#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA1	19	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107595004	107595004	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:107595004C>T	ENST00000374736.3	-	12	1754	c.1360G>A	c.(1360-1362)Gat>Aat	p.D454N	ABCA1_ENST00000494467.1_5'Flank	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	454					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	TCTAAGCCATCCAACTGCTGT	0.488																																					p.D454N		.											.	ABCA1	1016	0			c.G1360A						.						201.0	159.0	173.0					9																	107595004		2203	4300	6503	SO:0001583	missense	19	exon12			AGCCATCCAACTG	AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.1360G>A	9.37:g.107595004C>T	ENSP00000363868:p.Asp454Asn	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	24.0	NM_005502	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Missense_Mutation	SNP	ENST00000374736.3	37	CCDS6762.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392658	0.25118	.	.	ENSG00000165029	ENST00000374736	D	0.84873	-1.91	5.37	1.47	0.22746	.	0.966711	0.08613	N	0.919758	T	0.56891	0.2016	N	0.00707	-1.245	0.44523	D	0.99747	B	0.02656	0.0	B	0.01281	0.0	T	0.51482	-0.8700	10	0.20046	T	0.44	.	5.0513	0.14511	0.0:0.4026:0.1613:0.4362	.	454	O95477	ABCA1_HUMAN	N	454	ENSP00000363868:D454N	ENSP00000363868:D454N	D	-	1	0	ABCA1	106634825	0.032000	0.19561	0.776000	0.31678	0.982000	0.71751	0.824000	0.27379	0.659000	0.30945	-0.251000	0.11542	GAT	.		0.488	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053491.1	NM_005502	
AOC1	26	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150554178	150554178	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:150554178T>C	ENST00000493429.1	+	4	1204	c.620T>C	c.(619-621)gTa>gCa	p.V207A	AOC1_ENST00000360937.4_Missense_Mutation_p.V207A|AOC1_ENST00000416793.2_Missense_Mutation_p.V207A|AOC1_ENST00000467291.1_Missense_Mutation_p.V207A			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	207					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	CAGCGCTATGTAGAAGGCTAC	0.612																																					p.V207A		.											.	ABP1	139	0			c.T620C						.						76.0	79.0	78.0					7																	150554178		2024	4178	6202	SO:0001583	missense	26	exon2			GCTATGTAGAAGG	AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.620T>C	7.37:g.150554178T>C	ENSP00000418614:p.Val207Ala	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	8.0	NM_001091	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Missense_Mutation	SNP	ENST00000493429.1	37	CCDS43679.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801593	0.70682	.	.	ENSG00000002726	ENST00000493429;ENST00000467291;ENST00000460213;ENST00000360937;ENST00000416793;ENST00000437714;ENST00000483043	T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16	4.88	4.88	0.63580	Copper amine oxidase, N3-terminal (1);Copper amine oxidase, N2/N3-terminal (1);Copper amine oxidase, N-terminal (1);	0.125519	0.53938	D	0.000060	T	0.42854	0.1221	M	0.76328	2.33	0.50813	D	0.999891	P;D	0.58620	0.931;0.983	P;P	0.62649	0.527;0.905	T	0.37549	-0.9701	10	0.56958	D	0.05	-19.2859	12.497	0.55933	0.0:0.0:0.0:1.0	.	207;207	C9J690;P19801	.;ABP1_HUMAN	A	207;207;207;207;207;83;207	ENSP00000418614:V207A;ENSP00000418328:V207A;ENSP00000418557:V207A;ENSP00000354193:V207A;ENSP00000411613:V207A;ENSP00000417392:V207A	ENSP00000354193:V207A	V	+	2	0	ABP1	150185111	1.000000	0.71417	0.068000	0.19968	0.607000	0.37147	4.662000	0.61525	2.056000	0.61249	0.459000	0.35465	GTA	.		0.612	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350628.1	NM_001091	
