#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACSBG2	81616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6147641	6147641	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:6147641C>G	ENST00000586696.1	+	3	528	c.252C>G	c.(250-252)aaC>aaG	p.N84K	ACSBG2_ENST00000591403.1_Missense_Mutation_p.N84K|ACSBG2_ENST00000588485.1_5'UTR|ACSBG2_ENST00000252669.5_Missense_Mutation_p.N84K|ACSBG2_ENST00000588304.1_Missense_Mutation_p.N34K			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	84					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGAATTTCAACCAGTACTATG	0.408																																					p.N84K		.											.	ACSBG2	23	0			c.C252G						.						136.0	141.0	139.0					19																	6147641		2203	4300	6503	SO:0001583	missense	81616	exon3			TTTCAACCAGTAC		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.252C>G	19.37:g.6147641C>G	ENSP00000465589:p.Asn84Lys	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	24.0	NM_030924	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	ENST00000586696.1	37	CCDS12159.1	.	.	.	.	.	.	.	.	.	.	C	0.672	-0.801612	0.02841	.	.	ENSG00000130377	ENST00000252669	T	0.39056	1.1	5.79	-0.698	0.11280	AMP-dependent synthetase/ligase (1);	1.056920	0.07401	N	0.890849	T	0.12092	0.0294	N	0.01779	-0.725	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.11329	0.002;0.006	T	0.33675	-0.9859	10	0.02654	T	1	-19.9618	1.5747	0.02622	0.248:0.3744:0.2233:0.1543	.	84;84	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	K	84	ENSP00000252669:N84K	ENSP00000252669:N84K	N	+	3	2	ACSBG2	6098641	0.395000	0.25254	0.400000	0.26346	0.108000	0.19459	0.106000	0.15354	0.370000	0.24538	-0.181000	0.13052	AAC	.		0.408	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452898.1	NM_030924	
ADAMTS7	11173	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	79058475	79058475	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr15:79058475G>T	ENST00000388820.4	-	19	3988	c.3778C>A	c.(3778-3780)Ctg>Atg	p.L1260M	ADAMTS7_ENST00000566303.1_5'Flank	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1260					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CCTGTCCACAGCTCCGCCACG	0.672																																					p.L1260M		.											.	ADAMTS7	226	0			c.C3778A						.						18.0	19.0	19.0					15																	79058475		2190	4289	6479	SO:0001583	missense	11173	exon19			TCCACAGCTCCGC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3778C>A	15.37:g.79058475G>T	ENSP00000373472:p.Leu1260Met	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	23.0	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	g	8.618	0.890829	0.17613	.	.	ENSG00000136378	ENST00000388820	T	0.59772	0.24	4.07	2.03	0.26663	.	1.454380	0.05546	U	0.566621	T	0.47985	0.1475	L	0.29908	0.895	0.09310	N	1	D	0.54397	0.966	P	0.45037	0.467	T	0.33497	-0.9866	10	0.33141	T	0.24	.	6.5866	0.22624	0.1059:0.3604:0.5337:0.0	.	1260	Q9UKP4	ATS7_HUMAN	M	1260	ENSP00000373472:L1260M	ENSP00000373472:L1260M	L	-	1	2	ADAMTS7	76845530	0.007000	0.16637	0.001000	0.08648	0.002000	0.02628	1.554000	0.36266	0.235000	0.21160	0.472000	0.43445	CTG	.		0.672	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ANKRD30A	91074	hgsc.bcm.edu;bcgsc.ca	37	10	37455583	37455583	+	Silent	SNP	G	G	T	rs41276132		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr10:37455583G>T	ENST00000374660.1	+	19	2046	c.1947G>T	c.(1945-1947)gcG>gcT	p.A649A	ANKRD30A_ENST00000602533.1_Intron|ANKRD30A_ENST00000361713.1_Silent_p.A649A			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	586					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CCAAGGCTGCGCATCAAAAAG	0.299																																					p.A649A		.											.	ANKRD30A	161	0			c.G1947T						.						3.0	3.0	3.0					10																	37455583		1398	3151	4549	SO:0001819	synonymous_variant	91074	exon19			GGCTGCGCATCAA	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000374660.1:c.1947G>T	10.37:g.37455583G>T		Somatic	702.0	1.0		WXS	Illumina HiSeq	Phase_I	789.0	155.0	NM_052997	Q5W025	Silent	SNP	ENST00000374660.1	37																																																																																				A|1.000;|0.000		0.299	ANKRD30A-002	PUTATIVE	NMD_exception|basic	protein_coding	protein_coding	OTTHUMT00000047589.2	NM_052997	
ANO1	55107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	69995875	69995875	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:69995875C>T	ENST00000355303.5	+	12	1623	c.1318C>T	c.(1318-1320)Ctc>Ttc	p.L440F	ANO1_ENST00000530676.1_Missense_Mutation_p.L324F|ANO1_ENST00000398543.2_Missense_Mutation_p.L324F|ANO1_ENST00000316296.5_Missense_Mutation_p.L412F|ANO1_ENST00000531349.1_Missense_Mutation_p.L175F|ANO1_ENST00000538023.1_Missense_Mutation_p.L440F|RP11-805J14.3_ENST00000530525.1_RNA	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	440					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	CCGCTGGGACCTCACGGGCTT	0.582																																					p.L440F		.											.	ANO1	47	0			c.C1318T						.						60.0	70.0	67.0					11																	69995875		2039	4191	6230	SO:0001583	missense	55107	exon12			TGGGACCTCACGG	BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.1318C>T	11.37:g.69995875C>T	ENSP00000347454:p.Leu440Phe	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	50.0	NM_018043	A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	ENST00000355303.5	37	CCDS44663.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345718	0.82022	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000316296;ENST00000530676;ENST00000531349;ENST00000531300	T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.05	4.13	0.48395	.	0.000000	0.64402	D	0.000005	D	0.82779	0.5111	M	0.93720	3.45	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.86786	0.1982	9	.	.	.	.	12.5398	0.56163	0.0:0.9183:0.0:0.0817	.	175;412;440	E9PNA7;Q5XXA6-3;Q5XXA6	.;.;ANO1_HUMAN	F	440;440;324;224;412;324;175;17	ENSP00000347454:L440F;ENSP00000444689:L440F;ENSP00000381551:L324F;ENSP00000319477:L412F;ENSP00000435797:L324F;ENSP00000432843:L175F;ENSP00000435868:L17F	.	L	+	1	0	ANO1	69673523	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.221000	0.51215	2.367000	0.80283	0.555000	0.69702	CTC	.		0.582	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000393685.1	NM_018043	
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	21246408	21246408	+	Nonsense_Mutation	SNP	C	C	A	rs150005693		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:21246408C>A	ENST00000233242.1	-	17	2720	c.2593G>T	c.(2593-2595)Gaa>Taa	p.E865*		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	865					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGGCTACTTCCAGTTTTACT	0.408																																					p.E865X		.											.	APOB	175	0			c.G2593T						.						111.0	105.0	107.0					2																	21246408		2203	4300	6503	SO:0001587	stop_gained	338	exon17			CTACTTCCAGTTT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2593G>T	2.37:g.21246408C>A	ENSP00000233242:p.Glu865*	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	64.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	37	6.358045	0.97502	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	.	.	.	5.35	4.42	0.53409	.	0.293217	0.29438	N	0.012158	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	10.5341	0.44994	0.1166:0.6808:0.2027:0.0	.	.	.	.	X	865	.	ENSP00000233242:E865X	E	-	1	0	APOB	21099913	0.016000	0.18221	0.415000	0.26534	0.324000	0.28378	1.481000	0.35476	2.675000	0.91044	0.655000	0.94253	GAA	C|1.000;T|0.000		0.408	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ARL13B	200894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	93755396	93755396	+	Splice_Site	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:93755396G>A	ENST00000394222.3	+	5	762	c.487G>A	c.(487-489)Gaa>Aaa	p.E163K	ARL13B_ENST00000539730.1_5'UTR|ARL13B_ENST00000471138.1_Splice_Site_p.E163K|ARL13B_ENST00000303097.7_Splice_Site_p.E56K|ARL13B_ENST00000486562.1_3'UTR|ARL13B_ENST00000535334.1_Splice_Site_p.E60K	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	163					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						TCTGTTTTAGGAACCATGTTC	0.323																																					p.E163K		.											.	ARL13B	91	0			c.G487A						.						50.0	53.0	52.0					3																	93755396		2203	4300	6503	SO:0001630	splice_region_variant	200894	exon5			TTTTAGGAACCAT	AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.487-1G>A	3.37:g.93755396G>A		Somatic	282.0	0.0		WXS	Illumina HiSeq	Phase_I	361.0	37.0	NM_182896	D3DN29|G3V1S8|Q504W8|Q8TCL5	Missense_Mutation	SNP	ENST00000394222.3	37	CCDS2925.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979751	0.92982	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138	T;T;T;T	0.76316	-1.01;-0.42;-1.01;-1.01	5.77	5.77	0.91146	.	0.051837	0.85682	D	0.000000	D	0.84334	0.5449	L	0.54965	1.715	0.80722	D	1	P;P;D;P	0.57571	0.909;0.771;0.98;0.877	P;P;P;P	0.58970	0.701;0.53;0.849;0.627	T	0.82238	-0.0556	9	.	.	.	-13.7506	19.9795	0.97321	0.0:0.0:1.0:0.0	.	60;163;56;163	G3V1S8;B4DLH1;Q3SXY8-2;Q3SXY8	.;.;.;AR13B_HUMAN	K	60;56;163;163	ENSP00000445145:E60K;ENSP00000306225:E56K;ENSP00000377769:E163K;ENSP00000420780:E163K	.	E	+	1	0	ARL13B	95238086	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.294000	0.78760	2.720000	0.93068	0.650000	0.86243	GAA	.		0.323	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896	Missense_Mutation
ASNS	440	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	97486092	97486092	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:97486092G>C	ENST00000394309.3	-	8	1411	c.940C>G	c.(940-942)Ctt>Gtt	p.L314V	ASNS_ENST00000394308.3_Missense_Mutation_p.L314V|ASNS_ENST00000444334.1_Missense_Mutation_p.L293V|ASNS_ENST00000437628.1_Missense_Mutation_p.L231V|ASNS_ENST00000175506.4_Missense_Mutation_p.L314V|ASNS_ENST00000422745.1_Missense_Mutation_p.L293V|ASNS_ENST00000455086.1_Missense_Mutation_p.L231V	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	314	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	GAGTTAAAAAGGACTTCATAA	0.338																																					p.L314V	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	.											.	ASNS	91	0			c.C940G						.						97.0	103.0	101.0					7																	97486092		2203	4300	6503	SO:0001583	missense	440	exon8			TAAAAAGGACTTC	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.940C>G	7.37:g.97486092G>C	ENSP00000377846:p.Leu314Val	Somatic	309.0	1.0		WXS	Illumina HiSeq	Phase_I	302.0	87.0	NM_133436	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	37	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	G	10.24	1.296580	0.23650	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01;1.01;1.01	4.2	3.21	0.36854	Rossmann-like alpha/beta/alpha sandwich fold (1);Asparagine synthase (1);	0.158453	0.53938	D	0.000043	T	0.17109	0.0411	N	0.03324	-0.35	0.33421	D	0.579898	B	0.13594	0.008	B	0.12837	0.008	T	0.18681	-1.0329	10	0.15952	T	0.53	-15.1624	8.7397	0.34550	0.0:0.0:0.6525:0.3475	.	314	P08243	ASNS_HUMAN	V	314;314;231;314;293;231;293	ENSP00000175506:L314V;ENSP00000377846:L314V;ENSP00000414379:L231V;ENSP00000377845:L314V;ENSP00000414901:L293V;ENSP00000408472:L231V;ENSP00000406994:L293V	ENSP00000175506:L314V	L	-	1	0	ASNS	97324028	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.106000	0.50322	2.285000	0.76669	0.555000	0.69702	CTT	.		0.338	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
ATP8B2	57198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154320946	154320946	+	Missense_Mutation	SNP	G	G	A	rs368404389	byFrequency	TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:154320946G>A	ENST00000368489.3	+	27	3325	c.3325G>A	c.(3325-3327)Gtc>Atc	p.V1109I		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	1095					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CACCACAGTCGTCTGCATCAT	0.607													G|||	17	0.00339457	0.0	0.0	5008	,	,		10810	0.0		0.0	False		,,,				2504	0.0174				p.V1109I		.											.	ATP8B2	92	0			c.G3325A						.						92.0	76.0	81.0					1																	154320946		2203	4300	6503	SO:0001583	missense	57198	exon27			ACAGTCGTCTGCA	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.3325G>A	1.37:g.154320946G>A	ENSP00000357475:p.Val1109Ile	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	94.0	NM_020452	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	37	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645918	0.29246	.	.	ENSG00000143515	ENST00000368489	T	0.42513	0.97	4.55	4.55	0.56014	.	0.222920	0.37577	N	0.002028	T	0.08980	0.0222	N	0.05177	-0.1	0.80722	D	1	B	0.14012	0.009	B	0.17433	0.018	T	0.14671	-1.0464	10	0.09843	T	0.71	.	11.984	0.53135	0.0:0.1753:0.8246:0.0	.	1109	P98198-3	.	I	1109	ENSP00000357475:V1109I	ENSP00000357475:V1109I	V	+	1	0	ATP8B2	152587570	0.995000	0.38212	0.981000	0.43875	0.778000	0.44026	2.371000	0.44248	2.349000	0.79799	0.491000	0.48974	GTC	.		0.607	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
BAI1	575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	143623348	143623348	+	Silent	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:143623348C>T	ENST00000517894.1	+	28	4647	c.3753C>T	c.(3751-3753)ggC>ggT	p.G1251G	BAI1_ENST00000323289.5_Silent_p.G1251G			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1251					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CCATCACGGGCACACTGAAGC	0.672																																					p.G1251G		.											.	BAI1	1129	0			c.C3753T						.						7.0	9.0	9.0					8																	143623348		2059	4153	6212	SO:0001819	synonymous_variant	575	exon27			CACGGGCACACTG	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3753C>T	8.37:g.143623348C>T		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_001702		Silent	SNP	ENST00000517894.1	37																																																																																				.		0.672	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379963.3	NM_001702	
ERCC5	2073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103518669	103518669	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr13:103518669C>G	ENST00000355739.4	+	10	3680	c.2257C>G	c.(2257-2259)Caa>Gaa	p.Q753E	BIVM-ERCC5_ENST00000602836.1_Nonsense_Mutation_p.S1178*|ERCC5_ENST00000375954.1_5'UTR	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	753	I-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ACTGAAAGCTCAAAAACAGCA	0.433			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.Q1207E		.	yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	.	.	.	0			c.C3619G						.						59.0	63.0	62.0					13																	103518669		2203	4300	6503	SO:0001583	missense	0	exon18	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AAAGCTCAAAAAC	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2257C>G	13.37:g.103518669C>G	ENSP00000347978:p.Gln753Glu	Somatic	271.0	0.0		WXS	Illumina HiSeq	Phase_I	675.0	128.0	NM_001204425	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610307	0.66558	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955	T	0.46063	0.88	5.77	4.93	0.64822	.	0.242319	0.43260	N	0.000594	T	0.55194	0.1905	M	0.70275	2.135	0.80722	D	1	P;P	0.48016	0.904;0.684	P;P	0.53809	0.735;0.525	T	0.55704	-0.8099	10	0.06757	T	0.87	-9.2917	19.8224	0.96603	0.0:0.8871:0.1129:0.0	.	753;1178	P28715;Q59FZ7	ERCC5_HUMAN;.	E	1178;753;585	ENSP00000347978:Q753E	ENSP00000347978:Q753E	Q	+	1	0	ERCC5	102316670	1.000000	0.71417	0.812000	0.32479	0.865000	0.49528	4.508000	0.60441	0.799000	0.34018	-0.795000	0.03280	CAA	.		0.433	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045708.1		
BPIFA2	140683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31768351	31768351	+	Silent	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr20:31768351G>T	ENST00000253362.2	+	8	881	c.735G>T	c.(733-735)ctG>ctT	p.L245L	BPIFA2_ENST00000354932.5_Silent_p.L245L			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	245						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										AAACCCAGCTGCAAACCCTCA	0.502																																					p.L245L		.											.	.	.	0			c.G735T						.						86.0	82.0	83.0					20																	31768351		2203	4300	6503	SO:0001819	synonymous_variant	140683	exon8			CCAGCTGCAAACC	AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.735G>T	20.37:g.31768351G>T		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	30.0	NM_080574	Q9BQQ0	Silent	SNP	ENST00000253362.2	37	CCDS13214.1																																																																																			.		0.502	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257117.1	NM_080574	
DDIAS	220042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	82644353	82644353	+	Missense_Mutation	SNP	A	A	G	rs369733646		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:82644353A>G	ENST00000533655.1	+	6	2185	c.1973A>G	c.(1972-1974)aAt>aGt	p.N658S	C11orf82_ENST00000430323.2_Missense_Mutation_p.N658S|C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000329143.3_Missense_Mutation_p.N357S	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		658					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						GGACATATCAATAACAACGTA	0.343																																					p.N658S		.											.	C11orf82	70	0			c.A1973G						.	A	SER/ASN	0,4406		0,0,2203	164.0	154.0	157.0		1973	-8.4	0.0	11		157	1,8599	1.2+/-3.3	0,1,4299	no	missense	C11orf82	NM_145018.3	46	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	658/999	82644353	1,13005	2203	4300	6503	SO:0001583	missense	220042	exon6			ATATCAATAACAA																												ENST00000533655.1:c.1973A>G	11.37:g.82644353A>G	ENSP00000435421:p.Asn658Ser	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	18.0	NM_145018	Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	37	CCDS8263.1	.	.	.	.	.	.	.	.	.	.	A	0.124	-1.121688	0.01785	0.0	1.16E-4	ENSG00000165490	ENST00000430323;ENST00000533655;ENST00000329143	T;T;T	0.18960	2.45;2.45;2.18	5.93	-8.38	0.00973	.	1.184200	0.05810	N	0.613768	T	0.10680	0.0261	N	0.21448	0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29792	-1.0000	9	.	.	.	.	7.8718	0.29571	0.5992:0.0757:0.2492:0.0758	.	658	Q8IXT1	NOXIN_HUMAN	S	658;658;357	ENSP00000414687:N658S;ENSP00000435421:N658S;ENSP00000329930:N357S	.	N	+	2	0	C11orf82	82322001	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.540000	0.06106	-1.470000	0.01888	-1.223000	0.01593	AAT	.		0.343	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1		
C18orf25	147339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	43796312	43796312	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr18:43796312A>T	ENST00000282059.6	+	2	840	c.466A>T	c.(466-468)Aaa>Taa	p.K156*	C18orf25_ENST00000321319.6_Nonsense_Mutation_p.K156*	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	156										central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						GGCTGCCAAGAAAAACCGGCA	0.532																																					p.K156X		.											.	C18orf25	515	0			c.A466T						.						49.0	52.0	51.0					18																	43796312		1958	4137	6095	SO:0001587	stop_gained	147339	exon2			GCCAAGAAAAACC	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.466A>T	18.37:g.43796312A>T	ENSP00000282059:p.Lys156*	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	57.0	NM_145055	A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Nonsense_Mutation	SNP	ENST00000282059.6	37	CCDS42430.1	.	.	.	.	.	.	.	.	.	.	A	39	7.487936	0.98316	.	.	ENSG00000152242	ENST00000282059;ENST00000321319	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.6571	15.5421	0.76062	1.0:0.0:0.0:0.0	.	.	.	.	X	156	.	ENSP00000282059:K156X	K	+	1	0	C18orf25	42050310	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.866000	0.92307	2.090000	0.63153	0.459000	0.35465	AAA	.		0.532	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	NM_145055	
C1orf111	284680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	162344018	162344018	+	Silent	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:162344018G>T	ENST00000367935.5	-	3	685	c.606C>A	c.(604-606)atC>atA	p.I202I	RP11-565P22.6_ENST00000431696.1_Intron	NM_182581.3	NP_872387.2	Q5T0L3	CA111_HUMAN	chromosome 1 open reading frame 111	202										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	11	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)			AGCCCCTCTTGATGTGGCTCT	0.602																																					p.I202I		.											.	C1orf111	69	0			c.C606A						.						110.0	109.0	109.0					1																	162344018		2203	4300	6503	SO:0001819	synonymous_variant	284680	exon3			CCTCTTGATGTGG	BC032957	CCDS1238.1	1q23.3	2008-02-05			ENSG00000171722	ENSG00000171722			27648	protein-coding gene	gene with protein product						12477932	Standard	NM_182581		Approved		uc001gbx.2	Q5T0L3	OTTHUMG00000031375	ENST00000367935.5:c.606C>A	1.37:g.162344018G>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	42.0	NM_182581	Q6X961|Q8NEC3	Silent	SNP	ENST00000367935.5	37	CCDS1238.1																																																																																			.		0.602	C1orf111-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076791.2	NM_182581	
DPAGT1	1798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118980899	118980899	+	5'Flank	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:118980899A>G	ENST00000409993.2	-	0	0				C2CD2L_ENST00000528586.1_5'Flank|C2CD2L_ENST00000336702.3_Missense_Mutation_p.E147G			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)						cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		GACCAATCTGAGCATACCATG	0.547																																					p.E147G		.											.	C2CD2L	68	0			c.A440G						.						101.0	83.0	89.0					11																	118980899		2200	4295	6495	SO:0001631	upstream_gene_variant	9854	exon2			AATCTGAGCATAC	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533		11.37:g.118980899A>G	Exception_encountered	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	35.0	NM_014807	O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	ENST00000409993.2	37	CCDS8411.1	.	.	.	.	.	.	.	.	.	.	A	8.254	0.809598	0.16537	.	.	ENSG00000172375	ENST00000336702	T	0.23950	1.88	5.08	5.08	0.68730	.	0.363124	0.31612	N	0.007346	T	0.15955	0.0384	N	0.25647	0.755	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10154	-1.0642	10	0.23891	T	0.37	0.0021	7.6606	0.28400	0.9043:0.0:0.0957:0.0	.	147;147	O14523;O14523-2	C2C2L_HUMAN;.	G	147	ENSP00000338885:E147G	ENSP00000338885:E147G	E	+	2	0	C2CD2L	118486109	1.000000	0.71417	0.990000	0.47175	0.411000	0.31082	4.731000	0.62022	1.927000	0.55829	0.533000	0.62120	GAG	.		0.547	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382	
C2CD2L	9854	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118986773	118986773	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:118986773G>T	ENST00000336702.3	+	14	2290	c.1931G>T	c.(1930-1932)gGc>gTc	p.G644V	C2CD2L_ENST00000528586.1_3'UTR	NM_014807.3	NP_055622.3	O14523	C2C2L_HUMAN	C2CD2-like	643						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						CTGCGCAGCGGCACTAAGCTC	0.632																																					p.G644V		.											.	C2CD2L	68	0			c.G1931T						.						49.0	47.0	48.0					11																	118986773		2200	4295	6495	SO:0001583	missense	9854	exon14			GCAGCGGCACTAA	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000336702.3:c.1931G>T	11.37:g.118986773G>T	ENSP00000338885:p.Gly644Val	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	9.0	NM_014807	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000336702.3	37	CCDS8413.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414053	0.83449	.	.	ENSG00000172375	ENST00000336702	T	0.62788	-0.0	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.79064	0.4383	M	0.71036	2.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80926	-0.1164	10	0.87932	D	0	-0.3502	17.918	0.88958	0.0:0.0:1.0:0.0	.	643;644	O14523;O14523-2	C2C2L_HUMAN;.	V	644	ENSP00000338885:G644V	ENSP00000338885:G644V	G	+	2	0	C2CD2L	118491983	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.017000	0.93651	2.693000	0.91896	0.655000	0.94253	GGC	.		0.632	C2CD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388197.2	NM_014807	
CALB1	793	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	91094853	91094853	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:91094853delC	ENST00000265431.3	-	1	254	c.73delG	c.(73-75)gctfs	p.A25fs	CALB1_ENST00000518457.1_5'Flank	NM_004929.2	NP_004920.1	P05937	CALB1_HUMAN	calbindin 1, 28kDa	25	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular response to organic substance (GO:0071310)|cytosolic calcium ion homeostasis (GO:0051480)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|metanephric collecting duct development (GO:0072205)|metanephric connecting tubule development (GO:0072286)|metanephric distal convoluted tubule development (GO:0072221)|metanephric part of ureteric bud development (GO:0035502)|regulation of synaptic plasticity (GO:0048167)|retina layer formation (GO:0010842)|short-term memory (GO:0007614)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|vitamin D binding (GO:0005499)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(8)|pancreas(1)	11			BRCA - Breast invasive adenocarcinoma(11;0.00953)			TCACCGTCAGCGTCGAAATGG	0.502																																					p.A25fs	Melanoma(46;573 1182 27367 39727 48386)	.											.	CALB1	91	0			c.73delG						.						259.0	226.0	237.0					8																	91094853		2203	4300	6503	SO:0001589	frameshift_variant	793	exon1			CGTCAGCGTCGAA		CCDS6251.1	8q21.3	2013-01-10	2002-08-29		ENSG00000104327	ENSG00000104327		"""EF-hand domain containing"""	1434	protein-coding gene	gene with protein product		114050		CALB			Standard	NM_004929		Approved		uc003yel.1	P05937	OTTHUMG00000134314	ENST00000265431.3:c.73delG	8.37:g.91094853delC	ENSP00000265431:p.Ala25fs	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	62.0	NM_004929	B2R696|B7Z9J4	Frame_Shift_Del	DEL	ENST00000265431.3	37	CCDS6251.1																																																																																			.		0.502	CALB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259338.2	NM_004929	
CCDC80	151887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	112326103	112326103	+	Splice_Site	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:112326103C>T	ENST00000206423.3	-	7	3379	c.2426G>A	c.(2425-2427)gGt>gAt	p.G809D	CCDC80_ENST00000439685.2_Splice_Site_p.G809D	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	809					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						GTGGCGCAGACCTGAGAGAAA	0.363																																					p.G809D		.											.	CCDC80	92	0			c.G2426A						.						80.0	76.0	77.0					3																	112326103		2203	4300	6503	SO:0001630	splice_region_variant	151887	exon7			CGCAGACCTGAGA	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2426-1G>A	3.37:g.112326103C>T		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	19.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	37	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928462	0.52759	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000479368	T;T;T	0.38887	1.11;1.11;1.11	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.52980	0.1768	N	0.25286	0.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.47724	-0.9095	10	0.33141	T	0.24	.	19.976	0.97309	0.0:1.0:0.0:0.0	.	809;809	A3KC71;Q76M96	.;CCD80_HUMAN	D	809;809;87	ENSP00000206423:G809D;ENSP00000411814:G809D;ENSP00000418188:G87D	ENSP00000206423:G809D	G	-	2	0	CCDC80	113808793	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.152000	0.77419	2.713000	0.92767	0.655000	0.94253	GGT	.		0.363	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	Missense_Mutation
CCR6	1235	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167549831	167549831	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:167549831T>C	ENST00000341935.5	+	3	665	c.113T>C	c.(112-114)tTg>tCg	p.L38S	CCR6_ENST00000349984.4_Missense_Mutation_p.L38S|RP11-517H2.6_ENST00000609590.1_RNA|CCR6_ENST00000400926.2_Missense_Mutation_p.L38S	NM_031409.3	NP_113597.2	P51684	CCR6_HUMAN	chemokine (C-C motif) receptor 6	38					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|humoral immune response (GO:0006959)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	14		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;8.21e-20)|BRCA - Breast invasive adenocarcinoma(81;4.55e-06)|GBM - Glioblastoma multiforme(31;0.00507)		CTGTGCTCCTTGCAGGAGGTC	0.433																																					p.L38S		.											.	CCR6	227	0			c.T113C						.						168.0	163.0	165.0					6																	167549831		2203	4300	6503	SO:0001583	missense	1235	exon3			GCTCCTTGCAGGA	U68030	CCDS5298.1	6q27	2012-08-08			ENSG00000112486	ENSG00000112486		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1607	protein-coding gene	gene with protein product		601835		STRL22		8886020	Standard	NM_031409		Approved	CKR-L3, GPR-CY4, CMKBR6, GPR29, DRY-6, DCR2, BN-1, CD196	uc010kkm.3	P51684	OTTHUMG00000016015	ENST00000341935.5:c.113T>C	6.37:g.167549831T>C	ENSP00000343952:p.Leu38Ser	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	48.0	NM_004367	E1P5C6|P78553|Q92846	Missense_Mutation	SNP	ENST00000341935.5	37	CCDS5298.1	.	.	.	.	.	.	.	.	.	.	T	9.710	1.156913	0.21454	.	.	ENSG00000112486	ENST00000400926;ENST00000341935;ENST00000349984	T;T;T	0.39997	1.05;1.05;1.05	4.72	3.5	0.40072	.	1.042900	0.07696	U	0.939472	T	0.16981	0.0408	L	0.35542	1.07	0.09310	N	1	B	0.25743	0.133	B	0.30716	0.119	T	0.40289	-0.9571	10	0.46703	T	0.11	.	8.5607	0.33509	0.3274:0.0:0.0:0.6726	.	38	P51684	CCR6_HUMAN	S	38	ENSP00000383715:L38S;ENSP00000343952:L38S;ENSP00000339393:L38S	ENSP00000343952:L38S	L	+	2	0	CCR6	167469821	0.998000	0.40836	0.001000	0.08648	0.045000	0.14185	3.655000	0.54460	0.601000	0.29879	0.459000	0.35465	TTG	.		0.433	CCR6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043118.1		
CDCP1	64866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	45153829	45153829	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:45153829C>A	ENST00000296129.1	-	3	535	c.401G>T	c.(400-402)aGc>aTc	p.S134I	CDCP1_ENST00000490471.1_5'UTR|CDCP1_ENST00000425231.2_Missense_Mutation_p.S134I	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	134						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TAAACCGATGCTCTTATGAGC	0.552																																					p.S134I		.											.	CDCP1	117	0			c.G401T						.						163.0	169.0	167.0					3																	45153829		2203	4300	6503	SO:0001583	missense	64866	exon3			CCGATGCTCTTAT	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.401G>T	3.37:g.45153829C>A	ENSP00000296129:p.Ser134Ile	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	96.0	NM_178181	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	ENST00000296129.1	37	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	C	11.40	1.626685	0.28978	.	.	ENSG00000163814	ENST00000296129;ENST00000425231	T;T	0.47528	1.81;0.84	5.42	3.51	0.40186	.	0.927239	0.09386	N	0.809238	T	0.42899	0.1223	L	0.47716	1.5	0.09310	N	1	B;B	0.27416	0.178;0.178	B;B	0.30495	0.074;0.116	T	0.39800	-0.9596	10	0.54805	T	0.06	.	7.6706	0.28457	0.0:0.7193:0.0:0.2807	.	134;134	Q9H5V8-3;Q9H5V8	.;CDCP1_HUMAN	I	134	ENSP00000296129:S134I;ENSP00000399342:S134I	ENSP00000296129:S134I	S	-	2	0	CDCP1	45128833	0.003000	0.15002	0.484000	0.27391	0.376000	0.30014	0.158000	0.16422	0.551000	0.29008	0.563000	0.77884	AGC	.		0.552	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
