p13.2	2014-05-09			ENSG00000116489	ENSG00000116489			1488	protein-coding gene	gene with protein product		601580				7665558, 9119363	Standard	NM_006135		Approved		uc001ecj.1	P52907	OTTHUMG00000011769	ENST00000263168.3:c.139A>T	1.37:g.113192075A>T	ENSP00000263168:p.Arg47Trp	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	25.0	NM_006135	Q53FQ6|Q6FHD5	Missense_Mutation	SNP	ENST00000263168.3	37	CCDS30805.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.668677	0.88348	.	.	ENSG00000116489	ENST00000263168	.	.	.	5.39	5.39	0.77823	.	0.101850	0.64402	D	0.000003	T	0.71702	0.3371	M	0.66939	2.045	0.51767	D	0.99993	D	0.69078	0.997	D	0.74674	0.984	T	0.76242	-0.3031	9	0.72032	D	0.01	-26.4961	15.0963	0.72238	1.0:0.0:0.0:0.0	.	47	P52907	CAZA1_HUMAN	W	47	.	ENSP00000263168:R47W	R	+	1	2	CAPZA1	112993598	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.939000	0.70179	2.043000	0.60533	0.482000	0.46254	AGG	.		0.368	CAPZA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032567.2	NM_006135	
CD55	1604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207510136	207510136	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:207510136A>C	ENST00000367064.3	+	7	1210	c.952A>C	c.(952-954)Aca>Cca	p.T318P	CD55_ENST00000314754.8_Missense_Mutation_p.T318P|CD55_ENST00000465534.1_3'UTR|CD55_ENST00000367067.4_3'UTR|CD55_ENST00000391920.4_Missense_Mutation_p.T318P|CD55_ENST00000367063.2_Missense_Mutation_p.T318P|CD55_ENST00000367065.5_Missense_Mutation_p.T318P|CD55_ENST00000367062.4_Missense_Mutation_p.T318P|CD55_ENST00000391921.4_Missense_Mutation_p.T254P	NM_000574.3	NP_000565.1	P08174	DAF_HUMAN	CD55 molecule, decay accelerating factor for complement (Cromer blood group)	318	Ser/Thr-rich.				CD4-positive, alpha-beta T cell cytokine production (GO:0035743)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|maternal process involved in parturition (GO:0060137)|negative regulation of complement activation (GO:0045916)|positive regulation of CD4-positive, alpha-beta T cell activation (GO:2000516)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of complement activation (GO:0030449)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|respiratory burst (GO:0045730)|response to peptide hormone (GO:0043434)|response to virus (GO:0009615)|spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	enzyme inhibitor activity (GO:0004857)|lipid binding (GO:0008289)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16					Chloramphenicol(DB00446)	GAAAACCACCACAAAAACCAC	0.433																																					p.T318P		.											.	CD55	187	0			c.A952C						.						203.0	187.0	192.0					1																	207510136		2203	4300	6503	SO:0001583	missense	1604	exon7			ACCACCACAAAAA	BC001288	CCDS31006.1, CCDS44307.1, CCDS73022.1	1q32	2014-09-17	2006-03-28	2006-02-23	ENSG00000196352	ENSG00000196352		"""CD molecules"", ""Blood group antigens"""	2665	protein-coding gene	gene with protein product		125240	"""decay accelerating factor for complement (CD55, Cromer blood group system)"""	DAF			Standard	XM_005273077		Approved	CR, TC, CROM	uc001hfr.4	P08174	OTTHUMG00000036255	ENST00000367064.3:c.952A>C	1.37:g.207510136A>C	ENSP00000356031:p.Thr318Pro	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	81.0	NM_001114752	B1AP14|D3DT83|D3DT84|E7ER69|P09679|P78361|Q14UF2|Q14UF3|Q14UF4|Q14UF5|Q14UF6	Missense_Mutation	SNP	ENST00000367064.3	37	CCDS31006.1	.	.	.	.	.	.	.	.	.	.	A	15.18	2.755763	0.49362	.	.	ENSG00000196352	ENST00000367064;ENST00000367063;ENST00000391921;ENST00000536840;ENST00000314754;ENST00000367065;ENST00000391920;ENST00000367062	T;T;T;T;T;T;T	0.36878	1.26;1.46;1.63;1.38;1.36;1.23;1.24	3.43	-0.682	0.11339	.	.	.	.	.	T	0.37598	0.1009	L	0.29908	0.895	0.09310	N	0.999994	D;P;B;D;B;P	0.65815	0.995;0.932;0.116;0.962;0.116;0.627	D;P;B;P;B;B	0.70487	0.969;0.84;0.033;0.573;0.033;0.139	T	0.27157	-1.0082	9	0.24483	T	0.36	.	4.6885	0.12769	0.4232:0.3884:0.0:0.1885	.	318;254;318;318;318;318	Q14UF6;B1AP15;Q14UF4;P08174-2;P08174;B1AP13	.;.;.;.;DAF_HUMAN;.	P	318;318;254;254;318;318;318;318	ENSP00000356031:T318P;ENSP00000356030:T318P;ENSP00000375788:T254P;ENSP00000316333:T318P;ENSP00000356032:T318P;ENSP00000375787:T318P;ENSP00000356029:T318P	ENSP00000316333:T318P	T	+	1	0	CD55	205576759	0.027000	0.19231	0.005000	0.12908	0.110000	0.19582	0.223000	0.17719	-0.097000	0.12307	0.246000	0.17985	ACA	.		0.433	CD55-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088208.2	NM_000574	
CD99	4267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	2644348	2644348	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chrX:2644348G>A	ENST00000381192.3	+	8	591	c.409G>A	c.(409-411)Gcc>Acc	p.A137T	CD99_ENST00000381187.3_Missense_Mutation_p.A121T|CD99_ENST00000482405.2_3'UTR|CD99_ENST00000381184.1_Missense_Mutation_p.A137T	NM_001277710.1|NM_002414.3	NP_001264639.1|NP_002405.1	P14209	CD99_HUMAN	CD99 molecule	137					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11						TGTCGTGGTCGCCGTGGCTGG	0.567													.|||	1	0.000199681	0.0	0.0	5008	,	,		18417	0.0		0.001	False		,,,				2504	0.0				p.A137T		.											.	CD99	40	0			c.G409A						.						88.0	87.0	87.0					X																	2644348		2203	4296	6499	SO:0001583	missense	4267	exon8			GTGGTCGCCGTGG	M16279	CCDS14119.1, CCDS48071.1, CCDS75947.1	Xp22.32 and Yp11.3	2012-10-02	2006-03-28	2003-02-14	ENSG00000002586	ENSG00000002586		"""Pseudoautosomal regions / PAR1"", ""CD molecules"""	7082	protein-coding gene	gene with protein product		313470, 450000	"""antigen identified by monoclonal antibodies 12E7, F21 and O13"", ""CD99 antigen"""	MIC2			Standard	NM_001122898		Approved		uc004cqm.3	P14209	OTTHUMG00000021073	ENST00000381192.3:c.409G>A	X.37:g.2644348G>A	ENSP00000370588:p.Ala137Thr	Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	12.0	NM_002414	A6NIW1|O00518|Q6ICV7	Missense_Mutation	SNP	ENST00000381192.3	37	CCDS14119.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	12.10	1.836742	0.32421	.	.	ENSG00000002586	ENST00000381192;ENST00000381187;ENST00000381184;ENST00000449611	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	2.52	2.52	0.30459	.	0.185508	0.33895	U	0.004457	T	0.51702	0.1690	L	0.59436	1.845	0.09310	N	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.80764	0.994;0.994;0.994	T	0.35992	-0.9766	10	0.72032	D	0.01	.	10.3862	0.44140	0.0:0.0:1.0:0.0	.	121;137;137	A6NIW1;B2R932;P14209	.;.;CD99_HUMAN	T	137;121;137;180	ENSP00000370588:A137T;ENSP00000370582:A121T;ENSP00000370579:A137T;ENSP00000405544:A180T	ENSP00000370579:A137T	A	+	1	0	CD99	2654348	0.175000	0.23083	0.007000	0.13788	0.154000	0.21943	0.980000	0.29513	1.004000	0.39156	0.292000	0.19580	GCC	G|1.000;A|0.000		0.567	CD99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055624.1	NM_001122898	
CEP128	145508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	81251620	81251620	+	Silent	SNP	A	A	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr14:81251620A>C	ENST00000555265.1	-	15	2205	c.1830T>G	c.(1828-1830)gcT>gcG	p.A610A	CEP128_ENST00000281129.3_Silent_p.A610A			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	610						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CCTCCAAGTGAGCTTTCTCAA	0.448																																					p.A610A		.											.	CEP128	91	0			c.T1830G						.						186.0	178.0	181.0					14																	81251620		2203	4300	6503	SO:0001819	synonymous_variant	145508	exon14			CAAGTGAGCTTTC	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.1830T>G	14.37:g.81251620A>C		Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	16.0	NM_152446	B9EK52|Q86X97|Q96ML4	Silent	SNP	ENST00000555265.1	37	CCDS32130.1																																																																																			.		0.448	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
CLCN2	1181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184070097	184070097	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr3:184070097T>C	ENST00000265593.4	-	21	2465	c.2294A>G	c.(2293-2295)gAg>gGg	p.E765G	EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000344937.7_Missense_Mutation_p.E748G|CLCN2_ENST00000423355.2_3'UTR|CLCN2_ENST00000434054.2_Missense_Mutation_p.E721G|CLCN2_ENST00000457512.1_Missense_Mutation_p.E765G	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	765					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	AGGGCTCATCTCGCCTTCCAG	0.597																																					p.E765G		.											.	CLCN2	90	0			c.A2294G						.						92.0	82.0	86.0					3																	184070097		2203	4300	6503	SO:0001583	missense	1181	exon21			CTCATCTCGCCTT	S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.2294A>G	3.37:g.184070097T>C	ENSP00000265593:p.Glu765Gly	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	23.0	NM_004366	B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	ENST00000265593.4	37	CCDS3263.1	.	.	.	.	.	.	.	.	.	.	t	11.76	1.736179	0.30774	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	5.07	5.07	0.68467	.	0.440518	0.27424	N	0.019431	T	0.77791	0.4183	N	0.14661	0.345	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	T	0.72587	-0.4248	10	0.44086	T	0.13	-13.3713	7.1422	0.25562	0.0:0.0766:0.1475:0.7759	.	721;765;748;765;721	E9PBD9;E9PCD2;P51788-3;P51788;B4DZ58	.;.;.;CLCN2_HUMAN;.	G	765;748;721;765	ENSP00000265593:E765G;ENSP00000345056:E748G;ENSP00000400425:E721G;ENSP00000391928:E765G	ENSP00000265593:E765G	E	-	2	0	CLCN2	185552791	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	1.984000	0.40658	2.133000	0.65898	0.379000	0.24179	GAG	.		0.597	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345571.1		
CLPX	10845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	65443162	65443162	+	Silent	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:65443162T>C	ENST00000300107.3	-	14	2089	c.1901A>G	c.(1900-1902)tAa>tGa	p.*634*		NM_006660.3	NP_006651.2	O76031	CLPX_HUMAN	caseinolytic mitochondrial matrix peptidase chaperone subunit	0					ATP catabolic process (GO:0006200)|positive regulation of peptidase activity (GO:0010952)|protein folding (GO:0006457)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial endopeptidase Clp complex (GO:0009841)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|metal ion binding (GO:0046872)|peptidase activator activity (GO:0016504)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)|skin(2)	16						TATGACAGTTTAGCTGTTTGC	0.403																																					p.X634X		.											.	CLPX	90	0			c.A1901G						.						167.0	163.0	165.0					15																	65443162		2202	4299	6501	SO:0001819	synonymous_variant	10845	exon14			ACAGTTTAGCTGT	AJ006267	CCDS10202.1	15q22.31	2013-09-12	2013-09-12		ENSG00000166855	ENSG00000166855		"""ATPases / AAA-type"""	2088	protein-coding gene	gene with protein product		615611	"""ClpX (caseinolytic protease X, E. coli) homolog"", ""ClpX caseinolytic protease X homolog (E. coli)"", ""ClpX caseinolytic peptidase X homolog (E. coli)"""			22841477	Standard	NM_006660		Approved		uc002aom.3	O76031	OTTHUMG00000133139	ENST00000300107.3:c.1901A>G	15.37:g.65443162T>C		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	11.0	NM_006660	A1L428|A8K8F1|B9EGI8|Q9H4D9	Silent	SNP	ENST00000300107.3	37	CCDS10202.1																																																																																			.		0.403	CLPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256828.2	NM_006660	
CLTC	1213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	57758348	57758348	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr17:57758348G>C	ENST00000269122.3	+	19	3269	c.2995G>C	c.(2995-2997)Gac>Cac	p.D999H	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.D999H	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	999	Heavy chain arm.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					CATGACTGCAGACCTTCCTAA	0.418			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.D999H		.		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	CLTC	835	0			c.G2995C						.						147.0	141.0	143.0					17																	57758348		2203	4300	6503	SO:0001583	missense	1213	exon19			ACTGCAGACCTTC	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.2995G>C	17.37:g.57758348G>C	ENSP00000269122:p.Asp999His	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	43.0	NM_004859	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811597	0.90707	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.23147	1.92;1.92	5.09	5.09	0.68999	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.045427	0.85682	D	0.000000	T	0.60274	0.2256	M	0.91920	3.255	0.80722	D	1	P;P	0.48834	0.725;0.916	P;D	0.63877	0.791;0.919	T	0.70396	-0.4883	10	0.87932	D	0	.	18.4981	0.90872	0.0:0.0:1.0:0.0	.	999;999	Q00610;Q00610-2	CLH1_HUMAN;.	H	999	ENSP00000269122:D999H;ENSP00000376763:D999H	ENSP00000269122:D999H	D	+	1	0	CLTC	55113130	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.374000	0.81015	0.650000	0.86243	GAC	.		0.418	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258859.1	NM_004859	
COL5A1	1289	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137630606	137630606	+	Silent	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr9:137630606T>C	ENST00000371817.3	+	11	1860	c.1446T>C	c.(1444-1446)ccT>ccC	p.P482P		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	482	Interrupted collagenous region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TTCCCGGACCTCCAGGAACCA	0.557																																					p.P482P		.											.	COL5A1	524	0			c.T1446C						.						68.0	80.0	76.0					9																	137630606		2203	4300	6503	SO:0001819	synonymous_variant	1289	exon11			CGGACCTCCAGGA	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1446T>C	9.37:g.137630606T>C		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	18.0	NM_000093	Q15094|Q5SUX4	Silent	SNP	ENST00000371817.3	37	CCDS6982.1																																																																																			.		0.557	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
COX10	1352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	13980195	13980195	+	Silent	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr17:13980195A>G	ENST00000261643.3	+	3	398	c.321A>G	c.(319-321)ctA>ctG	p.L107L	COX10_ENST00000537334.1_Intron|COX10_ENST00000429152.2_Silent_p.L107L|COX10_ENST00000536205.1_5'UTR	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	107					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		CGCCCAGCCTATCTTTGTCCA	0.418																																					p.L107L		.											.	COX10	226	0			c.A321G						.						86.0	81.0	83.0					17																	13980195		2203	4300	6503	SO:0001819	synonymous_variant	1352	exon3			CAGCCTATCTTTG	U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.321A>G	17.37:g.13980195A>G		Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	44.0	NM_001303	B2R6U5|B4DJ50|O15334|Q969F7	Silent	SNP	ENST00000261643.3	37	CCDS11166.1	.	.	.	.	.	.	.	.	.	.	A	4.413	0.076389	0.08485	.	.	ENSG00000006695	ENST00000429152	.	.	.	5.35	-4.16	0.03869	.	.	.	.	.	T	0.17959	0.0431	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24584	-1.0156	4	.	.	.	.	1.9448	0.03354	0.4282:0.0959:0.2815:0.1944	.	.	.	.	V	68	.	.	I	+	1	0	COX10	13920920	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-1.818000	0.01717	-1.031000	0.03308	-1.229000	0.01577	ATC	.		0.418	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130003.1	NM_001303	
CPN1	1369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	101825001	101825001	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr10:101825001G>A	ENST00000370418.3	-	4	954	c.703C>T	c.(703-705)Cga>Tga	p.R235*		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	235	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CGGACCCCTCGGACCCGGTGC	0.612																																					p.R235X		.											.	CPN1	227	0			c.C703T						.						63.0	65.0	64.0					10																	101825001		2203	4300	6503	SO:0001587	stop_gained	1369	exon4			CCCCTCGGACCCG	X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.703C>T	10.37:g.101825001G>A	ENSP00000359446:p.Arg235*	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	8.0	NM_001308	B1AP59	Nonsense_Mutation	SNP	ENST00000370418.3	37	CCDS7486.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.911836	0.92178	.	.	ENSG00000120054	ENST00000370418;ENST00000441382	.	.	.	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.432	12.2185	0.54420	0.0:0.0:0.7045:0.2955	.	.	.	.	X	235;32	.	ENSP00000359446:R235X	R	-	1	2	CPN1	101814991	1.000000	0.71417	0.429000	0.26710	0.462000	0.32619	3.075000	0.50073	2.382000	0.81193	0.561000	0.74099	CGA	.		0.612	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049828.1	NM_001308	
CPS1	1373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	211471635	211471635	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:211471635G>T	ENST00000233072.5	+	18	2358	c.2162G>T	c.(2161-2163)cGa>cTa	p.R721L	CPS1_ENST00000430249.2_Missense_Mutation_p.R727L|CPS1_ENST00000451903.2_Missense_Mutation_p.R270L	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	721	ATP-grasp 1.		R -> Q (in CPS1D). {ECO:0000269|PubMed:21120950}.	RLSRS -> KMSPN (in Ref. 1; BAA14328). {ECO:0000305}.	anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AGACTGTCCCGAAGCTCTGCT	0.443																																					p.R727L		.											.	CPS1	162	0			c.G2180T						.						83.0	74.0	77.0					2																	211471635		2203	4300	6503	SO:0001583	missense	1373	exon19			TGTCCCGAAGCTC	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2162G>T	2.37:g.211471635G>T	ENSP00000233072:p.Arg721Leu	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	45.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	33	5.198622	0.94997	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.98777	-5.13;-5.13;-5.13	5.73	5.73	0.89815	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Carbamoyl-phosphate synthase, large subunit, CPS-domain (1);	0.000000	0.85682	D	0.000000	D	0.99664	0.9875	H	0.99859	4.855	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97157	0.9835	10	0.87932	D	0	-28.6625	19.9597	0.97242	0.0:0.0:1.0:0.0	.	731;721	Q59HF8;P31327	.;CPSM_HUMAN	L	727;729;721;270	ENSP00000402608:R727L;ENSP00000233072:R721L;ENSP00000406136:R270L	ENSP00000233072:R721L	R	+	2	0	CPS1	211179880	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	9.472000	0.97709	2.723000	0.93209	0.586000	0.80456	CGA	.		0.443	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
CYB5A	1528	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	71959015	71959027	+	Frame_Shift_Del	DEL	GTGGTGCAGGATC	GTGGTGCAGGATC	-			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	GTGGTGCAGGATC	GTGGTGCAGGATC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr18:71959015_71959027delGTGGTGCAGGATC	ENST00000340533.4	-	1	224_236	c.84_96delGATCCTGCACCAC	c.(82-96)ctgatcctgcaccacfs	p.LILHH28fs	CYB5A_ENST00000397914.4_Frame_Shift_Del_p.LILHH28fs|CYB5A_ENST00000494131.2_Frame_Shift_Del_p.LILHH28fs|CYB5A_ENST00000299438.9_5'Flank	NM_148923.3	NP_683725.1	P00167	CYB5_HUMAN	cytochrome b5 type A (microsomal)	28	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				hydrogen ion transmembrane transport (GO:1902600)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	aldo-keto reductase (NADP) activity (GO:0004033)|cytochrome-c oxidase activity (GO:0004129)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(1)|skin(1)	4		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)				CGTACACCTTGTGGTGCAGGATCAGCCAGGTGC	0.587											OREG0025052	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.28_32del	NSCLC(176;1530 2076 2606 27426 50572)|Ovarian(151;328 1870 2837 37860 52175)	.											.	CYB5A	90	0			c.84_96del						.																																			SO:0001589	frameshift_variant	1528	exon1			CACCTTGTGGTGC	M22865	CCDS12004.1, CCDS12005.1, CCDS54188.1	18q23	2006-01-30	2006-01-30	2006-01-30	ENSG00000166347	ENSG00000166347		"""Cytochrome b genes"""	2570	protein-coding gene	gene with protein product		613218	"""cytochrome b-5"", ""cytochrome b5 (microsomal)"""	CYB5		1840560	Standard	NM_148923		Approved		uc002lli.3	P00167	OTTHUMG00000132843	ENST00000340533.4:c.84_96delGATCCTGCACCAC	18.37:g.71959015_71959027delGTGGTGCAGGATC	ENSP00000341625:p.Leu28fs	Somatic	53.0	0.0	1134	WXS	Illumina HiSeq	Phase_I	61.0	12.0	NM_148923	A8MV91|F8WEU4|Q6IB14	Frame_Shift_Del	DEL	ENST00000340533.4	37	CCDS12004.1																																																																																			.		0.587	CYB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256316.1	NM_001914, NM_148923	