ADAMTS20	80070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	43769295	43769295	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:43769295C>T	ENST00000389420.3	-	36	5332	c.5333G>A	c.(5332-5334)tGt>tAt	p.C1778Y		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1778	GON. {ECO:0000255|PROSITE- ProRule:PRU00383}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ATTAAAAGGACATTGATATGG	0.358																																					p.C1778Y		.											.	ADAMTS20	795	0			c.G5333A						.						146.0	146.0	146.0					12																	43769295		2203	4300	6503	SO:0001583	missense	80070	exon36			AAAGGACATTGAT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.5333G>A	12.37:g.43769295C>T	ENSP00000374071:p.Cys1778Tyr	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	23.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	C	15.79	2.936072	0.52972	.	.	ENSG00000173157	ENST00000389420	T	0.39406	1.08	4.8	4.8	0.61643	Peptidase M12B, GON-ADAMTSs (2);	0.000000	0.56097	D	0.000038	T	0.71333	0.3327	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78006	-0.2373	10	0.87932	D	0	.	18.7512	0.91816	0.0:1.0:0.0:0.0	.	1778	P59510	ATS20_HUMAN	Y	1778	ENSP00000374071:C1778Y	ENSP00000374071:C1778Y	C	-	2	0	ADAMTS20	42055562	1.000000	0.71417	0.992000	0.48379	0.378000	0.30076	6.409000	0.73289	2.596000	0.87737	0.460000	0.39030	TGT	.		0.358	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61413791	61413791	+	IGR	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:61413791T>A	ENST00000398571.2	-	0	11357				AHSA2_ENST00000357022.2_Missense_Mutation_p.L95Q|AHSA2_ENST00000410073.1_Missense_Mutation_p.L104Q|AHSA2_ENST00000489653.1_3'UTR|AHSA2_ENST00000394457.3_Missense_Mutation_p.L95Q	NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34						positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GTGCCTACTCTAGGGCAAACA	0.338																																					p.L95Q		.											.	AHSA2	289	0			c.T284A						.						72.0	70.0	71.0					2																	61413791		2203	4300	6503	SO:0001628	intergenic_variant	130872	exon6			CTACTCTAGGGCA	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265		2.37:g.61413791T>A		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	22.0	NM_152392	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	.	10.56	1.385599	0.25031	.	.	ENSG00000173209	ENST00000357022;ENST00000394457;ENST00000430934;ENST00000410073	.	.	.	5.92	-4.97	0.03029	.	0.719989	0.12745	N	0.442708	T	0.19005	0.0456	L	0.36672	1.1	0.09310	N	1	P	0.38642	0.641	B	0.35413	0.202	T	0.33879	-0.9851	9	0.11485	T	0.65	.	8.4476	0.32852	0.0:0.5488:0.1178:0.3334	.	257	Q719I0	AHSA2_HUMAN	Q	95;95;258;104	.	ENSP00000349525:L95Q	L	+	2	0	AHSA2	61267295	0.000000	0.05858	0.054000	0.19295	0.934000	0.57294	-0.980000	0.03770	-0.561000	0.06094	-0.250000	0.11733	CTA	.		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
AIM1	202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	106969168	106969168	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:106969168T>C	ENST00000369066.3	+	2	3348	c.2861T>C	c.(2860-2862)cTg>cCg	p.L954P		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TTGTCAAAACTGAAGAATGAT	0.363																																					p.L954P		.											.	AIM1	139	0			c.T2861C						.						64.0	68.0	67.0					6																	106969168		2203	4300	6503	SO:0001583	missense	202	exon2			CAAAACTGAAGAA	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.2861T>C	6.37:g.106969168T>C	ENSP00000358062:p.Leu954Pro	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	45.0	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	37	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	T	5.771	0.326576	0.10900	.	.	ENSG00000112297	ENST00000369066	T	0.73469	-0.75	5.99	0.803	0.18691	.	1.097930	0.06923	N	0.809750	T	0.40196	0.1107	L	0.28192	0.835	0.24198	N	0.995521	B	0.17465	0.022	B	0.14578	0.011	T	0.30880	-0.9963	10	0.33940	T	0.23	.	9.1582	0.37005	0.0:0.3804:0.0:0.6196	.	954	Q9Y4K1	AIM1_HUMAN	P	954	ENSP00000358062:L954P	ENSP00000358062:L954P	L	+	2	0	AIM1	107075861	0.062000	0.20869	0.681000	0.30009	0.486000	0.33341	0.018000	0.13422	-0.074000	0.12820	0.533000	0.62120	CTG	.		0.363	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