CDK2	1017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	56365394	56365394	+	Silent	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:56365394C>G	ENST00000266970.4	+	7	1122	c.882C>G	c.(880-882)ccC>ccG	p.P294P	RAB5B_ENST00000448789.2_5'Flank|CDK2_ENST00000440311.2_Silent_p.P234P|RAB5B_ENST00000360299.5_5'Flank|RAB5B_ENST00000553116.1_5'Flank|CDK2_ENST00000354056.4_Silent_p.P260P|CDK2_ENST00000556656.1_3'UTR|CDK2_ENST00000553376.1_Silent_p.P342P	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2	294					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	AGCCAGTACCCCATCTTCGAC	0.562																																					p.P294P		.											.	CDK2	1511	0			c.C882G						.						122.0	108.0	113.0					12																	56365394		2203	4300	6503	SO:0001819	synonymous_variant	1017	exon7			AGTACCCCATCTT	M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.882C>G	12.37:g.56365394C>G		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	31.0	NM_001798	A8K7C6|O75100	Silent	SNP	ENST00000266970.4	37	CCDS8898.1																																																																																			.		0.562	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409650.1		
CELSR1	9620	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	46930838	46930838	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr22:46930838T>C	ENST00000262738.3	-	1	2229	c.2230A>G	c.(2230-2232)Atc>Gtc	p.I744V	CELSR1_ENST00000395964.1_Missense_Mutation_p.I744V|CELSR1_ENST00000497509.1_5'Flank	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	744	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCCAGGGTGATGAGGCCGCCC	0.632																																					p.I744V		.											.	CELSR1	525	0			c.A2230G						.						61.0	44.0	50.0					22																	46930838		2200	4300	6500	SO:0001583	missense	9620	exon1			GGGTGATGAGGCC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.2230A>G	22.37:g.46930838T>C	ENSP00000262738:p.Ile744Val	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	12.0	NM_014246	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	T	2.479	-0.320087	0.05386	.	.	ENSG00000075275	ENST00000262738;ENST00000395964	T;T	0.58060	0.36;0.36	4.6	3.57	0.40892	Cadherin (4);Cadherin-like (1);	0.078284	0.48767	U	0.000165	T	0.39860	0.1094	L	0.28694	0.88	0.31688	N	0.642239	B	0.30439	0.279	B	0.38225	0.268	T	0.41680	-0.9495	10	0.12430	T	0.62	.	9.2488	0.37543	0.0:0.0869:0.0:0.9131	.	744	Q9NYQ6	CELR1_HUMAN	V	744	ENSP00000262738:I744V;ENSP00000379293:I744V	ENSP00000262738:I744V	I	-	1	0	CELSR1	45309502	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	2.656000	0.46716	1.720000	0.51447	0.254000	0.18369	ATC	.		0.632	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318037.1	NM_014246	
CHPF	79586	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	220404347	220404347	+	Missense_Mutation	SNP	C	C	T	rs142415191		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:220404347C>T	ENST00000243776.6	-	4	2334	c.2086G>A	c.(2086-2088)Gaa>Aaa	p.E696K	CHPF_ENST00000535926.1_Missense_Mutation_p.E534K	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	696					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		TCTTCTTGTTCTGAGGCTGCC	0.647																																					p.E696K		.											.	CHPF	90	0			c.G2086A						.	C	LYS/GLU,LYS/GLU	1,4401		0,1,2200	44.0	50.0	48.0		1600,2086	4.6	0.9	2	dbSNP_134	48	1,8593		0,1,4296	no	missense,missense	CHPF	NM_001195731.1,NM_024536.5	56,56	0,2,6496	TT,TC,CC		0.0116,0.0227,0.0154	benign,benign	534/614,696/776	220404347	2,12994	2201	4297	6498	SO:0001583	missense	79586	exon4			CTTGTTCTGAGGC	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.2086G>A	2.37:g.220404347C>T	ENSP00000243776:p.Glu696Lys	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	54.0	NM_024536	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	37	CCDS2443.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	8.192	0.796316	0.16327	2.27E-4	1.16E-4	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15834	2.39;2.39	4.57	4.57	0.56435	.	0.289130	0.33553	N	0.004787	T	0.06371	0.0164	N	0.02011	-0.69	0.36830	D	0.886835	B	0.02656	0.0	B	0.12156	0.007	T	0.32903	-0.9889	10	0.13108	T	0.6	-13.7164	12.357	0.55182	0.0:0.6874:0.3126:0.0	.	696	Q8IZ52	CHSS2_HUMAN	K	696;534	ENSP00000243776:E696K;ENSP00000445571:E534K	ENSP00000243776:E696K	E	-	1	0	CHPF	220112591	0.999000	0.42202	0.860000	0.33809	0.315000	0.28087	3.200000	0.51051	2.544000	0.85801	0.561000	0.74099	GAA	C|0.999;G|0.000;T|0.000		0.647	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536	
CHRNA9	55584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	40351330	40351330	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr4:40351330G>T	ENST00000310169.2	+	4	936	c.797G>T	c.(796-798)gGa>gTa	p.G266V		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	266					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	GCAGCCTCCGGAGAAAAGGTC	0.507																																					p.G266V	Esophageal Squamous(115;1297 1602 22235 25158 43327)	.											.	CHRNA9	96	0			c.G797T						.						169.0	179.0	175.0					4																	40351330		2203	4300	6503	SO:0001583	missense	55584	exon4			CCTCCGGAGAAAA	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.797G>T	4.37:g.40351330G>T	ENSP00000312663:p.Gly266Val	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	252.0	138.0	NM_017581	Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	ENST00000310169.2	37	CCDS3459.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122748	0.77436	.	.	ENSG00000174343	ENST00000310169	D	0.88431	-2.38	5.55	4.71	0.59529	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.044547	0.85682	D	0.000000	D	0.95535	0.8549	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96330	0.9243	10	0.87932	D	0	.	14.1466	0.65355	0.0719:0.0:0.9281:0.0	.	266	Q9UGM1	ACHA9_HUMAN	V	266	ENSP00000312663:G266V	ENSP00000312663:G266V	G	+	2	0	CHRNA9	40046087	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.869000	0.99810	1.360000	0.45960	0.561000	0.74099	GGA	.		0.507	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216822.1		
CNGA3	1261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99013401	99013401	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:99013401G>A	ENST00000272602.2	+	7	1807	c.1768G>A	c.(1768-1770)Gag>Aag	p.E590K	CNGA3_ENST00000393504.1_Missense_Mutation_p.E590K|CNGA3_ENST00000436404.2_Missense_Mutation_p.E572K|CNGA3_ENST00000409937.1_Missense_Mutation_p.E594K			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	590			E -> K (in ACHM2; also found in patients with cone-rod dystrophy; the dose- response relationship for cGMP-activation is shifted toward a lower cGMP concentration). {ECO:0000269|PubMed:15712225, ECO:0000269|PubMed:24903488}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GGCCCTCACCGAGTACCCCGA	0.617																																					p.E590K		.											.	CNGA3	96	0			c.G1768A	GRCh37	CM051026	CNGA3	M		.						54.0	54.0	54.0					2																	99013401		2203	4300	6503	SO:0001583	missense	1261	exon8			CTCACCGAGTACC	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1768G>A	2.37:g.99013401G>A	ENSP00000272602:p.Glu590Lys	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	17.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333316	0.81801	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02	5.42	5.42	0.78866	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.94932	0.8361	L	0.60067	1.865	0.80722	D	1	D;D;D	0.71674	0.978;0.998;0.958	P;D;P	0.67900	0.861;0.954;0.741	D	0.94634	0.7824	10	0.56958	D	0.05	.	18.154	0.89686	0.0:0.0:1.0:0.0	.	594;572;590	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	K	590;572;590;594	ENSP00000377140:E590K;ENSP00000410070:E572K;ENSP00000272602:E590K;ENSP00000386761:E594K	ENSP00000272602:E590K	E	+	1	0	CNGA3	98379833	1.000000	0.71417	0.605000	0.28930	0.542000	0.35054	9.263000	0.95617	2.826000	0.97356	0.563000	0.77884	GAG	.		0.617	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130103715	130103715	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:130103715C>A	ENST00000432398.2	+	5	1863	c.1369C>A	c.(1369-1371)Cag>Aag	p.Q457K	COL6A5_ENST00000265379.6_Missense_Mutation_p.Q457K	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	457	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CCAGGAGAAACAGTTTGAGCA	0.418																																					p.Q457K		.											.	.	.	0			c.C1369A						.						91.0	82.0	85.0					3																	130103715		692	1591	2283	SO:0001583	missense	256076	exon5			GAGAAACAGTTTG	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1369C>A	3.37:g.130103715C>A	ENSP00000390895:p.Gln457Lys	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	69.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	C	7.833	0.720224	0.15372	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.75821	-0.97;-0.97	5.82	-4.32	0.03688	.	.	.	.	.	T	0.67571	0.2907	L	0.46157	1.445	0.09310	N	1	B	0.09022	0.002	B	0.18871	0.023	T	0.57027	-0.7881	9	0.62326	D	0.03	.	16.2869	0.82725	0.0:0.2127:0.659:0.1284	.	457	A8TX70-2	.	K	457	ENSP00000390895:Q457K;ENSP00000265379:Q457K	ENSP00000265379:Q457K	Q	+	1	0	COL6A5	131586405	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.365000	0.07573	-0.758000	0.04690	-2.568000	0.00172	CAG	.		0.418	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130103724	130103724	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:130103724C>G	ENST00000432398.2	+	5	1872	c.1378C>G	c.(1378-1380)Caa>Gaa	p.Q460E	COL6A5_ENST00000265379.6_Missense_Mutation_p.Q460E	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	460	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						ACAGTTTGAGCAAATCAAGAG	0.433																																					p.Q460E		.											.	.	.	0			c.C1378G						.						93.0	84.0	87.0					3																	130103724		692	1591	2283	SO:0001583	missense	256076	exon5			TTTGAGCAAATCA	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.1378C>G	3.37:g.130103724C>G	ENSP00000390895:p.Gln460Glu	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	67.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	37		.	.	.	.	.	.	.	.	.	.	C	8.110	0.778660	0.16120	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.82255	-1.59;-1.59	5.82	-1.3	0.09259	.	.	.	.	.	T	0.73024	0.3534	L	0.28014	0.82	0.09310	N	0.999997	B	0.06786	0.001	B	0.10450	0.005	T	0.53690	-0.8403	9	0.02654	T	1	.	23.2065	0.99980	0.0:0.1713:0.8287:0.0	.	460	A8TX70-2	.	E	460	ENSP00000390895:Q460E;ENSP00000265379:Q460E	ENSP00000265379:Q460E	Q	+	1	0	COL6A5	131586414	0.863000	0.29885	0.012000	0.15200	0.002000	0.02628	1.329000	0.33770	-0.185000	0.10550	-0.312000	0.09012	CAA	.		0.433	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CPA6	57094	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68334896	68334896	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:68334896G>T	ENST00000297770.4	-	11	1372	c.1157C>A	c.(1156-1158)gCc>gAc	p.A386D	CPA6_ENST00000297769.4_Missense_Mutation_p.A142D	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	386						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			ATTTTTGTAGGCCCAATCCAT	0.353																																					p.A386D		.											.	CPA6	92	0			c.C1157A						.						91.0	91.0	91.0					8																	68334896		2203	4300	6503	SO:0001583	missense	57094	exon11			TTGTAGGCCCAAT	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.1157C>A	8.37:g.68334896G>T	ENSP00000297770:p.Ala386Asp	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	165.0	21.0	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110308	0.77210	.	.	ENSG00000165078	ENST00000297769;ENST00000297770	T;T	0.35236	1.32;2.61	5.86	5.86	0.93980	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.63462	0.2513	M	0.85777	2.775	0.45250	D	0.998256	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.992	T	0.60073	-0.7334	10	0.08599	T	0.76	.	20.1858	0.98214	0.0:0.0:1.0:0.0	.	142;386	Q8N4T0-3;Q8N4T0	.;CBPA6_HUMAN	D	142;386	ENSP00000297769:A142D;ENSP00000297770:A386D	ENSP00000297769:A142D	A	-	2	0	CPA6	68497450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.445000	0.97587	2.777000	0.95525	0.591000	0.81541	GCC	.		0.353	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
CRHR1	1394	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	43884410	43884410	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:43884410C>T	ENST00000398285.3	+	2	68	c.68C>T	c.(67-69)gCc>gTc	p.A23V	RP11-105N13.4_ENST00000587305.1_RNA|CRHR1_ENST00000577353.1_Missense_Mutation_p.A23V|CRHR1_ENST00000314537.5_Missense_Mutation_p.A23V|CRHR1_ENST00000339069.5_5'UTR|CRHR1_ENST00000293493.7_5'UTR|CRHR1_ENST00000352855.5_Missense_Mutation_p.A23V	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	23					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		CCCGTCTCTGCCTCCCTCCAG	0.607																																					p.A23V	Ovarian(110;57 1568 10207 38216 49865)	.											.	CRHR1	522	0			c.C68T						.						64.0	71.0	69.0					17																	43884410		2095	4229	6324	SO:0001583	missense	1394	exon2			TCTCTGCCTCCCT	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.68C>T	17.37:g.43884410C>T	ENSP00000381333:p.Ala23Val	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	27.0	NM_001145148	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	37	CCDS45712.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.751909	0.31046	.	.	ENSG00000120088	ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T;T;T;T	0.55052	0.54;0.54;0.54;0.9	4.14	3.13	0.36017	.	0.612843	0.14455	N	0.318549	T	0.31451	0.0797	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.29188	0.004;0.236;0.01;0.012	B;B;B;B	0.20767	0.005;0.031;0.005;0.017	T	0.07501	-1.0769	10	0.30078	T	0.28	.	9.6881	0.40111	0.0:0.7875:0.2125:0.0	.	23;23;23;23	P34998-4;P34998;P34998-3;P34998-2	.;CRFR1_HUMAN;.;.	V	23	ENSP00000381333:A23V;ENSP00000326060:A23V;ENSP00000239167:A23V;ENSP00000344068:A23V	ENSP00000326060:A23V	A	+	2	0	CRHR1	41240190	0.920000	0.31207	0.827000	0.32855	0.695000	0.40330	1.447000	0.35101	1.043000	0.40175	0.555000	0.69702	GCC	.		0.607	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	3141773	3141773	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:3141773C>T	ENST00000520002.1	-	27	4604	c.4049G>A	c.(4048-4050)aGt>aAt	p.S1350N	CSMD1_ENST00000537824.1_Missense_Mutation_p.S1349N|CSMD1_ENST00000602723.1_Missense_Mutation_p.S1350N|CSMD1_ENST00000400186.3_Missense_Mutation_p.S1350N|CSMD1_ENST00000542608.1_Missense_Mutation_p.S1349N|CSMD1_ENST00000539096.1_Missense_Mutation_p.S1349N|CSMD1_ENST00000602557.1_Missense_Mutation_p.S1350N|CSMD1_ENST00000523387.1_5'UTR			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1350	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCGGAGCCACTCCACTCCTT	0.567											OREG0018505	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1349N		.											.	CSMD1	86	0			c.G4046A						.						101.0	112.0	109.0					8																	3141773		2130	4258	6388	SO:0001583	missense	64478	exon26			GAGCCACTCCACT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.4049G>A	8.37:g.3141773C>T	ENSP00000430733:p.Ser1350Asn	Somatic	140.0	0.0	608	WXS	Illumina HiSeq	Phase_I	38.0	23.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	22.0	4.235831	0.79800	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.60548	0.18;0.18;0.18;0.18;0.18	5.12	5.12	0.69794	CUB (5);	0.305751	0.32343	N	0.006233	T	0.79411	0.4441	M	0.85373	2.75	0.38795	D	0.955073	D;D;D	0.76494	0.998;0.999;0.994	D;D;D	0.77004	0.989;0.983;0.958	D	0.83966	0.0324	10	0.66056	D	0.02	.	18.573	0.91144	0.0:1.0:0.0:0.0	.	1350;1350;1350	E5RIG2;Q96PZ7;Q96PZ7-4	.;CSMD1_HUMAN;.	N	1350;1350;1212;1349;1349;1349	ENSP00000383047:S1350N;ENSP00000430733:S1350N;ENSP00000441462:S1349N;ENSP00000446243:S1349N;ENSP00000441675:S1349N	ENSP00000320445:S1212N	S	-	2	0	CSMD1	3129180	0.999000	0.42202	1.000000	0.80357	0.974000	0.67602	3.879000	0.56138	2.375000	0.81037	0.563000	0.77884	AGT	.		0.567	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CST9L	128821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	23546707	23546707	+	Silent	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr20:23546707T>C	ENST00000376979.3	-	2	556	c.258A>G	c.(256-258)gtA>gtG	p.V86V		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	86						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					CCATTGAGAATACAGTCTTGG	0.453																																					p.V86V		.											.	CST9L	90	0			c.A258G						.						184.0	161.0	169.0					20																	23546707		2203	4300	6503	SO:0001819	synonymous_variant	128821	exon2			TGAGAATACAGTC		CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.258A>G	20.37:g.23546707T>C		Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	38.0	NM_080610	B2R5A1	Silent	SNP	ENST00000376979.3	37	CCDS13157.1																																																																																			.		0.453	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078338.1	NM_080610	
DAAM2	23500	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	39864686	39864686	+	Missense_Mutation	SNP	C	C	A	rs146966805	byFrequency	TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:39864686C>A	ENST00000398904.2	+	20	2622	c.2440C>A	c.(2440-2442)Cgt>Agt	p.R814S	DAAM2_ENST00000538976.1_Missense_Mutation_p.R814S|RP11-61I13.3_ENST00000437947.1_RNA|RP11-61I13.3_ENST00000606829.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|RP11-61I13.3_ENST00000430595.1_RNA|DAAM2_ENST00000274867.4_Missense_Mutation_p.R814S			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	814	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					CAAAGGGCAGCGTGGGGGCGC	0.602																																					p.R814S		.											.	DAAM2	228	0			c.C2440A						.						33.0	40.0	38.0					6																	39864686		2007	4165	6172	SO:0001583	missense	23500	exon20			GGGCAGCGTGGGG	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2440C>A	6.37:g.39864686C>A	ENSP00000381876:p.Arg814Ser	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	42.0	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	37	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.827612	0.71143	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	T;T;T	0.19806	2.12;2.12;2.12	4.54	4.54	0.55810	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.49423	0.1556	H	0.96080	3.765	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.62774	-0.6783	10	0.87932	D	0	.	10.0014	0.41931	0.3183:0.6817:0.0:0.0	.	814;814	G5EA45;Q86T65	.;DAAM2_HUMAN	S	814	ENSP00000274867:R814S;ENSP00000381876:R814S;ENSP00000437808:R814S	ENSP00000274867:R814S	R	+	1	0	DAAM2	39972664	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.447000	0.44917	2.353000	0.79882	0.561000	0.74099	CGT	C|0.999;T|0.001		0.602	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124354994	124354994	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:124354994A>T	ENST00000409039.3	+	43	7272	c.7247A>T	c.(7246-7248)tAt>tTt	p.Y2416F		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2416					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTTCCAGAGTATATTCATGCC	0.433																																					p.Y2416F		.											.	DNAH10	95	0			c.A7247T						.						87.0	82.0	83.0					12																	124354994		1851	4105	5956	SO:0001583	missense	196385	exon43			CAGAGTATATTCA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7247A>T	12.37:g.124354994A>T	ENSP00000386770:p.Tyr2416Phe	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	15.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	26.3	4.728102	0.89390	.	.	ENSG00000197653	ENST00000409039	T	0.20332	2.08	5.06	5.06	0.68205	.	0.455836	0.19456	U	0.113803	T	0.32912	0.0845	L	0.49455	1.56	0.53688	D	0.999978	D	0.54207	0.965	P	0.59643	0.861	T	0.04551	-1.0943	10	0.07644	T	0.81	.	14.8535	0.70316	1.0:0.0:0.0:0.0	.	2416	Q8IVF4	DYH10_HUMAN	F	2416	ENSP00000386770:Y2416F	ENSP00000386770:Y2416F	Y	+	2	0	DNAH10	122920947	1.000000	0.71417	0.397000	0.26308	0.057000	0.15508	9.283000	0.95860	1.913000	0.55393	0.533000	0.62120	TAT	.		0.433	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169081429	169081429	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:169081429C>A	ENST00000256935.8	+	2	146	c.66C>A	c.(64-66)agC>agA	p.S22R		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	22	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCAAGGCAGCGGAGCCCCCC	0.562																																					p.S22R		.											.	DOCK2	97	0			c.C66A						.						73.0	78.0	76.0					5																	169081429		2203	4300	6503	SO:0001583	missense	1794	exon2			AGGCAGCGGAGCC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.66C>A	5.37:g.169081429C>A	ENSP00000256935:p.Ser22Arg	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	16.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	0.900	-0.722739	0.03158	.	.	ENSG00000134516	ENST00000256935	T	0.08634	3.07	5.82	-11.6	0.00059	Src homology-3 domain (3);Variant SH3 (1);	0.736937	0.14140	N	0.338787	T	0.02807	0.0084	N	0.10707	0.03	0.09310	N	1	B	0.19445	0.036	B	0.20577	0.03	T	0.32903	-0.9889	10	0.26408	T	0.33	.	10.682	0.45819	0.0854:0.4963:0.0:0.4183	.	22	Q92608	DOCK2_HUMAN	R	22	ENSP00000256935:S22R	ENSP00000256935:S22R	S	+	3	2	DOCK2	169014007	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.616000	0.00881	-2.552000	0.00479	-2.412000	0.00220	AGC	.		0.562	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
DPP3	10072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	66259030	66259030	+	Silent	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:66259030C>A	ENST00000360510.2	+	8	929	c.864C>A	c.(862-864)ggC>ggA	p.G288G	DPP3_ENST00000531863.1_Silent_p.G308G|DPP3_ENST00000532677.1_Silent_p.G307G|DPP3_ENST00000541961.1_Silent_p.G288G|DPP3_ENST00000530165.1_Silent_p.G258G|DPP3_ENST00000453114.1_Silent_p.G288G			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	288					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						TCACCCAGGGCTCCATCGAGG	0.662											OREG0021109	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G288G		.											.	DPP3	46	0			c.C864A						.						29.0	35.0	33.0					11																	66259030		2200	4295	6495	SO:0001819	synonymous_variant	10072	exon8			CCAGGGCTCCATC	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.864C>A	11.37:g.66259030C>A		Somatic	47.0	0.0	1090	WXS	Illumina HiSeq	Phase_I	53.0	22.0	NM_130443	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Silent	SNP	ENST00000360510.2	37	CCDS8141.1																																																																																			.		0.662	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
DPYSL5	56896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27156187	27156187	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:27156187C>G	ENST00000288699.6	+	7	934	c.776C>G	c.(775-777)gCt>gGt	p.A259G	DPYSL5_ENST00000401478.1_Missense_Mutation_p.A259G	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	259					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTATCGCAGCTGCTAAGATG	0.542																																					p.A259G		.											.	DPYSL5	92	0			c.C776G						.						202.0	146.0	165.0					2																	27156187		2203	4300	6503	SO:0001583	missense	56896	exon7			TCGCAGCTGCTAA	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.776C>G	2.37:g.27156187C>G	ENSP00000288699:p.Ala259Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	65.0	NM_001253724	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	37	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260699	0.59431	.	.	ENSG00000157851	ENST00000288699;ENST00000401478	D;D	0.90261	-2.64;-2.64	6.04	5.16	0.70880	Amidohydrolase 1 (1);	0.257421	0.45606	D	0.000358	D	0.89952	0.6864	M	0.68317	2.08	0.37067	D	0.898366	B	0.12013	0.005	B	0.25759	0.063	D	0.88937	0.3377	10	0.54805	T	0.06	-3.3249	14.5526	0.68078	0.0:0.9288:0.0:0.0712	.	259	Q9BPU6	DPYL5_HUMAN	G	259	ENSP00000288699:A259G;ENSP00000385549:A259G	ENSP00000288699:A259G	A	+	2	0	DPYSL5	27009691	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	5.390000	0.66261	1.568000	0.49683	0.561000	0.74099	GCT	.		0.542	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
EPHB3	2049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184295208	184295208	+	Silent	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:184295208C>A	ENST00000330394.2	+	6	1884	c.1432C>A	c.(1432-1434)Cgg>Agg	p.R478R	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	478	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			ACCCCCAGAGCGGCCCAACGG	0.612																																					p.R478R		.											.	EPHB3	1455	0			c.C1432A						.						50.0	54.0	53.0					3																	184295208		2203	4300	6503	SO:0001819	synonymous_variant	2049	exon6			CCAGAGCGGCCCA	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.1432C>A	3.37:g.184295208C>A		Somatic	380.0	0.0		WXS	Illumina HiSeq	Phase_I	377.0	201.0	NM_004443	Q7Z740	Silent	SNP	ENST00000330394.2	37	CCDS3268.1																																																																																			.		0.612	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
EPSTI1	94240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	43543304	43543304	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr13:43543304T>A	ENST00000398762.3	-	3	256	c.257A>T	c.(256-258)cAg>cTg	p.Q86L	EPSTI1_ENST00000313624.7_Missense_Mutation_p.Q86L|EPSTI1_ENST00000313640.7_Missense_Mutation_p.Q86L|EPSTI1_ENST00000476830.2_5'UTR			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	86										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		GGCCAGCTCCTGCTCCGCAAC	0.488											OREG0022383	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q86L		.											.	EPSTI1	91	0			c.A257T						.						84.0	68.0	74.0					13																	43543304		2203	4300	6503	SO:0001583	missense	94240	exon3			AGCTCCTGCTCCG	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.257A>T	13.37:g.43543304T>A	ENSP00000381746:p.Gln86Leu	Somatic	65.0	0.0	917	WXS	Illumina HiSeq	Phase_I	25.0	18.0	NM_001002264	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	37	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	T	11.07	1.531280	0.27387	.	.	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	T	0.23348	1.91	5.09	3.89	0.44902	.	0.280776	0.32624	N	0.005841	T	0.20659	0.0497	L	0.51422	1.61	0.26697	N	0.97123	B;P	0.36535	0.386;0.557	B;B	0.31101	0.124;0.085	T	0.14783	-1.0460	10	0.59425	D	0.04	-5.2976	8.9628	0.35858	0.0:0.0:0.1868:0.8132	.	86;86	Q96J88-2;Q96J88-3	.;.	L	86	ENSP00000318982:Q86L	ENSP00000318643:Q86L	Q	-	2	0	EPSTI1	42441304	0.968000	0.33430	0.914000	0.36105	0.182000	0.23217	1.875000	0.39578	0.939000	0.37446	0.528000	0.53228	CAG	.		0.488	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
ERBB2IP	55914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	65371047	65371047	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:65371047G>T	ENST00000284037.5	+	23	4341	c.3952G>T	c.(3952-3954)Gca>Tca	p.A1318S	ERBB2IP_ENST00000380939.2_Missense_Mutation_p.A1266S|ERBB2IP_ENST00000508515.1_Intron|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.A1277S|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.A1277S|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.A1273S|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.A1277S|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.A1325S|ERBB2IP_ENST00000503913.1_Intron|ERBB2IP_ENST00000416865.2_Missense_Mutation_p.A516S|ERBB2IP_ENST00000380935.1_Intron	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	1318					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		CCATGAACTGGCAAAACAAGA	0.363																																					p.A1325S		.											.	ERBB2IP	653	0			c.G3973T						.						81.0	83.0	82.0					5																	65371047		2203	4300	6503	SO:0001583	missense	55914	exon23			GAACTGGCAAAAC		CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.3952G>T	5.37:g.65371047G>T	ENSP00000284037:p.Ala1318Ser	Somatic	294.0	0.0		WXS	Illumina HiSeq	Phase_I	323.0	155.0	NM_001253699	A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	ENST00000284037.5	37	CCDS58953.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582986	0.28268	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000416865;ENST00000380939;ENST00000380936;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000512354	T;T;T;T;T;T;T;T	0.38560	1.41;1.45;1.45;1.44;1.57;1.13;1.44;1.43	5.57	4.7	0.59300	PDZ/DHR/GLGF (1);	0.353110	0.28187	N	0.016277	T	0.27169	0.0666	N	0.22421	0.69	0.80722	D	1	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.08055	0.001;0.002;0.002;0.003;0.001;0.001;0.002	T	0.06250	-1.0837	10	0.09338	T	0.73	.	13.2407	0.59995	0.0:0.0:0.5899:0.4101	.	516;1277;1325;1325;1273;1318;1277	B4DIP2;Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-2	.;.;.;.;.;LAP2_HUMAN;.	S	1318;1277;516;1266;1277;1277;1273;1325;155	ENSP00000284037:A1318S;ENSP00000370330:A1277S;ENSP00000397833:A516S;ENSP00000370326:A1266S;ENSP00000370323:A1277S;ENSP00000370325:A1277S;ENSP00000422766:A1273S;ENSP00000426632:A1325S	ENSP00000284037:A1318S	A	+	1	0	ERBB2IP	65406803	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.134000	0.42102	1.335000	0.45486	0.650000	0.86243	GCA	.		0.363	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000215070.1	NM_018695	
F13A1	2162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	6248626	6248626	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:6248626G>T	ENST00000264870.3	-	6	982	c.717C>A	c.(715-717)tgC>tgA	p.C239*		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	239					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	TCACATACAGGCAAGTGTCCA	0.423																																					p.C239X		.											.	F13A1	519	0			c.C717A						.						83.0	74.0	77.0					6																	6248626		2203	4300	6503	SO:0001587	stop_gained	2162	exon6			ATACAGGCAAGTG	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.717C>A	6.37:g.6248626G>T	ENSP00000264870:p.Cys239*	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	24.0	NM_000129	Q59HA7|Q8N6X2|Q96P24|Q9BX29	Nonsense_Mutation	SNP	ENST00000264870.3	37	CCDS4496.1	.	.	.	.	.	.	.	.	.	.	G	39	7.555049	0.98355	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	.	.	.	4.99	3.21	0.36854	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.054	0.42233	0.1625:0.0:0.8375:0.0	.	.	.	.	X	239;176	.	ENSP00000264870:C239X	C	-	3	2	F13A1	6193625	1.000000	0.71417	0.987000	0.45799	0.928000	0.56348	1.969000	0.40510	0.512000	0.28257	0.563000	0.77884	TGC	.		0.423	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039756.3	NM_000129	