DCSTAMP	81501	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	105361460	105361460	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr8:105361460C>A	ENST00000297581.2	+	2	729	c.680C>A	c.(679-681)aCt>aAt	p.T227N	DCSTAMP_ENST00000517991.1_Missense_Mutation_p.T227N|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	227					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											CTGCTTGGCACTGGCCTCTTC	0.493																																					p.T227N		.											.	.	.	0			c.C680A						.						101.0	93.0	96.0					8																	105361460		2203	4300	6503	SO:0001583	missense	81501	exon2			TTGGCACTGGCCT	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.680C>A	8.37:g.105361460C>A	ENSP00000297581:p.Thr227Asn	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	14.0	NM_001257317	B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	ENST00000297581.2	37	CCDS6301.1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.906201	0.72868	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T	0.33654	1.4	5.52	5.52	0.82312	.	0.047727	0.85682	D	0.000000	T	0.58278	0.2111	M	0.64997	1.995	0.53005	D	0.99996	D	0.89917	1.0	D	0.78314	0.991	T	0.54840	-0.8233	9	.	.	.	-17.6184	17.6314	0.88109	0.0:1.0:0.0:0.0	.	227	Q9H295	TM7S4_HUMAN	N	227	ENSP00000297581:T227N	.	T	+	2	0	TM7SF4	105430636	1.000000	0.71417	0.997000	0.53966	0.919000	0.55068	4.683000	0.61679	2.624000	0.88883	0.555000	0.69702	ACT	.		0.493	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380810.1	NM_030788	
DGKE	8526	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	54925299	54925299	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr17:54925299A>G	ENST00000284061.3	+	5	941	c.761A>G	c.(760-762)aAa>aGa	p.K254R		NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	254	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					GATGTAACTAAAACTCCTCCT	0.388																																					p.K254R		.											.	DGKE	289	0			c.A761G						.						85.0	87.0	86.0					17																	54925299		2203	4300	6503	SO:0001583	missense	8526	exon5			TAACTAAAACTCC	U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.761A>G	17.37:g.54925299A>G	ENSP00000284061:p.Lys254Arg	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	12.0	NM_003647	Q8TBM4|Q9UKQ3	Missense_Mutation	SNP	ENST00000284061.3	37	CCDS11590.1	.	.	.	.	.	.	.	.	.	.	A	14.21	2.468249	0.43839	.	.	ENSG00000153933	ENST00000284061	T	0.22134	1.97	5.57	5.57	0.84162	Diacylglycerol kinase, catalytic domain (3);	0.189132	0.56097	D	0.000034	T	0.18299	0.0439	N	0.26162	0.8	0.80722	D	1	B;B	0.14438	0.01;0.01	B;B	0.23716	0.048;0.048	T	0.03354	-1.1045	10	0.36615	T	0.2	.	15.7272	0.77770	1.0:0.0:0.0:0.0	.	254;254	A1L4Q0;P52429	.;DGKE_HUMAN	R	254	ENSP00000284061:K254R	ENSP00000284061:K254R	K	+	2	0	DGKE	52280298	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.538000	0.60650	2.102000	0.63906	0.482000	0.46254	AAA	.		0.388	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440601.1	NM_003647	
DISP2	85455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	40660976	40660976	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:40660976A>T	ENST00000267889.3	+	8	2750	c.2663A>T	c.(2662-2664)cAg>cTg	p.Q888L	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	888					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		GATGGCACCCAGGACCTGGGA	0.622																																					p.Q888L		.											.	DISP2	92	0			c.A2663T						.						32.0	34.0	34.0					15																	40660976		2203	4300	6503	SO:0001583	missense	85455	exon8			GCACCCAGGACCT	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2663A>T	15.37:g.40660976A>T	ENSP00000267889:p.Gln888Leu	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	12.0	NM_033510	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	ENST00000267889.3	37	CCDS10056.1	.	.	.	.	.	.	.	.	.	.	A	0.088	-1.172339	0.01646	.	.	ENSG00000140323	ENST00000267889	T	0.11712	2.75	4.99	0.938	0.19500	.	0.856524	0.10507	N	0.666624	T	0.02649	0.0080	N	0.00926	-1.1	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46400	-0.9194	10	0.10636	T	0.68	-4.1397	3.9036	0.09172	0.4827:0.0:0.3371:0.1802	.	888	A7MBM2	DISP2_HUMAN	L	888	ENSP00000267889:Q888L	ENSP00000267889:Q888L	Q	+	2	0	DISP2	38448268	0.000000	0.05858	0.083000	0.20561	0.630000	0.37929	0.212000	0.17497	0.017000	0.15025	-0.542000	0.04241	CAG	.		0.622	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252249.1	NM_033510	
DNAH10	196385	broad.mit.edu;bcgsc.ca	37	12	124383209	124383209	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr12:124383209A>G	ENST00000409039.3	+	55	9159	c.9134A>G	c.(9133-9135)aAg>aGg	p.K3045R		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3045	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCTCAGTGCAAGCGTCTGGAT	0.542																																					p.K3045R		.											.	DNAH10	95	0			c.A9134G						.						14.0	17.0	16.0					12																	124383209		2028	4200	6228	SO:0001583	missense	196385	exon55			AGTGCAAGCGTCT	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.9134A>G	12.37:g.124383209A>G	ENSP00000386770:p.Lys3045Arg	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	4.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	14.36	2.513439	0.44660	.	.	ENSG00000197653	ENST00000409039	T	0.21932	1.98	4.66	3.5	0.40072	.	0.051814	0.85682	D	0.000000	T	0.16599	0.0399	L	0.39633	1.23	0.42695	D	0.993592	B	0.28208	0.203	B	0.28709	0.093	T	0.06006	-1.0851	10	0.25106	T	0.35	.	10.2947	0.43616	0.9218:0.0:0.0782:0.0	.	3045	Q8IVF4	DYH10_HUMAN	R	3045	ENSP00000386770:K3045R	ENSP00000386770:K3045R	K	+	2	0	DNAH10	122949162	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	6.132000	0.71676	0.803000	0.34113	0.379000	0.24179	AAG	.		0.542	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
EDNRA	1909	broad.mit.edu;bcgsc.ca	37	4	148407203	148407203	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr4:148407203C>G	ENST00000324300.5	+	2	885	c.370C>G	c.(370-372)Ctt>Gtt	p.L124V	EDNRA_ENST00000358556.4_Missense_Mutation_p.L124V|EDNRA_ENST00000506066.1_Missense_Mutation_p.L124V|EDNRA_ENST00000339690.5_Missense_Mutation_p.L124V|EDNRA_ENST00000511804.1_Intron	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A	124					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	CAGTCTTGCCCTTGGAGACCT	0.428																																					p.L124V		.											.	EDNRA	586	0			c.C370G						.						105.0	97.0	99.0					4																	148407203		2203	4300	6503	SO:0001583	missense	1909	exon2			CTTGCCCTTGGAG	D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.370C>G	4.37:g.148407203C>G	ENSP00000315011:p.Leu124Val	Somatic	114.0	1.0		WXS	Illumina HiSeq	Phase_I	88.0	6.0	NM_001166055	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	Missense_Mutation	SNP	ENST00000324300.5	37	CCDS3769.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986695	0.74589	.	.	ENSG00000151617	ENST00000358556;ENST00000339690;ENST00000394047;ENST00000324300;ENST00000506066	T;T;T;T	0.37235	1.21;1.21;1.21;1.21	5.96	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.45716	0.1356	L	0.45352	1.415	0.58432	D	0.99999	P;D;D	0.65815	0.95;0.995;0.986	P;P;P	0.59424	0.475;0.857;0.856	T	0.31752	-0.9932	10	0.59425	D	0.04	-19.3949	11.1419	0.48408	0.1266:0.8065:0.0:0.0669	.	124;124;124	P25101-4;P25101-2;P25101	.;.;EDNRA_HUMAN	V	124	ENSP00000351359:L124V;ENSP00000341556:L124V;ENSP00000315011:L124V;ENSP00000425281:L124V	ENSP00000315011:L124V	L	+	1	0	EDNRA	148626653	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.778000	0.47726	2.832000	0.97577	0.655000	0.94253	CTT	.		0.428	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364635.1		
EIF4H	7458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	73609125	73609125	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:73609125G>T	ENST00000265753.8	+	6	663	c.524G>T	c.(523-525)cGa>cTa	p.R175L	EIF4H_ENST00000495187.1_3'UTR|EIF4H_ENST00000353999.6_Missense_Mutation_p.R155L	NM_022170.1	NP_071496.1	Q15056	IF4H_HUMAN	eukaryotic translation initiation factor 4H	175					cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|sexual reproduction (GO:0019953)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|lung(2)|prostate(1)	4						GGCGACCGGCGAACAGGCCCC	0.572																																					p.R175L		.											.	EIF4H	90	0			c.G524T						.						49.0	59.0	56.0					7																	73609125		2202	4299	6501	SO:0001583	missense	7458	exon6			ACCGGCGAACAGG		CCDS5564.1, CCDS5565.1	7q11.23	2013-02-12	2006-11-27	2006-11-27	ENSG00000106682	ENSG00000106682		"""RNA binding motif (RRM) containing"""	12741	protein-coding gene	gene with protein product		603431	"""Williams-Beuren syndrome chromosome region 1"""	WBSCR1		9516461, 15078951	Standard	NM_022170		Approved	WSCR1, KIAA0038	uc003uad.1	Q15056	OTTHUMG00000023025	ENST00000265753.8:c.524G>T	7.37:g.73609125G>T	ENSP00000265753:p.Arg175Leu	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	16.0	NM_022170	A8K3R1|D3DXF6|D3DXF8	Missense_Mutation	SNP	ENST00000265753.8	37	CCDS5564.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490058	0.84962	.	.	ENSG00000106682	ENST00000265753;ENST00000353999	T;T	0.37411	1.32;1.2	4.61	4.61	0.57282	.	0.000000	0.64402	D	0.000001	T	0.50360	0.1611	L	0.56769	1.78	0.80722	D	1	P;P	0.42785	0.79;0.686	P;P	0.56343	0.796;0.63	T	0.37056	-0.9722	10	0.30078	T	0.28	-5.9129	14.3085	0.66400	0.0:0.0:1.0:0.0	.	155;175	Q15056-2;Q15056	.;IF4H_HUMAN	L	175;155	ENSP00000265753:R175L;ENSP00000265754:R155L	ENSP00000265753:R175L	R	+	2	0	EIF4H	73247061	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.946000	0.56644	2.397000	0.81536	0.563000	0.77884	CGA	.		0.572	EIF4H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252375.2	NM_022170	
EIF5A	1984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7213030	7213030	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr17:7213030C>T	ENST00000336458.8	+	2	477	c.76C>T	c.(76-78)Cgt>Tgt	p.R26C	EIF5A_ENST00000572815.1_Missense_Mutation_p.R26C|EIF5A_ENST00000416016.2_Missense_Mutation_p.R26C|EIF5A_ENST00000571955.1_Missense_Mutation_p.R26C|EIF5A_ENST00000576930.1_Missense_Mutation_p.R26C|EIF5A_ENST00000336452.7_Missense_Mutation_p.R56C|EIF5A_ENST00000573542.1_Missense_Mutation_p.R26C|EIF5A_ENST00000419711.2_Missense_Mutation_p.R26C	NM_001970.4	NP_001961.1	P63241	IF5A1_HUMAN	eukaryotic translation initiation factor 5A	26	DOHH-binding.				apoptotic process (GO:0006915)|cellular protein metabolic process (GO:0044267)|mRNA export from nucleus (GO:0006406)|nucleocytoplasmic transport (GO:0006913)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of translational elongation (GO:0045901)|positive regulation of translational termination (GO:0045905)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|translational frameshifting (GO:0006452)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|translation elongation factor activity (GO:0003746)|U6 snRNA binding (GO:0017070)			endometrium(2)|kidney(1)|large_intestine(2)|urinary_tract(1)	6						CTCAGCATTACGTAAGAATGG	0.512																																					p.R56C		.											.	EIF5A	90	0			c.C166T						.						189.0	174.0	179.0					17																	7213030		2203	4300	6503	SO:0001583	missense	1984	exon2			GCATTACGTAAGA		CCDS11099.1, CCDS45601.1	17p13-p12	2009-05-01			ENSG00000132507	ENSG00000132507			3300	protein-coding gene	gene with protein product		600187				7759117	Standard	NM_001143760		Approved	EIF5A1, EIF-5A, MGC99547, MGC104255	uc002gfr.3	P63241	OTTHUMG00000102197	ENST00000336458.8:c.76C>T	17.37:g.7213030C>T	ENSP00000336776:p.Arg26Cys	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	17.0	NM_001143760	A8K9A0|D3DTP2|P10159|Q16182|Q7L7L3|Q7Z4L1|Q9D0G2	Missense_Mutation	SNP	ENST00000336458.8	37	CCDS11099.1	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242343	0.58995	.	.	ENSG00000132507	ENST00000336452;ENST00000336458;ENST00000419711;ENST00000416016	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	4.15	4.15	0.48705	Translation protein SH3-like (1);Translation protein SH3-like, subgroup (1);	0.171029	0.37530	N	0.002052	T	0.65995	0.2745	H	0.97659	4.05	0.80722	D	1	B;P	0.39376	0.418;0.67	B;B	0.32762	0.097;0.152	T	0.80065	-0.1538	10	0.72032	D	0.01	-19.2679	15.3693	0.74551	0.0:1.0:0.0:0.0	.	26;56	P63241;P63241-2	IF5A1_HUMAN;.	C	56;26;26;26	ENSP00000336702:R56C;ENSP00000336776:R26C;ENSP00000390677:R26C;ENSP00000396073:R26C	ENSP00000336702:R56C	R	+	1	0	EIF5A	7153754	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.295000	0.59049	2.158000	0.67659	0.400000	0.26472	CGT	.		0.512	EIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220047.3	NM_001970	
EMILIN2	84034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	2891529	2891529	+	Silent	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr18:2891529C>T	ENST00000254528.3	+	4	1563	c.1404C>T	c.(1402-1404)tgC>tgT	p.C468C		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	468					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		AAGAACATTGCTTTTACATTG	0.463																																					p.C468C		.											.	EMILIN2	93	0			c.C1404T						.						98.0	106.0	103.0					18																	2891529		2203	4300	6503	SO:0001819	synonymous_variant	84034	exon4			ACATTGCTTTTAC	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.1404C>T	18.37:g.2891529C>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	42.0	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Silent	SNP	ENST00000254528.3	37	CCDS11828.1																																																																																			.		0.463	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
ETV3	2117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	157095349	157095349	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:157095349A>G	ENST00000368192.4	-	5	887	c.823T>C	c.(823-825)Tcc>Ccc	p.S275P		NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	275					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				GGGCTATAGGAGAAGATGGTG	0.552																																					p.S275P		.											.	ETV3	226	0			c.T823C						.						147.0	146.0	146.0					1																	157095349		692	1591	2283	SO:0001583	missense	2117	exon5			TATAGGAGAAGAT	BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.823T>C	1.37:g.157095349A>G	ENSP00000357175:p.Ser275Pro	Somatic	103.0	1.0		WXS	Illumina HiSeq	Phase_I	219.0	85.0	NM_001145312	B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	ENST00000368192.4	37	CCDS44250.1	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463361	0.43736	.	.	ENSG00000117036	ENST00000368192	T	0.36699	1.24	4.9	3.76	0.43208	.	0.274126	0.31648	N	0.007288	T	0.11239	0.0274	L	0.28274	0.84	0.80722	D	1	B	0.20988	0.05	B	0.17722	0.019	T	0.05468	-1.0883	10	0.30854	T	0.27	.	9.966	0.41725	0.918:0.0:0.082:0.0	.	275	P41162	ETV3_HUMAN	P	275	ENSP00000357175:S275P	ENSP00000357175:S275P	S	-	1	0	ETV3	155361973	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.309000	0.43699	0.995000	0.38917	0.459000	0.35465	TCC	.		0.552	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082843.2	NM_005240	
FAM65B	9750	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	24847845	24847845	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr6:24847845delG	ENST00000259698.4	-	13	1327	c.1152delC	c.(1150-1152)gccfs	p.A384fs	FAM65B_ENST00000540914.1_Intron|FAM65B_ENST00000510784.2_Intron|FAM65B_ENST00000378023.4_Intron|FAM65B_ENST00000538035.1_Intron	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	384					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						GGTGCAGCTTGGCAAAGAAAG	0.602																																					p.A384fs		.											.	FAM65B	91	0			c.1152delC						.						42.0	47.0	46.0					6																	24847845		692	1591	2283	SO:0001589	frameshift_variant	9750	exon13			CAGCTTGGCAAAG	U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1152delC	6.37:g.24847845delG	ENSP00000259698:p.Ala384fs	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	12.0	NM_014722	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Frame_Shift_Del	DEL	ENST00000259698.4	37	CCDS47383.1																																																																																			.		0.602	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040024.2		
FANCD2	2177	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10128833	10128833	+	Silent	SNP	C	C	T	rs566518051		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr3:10128833C>T	ENST00000419585.1	+	34	3512	c.3351C>T	c.(3349-3351)taC>taT	p.Y1117Y	FANCD2_ENST00000383806.1_Silent_p.Y1117Y|FANCD2_ENST00000287647.3_Silent_p.Y1117Y|FANCD2_ENST00000383807.1_Silent_p.Y1117Y|FANCD2OS_ENST00000436517.1_5'UTR|FANCD2OS_ENST00000524279.1_Intron			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	1117					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GCGTCCATTACTTGCAGAATT	0.393			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				C|||	1	0.000199681	0.0	0.0	5008	,	,		19392	0.0		0.0	False		,,,				2504	0.001				p.Y1117Y		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	229	0			c.C3351T						.						230.0	227.0	228.0					3																	10128833		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon34	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CCATTACTTGCAG	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.3351C>T	3.37:g.10128833C>T		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	44.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			.		0.393	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
FHL5	9457	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	97053845	97053845	+	Silent	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr6:97053845A>G	ENST00000326771.2	+	5	782	c.402A>G	c.(400-402)cgA>cgG	p.R134R	FHL5_ENST00000541107.1_Silent_p.R134R	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	134	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		AGAATTGCCGACAACCTATAG	0.408																																					p.R134R		.											.	FHL5	92	0			c.A402G						.						108.0	98.0	102.0					6																	97053845		2203	4300	6503	SO:0001819	synonymous_variant	9457	exon5			TTGCCGACAACCT	AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.402A>G	6.37:g.97053845A>G		Somatic	118.0	1.0		WXS	Illumina HiSeq	Phase_I	129.0	49.0	NM_020482	B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Silent	SNP	ENST00000326771.2	37	CCDS5035.1																																																																																			.		0.408	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041559.1	NM_020482	
FOLR2	2350	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71932083	71932083	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr11:71932083T>A	ENST00000298223.6	+	3	507	c.320T>A	c.(319-321)cTg>cAg	p.L107Q	FOLR2_ENST00000454954.2_Missense_Mutation_p.L66Q|FOLR2_ENST00000449475.2_Missense_Mutation_p.L124Q	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	107					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	TCACCCAACCTGGGGCCCTGG	0.622																																					p.L107Q		.											.	FOLR2	290	0			c.T320A						.						25.0	25.0	25.0					11																	71932083		2200	4293	6493	SO:0001583	missense	2350	exon3			CCAACCTGGGGCC	AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.320T>A	11.37:g.71932083T>A	ENSP00000298223:p.Leu107Gln	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	24.0	NM_001113535	Q05CA5|Q6GTE8	Missense_Mutation	SNP	ENST00000298223.6	37	CCDS8212.1	.	.	.	.	.	.	.	.	.	.	t	18.88	3.717531	0.68844	.	.	ENSG00000165457	ENST00000449475;ENST00000298223;ENST00000454954;ENST00000539412;ENST00000536778;ENST00000535625;ENST00000321324;ENST00000538353	T;T;T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	4.37	3.25	0.37280	Folate receptor-like (1);	0.000000	0.64402	D	0.000013	D	0.88923	0.6569	M	0.93106	3.38	0.45464	D	0.998439	D	0.89917	1.0	D	0.97110	1.0	D	0.88508	0.3087	10	0.87932	D	0	.	8.5883	0.33670	0.0:0.0931:0.0:0.9069	.	107	P14207	FOLR2_HUMAN	Q	124;107;66;118;122;107;120;107	ENSP00000405638:L124Q;ENSP00000298223:L107Q;ENSP00000414094:L66Q;ENSP00000441547:L118Q;ENSP00000438568:L122Q;ENSP00000444794:L107Q;ENSP00000321957:L120Q;ENSP00000440337:L107Q	ENSP00000298223:L107Q	L	+	2	0	FOLR2	71609731	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	4.917000	0.63369	0.729000	0.32403	0.374000	0.22700	CTG	.		0.622	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317923.2	NM_000803	