AKAP11	11215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	42875560	42875560	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr13:42875560C>T	ENST00000025301.2	+	8	2853	c.2678C>T	c.(2677-2679)tCa>tTa	p.S893L		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	893					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TCAATGACATCATTGGAAGTT	0.368																																					p.S893L		.											.	AKAP11	227	0			c.C2678T						.						33.0	33.0	33.0					13																	42875560		2203	4299	6502	SO:0001583	missense	11215	exon8			TGACATCATTGGA	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.2678C>T	13.37:g.42875560C>T	ENSP00000025301:p.Ser893Leu	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	26.0	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468526	0.63625	.	.	ENSG00000023516	ENST00000025301	T	0.19938	2.11	6.03	6.03	0.97812	.	0.163542	0.38897	N	0.001533	T	0.42154	0.1190	M	0.65975	2.015	0.47407	D	0.999411	D	0.56746	0.977	P	0.55923	0.787	T	0.02625	-1.1132	10	0.40728	T	0.16	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	893	Q9UKA4	AKA11_HUMAN	L	893	ENSP00000025301:S893L	ENSP00000025301:S893L	S	+	2	0	AKAP11	41773560	0.780000	0.28664	0.272000	0.24630	0.376000	0.30014	7.111000	0.77077	2.861000	0.98227	0.655000	0.94253	TCA	.		0.368	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
AKR7A3	22977	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19612757	19612757	+	Silent	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:19612757G>A	ENST00000361640.4	-	2	864	c.324C>T	c.(322-324)gaC>gaT	p.D108D		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	108					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GGTAGAAGAGGTCCACTCGGG	0.607																																					p.D108D		.											.	AKR7A3	90	0			c.C324T						.						71.0	75.0	74.0					1																	19612757		2199	4300	6499	SO:0001819	synonymous_variant	22977	exon2			GAAGAGGTCCACT	AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.324C>T	1.37:g.19612757G>A		Somatic	267.0	1.0		WXS	Illumina HiSeq	Phase_I	238.0	68.0	NM_012067	Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Silent	SNP	ENST00000361640.4	37	CCDS193.1																																																																																			.		0.607	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067	
ALS2CR12	130540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	202211384	202211384	+	Silent	SNP	C	C	A	rs552883600		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:202211384C>A	ENST00000286190.5	-	4	295	c.249G>T	c.(247-249)gtG>gtT	p.V83V	ALS2CR12_ENST00000439709.1_Silent_p.V83V|ALS2CR12_ENST00000405148.2_Silent_p.V83V|ALS2CR12_ENST00000392257.3_Silent_p.V83V|ALS2CR12_ENST00000448967.1_5'UTR			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	83					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						AGCCAGGTGACACGTTGATCA	0.453																																					p.V83V		.											.	ALS2CR12	154	0			c.G249T						.						134.0	111.0	119.0					2																	202211384		2203	4300	6503	SO:0001819	synonymous_variant	130540	exon5			AGGTGACACGTTG	AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.249G>T	2.37:g.202211384C>A		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	11.0	NM_001127391	G5E9S3|Q53TT6|Q8N1B6	Silent	SNP	ENST00000286190.5	37	CCDS2346.1																																																																																			.		0.453	ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256286.1	NM_139163	