FAR1	84188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	13750208	13750208	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:13750208T>C	ENST00000354817.3	+	12	1579	c.1435T>C	c.(1435-1437)Tgg>Cgg	p.W479R	FAR1_ENST00000532502.1_Missense_Mutation_p.W103R	NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	479					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						GATCCTCATCTGGCGCATTTT	0.358																																					p.W479R		.											.	FAR1	92	0			c.T1435C						.						226.0	210.0	216.0					11																	13750208		2200	4294	6494	SO:0001583	missense	84188	exon12			CTCATCTGGCGCA	AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.1435T>C	11.37:g.13750208T>C	ENSP00000346874:p.Trp479Arg	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	18.0	NM_032228	D3DQW8|Q5CZA3	Missense_Mutation	SNP	ENST00000354817.3	37	CCDS7813.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.913867	0.52439	.	.	ENSG00000197601	ENST00000354817;ENST00000532502	T	0.25579	1.79	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.26085	0.0636	L	0.34521	1.04	0.80722	D	1	P	0.37122	0.583	B	0.40165	0.321	T	0.03608	-1.1020	10	0.66056	D	0.02	-4.1202	15.7013	0.77544	0.0:0.0:0.0:1.0	.	479	Q8WVX9	FACR1_HUMAN	R	479;103	ENSP00000346874:W479R	ENSP00000346874:W479R	W	+	1	0	FAR1	13706784	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.174000	0.68829	0.528000	0.53228	TGG	.		0.358	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385990.2	NM_032228	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92577146	92577146	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:92577146G>A	ENST00000298047.6	+	18	10630	c.10613G>A	c.(10612-10614)cGc>cAc	p.R3538H	FAT3_ENST00000533797.1_5'Flank|FAT3_ENST00000409404.2_Missense_Mutation_p.R3538H|FAT3_ENST00000525166.1_Missense_Mutation_p.R3388H			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3538	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTTACATCCGCGTGCGAGTC	0.468										TCGA Ovarian(4;0.039)																											p.R3538H		.											.	FAT3	73	0			c.G10613A						.						169.0	165.0	166.0					11																	92577146		1935	4142	6077	SO:0001583	missense	120114	exon18			ACATCCGCGTGCG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10613G>A	11.37:g.92577146G>A	ENSP00000298047:p.Arg3538His	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	40.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	G	4.008	-0.001180	0.07819	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.07800	3.16;3.16;3.16	5.62	1.7	0.24286	.	.	.	.	.	T	0.04048	0.0113	N	0.05510	-0.035	0.33044	D	0.53182	B	0.09022	0.002	B	0.06405	0.002	T	0.28933	-1.0028	9	0.31617	T	0.26	.	7.2209	0.25985	0.5237:0.0:0.4763:0.0	.	3538	Q8TDW7-3	.	H	3538;3538;3388	ENSP00000298047:R3538H;ENSP00000387040:R3538H;ENSP00000432586:R3388H	ENSP00000298047:R3538H	R	+	2	0	FAT3	92216794	0.260000	0.24053	0.100000	0.21137	0.179000	0.23085	1.490000	0.35573	0.332000	0.23536	-0.254000	0.11334	CGC	.		0.468	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FCAR	2204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55396884	55396884	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:55396884G>A	ENST00000355524.3	+	3	318	c.308G>A	c.(307-309)aGg>aAg	p.R103K	FCAR_ENST00000359272.4_Missense_Mutation_p.R91K|FCAR_ENST00000391726.3_Missense_Mutation_p.R91K|FCAR_ENST00000391723.3_Missense_Mutation_p.R91K|FCAR_ENST00000391725.3_Missense_Mutation_p.R103K|FCAR_ENST00000345937.4_Missense_Mutation_p.R103K|FCAR_ENST00000469767.1_Missense_Mutation_p.R103K|FCAR_ENST00000353758.4_Intron|FCAR_ENST00000391724.3_Missense_Mutation_p.R91K|FCAR_ENST00000482092.2_3'UTR	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	103	Ig-like C2-type 1.				immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		TGCCAATATAGGATAGGGCAC	0.488																																					p.R103K		.											.	FCAR	92	0			c.G308A						.						81.0	71.0	74.0					19																	55396884		2203	4300	6503	SO:0001583	missense	2204	exon3			AATATAGGATAGG	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.308G>A	19.37:g.55396884G>A	ENSP00000347714:p.Arg103Lys	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	31.0	NM_133279	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	ENST00000355524.3	37	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	G	9.667	1.145791	0.21288	.	.	ENSG00000186431	ENST00000433231;ENST00000391726;ENST00000355524;ENST00000391725;ENST00000345937;ENST00000359272;ENST00000391723;ENST00000391724	T;T;T;T;T;T;T	0.12879	2.71;2.64;2.64;2.71;2.64;2.64;2.64	3.09	-2.25	0.06888	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.198147	0.24708	N	0.036246	T	0.10937	0.0267	M	0.62154	1.92	0.09310	N	1	B;B;B;B;B;B;B;B	0.30793	0.114;0.073;0.295;0.013;0.005;0.253;0.007;0.077	B;B;B;B;B;B;B;B	0.34824	0.093;0.079;0.19;0.022;0.016;0.082;0.013;0.031	T	0.35475	-0.9787	10	0.13470	T	0.59	.	4.639	0.12540	0.1179:0.0:0.3275:0.5546	.	91;91;91;91;103;103;103;103	Q92588;Q92593;Q92587;Q9UEK0;Q53X39;P24071-3;P24071;P24071-4	.;.;.;.;.;.;FCAR_HUMAN;.	K	103;91;103;103;103;91;91;91	ENSP00000375606:R91K;ENSP00000347714:R103K;ENSP00000375605:R103K;ENSP00000338257:R103K;ENSP00000352218:R91K;ENSP00000375603:R91K;ENSP00000375604:R91K	ENSP00000338257:R103K	R	+	2	0	FCAR	60088696	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.092000	0.03366	-0.319000	0.08652	-0.244000	0.11960	AGG	.		0.488	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	
FEZ2	9637	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	36808548	36808548	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:36808548C>T	ENST00000405912.3	-	4	518	c.519G>A	c.(517-519)atG>atA	p.M173I	FEZ2_ENST00000305852.7_Missense_Mutation_p.M2I|FEZ2_ENST00000379245.4_Missense_Mutation_p.M173I	NM_005102.2	NP_005093.2	Q9UHY8	FEZ2_HUMAN	fasciculation and elongation protein zeta 2 (zygin II)	173					axon guidance (GO:0007411)|nervous system development (GO:0007399)|signal transduction (GO:0007165)					breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	7		all_hematologic(82;0.21)				GTGATTCCTGCATCATTTCTT	0.413																																					p.M173I		.											.	FEZ2	23	0			c.G519A						.						177.0	170.0	172.0					2																	36808548		1859	4111	5970	SO:0001583	missense	9637	exon4			TTCCTGCATCATT	U60061	CCDS46257.1, CCDS46258.1	2p21	2008-05-15			ENSG00000171055	ENSG00000171055			3660	protein-coding gene	gene with protein product		604826				9096408	Standard	NM_005102		Approved		uc002rpg.2	Q9UHY8	OTTHUMG00000152148	ENST00000405912.3:c.519G>A	2.37:g.36808548C>T	ENSP00000385112:p.Met173Ile	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	16.0	NM_001042548	Q5EBN3|Q76LN0|Q99690	Missense_Mutation	SNP	ENST00000405912.3	37	CCDS46257.1	.	.	.	.	.	.	.	.	.	.	C	34	5.326875	0.95708	.	.	ENSG00000171055	ENST00000379245;ENST00000305852;ENST00000405912;ENST00000357996	T;T;T;T	0.36520	1.25;1.25;1.25;1.25	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.60945	0.2308	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.76494	0.996;0.999;0.993;0.997	D;D;D;D	0.87578	0.986;0.998;0.981;0.992	T	0.55062	-0.8199	9	.	.	.	-14.3986	19.5705	0.95413	0.0:1.0:0.0:0.0	.	173;173;173;2	G3V0F5;Q9UHY8;Q9UHY8-2;Q7Z674	.;FEZ2_HUMAN;.;.	I	173;2;173;72	ENSP00000368547:M173I;ENSP00000305843:M2I;ENSP00000385112:M173I;ENSP00000350685:M72I	.	M	-	3	0	FEZ2	36662052	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.583000	0.82559	2.941000	0.99782	0.655000	0.94253	ATG	.		0.413	FEZ2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325432.1		
FLG	2312	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152277615	152277615	+	Missense_Mutation	SNP	G	G	T	rs146017726	byFrequency	TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:152277615G>T	ENST00000368799.1	-	3	9782	c.9747C>A	c.(9745-9747)caC>caA	p.H3249Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3249	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.H3249Q(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCTGGAGCCGTGCCTTGACT	0.582									Ichthyosis																												p.H3249Q		.											.	FLG	106	1	Substitution - Missense(1)	lung(1)	c.C9747A						.						233.0	235.0	234.0					1																	152277615		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GGAGCCGTGCCTT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9747C>A	1.37:g.152277615G>T	ENSP00000357789:p.His3249Gln	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	52.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	A	4.464	0.085938	0.08583	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.01613	4.73	2.56	-5.13	0.02884	.	.	.	.	.	T	0.01029	0.0034	L	0.36672	1.1	0.09310	N	1	D	0.58620	0.983	P	0.59703	0.862	T	0.34775	-0.9815	9	0.62326	D	0.03	.	2.1451	0.03785	0.1486:0.3085:0.3885:0.1545	.	3249	P20930	FILA_HUMAN	Q	3249;187	ENSP00000357789:H3249Q	ENSP00000357786:H187Q	H	-	3	2	FLG	150544239	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.870000	0.04228	-1.349000	0.02202	-0.572000	0.04151	CAC	G|0.997;A|0.003		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39262451	39262451	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr13:39262451G>A	ENST00000280481.7	+	1	1186	c.970G>A	c.(970-972)Gcc>Acc	p.A324T		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	324					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CAGTTTCGTGGCCATGATGAT	0.592																																					p.A324T		.											.	FREM2	100	0			c.G970A						.						119.0	91.0	100.0					13																	39262451		2203	4300	6503	SO:0001583	missense	341640	exon1			TTCGTGGCCATGA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.970G>A	13.37:g.39262451G>A	ENSP00000280481:p.Ala324Thr	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	95.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087200	0.76642	.	.	ENSG00000150893	ENST00000280481	T	0.21543	2.0	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.46964	0.1420	M	0.70595	2.14	0.80722	D	1	D	0.60575	0.988	P	0.62184	0.899	T	0.36261	-0.9755	10	0.72032	D	0.01	.	20.218	0.98305	0.0:0.0:1.0:0.0	.	324	Q5SZK8	FREM2_HUMAN	T	324	ENSP00000280481:A324T	ENSP00000280481:A324T	A	+	1	0	FREM2	38160451	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.002000	0.57053	2.791000	0.96007	0.561000	0.74099	GCC	.		0.592	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
GNAS	2778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	57428698	57428698	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr20:57428698G>T	ENST00000306120.3	+	1	188	c.188G>T	c.(187-189)gGg>gTg	p.G63V	GNAS_ENST00000371102.4_Silent_p.G126G|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371100.4_Silent_p.G126G|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371099.2_Silent_p.G126G|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371098.2_Intron|GNAS-AS1_ENST00000598163.1_RNA			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TCCCCAGTGGGGTCCATGCAG	0.637			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.G64V	Colon(117;935 1597 6045 8307 46442)	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	GNAS	4767	0			c.G191T						.						31.0	35.0	34.0					20																	57428698		1890	4108	5998	SO:0001583	missense	2778	exon1			CAGTGGGGTCCAT	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000306120.3:c.188G>T	20.37:g.57428698G>T	ENSP00000302237:p.Gly63Val	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	27.0	NM_001077490	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000306120.3	37		.	.	.	.	.	.	.	.	.	.	G	0.011	-1.732385	0.00687	.	.	ENSG00000087460	ENST00000306120	.	.	.	4.73	3.76	0.43208	.	.	.	.	.	T	0.31949	0.0813	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.18366	-1.0339	5	0.18276	T	0.48	.	10.736	0.46126	0.0:0.0:0.8089:0.1911	.	.	.	.	V	63	.	ENSP00000302237:G63V	G	+	2	0	GNAS	56862093	0.613000	0.27009	0.004000	0.12327	0.036000	0.12997	0.916000	0.28651	1.262000	0.44165	0.557000	0.71058	GGG	.		0.637	GNAS-050	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000267987.1	NM_000516	
GUCY1A2	2977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	106810405	106810405	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:106810405G>C	ENST00000526355.2	-	4	1455	c.987C>G	c.(985-987)ttC>ttG	p.F329L	GUCY1A2_ENST00000282249.2_Missense_Mutation_p.F329L|GUCY1A2_ENST00000347596.2_Missense_Mutation_p.F329L	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	329					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	ACATCAAGTGGAAAGGGAAGG	0.468																																					p.F329L		.											.	GUCY1A2	589	0			c.C987G						.						82.0	72.0	76.0					11																	106810405		2201	4298	6499	SO:0001583	missense	2977	exon4			CAAGTGGAAAGGG	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.987C>G	11.37:g.106810405G>C	ENSP00000431245:p.Phe329Leu	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	55.0	NM_000855	A1L4C4|B7ZLT5	Missense_Mutation	SNP	ENST00000526355.2	37	CCDS8335.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681297	0.47991	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.94758	-3.51;-3.51;-3.51	5.77	1.91	0.25777	Haem NO binding associated (1);	0.000000	0.47455	U	0.000240	D	0.97173	0.9076	M	0.91249	3.19	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.91635	0.992;0.999;0.992	D	0.95915	0.8926	10	0.87932	D	0	.	9.2424	0.37504	0.3777:0.0:0.6223:0.0	.	329;329;329	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	L	329	ENSP00000431245:F329L;ENSP00000282249:F329L;ENSP00000344874:F329L	ENSP00000282249:F329L	F	-	3	2	GUCY1A2	106315615	1.000000	0.71417	0.981000	0.43875	0.581000	0.36288	1.853000	0.39358	0.109000	0.17891	-0.952000	0.02654	TTC	.		0.468	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2		
HECW1	23072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	43484630	43484630	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:43484630C>A	ENST00000395891.2	+	11	2464	c.1859C>A	c.(1858-1860)cCc>cAc	p.P620H	HECW1_ENST00000453890.1_Missense_Mutation_p.P620H	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	620					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AGAGAAGAGCCCGAGGGGGCT	0.697																																					p.P620H		.											.	HECW1	669	0			c.C1859A						.						9.0	14.0	12.0					7																	43484630		2015	4156	6171	SO:0001583	missense	23072	exon11			AAGAGCCCGAGGG	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1859C>A	7.37:g.43484630C>A	ENSP00000379228:p.Pro620His	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	11.0	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	37	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	C	6.773	0.511580	0.12944	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.29917	1.55;1.55	3.94	-1.94	0.07571	.	4.721370	0.00357	N	0.000035	T	0.18635	0.0447	L	0.29908	0.895	0.09310	N	1	B;B	0.33448	0.168;0.412	B;B	0.27262	0.058;0.078	T	0.07462	-1.0771	10	0.48119	T	0.1	.	0.8368	0.01141	0.2687:0.3582:0.1195:0.2536	.	620;620	B4DH42;Q76N89	.;HECW1_HUMAN	H	620	ENSP00000379228:P620H;ENSP00000407774:P620H	ENSP00000265522:P620H	P	+	2	0	HECW1	43451155	0.000000	0.05858	0.000000	0.03702	0.498000	0.33706	-1.077000	0.03416	-0.570000	0.06022	0.563000	0.77884	CCC	.		0.697	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	28377352	28377352	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr15:28377352G>A	ENST00000261609.7	-	81	12572	c.12464C>T	c.(12463-12465)gCc>gTc	p.A4155V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAGGGTCTGGGCATCTCCACT	0.617																																					p.A4155V		.											.	HERC2	234	0			c.C12464T						.						70.0	57.0	61.0					15																	28377352		2203	4300	6503	SO:0001583	missense	8924	exon81			GTCTGGGCATCTC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12464C>T	15.37:g.28377352G>A	ENSP00000261609:p.Ala4155Val	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	159.0	66.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	33	5.229150	0.95173	.	.	ENSG00000128731	ENST00000261609	T	0.80480	-1.38	4.87	4.87	0.63330	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.88713	0.6511	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.90164	0.4230	10	0.87932	D	0	.	18.0199	0.89252	0.0:0.0:1.0:0.0	.	4155	O95714	HERC2_HUMAN	V	4155	ENSP00000261609:A4155V	ENSP00000261609:A4155V	A	-	2	0	HERC2	26050947	1.000000	0.71417	0.987000	0.45799	0.739000	0.42172	9.860000	0.99555	2.241000	0.73720	0.555000	0.69702	GCC	.		0.617	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HHIP	64399	broad.mit.edu;bcgsc.ca	37	4	145627786	145627786	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr4:145627786T>C	ENST00000296575.3	+	5	1590	c.935T>C	c.(934-936)aTc>aCc	p.I312T		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	312					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		CGGTGGGCTATCGGGCCTCAT	0.428																																					p.I312T		.											.	HHIP	283	0			c.T935C						.						90.0	79.0	83.0					4																	145627786		2203	4300	6503	SO:0001583	missense	64399	exon5			GGGCTATCGGGCC	AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.935T>C	4.37:g.145627786T>C	ENSP00000296575:p.Ile312Thr	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	9.0	NM_022475	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	ENST00000296575.3	37	CCDS3762.1	.	.	.	.	.	.	.	.	.	.	T	13.99	2.401478	0.42613	.	.	ENSG00000164161	ENST00000296575	T	0.05649	3.41	5.87	5.87	0.94306	Soluble quinoprotein glucose/sorbosone dehydrogenase (1);Six-bladed beta-propeller, TolB-like (1);	0.185530	0.56097	D	0.000024	T	0.04227	0.0117	N	0.12182	0.205	0.80722	D	1	B	0.17667	0.023	B	0.24006	0.05	T	0.47711	-0.9096	10	0.11794	T	0.64	-2.5644	12.1615	0.54107	0.0:0.0:0.1426:0.8574	.	312	Q96QV1	HHIP_HUMAN	T	312	ENSP00000296575:I312T	ENSP00000296575:I312T	I	+	2	0	HHIP	145847236	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.154000	0.71826	2.246000	0.74042	0.533000	0.62120	ATC	.		0.428	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2		
HID1	283987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	72959876	72959876	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:72959876C>A	ENST00000425042.2	-	3	423	c.346G>T	c.(346-348)Ggc>Tgc	p.G116C	HID1_ENST00000532900.1_5'UTR	NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	116					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											CAGAAGAAGCCCCTCCAGTCG	0.672																																					p.G116C		.											.	.	.	0			c.G346T						.						28.0	28.0	28.0					17																	72959876		2203	4300	6503	SO:0001583	missense	283987	exon3			AGAAGCCCCTCCA		CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.346G>T	17.37:g.72959876C>A	ENSP00000413520:p.Gly116Cys	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	28.0	NM_030630	Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	ENST00000425042.2	37	CCDS32726.1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.049561	0.93740	.	.	ENSG00000167861	ENST00000425042;ENST00000534480	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.76126	0.3944	M	0.85197	2.74	0.80722	D	1	B;B	0.30824	0.296;0.122	B;B	0.39027	0.248;0.288	T	0.79300	-0.1860	9	0.62326	D	0.03	-29.8564	17.944	0.89034	0.0:1.0:0.0:0.0	.	116;116	Q8IV36-2;Q8IV36	.;CQ028_HUMAN	C	116	.	ENSP00000413520:G116C	G	-	1	0	C17orf28	70471471	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.614000	0.82996	2.240000	0.73641	0.650000	0.86243	GGC	.		0.672	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390011.2	NM_030630	
HOOK1	51361	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	60324102	60324102	+	Silent	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:60324102A>G	ENST00000371208.3	+	13	1502	c.1245A>G	c.(1243-1245)agA>agG	p.R415R	HOOK1_ENST00000395561.2_Silent_p.R373R|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	415	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					CTTTTCAGAGACTAATTGAGC	0.313																																					p.R415R		.											.	HOOK1	154	0			c.A1245G						.						79.0	83.0	82.0					1																	60324102		2203	4300	6503	SO:0001819	synonymous_variant	51361	exon13			TCAGAGACTAATT	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1245A>G	1.37:g.60324102A>G		Somatic	251.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	167.0	NM_015888	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Silent	SNP	ENST00000371208.3	37	CCDS612.1																																																																																			.		0.313	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	NM_015888	
HPS6	79803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	103827340	103827340	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr10:103827340G>T	ENST00000299238.5	+	1	2194	c.2109G>T	c.(2107-2109)gaG>gaT	p.E703D		NM_024747.5	NP_079023.2	Q86YV9	HPS6_HUMAN	Hermansky-Pudlak syndrome 6	703					blood coagulation (GO:0007596)|melanocyte differentiation (GO:0030318)|organelle organization (GO:0006996)|protein localization to membrane (GO:0072657)	BLOC-2 complex (GO:0031084)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|Rab GTPase binding (GO:0017137)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|prostate(1)	11		Colorectal(252;0.122)		Epithelial(162;5.93e-08)|all cancers(201;1.03e-06)		CTCCAGCTGAGCTCCTGCTTC	0.627									Hermansky-Pudlak syndrome																												p.E703D		.											.	HPS6	90	0			c.G2109T						.						52.0	56.0	54.0					10																	103827340		2203	4300	6503	SO:0001583	missense	79803	exon1	Familial Cancer Database	HPS, HPS1-8	AGCTGAGCTCCTG	BC009258	CCDS7527.1	10q24.32	2014-06-18			ENSG00000166189	ENSG00000166189			18817	protein-coding gene	gene with protein product		607522				12548288	Standard	NM_024747		Approved	FLJ22501	uc001kuj.3	Q86YV9	OTTHUMG00000018945	ENST00000299238.5:c.2109G>T	10.37:g.103827340G>T	ENSP00000299238:p.Glu703Asp	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	22.0	NM_024747	Q5VV69|Q9H685	Missense_Mutation	SNP	ENST00000299238.5	37	CCDS7527.1	.	.	.	.	.	.	.	.	.	.	G	3.275	-0.148335	0.06627	.	.	ENSG00000166189	ENST00000299238	T	0.79352	-1.26	4.61	0.287	0.15714	.	0.243009	0.40728	N	0.001037	T	0.52273	0.1724	N	0.20401	0.57	0.26819	N	0.96882	B	0.06786	0.001	B	0.08055	0.003	T	0.17228	-1.0376	10	0.13470	T	0.59	-12.634	2.02	0.03506	0.1995:0.3177:0.3609:0.1219	.	703	Q86YV9	HPS6_HUMAN	D	703	ENSP00000299238:E703D	ENSP00000299238:E703D	E	+	3	2	HPS6	103817330	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	0.637000	0.24659	0.184000	0.20083	0.561000	0.74099	GAG	.		0.627	HPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050018.2	NM_024747	
IER2	9592	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	13264628	13264628	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:13264628G>T	ENST00000588173.1	+	1	1840	c.628G>T	c.(628-630)Gac>Tac	p.D210Y	CTC-250I14.6_ENST00000592882.1_RNA|IER2_ENST00000587885.1_Missense_Mutation_p.D210Y|CTC-250I14.6_ENST00000586483.1_RNA|IER2_ENST00000292433.3_Missense_Mutation_p.D210Y			Q9BTL4	IER2_HUMAN	immediate early response 2	210						cytoplasm (GO:0005737)				kidney(1)|lung(1)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			CCGCCCGGCGGACAGCATGCT	0.756																																					p.D210Y		.											.	IER2	537	0			c.G628T						.						2.0	3.0	2.0					19																	13264628		1505	3157	4662	SO:0001583	missense	9592	exon2			CCGGCGGACAGCA	M62831	CCDS12295.1	19p13.13	2008-02-05				ENSG00000160888			28871	protein-coding gene	gene with protein product						2061303	Standard	NM_004907		Approved	ETR101	uc002mwr.3	Q9BTL4		ENST00000588173.1:c.628G>T	19.37:g.13264628G>T	ENSP00000465617:p.Asp210Tyr	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	10.0	4.0	NM_004907	Q03827|Q2TAZ2	Missense_Mutation	SNP	ENST00000588173.1	37	CCDS12295.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198737	0.79015	.	.	ENSG00000160888	ENST00000292433	T	0.10477	2.87	4.6	4.6	0.57074	.	0.000000	0.44285	U	0.000465	T	0.15825	0.0381	N	0.24115	0.695	0.33933	D	0.64229	D	0.63880	0.993	D	0.64776	0.929	T	0.12630	-1.0540	10	0.48119	T	0.1	-12.3912	8.7135	0.34397	0.1052:0.0:0.8948:0.0	.	210	Q9BTL4	IER2_HUMAN	Y	210	ENSP00000292433:D210Y	ENSP00000292433:D210Y	D	+	1	0	IER2	13125628	0.993000	0.37304	0.998000	0.56505	0.943000	0.58893	1.776000	0.38594	2.098000	0.63641	0.462000	0.41574	GAC	.		0.756	IER2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453033.1	NM_004907	
INTS4	92105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	77692543	77692543	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:77692543C>T	ENST00000534064.1	-	3	360	c.326G>A	c.(325-327)tGc>tAc	p.C109Y	INTS4_ENST00000529807.1_Missense_Mutation_p.C109Y	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	109					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ATCCATAATGCAGTCTGGTGA	0.348																																					p.C109Y		.											.	INTS4	92	0			c.G326A						.						114.0	101.0	105.0					11																	77692543		2200	4292	6492	SO:0001583	missense	92105	exon3			ATAATGCAGTCTG	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.326G>A	11.37:g.77692543C>T	ENSP00000434466:p.Cys109Tyr	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	24.0	NM_033547	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	C	8.223	0.803012	0.16397	.	.	ENSG00000149262	ENST00000534064;ENST00000529807	T;T	0.64438	-0.1;1.55	4.75	4.75	0.60458	Armadillo-like helical (1);Armadillo-type fold (1);	0.051425	0.85682	D	0.000000	T	0.52741	0.1753	L	0.36672	1.1	0.80722	D	1	P	0.47350	0.894	B	0.41723	0.365	T	0.56147	-0.8027	10	0.44086	T	0.13	-10.1431	13.6551	0.62333	0.0:0.8452:0.1548:0.0	.	109	Q96HW7	INT4_HUMAN	Y	109	ENSP00000434466:C109Y;ENSP00000433644:C109Y	ENSP00000407787:C109Y	C	-	2	0	INTS4	77370191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.334000	0.65923	2.472000	0.83506	0.591000	0.81541	TGC	.		0.348	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
ITGA2B	3674	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42453683	42453683	+	Missense_Mutation	SNP	G	G	C	rs542591743		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:42453683G>C	ENST00000262407.5	-	23	2372	c.2341C>G	c.(2341-2343)Ctg>Gtg	p.L781V	ITGA2B_ENST00000353281.4_Missense_Mutation_p.L781V	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	781					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	CACCCTCGCAGCTCCACTTGG	0.602											OREG0024460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0	5008	,	,		16982	0.0		0.0	False		,,,				2504	0.001				p.L781V		.											.	ITGA2B	228	0			c.C2341G						.						98.0	112.0	107.0					17																	42453683		2203	4300	6503	SO:0001583	missense	3674	exon23			CTCGCAGCTCCAC		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.2341C>G	17.37:g.42453683G>C	ENSP00000262407:p.Leu781Val	Somatic	77.0	0.0	908	WXS	Illumina HiSeq	Phase_I	91.0	42.0	NM_000419	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	37	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328672	0.60743	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.47177	0.85;0.85	4.33	3.36	0.38483	Integrin alpha-2 (1);	0.000000	0.27936	U	0.017255	T	0.61776	0.2374	M	0.66939	2.045	0.80722	D	1	D;D	0.69078	0.974;0.997	P;D	0.68353	0.686;0.957	T	0.61671	-0.7015	10	0.49607	T	0.09	.	10.0083	0.41970	0.1008:0.0:0.8992:0.0	.	379;781	Q59FA8;P08514	.;ITA2B_HUMAN	V	781	ENSP00000262407:L781V;ENSP00000340536:L781V	ENSP00000262407:L781V	L	-	1	2	ITGA2B	39809209	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	3.885000	0.56182	1.040000	0.40099	0.462000	0.41574	CTG	.		0.602	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1		
JAK3	3718	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	17942056	17942056	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:17942056C>T	ENST00000527670.1	-	20	2988	c.2959G>A	c.(2959-2961)Ggc>Agc	p.G987S	JAK3_ENST00000458235.1_Missense_Mutation_p.G987S|JAK3_ENST00000534444.1_Missense_Mutation_p.G987S			P52333	JAK3_HUMAN	Janus kinase 3	987	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GGGCTCTGGCCTGGCTCGCGG	0.657		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.G987S		.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	JAK3	2418	0			c.G2959A						.						75.0	76.0	76.0					19																	17942056		2203	4300	6503	SO:0001583	missense	3718	exon21			TCTGGCCTGGCTC	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2959G>A	19.37:g.17942056C>T	ENSP00000432511:p.Gly987Ser	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	25.0	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747543	0.89663	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	T;T;D	0.88975	0.07;0.07;-2.45	3.22	3.22	0.36961	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.136270	0.48286	D	0.000194	D	0.91774	0.7398	L	0.55743	1.74	0.80722	D	1	D;P	0.76494	0.999;0.837	D;P	0.70716	0.97;0.475	D	0.92121	0.5704	10	0.62326	D	0.03	-33.9145	12.7152	0.57111	0.0:1.0:0.0:0.0	.	987;987	P52333-2;P52333	.;JAK3_HUMAN	S	987	ENSP00000391676:G987S;ENSP00000432511:G987S;ENSP00000436421:G987S	ENSP00000391676:G987S	G	-	1	0	JAK3	17803056	1.000000	0.71417	0.946000	0.38457	0.877000	0.50540	7.623000	0.83113	1.763000	0.52060	0.407000	0.27541	GGC	.		0.657	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
KDM3B	51780	broad.mit.edu;bcgsc.ca	37	5	137754700	137754700	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:137754700G>C	ENST00000314358.5	+	14	3694	c.3494G>C	c.(3493-3495)gGa>gCa	p.G1165A	KDM3B_ENST00000508386.1_3'UTR|KDM3B_ENST00000394866.1_Missense_Mutation_p.G821A|KDM3B_ENST00000542866.1_Missense_Mutation_p.G197A	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1165					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						TCTGGTGGAGGAGGACCGGCA	0.502																																					p.G1165A		.											.	KDM3B	542	0			c.G3494C						.						100.0	100.0	100.0					5																	137754700		2203	4300	6503	SO:0001583	missense	51780	exon14			GTGGAGGAGGACC	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.3494G>C	5.37:g.137754700G>C	ENSP00000326563:p.Gly1165Ala	Somatic	266.0	1.0		WXS	Illumina HiSeq	Phase_I	333.0	15.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	G	8.029	0.761430	0.15914	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.69926	0.13;-0.44;-0.38	5.64	5.64	0.86602	.	0.482992	0.22687	N	0.056864	T	0.47838	0.1467	N	0.16478	0.41	0.30524	N	0.768084	B;B	0.12013	0.004;0.005	B;B	0.10450	0.005;0.003	T	0.35773	-0.9775	10	0.08837	T	0.75	-8.828	13.5581	0.61773	0.0:0.2025:0.7975:0.0	.	821;1165	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	A	1165;955;821;197	ENSP00000326563:G1165A;ENSP00000378335:G821A;ENSP00000439462:G197A	ENSP00000326563:G1165A	G	+	2	0	KDM3B	137782599	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	3.931000	0.56529	2.669000	0.90835	0.655000	0.94253	GGA	.		0.502	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