MYZAP	100820829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	57953696	57953696	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:57953696C>G	ENST00000267853.5	+	11	1262	c.1168C>G	c.(1168-1170)Cag>Gag	p.Q390E	GCOM1_ENST00000380561.2_Intron|GCOM1_ENST00000380568.3_Missense_Mutation_p.Q390E|GCOM1_ENST00000574161.1_Missense_Mutation_p.Q390E|GCOM1_ENST00000572390.1_Intron|GCOM1_ENST00000380560.2_Missense_Mutation_p.Q321E|MYZAP_ENST00000380565.4_Intron|GCOM1_ENST00000587652.1_Missense_Mutation_p.Q390E|GCOM1_ENST00000380569.2_Missense_Mutation_p.Q390E|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000396180.1_Missense_Mutation_p.Q359E			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	390					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											CTTAATACTGCAGCTTTTAGA	0.318																																					p.Q390E		.											.	GCOM1	91	0			c.C1168G						.						64.0	61.0	62.0					15																	57953696		2191	4291	6482	SO:0001583	missense	145781	exon11			ATACTGCAGCTTT	FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.1168C>G	15.37:g.57953696C>G	ENSP00000267853:p.Gln390Glu	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	38.0	NM_001018090	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	ENST00000267853.5	37	CCDS10162.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162678	0.38217	.	.	ENSG00000137878	ENST00000380569;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380568;ENST00000461709	T;T;T;T;T;T	0.25250	2.1;2.12;2.14;2.08;2.09;1.81	5.88	5.88	0.94601	.	0.104213	0.64402	D	0.000002	T	0.29223	0.0727	N	0.11724	0.165	0.80722	D	1	D;B;P	0.63046	0.992;0.245;0.459	D;B;B	0.74674	0.984;0.367;0.086	T	0.04216	-1.0968	10	0.07644	T	0.81	-25.8335	15.7229	0.77728	0.0:1.0:0.0:0.0	.	390;390;390	P0CAP1-2;P0CAP1-11;P0CAP1	.;.;GCOM1_HUMAN	E	390;359;321;390;390;105	ENSP00000369943:Q390E;ENSP00000379483:Q359E;ENSP00000369933:Q321E;ENSP00000267853:Q390E;ENSP00000369942:Q390E;ENSP00000431396:Q105E	ENSP00000267853:Q390E	Q	+	1	0	GCOM1	55740988	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.007000	0.57093	2.789000	0.95967	0.655000	0.94253	CAG	.		0.318	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255716.2	NM_001018100	
FOXB1	27023	broad.mit.edu;bcgsc.ca	37	15	60297165	60297165	+	Start_Codon_SNP	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:60297165G>T	ENST00000396057.4	+	2	482	c.3G>T	c.(1-3)atG>atT	p.M1I	FOXB1_ENST00000560857.1_Intron	NM_012182.2	NP_036314.2	Q99853	FOXB1_HUMAN	forkhead box B1	1					axon target recognition (GO:0007412)|cell migration in diencephalon (GO:0061381)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|floor plate development (GO:0033504)|hypothalamus cell migration (GO:0021855)|inferior colliculus development (GO:0061379)|lactation (GO:0007595)|mammary gland lobule development (GO:0061377)|mammillary body development (GO:0021767)|mammillothalamic axonal tract development (GO:0061374)|midbrain development (GO:0030901)|negative regulation of neuron apoptotic process (GO:0043524)|somitogenesis (GO:0001756)|spinal cord development (GO:0021510)|telencephalon cell migration (GO:0022029)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|visual learning (GO:0008542)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|lung(3)|ovary(1)	6						GGAAGAAGATGCCTCGGCCCG	0.632																																					p.M1I		.											.	FOXB1	227	0			c.G3T						.						46.0	52.0	50.0					15																	60297165		2203	4300	6503	SO:0001582	initiator_codon_variant	27023	exon2			GAAGATGCCTCGG	AF055080	CCDS32255.1	15q22.2	2014-09-09			ENSG00000171956	ENSG00000171956		"""Forkhead boxes"""	3799	protein-coding gene	gene with protein product							Standard	NM_012182		Approved	HFKH-5, FKH5	uc002agj.1	Q99853	OTTHUMG00000172011	ENST00000396057.4:c.3G>T	15.37:g.60297165G>T	ENSP00000379369:p.Met1Ile	Somatic	45.0	1.0		WXS	Illumina HiSeq	Phase_I	57.0	19.0	NM_012182	O60652|O75917|Q14CL2	Missense_Mutation	SNP	ENST00000396057.4	37	CCDS32255.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605704	0.87157	.	.	ENSG00000171956	ENST00000396057	D	0.96745	-4.11	3.64	3.64	0.41730	.	0.000000	0.85682	U	0.000000	D	0.97879	0.9303	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	D	0.98628	1.0670	9	0.87932	D	0	.	14.0516	0.64739	0.0:0.0:1.0:0.0	.	1	Q99853	FOXB1_HUMAN	I	1	ENSP00000379369:M1I	ENSP00000379369:M1I	M	+	3	0	FOXB1	58084457	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.307000	0.96226	1.843000	0.53566	0.655000	0.94253	ATG	.		0.632	FOXB1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416378.1		Missense_Mutation
GGT7	2686	broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	33451284	33451284	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr20:33451284G>C	ENST00000336431.5	-	2	281	c.237C>G	c.(235-237)agC>agG	p.S79R		NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7	79					glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						ACCCGTCTTGGCTGCCCATCT	0.697																																					p.S79R		.											.	GGT7	91	0			c.C237G						.						15.0	14.0	14.0					20																	33451284		2197	4287	6484	SO:0001583	missense	2686	exon2			GTCTTGGCTGCCC	AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.237C>G	20.37:g.33451284G>C	ENSP00000338964:p.Ser79Arg	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	7.0	NM_178026	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	Missense_Mutation	SNP	ENST00000336431.5	37	CCDS13242.2	.	.	.	.	.	.	.	.	.	.	G	24.3	4.518565	0.85495	.	.	ENSG00000131067	ENST00000336431;ENST00000427420	T;T	0.42131	3.4;0.98	5.26	3.31	0.37934	.	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	L	0.51422	1.61	0.52501	D	0.999951	D;D;D	0.71674	0.998;0.998;0.997	D;P;D	0.69142	0.962;0.897;0.916	T	0.56980	-0.7889	10	0.72032	D	0.01	-24.5641	11.2078	0.48780	0.1476:0.0:0.8524:0.0	.	79;79;79	Q9UJ14-5;A4FU32;Q9UJ14	.;.;GGT7_HUMAN	R	79;96	ENSP00000338964:S79R;ENSP00000394993:S96R	ENSP00000338964:S79R	S	-	3	2	GGT7	32914945	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	3.210000	0.51129	1.229000	0.43630	0.650000	0.86243	AGC	.		0.697	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078816.2	NM_178026	
GNB2	2783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100275413	100275413	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:100275413A>G	ENST00000303210.4	+	7	951	c.469A>G	c.(469-471)Atc>Gtc	p.I157V	GNB2_ENST00000427895.1_Missense_Mutation_p.I57V|GNB2_ENST00000393926.1_Missense_Mutation_p.I157V|GNB2_ENST00000436220.1_Missense_Mutation_p.I113V|GNB2_ENST00000419828.1_Missense_Mutation_p.I57V|GNB2_ENST00000393924.1_Missense_Mutation_p.I157V|GNB2_ENST00000424361.1_Missense_Mutation_p.I113V	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2	157					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				TGACAACCAAATCATCACCAG	0.632																																					p.I157V		.											.	GNB2	229	0			c.A469G						.						64.0	53.0	56.0					7																	100275413		2203	4300	6503	SO:0001583	missense	2783	exon7			AACCAAATCATCA	M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.469A>G	7.37:g.100275413A>G	ENSP00000305260:p.Ile157Val	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	16.0	NM_005273	B3KPU1|P11016|P54312	Missense_Mutation	SNP	ENST00000303210.4	37	CCDS5703.1	.	.	.	.	.	.	.	.	.	.	.	26.1	4.701133	0.88924	.	.	ENSG00000172354	ENST00000303210;ENST00000451587;ENST00000436220;ENST00000424361;ENST00000419828;ENST00000427895;ENST00000393926;ENST00000431068;ENST00000393924	T;T;T;T;T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11;0.11	4.79	4.79	0.61399	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.54175	0.1842	N	0.16307	0.4	0.58432	D	0.999997	P	0.38617	0.64	P	0.51193	0.662	T	0.59778	-0.7390	10	0.59425	D	0.04	-2.8288	12.3252	0.55007	1.0:0.0:0.0:0.0	.	157	P62879	GBB2_HUMAN	V	157;157;113;113;57;57;157;157;157	ENSP00000305260:I157V;ENSP00000399904:I157V;ENSP00000401873:I113V;ENSP00000389391:I113V;ENSP00000390543:I57V;ENSP00000400286:I57V;ENSP00000377503:I157V;ENSP00000390077:I157V;ENSP00000377501:I157V	ENSP00000305260:I157V	I	+	1	0	GNB2	100113349	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.220000	0.78008	2.014000	0.59158	0.379000	0.24179	ATC	.		0.632	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268391.2	NM_005273	
GPRIN1	114787	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	176026296	176026296	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr5:176026296C>T	ENST00000303991.4	-	2	717	c.540G>A	c.(538-540)atG>atA	p.M180I		NM_052899.2	NP_443131.2	Q7Z2K8	GRIN1_HUMAN	G protein regulated inducer of neurite outgrowth 1	180					neuron projection development (GO:0031175)	cell projection (GO:0042995)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(89;0.00263)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCCTGTAAACATGGGATCTG	0.502																																					p.M180I		.											.	GPRIN1	92	0			c.G540A						.						63.0	66.0	65.0					5																	176026296		2203	4300	6503	SO:0001583	missense	114787	exon2			TGTAAACATGGGA	AB067480	CCDS4405.1	5q35.2	2008-02-05			ENSG00000169258	ENSG00000169258			24835	protein-coding gene	gene with protein product		611239				11572484	Standard	NM_052899		Approved	GRIN1, KIAA1893	uc003meo.1	Q7Z2K8	OTTHUMG00000130659	ENST00000303991.4:c.540G>A	5.37:g.176026296C>T	ENSP00000305839:p.Met180Ile	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	12.0	NM_052899	C9JM70|Q8ND74|Q96PZ4	Missense_Mutation	SNP	ENST00000303991.4	37	CCDS4405.1	.	.	.	.	.	.	.	.	.	.	C	6.933	0.541925	0.13250	.	.	ENSG00000169258	ENST00000303991;ENST00000335532	T	0.08008	3.14	5.25	3.34	0.38264	.	1.212230	0.06084	N	0.662396	T	0.07908	0.0198	L	0.40543	1.245	0.09310	N	1	B	0.13145	0.007	B	0.15484	0.013	T	0.39440	-0.9614	10	0.28530	T	0.3	4.7924	3.5392	0.07804	0.1777:0.5606:0.1714:0.0904	.	180	Q7Z2K8	GRIN1_HUMAN	I	180	ENSP00000305839:M180I	ENSP00000305839:M180I	M	-	3	0	GPRIN1	175958902	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.748000	0.04818	1.205000	0.43262	0.655000	0.94253	ATG	.		0.502	GPRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253149.1	NM_052899	
HCFC1	3054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153224782	153224782	+	Splice_Site	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chrX:153224782C>A	ENST00000310441.7	-	9	2571	c.1605G>T	c.(1603-1605)acG>acT	p.T535T	HCFC1_ENST00000354233.3_Splice_Site_p.T466T|HCFC1_ENST00000369984.4_Splice_Site_p.T535T|HCFC1_ENST00000461098.1_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	535	Required for interaction with OGT.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CACTCCTCACCGTTCCCTGGG	0.612																																					p.T535T		.											.	HCFC1	132	0			c.G1605T						.						135.0	142.0	139.0					X																	153224782		2087	4173	6260	SO:0001630	splice_region_variant	3054	exon9			CCTCACCGTTCCC		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1605+1G>T	X.37:g.153224782C>A		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	26.0	NM_005334	Q6P4G5	Silent	SNP	ENST00000310441.7	37	CCDS44020.1																																																																																			.		0.612	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	Silent
HOXA3	3200	broad.mit.edu;mdanderson.org	37	7	27150183	27150183	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:27150183T>C	ENST00000396352.4	-	2	276	c.77A>G	c.(76-78)tAt>tGt	p.Y26C	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000521401.1_5'Flank|HOXA3_ENST00000317201.2_Missense_Mutation_p.Y26C	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	26					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						ATTGGCATTATAAGCGAACCC	0.632																																					p.Y26C	Esophageal Squamous(136;1368 1743 5685 7935 50360)	.											.	HOXA3	153	0			c.A77G						.						43.0	33.0	37.0					7																	27150183		2054	4079	6133	SO:0001583	missense	3200	exon2			GCATTATAAGCGA		CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.77A>G	7.37:g.27150183T>C	ENSP00000379640:p.Tyr26Cys	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	5.0	NM_030661	A4D181	Missense_Mutation	SNP	ENST00000396352.4	37	CCDS5404.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601294	0.87055	.	.	ENSG00000105997	ENST00000396352;ENST00000317201;ENST00000522788;ENST00000522456	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.85856	0.5794	M	0.87617	2.895	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.88576	0.3133	10	0.87932	D	0	.	15.445	0.75223	0.0:0.0:0.0:1.0	.	26	O43365	HXA3_HUMAN	C	26	ENSP00000379640:Y26C;ENSP00000324884:Y26C;ENSP00000429426:Y26C;ENSP00000430566:Y26C	ENSP00000324884:Y26C	Y	-	2	0	HOXA3	27116708	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.603000	0.82811	2.056000	0.61249	0.379000	0.24179	TAT	.		0.632	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358708.2		
HOXA6	3203	broad.mit.edu;bcgsc.ca	37	7	27185389	27185389	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:27185389C>T	ENST00000222728.3	-	2	614	c.590G>A	c.(589-591)cGc>cAc	p.R197H	HOXA-AS3_ENST00000518947.2_RNA|HOXA5_ENST00000520854.1_5'Flank|HOXA-AS3_ENST00000521231.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA|HOXA5_ENST00000222726.3_5'Flank|HOXA6_ENST00000521478.1_5'UTR|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA	NM_024014.3	NP_076919.1	P31267	HXA6_HUMAN	homeobox A6	197					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(5)|lung(3)|ovary(1)	10						CTTGATCTGGCGCTCGGTGAG	0.587																																					p.R197H		.											HOXA6,brain,glioma,+1	HOXA6	91	0			c.G590A						.						170.0	162.0	164.0					7																	27185389		2203	4300	6503	SO:0001583	missense	3203	exon2			ATCTGGCGCTCGG		CCDS5407.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106006	ENSG00000106006		"""Homeoboxes / ANTP class : HOXL subclass"""	5107	protein-coding gene	gene with protein product		142951	"""homeo box A6"""	HOX1B, HOX1		1973146, 1358459	Standard	NM_024014		Approved		uc003syo.2	P31267	OTTHUMG00000023216	ENST00000222728.3:c.590G>A	7.37:g.27185389C>T	ENSP00000222728:p.Arg197His	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	5.0	NM_024014	A4D192|Q2M3G3|Q9UPM0	Missense_Mutation	SNP	ENST00000222728.3	37	CCDS5407.1	.	.	.	.	.	.	.	.	.	.	C	36	5.709341	0.96821	.	.	ENSG00000106006	ENST00000222728	D	0.96802	-4.13	5.36	5.36	0.76844	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.98510	0.9503	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99525	1.0959	10	0.87932	D	0	.	19.0808	0.93180	0.0:1.0:0.0:0.0	.	197	P31267	HXA6_HUMAN	H	197	ENSP00000222728:R197H	ENSP00000222728:R197H	R	-	2	0	HOXA6	27151914	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.814000	0.86154	2.511000	0.84671	0.561000	0.74099	CGC	.		0.587	HOXA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358697.1		
IFT43	112752	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	76548963	76548963	+	Silent	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr14:76548963C>A	ENST00000314067.6	+	7	406	c.372C>A	c.(370-372)atC>atA	p.I124I	IFT43_ENST00000238628.6_Silent_p.I129I	NM_001102564.1	NP_001096034.1	Q96FT9	IFT43_HUMAN	intraflagellar transport 43	124					cilium morphogenesis (GO:0060271)|intraciliary retrograde transport (GO:0035721)	cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						CCTTCAGCATCCAGATAAAGC	0.562																																					p.I129I		.											.	IFT43	90	0			c.C387A						.						123.0	110.0	114.0					14																	76548963		2203	4300	6503	SO:0001819	synonymous_variant	112752	exon6			CAGCATCCAGATA	BC010436	CCDS9847.1, CCDS41973.1, CCDS58330.1	14q24.3	2014-07-03	2014-07-03	2011-06-09				"""Intraflagellar transport homologs"""	29669	protein-coding gene	gene with protein product		614068	"""chromosome 14 open reading frame 179"", ""intraflagellar transport 43 homolog (Chlamydomonas)"""	C14orf179		21378380	Standard	NM_052873		Approved	FLJ32173, MGC16028	uc010asm.1	Q96FT9		ENST00000314067.6:c.372C>A	14.37:g.76548963C>A		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	5.0	NM_052873	B3KPT6|B4DZI9|G3V385|O95418|Q9ULA9	Silent	SNP	ENST00000314067.6	37	CCDS41973.1																																																																																			.		0.562	IFT43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052873	
IL20RA	53832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	137323486	137323486	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr6:137323486T>C	ENST00000316649.5	-	7	1106	c.871A>G	c.(871-873)Att>Gtt	p.I291V	IL20RA_ENST00000468393.1_5'Flank|RP11-204P2.3_ENST00000458017.1_RNA|IL20RA_ENST00000367748.1_Missense_Mutation_p.I180V|IL20RA_ENST00000541547.1_Missense_Mutation_p.I242V	NM_001278722.1|NM_014432.2	NP_001265651.1|NP_055247	Q9UHF4	I20RA_HUMAN	interleukin 20 receptor, alpha	291					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of bone resorption (GO:0045124)	integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000351)|OV - Ovarian serous cystadenocarcinoma(155;0.00459)		TTTCCATAAATCAAAATCTAT	0.308																																					p.I291V		.											.	IL20RA	94	0			c.A871G						.						22.0	26.0	24.0					6																	137323486		2147	4196	6343	SO:0001583	missense	53832	exon7			CATAAATCAAAAT	AF184971	CCDS5181.1, CCDS64535.1, CCDS64536.1	6q23.3	2008-02-05			ENSG00000016402	ENSG00000016402		"""Interleukins and interleukin receptors"""	6003	protein-coding gene	gene with protein product		605620				10875937, 11163236	Standard	NM_001278724		Approved	ZCYTOR7, IL-20R1	uc003qhj.3	Q9UHF4	OTTHUMG00000015654	ENST00000316649.5:c.871A>G	6.37:g.137323486T>C	ENSP00000314976:p.Ile291Val	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	20.0	NM_014432	B4DLR5|F5H675|Q14CW2|Q6UWA9|Q96SH8	Missense_Mutation	SNP	ENST00000316649.5	37	CCDS5181.1	.	.	.	.	.	.	.	.	.	.	T	9.284	1.048943	0.19827	.	.	ENSG00000016402	ENST00000316649;ENST00000367748;ENST00000541547	T;T;T	0.61274	0.37;1.84;0.12	5.81	4.62	0.57501	.	0.684874	0.14796	N	0.297930	T	0.34048	0.0884	M	0.61703	1.905	0.30836	N	0.73616	P;P	0.39181	0.663;0.473	B;B	0.35278	0.199;0.091	T	0.11690	-1.0577	10	0.32370	T	0.25	-6.8675	10.2775	0.43519	0.0:0.0:0.3189:0.6811	.	180;291	Q9UHF4-2;Q9UHF4	.;I20RA_HUMAN	V	291;180;242	ENSP00000314976:I291V;ENSP00000356722:I180V;ENSP00000437843:I242V	ENSP00000314976:I291V	I	-	1	0	IL20RA	137365179	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	1.044000	0.30329	0.989000	0.38761	0.533000	0.62120	ATT	.		0.308	IL20RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042393.1	NM_014432	
INPPL1	3636	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71944787	71944787	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr11:71944787A>G	ENST00000298229.2	+	19	2415	c.2211A>G	c.(2209-2211)aaA>aaG	p.K737K	INPPL1_ENST00000541756.1_Splice_Site_p.K495K|INPPL1_ENST00000538751.1_Splice_Site_p.K495K	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	737					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TCTCCAAGAAAGGTGACTGTT	0.517																																					p.K737K		.											.	INPPL1	660	0			c.A2211G						.						164.0	144.0	151.0					11																	71944787		2200	4293	6493	SO:0001630	splice_region_variant	3636	exon19			CAAGAAAGGTGAC	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.2212+1A>G	11.37:g.71944787A>G		Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	15.0	NM_001567	B2RTX5|Q13577|Q13578	Silent	SNP	ENST00000298229.2	37	CCDS8213.1																																																																																			.		0.517	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	Silent
INSIG1	3638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	155093275	155093275	+	Splice_Site	SNP	G	G	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:155093275G>C	ENST00000340368.4	+	3	623		c.e3-1		INSIG1_ENST00000344756.4_Intron|INSIG1_ENST00000342407.5_Intron	NM_005542.4	NP_005533.2	O15503	INSI1_HUMAN	insulin induced gene 1						cell proliferation (GO:0008283)|cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|metabolic process (GO:0008152)|middle ear morphogenesis (GO:0042474)|negative regulation of cargo loading into COPII-coated vesicle (GO:1901303)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				endometrium(2)|kidney(2)|large_intestine(1)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	19	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTTTAAAACAGCTGTTGTTGG	0.418																																					.		.											.	INSIG1	90	0			c.413-1G>C						.						160.0	151.0	154.0					7																	155093275		2203	4300	6503	SO:0001630	splice_region_variant	3638	exon3			AAAACAGCTGTTG		CCDS5938.1, CCDS5939.1	7q36	2008-07-18			ENSG00000186480	ENSG00000186480			6083	protein-coding gene	gene with protein product	"""INSIG-1 membrane protein"""	602055				9268630	Standard	NM_005542		Approved	CL-6, MGC1405	uc003wly.3	O15503	OTTHUMG00000151330	ENST00000340368.4:c.413-1G>C	7.37:g.155093275G>C		Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	21.0	NM_005542	A4D2N1|A8K6L0|Q53XW8|Q9BUV5	Splice_Site	SNP	ENST00000340368.4	37	CCDS5938.1	.	.	.	.	.	.	.	.	.	.	G	12.21	1.868648	0.32977	.	.	ENSG00000186480	ENST00000340368;ENST00000476756	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8026	0.92023	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	INSIG1	154724208	1.000000	0.71417	0.994000	0.49952	0.097000	0.18754	9.451000	0.97610	2.602000	0.87976	0.655000	0.94253	.	.		0.418	INSIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322244.3	NM_198336	Intron