PCED1B	91523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	47471425	47471425	+	5'Flank	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:47471425G>A	ENST00000546455.1	+	0	0				AMIGO2_ENST00000550413.1_Missense_Mutation_p.S454F|AMIGO2_ENST00000266581.4_Missense_Mutation_p.S454F|AMIGO2_ENST00000321382.3_Missense_Mutation_p.S454F|AMIGO2_ENST00000429635.1_Missense_Mutation_p.S454F			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B								hydrolase activity (GO:0016787)										TTCATCAGCGGAGGCATCACT	0.517																																					p.S454F		.											.	AMIGO2	92	0			c.C1361T						.						140.0	140.0	140.0					12																	47471425		2203	4300	6503	SO:0001631	upstream_gene_variant	347902	exon2			TCAGCGGAGGCAT	BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617		12.37:g.47471425G>A	Exception_encountered	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	20.0	NM_181847	Q96B20	Missense_Mutation	SNP	ENST00000546455.1	37	CCDS8752.1	.	.	.	.	.	.	.	.	.	.	G	9.285	1.049226	0.19827	.	.	ENSG00000139211	ENST00000266581;ENST00000550413;ENST00000429635;ENST00000321382	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.08	-0.142	0.13448	.	0.434925	0.21612	N	0.071766	T	0.30823	0.0777	L	0.39898	1.24	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.27434	-1.0074	10	0.10377	T	0.69	-0.2165	8.4226	0.32710	0.1357:0.3563:0.508:0.0	.	454	Q86SJ2	AMGO2_HUMAN	F	454	ENSP00000266581:S454F;ENSP00000449034:S454F;ENSP00000406020:S454F;ENSP00000320848:S454F	ENSP00000266581:S454F	S	-	2	0	AMIGO2	45757692	0.616000	0.27035	0.000000	0.03702	0.789000	0.44602	1.086000	0.30853	-0.126000	0.11682	-0.273000	0.10243	TCC	.		0.517	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405079.1	NM_138371	
ANGPT4	51378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	869031	869031	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr20:869031A>G	ENST00000381922.3	-	3	619	c.517T>C	c.(517-519)Tcc>Ccc	p.S173P	ANGPT4_ENST00000546022.1_Missense_Mutation_p.S173P	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	173					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						TTGTTGGTGGACAGAAAGGTC	0.577																																					p.S173P	Pancreas(181;481 2077 3259 31286 49856)	.											.	ANGPT4	92	0			c.T517C						.						98.0	86.0	90.0					20																	869031		2203	4300	6503	SO:0001583	missense	51378	exon3			TGGTGGACAGAAA	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.517T>C	20.37:g.869031A>G	ENSP00000371347:p.Ser173Pro	Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	10.0	NM_015985	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	ENST00000381922.3	37	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	a	12.57	1.979052	0.34942	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.14516	2.5;2.5	4.44	3.31	0.37934	.	0.260965	0.30723	N	0.009019	T	0.31199	0.0789	M	0.75615	2.305	0.42985	D	0.994474	D;D	0.76494	0.999;0.999	D;D	0.66196	0.942;0.942	T	0.02417	-1.1162	10	0.56958	D	0.05	.	8.3884	0.32514	0.8244:0.0:0.0:0.1755	.	173;173	B4E3J9;Q9Y264	.;ANGP4_HUMAN	P	173	ENSP00000371347:S173P;ENSP00000439605:S173P	ENSP00000371347:S173P	S	-	1	0	ANGPT4	817031	1.000000	0.71417	0.975000	0.42487	0.024000	0.10985	4.734000	0.62043	0.712000	0.32039	0.248000	0.18094	TCC	.		0.577	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077493.1	NM_015985	
ANLN	54443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	36435972	36435972	+	Missense_Mutation	SNP	G	G	T	rs555242135		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:36435972G>T	ENST00000265748.2	+	2	337	c.116G>T	c.(115-117)cGa>cTa	p.R39L	ANLN_ENST00000396068.2_Missense_Mutation_p.R39L	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	39	Interaction with CD2AP.|Nuclear localization.|Required for ubiquitination.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						CATGCTAAGCGAGCTAGACAG	0.473																																					p.R39L		.											.	ANLN	517	0			c.G116T						.						69.0	71.0	71.0					7																	36435972		2203	4300	6503	SO:0001583	missense	54443	exon2			CTAAGCGAGCTAG	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.116G>T	7.37:g.36435972G>T	ENSP00000265748:p.Arg39Leu	Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	33.0	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	37	CCDS5447.