KDM3B	51780	broad.mit.edu;bcgsc.ca	37	5	137766109	137766109	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:137766109C>T	ENST00000314358.5	+	22	5265	c.5065C>T	c.(5065-5067)Cac>Tac	p.H1689Y	KDM3B_ENST00000394866.1_Missense_Mutation_p.H1345Y|KDM3B_ENST00000542866.1_Missense_Mutation_p.H721Y	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1689	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						TGGAGCCCCACACCAGGTGGG	0.507																																					p.H1689Y		.											.	KDM3B	542	0			c.C5065T						.						111.0	105.0	107.0					5																	137766109		2203	4300	6503	SO:0001583	missense	51780	exon22			GCCCCACACCAGG	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.5065C>T	5.37:g.137766109C>T	ENSP00000326563:p.His1689Tyr	Somatic	125.0	1.0		WXS	Illumina HiSeq	Phase_I	136.0	11.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	37	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.510980	0.85389	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	D;D;D	0.97791	-4.54;-4.54;-4.54	5.81	5.81	0.92471	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.98566	0.9521	M	0.76727	2.345	0.80722	D	1	B;P	0.45474	0.376;0.859	B;P	0.61397	0.188;0.888	D	0.99123	1.0850	10	0.66056	D	0.02	-2.4653	20.0605	0.97671	0.0:1.0:0.0:0.0	.	1345;1689	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	Y	1689;1479;1345;721	ENSP00000326563:H1689Y;ENSP00000378335:H1345Y;ENSP00000439462:H721Y	ENSP00000326563:H1689Y	H	+	1	0	KDM3B	137794008	1.000000	0.71417	0.981000	0.43875	0.977000	0.68977	7.771000	0.85420	2.745000	0.94114	0.655000	0.94253	CAC	.		0.507	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
KIAA0753	9851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	6511774	6511774	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:6511774G>C	ENST00000361413.3	-	10	2081	c.1723C>G	c.(1723-1725)Cta>Gta	p.L575V	KIAA0753_ENST00000572370.1_Missense_Mutation_p.L276V|KIAA0753_ENST00000589033.1_Missense_Mutation_p.L31V|KIAA0753_ENST00000575027.1_5'Flank|KIAA0753_ENST00000542606.1_Missense_Mutation_p.L276V	NM_014804.2	NP_055619.2	Q2KHM9	K0753_HUMAN	KIAA0753	575						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(4)|large_intestine(11)|lung(5)|prostate(4)	24				COAD - Colon adenocarcinoma(228;0.157)		TTCACCTTTAGCCATGCAGCA	0.468																																					p.L575V		.											.	KIAA0753	90	0			c.C1723G						.						216.0	208.0	211.0					17																	6511774		1943	4140	6083	SO:0001583	missense	9851	exon10			CCTTTAGCCATGC		CCDS42247.1	17p13.1	2014-04-04			ENSG00000198920	ENSG00000198920			29110	protein-coding gene	gene with protein product						24613305	Standard	NM_014804		Approved		uc002gde.4	Q2KHM9	OTTHUMG00000177928	ENST00000361413.3:c.1723C>G	17.37:g.6511774G>C	ENSP00000355250:p.Leu575Val	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	48.0	NM_014804	A8KA11|B7Z479|O94853|Q05D97|Q2KHN0|Q9UG45	Missense_Mutation	SNP	ENST00000361413.3	37	CCDS42247.1	.	.	.	.	.	.	.	.	.	.	G	2.493	-0.317071	0.05386	.	.	ENSG00000198920	ENST00000361413;ENST00000542606;ENST00000542826	D;D	0.85556	-2.0;-2.0	5.06	-1.62	0.08372	.	1.751100	0.03366	N	0.198230	T	0.80232	0.4585	M	0.65975	2.015	0.09310	N	0.999995	B	0.25272	0.122	B	0.25291	0.059	T	0.55335	-0.8157	10	0.28530	T	0.3	-0.1196	0.5849	0.00718	0.197:0.1786:0.3099:0.3146	.	575	Q2KHM9	K0753_HUMAN	V	575;276;31	ENSP00000355250:L575V;ENSP00000444634:L276V	ENSP00000355250:L575V	L	-	1	2	KIAA0753	6452498	0.980000	0.34600	0.400000	0.26346	0.231000	0.25187	0.801000	0.27055	-0.082000	0.12640	0.467000	0.42956	CTA	.		0.468	KIAA0753-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439769.3	NM_014804	
KIF7	374654	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	90190176	90190176	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr15:90190176G>T	ENST00000394412.3	-	7	1749	c.1673C>A	c.(1672-1674)tCc>tAc	p.S558Y		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	558	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			AGGCACAAAGGACCCGGGAGG	0.687											OREG0023460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S558Y		.											.	KIF7	523	0			c.C1673A						.						24.0	27.0	26.0					15																	90190176		2198	4297	6495	SO:0001583	missense	374654	exon7			ACAAAGGACCCGG	AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.1673C>A	15.37:g.90190176G>T	ENSP00000377934:p.Ser558Tyr	Somatic	81.0	0.0	1273	WXS	Illumina HiSeq	Phase_I	43.0	26.0	NM_198525	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	ENST00000394412.3	37	CCDS32325.2	.	.	.	.	.	.	.	.	.	.	g	10.04	1.242794	0.22796	.	.	ENSG00000166813	ENST00000394412	T	0.70631	-0.5	5.17	3.04	0.35103	.	0.515669	0.21098	N	0.080209	T	0.64305	0.2586	L	0.44542	1.39	0.09310	N	1	P;P	0.42620	0.785;0.454	B;B	0.44224	0.444;0.133	T	0.57866	-0.7737	10	0.59425	D	0.04	.	9.2862	0.37758	0.0:0.1316:0.6735:0.195	.	45;558	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	Y	558	ENSP00000377934:S558Y	ENSP00000377934:S558Y	S	-	2	0	KIF7	87991180	0.023000	0.18921	0.202000	0.23494	0.403000	0.30841	1.697000	0.37784	1.113000	0.41760	0.457000	0.33378	TCC	.		0.687	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347782.1	NM_198525	
KLF15	28999	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	126062613	126062613	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:126062613T>A	ENST00000296233.3	-	3	1438	c.1208A>T	c.(1207-1209)cAc>cTc	p.H403L		NM_014079.3	NP_054798.1	Q9UIH9	KLF15_HUMAN	Kruppel-like factor 15	403					cardiac muscle hypertrophy in response to stress (GO:0014898)|cellular response to peptide (GO:1901653)|glial cell differentiation (GO:0010001)|glomerular visceral epithelial cell differentiation (GO:0072112)|glucose transport (GO:0015758)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(7)|ovary(2)|skin(2)	12				GBM - Glioblastoma multiforme(114;0.147)		CGGGAAGCGGTGCACCTTGAT	0.647																																					p.H403L		.											.	KLF15	91	0			c.A1208T						.						52.0	50.0	50.0					3																	126062613		2203	4300	6503	SO:0001583	missense	28999	exon3			AAGCGGTGCACCT	AB029254	CCDS3036.1	3q21.3	2013-01-08			ENSG00000163884	ENSG00000163884		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	14536	protein-coding gene	gene with protein product	"""kidney-enriched Kruppel-like factor"""	606465				10982849	Standard	NM_014079		Approved	KKLF	uc011bkk.1	Q9UIH9	OTTHUMG00000162689	ENST00000296233.3:c.1208A>T	3.37:g.126062613T>A	ENSP00000296233:p.His403Leu	Somatic	261.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	52.0	NM_014079		Missense_Mutation	SNP	ENST00000296233.3	37	CCDS3036.1	.	.	.	.	.	.	.	.	.	.	T	32	5.125359	0.94429	.	.	ENSG00000163884	ENST00000296233	T	0.78816	-1.21	5.13	5.13	0.70059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.87708	0.6245	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89294	0.3621	10	0.87932	D	0	.	12.8907	0.58069	0.0:0.0:0.0:1.0	.	403	Q9UIH9	KLF15_HUMAN	L	403	ENSP00000296233:H403L	ENSP00000296233:H403L	H	-	2	0	KLF15	127545303	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.916000	0.87491	1.931000	0.55961	0.260000	0.18958	CAC	.		0.647	KLF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370096.1	NM_014079	
KNTC1	9735	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123070262	123070262	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:123070262A>T	ENST00000333479.7	+	37	3791	c.3614A>T	c.(3613-3615)gAg>gTg	p.E1205V	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1205					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ATTGTTCTTGAGTCACAGATG	0.378																																					p.E1205V		.											.	KNTC1	543	0			c.A3614T						.						202.0	191.0	194.0					12																	123070262		1894	4119	6013	SO:0001583	missense	9735	exon37			TTCTTGAGTCACA		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3614A>T	12.37:g.123070262A>T	ENSP00000328236:p.Glu1205Val	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	29.0	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.874452	0.91664	.	.	ENSG00000184445	ENST00000333479	T	0.15834	2.39	6.03	6.03	0.97812	.	0.048702	0.85682	D	0.000000	T	0.30916	0.0780	L	0.57536	1.79	0.80722	D	1	D	0.57571	0.98	P	0.51701	0.677	T	0.01786	-1.1274	10	0.87932	D	0	-25.9041	16.5724	0.84622	1.0:0.0:0.0:0.0	.	1205	P50748	KNTC1_HUMAN	V	1205	ENSP00000328236:E1205V	ENSP00000328236:E1205V	E	+	2	0	KNTC1	121636215	1.000000	0.71417	0.872000	0.34217	0.958000	0.62258	8.432000	0.90288	2.313000	0.78055	0.455000	0.32223	GAG	.		0.378	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
KPRP	448834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152733416	152733416	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:152733416G>T	ENST00000606109.1	+	1	1380	c.1352G>T	c.(1351-1353)cGc>cTc	p.R451L	KPRP_ENST00000368773.1_Missense_Mutation_p.R451L			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	451	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCCTTCCTCGCCCAGGGCAG	0.617																																					p.R451L		.											.	KPRP	95	0			c.G1352T						.						150.0	149.0	149.0					1																	152733416		2203	4300	6503	SO:0001583	missense	448834	exon2			TTCCTCGCCCAGG	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1352G>T	1.37:g.152733416G>T	ENSP00000475216:p.Arg451Leu	Somatic	32.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	48.0	NM_001025231		Missense_Mutation	SNP	ENST00000606109.1	37	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.733361	0.48939	.	.	ENSG00000203786	ENST00000368773	T	0.15834	2.39	4.61	3.69	0.42338	.	0.189519	0.24323	N	0.039536	T	0.07773	0.0195	L	0.52573	1.65	0.09310	N	1	P	0.38020	0.615	B	0.41440	0.357	T	0.13656	-1.0501	10	0.56958	D	0.05	-1.0544	5.9247	0.19104	0.0963:0.0:0.7121:0.1916	.	451	Q5T749	KPRP_HUMAN	L	451	ENSP00000357762:R451L	ENSP00000357762:R451L	R	+	2	0	KPRP	151000040	0.000000	0.05858	0.002000	0.10522	0.214000	0.24535	0.351000	0.20096	1.280000	0.44463	0.462000	0.41574	CGC	.		0.617	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
KREMEN1	83999	broad.mit.edu;bcgsc.ca	37	22	29490382	29490382	+	Silent	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr22:29490382G>C	ENST00000407188.1	+	2	228	c.228G>C	c.(226-228)ggG>ggC	p.G76G	KREMEN1_ENST00000400335.4_Silent_p.G78G|KREMEN1_ENST00000400338.2_Silent_p.G78G|KREMEN1_ENST00000327813.5_Silent_p.G78G			Q96MU8	KREM1_HUMAN	kringle containing transmembrane protein 1	76	Kringle. {ECO:0000255|PROSITE- ProRule:PRU00121}.				cell communication (GO:0007154)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	20						ACGGGGAGGGGGGCCTGGGTG	0.483																																					p.G78G		.											.	KREMEN1	659	0			c.G234C						.						55.0	56.0	56.0					22																	29490382		1880	4086	5966	SO:0001819	synonymous_variant	83999	exon2			GGAGGGGGGCCTG	AB059618	CCDS43000.1, CCDS13849.1, CCDS43000.2	22q12.1	2008-03-27	2002-11-13	2002-11-15	ENSG00000183762	ENSG00000183762			17550	protein-coding gene	gene with protein product		609898	"""kringle containing transmembrane protein"""	KREMEN		11267660	Standard	NM_001039570		Approved	KRM1	uc011akm.1	Q96MU8	OTTHUMG00000030987	ENST00000407188.1:c.228G>C	22.37:g.29490382G>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	8.0	NM_001039570	B0QY46|B0QY47|B1AJR5|Q5TIB9|Q6P3X6|Q9BY70|Q9UGS5|Q9UGU1	Silent	SNP	ENST00000407188.1	37	CCDS43000.2																																																																																			.		0.483	KREMEN1-004	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320947.1		
LACE1	246269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	108645051	108645051	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:108645051G>T	ENST00000368977.4	+	2	348	c.162G>T	c.(160-162)gaG>gaT	p.E54D		NM_145315.3	NP_660358.2	Q8WV93	LACE1_HUMAN	lactation elevated 1	54						mitochondrion (GO:0005739)	ATP binding (GO:0005524)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		all_cancers(87;1.5e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;6.79e-05)|Colorectal(196;0.0294)|all_lung(197;0.0486)|Lung SC(18;0.152)		BRCA - Breast invasive adenocarcinoma(108;0.00179)|Epithelial(106;0.0024)|all cancers(137;0.00379)|OV - Ovarian serous cystadenocarcinoma(136;0.0118)		AGACATCCGAGAGCATGACCC	0.393																																					p.E54D		.											.	LACE1	90	0			c.G162T						.						95.0	90.0	92.0					6																	108645051		2203	4300	6503	SO:0001583	missense	246269	exon2			ATCCGAGAGCATG	AF520418	CCDS5067.1	6q22.1	2006-11-10			ENSG00000135537	ENSG00000135537			16411	protein-coding gene	gene with protein product	"""ATPase family gene 1 homolog (S. cerevisiae)"""					12079282	Standard	XM_005266885		Approved	AFG1	uc003psj.3	Q8WV93	OTTHUMG00000015324	ENST00000368977.4:c.162G>T	6.37:g.108645051G>T	ENSP00000357973:p.Glu54Asp	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	71.0	NM_145315	Q8N6A3	Missense_Mutation	SNP	ENST00000368977.4	37	CCDS5067.1	.	.	.	.	.	.	.	.	.	.	G	10.68	1.419425	0.25552	.	.	ENSG00000135537	ENST00000368977;ENST00000437715	.	.	.	5.44	-0.536	0.11876	.	0.364212	0.26244	N	0.025490	T	0.11922	0.0290	L	0.36672	1.1	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.27191	-1.0081	9	0.49607	T	0.09	-1.0403	6.8782	0.24158	0.3331:0.2146:0.4523:0.0	.	54	Q8WV93	LACE1_HUMAN	D	54;21	.	ENSP00000357973:E54D	E	+	3	2	LACE1	108751744	0.185000	0.23213	0.003000	0.11579	0.031000	0.12232	0.264000	0.18497	-0.027000	0.13873	-0.326000	0.08463	GAG	.		0.393	LACE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041719.4	NM_145315	
LAMA3	3909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	21422647	21422647	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr18:21422647A>T	ENST00000313654.9	+	29	3777	c.3536A>T	c.(3535-3537)gAg>gTg	p.E1179V	LAMA3_ENST00000399516.3_Missense_Mutation_p.E1179V	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1179	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GGCCAGATTGAGTTTGACATC	0.527																																					p.E1179V		.											.	LAMA3	100	0			c.A3536T						.						131.0	139.0	136.0					18																	21422647		2011	4185	6196	SO:0001583	missense	3909	exon29			AGATTGAGTTTGA	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.3536A>T	18.37:g.21422647A>T	ENSP00000324532:p.Glu1179Val	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	75.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	37	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	9.776	1.173925	0.21704	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.17854	2.27;2.25	5.83	4.67	0.58626	.	.	.	.	.	T	0.16041	0.0386	L	0.41492	1.28	0.19575	N	0.999968	P;P	0.45986	0.577;0.87	B;B	0.41571	0.202;0.36	T	0.07328	-1.0778	9	0.29301	T	0.29	.	11.9307	0.52845	0.7053:0.2947:0.0:0.0	.	1179;1179	Q6VU67;Q16787	.;LAMA3_HUMAN	V	1179;1179;1177	ENSP00000324532:E1179V;ENSP00000382432:E1179V	ENSP00000324532:E1179V	E	+	2	0	LAMA3	19676645	1.000000	0.71417	0.978000	0.43139	0.855000	0.48748	2.354000	0.44098	1.040000	0.40099	0.533000	0.62120	GAG	.		0.527	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
LGI4	163175	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35624619	35624619	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:35624619C>A	ENST00000310123.3	-	3	811	c.292G>T	c.(292-294)Ggc>Tgc	p.G98C	LGI4_ENST00000493050.1_5'UTR|LGI4_ENST00000591633.1_Missense_Mutation_p.G98C|LGI4_ENST00000392225.3_Missense_Mutation_p.G98C	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	98					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			TGGGACAGGCCCGCAAATGCA	0.582																																					p.G98C		.											.	LGI4	91	0			c.G292T						.						40.0	35.0	37.0					19																	35624619		2203	4299	6502	SO:0001583	missense	163175	exon3			ACAGGCCCGCAAA	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.292G>T	19.37:g.35624619C>A	ENSP00000312273:p.Gly98Cys	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	28.0	NM_139284	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	ENST00000310123.3	37	CCDS12444.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081095	0.55753	.	.	ENSG00000153902	ENST00000310123;ENST00000392225;ENST00000437421	D;D	0.91068	-2.78;-2.78	4.72	4.72	0.59763	.	0.000000	0.64402	D	0.000014	D	0.96204	0.8762	M	0.93197	3.39	0.47862	D	0.999539	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96797	0.9586	10	0.87932	D	0	.	13.0321	0.58847	0.0:1.0:0.0:0.0	.	98;98	Q8N135-2;Q8N135	.;LGI4_HUMAN	C	98	ENSP00000312273:G98C;ENSP00000376059:G98C	ENSP00000312273:G98C	G	-	1	0	LGI4	40316459	1.000000	0.71417	0.953000	0.39169	0.444000	0.32077	5.245000	0.65405	2.452000	0.82932	0.563000	0.77884	GGC	.		0.582	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
LMLN	89782	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	197687166	197687166	+	Missense_Mutation	SNP	G	G	T	rs547037533		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:197687166G>T	ENST00000330198.4	+	1	96	c.74G>T	c.(73-75)gGc>gTc	p.G25V	IQCG_ENST00000480302.1_5'Flank|IQCG_ENST00000265239.6_5'Flank|LMLN_ENST00000482695.1_Silent_p.G13G|LMLN_ENST00000332636.5_Silent_p.G13G|LMLN_ENST00000420910.2_Missense_Mutation_p.G25V	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	25					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		TCAGGCCCGGGCCGGAGCCGG	0.697																																					p.G25V		.											.	LMLN	91	0			c.G74T						.						23.0	29.0	27.0					3																	197687166		2200	4295	6495	SO:0001583	missense	89782	exon1			GCCCGGGCCGGAG	AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.74G>T	3.37:g.197687166G>T	ENSP00000328829:p.Gly25Val	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	33.0	NM_001136049	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Missense_Mutation	SNP	ENST00000330198.4	37	CCDS3332.1	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904640	0.33628	.	.	ENSG00000185621	ENST00000330198;ENST00000420910	T;T	0.49432	0.78;0.83	3.85	-0.54	0.11861	.	0.666329	0.13088	N	0.414790	T	0.28433	0.0703	N	0.19112	0.55	0.19300	N	0.999979	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.17137	-1.0379	10	0.56958	D	0.05	0.0861	6.5932	0.22658	0.0:0.3255:0.3414:0.3331	.	25;25	Q96KR4;F8WB28	LMLN_HUMAN;.	V	25	ENSP00000328829:G25V;ENSP00000410926:G25V	ENSP00000328829:G25V	G	+	2	0	LMLN	199171563	0.000000	0.05858	0.015000	0.15790	0.677000	0.39632	0.194000	0.17135	-0.220000	0.09988	0.456000	0.33151	GGC	.		0.697	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339701.1	NM_033029	
SCGB1C1	147199	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	194445	194445	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:194445G>A	ENST00000342878.2	+	3	303	c.283G>A	c.(283-285)Gcc>Acc	p.A95T	ODF3_ENST00000525282.1_5'Flank|ODF3_ENST00000325113.4_5'Flank|BET1L_ENST00000410108.1_Intron|ODF3_ENST00000342593.5_5'Flank	NM_145651.2	NP_663626.2	Q8TD33	SG1C1_HUMAN	secretoglobin, family 1C, member 1	95						extracellular region (GO:0005576)				endometrium(1)|liver(2)|lung(1)|skin(1)	5		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TCAGGACGGTGCCTAAGTGGA	0.567																																					p.A95T		.											.	.	.	0			c.G283A						.						144.0	152.0	150.0					11																	194445		2168	4262	6430	SO:0001583	missense	0	exon3			GACGGTGCCTAAG	AY026938	CCDS41581.1	11p15.5	2011-12-14			ENSG00000188076	ENSG00000188076		"""Secretoglobins"""	18394	protein-coding gene	gene with protein product		610176				22155607	Standard	NM_145651		Approved	RYD5	uc001loa.1	Q8TD33	OTTHUMG00000165539	ENST00000342878.2:c.283G>A	11.37:g.194445G>A	ENSP00000344545:p.Ala95Thr	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	21.0	NM_001097610	A8MSI9|Q14DW0	Missense_Mutation	SNP	ENST00000342878.2	37	CCDS41581.1	.	.	.	.	.	.	.	.	.	.	.	13.33	2.203518	0.38905	.	.	ENSG00000188076	ENST00000342878	T	0.26067	1.76	4.14	0.925	0.19424	.	0.674171	0.14117	N	0.340321	T	0.14356	0.0347	.	.	.	0.09310	N	1	B	0.12630	0.006	B	0.12837	0.008	T	0.22138	-1.0225	9	0.33141	T	0.24	.	4.2115	0.10514	0.1182:0.0:0.4313:0.4504	.	95	Q8TD33	SG1C1_HUMAN	T	95	ENSP00000344545:A95T	ENSP00000344545:A95T	A	+	1	0	SCGB1C1	184445	0.000000	0.05858	0.001000	0.08648	0.260000	0.26232	-0.203000	0.09438	0.199000	0.20427	0.491000	0.48974	GCC	.		0.567	SCGB1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384759.1	NM_145651	
LRRC18	474354	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50121829	50121829	+	Silent	SNP	G	G	A	rs144747704	byFrequency	TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr10:50121829G>A	ENST00000374160.3	-	1	448	c.372C>T	c.(370-372)cgC>cgT	p.R124R	WDFY4_ENST00000413659.2_Intron|WDFY4_ENST00000325239.5_Intron|LRRC18_ENST00000298124.3_Silent_p.R124R|RP11-523O18.7_ENST00000430438.1_RNA	NM_001006939.3	NP_001006940.3	Q8N456	LRC18_HUMAN	leucine rich repeat containing 18	124						cytoplasm (GO:0005737)		p.R124R(1)		NS(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						GGTTCACAGCGCGGATGTTCT	0.597													G|||	3	0.000599042	0.0023	0.0	5008	,	,		19139	0.0		0.0	False		,,,				2504	0.0				p.R124R		.											.	LRRC18	92	1	Substitution - coding silent(1)	large_intestine(1)	c.C372T						.	G	,	7,4399	12.9+/-30.5	0,7,2196	93.0	90.0	91.0		372,	-2.0	0.4	10	dbSNP_134	91	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous,intron	WDFY4,LRRC18	NM_001006939.3,NM_020945.1	,	0,9,6494	AA,AG,GG		0.0233,0.1589,0.0692	,	124/262,	50121829	9,12997	2203	4300	6503	SO:0001819	synonymous_variant	474354	exon1			CACAGCGCGGATG	AY358137	CCDS31197.1	10q11.23	2011-02-10			ENSG00000165383	ENSG00000165383			23199	protein-coding gene	gene with protein product							Standard	NM_001006939		Approved	UNQ933, MGC34773, UNQ9338, VKGE9338	uc001jhd.3	Q8N456	OTTHUMG00000018182	ENST00000374160.3:c.372C>T	10.37:g.50121829G>A		Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	30.0	NM_001006939	Q6UY02	Silent	SNP	ENST00000374160.3	37	CCDS31197.1																																																																																			G|0.999;A|0.001		0.597	LRRC18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047964.1	NM_001006939	
LYPD3	27076	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43969693	43969693	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:43969693C>A	ENST00000244333.3	-	1	119	c.31G>T	c.(31-33)Gcc>Tcc	p.A11S		NM_014400.2	NP_055215.2	O95274	LYPD3_HUMAN	LY6/PLAUR domain containing 3	11					cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|pancreas(1)|upper_aerodigestive_tract(2)	11		Prostate(69;0.0153)				CAGATCATGGCCTGGGCACCT	0.682																																					p.A11S		.											.	LYPD3	91	0			c.G31T						.						97.0	81.0	87.0					19																	43969693		2203	4300	6503	SO:0001583	missense	27076	exon1			TCATGGCCTGGGC	AF082889	CCDS12620.1	19q13.31	2008-02-05				ENSG00000124466			24880	protein-coding gene	gene with protein product		609484				11179665, 11245483	Standard	NM_014400		Approved	C4.4A	uc002owl.1	O95274		ENST00000244333.3:c.31G>T	19.37:g.43969693C>A	ENSP00000244333:p.Ala11Ser	Somatic	41.0	1.0		WXS	Illumina HiSeq	Phase_I	37.0	15.0	NM_014400	Q9UJ74	Missense_Mutation	SNP	ENST00000244333.3	37	CCDS12620.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123110	0.37436	.	.	ENSG00000124466	ENST00000244333;ENST00000377995	T	0.13089	2.62	4.56	0.74	0.18330	.	0.290697	0.23429	N	0.048275	T	0.08935	0.0221	L	0.29908	0.895	0.09310	N	1	B;B	0.18310	0.027;0.01	B;B	0.17098	0.017;0.002	T	0.25222	-1.0138	10	0.45353	T	0.12	.	7.375	0.26823	0.1749:0.4583:0.3668:0.0	.	11;11	B2RBR3;O95274	.;LYPD3_HUMAN	S	11	ENSP00000244333:A11S	ENSP00000244333:A11S	A	-	1	0	LYPD3	48661533	0.000000	0.05858	0.002000	0.10522	0.339000	0.28857	0.408000	0.21065	0.437000	0.26423	0.558000	0.71614	GCC	.		0.682	LYPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463177.1	NM_014400	
MAMDC2	256691	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	72723140	72723140	+	Silent	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr9:72723140T>C	ENST00000377182.4	+	3	779	c.162T>C	c.(160-162)taT>taC	p.Y54Y	MAMDC2-AS1_ENST00000414515.3_RNA|MAMDC2-AS1_ENST00000591368.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	54	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						ATTACATTTATGTGGATACCT	0.443																																					p.Y54Y		.											.	MAMDC2	91	0			c.T162C						.						115.0	114.0	114.0					9																	72723140		2203	4300	6503	SO:0001819	synonymous_variant	256691	exon3			CATTTATGTGGAT	BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.162T>C	9.37:g.72723140T>C		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	29.0	NM_153267	Q5VW47|Q8WX43|Q96BM4	Silent	SNP	ENST00000377182.4	37	CCDS6631.1																																																																																			.		0.443	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	NM_153267	
MAP3K19	80122	broad.mit.edu;ucsc.edu	37	2	135757514	135757514	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:135757514C>A	ENST00000375845.3	-	4	337	c.307G>T	c.(307-309)Gaa>Taa	p.E103*	MAP3K19_ENST00000392915.1_Nonsense_Mutation_p.E120*|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Nonsense_Mutation_p.E103*|MAP3K19_ENST00000392918.3_Nonsense_Mutation_p.E103*|MAP3K19_ENST00000392917.3_Nonsense_Mutation_p.E103*|MAP3K19_ENST00000358371.4_Intron	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	103							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										TACTTCTTTTCTTTTAAGTCT	0.348																																					p.E103X		.											.	.	.	0			c.G307T						.						182.0	166.0	171.0					2																	135757514		2203	4300	6503	SO:0001587	stop_gained	80122	exon4			TCTTTTCTTTTAA	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.307G>T	2.37:g.135757514C>A	ENSP00000365005:p.Glu103*	Somatic	59.0	1.0		WXS	Illumina HiSeq	Phase_I	47.0	5.0	NM_025052	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Nonsense_Mutation	SNP	ENST00000375845.3	37	CCDS2176.2	.	.	.	.	.	.	.	.	.	.	C	17.88	3.496267	0.64186	.	.	ENSG00000176601	ENST00000375845;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915;ENST00000425952	.	.	.	4.55	3.67	0.42095	.	0.501716	0.16794	N	0.199254	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	8.4553	0.32895	0.0:0.8937:0.0:0.1063	.	.	.	.	X	103;103;103;103;120;75	.	ENSP00000365004:E103X	E	-	1	0	YSK4	135473984	0.970000	0.33590	0.977000	0.42913	0.838000	0.47535	1.091000	0.30915	1.287000	0.44583	0.655000	0.94253	GAA	.		0.348	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000158244.1	NM_025052	
MAP3K3	4215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61768464	61768464	+	Silent	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:61768464G>A	ENST00000361733.3	+	13	1535	c.1215G>A	c.(1213-1215)gaG>gaA	p.E405E	MAP3K3_ENST00000577395.1_Silent_p.E401E|MAP3K3_ENST00000584573.1_Silent_p.E432E|MAP3K3_ENST00000579585.1_Silent_p.E436E|MAP3K3_ENST00000361357.3_Silent_p.E436E	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	405	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)			breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						TCCCCTAGGAGGTGAGTGCTC	0.602																																					p.E436E		.											.	MAP3K3	979	0			c.G1308A						.						77.0	66.0	69.0					17																	61768464		2203	4300	6503	SO:0001819	synonymous_variant	4215	exon14			CTAGGAGGTGAGT	U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1215G>A	17.37:g.61768464G>A		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	14.0	NM_203351	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Silent	SNP	ENST00000361733.3	37	CCDS32702.1																																																																																			.		0.602	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443867.1	NM_002401	
MCPH1	79648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	6302684	6302684	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:6302684A>G	ENST00000344683.5	+	8	1517	c.1441A>G	c.(1441-1443)Atc>Gtc	p.I481V	MCPH1_ENST00000519480.1_Missense_Mutation_p.I481V|MCPH1_ENST00000522905.1_Missense_Mutation_p.I433V	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	481					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		AGCAAAAACCATCTCCAGTCC	0.448																																					p.I481V	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1	229	0			c.A1441G						.						71.0	71.0	71.0					8																	6302684		1861	4108	5969	SO:0001583	missense	79648	exon8			AAAACCATCTCCA	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1441A>G	8.37:g.6302684A>G	ENSP00000342924:p.Ile481Val	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	22.0	NM_001172574	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	ENST00000344683.5	37	CCDS43689.1	.	.	.	.	.	.	.	.	.	.	A	7.565	0.665610	0.14710	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.09445	2.98;2.98;2.98	5.37	-3.5	0.04710	.	1.395730	0.03890	N	0.278519	T	0.09291	0.0229	L	0.51422	1.61	0.09310	N	1	B;B;B	0.14438	0.01;0.005;0.006	B;B;B	0.17098	0.01;0.017;0.006	T	0.35773	-0.9775	10	0.29301	T	0.29	-0.2221	1.834	0.03136	0.3818:0.1414:0.34:0.1369	.	433;481;481	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	V	481;481;433	ENSP00000342924:I481V;ENSP00000430962:I481V;ENSP00000430768:I433V	ENSP00000342924:I481V	I	+	1	0	MCPH1	6290092	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.184000	0.09698	-0.505000	0.06568	-0.263000	0.10527	ATC	.		0.448	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
MEOX1	4222	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	41738808	41738808	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:41738808G>A	ENST00000318579.4	-	1	514	c.95C>T	c.(94-96)gCc>gTc	p.A32V	MEOX1_ENST00000393661.2_Intron|MEOX1_ENST00000329168.3_Missense_Mutation_p.A32V|MEOX1_ENST00000549132.1_Missense_Mutation_p.P3S	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	32					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		TAGCCCTGAGGCCCCATTGCC	0.662																																					p.A32V		.											.	MEOX1	90	0			c.C95T						.						19.0	24.0	22.0					17																	41738808		2186	4281	6467	SO:0001583	missense	4222	exon1			CCTGAGGCCCCAT		CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.95C>T	17.37:g.41738808G>A	ENSP00000321684:p.Ala32Val	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	59.0	NM_004527	A8K524|A8MWF9|Q15069	Missense_Mutation	SNP	ENST00000318579.4	37	CCDS11466.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.36|15.36	2.810657|2.810657	0.50421|0.50421	.|.	.|.	ENSG00000005102|ENSG00000005102	ENST00000318579;ENST00000329168|ENST00000549132	D;T|.	0.91295|.	-2.82;0.62|.	4.68|4.68	3.72|3.72	0.42706|0.42706	.|.	0.312282|.	0.33650|.	N|.	0.004689|.	T|T	0.63094|0.63094	0.2482|0.2482	L|L	0.53249|0.53249	1.67|1.67	0.50171|0.50171	D|D	0.99985|0.99985	B;B|.	0.12630|.	0.006;0.001|.	B;B|.	0.17433|.	0.018;0.002|.	T|T	0.65977|0.65977	-0.6037|-0.6037	10|6	0.59425|0.87932	D|D	0.04|0	-16.4|-16.4	11.2408|11.2408	0.48968|0.48968	0.0848:0.0:0.9152:0.0|0.0848:0.0:0.9152:0.0	.|.	32;32|.	Q15069;P50221|.	.;MEOX1_HUMAN|.	V|S	32|3	ENSP00000321684:A32V;ENSP00000328678:A32V|.	ENSP00000321684:A32V|ENSP00000449049:P3S	A|P	-|-	2|1	0|0	MEOX1|MEOX1	39094334|39094334	0.259000|0.259000	0.24043|0.24043	0.992000|0.992000	0.48379|0.48379	0.975000|0.975000	0.68041|0.68041	2.675000|2.675000	0.46875|0.46875	1.203000|1.203000	0.43233|0.43233	0.563000|0.563000	0.77884|0.77884	GCC|CCT	.		0.662	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409452.1		