IPO8	10526	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	12	30789975	30789975	+	Missense_Mutation	SNP	C	C	A	rs61751231	byFrequency	TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr12:30789975C>A	ENST00000256079.4	-	22	2974	c.2636G>T	c.(2635-2637)aGa>aTa	p.R879I	IPO8_ENST00000544829.1_Missense_Mutation_p.R674I	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	879					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TACCAGTTGTCTAGTAGCACA	0.398																																					p.R879I		.											.	IPO8	227	0			c.G2636T						.						118.0	109.0	112.0					12																	30789975		2203	4300	6503	SO:0001583	missense	10526	exon22			AGTTGTCTAGTAG	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2636G>T	12.37:g.30789975C>A	ENSP00000256079:p.Arg879Ile	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	7.0	NM_006390	B7Z7M3	Missense_Mutation	SNP	ENST00000256079.4	37	CCDS8719.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.86|14.86	2.660895|2.660895	0.47572|0.47572	.|.	.|.	ENSG00000133704|ENSG00000133704	ENST00000535598|ENST00000256079;ENST00000545286;ENST00000544829	.|T;T	.|0.53857	.|1.6;0.6	5.06|5.06	3.23|3.23	0.37069|0.37069	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70081|0.70081	0.3183|0.3183	M|M	0.77103|0.77103	2.36|2.36	0.80722|0.80722	D|D	1|1	.|D;D;P	.|0.89917	.|0.993;1.0;0.638	.|D;D;B	.|0.91635	.|0.93;0.999;0.313	T|T	0.69764|0.69764	-0.5057|-0.5057	5|10	.|0.44086	.|T	.|0.13	-10.2807|-10.2807	11.9359|11.9359	0.52874|0.52874	0.0:0.8563:0.0:0.1437|0.0:0.8563:0.0:0.1437	.|.	.|674;355;879	.|B7Z7M3;Q59F59;O15397	.|.;.;IPO8_HUMAN	Y|I	37|879;355;674	.|ENSP00000256079:R879I;ENSP00000444520:R674I	.|ENSP00000256079:R879I	D|R	-|-	1|2	0|0	IPO8|IPO8	30681242|30681242	0.066000|0.066000	0.20996|0.20996	0.089000|0.089000	0.20774|0.20774	0.130000|0.130000	0.20726|0.20726	2.773000|2.773000	0.47686|0.47686	0.645000|0.645000	0.30675|0.30675	-0.157000|-0.157000	0.13467|0.13467	GAC|AGA	C|0.992;T|0.008		0.398	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
KIAA1033	23325	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	105519876	105519876	+	Nonsense_Mutation	SNP	C	C	G	rs190039477		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr12:105519876C>G	ENST00000332180.5	+	11	968	c.881C>G	c.(880-882)tCa>tGa	p.S294*		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						AGTATTCGGTCAATTTTTGCA	0.313																																					p.S294X		.											.	KIAA1033	91	0			c.C881G						.						112.0	100.0	103.0					12																	105519876		1819	4077	5896	SO:0001587	stop_gained	23325	exon11			TTCGGTCAATTTT	AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.881C>G	12.37:g.105519876C>G	ENSP00000328062:p.Ser294*	Somatic	161.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	38.0	NM_015275		Nonsense_Mutation	SNP	ENST00000332180.5	37	CCDS41826.1	.	.	.	.	.	.	.	.	.	.	C	30	5.056560	0.93793	.	.	ENSG00000136051	ENST00000332180	.	.	.	5.56	5.56	0.83823	.	0.103125	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.5177	0.95171	0.0:1.0:0.0:0.0	.	.	.	.	X	294	.	ENSP00000328062:S294X	S	+	2	0	KIAA1033	104044006	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.920000	0.70017	2.605000	0.88082	0.557000	0.71058	TCA	C|0.999;T|0.000		0.313	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406138.4	NM_015275	
KIAA1211L	343990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99449388	99449388	+	Silent	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:99449388G>A	ENST00000397899.2	-	4	643	c.312C>T	c.(310-312)gaC>gaT	p.D104D	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	104																	GCCGAGTAGCGTCCTGTCCGG	0.537																																					p.D104D		.											.	.	.	0			c.C312T						.						142.0	153.0	150.0					2																	99449388		1930	4131	6061	SO:0001819	synonymous_variant	343990	exon4			AGTAGCGTCCTGT	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.312C>T	2.37:g.99449388G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	9.0	NM_207362		Silent	SNP	ENST00000397899.2	37	CCDS42720.1																																																																																			.		0.537	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
LAMP1	3916	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	113960890	113960890	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr13:113960890C>T	ENST00000332556.4	+	2	346	c.152C>T	c.(151-153)tCa>tTa	p.S51L	LAMP1_ENST00000397181.3_Missense_Mutation_p.S51L	NM_005561.3	NP_005552.3	P11279	LAMP1_HUMAN	lysosomal-associated membrane protein 1	51	First lumenal domain.				autophagic cell death (GO:0048102)|autophagy (GO:0006914)|establishment of protein localization to organelle (GO:0072594)|Golgi to lysosome transport (GO:0090160)|granzyme-mediated apoptotic signaling pathway (GO:0008626)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|protein stabilization (GO:0050821)|regulation of organelle transport along microtubule (GO:1902513)	alveolar lamellar body (GO:0097208)|cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|phagolysosome membrane (GO:0061474)|sarcolemma (GO:0042383)	enzyme binding (GO:0019899)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|skin(1)|stomach(2)	16	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			GCTGCCTTCTCAGTGAACTAC	0.478																																					p.S51L		.											.	LAMP1	514	0			c.C152T						.						128.0	125.0	126.0					13																	113960890		2054	4220	6274	SO:0001583	missense	3916	exon2			CCTTCTCAGTGAA	J03263	CCDS41909.1	13q34	2011-11-24			ENSG00000185896	ENSG00000185896		"""CD molecules"""	6499	protein-coding gene	gene with protein product		153330					Standard	NM_005561		Approved	CD107a	uc001vtm.1	P11279	OTTHUMG00000017380	ENST00000332556.4:c.152C>T	13.37:g.113960890C>T	ENSP00000333298:p.Ser51Leu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	48.0	NM_005561	B4DWL3|Q8WU33|Q96I40|Q9BRD2|Q9NP13	Missense_Mutation	SNP	ENST00000332556.4	37	CCDS41909.1	.	.	.	.	.	.	.	.	.	.	C	1.527	-0.545454	0.04024	.	.	ENSG00000185896	ENST00000332556;ENST00000397181	T;T	0.34072	1.51;1.38	5.24	-4.04	0.04010	Lysosome-associated membrane glycoprotein, conserved site (1);	0.508978	0.20061	N	0.100086	T	0.12092	0.0294	N	0.04686	-0.185	0.09310	N	1	B;B	0.12013	0.0;0.005	B;B	0.09377	0.002;0.004	T	0.26087	-1.0113	10	0.16420	T	0.52	-0.9467	6.6254	0.22826	0.0:0.4712:0.3116:0.2171	.	51;51	B4DWL3;P11279	.;LAMP1_HUMAN	L	51	ENSP00000333298:S51L;ENSP00000415354:S51L	ENSP00000333298:S51L	S	+	2	0	LAMP1	113008891	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.598000	0.00419	-0.496000	0.06650	-0.302000	0.09304	TCA	.		0.478	LAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045876.2		
LCE5A	254910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152484032	152484032	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:152484032C>A	ENST00000334269.2	+	2	198	c.22C>A	c.(22-24)Cag>Aag	p.Q8K	CRCT1_ENST00000368790.3_5'Flank	NM_178438.4	NP_848525.1	Q5TCM9	LCE5A_HUMAN	late cornified envelope 5A	8	Cys-rich.				keratinization (GO:0031424)			p.Q8E(1)		lung(3)|ovary(1)|prostate(3)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCAGAGCCAGCAGCAGTGCCA	0.493																																					p.Q8K		.											.	LCE5A	91	1	Substitution - Missense(1)	prostate(1)	c.C22A						.						78.0	75.0	76.0					1																	152484032		2203	4300	6503	SO:0001583	missense	254910	exon2			AGCCAGCAGCAGT	BI670518	CCDS1011.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000186207	ENSG00000186207		"""Late cornified envelopes"""	16614	protein-coding gene	gene with protein product		612619	"""small proline rich-like (epidermal differentiation complex) 5A"""	SPRL5A		11698679	Standard	NM_178438		Approved	LEP18	uc001ezy.3	Q5TCM9	OTTHUMG00000014401	ENST00000334269.2:c.22C>A	1.37:g.152484032C>A	ENSP00000333952:p.Gln8Lys	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	14.0	NM_178438		Missense_Mutation	SNP	ENST00000334269.2	37	CCDS1011.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687947	0.29962	.	.	ENSG00000186207	ENST00000334269	T	0.03982	3.74	5.13	2.98	0.34508	.	.	.	.	.	T	0.02012	0.0063	M	0.75447	2.3	0.22457	N	0.999089	B	0.20052	0.041	B	0.19666	0.026	T	0.50101	-0.8867	9	0.07175	T	0.84	-0.2166	11.301	0.49306	0.257:0.743:0.0:0.0	.	8	Q5TCM9	LCE5A_HUMAN	K	8	ENSP00000333952:Q8K	ENSP00000333952:Q8K	Q	+	1	0	LCE5A	150750656	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	-0.093000	0.11111	0.476000	0.27440	0.603000	0.83216	CAG	.		0.493	LCE5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040059.1	NM_178438	
LINS	55180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	101112222	101112222	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:101112222T>A	ENST00000314742.8	-	6	1493	c.1271A>T	c.(1270-1272)cAt>cTt	p.H424L	LINS_ENST00000559149.1_5'Flank	NM_001040616.2	NP_001035706	Q8NG48	LINES_HUMAN	lines homolog (Drosophila)	424										central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(4)	21						GGGCTGAAGATGAGGCTTTAA	0.413																																					p.H424L		.											.	LINS	92	0			c.A1271T						.						92.0	88.0	89.0					15																	101112222		2203	4300	6503	SO:0001583	missense	55180	exon6			TGAAGATGAGGCT	AK095448	CCDS10385.1	15q26.3	2010-09-08	2010-09-08	2010-09-08	ENSG00000140471	ENSG00000140471			30922	protein-coding gene	gene with protein product		610350	"""lines homolog 1 (Drosophila)"""	LINS1		12119551, 8889548	Standard	NM_001040616		Approved	WINS1	uc002bwg.3	Q8NG48	OTTHUMG00000149865	ENST00000314742.8:c.1271A>T	15.37:g.101112222T>A	ENSP00000318423:p.His424Leu	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	9.0	NM_001040616	Q96FW2|Q9NVQ3	Missense_Mutation	SNP	ENST00000314742.8	37	CCDS10385.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572337	0.86542	.	.	ENSG00000140471	ENST00000314742	T	0.17528	2.27	6.07	4.93	0.64822	.	0.333575	0.35262	N	0.003333	T	0.34832	0.0911	M	0.69823	2.125	0.80722	D	1	D	0.56746	0.977	P	0.55923	0.787	T	0.12656	-1.0539	10	0.87932	D	0	-5.0496	13.4669	0.61260	0.0:0.0:0.1306:0.8694	.	424	Q8NG48	LINES_HUMAN	L	424	ENSP00000318423:H424L	ENSP00000318423:H424L	H	-	2	0	LINS	98929745	1.000000	0.71417	0.965000	0.40720	0.968000	0.65278	3.127000	0.50484	1.078000	0.41014	0.533000	0.62120	CAT	.		0.413	LINS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313592.1	NM_018148	
LRRIQ3	127255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	74649130	74649130	+	Missense_Mutation	SNP	T	T	G	rs552021191		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:74649130T>G	ENST00000395089.1	-	1	238	c.239A>C	c.(238-240)cAt>cCt	p.H80P	LRRIQ3_ENST00000370909.2_Missense_Mutation_p.H80P|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.H80P|LRRIQ3_ENST00000354431.4_Missense_Mutation_p.H80P			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	80										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						CTGATTTCCATGGAGATCAAG	0.303																																					p.H80P		.											.	LRRIQ3	92	0			c.A239C						.						62.0	67.0	66.0					1																	74649130		2199	4294	6493	SO:0001583	missense	127255	exon2			TTTCCATGGAGAT	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.239A>C	1.37:g.74649130T>G	ENSP00000378524:p.His80Pro	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	36.0	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	ENST00000395089.1	37	CCDS41350.1	.	.	.	.	.	.	.	.	.	.	T	18.47	3.630914	0.67015	.	.	ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000370909;ENST00000388972;ENST00000370911	T;T;T;T	0.33216	1.9;1.9;1.42;1.9	5.27	5.27	0.74061	.	0.190840	0.35013	N	0.003510	T	0.44498	0.1296	M	0.73598	2.24	0.38529	D	0.948936	D	0.60575	0.988	P	0.62813	0.907	T	0.51537	-0.8693	10	0.72032	D	0.01	.	14.4564	0.67418	0.0:0.0:0.0:1.0	.	80	A6PVS8	LRIQ3_HUMAN	P	80	ENSP00000378524:H80P;ENSP00000346414:H80P;ENSP00000359946:H80P;ENSP00000359948:H80P	ENSP00000346414:H80P	H	-	2	0	LRRIQ3	74421718	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.224000	0.65288	2.102000	0.63906	0.533000	0.62120	CAT	.		0.303	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
MAP1A	4130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43815176	43815176	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:43815176C>T	ENST00000300231.5	+	4	1955	c.1505C>T	c.(1504-1506)cCc>cTc	p.P502L	MAP1A_ENST00000382031.1_Missense_Mutation_p.P740L|MAP1A_ENST00000399453.1_Missense_Mutation_p.P502L			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	502	9 X 3 AA repeats of K-K-[DE].				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TCTTCTGAGCCCCAGACACCC	0.562																																					p.P502L		.											.	MAP1A	141	0			c.C1505T						.						47.0	48.0	48.0					15																	43815176		1967	4134	6101	SO:0001583	missense	4130	exon4			CTGAGCCCCAGAC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1505C>T	15.37:g.43815176C>T	ENSP00000300231:p.Pro502Leu	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	40.0	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	37	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	C	10.43	1.349227	0.24426	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.46063	0.88;0.88;0.88	5.07	5.07	0.68467	.	0.275737	0.19642	N	0.109428	T	0.35828	0.0945	M	0.63428	1.95	0.41925	D	0.990538	B	0.16802	0.019	B	0.17433	0.018	T	0.19289	-1.0310	10	0.20519	T	0.43	-7.6473	6.5579	0.22469	0.2978:0.6187:0.0:0.0835	.	502	P78559	MAP1A_HUMAN	L	740;502;502;502	ENSP00000371462:P740L;ENSP00000382380:P502L;ENSP00000300231:P502L	ENSP00000300231:P502L	P	+	2	0	MAP1A	41602468	0.651000	0.27340	1.000000	0.80357	0.873000	0.50193	1.389000	0.34453	2.804000	0.96469	0.655000	0.94253	CCC	.		0.562	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
MICAL3	57553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	18374289	18374289	+	Silent	SNP	G	G	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr22:18374289G>C	ENST00000441493.2	-	12	2008	c.1656C>G	c.(1654-1656)gcC>gcG	p.A552A	MICAL3_ENST00000429452.1_Silent_p.A552A|MICAL3_ENST00000585038.1_Silent_p.A552A|MICAL3_ENST00000444520.1_Silent_p.A552A|MICAL3_ENST00000414725.2_Silent_p.A552A|MICAL3_ENST00000400561.2_Silent_p.A552A|MICAL3_ENST00000383094.3_Silent_p.A552A|MICAL3_ENST00000207726.7_Silent_p.A552A	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	552	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTGCACAAAGGGCCAAGCCAC	0.473																																					p.A552A		.											.	MICAL3	68	0			c.C1656G						.						101.0	85.0	90.0					22																	18374289		1568	3582	5150	SO:0001819	synonymous_variant	57553	exon12			ACAAAGGGCCAAG	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.1656C>G	22.37:g.18374289G>C		Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	56.0	NM_015241	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Silent	SNP	ENST00000441493.2	37	CCDS46659.1																																																																																			.		0.473	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447351.1		
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108156479	108156479	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr3:108156479T>G	ENST00000273353.3	-	26	3259	c.3203A>C	c.(3202-3204)gAg>gCg	p.E1068A		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1068						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TAAATTGCCCTCCAGTTTGTG	0.458																																					p.E1068A		.											.	MYH15	73	0			c.A3203C						.						235.0	228.0	230.0					3																	108156479		1905	4127	6032	SO:0001583	missense	22989	exon26			TTGCCCTCCAGTT	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.3203A>C	3.37:g.108156479T>G	ENSP00000273353:p.Glu1068Ala	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	38.0	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.618381	0.66787	.	.	ENSG00000144821	ENST00000273353	D	0.93659	-3.26	5.56	5.56	0.83823	.	.	.	.	.	D	0.95611	0.8573	M	0.82517	2.595	0.54753	D	0.999985	P	0.51351	0.944	P	0.52424	0.698	D	0.96157	0.9112	9	0.87932	D	0	.	16.002	0.80301	0.0:0.0:0.0:1.0	.	1068	Q9Y2K3	MYH15_HUMAN	A	1068	ENSP00000273353:E1068A	ENSP00000273353:E1068A	E	-	2	0	MYH15	109639169	1.000000	0.71417	0.395000	0.26283	0.157000	0.22087	4.925000	0.63425	2.241000	0.73720	0.533000	0.62120	GAG	.		0.458	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
MYO1E	4643	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	59502718	59502718	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:59502718T>G	ENST00000288235.4	-	13	1756	c.1357A>C	c.(1357-1359)Aaa>Caa	p.K453Q	RNU4-80P_ENST00000363200.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	453	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		CTTACCACTTTGTTCTCTATG	0.353																																					p.K453Q		.											.	MYO1E	514	0			c.A1357C						.						185.0	176.0	179.0					15																	59502718		2191	4290	6481	SO:0001583	missense	4643	exon13			CCACTTTGTTCTC	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1357A>C	15.37:g.59502718T>G	ENSP00000288235:p.Lys453Gln	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	32.0	NM_004998	Q14778	Missense_Mutation	SNP	ENST00000288235.4	37	CCDS32254.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.365824	0.61513	.	.	ENSG00000157483	ENST00000288235	D	0.96104	-3.91	5.36	5.36	0.76844	Myosin head, motor domain (3);	0.000000	0.85682	D	0.000000	D	0.97337	0.9129	M	0.88570	2.965	0.80722	D	1	D	0.61697	0.99	P	0.55508	0.777	D	0.97933	1.0321	10	0.66056	D	0.02	.	15.5164	0.75828	0.0:0.0:0.0:1.0	.	453	Q12965	MYO1E_HUMAN	Q	453	ENSP00000288235:K453Q	ENSP00000288235:K453Q	K	-	1	0	MYO1E	57290010	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.841000	0.86834	2.257000	0.74773	0.459000	0.35465	AAA	.		0.353	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416024.1	NM_004998	
NAAA	27163	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	76857288	76857288	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr4:76857288C>A	ENST00000286733.4	-	3	573	c.472G>T	c.(472-474)Gat>Tat	p.D158Y	NAAA_ENST00000505594.1_Missense_Mutation_p.D57Y|NAAA_ENST00000399497.3_Missense_Mutation_p.D158Y|NAAA_ENST00000507956.1_Missense_Mutation_p.D158Y|NAAA_ENST00000507187.2_Missense_Mutation_p.D158Y	NM_014435.3	NP_055250.2	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase	158					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	11						AATTGCACATCCACTGTCAGC	0.413																																					p.D158Y		.											.	NAAA	91	0			c.G472T						.						149.0	137.0	141.0					4																	76857288		1863	4114	5977	SO:0001583	missense	27163	exon3			GCACATCCACTGT	M92449	CCDS43239.1	4q21.1	2011-09-23	2008-04-24	2008-04-24	ENSG00000138744	ENSG00000138744	3.5.1.-		736	protein-coding gene	gene with protein product		607469	"""N-acylsphingosine amidohydrolase (acid ceramidase)-like"""	ASAHL		10610717, 1446826	Standard	NM_001042402		Approved		uc003hjb.3	Q02083	OTTHUMG00000160855	ENST00000286733.4:c.472G>T	4.37:g.76857288C>A	ENSP00000286733:p.Asp158Tyr	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	10.0	NM_014435	Q5KTF2|Q96EY2|Q9BRA8	Missense_Mutation	SNP	ENST00000286733.4	37	CCDS43239.1	.	.	.	.	.	.	.	.	.	.	C	10.45	1.352310	0.24512	.	.	ENSG00000138744	ENST00000399497;ENST00000286733;ENST00000507956;ENST00000505594;ENST00000399490;ENST00000507187	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;0.87	5.9	4.17	0.49024	.	0.202861	0.51477	D	0.000093	D	0.82462	0.5042	L	0.59436	1.845	0.36839	D	0.887306	D;P;D	0.63880	0.984;0.798;0.993	D;B;D	0.63381	0.914;0.341;0.914	T	0.82301	-0.0525	10	0.30078	T	0.28	-14.7971	11.1999	0.48734	0.0:0.8517:0.0:0.1483	.	57;158;158	B4DVL2;D6R9S9;Q02083	.;.;NAAA_HUMAN	Y	158;158;158;57;158;158	ENSP00000382420:D158Y;ENSP00000286733:D158Y;ENSP00000427641:D158Y;ENSP00000426977:D57Y;ENSP00000423142:D158Y	ENSP00000286733:D158Y	D	-	1	0	NAAA	77076312	0.998000	0.40836	0.971000	0.41717	0.070000	0.16714	2.597000	0.46214	0.825000	0.34637	0.650000	0.86243	GAT	.		0.413	NAAA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362843.4		