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356902	0.82243	.	.	ENSG00000011426	ENST00000265748;ENST00000396068;ENST00000424865;ENST00000418118	T;T;T	0.55234	0.53;0.53;3.95	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.74550	0.3731	M	0.75264	2.295	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.76462	-0.2950	10	0.87932	D	0	-13.6627	19.774	0.96385	0.0:0.0:1.0:0.0	.	39;39;39	A8K5D9;Q9NQW6-2;Q9NQW6	.;.;ANLN_HUMAN	L	39;39;17;17	ENSP00000265748:R39L;ENSP00000379380:R39L;ENSP00000404979:R17L	ENSP00000265748:R39L	R	+	2	0	ANLN	36402497	1.000000	0.71417	0.467000	0.27180	0.321000	0.28281	8.351000	0.90072	2.679000	0.91253	0.591000	0.81541	CGA	.		0.473	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	73069858	73069858	+	Silent	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr5:73069858C>A	ENST00000426542.2	+	4	674	c.654C>A	c.(652-654)gtC>gtA	p.V218V	ARHGEF28_ENST00000287898.5_Silent_p.V218V|ARHGEF28_ENST00000296794.6_Silent_p.V218V|ARHGEF28_ENST00000545377.1_Silent_p.V218V|ARHGEF28_ENST00000513042.2_Silent_p.V218V|ARHGEF28_ENST00000437974.1_Silent_p.V218V			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	218					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										TGGAAGACGTCACAAAGTGAG	0.453																																					p.V218V		.											.	.	.	0			c.C654A						.						24.0	23.0	23.0					5																	73069858		1893	4113	6006	SO:0001819	synonymous_variant	64283	exon5			AGACGTCACAAAG		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.654C>A	5.37:g.73069858C>A		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	17.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Silent	SNP	ENST00000426542.2	37	CCDS54870.1																																																																																			.		0.453	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
ASB5	140458	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	177146466	177146466	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr4:177146466G>A	ENST00000296525.3	-	2	336	c.223C>T	c.(223-225)Cat>Tat	p.H75Y	ASB5_ENST00000511879.1_5'UTR|ASB5_ENST00000512254.1_Missense_Mutation_p.H22Y	NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	75					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		GCTGCTTCATGTAGTGGTGAT	0.373																																					p.H75Y		.											.	ASB5	228	0			c.C223T						.						91.0	95.0	94.0					4																	177146466		2203	4300	6503	SO:0001583	missense	140458	exon2			CTTCATGTAGTGG	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.223C>T	4.37:g.177146466G>A	ENSP00000296525:p.His75Tyr	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	47.0	NM_080874	Q8N7B5	Missense_Mutation	SNP	ENST00000296525.3	37	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	G	31	5.085281	0.94100	.	.	ENSG00000164122	ENST00000296525;ENST00000512254	T;T	0.70399	-0.48;-0.48	6.16	6.16	0.99307	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	D	0.84692	0.5528	M	0.71871	2.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.985;0.993	D	0.83855	0.0265	10	0.62326	D	0.03	-27.2356	20.8598	0.99761	0.0:0.0:1.0:0.0	.	75;22	Q8WWX0;Q8N7B5	ASB5_HUMAN;.	Y	75;22	ENSP00000296525:H75Y;ENSP00000422877:H22Y	ENSP00000296525:H75Y	H	-	1	0	ASB5	177383460	1.000000	0.71417	0.978000	0.43139	0.938000	0.57974	9.110000	0.94302	2.937000	0.99478	0.650000	0.86243	CAT	.		0.373	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1		