MUC6	4588	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1017131	1017131	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:1017131G>T	ENST00000421673.2	-	31	5720	c.5670C>A	c.(5668-5670)caC>caA	p.H1890Q		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1890	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGGGGCTGTGTGGGTGGACC	0.567																																					p.H1890Q		.											.	MUC6	23	0			c.C5670A						.						561.0	572.0	569.0					11																	1017131		2201	4287	6488	SO:0001583	missense	4588	exon31			GGCTGTGTGGGTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5670C>A	11.37:g.1017131G>T	ENSP00000406861:p.His1890Gln	Somatic	139.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	21.0	NM_005961	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	6.765	0.510107	0.12883	.	.	ENSG00000184956	ENST00000421673	T	0.22336	1.96	3.21	-0.388	0.12459	.	.	.	.	.	T	0.22126	0.0533	L	0.49126	1.545	0.09310	N	1	P	0.42692	0.787	P	0.49502	0.613	T	0.17806	-1.0357	9	0.26408	T	0.33	.	3.4944	0.07649	0.2666:0.2124:0.5209:0.0	.	1890	Q6W4X9	MUC6_HUMAN	Q	1890	ENSP00000406861:H1890Q	ENSP00000406861:H1890Q	H	-	3	2	MUC6	1007131	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.453000	0.06778	0.158000	0.19367	-0.671000	0.03813	CAC	.		0.567	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MYH15	22989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	108203979	108203979	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:108203979T>C	ENST00000273353.3	-	12	1189	c.1133A>G	c.(1132-1134)cAg>cGg	p.Q378R		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	378	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TCTAGGTTTCTGTTTAAATTT	0.418																																					p.Q378R		.											.	MYH15	73	0			c.A1133G						.						134.0	124.0	127.0					3																	108203979		1872	4101	5973	SO:0001583	missense	22989	exon12			GGTTTCTGTTTAA	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1133A>G	3.37:g.108203979T>C	ENSP00000273353:p.Gln378Arg	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	29.0	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	37	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	T	19.55	3.849548	0.71603	.	.	ENSG00000144821	ENST00000273353	D	0.87809	-2.3	6.05	6.05	0.98169	Myosin head, motor domain (2);	.	.	.	.	D	0.89252	0.6662	M	0.79614	2.46	0.48395	D	0.999641	B	0.12013	0.005	B	0.30401	0.115	D	0.86424	0.1756	9	0.66056	D	0.02	.	16.5932	0.84781	0.0:0.0:0.0:1.0	.	378	Q9Y2K3	MYH15_HUMAN	R	378	ENSP00000273353:Q378R	ENSP00000273353:Q378R	Q	-	2	0	MYH15	109686669	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.089000	0.71384	2.320000	0.78422	0.528000	0.53228	CAG	.		0.418	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
MYLIP	29116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	16145305	16145305	+	Silent	SNP	T	T	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:16145305T>A	ENST00000356840.3	+	6	1203	c.1005T>A	c.(1003-1005)gtT>gtA	p.V335V	MYLIP_ENST00000349606.4_Silent_p.V154V	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein	335					cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			ATGCTGGCGTTGTGGACCTCG	0.483																																					p.V335V		.											.	MYLIP	91	0			c.T1005A						.						114.0	117.0	116.0					6																	16145305		2203	4300	6503	SO:0001819	synonymous_variant	29116	exon6			TGGCGTTGTGGAC	AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405	ENST00000356840.3:c.1005T>A	6.37:g.16145305T>A		Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	97.0	NM_013262	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	Silent	SNP	ENST00000356840.3	37	CCDS4536.1																																																																																			.		0.483	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043864.1	NM_013262	
MYO18B	84700	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26164107	26164107	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr22:26164107C>G	ENST00000407587.2	+	4	393	c.224C>G	c.(223-225)cCc>cGc	p.P75R	MYO18B_ENST00000536101.1_Missense_Mutation_p.P75R|MYO18B_ENST00000335473.7_Missense_Mutation_p.P75R			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	75	Ser-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						ATCAGCCAACCCAACAGCAAG	0.522																																					p.P75R		.											.	MYO18B	142	0			c.C224G						.						133.0	143.0	139.0					22																	26164107		2063	4205	6268	SO:0001583	missense	84700	exon4			GCCAACCCAACAG	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.224C>G	22.37:g.26164107C>G	ENSP00000386096:p.Pro75Arg	Somatic	266.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	71.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	37		.	.	.	.	.	.	.	.	.	.	C	16.86	3.238853	0.58995	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86865	-2.16;-2.16;-2.18	4.87	3.84	0.44239	.	0.000000	0.36234	N	0.002707	D	0.85492	0.5709	L	0.51422	1.61	0.09310	N	1	P	0.48016	0.904	P	0.48227	0.571	T	0.79408	-0.1816	10	0.87932	D	0	.	9.6041	0.39624	0.0:0.8983:0.0:0.1017	.	75	F5GYU7	.	R	75	ENSP00000441229:P75R;ENSP00000334563:P75R;ENSP00000386096:P75R	ENSP00000334563:P75R	P	+	2	0	MYO18B	24494107	0.005000	0.15991	0.014000	0.15608	0.317000	0.28152	2.097000	0.41748	2.271000	0.75665	0.484000	0.47621	CCC	.		0.522	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
MYO3B	140469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	171092541	171092541	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:171092541C>A	ENST00000408978.4	+	7	787	c.644C>A	c.(643-645)gCt>gAt	p.A215D	MYO3B_ENST00000409044.3_Missense_Mutation_p.A215D|MYO3B_ENST00000334231.6_Missense_Mutation_p.A224D|MYO3B_ENST00000602629.1_3'UTR	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	215	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TCCTATGACGCTCGCTGTGAC	0.483											OREG0014376	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A215D		.											.	MYO3B	530	0			c.C644A						.						206.0	197.0	200.0					2																	171092541		2038	4199	6237	SO:0001583	missense	140469	exon7			ATGACGCTCGCTG		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.644C>A	2.37:g.171092541C>A	ENSP00000386213:p.Ala215Asp	Somatic	77.0	0.0	1890	WXS	Illumina HiSeq	Phase_I	78.0	17.0	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	ENST00000408978.4	37	CCDS42773.1	.	.	.	.	.	.	.	.	.	.	C	15.85	2.956101	0.53293	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.048517	0.85682	D	0.000000	T	0.65964	0.2742	L	0.31926	0.97	0.46376	D	0.999018	P;D;P;D	0.53462	0.951;0.96;0.835;0.96	P;P;P;P	0.58130	0.743;0.833;0.576;0.833	T	0.66874	-0.5813	10	0.59425	D	0.04	.	13.4829	0.61348	0.0:0.9291:0.0:0.0708	.	215;215;215;215	Q8WXR4-5;B7ZM71;Q8WXR4-4;Q8WXR4	.;.;.;MYO3B_HUMAN	D	215;215;214;224;224	ENSP00000386497:A215D;ENSP00000386213:A215D;ENSP00000446237:A224D;ENSP00000335100:A224D	ENSP00000314213:A214D	A	+	2	0	MYO3B	170800787	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.025000	0.57225	2.793000	0.96121	0.655000	0.94253	GCT	.		0.483	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
NBEAL2	23218	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	47043973	47043973	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:47043973G>T	ENST00000450053.3	+	32	5443	c.5264G>T	c.(5263-5265)cGc>cTc	p.R1755L	NBEAL2_ENST00000292309.5_Missense_Mutation_p.R1571L|NBEAL2_ENST00000383740.2_Missense_Mutation_p.R34L	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1755					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)		p.R1755H(1)|p.R1132H(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GGGCAGCGGCGCCAGTGGGAG	0.577																																					p.R1755L		.											.	NBEAL2	69	2	Substitution - Missense(2)	lung(2)	c.G5264T						.						40.0	41.0	41.0					3																	47043973		2075	4186	6261	SO:0001583	missense	23218	exon32			AGCGGCGCCAGTG	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.5264G>T	3.37:g.47043973G>T	ENSP00000415034:p.Arg1755Leu	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	27.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	ENST00000450053.3	37	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.09|13.09	2.134664|2.134664	0.37630|0.37630	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000416683|ENST00000292309;ENST00000383740;ENST00000450053	.|T;T;T	.|0.64618	.|-0.06;0.63;-0.11	5.03|5.03	1.62|1.62	0.23740|0.23740	.|.	.|0.507855	.|0.19286	.|N	.|0.118036	T|T	0.56337|0.56337	0.1978|0.1978	M|M	0.72353|0.72353	2.195|2.195	0.40524|0.40524	D|D	0.980869|0.980869	.|B;B	.|0.12630	.|0.006;0.003	.|B;B	.|0.18561	.|0.01;0.022	T|T	0.53158|0.53158	-0.8478|-0.8478	5|10	.|0.72032	.|D	.|0.01	.|.	5.6607|5.6607	0.17667|0.17667	0.2093:0.0:0.6476:0.1431|0.2093:0.0:0.6476:0.1431	.|.	.|1571;1755	.|Q6ZNJ1-2;Q6ZNJ1	.|.;NBEL2_HUMAN	S|L	1043|1571;34;1755	.|ENSP00000292309:R1571L;ENSP00000373246:R34L;ENSP00000415034:R1755L	.|ENSP00000292309:R1571L	A|R	+|+	1|2	0|0	NBEAL2|NBEAL2	47018977|47018977	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.381000|0.381000	0.30169|0.30169	2.278000|2.278000	0.43426|0.43426	0.118000|0.118000	0.18165|0.18165	-0.131000|-0.131000	0.14894|0.14894	GCC|CGC	.		0.577	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
NCAPG2	54892	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	158437057	158437057	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:158437057T>C	ENST00000409423.1	-	28	3476	c.3304A>G	c.(3304-3306)Agg>Ggg	p.R1102G	NCAPG2_ENST00000449727.2_Missense_Mutation_p.R1102G|NCAPG2_ENST00000275830.10_Missense_Mutation_p.R847G|NCAPG2_ENST00000356309.3_Missense_Mutation_p.R1102G|NCAPG2_ENST00000541468.1_Missense_Mutation_p.R556G|NCAPG2_ENST00000409339.3_Missense_Mutation_p.R1102G	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2	1102					chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)	p.R1102W(1)		NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		GCAACCTCCCTCACTTTTGAG	0.363																																					p.R1102G		.											.	NCAPG2	272	1	Substitution - Missense(1)	liver(1)	c.A3304G						.						189.0	177.0	181.0					7																	158437057		1859	4086	5945	SO:0001583	missense	54892	exon27			CCTCCCTCACTTT	BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.3304A>G	7.37:g.158437057T>C	ENSP00000386569:p.Arg1102Gly	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	12.0	NM_017760	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	Missense_Mutation	SNP	ENST00000409423.1	37	CCDS43686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.48|12.48	1.952044|1.952044	0.34471|0.34471	.|.	.|.	ENSG00000146918|ENSG00000146918	ENST00000541468;ENST00000356309;ENST00000409423;ENST00000275830;ENST00000409339;ENST00000545393;ENST00000449727|ENST00000441982	T;T;T;T;T;T|.	0.34667|.	1.39;1.37;1.37;1.39;1.35;1.35|.	5.55|5.55	3.04|3.04	0.35103|0.35103	.|.	0.194589|.	0.52532|.	D|.	0.000068|.	T|.	0.31420|.	0.0796|.	N|N	0.22421|0.22421	0.69|0.69	0.23192|0.23192	N|N	0.998145|0.998145	B;B;B;B|.	0.31625|.	0.332;0.1;0.001;0.102|.	B;B;B;B|.	0.26969|.	0.075;0.039;0.0;0.034|.	T|.	0.19031|.	-1.0318|.	10|.	0.87932|.	D|.	0|.	-14.649|-14.649	10.5386|10.5386	0.45020|0.45020	0.0:0.0:0.3103:0.6897|0.0:0.0:0.3103:0.6897	.|.	1102;545;847;1102|.	Q86XI2-2;B4DHE5;E7EUH9;Q86XI2|.	.;.;.;CNDG2_HUMAN|.	G|W	556;1102;1102;847;1102;545;1102|856	ENSP00000442337:R556G;ENSP00000348657:R1102G;ENSP00000386569:R1102G;ENSP00000275830:R847G;ENSP00000387007:R1102G;ENSP00000388326:R1102G|.	ENSP00000275830:R847G|.	R|X	-|-	1|3	2|0	NCAPG2|NCAPG2	158129818|158129818	0.969000|0.969000	0.33509|0.33509	0.978000|0.978000	0.43139|0.43139	0.613000|0.613000	0.37349|0.37349	1.211000|1.211000	0.32382|0.32382	0.331000|0.331000	0.23511|0.23511	0.533000|0.533000	0.62120|0.62120	AGG|TGA	.		0.363	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327111.1	NM_017760	
NCOA2	10499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	71087033	71087033	+	Missense_Mutation	SNP	C	C	A	rs369349334		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:71087033C>A	ENST00000452400.2	-	5	502	c.321G>T	c.(319-321)caG>caT	p.Q107H		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	107					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CGATGACACCCTGCCCTGTAG	0.413			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.Q107H		.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	639	0			c.G321T						.						185.0	183.0	184.0					8																	71087033		2034	4186	6220	SO:0001583	missense	10499	exon5			GACACCCTGCCCT	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.321G>T	8.37:g.71087033C>A	ENSP00000399968:p.Gln107His	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	23.0	NM_006540	Q14CD2	Missense_Mutation	SNP	ENST00000452400.2	37	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499025	0.64298	.	.	ENSG00000140396	ENST00000452400	T	0.01854	4.6	5.55	2.61	0.31194	.	0.000000	0.85682	D	0.000000	T	0.08626	0.0214	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.02275	-1.1184	10	0.87932	D	0	.	9.5059	0.39046	0.0:0.6985:0.0:0.3015	.	107	Q15596	NCOA2_HUMAN	H	107	ENSP00000399968:Q107H	ENSP00000399968:Q107H	Q	-	3	2	NCOA2	71249587	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	0.849000	0.27723	0.900000	0.36469	0.655000	0.94253	CAG	.		0.413	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
NIPAL4	348938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	156890181	156890181	+	Missense_Mutation	SNP	C	C	A	rs200083422	byFrequency	TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:156890181C>A	ENST00000311946.7	+	2	419	c.303C>A	c.(301-303)agC>agA	p.S101R	ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000521390.1_3'UTR|NIPAL4_ENST00000435489.2_Missense_Mutation_p.S101R	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4	101						integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						AGGTGCCCAGCAATGCCACCT	0.562													C|||	2	0.000399361	0.0015	0.0	5008	,	,		20838	0.0		0.0	False		,,,				2504	0.0				p.S101R		.											.	NIPAL4	68	0			c.C303A						.	C	ARG/SER,ARG/SER	6,4030		0,6,2012	110.0	109.0	109.0		303,303	2.4	0.1	5		109	0,8366		0,0,4183	yes	missense,missense	NIPAL4	NM_001099287.1,NM_001172292.1	110,110	0,6,6195	AA,AC,CC		0.0,0.1487,0.0484	possibly-damaging,possibly-damaging	101/467,101/448	156890181	6,12396	2018	4183	6201	SO:0001583	missense	348938	exon2			GCCCAGCAATGCC	AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.303C>A	5.37:g.156890181C>A	ENSP00000311687:p.Ser101Arg	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	28.0	NM_001099287	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	Missense_Mutation	SNP	ENST00000311946.7	37	CCDS47328.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	C	5.614	0.298045	0.10622	0.001487	0.0	ENSG00000172548	ENST00000435489;ENST00000311946	D;D	0.91180	-2.8;-2.72	5.18	2.37	0.29283	.	1.350690	0.04321	N	0.350782	D	0.85737	0.5766	L	0.34521	1.04	0.26021	N	0.981861	B;B	0.27656	0.184;0.006	B;B	0.21917	0.037;0.002	T	0.72323	-0.4328	10	0.54805	T	0.06	-16.2729	7.5807	0.27963	0.1343:0.722:0.0:0.1437	.	101;101	Q0D2K0-2;Q0D2K0	.;NIPA4_HUMAN	R	101	ENSP00000406456:S101R;ENSP00000311687:S101R	ENSP00000311687:S101R	S	+	3	2	NIPAL4	156822759	0.016000	0.18221	0.069000	0.20011	0.126000	0.20510	0.163000	0.16520	0.174000	0.19809	-0.254000	0.11334	AGC	C|0.999;A|0.001		0.562	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373789.1	NM_001099287	
NOL4	8715	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	31523091	31523097	+	Frame_Shift_Del	DEL	CCAAGAT	CCAAGAT	-			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	CCAAGAT	CCAAGAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr18:31523091_31523097delCCAAGAT	ENST00000261592.5	-	9	1771_1777	c.1474_1480delATCTTGG	c.(1474-1482)atcttggctfs	p.ILA492fs	NOL4_ENST00000538587.1_Frame_Shift_Del_p.ILA418fs|NOL4_ENST00000535475.1_Frame_Shift_Del_p.ILA273fs|NOL4_ENST00000269185.4_Intron|NOL4_ENST00000535384.1_Frame_Shift_Del_p.ILA207fs|NOL4_ENST00000589544.1_Intron	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	492						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CAAGCTGAAGCCAAGATACTCTCTGCA	0.42																																					p.492_494del		.											.	NOL4	93	0			c.1474_1480del						.																																			SO:0001589	frameshift_variant	8715	exon9			CTGAAGCCAAGAT	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1474_1480delATCTTGG	18.37:g.31523091_31523097delCCAAGAT	ENSP00000261592:p.Ile492fs	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	0.0	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Frame_Shift_Del	DEL	ENST00000261592.5	37	CCDS11907.2																																																																																			.		0.420	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
NXPE2	120406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	114569227	114569227	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:114569227A>C	ENST00000389586.4	+	3	783	c.593A>C	c.(592-594)gAa>gCa	p.E198A	NXPE2_ENST00000375475.5_Missense_Mutation_p.E198A	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	198						integral component of membrane (GO:0016021)											CACCCCAGTGAAGGGGTATCA	0.527																																					p.E198A		.											.	.	.	0			c.A593C						.						85.0	91.0	89.0					11																	114569227		692	1591	2283	SO:0001583	missense	120406	exon3			CCAGTGAAGGGGT	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.593A>C	11.37:g.114569227A>C	ENSP00000374237:p.Glu198Ala	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	34.0	NM_182495	Q2NKI8	Missense_Mutation	SNP	ENST00000389586.4	37	CCDS44738.1	.	.	.	.	.	.	.	.	.	.	A	19.97	3.925452	0.73213	.	.	ENSG00000204361	ENST00000389586;ENST00000375475;ENST00000505358	T;T	0.37915	2.0;1.17	4.66	4.66	0.58398	.	0.000000	0.64402	D	0.000008	T	0.69405	0.3107	H	0.95611	3.695	0.47778	D	0.99951	D	0.89917	1.0	D	0.97110	1.0	T	0.78628	-0.2130	10	0.87932	D	0	.	12.076	0.53644	1.0:0.0:0.0:0.0	.	198	Q96DL1	FA55B_HUMAN	A	198	ENSP00000374237:E198A;ENSP00000364624:E198A	ENSP00000364624:E198A	E	+	2	0	FAM55B	114074437	1.000000	0.71417	0.996000	0.52242	0.779000	0.44077	7.402000	0.79972	1.740000	0.51718	0.482000	0.46254	GAA	.		0.527	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399181.1	NM_182495	
OR6Y1	391112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158517456	158517456	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:158517456C>G	ENST00000302617.3	-	1	439	c.440G>C	c.(439-441)gGc>gCc	p.G147A		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G147A(1)		NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					AGCCAGTGTGCCACAGAGCTG	0.473																																					p.G147A		.											.	OR6Y1	69	1	Substitution - Missense(1)	lung(1)	c.G440C						.						67.0	58.0	61.0					1																	158517456		2203	4300	6503	SO:0001583	missense	391112	exon1			AGTGTGCCACAGA	BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.440G>C	1.37:g.158517456C>G	ENSP00000304807:p.Gly147Ala	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	83.0	NM_001005189	Q6IFS0	Missense_Mutation	SNP	ENST00000302617.3	37	CCDS30899.1	.	.	.	.	.	.	.	.	.	.	C	5.039	0.192940	0.09599	.	.	ENSG00000197532	ENST00000302617	T	0.35789	1.29	5.13	5.13	0.70059	GPCR, rhodopsin-like superfamily (1);	0.159452	0.29410	N	0.012223	T	0.05456	0.0144	N	0.03983	-0.305	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.23154	-1.0196	10	0.07482	T	0.82	.	12.2129	0.54389	0.0:0.7183:0.2817:0.0	.	147	Q8NGX8	OR6Y1_HUMAN	A	147	ENSP00000304807:G147A	ENSP00000304807:G147A	G	-	2	0	OR6Y1	156784080	0.000000	0.05858	0.692000	0.30179	0.875000	0.50365	0.305000	0.19254	2.653000	0.90120	0.563000	0.77884	GGC	.		0.473	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051844.1	NM_001005189	
ORC3	23595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	88374575	88374575	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:88374575G>C	ENST00000392844.3	+	18	1996	c.1948G>C	c.(1948-1950)Gag>Cag	p.E650Q	ORC3_ENST00000546266.1_Missense_Mutation_p.E507Q|ORC3_ENST00000257789.4_Missense_Mutation_p.E651Q	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	650					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						GGACTGGTCAGAGGTAGGTTG	0.418																																					p.E651Q		.											.	ORC3	206	0			c.G1951C						.						128.0	119.0	122.0					6																	88374575		2203	4300	6503	SO:0001583	missense	23595	exon18			TGGTCAGAGGTAG	AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.1948G>C	6.37:g.88374575G>C	ENSP00000376586:p.Glu650Gln	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	94.0	NM_181837	A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Missense_Mutation	SNP	ENST00000392844.3	37	CCDS43486.1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.348521	0.41599	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000546266	T;T;T	0.09538	3.36;3.36;2.97	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.03915	0.0110	N	0.04275	-0.24	0.80722	D	1	B;B;P	0.45044	0.063;0.371;0.849	B;B;P	0.47705	0.057;0.213;0.555	T	0.49370	-0.8947	10	0.09843	T	0.71	-18.6999	19.8718	0.96853	0.0:0.0:1.0:0.0	.	588;650;651	B4E014;Q9UBD5;Q9UBD5-2	.;ORC3_HUMAN;.	Q	650;651;507	ENSP00000376586:E650Q;ENSP00000257789:E651Q;ENSP00000444695:E507Q	ENSP00000257789:E651Q	E	+	1	0	ORC3	88431294	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.254000	0.72460	2.808000	0.96608	0.650000	0.86243	GAG	.		0.418	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041452.2		
PCDHA3	56145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140180920	140180920	+	Silent	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:140180920C>A	ENST00000522353.2	+	1	138	c.138C>A	c.(136-138)ggC>ggA	p.G46G	PCDHA3_ENST00000532566.2_Silent_p.G46G|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	46	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCGTGGGCCGCATCGCGC	0.662																																					p.G46G		.											.	PCDHA3	98	0			c.C138A						.						53.0	62.0	59.0					5																	140180920		2203	4300	6503	SO:0001819	synonymous_variant	56145	exon1			CGTGGGCCGCATC	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.138C>A	5.37:g.140180920C>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	16.0	NM_031497	O75286	Silent	SNP	ENST00000522353.2	37	CCDS54915.1																																																																																			.		0.662	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372848.2	NM_018906	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140222940	140222940	+	Silent	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:140222940G>A	ENST00000531613.1	+	1	2034	c.2034G>A	c.(2032-2034)gcG>gcA	p.A678A	PCDHA4_ENST00000512229.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.A678A|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCCAAAAGCGTCATCGAGGC	0.632																																					p.A678A		.											.	PCDHA8	92	0			c.G2034A						.						67.0	66.0	66.0					5																	140222940		2196	4266	6462	SO:0001819	synonymous_variant	56140	exon1			AAAAGCGTCATCG	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.2034G>A	5.37:g.140222940G>A		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	55.0	NM_031856	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																			.		0.632	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCDHB16	57717	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	140562729	140562730	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:140562729_140562730insA	ENST00000361016.2	+	1	1750_1751	c.595_596insA	c.(595-597)gagfs	p.E199fs		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	199	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GTTGGATAAAGAGCTGGATCGG	0.48																																					p.E199fs		.											.	PCDHB16	92	0			c.595_596insA						.																																			SO:0001589	frameshift_variant	57717	exon1			GATAAAGAGCTGG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.596dupA	5.37:g.140562730_140562730dupA	ENSP00000354293:p.Glu199fs	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	27.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Frame_Shift_Ins	INS	ENST00000361016.2	37	CCDS4251.1																																																																																			.		0.480	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDHB10	56126	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	140573693	140573693	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:140573693C>A	ENST00000239446.4	+	1	1752	c.1568C>A	c.(1567-1569)gCc>gAc	p.A523D		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	523	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACTACGAGGCCCTGCAGGCT	0.706																																					p.A523D		.											.	PCDHB10	92	0			c.C1568A						.						91.0	110.0	103.0					5																	140573693		2203	4298	6501	SO:0001583	missense	56126	exon1			ACGAGGCCCTGCA	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1568C>A	5.37:g.140573693C>A	ENSP00000239446:p.Ala523Asp	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	21.0	NM_018930	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	37	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	c	15.99	2.995331	0.54147	.	.	ENSG00000120324	ENST00000239446	T	0.03301	3.98	3.53	3.53	0.40419	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.03827	0.0108	N	0.25201	0.72	0.36476	D	0.867571	B	0.26512	0.151	B	0.33690	0.168	T	0.40156	-0.9578	9	0.62326	D	0.03	.	9.1868	0.37176	0.3799:0.6201:0.0:0.0	.	523	Q9UN67	PCDBA_HUMAN	D	523	ENSP00000239446:A523D	ENSP00000239446:A523D	A	+	2	0	PCDHB10	140553877	0.009000	0.17119	0.993000	0.49108	0.971000	0.66376	1.474000	0.35398	1.994000	0.58287	0.549000	0.68633	GCC	.		0.706	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCK1	5105	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	56140768	56140769	+	Frame_Shift_Del	DEL	GA	GA	-	rs201175342		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr20:56140768_56140769delGA	ENST00000319441.4	+	10	1941_1942	c.1777_1778delGA	c.(1777-1779)gagfs	p.E593fs	PCK1_ENST00000543666.1_Frame_Shift_Del_p.E276fs	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	593					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GGAAGACATCGAGAAGTATCTG	0.5																																					p.593_593del		.											.	PCK1	227	0			c.1777_1778del						.																																			SO:0001589	frameshift_variant	5105	exon10			GACATCGAGAAGT		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1777_1778delGA	20.37:g.56140770_56140771delGA	ENSP00000319814:p.Glu593fs	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	0.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Frame_Shift_Del	DEL	ENST00000319441.4	37	CCDS13460.1																																																																																			.		0.500	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
PCLO	27445	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82546021	82546021	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:82546021T>G	ENST00000333891.9	-	7	11618	c.11281A>C	c.(11281-11283)Aag>Cag	p.K3761Q	PCLO_ENST00000423517.2_Missense_Mutation_p.K3761Q|PCLO_ENST00000437081.1_Missense_Mutation_p.K481Q	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TGGAGAATCTTGGCTCGTGCC	0.463																																					p.K3761Q		.											.	PCLO	29	0			c.A11281C						.						120.0	109.0	112.0					7																	82546021		1909	4138	6047	SO:0001583	missense	27445	exon7			GAATCTTGGCTCG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11281A>C	7.37:g.82546021T>G	ENSP00000334319:p.Lys3761Gln	Somatic	118.0	1.0		WXS	Illumina HiSeq	Phase_I	99.0	32.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.978814	0.92982	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.19532	2.14;2.14	6.0	6.0	0.97389	.	.	.	.	.	T	0.46054	0.1373	M	0.65498	2.005	0.58432	D	0.999994	D;D;D	0.69078	0.986;0.997;0.997	P;D;D	0.71656	0.722;0.974;0.974	T	0.41716	-0.9493	9	0.87932	D	0	.	16.5724	0.84622	0.0:0.0:0.0:1.0	.	3692;3761;3761	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	Q	3761;3761;481	ENSP00000334319:K3761Q;ENSP00000388393:K3761Q	ENSP00000334319:K3761Q	K	-	1	0	PCLO	82383957	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.037000	0.88933	2.313000	0.78055	0.456000	0.33151	AAG	.		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82583500	82583500	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:82583500C>A	ENST00000333891.9	-	5	7106	c.6769G>T	c.(6769-6771)Gct>Tct	p.A2257S	PCLO_ENST00000423517.2_Missense_Mutation_p.A2257S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCAGCACTAGCTCTACCATCT	0.393																																					p.A2257S		.											.	PCLO	29	0			c.G6769T						.						77.0	74.0	75.0					7																	82583500		1874	4096	5970	SO:0001583	missense	27445	exon5			CACTAGCTCTACC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6769G>T	7.37:g.82583500C>A	ENSP00000334319:p.Ala2257Ser	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	16.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	8.245	0.807719	0.16467	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.15718	2.4;2.4	5.7	-2.67	0.06059	.	.	.	.	.	T	0.10852	0.0265	N	0.22421	0.69	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.09377	0.004;0.003	T	0.28964	-1.0027	9	0.87932	D	0	.	9.3097	0.37895	0.0:0.4796:0.1134:0.407	.	2257;2257	Q9Y6V0-5;Q9Y6V0-6	.;.	S	2188;2257;2257	ENSP00000334319:A2257S;ENSP00000388393:A2257S	ENSP00000334319:A2257S	A	-	1	0	PCLO	82421436	0.000000	0.05858	0.015000	0.15790	0.587000	0.36485	-1.073000	0.03430	-0.757000	0.04697	-0.199000	0.12753	GCT	.		0.393	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCLO	27445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	82764880	82764880	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:82764880C>A	ENST00000333891.9	-	3	2323	c.1986G>T	c.(1984-1986)aaG>aaT	p.K662N	PCLO_ENST00000423517.2_Missense_Mutation_p.K662N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CAGGTGCAGTCTTCAGTTTGG	0.498																																					p.K662N		.											.	PCLO	29	0			c.G1986T						.						112.0	112.0	112.0					7																	82764880		2030	4177	6207	SO:0001583	missense	27445	exon3			TGCAGTCTTCAGT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1986G>T	7.37:g.82764880C>A	ENSP00000334319:p.Lys662Asn	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	27.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	37	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	2.337	-0.352018	0.05173	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17370	2.28;2.28	5.46	4.58	0.56647	.	.	.	.	.	T	0.17023	0.0409	L	0.32530	0.975	0.80722	D	1	P;P	0.46512	0.879;0.879	B;B	0.43103	0.295;0.408	T	0.01553	-1.1326	9	0.87932	D	0	.	14.2118	0.65769	0.0:0.9279:0.0:0.0721	.	662;662	Q9Y6V0-5;Q9Y6V0-6	.;.	N	608;662;662	ENSP00000334319:K662N;ENSP00000388393:K662N	ENSP00000334319:K662N	K	-	3	2	PCLO	82602816	0.911000	0.30947	0.012000	0.15200	0.010000	0.07245	1.456000	0.35201	1.313000	0.45069	0.591000	0.81541	AAG	.		0.498	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