NACA	4666	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57113603	57113603	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr12:57113603G>T	ENST00000454682.1	-	3	1992	c.1711C>A	c.(1711-1713)Cct>Act	p.P571T	NACA_ENST00000356769.3_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000550952.1_Missense_Mutation_p.P571T|NACA_ENST00000552540.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000551793.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	571	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						TGGAAAGAAGGGGAATTTTTA	0.507			T	BCL6	NHL																																p.P571T		.		Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	.	NACA	254	0			c.C1711A						.						66.0	66.0	66.0					12																	57113603		1568	3582	5150	SO:0001583	missense	4666	exon3			AAGAAGGGGAATT	X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.1711C>A	12.37:g.57113603G>T	ENSP00000403817:p.Pro571Thr	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	11.0	NM_001113203		Missense_Mutation	SNP	ENST00000454682.1	37		.	.	.	.	.	.	.	.	.	.	G	8.757	0.922697	0.18056	.	.	ENSG00000196531	ENST00000454682;ENST00000550952	T;T	0.53640	0.66;0.61	3.55	-2.58	0.06228	.	.	.	.	.	T	0.23926	0.0579	N	0.08118	0	0.09310	N	1	B;B	0.25351	0.124;0.051	B;B	0.26969	0.055;0.075	T	0.26950	-1.0088	9	0.87932	D	0	.	5.5362	0.17013	0.2233:0.502:0.2748:0.0	.	571;571	E9PAV3;F8VU71	.;.	T	571	ENSP00000403817:P571T;ENSP00000448035:P571T	ENSP00000403817:P571T	P	-	1	0	NACA	55399870	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.569000	0.05902	-0.129000	0.11620	-1.944000	0.00493	CCT	.		0.507	NACA-201	KNOWN	basic	protein_coding	protein_coding		NM_005594	
NDUFA5	4698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	123197496	123197496	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:123197496C>A	ENST00000355749.2	-	2	487	c.28G>T	c.(28-30)Ggc>Tgc	p.G10C	NDUFA5_ENST00000467117.1_5'UTR|NDUFA5_ENST00000471770.1_Missense_Mutation_p.G10C	NM_001282419.1|NM_005000.2	NP_001269348.1|NP_004991.1	Q16718	NDUA5_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5	10					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.G10S(1)		large_intestine(1)|urinary_tract(1)	2						CCCACAAGGCCAGTGGTCTGT	0.438																																					p.G10C		.											.	NDUFA5	90	1	Substitution - Missense(1)	urinary_tract(1)	c.G28T						.						117.0	88.0	98.0					7																	123197496		2203	4300	6503	SO:0001583	missense	4698	exon2			CAAGGCCAGTGGT		CCDS5788.1, CCDS64760.1, CCDS75655.1, CCDS75656.1	7q31.33	2013-06-19	2013-06-19		ENSG00000128609	ENSG00000128609		"""Mitochondrial respiratory chain complex / Complex I"""	7688	protein-coding gene	gene with protein product	"""complex I 13kDa subunit B"", ""ubiquinone reductase"", ""type I dehydrogenase"", ""NADH-ubiquinone oxidoreductase 13 kDa-B subunit"""	601677	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (13kD, B13)"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa"""			9763677, 9021153	Standard	XM_005250371		Approved	B13, NUFM, CI-13KD-B, UQOR13, CI-13kB	uc003vks.3	Q16718	OTTHUMG00000157348	ENST00000355749.2:c.28G>T	7.37:g.123197496C>A	ENSP00000347988:p.Gly10Cys	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	38.0	NM_005000	B2RD98|Q5H9R2|Q6IRX7	Missense_Mutation	SNP	ENST00000355749.2	37	CCDS5788.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.2|26.2	4.713270|4.713270	0.89112|0.89112	.|.	.|.	ENSG00000128609|ENSG00000128609	ENST00000471770;ENST00000355749;ENST00000470123;ENST00000340034|ENST00000378795	.|.	.|.	.|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|.	.|.	.|.	.|.	D|D	0.87374|0.87374	0.6161|0.6161	H|H	0.94847|0.94847	3.59|3.59	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.993|.	D|D	0.90497|0.90497	0.4471|0.4471	8|5	0.87932|.	D|.	0|.	.|.	18.4182|18.4182	0.90577|0.90577	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	10;10|.	E7ENS4;Q16718|.	.;NDUA5_HUMAN|.	C|L	10;10;20;10|5	.|.	ENSP00000341719:G10C|.	G|W	-|-	1|2	0|0	NDUFA5|NDUFA5	122984732|122984732	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	4.896000|4.896000	0.63222|0.63222	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	GGC|TGG	.		0.438	NDUFA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348533.1	NM_005000	
NEIL1	79661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75641492	75641492	+	Silent	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:75641492C>T	ENST00000564784.1	+	3	875	c.246C>T	c.(244-246)tcC>tcT	p.S82S	NEIL1_ENST00000567959.1_Intron|NEIL1_ENST00000569035.1_Silent_p.S82S|NEIL1_ENST00000355059.4_Silent_p.S82S			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	82			S -> C (in dbSNP:rs5745905). {ECO:0000269|Ref.3}.		base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						TCGGCATGTCCGGCTCTTTTC	0.687								Base excision repair (BER), DNA glycosylases																													p.S168S		.											.	NEIL1	659	0			c.C504T						.						37.0	34.0	35.0					15																	75641492		2197	4294	6491	SO:0001819	synonymous_variant	79661	exon2			CATGTCCGGCTCT	AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.246C>T	15.37:g.75641492C>T		Somatic	17.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	5.0	NM_001256552	D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Silent	SNP	ENST00000564784.1	37	CCDS10278.1																																																																																			.		0.687	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419885.1	NM_024608	
NLRC4	58484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32463205	32463205	+	Silent	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:32463205G>A	ENST00000404025.2	-	7	3005	c.2517C>T	c.(2515-2517)atC>atT	p.I839I	NLRC4_ENST00000360906.5_Silent_p.I839I|NLRC4_ENST00000402280.1_Silent_p.I839I|NLRC4_ENST00000342905.6_Silent_p.I174I			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	839					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGTTACCTAGGATTTTCACTG	0.363																																					p.I839I		.											.	NLRC4	276	0			c.C2517T						.						150.0	143.0	145.0					2																	32463205		2203	4300	6503	SO:0001819	synonymous_variant	58484	exon6			ACCTAGGATTTTC	AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.2517C>T	2.37:g.32463205G>A		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	20.0	NM_001199138	A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Silent	SNP	ENST00000404025.2	37	CCDS33174.1																																																																																			.		0.363	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325222.2	NM_021209	
NEU2	4759	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233899496	233899496	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:233899496A>T	ENST00000233840.3	+	2	872	c.872A>T	c.(871-873)cAg>cTg	p.Q291L		NM_005383.2	NP_005374.2	Q9Y3R4	NEUR2_HUMAN	sialidase 2 (cytosolic sialidase)	291					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)			endometrium(3)|large_intestine(2)|lung(10)|skin(2)|urinary_tract(1)	18		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0271)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0839)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0488)	Oseltamivir(DB00198)|Zanamivir(DB00558)	TCCCCAGCCCAGTGGCTGCTC	0.701																																					p.Q291L		.											.	NEU2	90	0			c.A872T						.						25.0	31.0	29.0					2																	233899496		2193	4280	6473	SO:0001583	missense	4759	exon2			CAGCCCAGTGGCT	Y16535	CCDS2501.1	2q37	2008-05-27			ENSG00000115488	ENSG00000115488			7759	protein-coding gene	gene with protein product	"""N-acetyl-alpha-neuraminidase 2"""	605528				10191093, 14613940	Standard	NM_005383		Approved	SIAL2	uc010zmn.2	Q9Y3R4	OTTHUMG00000133274	ENST00000233840.3:c.872A>T	2.37:g.233899496A>T	ENSP00000233840:p.Gln291Leu	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	12.0	NM_005383	Q3KNW4|Q6NTB4	Missense_Mutation	SNP	ENST00000233840.3	37	CCDS2501.1	.	.	.	.	.	.	.	.	.	.	A	2.438	-0.329182	0.05314	.	.	ENSG00000115488	ENST00000233840	D	0.85339	-1.97	5.05	-10.1	0.00402	Neuraminidase (2);	3.993760	0.00954	N	0.003010	T	0.73999	0.3659	N	0.22421	0.69	0.09310	N	1	B	0.20368	0.044	B	0.24394	0.053	T	0.65240	-0.6216	10	0.33141	T	0.24	2.1376	10.0018	0.41933	0.0968:0.4552:0.383:0.065	.	291	Q9Y3R4	NEUR2_HUMAN	L	291	ENSP00000233840:Q291L	ENSP00000233840:Q291L	Q	+	2	0	NEU2	233607740	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-3.244000	0.00542	-4.887000	0.00028	-0.316000	0.08728	CAG	.		0.701	NEU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257053.2	NM_005383	
NOBOX	135935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	144096113	144096113	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:144096113G>T	ENST00000467773.1	-	8	1398	c.1399C>A	c.(1399-1401)Cca>Aca	p.P467T	NOBOX_ENST00000223140.5_Missense_Mutation_p.P350T|NOBOX_ENST00000483238.1_Missense_Mutation_p.P435T	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	467	Pro-rich.				oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					ATCAGCAGTGGCATCAGTTGG	0.627																																					p.P467T		.											.	NOBOX	69	0			c.C1399A						.						9.0	10.0	10.0					7																	144096113		1915	4132	6047	SO:0001583	missense	135935	exon8			GCAGTGGCATCAG			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1399C>A	7.37:g.144096113G>T	ENSP00000419457:p.Pro467Thr	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	26.0	NM_001080413	A6NCD3|A8MZN5	Missense_Mutation	SNP	ENST00000467773.1	37		.	.	.	.	.	.	.	.	.	.	G	12.42	1.931841	0.34096	.	.	ENSG00000106410	ENST00000483238;ENST00000467773;ENST00000223140	D;D;D	0.96685	-3.5;-4.09;-3.61	4.78	3.89	0.44902	.	0.309371	0.32301	N	0.006296	D	0.97266	0.9106	M	0.69823	2.125	0.44500	D	0.997447	D	0.89917	1.0	D	0.91635	0.999	D	0.95953	0.8956	10	0.33141	T	0.24	-6.5832	11.1343	0.48365	0.0921:0.0:0.9079:0.0	.	467	O60393	NOBOX_HUMAN	T	435;467;350	ENSP00000419565:P435T;ENSP00000419457:P467T;ENSP00000223140:P350T	ENSP00000223140:P350T	P	-	1	0	NOBOX	143727046	1.000000	0.71417	0.723000	0.30687	0.045000	0.14185	1.974000	0.40559	0.995000	0.38917	0.655000	0.94253	CCA	.		0.627	NOBOX-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000350095.1	XM_001134420	
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15300099	15300099	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr19:15300099C>G	ENST00000263388.2	-	7	1252	c.1177G>C	c.(1177-1179)Gac>Cac	p.D393H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	393	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GAGCACTCGTCCACATCCTGG	0.632																																					p.D393H		.											.	NOTCH3	855	0			c.G1177C						.						84.0	82.0	83.0					19																	15300099		2203	4300	6503	SO:0001583	missense	4854	exon7			ACTCGTCCACATC	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1177G>C	19.37:g.15300099C>G	ENSP00000263388:p.Asp393His	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	12.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680284	0.68042	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.95622	-3.76	4.68	4.68	0.58851	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.98043	0.9355	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.99316	1.0905	9	0.87932	D	0	.	16.3746	0.83381	0.0:1.0:0.0:0.0	.	396;393	Q59FL3;Q9UM47	.;NOTC3_HUMAN	H	393;395	ENSP00000263388:D393H	ENSP00000263388:D393H	D	-	1	0	NOTCH3	15161099	1.000000	0.71417	0.998000	0.56505	0.539000	0.34962	5.645000	0.67909	2.154000	0.67381	0.491000	0.48974	GAC	.		0.632	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
NOX4	50507	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	89133229	89133229	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr11:89133229G>C	ENST00000263317.4	-	11	1268	c.1030C>G	c.(1030-1032)Ccc>Gcc	p.P344A	NOX4_ENST00000542487.1_Missense_Mutation_p.P320A|NOX4_ENST00000532825.1_Missense_Mutation_p.P320A|NOX4_ENST00000527956.1_Missense_Mutation_p.P320A|NOX4_ENST00000535633.1_Missense_Mutation_p.P320A|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000528341.1_Missense_Mutation_p.P319A|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000534731.1_Missense_Mutation_p.P344A|NOX4_ENST00000413594.2_Missense_Mutation_p.P365A|NOX4_ENST00000343727.5_Missense_Mutation_p.P320A|NOX4_ENST00000527626.1_Missense_Mutation_p.P178A|NOX4_ENST00000424319.1_Missense_Mutation_p.P320A			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	344	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				GATACACTGGGACAATGTAGA	0.308																																					p.P344A		.											.	NOX4	515	0			c.C1030G						.						86.0	87.0	87.0					11																	89133229		2201	4298	6499	SO:0001583	missense	50507	exon11			CACTGGGACAATG	AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1030C>G	11.37:g.89133229G>C	ENSP00000263317:p.Pro344Ala	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	13.0	NM_001143836	A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	ENST00000263317.4	37	CCDS8285.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.949219	0.73787	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594	T;T;T;T;T;T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41	4.77	4.77	0.60923	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	M	0.71920	2.185	0.58432	D	0.999997	D;D;D;D;D	0.89917	0.994;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.981;0.999;1.0;0.986;0.995	T	0.28073	-1.0055	9	.	.	.	-11.8467	18.1413	0.89641	0.0:0.0:1.0:0.0	.	320;178;319;344;344	E9PMY6;E9PR43;E9PPP2;Q9NPH5-6;Q9NPH5	.;.;.;.;NOX4_HUMAN	A	320;320;320;344;344;320;320;320;178;319;365	ENSP00000412446:P320A;ENSP00000440172:P320A;ENSP00000344747:P320A;ENSP00000436892:P344A;ENSP00000263317:P344A;ENSP00000434924:P320A;ENSP00000433797:P320A;ENSP00000439373:P320A;ENSP00000436093:P178A;ENSP00000436970:P319A;ENSP00000405705:P365A	.	P	-	1	0	NOX4	88772877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.237000	0.89807	2.362000	0.80069	0.561000	0.74099	CCC	.		0.308	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394054.1	NM_016931	
OLFM3	118427	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	102302451	102302451	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:102302451C>A	ENST00000338858.5	-	2	259	c.260G>T	c.(259-261)cGc>cTc	p.R87L	OLFM3_ENST00000370103.4_Missense_Mutation_p.R67L|OLFM3_ENST00000359814.3_Missense_Mutation_p.R87L|OLFM3_ENST00000536598.1_5'UTR|OLFM3_ENST00000462354.1_5'UTR			Q96PB7	NOE3_HUMAN	olfactomedin 3	87					eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)		p.R67L(1)|p.R87L(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		CAGTAGTTGGCGAAGTTGCCT	0.458																																					p.R67L		.											.	OLFM3	93	2	Substitution - Missense(2)	lung(2)	c.G200T						.						125.0	117.0	120.0					1																	102302451		2203	4300	6503	SO:0001583	missense	118427	exon2			AGTTGGCGAAGTT	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.260G>T	1.37:g.102302451C>A	ENSP00000345192:p.Arg87Leu	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	23.0	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	C	31	5.060999	0.93846	.	.	ENSG00000118733	ENST00000370103;ENST00000338858;ENST00000359814	T;T;T	0.53206	0.63;0.63;0.63	5.62	5.62	0.85841	.	0.055319	0.64402	D	0.000001	T	0.62672	0.2447	M	0.66939	2.045	0.80722	D	1	D;D	0.69078	0.979;0.997	D;D	0.79784	0.91;0.993	T	0.61242	-0.7102	10	0.48119	T	0.1	.	19.2804	0.94051	0.0:1.0:0.0:0.0	.	67;87	Q5T3V6;Q96PB7	.;NOE3_HUMAN	L	67;87;87	ENSP00000359121:R67L;ENSP00000345192:R87L;ENSP00000352867:R87L	ENSP00000345192:R87L	R	-	2	0	OLFM3	102075039	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.047000	0.71038	2.639000	0.89480	0.585000	0.79938	CGC	.		0.458	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
OR10G7	390265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	123909699	123909699	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr11:123909699C>T	ENST00000330487.5	-	1	18	c.10G>A	c.(10-12)Gcc>Acc	p.A4T		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AGTAGGGTGGCGTTGGACATT	0.488																																					p.A4T		.											.	OR10G7	70	0			c.G10A						.						87.0	76.0	80.0					11																	123909699		2200	4299	6499	SO:0001583	missense	390265	exon1			GGGTGGCGTTGGA	AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.10G>A	11.37:g.123909699C>T	ENSP00000329689:p.Ala4Thr	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	49.0	NM_001004463	Q6IFE8	Missense_Mutation	SNP	ENST00000330487.5	37	CCDS31705.1	.	.	.	.	.	.	.	.	.	.	C	0.165	-1.077648	0.01903	.	.	ENSG00000182634	ENST00000330487	T	0.00507	6.92	3.38	-6.76	0.01732	.	3.429150	0.00851	N	0.001833	T	0.00241	0.0007	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46020	-0.9221	10	0.07325	T	0.83	.	7.9091	0.29780	0.0815:0.0994:0.1147:0.7044	.	4	Q8NGN6	O10G7_HUMAN	T	4	ENSP00000329689:A4T	ENSP00000329689:A4T	A	-	1	0	OR10G7	123414909	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.737000	0.00055	-3.306000	0.00191	-2.177000	0.00319	GCC	.		0.488	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387271.1	NM_001004463	
PCDHGB3	56102	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	5	140778538	140778538	+	Intron	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr5:140778538T>C	ENST00000576222.1	+	1	2546				PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTATTCCTTCTACAGAACCGG	0.443																																					p.Y282H		.											.	.	.	0			c.T844C						.						94.0	100.0	98.0					5																	140778538		1935	4140	6075	SO:0001627	intron_variant	56101	exon1			TCCTTCTACAGAA	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+26162T>C	5.37:g.140778538T>C		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	23.0	NM_018925	A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	37	CCDS58980.1																																																																																			.		0.443	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
PHTF2	57157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	77551943	77551943	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:77551943A>G	ENST00000248550.7	+	10	1043	c.967A>G	c.(967-969)Acc>Gcc	p.T323A	PHTF2_ENST00000424760.1_Missense_Mutation_p.T285A|PHTF2_ENST00000454592.1_3'UTR|PHTF2_ENST00000422959.2_Missense_Mutation_p.T289A|PHTF2_ENST00000415251.2_Missense_Mutation_p.T285A|PHTF2_ENST00000416283.2_Missense_Mutation_p.T289A|PHTF2_ENST00000450574.1_Missense_Mutation_p.T289A|PHTF2_ENST00000275575.7_Missense_Mutation_p.T285A|PHTF2_ENST00000307305.8_Missense_Mutation_p.T285A			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						AACTTAGGATACCCAAAGGAC	0.373																																					p.T289A		.											.	PHTF2	23	0			c.A865G						.						56.0	52.0	54.0					7																	77551943		1835	4086	5921	SO:0001583	missense	57157	exon9			TAGGATACCCAAA	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.967A>G	7.37:g.77551943A>G	ENSP00000248550:p.Thr323Ala	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	17.0	NM_001127359	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	ENST00000248550.7	37		.	.	.	.	.	.	.	.	.	.	A	0.017	-1.492519	0.01009	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000424760;ENST00000415251;ENST00000275575;ENST00000450574;ENST00000416283;ENST00000248550	.	.	.	5.33	-0.00888	0.14003	.	0.904024	0.09556	N	0.786323	T	0.16854	0.0405	N	0.14661	0.345	0.23386	N	0.997783	B;B;B;B;B;B;B;B;B	0.19073	0.033;0.0;0.0;0.0;0.0;0.004;0.0;0.0;0.001	B;B;B;B;B;B;B;B;B	0.17979	0.02;0.0;0.001;0.0;0.0;0.005;0.0;0.0;0.001	T	0.32481	-0.9905	9	0.07325	T	0.83	0.2545	6.1327	0.20215	0.6723:0.1247:0.203:0.0	.	127;285;148;289;323;289;285;285;285	Q8WVD6;Q8N3S3-4;Q8N5I6;Q8N3S3-2;Q8N3S3;G5E9H7;Q8N3S3-3;B3KQZ2;E9PEE3	.;.;.;.;PHTF2_HUMAN;.;.;.;.	A	289;289;285;285;285;285;289;289;323	.	ENSP00000248550:T323A	T	+	1	0	PHTF2	77389879	0.027000	0.19231	0.695000	0.30226	0.088000	0.18126	0.078000	0.14761	-0.240000	0.09696	0.383000	0.25322	ACC	.		0.373	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