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197072361	197072361	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:197072361T>G	ENST00000367409.4	-	18	6276	c.6020A>C	c.(6019-6021)tAc>tCc	p.Y2007S	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2007					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TCCAATACTGTAAGCCCTATA	0.328																																					p.Y2007S		.											.	ASPM	615	0			c.A6020C						.						87.0	91.0	89.0					1																	197072361		2203	4299	6502	SO:0001583	missense	259266	exon18			ATACTGTAAGCCC	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.6020A>C	1.37:g.197072361T>G	ENSP00000356379:p.Tyr2007Ser	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	11.0	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	t	9.770	1.172510	0.21704	.	.	ENSG00000066279	ENST00000367409	T	0.73363	-0.74	5.6	5.6	0.85130	.	0.261257	0.33253	N	0.005103	D	0.84101	0.5398	M	0.91459	3.21	0.09310	N	0.999999	D	0.55605	0.972	P	0.52267	0.694	T	0.80885	-0.1182	10	0.66056	D	0.02	.	11.5511	0.50721	0.1338:0.0:0.0:0.8662	.	2007	Q8IZT6	ASPM_HUMAN	S	2007	ENSP00000356379:Y2007S	ENSP00000356379:Y2007S	Y	-	2	0	ASPM	195338984	0.485000	0.25972	0.077000	0.20336	0.232000	0.25224	1.367000	0.34204	2.136000	0.66102	0.524000	0.50904	TAC	.		0.328	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
ATP10D	57205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47525056	47525056	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr4:47525056C>G	ENST00000273859.3	+	4	782	c.513C>G	c.(511-513)tgC>tgG	p.C171W	ATP10D_ENST00000504445.1_Missense_Mutation_p.C171W	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	171			C -> R (in dbSNP:rs7683838).		cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TTGACCGATGCTGGAAAGACG	0.338																																					p.C171W		.											.	ATP10D	93	0			c.C513G						.						86.0	78.0	81.0					4																	47525056		2203	4300	6503	SO:0001583	missense	57205	exon4			CCGATGCTGGAAA	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.513C>G	4.37:g.47525056C>G	ENSP00000273859:p.Cys171Trp	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	20.0	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.129973	0.37630	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.74737	-0.87;-0.87	5.94	2.21	0.28008	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.173510	0.52532	D	0.000077	T	0.79563	0.4467	M	0.66939	2.045	0.49051	D	0.999748	D;P	0.65815	0.995;0.886	P;P	0.61275	0.886;0.762	T	0.74731	-0.3566	10	0.38643	T	0.18	-9.2528	8.3469	0.32279	0.0:0.6113:0.0:0.3887	.	171;171	Q9P241;Q6PEW3	AT10D_HUMAN;.	W	171	ENSP00000273859:C171W;ENSP00000420909:C171W	ENSP00000273859:C171W	C	+	3	2	ATP10D	47219813	1.000000	0.71417	0.932000	0.37286	0.540000	0.34992	1.258000	0.32944	0.095000	0.17434	-0.439000	0.05793	TGC	.		0.338	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
ATP13A5	344905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	193025125	193025125	+	Silent	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:193025125G>A	ENST00000342358.4	-	22	2676	c.2559C>T	c.(2557-2559)aaC>aaT	p.N853N	ATP13A5_ENST00000495496.1_5'UTR|ATP13A5-AS1_ENST00000414634.1_RNA	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	853						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CCCCACAGTCGTTAGCTCCAT	0.458																																					p.N853N		.											.	ATP13A5	144	0			c.C2559T						.						104.0	90.0	95.0					3																	193025125		2203	4300	6503	SO:0001819	synonymous_variant	344905	exon22			ACAGTCGTTAGCT	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2559C>T	3.37:g.193025125G>A		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	38.0	NM_198505	Q6UWS4|Q6ZWL0	Silent	SNP	ENST00000342358.4	37	CCDS33914.1																																																																																			.		0.458	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