PCSK2	5126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	17240976	17240976	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr20:17240976A>G	ENST00000262545.2	+	2	584	c.269A>G	c.(268-270)gAg>gGg	p.E90G	PCSK2_ENST00000536609.1_Intron|PCSK2_ENST00000377899.1_Missense_Mutation_p.E71G	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	90					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAGCAGCTGGAGAGAGACCCC	0.562																																					p.E90G		.											.	PCSK2	157	0			c.A269G						.						87.0	84.0	85.0					20																	17240976		2203	4300	6503	SO:0001583	missense	5126	exon2			AGCTGGAGAGAGA	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.269A>G	20.37:g.17240976A>G	ENSP00000262545:p.Glu90Gly	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	59.0	NM_002594	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	A	13.47	2.247425	0.39697	.	.	ENSG00000125851	ENST00000377899;ENST00000262545	T;T	0.30182	1.54;1.54	5.45	5.45	0.79879	Proteinase inhibitor, propeptide (1);	0.123300	0.56097	D	0.000035	T	0.26738	0.0654	L	0.40543	1.245	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.04373	-1.0956	10	0.56958	D	0.05	-37.5868	11.8957	0.52656	1.0:0.0:0.0:0.0	.	90	P16519	NEC2_HUMAN	G	71;90	ENSP00000367131:E71G;ENSP00000262545:E90G	ENSP00000262545:E90G	E	+	2	0	PCSK2	17188976	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.112000	0.71547	2.065000	0.61736	0.460000	0.39030	GAG	.		0.562	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
PDGFRA	5156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55156636	55156636	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr4:55156636A>G	ENST00000257290.5	+	22	3368	c.3037A>G	c.(3037-3039)Agc>Ggc	p.S1013G	FIP1L1_ENST00000507166.1_Missense_Mutation_p.S773G	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	1013					adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	GCAGAGACTGAGCGCTGACAG	0.547			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.S1013G	Pancreas(151;208 1913 7310 23853 37092)	.		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	PDGFRA	9497	0			c.A3037G						.						195.0	161.0	173.0					4																	55156636		2203	4300	6503	SO:0001583	missense	5156	exon22	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	AGACTGAGCGCTG	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.3037A>G	4.37:g.55156636A>G	ENSP00000257290:p.Ser1013Gly	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	24.0	NM_006206	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	37	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.596622	0.86953	.	.	ENSG00000145216;ENSG00000134853	ENST00000507166;ENST00000257290	T;T	0.78246	-1.16;-0.99	5.92	5.92	0.95590	.	0.000000	0.37483	U	0.002079	D	0.84188	0.5417	L	0.45581	1.43	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.83123	-0.0117	10	0.37606	T	0.19	.	16.3594	0.83251	1.0:0.0:0.0:0.0	.	1013	P16234	PGFRA_HUMAN	G	773;1013	ENSP00000423325:S773G;ENSP00000257290:S1013G	ENSP00000423325:S773G	S	+	1	0	FIP1L1;PDGFRA	54851393	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.803000	0.91915	2.266000	0.75297	0.455000	0.32223	AGC	.		0.547	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
PHRF1	57661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	609135	609135	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:609135C>G	ENST00000264555.5	+	14	3807	c.3679C>G	c.(3679-3681)Cat>Gat	p.H1227D	PHRF1_ENST00000416188.2_Missense_Mutation_p.H1226D|PHRF1_ENST00000533464.1_Missense_Mutation_p.H1223D|PHRF1_ENST00000413872.2_Missense_Mutation_p.H1225D	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1227					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GGGGGAAGCACATGTCTCGCC	0.697																																					p.H1226D		.											.	PHRF1	22	0			c.C3676G						.						22.0	27.0	25.0					11																	609135		2116	4198	6314	SO:0001583	missense	57661	exon14			GAAGCACATGTCT	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.3679C>G	11.37:g.609135C>G	ENSP00000264555:p.His1227Asp	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	9.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	C	1.963	-0.438399	0.04636	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	4.45	-2.78	0.05859	.	1.710460	0.03392	N	0.202064	T	0.46425	0.1392	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.10296	0.003;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.0;0.0;0.0	T	0.31194	-0.9952	10	0.13853	T	0.58	1.4132	0.3529	0.00352	0.3363:0.2591:0.1798:0.2249	.	1223;1225;1226;1227	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	D	1227;1225;1226;1223	ENSP00000264555:H1227D;ENSP00000388589:H1225D;ENSP00000410626:H1226D;ENSP00000431870:H1223D	ENSP00000264555:H1227D	H	+	1	0	PHRF1	599135	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.040000	0.12104	-0.816000	0.04340	-0.502000	0.04539	CAT	.		0.697	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
PIWIL4	143689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	94316706	94316706	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:94316706C>A	ENST00000299001.6	+	5	817	c.606C>A	c.(604-606)tgC>tgA	p.C202*	RP11-867G2.8_ENST00000537874.1_RNA|RP11-867G2.8_ENST00000536540.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	202					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CTCCCGTGTGCATCCAGGTCT	0.418																																					p.C202X		.											.	PIWIL4	91	0			c.C606A						.						160.0	160.0	160.0					11																	94316706		2201	4298	6499	SO:0001587	stop_gained	143689	exon5			CGTGTGCATCCAG	AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.606C>A	11.37:g.94316706C>A	ENSP00000299001:p.Cys202*	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	46.0	NM_152431	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Nonsense_Mutation	SNP	ENST00000299001.6	37	CCDS31656.1	.	.	.	.	.	.	.	.	.	.	C	33	5.280438	0.95489	.	.	ENSG00000134627	ENST00000299001	.	.	.	5.54	3.65	0.41850	.	0.069855	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.1243	11.7711	0.51960	0.0:0.8514:0.0:0.1486	.	.	.	.	X	202	.	ENSP00000299001:C202X	C	+	3	2	PIWIL4	93956354	1.000000	0.71417	0.998000	0.56505	0.835000	0.47333	0.953000	0.29162	1.593000	0.50029	0.650000	0.86243	TGC	.		0.418	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396388.1	NM_152431	
PRB2	653247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	11546698	11546698	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:11546698C>A	ENST00000389362.4	-	3	349	c.314G>T	c.(313-315)gGa>gTa	p.G105V	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	105	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGACTTGTCTCCTTGTGGGGG	0.607																																					p.G105V		.											.	PRB2	22	0			c.G314T						.						295.0	321.0	312.0					12																	11546698		2203	4300	6503	SO:0001583	missense	653247	exon3			TTGTCTCCTTGTG	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.314G>T	12.37:g.11546698C>A	ENSP00000374013:p.Gly105Val	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	56.0	NM_006248	O00599|P02811|P04281	Missense_Mutation	SNP	ENST00000389362.4	37	CCDS41757.2	.	.	.	.	.	.	.	.	.	.	.	5.747	0.322227	0.10900	.	.	ENSG00000121335	ENST00000389362	T	0.09445	2.98	1.0	-0.174	0.13319	.	.	.	.	.	T	0.09555	0.0235	M	0.82323	2.585	0.09310	N	1	P	0.39809	0.689	B	0.25987	0.065	T	0.28106	-1.0054	9	0.27082	T	0.32	.	2.2991	0.04158	0.0:0.3954:0.3405:0.264	.	105	P02812	PRB2_HUMAN	V	105	ENSP00000374013:G105V	ENSP00000374013:G105V	G	-	2	0	PRB2	11437965	0.000000	0.05858	0.001000	0.08648	0.036000	0.12997	-1.529000	0.02223	0.542000	0.28846	0.000000	0.15137	GGA	.		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2	NM_006248	
PPM1H	57460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	63042384	63042384	+	Missense_Mutation	SNP	C	C	A	rs540042623		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:63042384C>A	ENST00000228705.6	-	10	1730	c.1430G>T	c.(1429-1431)cGt>cTt	p.R477L	PPM1H_ENST00000551214.1_5'UTR|snoU13_ENST00000459527.1_RNA	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	477	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)	p.R477H(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		ACCCCGGGCACGCATCACCAG	0.522																																					p.R477L		.											.	PPM1H	637	1	Substitution - Missense(1)	large_intestine(1)	c.G1430T						.						57.0	60.0	59.0					12																	63042384		2095	4238	6333	SO:0001583	missense	57460	exon10			CGGGCACGCATCA	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1430G>T	12.37:g.63042384C>A	ENSP00000228705:p.Arg477Leu	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	27.0	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	ENST00000228705.6	37	CCDS44934.1	.	.	.	.	.	.	.	.	.	.	C	32	5.191308	0.94923	.	.	ENSG00000111110	ENST00000228705	T	0.08102	3.13	5.93	5.93	0.95920	Protein phosphatase 2C-like (4);	0.122569	0.56097	D	0.000035	T	0.18383	0.0441	L	0.35644	1.08	0.80722	D	1	P	0.46512	0.879	P	0.55923	0.787	T	0.00411	-1.1756	9	.	.	.	3.064	20.3507	0.98813	0.0:1.0:0.0:0.0	.	477	Q9ULR3	PPM1H_HUMAN	L	477	ENSP00000228705:R477L	.	R	-	2	0	PPM1H	61328651	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.207000	0.77899	2.808000	0.96608	0.655000	0.94253	CGT	.		0.522	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
PRODH2	58510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36297613	36297613	+	Silent	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:36297613C>A	ENST00000301175.3	-	7	1043	c.1026G>T	c.(1024-1026)ggG>ggT	p.G342G		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	342					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACACCCAGGGCCCGCCTTCAC	0.647																																					p.G342G		.											.	PRODH2	92	0			c.G1026T						.						34.0	33.0	33.0					19																	36297613		2203	4300	6503	SO:0001819	synonymous_variant	58510	exon7			CCAGGGCCCGCCT	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1026G>T	19.37:g.36297613C>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	27.0	NM_021232		Silent	SNP	ENST00000301175.3	37	CCDS12478.1																																																																																			.		0.647	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2	NM_021232	
PRSS58	136541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	141955440	141955440	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:141955440C>A	ENST00000552471.1	-	2	413	c.94G>T	c.(94-96)Gtc>Ttc	p.V32F	PRSS58_ENST00000547058.2_Missense_Mutation_p.V32F			Q8IYP2	PRS58_HUMAN	protease, serine, 58	32	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						TTCAAATAGACCAAGTAAGGG	0.468																																					p.V32F		.											.	PRSS58	24	0			c.G94T						.						87.0	85.0	85.0					7																	141955440		2203	4300	6503	SO:0001583	missense	136541	exon3			AATAGACCAAGTA		CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.94G>T	7.37:g.141955440C>A	ENSP00000446916:p.Val32Phe	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	58.0	NM_001001317	B3KVJ6|D3DXD2	Missense_Mutation	SNP	ENST00000552471.1	37	CCDS5871.1	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216875	0.58452	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.87334	-2.24;-2.24	5.0	4.12	0.48240	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.91178	0.7221	M	0.92122	3.275	0.09310	N	1	D	0.58970	0.984	P	0.47346	0.544	D	0.85411	0.1137	9	0.87932	D	0	.	11.1741	0.48588	0.0:0.9106:0.0:0.0894	.	32	Q8IYP2	PRS58_HUMAN	F	32	ENSP00000447588:V32F;ENSP00000446916:V32F	ENSP00000307206:V32F	V	-	1	0	PRSS58	141601917	0.138000	0.22547	0.028000	0.17463	0.034000	0.12701	0.718000	0.25866	1.345000	0.45676	0.655000	0.94253	GTC	.		0.468	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351328.2	NM_001001317	
PTPN5	84867	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	18754797	18754797	+	Silent	SNP	G	G	T	rs367543225		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:18754797G>T	ENST00000358540.2	-	11	1633	c.1203C>A	c.(1201-1203)atC>atA	p.I401I	PTPN5_ENST00000396168.1_Silent_p.I377I|PTPN5_ENST00000477854.1_Silent_p.I205I|PTPN5_ENST00000396166.3_5'Flank|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396170.1_Silent_p.I369I|PTPN5_ENST00000396171.4_Silent_p.I401I|PTPN5_ENST00000396167.2_Silent_p.I369I	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	401	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						TCATCTCCTCGATGTTGGTGA	0.517																																					p.I401I		.											.	PTPN5	229	0			c.C1203A						.						189.0	157.0	168.0					11																	18754797		2199	4293	6492	SO:0001819	synonymous_variant	84867	exon11			CTCCTCGATGTTG	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1203C>A	11.37:g.18754797G>T		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	16.0	NM_032781	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Silent	SNP	ENST00000358540.2	37	CCDS7845.1																																																																																			.		0.517	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970	
PTPRS	5802	broad.mit.edu;mdanderson.org	37	19	5223017	5223017	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:5223017C>T	ENST00000587303.1	-	17	2885	c.2786G>A	c.(2785-2787)cGt>cAt	p.R929H	PTPRS_ENST00000588012.1_Missense_Mutation_p.R907H|PTPRS_ENST00000592099.1_Intron|PTPRS_ENST00000348075.2_Missense_Mutation_p.R907H|PTPRS_ENST00000357368.4_Missense_Mutation_p.R929H|PTPRS_ENST00000588552.1_Intron|PTPRS_ENST00000262963.6_Missense_Mutation_p.R925H|PTPRS_ENST00000372412.4_Missense_Mutation_p.R930H|PTPRS_ENST00000353284.2_Intron			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	929	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CGGGTGGCCACGGGGCGTGTC	0.746																																					p.R929H		.											.	PTPRS	357	0			c.G2786A						.						3.0	5.0	4.0					19																	5223017		1933	3743	5676	SO:0001583	missense	5802	exon18			TGGCCACGGGGCG	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.2786G>A	19.37:g.5223017C>T	ENSP00000467537:p.Arg929His	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	11.0	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.385887	0.42308	.	.	ENSG00000105426	ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075	T;T;T;T	0.76578	-1.03;-1.03;-1.03;0.5	4.09	0.505	0.16953	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.430477	0.21093	U	0.080293	T	0.68311	0.2987	L	0.54323	1.7	0.09310	N	1	P;P	0.47910	0.567;0.902	B;B	0.41202	0.216;0.35	T	0.61347	-0.7081	10	0.52906	T	0.07	.	7.1624	0.25671	0.0:0.5237:0.0:0.4762	.	907;929	Q13332-6;Q13332	.;PTPRS_HUMAN	H	930;929;929;920;925;907	ENSP00000361489:R930H;ENSP00000349932:R929H;ENSP00000262963:R925H;ENSP00000269907:R907H	ENSP00000262963:R925H	R	-	2	0	PTPRS	5174017	0.000000	0.05858	0.971000	0.41717	0.387000	0.30353	0.313000	0.19415	0.385000	0.24970	0.557000	0.71058	CGT	.		0.746	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	121652602	121652602	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:121652602T>A	ENST00000393386.2	+	12	3913	c.3502T>A	c.(3502-3504)Tta>Ata	p.L1168I	PTPRZ1_ENST00000483028.1_Intron|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1168					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AACTCAGCTCTTATTTTATGA	0.428																																					p.L1168I		.											.	PTPRZ1	699	0			c.T3502A						.						206.0	201.0	203.0					7																	121652602		2203	4300	6503	SO:0001583	missense	5803	exon12			CAGCTCTTATTTT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.3502T>A	7.37:g.121652602T>A	ENSP00000377047:p.Leu1168Ile	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	18.0	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Missense_Mutation	SNP	ENST00000393386.2	37	CCDS34740.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.752738	0.31046	.	.	ENSG00000106278	ENST00000393386	T	0.56611	0.45	5.51	0.193	0.15139	.	1.165150	0.06426	N	0.723254	T	0.48187	0.1486	M	0.67953	2.075	0.09310	N	1	B	0.32573	0.376	B	0.30401	0.115	T	0.42916	-0.9423	10	0.72032	D	0.01	.	4.9299	0.13912	0.0:0.2294:0.2542:0.5164	.	1168	P23471	PTPRZ_HUMAN	I	1168	ENSP00000377047:L1168I	ENSP00000377047:L1168I	L	+	1	2	PTPRZ1	121439838	0.002000	0.14202	0.037000	0.18230	0.995000	0.86356	0.620000	0.24403	-0.195000	0.10382	0.454000	0.30748	TTA	.		0.428	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
RAB3GAP2	25782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220406172	220406172	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:220406172C>A	ENST00000358951.2	-	2	265	c.149G>T	c.(148-150)gGa>gTa	p.G50V		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	50					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TTCCCATGCTCCCCAACCATC	0.328																																					p.G50V		.											.	RAB3GAP2	90	0			c.G149T						.						215.0	194.0	201.0					1																	220406172		2203	4300	6503	SO:0001583	missense	25782	exon2			CATGCTCCCCAAC	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.149G>T	1.37:g.220406172C>A	ENSP00000351832:p.Gly50Val	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	178.0	NM_012414	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.355798	0.61293	.	.	ENSG00000118873	ENST00000358951	T	0.32988	1.43	5.51	5.51	0.81932	.	0.050568	0.85682	D	0.000000	T	0.36413	0.0966	L	0.36672	1.1	0.80722	D	1	P;B	0.52842	0.956;0.383	P;B	0.51016	0.656;0.203	T	0.07443	-1.0772	10	0.72032	D	0.01	.	15.27	0.73693	0.0:1.0:0.0:0.0	.	50;50	Q9H2M9-2;Q9H2M9	.;RBGPR_HUMAN	V	50	ENSP00000351832:G50V	ENSP00000351832:G50V	G	-	2	0	RAB3GAP2	218472795	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.187000	0.58344	2.756000	0.94617	0.655000	0.94253	GGA	.		0.328	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
RAI1	10743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	17697493	17697493	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:17697493G>T	ENST00000353383.1	+	3	1700	c.1231G>T	c.(1231-1233)Gct>Tct	p.A411S	RAI1_ENST00000261641.6_Missense_Mutation_p.A411S	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	411					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GGACACCCAGGCTGGCAACTG	0.627																																					p.A411S		.											.	RAI1	91	0			c.G1231T						.						99.0	99.0	99.0					17																	17697493		2203	4300	6503	SO:0001583	missense	10743	exon3			ACCCAGGCTGGCA	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.1231G>T	17.37:g.17697493G>T	ENSP00000323074:p.Ala411Ser	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	36.0	NM_030665	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	ENST00000353383.1	37	CCDS11188.1	.	.	.	.	.	.	.	.	.	.	G	3.092	-0.186592	0.06340	.	.	ENSG00000108557	ENST00000353383;ENST00000395774;ENST00000395776;ENST00000355970;ENST00000261641	T;T;T	0.25749	1.78;1.78;1.78	5.55	4.58	0.56647	.	0.421941	0.24433	N	0.038570	T	0.14399	0.0348	L	0.31664	0.95	0.09310	N	0.999998	B	0.16396	0.017	B	0.09377	0.004	T	0.18398	-1.0338	10	0.22109	T	0.4	.	2.867	0.05604	0.1566:0.1332:0.5545:0.1557	.	411	Q7Z5J4	RAI1_HUMAN	S	411	ENSP00000323074:A411S;ENSP00000379120:A411S;ENSP00000261641:A411S	ENSP00000261641:A411S	A	+	1	0	RAI1	17638218	0.966000	0.33281	0.893000	0.35052	0.316000	0.28119	1.139000	0.31504	1.342000	0.45619	0.561000	0.74099	GCT	.		0.627	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131775.1	NM_030665	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	49039196	49039228	+	In_Frame_Del	DEL	GGTCTTCATGCAGAGACTGAAAACAAATATTTT	GGTCTTCATGCAGAGACTGAAAACAAATATTTT	-	rs138637932|rs558114005		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	GGTCTTCATGCAGAGACTGAAAACAAATATTTT	GGTCTTCATGCAGAGACTGAAAACAAATATTTT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr13:49039196_49039228delGGTCTTCATGCAGAGACTGAAAACAAATATTTT	ENST00000267163.4	+	22	2412_2444	c.2274_2306delGGTCTTCATGCAGAGACTGAAAACAAATATTTT	c.(2272-2307)tcggtcttcatgcagagactgaaaacaaatattttg>tcg	p.VFMQRLKTNIL759del		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	759	Domain B.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(12)|p.Q762*(2)|p.K765*(1)|p.M761fs*4(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCTATAACTCGGTCTTCATGCAGAGACTGAAAACAAATATTTTGCAGTATGCT	0.3		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.758_769del		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	3784	31	Whole gene deletion(15)|Unknown(12)|Substitution - Nonsense(3)|Deletion - Frameshift(1)	bone(11)|breast(5)|haematopoietic_and_lymphoid_tissue(4)|endometrium(3)|urinary_tract(2)|lung(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|liver(1)	c.2274_2306del	GRCh37	CD071386|CM030515|CM961237	RB1	D|M		.																																			SO:0001651	inframe_deletion	5925	exon22	Familial Cancer Database		TAACTCGGTCTTC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2274_2306delGGTCTTCATGCAGAGACTGAAAACAAATATTTT	13.37:g.49039196_49039228delGGTCTTCATGCAGAGACTGAAAACAAATATTTT	ENSP00000267163:p.Val759_Leu769del	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	17.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	In_Frame_Del	DEL	ENST00000267163.4	37	CCDS31973.1																																																																																			.		0.300	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
RHPN1	114822	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144462150	144462150	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:144462150G>A	ENST00000289013.6	+	9	1198	c.1097G>A	c.(1096-1098)gGc>gAc	p.G366D		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	366	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CTCTGCGACGGCTCCCGTGAG	0.667																																					p.G366D		.											.	RHPN1	67	0			c.G1097A						.						31.0	38.0	36.0					8																	144462150		2090	4145	6235	SO:0001583	missense	114822	exon9			GCGACGGCTCCCG	AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1097G>A	8.37:g.144462150G>A	ENSP00000289013:p.Gly366Asp	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	8.0	NM_052924	Q8TAV1|Q96PV9	Missense_Mutation	SNP	ENST00000289013.6	37	CCDS47927.1	.	.	.	.	.	.	.	.	.	.	G	2.493	-0.316997	0.05386	.	.	ENSG00000158106	ENST00000289013	T	0.52057	0.68	4.26	4.26	0.50523	.	0.606575	0.17690	N	0.165297	T	0.38374	0.1038	L	0.59436	1.845	0.09310	N	1	P	0.38767	0.646	B	0.35931	0.214	T	0.20140	-1.0284	10	0.12103	T	0.63	-9.4896	9.5078	0.39058	0.0998:0.0:0.9002:0.0	.	366	Q8TCX5-2	.	D	366	ENSP00000289013:G366D	ENSP00000289013:G366D	G	+	2	0	RHPN1	144533293	0.955000	0.32602	0.004000	0.12327	0.181000	0.23173	5.635000	0.67841	1.904000	0.55121	0.511000	0.50034	GGC	.		0.667	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381417.1		
RNF135	84282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29325932	29325932	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:29325932G>T	ENST00000328381.5	+	5	1895	c.1022G>T	c.(1021-1023)gGa>gTa	p.G341V	RNF135_ENST00000443677.2_3'UTR|RNF135_ENST00000324689.4_3'UTR|RNF135_ENST00000535306.2_3'UTR	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	341	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				CAGGTCCTGGGAAGGACTATG	0.557																																					p.G341V		.											.	RNF135	227	1	Unknown(1)	central_nervous_system(1)	c.G1022T						.						57.0	54.0	55.0					17																	29325932		2203	4300	6503	SO:0001583	missense	84282	exon5			TCCTGGGAAGGAC	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.1022G>T	17.37:g.29325932G>T	ENSP00000328340:p.Gly341Val	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	70.0	NM_032322	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	37	CCDS11262.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243868	0.79912	.	.	ENSG00000181481	ENST00000328381;ENST00000535605	T	0.73363	-0.74	5.21	5.21	0.72293	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.44097	D	0.000490	D	0.85630	0.5741	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82778	-0.0289	10	0.20046	T	0.44	-14.8505	16.6225	0.84934	0.0:0.0:1.0:0.0	.	341	Q8IUD6	RN135_HUMAN	V	341;160	ENSP00000328340:G341V	ENSP00000328340:G341V	G	+	2	0	RNF135	26350058	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.441000	0.73439	2.613000	0.88420	0.655000	0.94253	GGA	.		0.557	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	
RUSC1	23623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155292170	155292170	+	Silent	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:155292170G>A	ENST00000368352.5	+	2	757	c.606G>A	c.(604-606)agG>agA	p.R202R	RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368349.4_5'Flank|RUSC1_ENST00000292254.4_5'Flank|RUSC1_ENST00000368347.4_5'Flank|RUSC1_ENST00000368354.3_Silent_p.R202R|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	202					positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			AGGACGAGAGGGCGGAGCAGG	0.577																																					p.R202R		.											.	RUSC1	92	0			c.G606A						.						50.0	52.0	51.0					1																	155292170		1924	4143	6067	SO:0001819	synonymous_variant	23623	exon2			CGAGAGGGCGGAG	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.606G>A	1.37:g.155292170G>A		Somatic	228.0	0.0		WXS	Illumina HiSeq	Phase_I	363.0	310.0	NM_001105203	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Silent	SNP	ENST00000368352.5	37	CCDS41410.1																																																																																			.		0.577	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;bcgsc.ca	37	19	39001379	39001380	+	Missense_Mutation	DNP	GC	GC	TA	rs375021688		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G|C	G|C	.	.	.	.	Unknown|.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:39001379_39001380GC>TA	ENST00000359596.3	+	60	9080_9081	c.9080_9081GC>TA	c.(9079-9081)aGC>aTA	p.S3027I	RYR1_ENST00000360985.3_Missense_Mutation_p.S3027I|RYR1_ENST00000355481.4_Missense_Mutation_p.S3027I			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3027					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GTGCTGGGCAGCGGTGGCCACG	0.569																																					p.S3027I|p.S3027R		.											.	RYR1	100	0			c.G9080T|c.C9081A						.																																			SO:0001583	missense	6261	exon60			TGGGCAGCGGTGG|GGGCAGCGGTGGC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		Exception_encountered	19.37:g.39001379_39001380delinsTA	ENSP00000352608:p.Ser3027Ile	Somatic	94.0|95.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	41.0|42.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.569	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
RYR3	6263	broad.mit.edu;ucsc.edu	37	15	33954429	33954429	+	Silent	SNP	C	C	T	rs563422149		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr15:33954429C>T	ENST00000389232.4	+	35	4768	c.4698C>T	c.(4696-4698)agC>agT	p.S1566S	RYR3_ENST00000415757.3_Silent_p.S1566S	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1566	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGCTCTACAGCGCGGTGTGCG	0.607																																					p.S1566S		.											.	RYR3	520	0			c.C4698T						.						50.0	50.0	50.0					15																	33954429		2075	4223	6298	SO:0001819	synonymous_variant	6263	exon35			CTACAGCGCGGTG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4698C>T	15.37:g.33954429C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	4.0	NM_001243996	O15175|Q15412	Silent	SNP	ENST00000389232.4	37	CCDS45210.1																																																																																			.		0.607	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
SERPINF2	5345	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	1657772	1657772	+	Silent	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:1657772T>C	ENST00000324015.3	+	10	1497	c.1420T>C	c.(1420-1422)Tta>Cta	p.L474L	SERPINF2_ENST00000450523.2_Silent_p.L410L|SERPINF2_ENST00000382061.4_Silent_p.L474L	NM_000934.3	NP_000925.2	P08697	A2AP_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	474					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of proteolysis (GO:0030162)|response to organic substance (GO:0010033)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Ocriplasmin(DB08888)	CGGCCCTGACTTAAAACTTGT	0.617																																					p.L474L		.											.	SERPINF2	226	0			c.T1420C						.						59.0	65.0	63.0					17																	1657772		2203	4300	6503	SO:0001819	synonymous_variant	5345	exon10			CCTGACTTAAAAC	D00174	CCDS11011.1, CCDS54064.1	17p13.3	2014-02-18	2005-08-18		ENSG00000167711	ENSG00000167711		"""Serine (or cysteine) peptidase inhibitors"""	9075	protein-coding gene	gene with protein product	"""alpha-2-plasmin inhibitor"", ""alpha-2-antiplasmin"""	613168	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2"""	PLI		3416655, 24172014	Standard	NM_000934		Approved	API, ALPHA-2-PI, A2AP, AAP	uc002ftk.1	P08697	OTTHUMG00000090552	ENST00000324015.3:c.1420T>C	17.37:g.1657772T>C		Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	35.0	NM_000934	B4E1B7|Q8N5U7|Q9UCG2|Q9UCG3	Silent	SNP	ENST00000324015.3	37	CCDS11011.1																																																																																			.		0.617	SERPINF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207078.3	NM_000934	
SETD2	29072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	47155493	47155493	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:47155493A>T	ENST00000409792.3	-	5	4630	c.4588T>A	c.(4588-4590)Tct>Act	p.S1530T		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1530	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CACCGAGAAGAACTGAAATGA	0.353			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.S1530T		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	1273	0			c.T4588A						.						98.0	99.0	99.0					3																	47155493		2203	4300	6503	SO:0001630	splice_region_variant	29072	exon5			GAGAAGAACTGAA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4587-1T>A	3.37:g.47155493A>T		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	12.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	A	18.45	3.625943	0.66901	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.81659	-1.52	5.44	5.44	0.79542	AWS (2);	0.000000	0.56097	D	0.000039	T	0.74191	0.3684	L	0.39566	1.225	0.80722	D	1	B;B	0.31009	0.303;0.303	B;B	0.27262	0.078;0.078	T	0.74244	-0.3728	10	0.52906	T	0.07	.	15.7674	0.78138	1.0:0.0:0.0:0.0	.	1530;1530	F2Z317;Q9BYW2	.;SETD2_HUMAN	T	1530	ENSP00000386759:S1530T	ENSP00000386759:S1530T	S	-	1	0	SETD2	47130497	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.883000	0.92426	2.188000	0.69820	0.477000	0.44152	TCT	.		0.353	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	Missense_Mutation