PKD1	5310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2158258	2158258	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr16:2158258T>C	ENST00000262304.4	-	15	7118	c.6910A>G	c.(6910-6912)Aca>Gca	p.T2304A	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Missense_Mutation_p.T2304A	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2304	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGACCTGTGTCGAAGCCACA	0.667																																					p.T2304A		.											.	PKD1	91	0			c.A6910G						.						23.0	26.0	25.0					16																	2158258		2183	4281	6464	SO:0001583	missense	5310	exon15			CCTGTGTCGAAGC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.6910A>G	16.37:g.2158258T>C	ENSP00000262304:p.Thr2304Ala	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	8.0	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	t	12.50	1.958122	0.34565	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.69561	-0.41;-0.41	5.05	2.71	0.32032	Egg jelly receptor, REJ-like (1);PKD/REJ-like protein (1);Polycystin cation channel (1);	0.311612	0.31233	N	0.008020	T	0.60792	0.2296	L	0.56769	1.78	0.23198	N	0.998135	P;P	0.43024	0.798;0.566	B;B	0.44044	0.439;0.438	T	0.52223	-0.8604	10	0.39692	T	0.17	.	5.8446	0.18659	0.3393:0.0:0.1039:0.5568	.	2304;2304	P98161-3;P98161	.;PKD1_HUMAN	A	2304;2304;1655;583	ENSP00000262304:T2304A;ENSP00000399501:T2304A	ENSP00000262304:T2304A	T	-	1	0	PKD1	2098259	0.986000	0.35501	0.021000	0.16686	0.885000	0.51271	1.987000	0.40687	0.225000	0.20959	0.445000	0.29226	ACA	.		0.667	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PKD1L2	114780	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	81190514	81190514	+	RNA	SNP	C	C	T	rs375813573		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr16:81190514C>T	ENST00000525539.1	-	0	4074				PKD1L2_ENST00000533478.1_RNA	NM_052892.3	NP_443124.3	Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						ACCACCAGCACGTAGACCACA	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18544	0.0		0.0	False		,,,				2504	0.0				.		.											.	PKD1L2	92	0			.						.						63.0	65.0	64.0					16																	81190514		2174	4271	6445			114780	.			CCAGCACGTAGAC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81190514C>T		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	25.0	.	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	RNA	SNP	ENST00000525539.1	37																																																																																				.		0.587	PKD1L2-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000387972.2		
PKN1	5585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14574553	14574553	+	Splice_Site	SNP	A	A	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr19:14574553A>C	ENST00000242783.6	+	10	1659	c.1494A>C	c.(1492-1494)caA>caC	p.Q498H	PKN1_ENST00000342216.4_Splice_Site_p.Q504H	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	498					activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						CCAAGCAGCAAGGTGAGAGGG	0.617																																					p.Q504H	NSCLC(185;2539 2965 10733 52867)	.											.	PKN1	1481	0			c.A1512C						.						66.0	72.0	70.0					19																	14574553		2053	4191	6244	SO:0001630	splice_region_variant	5585	exon10			GCAGCAAGGTGAG	S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.1495+1A>C	19.37:g.14574553A>C		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	32.0	NM_213560	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	ENST00000242783.6	37	CCDS42513.1	.	.	.	.	.	.	.	.	.	.	A	14.12	2.441295	0.43326	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.37058	1.22;1.22	4.72	2.47	0.30058	.	0.000000	0.64402	U	0.000003	T	0.53270	0.1786	M	0.76170	2.325	0.38450	D	0.946931	D;D	0.69078	0.997;0.995	D;D	0.81914	0.995;0.99	T	0.53746	-0.8395	10	0.72032	D	0.01	-13.5973	5.9547	0.19267	0.5415:0.0:0.4585:0.0	.	504;498	Q16512-2;Q16512	.;PKN1_HUMAN	H	498;504	ENSP00000242783:Q498H;ENSP00000343325:Q504H	ENSP00000242783:Q498H	Q	+	3	2	PKN1	14435553	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	1.426000	0.34870	0.227000	0.20999	0.454000	0.30748	CAA	.		0.617	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095510.1	NM_002741, NM_213560	Missense_Mutation
POT1	25913	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	124475442	124475442	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:124475442G>A	ENST00000357628.3	-	15	1994	c.1396C>T	c.(1396-1398)Ctc>Ttc	p.L466F	POT1_ENST00000393329.1_Missense_Mutation_p.L335F	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	466					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						TTGTTCGAGAGTTTGCAAATT	0.358																																					p.L466F	Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	.											.	POT1	227	0			c.C1396T						.						136.0	137.0	137.0					7																	124475442		2203	4300	6503	SO:0001583	missense	25913	exon15			TCGAGAGTTTGCA	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.1396C>T	7.37:g.124475442G>A	ENSP00000350249:p.Leu466Phe	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	15.0	NM_015450	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	ENST00000357628.3	37	CCDS5793.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603755	0.87157	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000265391	T;T	0.62364	0.03;0.03	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.80336	0.4604	M	0.78049	2.395	0.54753	D	0.999989	D	0.89917	1.0	D	0.87578	0.998	T	0.82464	-0.0444	10	0.87932	D	0	-10.4882	17.938	0.89018	0.0:0.0:1.0:0.0	.	466	Q9NUX5	POTE1_HUMAN	F	466;335;466;465	ENSP00000350249:L466F;ENSP00000377002:L335F	ENSP00000265391:L465F	L	-	1	0	POT1	124262678	1.000000	0.71417	0.623000	0.29173	0.990000	0.78478	4.205000	0.58466	2.648000	0.89879	0.591000	0.81541	CTC	.		0.358	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347861.1		
PLXNA4	91584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	131925877	131925877	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:131925877C>A	ENST00000359827.3	-	5	2514	c.1552G>T	c.(1552-1554)Gag>Tag	p.E518*	PLXNA4_ENST00000321063.4_Nonsense_Mutation_p.E518*			Q9HCM2	PLXA4_HUMAN	plexin A4	518	PSI 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CCAAGGCACTCGCCGCAGCTC	0.597																																					p.E518X		.											.	PLXNA4	91	0			c.G1552T						.						42.0	49.0	46.0					7																	131925877		2139	4276	6415	SO:0001587	stop_gained	91584	exon5			GGCACTCGCCGCA	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1552G>T	7.37:g.131925877C>A	ENSP00000352882:p.Glu518*	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	31.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Nonsense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	42	9.366496	0.99150	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	.	.	.	5.23	5.23	0.72850	.	0.053552	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	17.5561	0.87890	0.0:1.0:0.0:0.0	.	.	.	.	X	518	.	ENSP00000323194:E518X	E	-	1	0	PLXNA4	131576417	1.000000	0.71417	0.978000	0.43139	0.995000	0.86356	4.521000	0.60532	2.425000	0.82216	0.561000	0.74099	GAG	.		0.597	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
PRMT1	3276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	50187272	50187272	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr19:50187272C>A	ENST00000391851.4	+	5	576	c.447C>A	c.(445-447)tgC>tgA	p.C149*	MIR5088_ENST00000581740.1_RNA|PRMT1_ENST00000454376.2_Nonsense_Mutation_p.C167*|PRMT1_ENST00000532489.1_Nonsense_Mutation_p.C121*	NM_198318.4	NP_938074.2	Q99873	ANM1_HUMAN	protein arginine methyltransferase 1	157	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.			DIIISEWMGYCLFYESMLNTVLYARDKWL -> ASSSASGW ATASSTSPCSTPCSMPGTSV (in Ref. 2; BAA11029). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of megakaryocyte differentiation (GO:0045653)|neuron projection development (GO:0031175)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|protein methylation (GO:0006479)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|identical protein binding (GO:0042802)|methyltransferase activity (GO:0008168)|N-methyltransferase activity (GO:0008170)|poly(A) RNA binding (GO:0044822)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(2)	12		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)		TGGGCTACTGCCTCTTCTACG	0.632																																					p.C167X		.											.	PRMT1	91	0			c.C501A						.						207.0	136.0	160.0					19																	50187272		2203	4300	6503	SO:0001587	stop_gained	3276	exon6			CTACTGCCTCTTC	D66904	CCDS42592.1, CCDS46145.1, CCDS74425.1	19q13	2014-06-12	2006-02-16	2006-02-16	ENSG00000126457	ENSG00000126457	2.1.1.125	"""Protein arginine methyltransferases"""	5187	protein-coding gene	gene with protein product		602950	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 2"", ""HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae)"""	HRMT1L2		9545638	Standard	NM_001207042		Approved	HCP1, ANM1	uc010enf.2	Q99873	OTTHUMG00000167568	ENST00000391851.4:c.447C>A	19.37:g.50187272C>A	ENSP00000375724:p.Cys149*	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	22.0	NM_001536	B4E3C3|G5E9B6|Q15529|Q2VP93|Q6LEU5|Q8WUW5|Q99872|Q99874|Q9NZ04|Q9NZ05|Q9NZ06	Nonsense_Mutation	SNP	ENST00000391851.4	37	CCDS42592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.5|22.5	4.302155|4.302155	0.81136|0.81136	.|.	.|.	ENSG00000126457|ENSG00000126457	ENST00000524771|ENST00000529284;ENST00000532489;ENST00000527382;ENST00000534465;ENST00000391851;ENST00000449059;ENST00000454376;ENST00000526224	.|.	.|.	.|.	4.15|4.15	3.11|3.11	0.35812|0.35812	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.27697|.	0.0681|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.29119|.	-1.0022|.	3|.	.|0.10111	.|T	.|0.7	-4.5292|-4.5292	6.2474|6.2474	0.20827|0.20827	0.0:0.7754:0.0:0.2246|0.0:0.7754:0.0:0.2246	.|.	.|.	.|.	.|.	D|X	177|121;121;121;121;149;143;167;121	.|.	.|ENSP00000375724:C149X	A|C	+|+	2|3	0|2	PRMT1|PRMT1	54879084|54879084	0.369000|0.369000	0.25039|0.25039	1.000000|1.000000	0.80357|0.80357	0.930000|0.930000	0.56654|0.56654	-0.264000|-0.264000	0.08658|0.08658	0.933000|0.933000	0.37291|0.37291	0.591000|0.591000	0.81541|0.81541	GCC|TGC	.		0.632	PRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395065.1	NM_001536	
PRMT6	55170	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	107600118	107600118	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:107600118G>T	ENST00000370078.1	+	1	818	c.781G>T	c.(781-783)Gcc>Tcc	p.A261S	PRMT6_ENST00000361318.5_Missense_Mutation_p.A202S			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	261	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		GCTCTCCCGCGCCGGCTTGGA	0.677																																					p.A261S		.											.	PRMT6	90	0			c.G781T						.						18.0	21.0	20.0					1																	107600118		1915	4124	6039	SO:0001583	missense	55170	exon1			TCCCGCGCCGGCT	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.781G>T	1.37:g.107600118G>T	ENSP00000359095:p.Ala261Ser	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	15.0	NM_018137	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Missense_Mutation	SNP	ENST00000370078.1	37	CCDS41360.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.95|11.95	1.792575|1.792575	0.31685|0.31685	.|.	.|.	ENSG00000198890|ENSG00000198890	ENST00000361318;ENST00000370078|ENST00000540389	T;T|.	0.22945|.	1.93;1.93|.	4.98|4.98	1.9|1.9	0.25705|0.25705	.|.	0.849552|.	0.10338|.	N|.	0.686655|.	T|T	0.18425|0.18425	0.0442|0.0442	L|L	0.43152|0.43152	1.355|1.355	0.20703|0.20703	N|N	0.999862|0.999862	B|.	0.02656|.	0.0|.	B|.	0.09377|.	0.004|.	T|T	0.31392|0.31392	-0.9945|-0.9945	10|6	0.66056|0.87932	D|D	0.02|0	-21.247|-21.247	2.9449|2.9449	0.05842|0.05842	0.1022:0.1761:0.5397:0.182|0.1022:0.1761:0.5397:0.182	.|.	261|.	Q96LA8|.	ANM6_HUMAN|.	S|L	202;261|154	ENSP00000355145:A202S;ENSP00000359095:A261S|.	ENSP00000355145:A202S|ENSP00000440829:R154L	A|R	+|+	1|2	0|0	PRMT6|PRMT6	107401641|107401641	0.592000|0.592000	0.26832|0.26832	0.591000|0.591000	0.28745|0.28745	0.630000|0.630000	0.37929|0.37929	2.512000|2.512000	0.45485|0.45485	0.221000|0.221000	0.20879|0.20879	0.442000|0.442000	0.29010|0.29010	GCC|CGC	.		0.677	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137	
PSMB6	5694	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	4701710	4701710	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr17:4701710C>A	ENST00000270586.3	+	6	764	c.713C>A	c.(712-714)cCc>cAc	p.P238H	RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001270481.1|NM_002798.2	NP_001257410.1|NP_002789.1	P28072	PSB6_HUMAN	proteasome (prosome, macropain) subunit, beta type, 6	238					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	endopeptidase activity (GO:0004175)|threonine-type endopeptidase activity (GO:0004298)			endometrium(3)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11						ACTTTACCACCCGCCTGAATC	0.478																																					p.P238H		.											.	PSMB6	92	0			c.C713A						.						101.0	94.0	97.0					17																	4701710		2203	4300	6503	SO:0001583	missense	5694	exon6			TACCACCCGCCTG	BC000835	CCDS11056.1, CCDS73944.1	17p13	2004-02-18			ENSG00000142507	ENSG00000142507		"""Proteasome (prosome, macropain) subunits"""	9543	protein-coding gene	gene with protein product		600307				8066462, 1888762	Standard	NM_002798		Approved	Y, DELTA	uc002fzb.4	P28072	OTTHUMG00000090777	ENST00000270586.3:c.713C>A	17.37:g.4701710C>A	ENSP00000270586:p.Pro238His	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	14.0	NM_002798	Q96J55	Missense_Mutation	SNP	ENST00000270586.3	37	CCDS11056.1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.655578	0.29425	.	.	ENSG00000142507	ENST00000270586	T	0.30714	1.52	5.43	2.27	0.28462	.	0.087960	0.44483	D	0.000441	T	0.14270	0.0345	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18524	-1.0334	10	0.87932	D	0	-11.7244	6.4178	0.21725	0.3216:0.593:0.0:0.0855	.	238	P28072	PSB6_HUMAN	H	238	ENSP00000270586:P238H	ENSP00000270586:P238H	P	+	2	0	PSMB6	4648668	0.063000	0.20901	0.001000	0.08648	0.028000	0.11728	0.862000	0.27899	0.230000	0.21059	-0.136000	0.14681	CCC	.		0.478	PSMB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207559.2	NM_002798	
PSMD14	10213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	162227718	162227718	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:162227718C>G	ENST00000409682.3	+	7	1051	c.347C>G	c.(346-348)cCt>cGt	p.P116R		NM_005805.5	NP_005796.1	O00487	PSDE_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 14	116	MPN.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K63-linked deubiquitination (GO:0070536)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, lid subcomplex (GO:0008541)	endopeptidase activator activity (GO:0061133)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|proteasome binding (GO:0070628)|ubiquitin thiolesterase activity (GO:0004221)			breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	12						CACAGTCACCCTGGCTTTGGT	0.463																																					p.P116R		.											.	PSMD14	433	0			c.C347G						.						151.0	151.0	151.0					2																	162227718		2013	4179	6192	SO:0001583	missense	10213	exon7			GTCACCCTGGCTT	U86782	CCDS46437.1	2q14.3	2008-05-22			ENSG00000115233	ENSG00000115233		"""Proteasome (prosome, macropain) subunits"""	16889	protein-coding gene	gene with protein product		607173				9374539	Standard	NM_005805		Approved	POH1, pad1, Rpn11	uc002ubu.3	O00487	OTTHUMG00000153882	ENST00000409682.3:c.347C>G	2.37:g.162227718C>G	ENSP00000386541:p.Pro116Arg	Somatic	265.0	0.0		WXS	Illumina HiSeq	Phase_I	263.0	55.0	NM_005805	B3KNW2|O00176	Missense_Mutation	SNP	ENST00000409682.3	37	CCDS46437.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851033	0.71719	.	.	ENSG00000115233	ENST00000409682	D	0.87412	-2.25	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.96765	0.8944	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97907	1.0306	10	0.87932	D	0	-1.1902	20.1392	0.98050	0.0:1.0:0.0:0.0	.	116	O00487	PSDE_HUMAN	R	116	ENSP00000386541:P116R	ENSP00000386541:P116R	P	+	2	0	PSMD14	161935964	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.052000	0.71080	2.751000	0.94390	0.591000	0.81541	CCT	.		0.463	PSMD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332833.1	NM_005805	
RAB25	57111	hgsc.bcm.edu;broad.mit.edu	37	1	156035802	156035802	+	Silent	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:156035802G>A	ENST00000361084.5	+	2	385	c.144G>A	c.(142-144)gaG>gaA	p.E48E	RAB25_ENST00000487325.1_Intron	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	48					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					TCGGGGTTGAGTTCTCCACCC	0.607																																					p.E48E		.											.	RAB25	227	0			c.G144A						.						62.0	68.0	66.0					1																	156035802		2158	4272	6430	SO:0001819	synonymous_variant	57111	exon2			GGTTGAGTTCTCC	AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.144G>A	1.37:g.156035802G>A		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	4.0	NM_020387	Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Silent	SNP	ENST00000361084.5	37	CCDS41413.1																																																																																			.		0.607	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046185.1		
RANBP3	8498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5931460	5931460	+	Silent	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr19:5931460T>C	ENST00000340578.6	-	8	705	c.648A>G	c.(646-648)gcA>gcG	p.A216A	RANBP3_ENST00000439268.2_Silent_p.A216A|RANBP3_ENST00000591124.1_5'Flank|RANBP3_ENST00000591092.1_Silent_p.A148A|RANBP3_ENST00000034275.8_Silent_p.A148A|RANBP3_ENST00000541471.1_Silent_p.A88A	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	216					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						GACTTCTCCATGCAGCAGTGT	0.647																																					p.A216A		.											.	RANBP3	272	0			c.A648G						.						42.0	48.0	46.0					19																	5931460		2134	4246	6380	SO:0001819	synonymous_variant	8498	exon8			TCTCCATGCAGCA	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.648A>G	19.37:g.5931460T>C		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	19.0	NM_007322	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	ENST00000340578.6	37	CCDS42478.1																																																																																			.		0.647	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
ROBO1	6091	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	79639035	79639036	+	Frame_Shift_Ins	INS	-	-	A	rs200846416		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr3:79639035_79639036insA	ENST00000464233.1	-	2	139_140	c.26_27insT	c.(25-27)ttgfs	p.L9fs		NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATATCATGACCAAAAAAGGAAC	0.391																																					p.L9fs		.											.	ROBO1	67	0			c.27_28insT						.																																			SO:0001589	frameshift_variant	6091	exon2			CATGACCAAAAAA	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.27dupT	3.37:g.79639041_79639041dupA	ENSP00000420321:p.Leu9fs	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	11.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Frame_Shift_Ins	INS	ENST00000464233.1	37	CCDS54611.1																																																																																			.		0.391	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
RYR3	6263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	33936690	33936690	+	Silent	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr15:33936690C>A	ENST00000389232.4	+	28	3805	c.3735C>A	c.(3733-3735)gtC>gtA	p.V1245V	RYR3_ENST00000415757.3_Silent_p.V1245V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1245	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGACGTTTGTCAACGTGCCAA	0.512																																					p.V1245V		.											.	RYR3	520	0			c.C3735A						.						73.0	72.0	73.0					15																	33936690		1996	4161	6157	SO:0001819	synonymous_variant	6263	exon28			GTTTGTCAACGTG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.3735C>A	15.37:g.33936690C>A		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	44.0	NM_001243996	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																			.		0.512	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SEC31B	25956	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	102250534	102250534	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr10:102250534T>C	ENST00000370345.3	-	20	2676	c.2579A>G	c.(2578-2580)aAt>aGt	p.N860S		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	860	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GTCACTTATATTCTGTGTCCT	0.567																																					p.N860S		.											.	SEC31B	91	0			c.A2579G						.						53.0	50.0	51.0					10																	102250534		2203	4300	6503	SO:0001583	missense	25956	exon20			CTTATATTCTGTG	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2579A>G	10.37:g.102250534T>C	ENSP00000359370:p.Asn860Ser	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	5.0	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.627971	0.00813	.	.	ENSG00000075826	ENST00000370345	T	0.48201	0.82	4.83	-2.18	0.07037	.	0.948542	0.08888	N	0.879046	T	0.35682	0.0940	L	0.48362	1.52	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.001	T	0.41716	-0.9493	10	0.05620	T	0.96	0.0536	13.8403	0.63435	0.0:0.0:0.7447:0.2553	.	859;860	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	S	860	ENSP00000359370:N860S	ENSP00000359370:N860S	N	-	2	0	SEC31B	102240524	0.001000	0.12720	0.027000	0.17364	0.216000	0.24613	-0.359000	0.07632	-0.058000	0.13177	-0.478000	0.04885	AAT	.		0.567	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