BAG6	7917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31608213	31608213	+	Silent	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:31608213T>C	ENST00000375964.6	-	22	3310	c.2997A>G	c.(2995-2997)gaA>gaG	p.E999E	BAG6_ENST00000362049.6_Silent_p.E993E|BAG6_ENST00000211379.5_Silent_p.E993E|BAG6_ENST00000375976.4_Silent_p.E993E|BAG6_ENST00000404765.2_Silent_p.E1029E|BAG6_ENST00000439687.2_Intron|BAG6_ENST00000470875.1_5'Flank	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	999					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						CTCCATCCTGTTCATCCCGGG	0.597																																					p.E999E		.											.	BAG6	154	0			c.A2997G						.						112.0	131.0	124.0					6																	31608213		1511	2709	4220	SO:0001819	synonymous_variant	7917	exon22			ATCCTGTTCATCC	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.2997A>G	6.37:g.31608213T>C		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	11.0	NM_004639	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Silent	SNP	ENST00000375964.6	37	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	T	6.876	0.531031	0.13127	.	.	ENSG00000204463	ENST00000441793	.	.	.	5.54	-5.72	0.02406	.	.	.	.	.	T	0.20700	0.0498	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42531	-0.9446	4	.	.	.	.	2.6061	0.04878	0.1032:0.3374:0.2112:0.3482	.	.	.	.	S	142	.	.	N	-	2	0	BAG6	31716192	0.976000	0.34144	0.841000	0.33234	0.944000	0.59088	-0.251000	0.08818	-0.639000	0.05502	-0.327000	0.08410	AAC	.		0.597	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	
BNIPL	149428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151015463	151015463	+	Silent	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:151015463C>A	ENST00000368931.3	+	5	621	c.465C>A	c.(463-465)acC>acA	p.T155T	BNIPL_ENST00000295294.7_Silent_p.T73T	NM_138278.3	NP_612122.2	Q7Z465	BNIPL_HUMAN	BCL2/adenovirus E1B 19kD interacting protein like	155					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|regulation of growth rate (GO:0040009)	cytosol (GO:0005829)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|endometrium(3)|large_intestine(1)|lung(4)|skin(1)	10	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTCTGGGCACCAGTGAGACAG	0.532																																					p.T155T		.											.	BNIPL	227	0			c.C465A						.						125.0	118.0	120.0					1																	151015463		2203	4300	6503	SO:0001819	synonymous_variant	149428	exon5			GGGCACCAGTGAG	AF193056	CCDS978.2, CCDS53362.1	1q21.2	2008-02-05			ENSG00000163141	ENSG00000163141			16976	protein-coding gene	gene with protein product		611275				12681488, 11741952	Standard	NM_138278		Approved	BNIPl-1, BNIPL-2, PP753	uc001ewl.2	Q7Z465	OTTHUMG00000035157	ENST00000368931.3:c.465C>A	1.37:g.151015463C>A		Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	22.0	NM_138278	Q6DK43|Q8TCY7|Q8WYG2	Silent	SNP	ENST00000368931.3	37	CCDS978.2																																																																																			.		0.532	BNIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085092.1	NM_138279	
BRD8	10902	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	137485482	137485482	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr5:137485482T>C	ENST00000254900.5	-	23	3496	c.3125A>G	c.(3124-3126)gAg>gGg	p.E1042G		NM_139199.1	NP_631938	Q9H0E9	BRD8_HUMAN	bromodomain containing 8	1042					cell surface receptor signaling pathway (GO:0007166)|chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|intracellular receptor signaling pathway (GO:0030522)|regulation of growth (GO:0040008)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(3)|urinary_tract(1)	35			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTGCTGAGCCTCCCCCTAGGA	0.458																																					p.E1042G		.											.	BRD8	91	0			c.A3125G						.						125.0	111.0	115.0					5																	137485482		2203	4300	6503	SO:0001583	missense	10902	exon23			TGAGCCTCCCCCT	AF016270	CCDS4198.1, CCDS34241.1, CCDS54907.1	5q31	2008-02-05			ENSG00000112983	ENSG00000112983			19874	protein-coding gene	gene with protein product		602848				8611617, 9368056	Standard	NM_001164326		Approved	SMAP, p120	uc003lcf.1	Q9H0E9	OTTHUMG00000129204	ENST00000254900.5:c.3125A>G	5.37:g.137485482T>C	ENSP00000254900:p.Glu1042Gly	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	5.0	NM_139199	O43178|Q15355|Q58AB0|Q59GN0|Q969M9	Missense_Mutation	SNP	ENST00000254900.5	37	CCDS4198.1	.	