SH3RF3	344558	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	109964184	109964184	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:109964184C>A	ENST00000309415.6	+	2	628	c.628C>A	c.(628-630)Cct>Act	p.P210T		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	210	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						GGGGAAGGAACCTGGTGACCT	0.597																																					p.P210T		.											.	SH3RF3	24	0			c.C628A						.						58.0	62.0	61.0					2																	109964184		2142	4240	6382	SO:0001583	missense	344558	exon2			AAGGAACCTGGTG	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.628C>A	2.37:g.109964184C>A	ENSP00000309186:p.Pro210Thr	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	9.0	NM_001099289	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	37		.	.	.	.	.	.	.	.	.	.	C	18.27	3.587937	0.66105	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.31769	1.48;1.48	4.92	4.92	0.64577	Src homology-3 domain (4);	.	.	.	.	T	0.56572	0.1994	.	.	.	0.58432	D	0.999999	D	0.54207	0.965	D	0.69142	0.962	T	0.58578	-0.7612	8	0.48119	T	0.1	.	18.1181	0.89563	0.0:1.0:0.0:0.0	.	210	Q8TEJ3	SH3R3_HUMAN	T	210	ENSP00000414997:P210T;ENSP00000309186:P210T	ENSP00000309186:P210T	P	+	1	0	SH3RF3	109330616	1.000000	0.71417	0.608000	0.28969	0.362000	0.29581	6.068000	0.71201	2.267000	0.75376	0.484000	0.47621	CCT	.		0.597	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
SIGLEC15	284266	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	18	43418741	43418741	+	Silent	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr18:43418741G>T	ENST00000389474.3	+	4	772	c.555G>T	c.(553-555)gcG>gcT	p.A185A	SIGLEC15_ENST00000546268.1_Silent_p.A31A|SIGLEC15_ENST00000587418.1_5'UTR|SIGLEC15_ENST00000602118.2_3'UTR	NM_213602.2	NP_998767.1	Q6ZMC9	SIG15_HUMAN	sialic acid binding Ig-like lectin 15	185	Ig-like C2-type.				cellular response to lipoprotein particle stimulus (GO:0071402)|innate immune response (GO:0045087)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of bone resorption (GO:0045124)|regulation of osteoclast development (GO:2001204)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)				endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						CCTTCCGCGCGCTCTGCACTG	0.736																																					p.A185A		.											.	SIGLEC15	90	0			c.G555T						.						6.0	7.0	7.0					18																	43418741		2114	4146	6260	SO:0001819	synonymous_variant	284266	exon4			CCGCGCGCTCTGC	AK095432	CCDS32819.1	18q21.1	2014-01-28	2007-05-31	2007-05-31	ENSG00000197046	ENSG00000197046		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27596	protein-coding gene	gene with protein product			"""CD33 antigen-like 3"", ""CD33 molecule-like 3"""	CD33L3		17483134	Standard	NM_213602		Approved	HsT1361	uc002lbl.1	Q6ZMC9		ENST00000389474.3:c.555G>T	18.37:g.43418741G>T		Somatic	13.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	7.0	NM_213602	A8K2Y5|B4DVQ9	Silent	SNP	ENST00000389474.3	37	CCDS32819.1																																																																																			.		0.736	SIGLEC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410768.2	NM_213602	
SLC17A1	6568	hgsc.bcm.edu;bcgsc.ca	37	6	25811666	25811666	+	Silent	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:25811666A>G	ENST00000244527.4	-	10	1253	c.1138T>C	c.(1138-1140)Ttg>Ctg	p.L380L	SLC17A1_ENST00000427328.1_Silent_p.L326L|SLC17A1_ENST00000476801.1_Silent_p.L380L|SLC17A1_ENST00000468082.1_Silent_p.L326L	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	380					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						ACTCCACCCAAGCAAAAGCTG	0.383																																					p.L380L		.											.	SLC17A1	94	0			c.T1138C						.						144.0	149.0	147.0					6																	25811666		2203	4300	6503	SO:0001819	synonymous_variant	6568	exon10			CACCCAAGCAAAA		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.1138T>C	6.37:g.25811666A>G		Somatic	250.0	0.0		WXS	Illumina HiSeq	Phase_I	395.0	26.0	NM_005074	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Silent	SNP	ENST00000244527.4	37	CCDS4565.1																																																																																			.		0.383	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2		
SLC17A1	6568	hgsc.bcm.edu;bcgsc.ca	37	6	25811734	25811734	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:25811734T>C	ENST00000244527.4	-	10	1185	c.1070A>G	c.(1069-1071)tAc>tGc	p.Y357C	SLC17A1_ENST00000427328.1_Missense_Mutation_p.Y303C|SLC17A1_ENST00000476801.1_Missense_Mutation_p.Y357C|SLC17A1_ENST00000468082.1_Missense_Mutation_p.Y303C	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	357					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						GGAACTCAGGTAAGGCAGGCA	0.453																																					p.Y357C		.											.	SLC17A1	94	0			c.A1070G						.						107.0	109.0	108.0					6																	25811734		2203	4300	6503	SO:0001583	missense	6568	exon10			CTCAGGTAAGGCA		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.1070A>G	6.37:g.25811734T>C	ENSP00000244527:p.Tyr357Cys	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	278.0	38.0	NM_005074	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Missense_Mutation	SNP	ENST00000244527.4	37	CCDS4565.1	.	.	.	.	.	.	.	.	.	.	T	11.32	1.603645	0.28534	.	.	ENSG00000124568	ENST00000244527;ENST00000427328;ENST00000476801;ENST00000468082	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	3.49	2.3	0.28687	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.642833	0.12914	N	0.428672	T	0.63850	0.2546	M	0.84948	2.725	0.19300	N	0.999978	D;D	0.71674	0.996;0.998	D;D	0.70487	0.923;0.969	T	0.53158	-0.8478	10	0.87932	D	0	.	6.905	0.24303	0.0:0.0:0.2367:0.7633	.	303;357	Q14916-2;Q14916	.;NPT1_HUMAN	C	357;303;357;303	ENSP00000244527:Y357C;ENSP00000410549:Y303C;ENSP00000420614:Y357C;ENSP00000420546:Y303C	ENSP00000244527:Y357C	Y	-	2	0	SLC17A1	25919713	0.000000	0.05858	0.265000	0.24526	0.142000	0.21351	-0.060000	0.11712	0.689000	0.31550	0.533000	0.62120	TAC	.		0.453	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2		
SLC29A1	2030	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	44198616	44198616	+	Silent	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr6:44198616C>T	ENST00000393841.1	+	9	1247	c.756C>T	c.(754-756)ctC>ctT	p.L252L	SLC29A1_ENST00000427851.2_Silent_p.L252L|SLC29A1_ENST00000371724.1_Silent_p.L252L|SLC29A1_ENST00000393844.1_Silent_p.L252L|SLC29A1_ENST00000371755.3_Silent_p.L252L|SLC29A1_ENST00000371713.1_Silent_p.L252L|SLC29A1_ENST00000313248.7_Silent_p.L331L|SLC29A1_ENST00000371740.5_Silent_p.L252L|SLC29A1_ENST00000371708.1_Silent_p.L252L|SLC29A1_ENST00000371731.1_Silent_p.L252L|SLC29A1_ENST00000472176.1_3'UTR	NM_001078177.1	NP_001071645.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1	252					cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	AGTTGGACCTCATTAGCAAAG	0.542																																					p.L252L		.											.	SLC29A1	154	0			c.C756T						.						88.0	101.0	97.0					6																	44198616		2203	4300	6503	SO:0001819	synonymous_variant	2030	exon8			GGACCTCATTAGC	U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393841.1:c.756C>T	6.37:g.44198616C>T		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	53.0	NM_004955	B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	Silent	SNP	ENST00000393841.1	37	CCDS4908.1																																																																																			.		0.542	SLC29A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040721.1		
SLC2A11	66035	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24224833	24224833	+	Splice_Site	SNP	G	G	T	rs199527068		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr22:24224833G>T	ENST00000345044.6	+	7	1141	c.873G>T	c.(871-873)tcG>tcT	p.S291S	SLC2A11_ENST00000467660.1_3'UTR|SLC2A11_ENST00000316185.8_Splice_Site_p.S294S|SLC2A11_ENST00000398356.2_Splice_Site_p.S298S|RN7SL268P_ENST00000491172.2_RNA|AP000350.10_ENST00000433835.3_Intron			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11	291					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						GGAATGACTCGGTGAGACCCC	0.692																																					p.S298S		.											.	SLC2A11	91	0			c.G894T						.						23.0	20.0	21.0					22																	24224833		2202	4298	6500	SO:0001630	splice_region_variant	66035	exon8			TGACTCGGTGAGA	AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.873+1G>T	22.37:g.24224833G>T		Somatic	32.0	1.0		WXS	Illumina HiSeq	Phase_I	47.0	27.0	NM_030807	E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	Silent	SNP	ENST00000345044.6	37	CCDS46673.1	.	.	.	.	.	.	.	.	.	.	G	6.071	0.381465	0.11524	.	.	ENSG00000251357	ENST00000502845	.	.	.	4.12	2.98	0.34508	.	.	.	.	.	T	0.60919	0.2306	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58999	-0.7536	4	.	.	.	.	11.4007	0.49868	0.0:0.1856:0.8143:0.0	.	.	.	.	L	63	.	.	R	+	2	0	AP000350.10	22554833	0.998000	0.40836	0.932000	0.37286	0.068000	0.16541	0.744000	0.26245	2.252000	0.74401	0.597000	0.82753	CGG	G|0.999;A|0.000		0.692	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319889.3	NM_030807	Silent
SLC35A5	55032	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	112300032	112300032	+	Silent	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:112300032C>T	ENST00000492406.1	+	6	1351	c.1068C>T	c.(1066-1068)tcC>tcT	p.S356S	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	356					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						TCAGGCCCTCCCTGGAATTTT	0.453																																					p.S356S		.											.	SLC35A5	91	0			c.C1068T						.						65.0	66.0	65.0					3																	112300032		2203	4299	6502	SO:0001819	synonymous_variant	55032	exon6			GCCCTCCCTGGAA	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.1068C>T	3.37:g.112300032C>T		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	44.0	NM_017945	D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Silent	SNP	ENST00000492406.1	37	CCDS2967.1																																																																																			.		0.453	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354184.1	NM_017945	
SLC4A10	57282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	162719562	162719562	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:162719562G>T	ENST00000446997.1	+	6	849	c.756G>T	c.(754-756)atG>atT	p.M252I	SLC4A10_ENST00000375514.5_Missense_Mutation_p.M263I|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000415876.2_Missense_Mutation_p.M252I|SLC4A10_ENST00000272716.5_Missense_Mutation_p.M252I|SLC4A10_ENST00000535165.1_Missense_Mutation_p.M252I|SLC4A10_ENST00000421911.1_Missense_Mutation_p.M252I	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	252					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	CAAATTCCATGGACAAAAATG	0.338																																					p.M263I		.											.	SLC4A10	229	0			c.G789T						.						72.0	78.0	76.0					2																	162719562		1865	4123	5988	SO:0001583	missense	57282	exon7			TTCCATGGACAAA		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.756G>T	2.37:g.162719562G>T	ENSP00000393066:p.Met252Ile	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	92.0	NM_001178016	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	37	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	G	17.09	3.300954	0.60195	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2	5.81	5.81	0.92471	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.035707	0.85682	D	0.000000	T	0.60971	0.2310	L	0.54908	1.71	0.58432	D	0.999999	B;B;B;B	0.06786	0.0;0.001;0.0;0.001	B;B;B;B	0.15870	0.005;0.001;0.005;0.014	T	0.53788	-0.8389	10	0.30078	T	0.28	.	19.6853	0.95977	0.0:0.0:1.0:0.0	.	263;252;252;252	F8W675;E7EW28;Q6U841-2;Q6U841	.;.;.;S4A10_HUMAN	I	263;252;252;252;252;252;252;252	ENSP00000364664:M263I;ENSP00000395797:M252I;ENSP00000437527:M252I;ENSP00000272716:M252I;ENSP00000393066:M252I;ENSP00000404486:M252I	ENSP00000272716:M252I	M	+	3	0	SLC4A10	162427808	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.799000	0.85936	2.759000	0.94783	0.591000	0.81541	ATG	.		0.338	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
SLC4A8	9498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	51890828	51890828	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:51890828C>G	ENST00000453097.2	+	22	3218	c.3001C>G	c.(3001-3003)Ctg>Gtg	p.L1001V	SLC4A8_ENST00000358657.3_Missense_Mutation_p.L1028V	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		TAAGCGAGAGCTGAGCTGGCT	0.408																																					p.L1001V		.											.	SLC4A8	95	0			c.C3001G						.						101.0	101.0	101.0					12																	51890828		2203	4300	6503	SO:0001583	missense	9498	exon22			CGAGAGCTGAGCT	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.3001C>G	12.37:g.51890828C>G	ENSP00000405812:p.Leu1001Val	Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	16.0	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	37	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188195	0.78789	.	.	ENSG00000050438	ENST00000358657;ENST00000453097;ENST00000319957;ENST00000551071	T;T	0.78364	-1.17;-1.17	5.63	4.74	0.60224	.	0.000000	0.85682	D	0.000000	D	0.86310	0.5902	M	0.84773	2.715	0.80722	D	1	D;D;B	0.58268	0.982;0.974;0.446	P;P;P	0.56278	0.775;0.795;0.552	D	0.88515	0.3092	10	0.66056	D	0.02	.	13.9884	0.64350	0.0:0.9257:0.0:0.0743	.	1028;1001;1001	Q2Y0W8-2;Q2Y0W8;Q2Y0W8-3	.;S4A8_HUMAN;.	V	1028;1001;1001;948	ENSP00000351483:L1028V;ENSP00000405812:L1001V	ENSP00000315789:L1001V	L	+	1	2	SLC4A8	50177095	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.968000	0.70413	1.528000	0.49103	-0.150000	0.13652	CTG	.		0.408	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
SLC9A3	6550	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	475176	475176	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:475176G>T	ENST00000264938.3	-	16	2332	c.2323C>A	c.(2323-2325)Ctg>Atg	p.L775M	CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.7_ENST00000607005.1_RNA|CTD-2228K2.5_ENST00000510714.1_5'Flank|SLC9A3_ENST00000514375.1_Missense_Mutation_p.L766M|CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.7_ENST00000607286.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	775					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CCGGGAGACAGCCAGGGCGGC	0.677																																					p.L775M		.											.	SLC9A3	90	0			c.C2323A						.						27.0	34.0	32.0					5																	475176		2202	4298	6500	SO:0001583	missense	6550	exon16			GAGACAGCCAGGG		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2323C>A	5.37:g.475176G>T	ENSP00000264938:p.Leu775Met	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	44.0	NM_004174	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851622	0.51270	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.74737	-0.87;-0.87	4.81	1.46	0.22682	.	7.006960	0.00357	N	0.000021	D	0.83640	0.5298	M	0.75264	2.295	0.29344	N	0.865825	D;D	0.71674	0.998;0.981	P;P	0.61658	0.892;0.77	T	0.62020	-0.6942	10	0.34782	T	0.22	.	7.2475	0.26129	0.2229:0.0:0.6406:0.1366	.	766;775	E9PF67;P48764	.;SL9A3_HUMAN	M	775;766	ENSP00000264938:L775M;ENSP00000422983:L766M	ENSP00000264938:L775M	L	-	1	2	SLC9A3	528176	0.999000	0.42202	0.988000	0.46212	0.957000	0.61999	1.019000	0.30014	0.436000	0.26393	0.462000	0.41574	CTG	.		0.677	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
SLC6A3	6531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	1406399	1406399	+	Silent	SNP	A	A	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:1406399A>T	ENST00000270349.9	-	12	1630	c.1503T>A	c.(1501-1503)gtT>gtA	p.V501V	SLC6A3_ENST00000453492.2_Silent_p.V501V	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	501					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	TGAACTGCCCAACACCTGAGG	0.637																																					p.V501V		.											.	SLC6A3	157	0			c.T1503A						.						74.0	68.0	70.0					5																	1406399		2203	4300	6503	SO:0001819	synonymous_variant	6531	exon12			CTGCCCAACACCT		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1503T>A	5.37:g.1406399A>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	27.0	NM_001044	A2RUN4|Q14996	Silent	SNP	ENST00000270349.9	37	CCDS3863.1																																																																																			.		0.637	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
SNTG2	54221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	1241790	1241790	+	Splice_Site	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr2:1241790G>A	ENST00000308624.5	+	10	978		c.e10+1		SNTG2_ENST00000407292.1_Splice_Site	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		ACTTCAGAACGTGAGCACACG	0.507																																					.		.											.	SNTG2	136	0			c.849+1G>A						.						33.0	37.0	35.0					2																	1241790		2181	4273	6454	SO:0001630	splice_region_variant	54221	exon10			CAGAACGTGAGCA	AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.849+1G>A	2.37:g.1241790G>A		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	15.0	NM_018968	Q05AH5	Splice_Site	SNP	ENST00000308624.5	37	CCDS46220.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005186	0.35415	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0898	0.72185	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SNTG2	1224341	1.000000	0.71417	0.879000	0.34478	0.125000	0.20455	7.070000	0.76763	2.214000	0.71695	0.655000	0.94253	.	.		0.507	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322454.1	NM_018968	Intron
SORCS2	57537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	7705958	7705958	+	Silent	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr4:7705958G>T	ENST00000507866.2	+	14	1924	c.1815G>T	c.(1813-1815)tcG>tcT	p.S605S	SORCS2_ENST00000329016.9_Silent_p.S433S	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	605					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						CCAGCACCTCGGTGTTTGTGG	0.637																																					p.S605S		.											.	SORCS2	91	0			c.G1815T						.						50.0	59.0	56.0					4																	7705958		2134	4233	6367	SO:0001819	synonymous_variant	57537	exon14			CACCTCGGTGTTT	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.1815G>T	4.37:g.7705958G>T		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	24.0	NM_020777	Q9P2L7	Silent	SNP	ENST00000507866.2	37	CCDS47008.1																																																																																			.		0.637	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	
SPOCD1	90853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32256443	32256443	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:32256443G>A	ENST00000360482.2	-	16	3541	c.3412C>T	c.(3412-3414)Cac>Tac	p.H1138Y	SPOCD1_ENST00000373648.2_3'UTR|SPOCD1_ENST00000257100.3_Missense_Mutation_p.H618Y|SPOCD1_ENST00000533231.1_Missense_Mutation_p.H1125Y|RP11-84A19.3_ENST00000527035.1_RNA	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	1138					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CTGTGGAAGTGCTGGCCACGG	0.647																																					p.H1138Y		.											.	SPOCD1	158	0			c.C3412T						.						20.0	20.0	20.0					1																	32256443		2190	4289	6479	SO:0001583	missense	90853	exon16			GGAAGTGCTGGCC	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.3412C>T	1.37:g.32256443G>A	ENSP00000353670:p.His1138Tyr	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	49.0	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371525	0.42003	.	.	ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000452755;ENST00000533231	T;T;T;T	0.52983	0.66;1.69;0.64;1.68	5.06	1.84	0.25277	.	.	.	.	.	T	0.28499	0.0705	L	0.29908	0.895	0.80722	D	1	B;B;B	0.32653	0.379;0.022;0.261	B;B;B	0.28553	0.091;0.008;0.042	T	0.17349	-1.0372	9	0.87932	D	0	-11.6897	2.7397	0.05250	0.0996:0.1711:0.5199:0.2093	.	1125;561;1138	Q6ZMY3-2;E9PPM7;Q6ZMY3	.;.;SPOC1_HUMAN	Y	618;1138;561;1125	ENSP00000257100:H618Y;ENSP00000353670:H1138Y;ENSP00000399778:H561Y;ENSP00000435851:H1125Y	ENSP00000257100:H618Y	H	-	1	0	SPOCD1	32029030	0.977000	0.34250	0.996000	0.52242	0.960000	0.62799	0.707000	0.25704	0.741000	0.32674	0.655000	0.94253	CAC	.		0.647	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
SSPO	23145	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	149523554	149523554	+	RNA	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:149523554A>G	ENST00000378016.2	+	0	14468							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCCCCTGGCCAGGTGCTTAGT	0.672																																					p.Q4822R		.											.	.	.	0			c.A14465G						.						24.0	28.0	27.0					7																	149523554		2120	4243	6363			23145	exon102			CTGGCCAGGTGCT	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149523554A>G		Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	10.0	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				.		0.672	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
TAS1R1	80835	broad.mit.edu;mdanderson.org	37	1	6635435	6635435	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr1:6635435C>T	ENST00000333172.6	+	3	1436	c.1243C>T	c.(1243-1245)Cga>Tga	p.R415*	TAS1R1_ENST00000351136.3_Intron|TAS1R1_ENST00000328191.4_Nonsense_Mutation_p.R415*	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	415					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TTCCAGGGGCCGAGTCTACCC	0.617																																					p.R415X		.											.	TAS1R1	516	0			c.C1243T						.						22.0	22.0	22.0					1																	6635435		2019	3993	6012	SO:0001587	stop_gained	80835	exon3			AGGGGCCGAGTCT		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.1243C>T	1.37:g.6635435C>T	ENSP00000331867:p.Arg415*	Somatic	62.0	1.0		WXS	Illumina HiSeq	Phase_I	44.0	32.0	NM_138697	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Nonsense_Mutation	SNP	ENST00000333172.6	37	CCDS81.1	.	.	.	.	.	.	.	.	.	.	C	38	6.741260	0.97805	.	.	ENSG00000173662	ENST00000333172;ENST00000328191	.	.	.	5.45	2.09	0.27110	.	2.077350	0.02803	N	0.123382	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	.	3.0858	0.06277	0.1772:0.5431:0.1119:0.1678	.	.	.	.	X	415	.	ENSP00000327705:R415X	R	+	1	2	TAS1R1	6558022	0.000000	0.05858	0.001000	0.08648	0.899000	0.52679	-0.112000	0.10791	0.624000	0.30286	0.591000	0.81541	CGA	.		0.617	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004211.1		
TBC1D16	125058	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	77922702	77922702	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:77922702C>A	ENST00000310924.2	-	8	1625	c.1510G>T	c.(1510-1512)Ggg>Tgg	p.G504W	TBC1D16_ENST00000340848.7_Missense_Mutation_p.G142W|TBC1D16_ENST00000572862.1_Missense_Mutation_p.G142W|TBC1D16_ENST00000576768.1_Missense_Mutation_p.G129W|TBC1D16_ENST00000570373.1_Missense_Mutation_p.G143W	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	504	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			TTGTCTTCCCCCCGGAAGAAC	0.572																																					p.G504W	Ovarian(14;397 562 4850 31922 49378)	.											.	TBC1D16	90	0			c.G1510T						.						224.0	179.0	194.0					17																	77922702		2203	4300	6503	SO:0001583	missense	125058	exon8			CTTCCCCCCGGAA	AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1510G>T	17.37:g.77922702C>A	ENSP00000309794:p.Gly504Trp	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	16.0	NM_019020	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	SNP	ENST00000310924.2	37	CCDS11766.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255432	0.80135	.	.	ENSG00000167291	ENST00000340848;ENST00000310924	T;T	0.11604	2.76;2.76	5.18	4.21	0.49690	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.44644	0.1303	H	0.95504	3.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	T	0.60900	-0.7171	10	0.87932	D	0	-38.0032	13.3375	0.60526	0.0:0.9239:0.0:0.076	.	164;504;504;142	Q96DH7;Q8TBP0;B9A6L7;Q8N3Z4	.;TBC16_HUMAN;.;.	W	142;504	ENSP00000341517:G142W;ENSP00000309794:G504W	ENSP00000309794:G504W	G	-	1	0	TBC1D16	75537297	1.000000	0.71417	0.326000	0.25389	0.860000	0.49131	7.454000	0.80714	1.164000	0.42652	0.655000	0.94253	GGG	.		0.572	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437145.1	NM_019020	
TBX5	6910	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	114823367	114823367	+	Silent	SNP	C	C	A	rs376519728		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:114823367C>A	ENST00000310346.4	-	7	1335	c.669G>T	c.(667-669)acG>acT	p.T223T	TBX5_ENST00000405440.2_Silent_p.T223T|TBX5_ENST00000526441.1_Silent_p.T223T|TBX5_ENST00000349716.5_Silent_p.T173T	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	223					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.T223T(2)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		TCTTTAATTGCGTGATCTGAA	0.418																																					p.T223T	NSCLC(152;1358 1980 4050 23898 40356)	.											.	TBX5	98	2	Substitution - coding silent(2)	lung(2)	c.G669T						.						106.0	94.0	98.0					12																	114823367		2203	4300	6503	SO:0001819	synonymous_variant	6910	exon7			TAATTGCGTGATC	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.669G>T	12.37:g.114823367C>A		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	17.0	NM_000192	A6ND77|O15301|Q96TB0|Q9Y4I2	Silent	SNP	ENST00000310346.4	37	CCDS9173.1																																																																																			.		0.418	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388297.1	NM_080717	
TG	7038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133899348	133899348	+	Missense_Mutation	SNP	C	C	A	rs369032480		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr8:133899348C>A	ENST00000220616.4	+	9	1771	c.1731C>A	c.(1729-1731)ttC>ttA	p.F577L	TG_ENST00000377869.1_Missense_Mutation_p.F577L	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	577					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TTCCAGAATTCCTTCTCTTCT	0.458																																					p.F577L		.											.	TG	145	0			c.C1731A						.						105.0	102.0	103.0					8																	133899348		2203	4300	6503	SO:0001583	missense	7038	exon9			AGAATTCCTTCTC	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1731C>A	8.37:g.133899348C>A	ENSP00000220616:p.Phe577Leu	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	246.0	63.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066703	0.55539	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.70282	-0.47;-0.43	5.02	1.99	0.26369	.	0.000000	0.64402	D	0.000002	T	0.72598	0.3480	L	0.34521	1.04	0.29138	N	0.879212	D	0.76494	0.999	D	0.77004	0.989	T	0.66228	-0.5976	10	0.87932	D	0	.	8.5533	0.33465	0.0:0.6621:0.0:0.3378	.	577	P01266	THYG_HUMAN	L	577	ENSP00000367100:F577L;ENSP00000220616:F577L	ENSP00000220616:F577L	F	+	3	2	TG	133968530	0.998000	0.40836	1.000000	0.80357	0.719000	0.41307	0.924000	0.28777	0.684000	0.31448	0.650000	0.86243	TTC	.		0.458	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TMEM132C	92293	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	128899810	128899810	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr12:128899810G>C	ENST00000435159.2	+	2	619	c.619G>C	c.(619-621)Gcc>Ccc	p.A207P		NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	207						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CTGGTTCAGTGCCCCGACGGT	0.657																																					p.A207P		.											.	TMEM132C	68	0			c.G619C						.						21.0	26.0	25.0					12																	128899810		692	1591	2283	SO:0001583	missense	92293	exon2			TTCAGTGCCCCGA	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.619G>C	12.37:g.128899810G>C	ENSP00000410852:p.Ala207Pro	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	52.0	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		.	.	.	.	.	.	.	.	.	.	g	0.005	-2.187633	0.00305	.	.	ENSG00000181234	ENST00000435159	T	0.42900	0.96	5.08	-5.77	0.02369	.	.	.	.	.	T	0.07143	0.0181	N	0.00186	-1.895	0.09310	N	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.31336	-0.9947	9	0.02654	T	1	.	5.9061	0.19002	0.2881:0.3507:0.3021:0.0591	.	207	Q8N3T6	T132C_HUMAN	P	207	ENSP00000410852:A207P	ENSP00000410852:A207P	A	+	1	0	TMEM132C	127465763	0.005000	0.15991	0.001000	0.08648	0.000000	0.00434	0.317000	0.19487	-1.130000	0.02914	-2.651000	0.00149	GCC	.		0.657	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
TMPRSS15	5651	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	19687499	19687499	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr21:19687499G>C	ENST00000284885.3	-	17	2029	c.1996C>G	c.(1996-1998)Ctg>Gtg	p.L666V		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	666	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCACAGTGCAGATGACCGTCA	0.403																																					p.L666V		.											.	TMPRSS15	160	0			c.C1996G						.						171.0	140.0	150.0					21																	19687499		2203	4300	6503	SO:0001583	missense	5651	exon17			AGTGCAGATGACC		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.1996C>G	21.37:g.19687499G>C	ENSP00000284885:p.Leu666Val	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	38.0	NM_002772	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	G	0.202	-1.043668	0.01997	.	.	ENSG00000154646	ENST00000284885	D	0.95307	-3.67	5.27	1.35	0.21983	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.815167	0.11580	N	0.549832	D	0.82536	0.5058	N	0.04148	-0.265	0.09310	N	1	B	0.09022	0.002	B	0.13407	0.009	T	0.69899	-0.5020	9	.	.	.	.	2.9886	0.05975	0.1604:0.1416:0.5517:0.1463	.	666	P98073	ENTK_HUMAN	V	666	ENSP00000284885:L666V	.	L	-	1	2	TMPRSS15	18609370	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.074000	0.14662	0.071000	0.16664	-0.181000	0.13052	CTG	.		0.403	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	7578188	7578188	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:7578188C>A	ENST00000269305.4	-	6	850	c.661G>T	c.(661-663)Gag>Tag	p.E221*	TP53_ENST00000445888.2_Nonsense_Mutation_p.E221*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E221*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E221*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E221*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.E221*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	221	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E221*(14)|p.?(11)|p.0?(8)|p.E221fs*4(3)|p.E128*(3)|p.E221K(2)|p.Y220_P223delYEPP(1)|p.E221fs*2(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y220fs*25(1)|p.E221fs*26(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCAGGCGGCTCATAGGGCACC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E221X	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,+2	TP53	70225	48	Substitution - Nonsense(17)|Unknown(11)|Whole gene deletion(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Insertion - Frameshift(3)|Substitution - Missense(2)	upper_aerodigestive_tract(9)|biliary_tract(5)|endometrium(5)|urinary_tract(5)|lung(5)|bone(4)|central_nervous_system(3)|oesophagus(2)|ovary(2)|vulva(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|salivary_gland(1)|breast(1)|skin(1)|large_intestine(1)|liver(1)	c.G661T						.						100.0	92.0	94.0					17																	7578188		2203	4300	6503	SO:0001587	stop_gained	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCGGCTCATAGGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.661G>T	17.37:g.7578188C>A	ENSP00000269305:p.Glu221*	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	64.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	34	5.353387	0.95830	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.31	0.51392	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.6014	12.2235	0.54447	0.0:0.9162:0.0:0.0838	.	.	.	.	X	221;221;221;221;221;221;210;128;89;128	.	ENSP00000269305:E221X	E	-	1	0	TP53	7518913	1.000000	0.71417	0.299000	0.25016	0.996000	0.88848	6.045000	0.71020	1.364000	0.46038	0.563000	0.77884	GAG	.		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRAPPC10	7109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45504036	45504036	+	Silent	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr21:45504036C>T	ENST00000291574.4	+	15	2447	c.2272C>T	c.(2272-2274)Ctg>Ttg	p.L758L		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	758					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						ACTCAGGCAGCTGTGCGCCTC	0.567																																					p.L758L		.											.	TRAPPC10	92	0			c.C2272T						.						93.0	69.0	77.0					21																	45504036		2203	4300	6503	SO:0001819	synonymous_variant	7109	exon15			AGGCAGCTGTGCG	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.2272C>T	21.37:g.45504036C>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	20.0	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Silent	SNP	ENST00000291574.4	37	CCDS13704.1																																																																																			.		0.567	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