SIPA1L3	23094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	38633246	38633246	+	Silent	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr19:38633246A>G	ENST00000222345.6	+	12	3938	c.3429A>G	c.(3427-3429)gtA>gtG	p.V1143V		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1143					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CTTACACAGTATCACCAGCAG	0.617											OREG0025445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V1143V		.											.	SIPA1L3	91	0			c.A3429G						.						226.0	218.0	221.0					19																	38633246		2203	4300	6503	SO:0001819	synonymous_variant	23094	exon12			CACAGTATCACCA	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.3429A>G	19.37:g.38633246A>G		Somatic	32.0	0.0	879	WXS	Illumina HiSeq	Phase_I	27.0	7.0	NM_015073	Q2TV87	Silent	SNP	ENST00000222345.6	37	CCDS33007.1																																																																																			.		0.617	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2	XM_032278	
SLC16A10	117247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	111540208	111540208	+	Silent	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr6:111540208C>T	ENST00000368851.5	+	5	1453	c.1278C>T	c.(1276-1278)ttC>ttT	p.F426F	SLC16A10_ENST00000368850.3_Silent_p.F112F	NM_018593.4	NP_061063.2	Q8TF71	MOT10_HUMAN	solute carrier family 16 (aromatic amino acid transporter), member 10	426					amino acid transport (GO:0006865)|aromatic amino acid transport (GO:0015801)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)	12		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)	Droxidopa(DB06262)|Glycine(DB00145)|L-Alanine(DB00160)|L-Arginine(DB00125)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Cystine(DB00138)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Histidine(DB00117)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Lysine(DB00123)|L-Methionine(DB00134)|L-Phenylalanine(DB00120)|L-Proline(DB00172)|L-Serine(DB00133)|L-Threonine(DB00156)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|L-Valine(DB00161)|Liothyronine(DB00279)|Liotrix(DB01583)|Pyruvic acid(DB00119)	TGCTCGGATTCATGTCTATAC	0.408																																					p.F426F		.											.	SLC16A10	514	0			c.C1278T						.						143.0	126.0	132.0					6																	111540208		2203	4300	6503	SO:0001819	synonymous_variant	117247	exon5			CGGATTCATGTCT	AF116652	CCDS5089.1	6q21-q22	2014-01-28	2013-07-18		ENSG00000112394	ENSG00000112394		"""Solute carriers"""	17027	protein-coding gene	gene with protein product		607550	"""solute carrier family 16 (monocarboxylic acid transporters), member 10"""			11278508, 11827462	Standard	NM_018593		Approved	TAT1, MCT10	uc003pus.3	Q8TF71	OTTHUMG00000015371	ENST00000368851.5:c.1278C>T	6.37:g.111540208C>T		Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	82.0	NM_018593	B3KWY0|Q6ZMG0|Q8WVI5	Silent	SNP	ENST00000368851.5	37	CCDS5089.1																																																																																			.		0.408	SLC16A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041822.2		
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	16259330	16259330	+	Missense_Mutation	SNP	G	G	T	rs550359408		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:16259330G>T	ENST00000375759.3	+	11	6799	c.6595G>T	c.(6595-6597)Gcc>Tcc	p.A2199S		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2199	Interaction with MSX2. {ECO:0000250}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AGAGGGCCTTGCCCCAGAGGA	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		18040	0.001		0.0	False		,,,				2504	0.0				p.A2199S		.											.	SPEN	298	0			c.G6595T						.						54.0	54.0	54.0					1																	16259330		2203	4300	6503	SO:0001583	missense	23013	exon11			GGCCTTGCCCCAG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.6595G>T	1.37:g.16259330G>T	ENSP00000364912:p.Ala2199Ser	Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	86.0	28.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	2.623	-0.288185	0.05605	.	.	ENSG00000065526	ENST00000375759	T	0.08807	3.05	5.05	-0.175	0.13315	.	.	.	.	.	T	0.02342	0.0072	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47156	-0.9139	9	0.07325	T	0.83	-1.2267	5.6873	0.17811	0.0834:0.1089:0.5737:0.234	.	2199	Q96T58	MINT_HUMAN	S	2199	ENSP00000364912:A2199S	ENSP00000364912:A2199S	A	+	1	0	SPEN	16131917	0.000000	0.05858	0.002000	0.10522	0.257000	0.26127	-0.343000	0.07791	0.047000	0.15862	0.462000	0.41574	GCC	.		0.582	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
STAB1	23166	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52558208	52558208	+	Silent	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr3:52558208C>T	ENST00000321725.6	+	68	7711	c.7635C>T	c.(7633-7635)gaC>gaT	p.D2545D		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2545					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		TTGGCAGCGACACCTTTTGTG	0.582																																					p.D2545D		.											.	STAB1	139	0			c.C7635T						.						214.0	195.0	201.0					3																	52558208		2203	4300	6503	SO:0001819	synonymous_variant	23166	exon68			CAGCGACACCTTT	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.7635C>T	3.37:g.52558208C>T		Somatic	114.0	1.0		WXS	Illumina HiSeq	Phase_I	78.0	21.0	NM_015136	A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	ENST00000321725.6	37	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	C	2.442	-0.328417	0.05314	.	.	ENSG00000010327	ENST00000469989	.	.	.	5.67	-11.3	0.00108	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	T	0.22138	-1.0225	4	.	.	.	.	10.2553	0.43394	0.0947:0.616:0.1901:0.0992	.	.	.	.	Y	152	.	.	H	+	1	0	STAB1	52533248	0.000000	0.05858	0.000000	0.03702	0.289000	0.27227	-2.512000	0.00957	-2.253000	0.00698	-0.367000	0.07326	CAC	.		0.582	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2	NM_015136	
STAM	8027	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	17730065	17730065	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr10:17730065G>A	ENST00000377524.3	+	5	552	c.337G>A	c.(337-339)Gtt>Att	p.V113I	STAM_ENST00000540523.1_Missense_Mutation_p.V2I	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	113	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						GGCTCTTATGGTTGAATGGAC	0.343																																					p.V113I		.											.	STAM	154	0			c.G337A						.						116.0	121.0	119.0					10																	17730065		2203	4300	6503	SO:0001583	missense	8027	exon5			CTTATGGTTGAAT	U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.337G>A	10.37:g.17730065G>A	ENSP00000366746:p.Val113Ile	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	33.0	NM_003473	B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	ENST00000377524.3	37	CCDS7122.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020537	0.93462	.	.	ENSG00000136738	ENST00000377524;ENST00000445846;ENST00000377500;ENST00000540523	T;T	0.22336	1.96;2.01	5.83	5.83	0.93111	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.000000	0.85682	D	0.000000	T	0.45296	0.1335	L	0.60455	1.87	0.80722	D	1	D	0.59357	0.985	D	0.68483	0.958	T	0.09443	-1.0674	10	0.48119	T	0.1	-29.0262	20.1133	0.97917	0.0:0.0:1.0:0.0	.	113	Q92783	STAM1_HUMAN	I	113;63;16;2	ENSP00000366746:V113I;ENSP00000438073:V2I	ENSP00000366721:V16I	V	+	1	0	STAM	17770071	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.796000	0.99103	2.762000	0.94881	0.591000	0.81541	GTT	.		0.343	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047039.1	NM_003473	
SUSD3	203328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	95846880	95846880	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr9:95846880G>A	ENST00000375472.3	+	5	655	c.619G>A	c.(619-621)Ggg>Agg	p.G207R	SUSD3_ENST00000375469.1_Missense_Mutation_p.G194R	NM_145006.2	NP_659443.1	Q96L08	SUSD3_HUMAN	sushi domain containing 3	207						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	13						CAAGGACCCTGGGATCCCCAG	0.617																																					p.G207R		.											.	SUSD3	292	0			c.G619A						.						108.0	99.0	102.0					9																	95846880		2203	4300	6503	SO:0001583	missense	203328	exon5			GACCCTGGGATCC	AK128289	CCDS6701.1, CCDS69620.1, CCDS75857.1	9q22.32	2004-01-29			ENSG00000157303	ENSG00000157303			28391	protein-coding gene	gene with protein product						12975309	Standard	NM_001287007		Approved	MGC26847	uc004atb.3	Q96L08	OTTHUMG00000020241	ENST00000375472.3:c.619G>A	9.37:g.95846880G>A	ENSP00000364621:p.Gly207Arg	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	9.0	NM_145006	Q49AA6|Q6UXV7	Missense_Mutation	SNP	ENST00000375472.3	37	CCDS6701.1	.	.	.	.	.	.	.	.	.	.	G	2.695	-0.272242	0.05716	.	.	ENSG00000157303	ENST00000375472;ENST00000375469	T;T	0.60040	0.22;0.63	4.33	-6.6	0.01824	.	1.212030	0.06033	N	0.653491	T	0.31451	0.0797	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.13656	-1.0501	10	0.21540	T	0.41	-2.2038	0.3483	0.00345	0.3556:0.251:0.1658:0.2275	.	194;207	Q96L08-2;Q96L08	.;SUSD3_HUMAN	R	207;194	ENSP00000364621:G207R;ENSP00000364618:G194R	ENSP00000364618:G194R	G	+	1	0	SUSD3	94886701	0.025000	0.19082	0.000000	0.03702	0.006000	0.05464	-0.532000	0.06164	-1.418000	0.02014	-1.785000	0.00643	GGG	.		0.617	SUSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053120.1	NM_145006	
SURF4	6836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	136234218	136234218	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr9:136234218T>A	ENST00000371989.3	-	2	281	c.152A>T	c.(151-153)cAg>cTg	p.Q51L	SURF4_ENST00000485435.2_Missense_Mutation_p.Q51L|SURF4_ENST00000467910.1_5'UTR|SURF4_ENST00000545297.1_Missense_Mutation_p.Q51L|SURF4_ENST00000371991.3_Missense_Mutation_p.Q51L	NM_001280788.1|NM_001280790.1|NM_001280791.1|NM_033161.2	NP_001267717.1|NP_001267719.1|NP_001267720.1|NP_149351.1	O15260	SURF4_HUMAN	surfeit 4	51					Golgi organization (GO:0007030)|positive regulation of organelle organization (GO:0010638)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(5)	8				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)		GTAGTCGCGCTGCTCGCTCCA	0.612																																					p.Q51L		.											.	SURF4	90	0			c.A152T						.						123.0	98.0	106.0					9																	136234218		2203	4300	6503	SO:0001583	missense	6836	exon2			TCGCGCTGCTCGC		CCDS6968.1, CCDS65177.1, CCDS65178.1, CCDS75929.1	9q33-q34	2008-07-21			ENSG00000148248	ENSG00000148248			11476	protein-coding gene	gene with protein product	"""surfeit locus protein 4"", ""surface 4 integral membrane protein"""	185660				8499913, 7540914	Standard	NM_033161		Approved	ERV29, FLJ22993, MGC102753	uc004cdj.3	O15260	OTTHUMG00000020868	ENST00000371989.3:c.152A>T	9.37:g.136234218T>A	ENSP00000361057:p.Gln51Leu	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	8.0	NM_033161	B7Z6A4|O60923|Q5T8U6|Q9UNZ0|Q9UNZ1	Missense_Mutation	SNP	ENST00000371989.3	37	CCDS6968.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.989404	0.93106	.	.	ENSG00000148248	ENST00000371989;ENST00000485435;ENST00000545297;ENST00000541390;ENST00000371991	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.85539	0.5720	M	0.93594	3.435	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;1.0	D;D;D;D	0.81914	0.978;0.992;0.973;0.995	D	0.89348	0.3659	9	0.87932	D	0	-5.6625	13.8621	0.63566	0.0:0.0:0.0:1.0	.	51;42;51;51	B7Z6A4;B7Z7A8;O15260-2;O15260	.;.;.;SURF4_HUMAN	L	51;51;51;42;51	.	ENSP00000361057:Q51L	Q	-	2	0	SURF4	135224039	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.912000	0.87465	1.858000	0.53909	0.533000	0.62120	CAG	.		0.612	SURF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054886.1	NM_033161	
SVIL	6840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	29818698	29818698	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr10:29818698G>A	ENST00000355867.4	-	12	2934	c.2182C>T	c.(2182-2184)Cgc>Tgc	p.R728C	SVIL_ENST00000375400.3_Missense_Mutation_p.R334C|SVIL_ENST00000375398.2_Missense_Mutation_p.R728C	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	728					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TGCAGACGGCGTAGCCTCTGC	0.502																																					p.R728C		.											.	SVIL	96	0			c.C2182T						.						122.0	107.0	112.0					10																	29818698		2203	4300	6503	SO:0001583	missense	6840	exon12			GACGGCGTAGCCT	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2182C>T	10.37:g.29818698G>A	ENSP00000348128:p.Arg728Cys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	11.0	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	ENST00000355867.4	37	CCDS7164.1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.363477	0.61513	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.66995	-0.24;-0.24;-0.24	5.21	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.80330	0.4603	M	0.76328	2.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81217	-0.1033	9	.	.	.	-18.1198	13.7812	0.63084	0.0:0.0:0.7213:0.2787	.	334;728	O95425-2;O95425	.;SVIL_HUMAN	C	334;728;728	ENSP00000364549:R334C;ENSP00000364547:R728C;ENSP00000348128:R728C	.	R	-	1	0	SVIL	29858704	0.996000	0.38824	0.205000	0.23548	0.629000	0.37895	2.510000	0.45468	1.284000	0.44531	0.591000	0.81541	CGC	.		0.502	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
TANC2	26115	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	61476233	61476233	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr17:61476233C>T	ENST00000424789.2	+	17	3071	c.3067C>T	c.(3067-3069)Cga>Tga	p.R1023*	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Nonsense_Mutation_p.R1023*|AC015923.1_ENST00000431604.1_RNA	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1023					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						GGAAGTAGAGCGAGCACAGAT	0.453																																					p.R1023X		.											.	TANC2	24	0			c.C3067T						.						114.0	116.0	115.0					17																	61476233		1975	4157	6132	SO:0001587	stop_gained	26115	exon17			GTAGAGCGAGCAC	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.3067C>T	17.37:g.61476233C>T	ENSP00000387593:p.Arg1023*	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	43.0	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Nonsense_Mutation	SNP	ENST00000424789.2	37	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	C	40	8.250445	0.98727	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	.	.	.	5.92	4.95	0.65309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2632	0.66099	0.3834:0.6166:0.0:0.0	.	.	.	.	X	1023	.	ENSP00000374171:R1023X	R	+	1	2	TANC2	58829965	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.200000	0.51051	1.504000	0.48704	0.561000	0.74099	CGA	.		0.453	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
TAS2R38	5726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141673256	141673256	+	Silent	SNP	A	A	G			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:141673256A>G	ENST00000547270.1	-	1	317	c.234T>C	c.(232-234)ctT>ctC	p.L78L		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	78					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GGAAGTGGGTAAGCTGGATAG	0.517																																					p.L78L		.											.	TAS2R38	92	0			c.T234C						.						147.0	140.0	143.0					7																	141673256		2203	4300	6503	SO:0001819	synonymous_variant	5726	exon1			GTGGGTAAGCTGG	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.234T>C	7.37:g.141673256A>G		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	28.0	NM_176817	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Silent	SNP	ENST00000547270.1	37	CCDS34765.1																																																																																			.		0.517	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350810.2	NM_176817	
TCF7L2	6934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	114910795	114910795	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr10:114910795A>T	ENST00000355995.4	+	9	1421	c.914A>T	c.(913-915)cAc>cTc	p.H305L	TCF7L2_ENST00000534894.1_Missense_Mutation_p.H305L|TCF7L2_ENST00000352065.5_Missense_Mutation_p.H282L|TCF7L2_ENST00000369397.4_Missense_Mutation_p.H282L|TCF7L2_ENST00000543371.1_Missense_Mutation_p.H305L|TCF7L2_ENST00000542695.1_Missense_Mutation_p.H21L|TCF7L2_ENST00000536810.1_Missense_Mutation_p.H305L|TCF7L2_ENST00000355717.4_Missense_Mutation_p.H329L|TCF7L2_ENST00000538897.1_Missense_Mutation_p.H305L|TCF7L2_ENST00000545257.1_Missense_Mutation_p.H305L|TCF7L2_ENST00000369389.1_Missense_Mutation_p.H16L|TCF7L2_ENST00000369386.1_5'Flank			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	305	Mediates interaction with MAD2L2.|Pro-rich.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		CATACGCTACACACGACGGGC	0.493			T	VTI1A	colorectal																																p.H329L		.		Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	.	TCF7L2	586	0			c.A986T						.						222.0	174.0	190.0					10																	114910795		2203	4300	6503	SO:0001583	missense	6934	exon9			CGCTACACACGAC	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.914A>T	10.37:g.114910795A>T	ENSP00000348274:p.His305Leu	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	19.0	NM_001146283	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Missense_Mutation	SNP	ENST00000355995.4	37		.	.	.	.	.	.	.	.	.	.	a	23.7	4.446928	0.84101	.	.	ENSG00000148737	ENST00000355995;ENST00000545257;ENST00000543371;ENST00000536810;ENST00000355717;ENST00000538897;ENST00000534894;ENST00000369397;ENST00000352065;ENST00000542695;ENST00000369389;ENST00000277945	D;D;D;D;D;D;D;D;D;D;D;D	0.99319	-5.18;-5.18;-5.19;-5.21;-5.7;-5.74;-5.71;-5.18;-5.7;-5.15;-5.71;-5.68	5.17	5.17	0.71159	.	0.146153	0.64402	D	0.000010	D	0.99363	0.9776	M	0.84326	2.69	0.80722	D	1	P;P;P;P;P;D;D;P;D;P;P;D;D;P;D;P;D;D;D	0.67145	0.803;0.895;0.892;0.944;0.945;0.996;0.972;0.937;0.992;0.803;0.773;0.984;0.968;0.902;0.99;0.945;0.974;0.981;0.996	P;P;P;D;P;D;P;P;D;P;B;P;P;P;D;P;D;D;D	0.76071	0.579;0.579;0.621;0.909;0.621;0.917;0.835;0.561;0.909;0.474;0.358;0.889;0.843;0.476;0.987;0.621;0.969;0.925;0.933	D	0.98988	1.0807	10	0.52906	T	0.07	-19.1255	15.0145	0.71573	1.0:0.0:0.0:0.0	.	162;122;204;305;176;220;278;282;282;248;305;282;282;287;329;282;305;278;282	B4DJZ2;B7Z9Z6;B4DWD5;Q9NQB0;C6ZRK4;C6ZRJ6;C6ZRJ9;F8W742;B4DRJ8;C6ZRK2;B9X074;C6ZRJ8;C6ZRK1;C6ZRJ7;F8W7T5;C6ZRK5;Q9NQB0-7;Q9NQB0-10;Q6FHW4	.;.;.;TF7L2_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	L	305;305;305;305;329;305;305;282;282;21;16;22	ENSP00000348274:H305L;ENSP00000440547:H305L;ENSP00000444972:H305L;ENSP00000446238:H305L;ENSP00000347949:H329L;ENSP00000446172:H305L;ENSP00000443626:H305L;ENSP00000358404:H282L;ENSP00000344823:H282L;ENSP00000443883:H21L;ENSP00000358396:H16L;ENSP00000277945:H22L	ENSP00000277945:H22L	H	+	2	0	TCF7L2	114900785	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.302000	0.78861	1.955000	0.56771	0.533000	0.62120	CAC	.		0.493	TCF7L2-203	KNOWN	basic	protein_coding	protein_coding		NM_030756	
TECTA	7007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	121036027	121036027	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr11:121036027G>T	ENST00000392793.1	+	17	5589	c.5318G>T	c.(5317-5319)cGa>cTa	p.R1773L	TECTA_ENST00000264037.2_Missense_Mutation_p.R1773L			O75443	TECTA_HUMAN	tectorin alpha	1773					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TGTCCCAACCGAACTTGCGAG	0.542																																					p.R1773L		.											.	TECTA	225	0			c.G5318T						.						196.0	161.0	173.0					11																	121036027		2203	4299	6502	SO:0001583	missense	7007	exon16			CCAACCGAACTTG	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.5318G>T	11.37:g.121036027G>T	ENSP00000376543:p.Arg1773Leu	Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	40.0	NM_005422		Missense_Mutation	SNP	ENST00000392793.1	37	CCDS8434.1	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597665	0.46318	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.36340	1.26;1.26	5.74	5.74	0.90152	.	0.372397	0.28766	N	0.014209	T	0.24736	0.0600	N	0.19112	0.55	0.34327	D	0.687201	P	0.40660	0.726	B	0.33690	0.168	T	0.18681	-1.0329	10	0.19590	T	0.45	.	19.9403	0.97159	0.0:0.0:1.0:0.0	.	1773	O75443	TECTA_HUMAN	L	1773	ENSP00000376543:R1773L;ENSP00000264037:R1773L	ENSP00000264037:R1773L	R	+	2	0	TECTA	120541237	1.000000	0.71417	0.945000	0.38365	0.909000	0.53808	5.735000	0.68587	2.712000	0.92718	0.650000	0.86243	CGA	.		0.542	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313850.1	NM_005422	
TMEM215	401498	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	32784555	32784555	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr9:32784555G>A	ENST00000342743.5	+	2	739	c.374G>A	c.(373-375)aGc>aAc	p.S125N		NM_212558.2	NP_997723.2	Q68D42	TM215_HUMAN	transmembrane protein 215	125						integral component of membrane (GO:0016021)				endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|prostate(2)	12						CCCCCACAAAGCCAGGGTGAG	0.622																																					p.S125N		.											.	TMEM215	90	0			c.G374A						.						39.0	41.0	40.0					9																	32784555		2203	4300	6503	SO:0001583	missense	401498	exon2			CACAAAGCCAGGG		CCDS6530.1	9p21.1	2008-08-08			ENSG00000188133	ENSG00000188133			33816	protein-coding gene	gene with protein product							Standard	NM_212558		Approved		uc003zri.4	Q68D42	OTTHUMG00000129521	ENST00000342743.5:c.374G>A	9.37:g.32784555G>A	ENSP00000345468:p.Ser125Asn	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	11.0	NM_212558	Q6ZUU2	Missense_Mutation	SNP	ENST00000342743.5	37	CCDS6530.1	.	.	.	.	.	.	.	.	.	.	G	1.655	-0.513084	0.04200	.	.	ENSG00000188133	ENST00000342743	.	.	.	5.73	4.81	0.61882	.	0.159567	0.43260	D	0.000586	T	0.17746	0.0426	N	0.08118	0	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.13710	-1.0499	9	0.29301	T	0.29	-11.5239	7.9653	0.30095	0.0841:0.1631:0.7528:0.0	.	125	Q68D42	TM215_HUMAN	N	125	.	ENSP00000345468:S125N	S	+	2	0	TMEM215	32774555	0.997000	0.39634	0.255000	0.24374	0.077000	0.17291	2.274000	0.43390	1.391000	0.46566	0.655000	0.94253	AGC	.		0.622	TMEM215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251701.1	NM_212558	
TMF1	7110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	69097137	69097137	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr3:69097137T>C	ENST00000398559.2	-	2	935	c.719A>G	c.(718-720)aAt>aGt	p.N240S	TMF1_ENST00000543976.1_Missense_Mutation_p.N240S|MIR3136_ENST00000583498.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	240					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		AGAAGGTGTATTGCTCTGCCT	0.403																																					p.N240S		.											.	TMF1	90	0			c.A719G						.						101.0	102.0	102.0					3																	69097137		1949	4150	6099	SO:0001583	missense	7110	exon2			GGTGTATTGCTCT		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.719A>G	3.37:g.69097137T>C	ENSP00000381567:p.Asn240Ser	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	44.0	NM_007114	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	ENST00000398559.2	37	CCDS43105.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.333595	0.41297	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248;ENST00000438636	T;T	0.76709	-1.04;-1.04	5.72	5.72	0.89469	.	0.082561	0.85682	D	0.000000	D	0.84061	0.5389	M	0.64997	1.995	0.58432	D	0.999994	D;D	0.61697	0.99;0.983	P;P	0.57244	0.816;0.659	D	0.85116	0.0966	10	0.54805	T	0.06	-18.5448	16.0634	0.80856	0.0:0.0:0.0:1.0	.	240;240	P82094-2;P82094	.;TMF1_HUMAN	S	240;240;153;240	ENSP00000381567:N240S;ENSP00000438706:N240S	ENSP00000348582:N153S	N	-	2	0	TMF1	69179827	1.000000	0.71417	0.991000	0.47740	0.068000	0.16541	8.037000	0.88933	2.192000	0.70111	0.524000	0.50904	AAT	.		0.403	TMF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352106.1	NM_007114	
TNRC6B	23112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	22	40662452	40662452	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr22:40662452C>T	ENST00000454349.2	+	5	2429	c.2218C>T	c.(2218-2220)Caa>Taa	p.Q740*	TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Nonsense_Mutation_p.Q740*|TNRC6B_ENST00000301923.9_Intron	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	740	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						CCAGCCCAATCAAGGATGGTC	0.522																																					p.Q740X		.											.	TNRC6B	22	0			c.C2218T						.						36.0	36.0	36.0					22																	40662452		1887	4115	6002	SO:0001587	stop_gained	23112	exon5			CCCAATCAAGGAT	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.2218C>T	22.37:g.40662452C>T	ENSP00000401946:p.Gln740*	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	54.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Nonsense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	C	37	6.126756	0.97305	.	.	ENSG00000100354	ENST00000454349;ENST00000400140;ENST00000335727	.	.	.	5.46	5.46	0.80206	.	0.591582	0.18879	N	0.128612	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	0.0239	19.3029	0.94150	0.0:1.0:0.0:0.0	.	.	.	.	X	740	.	ENSP00000338371:Q740X	Q	+	1	0	TNRC6B	38992398	1.000000	0.71417	0.995000	0.50966	0.422000	0.31414	3.532000	0.53553	2.575000	0.86900	0.561000	0.74099	CAA	.		0.522	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
TSLP	85480	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	110409217	110409217	+	Silent	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr5:110409217C>T	ENST00000344895.3	+	3	424	c.225C>T	c.(223-225)tgC>tgT	p.C75C	TSLP_ENST00000379706.4_5'UTR|TSLP_ENST00000420978.2_Silent_p.C75C	NM_033035.4	NP_149024.1	Q969D9	TSLP_HUMAN	thymic stromal lymphopoietin	75						extracellular space (GO:0005615)				breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	11		all_cancers(142;2.72e-05)|all_epithelial(76;4.39e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0417)|Ovarian(225;0.0443)|Colorectal(57;0.0464)|all_lung(232;0.0507)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.24e-08)|Epithelial(69;1.54e-07)|all cancers(49;1.73e-05)|COAD - Colon adenocarcinoma(37;0.109)		AGCCACATTGCCTTACTGAAA	0.502																																					p.C75C		.											.	TSLP	90	0			c.C225T						.						147.0	153.0	151.0					5																	110409217		2202	4300	6502	SO:0001819	synonymous_variant	85480	exon3			ACATTGCCTTACT	BC040592	CCDS4101.1	5q22.1	2007-08-24			ENSG00000145777	ENSG00000145777			30743	protein-coding gene	gene with protein product		607003				11418668, 11480573	Standard	NM_033035		Approved		uc003kpb.2	Q969D9	OTTHUMG00000128791	ENST00000344895.3:c.225C>T	5.37:g.110409217C>T		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	18.0	NM_033035	Q8IW99	Silent	SNP	ENST00000344895.3	37	CCDS4101.1																																																																																			.		0.502	TSLP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250717.1	NM_033035	
TSSK1B	83942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112769739	112769739	+	Silent	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr5:112769739G>T	ENST00000390666.3	-	1	989	c.798C>A	c.(796-798)atC>atA	p.I266I	MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		AGTGGCTGAGGATCTCGTCGA	0.617																																					p.I266I		.											.	TSSK1B	268	0			c.C798A						.						43.0	42.0	43.0					5																	112769739		2202	4300	6502	SO:0001819	synonymous_variant	83942	exon1			GCTGAGGATCTCG	AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.798C>A	5.37:g.112769739G>T		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	14.0	NM_032028	B2R8D9	Silent	SNP	ENST00000390666.3	37	CCDS4112.1																																																																																			.		0.617	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250774.2	NM_032028	
TTBK1	84630	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	43250675	43250675	+	Nonsense_Mutation	SNP	G	G	T	rs543120452		TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr6:43250675G>T	ENST00000259750.4	+	14	2280	c.2197G>T	c.(2197-2199)Gag>Tag	p.E733*		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	733	Glu-rich.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			TAATGGGAaggaggaagagga	0.582																																					p.E733X		.											.	TTBK1	353	0			c.G2197T						.						27.0	27.0	27.0					6																	43250675		2203	4300	6503	SO:0001587	stop_gained	84630	exon14			GGGAAGGAGGAAG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.2197G>T	6.37:g.43250675G>T	ENSP00000259750:p.Glu733*	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	25.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Nonsense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	G	36	5.922496	0.97105	.	.	ENSG00000146216	ENST00000259750	.	.	.	4.12	4.12	0.48240	.	0.573824	0.14998	N	0.286270	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	9.3516	0.38142	0.0:0.0:0.7862:0.2138	.	.	.	.	X	733	.	ENSP00000259750:E733X	E	+	1	0	TTBK1	43358653	0.371000	0.25056	0.998000	0.56505	0.949000	0.60115	0.574000	0.23714	1.835000	0.53391	0.555000	0.69702	GAG	.		0.582	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
UBXN4	23190	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	136513213	136513213	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:136513213C>T	ENST00000272638.9	+	5	771	c.460C>T	c.(460-462)Ctt>Ttt	p.L154F	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	154					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						AAATGCAGAGCTTTGTGAGAT	0.403																																					p.L154F		.											.	UBXN4	92	0			c.C460T						.						110.0	105.0	106.0					2																	136513213		1854	4108	5962	SO:0001583	missense	23190	exon5			GCAGAGCTTTGTG	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.460C>T	2.37:g.136513213C>T	ENSP00000272638:p.Leu154Phe	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	12.0	NM_014607	A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	ENST00000272638.9	37	CCDS42761.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801463	0.31869	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.47177	0.85	5.3	4.42	0.53409	.	0.719824	0.13327	N	0.396207	T	0.42743	0.1216	L	0.54323	1.7	0.24617	N	0.993691	P	0.49961	0.93	B	0.39068	0.289	T	0.33828	-0.9853	10	0.56958	D	0.05	.	11.4784	0.50312	0.0:0.9124:0.0:0.0876	.	154	Q92575	UBXN4_HUMAN	F	154;136	ENSP00000272638:L154F	ENSP00000272638:L154F	L	+	1	0	UBXN4	136229683	0.442000	0.25633	0.368000	0.25939	0.764000	0.43329	0.991000	0.29654	1.232000	0.43678	0.557000	0.71058	CTT	.		0.403	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331696.1	NM_014607	
TTN	7273	broad.mit.edu;bcgsc.ca	37	2	179407287	179407287	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:179407287T>C	ENST00000591111.1	-	299	92497	c.92273A>G	c.(92272-92274)aAg>aGg	p.K30758R	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K32399R|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K23526R|TTN_ENST00000342992.6_Missense_Mutation_p.K29831R|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K23459R|TTN_ENST00000460472.2_Missense_Mutation_p.K23334R|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30758					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGACCAGGCTTGTCTATGAA	0.388																																					p.K32399R		.											.	TTN	636	0			c.A97196G						.						54.0	55.0	55.0					2																	179407287		1865	4097	5962	SO:0001583	missense	7273	exon349			CCAGGCTTGTCTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92273A>G	2.37:g.179407287T>C	ENSP00000465570:p.Lys30758Arg	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	T	18.67	3.673078	0.67928	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.78	5.78	0.91487	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61248	0.2332	L	0.53729	1.69	0.54753	D	0.999984	D;D;D;D	0.76494	0.997;0.999;0.999;0.997	D;D;D;D	0.83275	0.985;0.996;0.996;0.985	T	0.63817	-0.6551	9	0.87932	D	0	.	16.1193	0.81336	0.0:0.0:0.0:1.0	.	23334;23459;23526;30758	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	29831;23334;23526;23459;23331	ENSP00000343764:K29831R;ENSP00000434586:K23334R;ENSP00000340554:K23526R;ENSP00000352154:K23459R	ENSP00000340554:K23526R	K	-	2	0	TTN	179115533	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.204000	0.70986	0.528000	0.53228	AAG	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UNC80	285175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	210835632	210835632	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr2:210835632C>A	ENST00000439458.1	+	53	8089	c.8009C>A	c.(8008-8010)cCt>cAt	p.P2670H	UNC80_ENST00000272845.6_Missense_Mutation_p.P2665H|UNC80_ENST00000539183.1_Missense_Mutation_p.P116H	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2670					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						CTCTCACCACCTCTGCCCTTC	0.498																																					p.P2670H		.											.	UNC80	90	0			c.C8009A						.						394.0	291.0	322.0					2																	210835632		692	1591	2283	SO:0001583	missense	285175	exon53			CACCACCTCTGCC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.8009C>A	2.37:g.210835632C>A	ENSP00000391088:p.Pro2670His	Somatic	243.0	0.0		WXS	Illumina HiSeq	Phase_I	254.0	47.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	19.06	3.754698	0.69648	.	.	ENSG00000144406	ENST00000439458;ENST00000272845;ENST00000333907;ENST00000539183	T;T	0.50277	0.75;0.75	5.27	5.27	0.74061	.	.	.	.	.	T	0.68210	0.2976	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.70554	-0.4840	9	0.87932	D	0	.	19.2563	0.93947	0.0:1.0:0.0:0.0	.	2665;2670	C9J1U3;Q8N2C7	.;UNC80_HUMAN	H	2670;2665;196;116	ENSP00000391088:P2670H;ENSP00000272845:P2665H	ENSP00000272845:P2665H	P	+	2	0	UNC80	210543877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.526000	0.81920	2.621000	0.88768	0.655000	0.94253	CCT	.		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
YIPF2	78992	ucsc.edu;bcgsc.ca	37	19	11034084	11034084	+	Splice_Site	SNP	C	C	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr19:11034084C>T	ENST00000586748.1	-	9	1007		c.e9-1		YIPF2_ENST00000253031.2_Splice_Site|YIPF2_ENST00000590329.1_Splice_Site			Q9BWQ6	YIPF2_HUMAN	Yip1 domain family, member 2							integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				cervix(1)|endometrium(1)|lung(3)|ovary(2)	7						AGAAGTACAACTGCACAAGAC	0.642																																					.		.											.	YIPF2	90	0			c.835-1G>A						.						119.0	121.0	120.0					19																	11034084		2203	4300	6503	SO:0001630	splice_region_variant	78992	exon10			GTACAACTGCACA	BC013014	CCDS12251.1	19p13.2	2008-02-05				ENSG00000130733		"""Yip1 domain family"""	28476	protein-coding gene	gene with protein product						12477932	Standard	NM_024029		Approved	MGC3262, FinGER2	uc002mqc.3	Q9BWQ6		ENST00000586748.1:c.835-1G>A	19.37:g.11034084C>T		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_024029		Splice_Site	SNP	ENST00000586748.1	37	CCDS12251.1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519549	0.44866	.	.	ENSG00000130733	ENST00000253031	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8411	0.63439	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	YIPF2	10895084	1.000000	0.71417	0.984000	0.44739	0.401000	0.30781	4.631000	0.61304	2.323000	0.78572	0.655000	0.94253	.	.		0.642	YIPF2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453045.1	NM_024029	Intron
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	77766040	77766041	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr8:77766040_77766041insA	ENST00000521891.2	+	10	7331_7332	c.6883_6884insA	c.(6883-6885)gaafs	p.E2295fs	ZFHX4_ENST00000050961.6_Frame_Shift_Ins_p.E2250fs|ZFHX4_ENST00000518282.1_Frame_Shift_Ins_p.E2269fs|ZFHX4_ENST00000455469.2_Frame_Shift_Ins_p.E2250fs	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAAAGATAATGAAAAAAGAGAA	0.396										HNSCC(33;0.089)																											p.E2295fs		.											.	ZFHX4	98	0			c.6883_6884insA						.																																			SO:0001589	frameshift_variant	79776	exon10			GATAATGAAAAAA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.6889dupA	8.37:g.77766046_77766046dupA	ENSP00000430497:p.Glu2295fs	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	61.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Frame_Shift_Ins	INS	ENST00000521891.2	37	CCDS47878.2																																																																																			.		0.396	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZNF644	84146	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	91406103	91406103	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr1:91406103T>C	ENST00000370440.1	-	3	1025	c.808A>G	c.(808-810)Atg>Gtg	p.M270V	ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000337393.5_Missense_Mutation_p.M270V			Q9H582	ZN644_HUMAN	zinc finger protein 644	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCATTAGTCATAAGAAATTGA	0.348																																					p.M270V		.											.	ZNF644	155	0			c.A808G						.						95.0	94.0	95.0					1																	91406103		2202	4300	6502	SO:0001583	missense	84146	exon3			TAGTCATAAGAAA	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.808A>G	1.37:g.91406103T>C	ENSP00000359469:p.Met270Val	Somatic	239.0	2.0		WXS	Illumina HiSeq	Phase_I	217.0	74.0	NM_201269	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	ENST00000370440.1	37	CCDS731.1	.	.	.	.	.	.	.	.	.	.	T	6.232	0.410991	0.11812	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000541557	T;T	0.00571	6.5;6.5	5.79	5.79	0.91817	.	0.236710	0.52532	D	0.000073	T	0.00178	0.0005	N	0.19112	0.55	0.37994	D	0.934029	B	0.02656	0.0	B	0.01281	0.0	T	0.55636	-0.8110	10	0.17369	T	0.5	-0.5945	10.4617	0.44583	0.0:0.072:0.0:0.928	.	270	Q9H582	ZN644_HUMAN	V	270	ENSP00000359469:M270V;ENSP00000337008:M270V	ENSP00000337008:M270V	M	-	1	0	ZNF644	91178691	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.685000	0.54678	2.218000	0.71995	0.533000	0.62120	ATG	.		0.348	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027846.2	NM_032186	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	88963648	88963648	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr7:88963648G>T	ENST00000333190.4	+	4	1961	c.1352G>T	c.(1351-1353)gGc>gTc	p.G451V		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	451							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGCAAGGATGGCCACACCACT	0.403										HNSCC(36;0.09)																											p.G451V		.											.	ZNF804B	101	0			c.G1352T						.						74.0	71.0	72.0					7																	88963648		2200	4297	6497	SO:0001583	missense	219578	exon4			AGGATGGCCACAC	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1352G>T	7.37:g.88963648G>T	ENSP00000329638:p.Gly451Val	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	28.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124073	0.56613	.	.	ENSG00000182348	ENST00000333190	T	0.10763	2.84	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000003	T	0.37348	0.1000	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.06752	-1.0809	10	0.87932	D	0	-14.3725	19.5755	0.95441	0.0:0.0:1.0:0.0	.	451	A4D1E1	Z804B_HUMAN	V	451	ENSP00000329638:G451V	ENSP00000329638:G451V	G	+	2	0	ZNF804B	88801584	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	7.024000	0.76443	2.865000	0.98341	0.655000	0.94253	GGC	.		0.403	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ZNF98	148198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22575694	22575694	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MC-01A-11D-A22F-10	TCGA-CC-A3MC-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	53285fbd-271b-4966-99a6-be108d4ca51c	b6adfc43-1baa-4942-bf7d-41745f3c0f90	g.chr19:22575694A>T	ENST00000357774.5	-	4	464	c.343T>A	c.(343-345)Tgt>Agt	p.C115S		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	115					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TCACGTCCACATTTTTTATAT	0.328																																					p.C115S		.											.	ZNF98	24	0			c.T343A						.						62.0	50.0	54.0					19																	22575694		1949	4162	6111	SO:0001583	missense	148198	exon4			GTCCACATTTTTT		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.343T>A	19.37:g.22575694A>T	ENSP00000350418:p.Cys115Ser	Somatic	325.0	1.0		WXS	Illumina HiSeq	Phase_I	284.0	103.0	NM_001098626		Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	6.372	0.436684	0.12104	.	.	ENSG00000197360	ENST00000357774	T	0.06218	3.33	0.916	-1.36	0.09085	.	.	.	.	.	T	0.06962	0.0177	M	0.66297	2.02	0.09310	N	1	B	0.18863	0.031	B	0.21917	0.037	T	0.40683	-0.9550	9	0.38643	T	0.18	.	2.3219	0.04213	0.5256:0.0:0.0:0.4744	.	115	A6NK75	ZNF98_HUMAN	S	115	ENSP00000350418:C115S	ENSP00000350418:C115S	C	-	1	0	ZNF98	22367534	0.000000	0.05858	0.174000	0.22961	0.170000	0.22686	-0.037000	0.12164	0.257000	0.21650	0.254000	0.18369	TGT	.		0.328	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