TRPC7	57113	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	135561777	135561777	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:135561777T>A	ENST00000513104.1	-	9	2489	c.2207A>T	c.(2206-2208)aAg>aTg	p.K736M	TRPC7_ENST00000426057.2_Missense_Mutation_p.K620M|TRPC7_ENST00000355180.3_Missense_Mutation_p.K675M	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	736					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCTTTTGGCCTTAGATTTGCA	0.408																																					p.K736M		.											.	.	.	0			c.A2207T						.						86.0	78.0	80.0					5																	135561777		1909	4119	6028	SO:0001583	missense	57113	exon9			TTGGCCTTAGATT	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.2207A>T	5.37:g.135561777T>A	ENSP00000426070:p.Lys736Met	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	50.0	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	37	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.61|18.61	3.661672|3.661672	0.67700|0.67700	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193|ENST00000352189;ENST00000378459;ENST00000502753	D;D;D|.	0.81821|.	-1.54;-1.54;-1.54|.	4.99|4.99	4.99|4.99	0.66335|0.66335	.|.	0.120318|.	0.64402|.	D|.	0.000014|.	T|.	0.68467|.	0.3004|.	L|L	0.55213|0.55213	1.73|1.73	0.43076|0.43076	D|D	0.994728|0.994728	D;B;B;B|.	0.54397|.	0.966;0.104;0.444;0.444|.	P;B;B;B|.	0.52554|.	0.702;0.089;0.401;0.401|.	T|.	0.67741|.	-0.5592|.	10|.	0.66056|.	D|.	0.02|.	-24.4053|-24.4053	14.8563|14.8563	0.70341|0.70341	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	620;675;681;736|.	Q8IWP7;F5H5U9;Q70T25;Q9HCX4|.	.;.;.;TRPC7_HUMAN|.	M|Y	675;620;736;736|619;674;680	ENSP00000347312:K675M;ENSP00000441628:K620M;ENSP00000426070:K736M|.	ENSP00000265193:K736M|.	K|X	-|-	2|3	0|2	TRPC7|TRPC7	135589676|135589676	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.785000|3.785000	0.55424|0.55424	2.094000|2.094000	0.63399|0.63399	0.482000|0.482000	0.46254|0.46254	AAG|TAA	.		0.408	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
TRPM3	80036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	73151774	73151774	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr9:73151774T>C	ENST00000377110.3	-	25	4462	c.4219A>G	c.(4219-4221)Atg>Gtg	p.M1407V	TRPM3_ENST00000357533.2_Missense_Mutation_p.M1411V|TRPM3_ENST00000396285.1_Missense_Mutation_p.M1266V|TRPM3_ENST00000423814.3_Missense_Mutation_p.M1434V|TRPM3_ENST00000377106.1_Missense_Mutation_p.M1279V|TRPM3_ENST00000360823.2_Missense_Mutation_p.M1269V|TRPM3_ENST00000396292.4_Missense_Mutation_p.M1279V|TRPM3_ENST00000358082.3_Missense_Mutation_p.M1269V|TRPM3_ENST00000396280.5_Missense_Mutation_p.M1256V|TRPM3_ENST00000377105.1_Missense_Mutation_p.M1266V|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000408909.2_Missense_Mutation_p.M1266V			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1432					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						AGCTCATCCATAGCAGAGACA	0.512																																					p.M1407V		.											.	TRPM3	521	0			c.A4219G						.						109.0	103.0	105.0					9																	73151774		2203	4300	6503	SO:0001583	missense	80036	exon25			CATCCATAGCAGA	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4219A>G	9.37:g.73151774T>C	ENSP00000366314:p.Met1407Val	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	50.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377110.3	37	CCDS43835.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.483|9.483	1.098784|1.098784	0.20552|0.20552	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814|ENST00000396280	T;T;T;T;T;T;T;T;T;T|.	0.54479|.	0.65;0.6;0.6;0.57;0.65;0.57;0.6;0.6;0.6;0.64|.	6.02|6.02	6.02|6.02	0.97574|0.97574	.|.	0.143086|.	0.64402|.	D|.	0.000004|.	T|T	0.48572|0.48572	0.1507|0.1507	N|N	0.24115|0.24115	0.695|0.695	0.32656|0.32656	N|N	0.518694|0.518694	B;B;B;B;B;B;B|.	0.33318|.	0.091;0.131;0.118;0.055;0.408;0.091;0.055|.	B;B;B;B;B;B;B|.	0.31337|.	0.051;0.046;0.049;0.023;0.128;0.035;0.016|.	T|T	0.56872|0.56872	-0.7907|-0.7907	10|5	0.27082|.	T|.	0.32|.	-31.395|-31.395	16.5446|16.5446	0.84426|0.84426	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1407;1397;1411;1269;1266;1379;1266|.	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3|.	.;.;.;.;.;.;.|.	V|C	1407;1279;1269;1266;1411;1266;1266;1279;1269;1434|1255	ENSP00000366314:M1407V;ENSP00000366310:M1279V;ENSP00000354066:M1269V;ENSP00000366309:M1266V;ENSP00000350140:M1411V;ENSP00000386127:M1266V;ENSP00000379581:M1266V;ENSP00000379587:M1279V;ENSP00000350791:M1269V;ENSP00000389542:M1434V|.	ENSP00000350140:M1411V|.	M|Y	-|-	1|2	0|0	TRPM3|TRPM3	72341594|72341594	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.680000|5.680000	0.68168|0.68168	2.311000|2.311000	0.77944|0.77944	0.533000|0.533000	0.62120|0.62120	ATG|TAT	.		0.512	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	NM_206945	
TSC22D2	9819	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	150127752	150127752	+	Silent	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:150127752C>T	ENST00000361875.3	+	1	1631	c.615C>T	c.(613-615)agC>agT	p.S205S	TSC22D2_ENST00000361136.2_Silent_p.S205S	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	205					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TTAGACACAGCAGTACTTTTG	0.617																																					p.S205S		.											.	TSC22D2	91	0			c.C615T						.						81.0	83.0	82.0					3																	150127752		2203	4300	6503	SO:0001819	synonymous_variant	9819	exon1			ACACAGCAGTACT	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.615C>T	3.37:g.150127752C>T		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	26.0	NM_014779	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Silent	SNP	ENST00000361875.3	37	CCDS3149.1																																																																																			.		0.617	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
TTLL9	164395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	30522615	30522615	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr20:30522615C>T	ENST00000375938.4	+	12	1181	c.928C>T	c.(928-930)Cag>Tag	p.Q310*	TTLL9_ENST00000310998.4_Nonsense_Mutation_p.Q275*|TTLL9_ENST00000375934.4_Silent_p.C277C|TTLL9_ENST00000375921.2_Intron|TTLL9_ENST00000375922.4_Nonsense_Mutation_p.Q252*|TTLL9_ENST00000535842.1_Nonsense_Mutation_p.Q310*			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	310	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GCAGAGTGTGCAGAAGGTGAT	0.567																																					p.Q310X		.											.	TTLL9	92	0			c.C928T						.						118.0	118.0	118.0					20																	30522615		2085	4223	6308	SO:0001587	stop_gained	164395	exon12			AGTGTGCAGAAGG	AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.928C>T	20.37:g.30522615C>T	ENSP00000365105:p.Gln310*	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	24.0	NM_001008409	A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Nonsense_Mutation	SNP	ENST00000375938.4	37	CCDS42863.1	.	.	.	.	.	.	.	.	.	.	C	39	7.302232	0.98196	.	.	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000310998;ENST00000375935;ENST00000375922	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	17.4403	0.87563	0.0:1.0:0.0:0.0	.	.	.	.	X	310;310;275;299;252	.	ENSP00000308980:Q275X	Q	+	1	0	TTLL9	29986276	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.857000	0.75455	2.526000	0.85167	0.561000	0.74099	CAG	.		0.567	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001008409	
UBA1	7317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	47065468	47065468	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chrX:47065468A>G	ENST00000335972.6	+	15	1880	c.1697A>G	c.(1696-1698)cAa>cGa	p.Q566R	UBA1_ENST00000490869.1_Intron|UBA1_ENST00000377269.3_5'Flank|INE1_ENST00000456273.1_RNA|UBA1_ENST00000377351.4_Missense_Mutation_p.Q566R	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	566	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GATTTTTTCCAAAACCTAGAT	0.557																																					p.Q566R		.											.	UBA1	227	0			c.A1697G						.						60.0	41.0	47.0					X																	47065468		2203	4300	6503	SO:0001583	missense	7317	exon15			TTTTCCAAAACCT	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.1697A>G	X.37:g.47065468A>G	ENSP00000338413:p.Gln566Arg	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	72.0	NM_153280	Q5JRR8|Q96E13	Missense_Mutation	SNP	ENST00000335972.6	37	CCDS14275.1	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715556	0.48622	.	.	ENSG00000130985	ENST00000377351;ENST00000335972	T;T	0.41400	1.0;1.0	4.61	4.61	0.57282	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.174906	0.49916	D	0.000137	T	0.30510	0.0767	N	0.16656	0.425	0.80722	D	1	B	0.27013	0.166	B	0.33121	0.158	T	0.13737	-1.0498	10	0.42905	T	0.14	-9.2467	12.3648	0.55222	1.0:0.0:0.0:0.0	.	566	P22314	UBA1_HUMAN	R	566	ENSP00000366568:Q566R;ENSP00000338413:Q566R	ENSP00000338413:Q566R	Q	+	2	0	UBA1	46950412	1.000000	0.71417	0.993000	0.49108	0.502000	0.33828	4.124000	0.57924	1.623000	0.50342	0.474000	0.43551	CAA	.		0.557	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056389.1	NM_003334	
UTS2R	2837	bcgsc.ca;mdanderson.org	37	17	80333246	80333246	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:80333246C>A	ENST00000313135.2	+	1	1094	c.1046C>A	c.(1045-1047)gCc>gAc	p.A349D		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	349					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			CAGCCCCGCGCCCGCTTCCAG	0.776																																					p.A349D		.											.	UTS2R	153	0			c.C1046A						.						7.0	8.0	7.0					17																	80333246		1924	3970	5894	SO:0001583	missense	2837	exon1			CCCGCGCCCGCTT	AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.1046C>A	17.37:g.80333246C>A	ENSP00000323516:p.Ala349Asp	Somatic	52.0	2.0		WXS	Illumina HiSeq	Phase_1	25.0	13.0	NM_018949	B2RMV8	Missense_Mutation	SNP	ENST00000313135.2	37	CCDS11810.1	.	.	.	.	.	.	.	.	.	.	C	2.719	-0.266987	0.05754	.	.	ENSG00000181408	ENST00000313135	T	0.69040	-0.37	3.38	-6.76	0.01732	.	0.916550	0.09168	U	0.839303	T	0.32912	0.0845	N	0.08118	0	0.09310	N	1	B	0.23128	0.08	B	0.15052	0.012	T	0.23119	-1.0197	10	0.13108	T	0.6	.	3.8934	0.09128	0.0811:0.4844:0.1782:0.2563	.	349	Q9UKP6	UR2R_HUMAN	D	349	ENSP00000323516:A349D	ENSP00000323516:A349D	A	+	2	0	UTS2R	77926535	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.167000	0.03126	-1.905000	0.01090	-0.810000	0.03169	GCC	.		0.776	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443506.1	NM_018949	
VCAN	1462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	82816787	82816787	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr5:82816787T>A	ENST00000265077.3	+	7	3227	c.2662T>A	c.(2662-2664)Tca>Aca	p.S888T	VCAN_ENST00000342785.4_Missense_Mutation_p.S888T|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.S840T	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	888	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GCCAACTACATCAACTGGTAT	0.388																																					p.S888T		.											.	VCAN	238	0			c.T2662A						.						107.0	111.0	109.0					5																	82816787		2203	4300	6503	SO:0001583	missense	1462	exon7			ACTACATCAACTG	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2662T>A	5.37:g.82816787T>A	ENSP00000265077:p.Ser888Thr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	52.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	37	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.448756	0.26074	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.27104	1.69;1.69;1.69	5.8	-0.797	0.10909	.	0.795307	0.10853	N	0.626997	T	0.17023	0.0409	L	0.60455	1.87	0.09310	N	1	B;P	0.47106	0.417;0.89	B;B	0.38378	0.153;0.272	T	0.19321	-1.0309	10	0.33940	T	0.23	.	0.3142	0.00292	0.2399:0.1797:0.154:0.4264	.	888;888	P13611-3;P13611	.;CSPG2_HUMAN	T	888;888;840	ENSP00000265077:S888T;ENSP00000342768:S888T;ENSP00000425959:S840T	ENSP00000265077:S888T	S	+	1	0	VCAN	82852543	0.001000	0.12720	0.495000	0.27527	0.738000	0.42128	0.426000	0.21363	0.442000	0.26555	0.533000	0.62120	TCA	.		0.388	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
WDR49	151790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	167277885	167277885	+	Silent	SNP	C	C	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr3:167277885C>T	ENST00000308378.3	-	5	923	c.618G>A	c.(616-618)cgG>cgA	p.R206R	WDR49_ENST00000476376.1_Silent_p.R31R|WDR49_ENST00000479765.1_Intron|WDR49_ENST00000453925.2_Silent_p.R259R	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	206										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						CAGTCAAAAGCCGAGTCTCAT	0.458																																					p.R206R		.											.	WDR49	155	0			c.G618A						.						186.0	170.0	175.0					3																	167277885		2203	4300	6503	SO:0001819	synonymous_variant	151790	exon5			CAAAAGCCGAGTC	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.618G>A	3.37:g.167277885C>T		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	35.0	NM_178824	Q8N297	Silent	SNP	ENST00000308378.3	37	CCDS3201.1	.	.	.	.	.	.	.	.	.	.	C	6.840	0.524142	0.13066	.	.	ENSG00000174776	ENST00000472600	.	.	.	4.94	4.06	0.47325	.	.	.	.	.	T	0.69223	0.3087	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68416	-0.5414	4	.	.	.	.	13.8469	0.63472	0.1545:0.8455:0.0:0.0	.	.	.	.	D	271	.	.	G	-	2	0	WDR49	168760579	0.999000	0.42202	0.986000	0.45419	0.665000	0.39181	1.393000	0.34497	1.196000	0.43129	0.591000	0.81541	GGC	.		0.458	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
WDR76	79968	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	44158353	44158353	+	Silent	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr15:44158353G>T	ENST00000263795.6	+	13	1714	c.1644G>T	c.(1642-1644)ctG>ctT	p.L548L	WDR76_ENST00000381246.2_Silent_p.L484L|WDR76_ENST00000478130.1_3'UTR|Y_RNA_ENST00000363521.1_RNA	NM_001167941.1|NM_024908.3	NP_001161413.1|NP_079184.2	Q9H967	WDR76_HUMAN	WD repeat domain 76	548										breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)	20		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		all cancers(107;3.78e-21)|GBM - Glioblastoma multiforme(94;5.04e-07)		GGCGATGGCTGACCAGGTTCC	0.448																																					p.L548L		.											.	WDR76	90	0			c.G1644T						.						118.0	105.0	109.0					15																	44158353		2198	4298	6496	SO:0001819	synonymous_variant	79968	exon13			ATGGCTGACCAGG	AK023035	CCDS10106.1, CCDS53938.1	15q15.3	2013-01-09			ENSG00000092470	ENSG00000092470		"""WD repeat domain containing"""	25773	protein-coding gene	gene with protein product						12860291	Standard	NM_024908		Approved	FLJ12973	uc001zti.2	Q9H967	OTTHUMG00000060143	ENST00000263795.6:c.1644G>T	15.37:g.44158353G>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	39.0	NM_024908	A0MNP5|Q05CI4	Silent	SNP	ENST00000263795.6	37	CCDS10106.1																																																																																			.		0.448	WDR76-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000133482.2	NM_024908	
XPNPEP2	7512	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	128893170	128893170	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chrX:128893170A>T	ENST00000371106.3	+	15	1574	c.1382A>T	c.(1381-1383)gAc>gTc	p.D461V		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	461						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GGGACCACAGACATCACCAGA	0.587																																					p.D461V		.											.	XPNPEP2	130	0			c.A1382T						.						132.0	100.0	111.0					X																	128893170		2203	4300	6503	SO:0001583	missense	7512	exon15			CCACAGACATCAC	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1382A>T	X.37:g.128893170A>T	ENSP00000360147:p.Asp461Val	Somatic	65.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	51.0	NM_003399	A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.840189	0.71488	.	.	ENSG00000122121	ENST00000371106	D	0.85171	-1.95	5.97	4.81	0.61882	Peptidase M24, structural domain (3);	0.041854	0.85682	D	0.000000	D	0.95335	0.8486	H	0.99225	4.475	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94927	0.8079	10	0.87932	D	0	-1.6485	10.0837	0.42406	0.9198:0.0:0.0802:0.0	.	461	O43895	XPP2_HUMAN	V	461	ENSP00000360147:D461V	ENSP00000360147:D461V	D	+	2	0	XPNPEP2	128720851	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	7.343000	0.79319	0.870000	0.35726	0.486000	0.48141	GAC	.		0.587	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058210.1	NM_003399	
ZAN	7455	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100361473	100361473	+	RNA	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr7:100361473C>G	ENST00000348028.3	+	0	4196				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TGTGATTCATCTCTGCAGAGC	0.577																																					.		.											.	ZAN	142	0			.						.						138.0	134.0	135.0					7																	100361473		2017	4177	6194			7455	.			ATTCATCTCTGCA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100361473C>G		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	22.0	.	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	RNA	SNP	ENST00000348028.3	37		.	.	.	.	.	.	.	.	.	.	C	13.94	2.387464	0.42308	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.16897	2.34;2.34;2.31	4.33	1.3	0.21679	von Willebrand factor, type D domain (1);	0.833390	0.10061	N	0.720938	T	0.18045	0.0433	L	0.38953	1.18	0.09310	N	0.999994	P;P	0.52463	0.953;0.921	P;B	0.48571	0.582;0.378	T	0.17018	-1.0383	10	0.72032	D	0.01	.	6.9944	0.24774	0.3338:0.4845:0.1817:0.0	.	1344;1344	F5H0T8;Q9Y493	.;ZAN_HUMAN	C	1344	ENSP00000445943:S1344C;ENSP00000445091:S1344C;ENSP00000444427:S1344C	ENSP00000423579:S1344C	S	+	2	0	ZAN	100199409	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.350000	0.07721	0.120000	0.18254	0.555000	0.69702	TCT	.		0.577	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
ZFYVE28	57732	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	2273119	2273119	+	Silent	SNP	G	G	A	rs146945400		TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr4:2273119G>A	ENST00000290974.2	-	12	2790	c.2451C>T	c.(2449-2451)gaC>gaT	p.D817D	ZFYVE28_ENST00000511071.1_Silent_p.D787D|ZFYVE28_ENST00000515312.1_Silent_p.D747D|ZFYVE28_ENST00000508471.1_Silent_p.D122D	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	817					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						CACAGGCCTCGTCTGGCACCC	0.662																																					p.D817D		.											.	ZFYVE28	93	0			c.C2451T						.	G	,,	0,4402		0,0,2201	24.0	24.0	24.0		2361,2241,2451	-5.9	0.3	4	dbSNP_134	24	1,8591		0,1,4295	no	coding-synonymous,coding-synonymous,coding-synonymous	ZFYVE28	NM_001172656.1,NM_001172659.1,NM_020972.2	,,	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	,,	787/858,747/818,817/888	2273119	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	57732	exon12			GGCCTCGTCTGGC	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.2451C>T	4.37:g.2273119G>A		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	29.0	NM_020972	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	ENST00000290974.2	37	CCDS33942.1																																																																																			G|1.000;A|0.000		0.662	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
ZNF135	7694	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	58574854	58574854	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:58574854G>T	ENST00000313434.5	+	4	302	c.201G>T	c.(199-201)gaG>gaT	p.E67D	ZNF135_ENST00000359978.6_Missense_Mutation_p.E79D|ZNF135_ENST00000401053.4_Missense_Mutation_p.E79D|ZNF135_ENST00000439855.2_Missense_Mutation_p.E67D|ZNF135_ENST00000511556.1_Missense_Mutation_p.E67D|ZNF135_ENST00000506786.1_Missense_Mutation_p.E25D	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CCCTGCTGGAGCAAGAGGCAG	0.577																																					p.E79D		.											.	ZNF135	91	0			c.G237T						.						112.0	97.0	102.0					19																	58574854		2203	4300	6503	SO:0001583	missense	7694	exon3			GCTGGAGCAAGAG	U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.201G>T	19.37:g.58574854G>T	ENSP00000321406:p.Glu67Asp	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	51.0	NM_007134	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	ENST00000313434.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.77|11.77	1.738485|1.738485	0.30774|0.30774	.|.	.|.	ENSG00000176293|ENSG00000176293	ENST00000504540;ENST00000401053;ENST00000359978;ENST00000439855;ENST00000313434;ENST00000511556;ENST00000506786|ENST00000391699	T;T;T;T;T;T|.	0.01113|.	5.32;5.32;5.32;5.32;5.32;5.32|.	2.51|2.51	0.346|0.346	0.16017|0.16017	Krueppel-associated box (3);|.	.|.	.|.	.|.	.|.	T|T	0.42449|0.42449	0.1203|0.1203	M|M	0.66297|0.66297	2.02|2.02	0.09310|0.09310	N|N	1|1	P;P;P|.	0.45212|.	0.853;0.853;0.853|.	B;B;B|.	0.39562|.	0.297;0.297;0.303|.	T|T	0.36962|0.36962	-0.9726|-0.9726	9|5	0.56958|.	D|.	0.05|.	.|.	4.4324|4.4324	0.11535|0.11535	0.3334:0.0:0.6666:0.0|0.3334:0.0:0.6666:0.0	.|.	67;67;79|.	E9PEV2;P52742;Q8N1I7|.	.;ZN135_HUMAN;.|.	D|I	79;79;79;67;67;67;25|73	ENSP00000441410:E79D;ENSP00000369437:E79D;ENSP00000444828:E67D;ENSP00000321406:E67D;ENSP00000422074:E67D;ENSP00000427691:E25D|.	ENSP00000321406:E67D|.	E|S	+|+	3|2	2|0	ZNF135|ZNF135	63266666|63266666	0.249000|0.249000	0.23941|0.23941	0.252000|0.252000	0.24328|0.24328	0.169000|0.169000	0.22640|0.22640	0.188000|0.188000	0.17018|0.17018	0.166000|0.166000	0.19597|0.19597	0.563000|0.563000	0.77884|0.77884	GAG|AGC	.		0.577	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000361899.2	NM_003436	
ZNF215	7762	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6964783	6964783	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr11:6964783T>A	ENST00000278319.5	+	6	1211	c.623T>A	c.(622-624)cTa>cAa	p.L208Q	ZNF215_ENST00000529903.1_Missense_Mutation_p.L208Q|ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000414517.2_Missense_Mutation_p.L208Q	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	208	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		ACAGCACATCTACTTTCCAAA	0.333																																					p.L208Q		.											.	ZNF215	514	0			c.T623A						.						103.0	106.0	105.0					11																	6964783		2201	4296	6497	SO:0001583	missense	7762	exon6			CACATCTACTTTC	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.623T>A	11.37:g.6964783T>A	ENSP00000278319:p.Leu208Gln	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	46.0	NM_013250	Q96C84	Missense_Mutation	SNP	ENST00000278319.5	37	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	T	13.45	2.241499	0.39598	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.00832	5.64;5.64;5.64	3.94	-0.29	0.12847	Krueppel-associated box (3);	0.633514	0.12050	N	0.504221	T	0.00608	0.0020	N	0.12663	0.25	0.09310	N	1	B;B	0.26363	0.147;0.079	B;B	0.24701	0.035;0.055	T	0.46775	-0.9167	10	0.15066	T	0.55	-1.3258	6.9204	0.24385	0.5779:0.0:0.0:0.4221	.	208;208	Q96C84;Q9UL58	.;ZN215_HUMAN	Q	208	ENSP00000278319:L208Q;ENSP00000393202:L208Q;ENSP00000432306:L208Q	ENSP00000278319:L208Q	L	+	2	0	ZNF215	6921359	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-0.238000	0.08977	0.156000	0.19299	0.533000	0.62120	CTA	.		0.333	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384550.1		
ZNF823	55552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11834023	11834023	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:11834023C>G	ENST00000341191.6	-	4	479	c.326G>C	c.(325-327)gGt>gCt	p.G109A	CTC-499B15.6_ENST00000586983.1_RNA|ZNF823_ENST00000545749.1_5'UTR|ZNF823_ENST00000440527.1_3'UTR	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						AGACGAATGACCCAAGACGAC	0.433										HNSCC(68;0.2)																											p.G109A		.											.	ZNF823	24	0			c.G326C						.						155.0	147.0	149.0					19																	11834023		2202	4300	6502	SO:0001583	missense	55552	exon4			GAATGACCCAAGA	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.326G>C	19.37:g.11834023C>G	ENSP00000340683:p.Gly109Ala	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	21.0	NM_001080493	A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	ENST00000341191.6	37	CCDS45981.1	.	.	.	.	.	.	.	.	.	.	c	7.007	0.556105	0.13436	.	.	ENSG00000197933	ENST00000341191;ENST00000431998	T;T	0.06294	4.18;3.32	0.632	-0.616	0.11583	.	.	.	.	.	T	0.07954	0.0199	L	0.38649	1.16	0.23076	N	0.998334	D	0.58268	0.982	P	0.55112	0.769	T	0.32295	-0.9912	9	0.15499	T	0.54	.	4.8531	0.13547	0.0:0.7326:0.0:0.2674	.	109	P16415	ZN823_HUMAN	A	109;65	ENSP00000340683:G109A;ENSP00000410654:G65A	ENSP00000340683:G109A	G	-	2	0	ZNF823	11695023	0.000000	0.05858	0.005000	0.12908	0.040000	0.13550	-1.112000	0.03299	-0.206000	0.10203	0.298000	0.19748	GGT	.		0.433	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344516.2	NM_001080493	
ZNF830	91603	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	33288615	33288615	+	Silent	SNP	G	G	T			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr17:33288615G>T	ENST00000361952.3	+	1	67	c.30G>T	c.(28-30)ccG>ccT	p.P10P	CCT6B_ENST00000421975.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank|CCT6B_ENST00000436961.3_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	10					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				CCCGGACTCCGGCAGGGAAGC	0.562																																					p.P10P		.											.	ZNF830	89	0			c.G30T						.						73.0	79.0	77.0					17																	33288615		2203	4300	6503	SO:0001819	synonymous_variant	91603	exon1			GACTCCGGCAGGG	AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.30G>T	17.37:g.33288615G>T		Somatic	85.0	1.0		WXS	Illumina HiSeq	Phase_I	121.0	53.0	NM_052857	Q96F60|Q96GZ5|Q9BU38	Silent	SNP	ENST00000361952.3	37	CCDS32618.1																																																																																			.		0.562	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448018.1	NM_052857	
ZNF85	7639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	21132144	21132144	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:21132144C>A	ENST00000328178.8	+	4	937	c.824C>A	c.(823-825)aCc>aAc	p.T275N	ZNF85_ENST00000601023.1_Missense_Mutation_p.T216N|ZNF85_ENST00000345030.6_Missense_Mutation_p.T242N	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	275					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						ACTCTTACTACCCATAAGATA	0.338																																					p.T305N		.											.	ZNF85	514	0			c.C914A						.						26.0	29.0	28.0					19																	21132144		2197	4288	6485	SO:0001583	missense	7639	exon5			TTACTACCCATAA	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.824C>A	19.37:g.21132144C>A	ENSP00000329793:p.Thr275Asn	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	10.0	NM_001256171	B9ZVP4|Q6NVI0	Missense_Mutation	SNP	ENST00000328178.8	37	CCDS32977.1	.	.	.	.	.	.	.	.	.	.	.	0.046	-1.266920	0.01433	.	.	ENSG00000105750	ENST00000328178;ENST00000345030;ENST00000421385	T;T	0.35789	1.29;1.29	1.35	-2.7	0.06004	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15132	0.0365	N	0.04203	-0.255	0.09310	N	1	P;P;B	0.42961	0.726;0.795;0.003	P;B;B	0.44696	0.458;0.268;0.026	T	0.10132	-1.0643	9	0.19590	T	0.45	.	2.64	0.04968	0.2163:0.2947:0.0:0.4889	.	242;216;275	Q03923-2;Q49A12;Q03923	.;.;ZNF85_HUMAN	N	275;242;150	ENSP00000329793:T275N;ENSP00000342340:T242N	ENSP00000329793:T275N	T	+	2	0	ZNF85	20923984	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	-8.361000	0.00021	-0.973000	0.03555	-0.379000	0.06801	ACC	.		0.338	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
ZNF98	148198	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	22575415	22575415	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:22575415T>C	ENST00000357774.5	-	4	743	c.622A>G	c.(622-624)Aaa>Gaa	p.K208E		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				TTGTAGGGTTTCTCTCCACTA	0.353																																					p.K208E		.											.	ZNF98	24	0			c.A622G						.						9.0	9.0	9.0					19																	22575415		1826	4053	5879	SO:0001583	missense	148198	exon4			AGGGTTTCTCTCC		CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.622A>G	19.37:g.22575415T>C	ENSP00000350418:p.Lys208Glu	Somatic	305.0	0.0		WXS	Illumina HiSeq	Phase_I	307.0	152.0	NM_001098626		Missense_Mutation	SNP	ENST00000357774.5	37	CCDS46031.1	.	.	.	.	.	.	.	.	.	.	.	10.49	1.365928	0.24684	.	.	ENSG00000197360	ENST00000357774	T	0.27104	1.69	1.28	0.0438	0.14223	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31606	0.0802	M	0.86953	2.85	0.26586	N	0.973286	B	0.10296	0.003	B	0.15484	0.013	T	0.37478	-0.9704	9	0.87932	D	0	.	6.0583	0.19824	0.0:0.0:0.2636:0.7363	.	208	A6NK75	ZNF98_HUMAN	E	208	ENSP00000350418:K208E	ENSP00000350418:K208E	K	-	1	0	ZNF98	22367255	0.990000	0.36364	0.001000	0.08648	0.005000	0.04900	2.954000	0.49113	-0.285000	0.09089	-0.973000	0.02599	AAA	.		0.353	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464398.1	NM_001098626	
ZNF99	7652	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	22941607	22941607	+	Silent	SNP	G	G	A			TCGA-CC-A7IG-01A-11D-A33K-10	TCGA-CC-A7IG-10A-01D-A33K-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	5b4be76e-ec2a-4157-a9ad-333f706662d5	b69cebd4-506b-4c1a-9724-dd4429b628b2	g.chr19:22941607G>A	ENST00000596209.1	-	4	1194	c.1104C>T	c.(1102-1104)ccC>ccT	p.P368P	ZNF99_ENST00000397104.3_Silent_p.P277P	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CATATTTGTAGGGTTTCTCTT	0.368																																					p.P368P		.											.	ZNF99	24	0			c.C1104T						.						76.0	83.0	81.0					19																	22941607		2019	4208	6227	SO:0001819	synonymous_variant	7652	exon4			TTTGTAGGGTTTC	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1104C>T	19.37:g.22941607G>A		Somatic	45.0	1.0		WXS	Illumina HiSeq	Phase_I	35.0	10.0	NM_001080409	M0R335	Silent	SNP	ENST00000596209.1	37	CCDS59369.1																																																																																			.		0.368	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