.	.	.	.	.	.	.	.	.	T	1.823	-0.471730	0.04445	.	.	ENSG00000112983	ENST00000254900;ENST00000427976	T;T	0.28454	1.88;1.61	4.84	2.45	0.29901	.	0.925692	0.08964	N	0.868328	T	0.17152	0.0412	N	0.14661	0.345	0.19575	N	0.999967	B	0.02656	0.0	B	0.04013	0.001	T	0.26849	-1.0091	10	0.23891	T	0.37	.	7.0267	0.24944	0.0:0.2081:0.0:0.7919	.	1042	Q9H0E9	BRD8_HUMAN	G	1042;148	ENSP00000254900:E1042G;ENSP00000392646:E148G	ENSP00000254900:E1042G	E	-	2	0	BRD8	137513381	0.001000	0.12720	0.289000	0.24876	0.126000	0.20510	0.967000	0.29344	0.871000	0.35750	0.528000	0.53228	GAG	.		0.458	BRD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251282.3	NM_006696	
BTN2A1	11120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26468554	26468554	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:26468554T>A	ENST00000312541.5	+	8	1609	c.1361T>A	c.(1360-1362)cTg>cAg	p.L454Q	BTN2A1_ENST00000541522.1_Missense_Mutation_p.L393Q|BTN2A1_ENST00000469185.1_Intron|BTN2A1_ENST00000429381.1_3'UTR	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	454	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						GGCGTCTTCCTGGACTATGAA	0.547																																					p.L454Q		.											.	BTN2A1	92	0			c.T1361A						.						136.0	119.0	125.0					6																	26468554		2203	4298	6501	SO:0001583	missense	11120	exon8			TCTTCCTGGACTA	U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.1361T>A	6.37:g.26468554T>A	ENSP00000312158:p.Leu454Gln	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	24.0	NM_007049	B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	ENST00000312541.5	37	CCDS4613.1	.	.	.	.	.	.	.	.	.	.	T	16.68	3.191563	0.58017	.	.	ENSG00000112763	ENST00000312541;ENST00000541522;ENST00000265424	T;T	0.79940	-1.32;-1.32	2.72	1.54	0.23209	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.39687	N	0.001285	D	0.88894	0.6561	H	0.97365	3.99	0.32474	N	0.542464	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.85022	0.0912	10	0.87932	D	0	.	6.2113	0.20631	0.0:0.1339:0.0:0.8661	.	393;454	B4DLP9;Q7KYR7	.;BT2A1_HUMAN	Q	454;393;440	ENSP00000312158:L454Q;ENSP00000443909:L393Q	ENSP00000265424:L440Q	L	+	2	0	BTN2A1	26576533	1.000000	0.71417	0.918000	0.36340	0.743000	0.42351	6.022000	0.70839	0.462000	0.27095	0.402000	0.26972	CTG	.		0.547	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040122.2	NM_007049	
CAD	790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27456323	27456323	+	Silent	SNP	T	T	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:27456323T>G	ENST00000403525.1	+	19	3090	c.2946T>G	c.(2944-2946)gcT>gcG	p.A982A	CAD_ENST00000264705.4_Silent_p.A1045A			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGACTCGGCTGAGAACCGTT	0.607																																					p.A1045A		.											.	CAD	295	0			c.T3135G						.						52.0	51.0	51.0					2																	27456323		2203	4300	6503	SO:0001819	synonymous_variant	790	exon20			CTCGGCTGAGAAC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2946T>G	2.37:g.27456323T>G		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	7.0	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Silent	SNP	ENST00000403525.1	37																																																																																				.		0.607	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
CASC5	57082	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	40916828	40916828	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr15:40916828G>A	ENST00000346991.5	+	11	4834	c.4444G>A	c.(4444-4446)Gga>Aga	p.G1482R	CASC5_ENST00000399668.2_Missense_Mutation_p.G1456R			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	1482					acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ACCTAAAAAAGGACAGAGTAG	0.328																																					p.G1482R		.											.	CASC5	660	0			c.G4444A						.						68.0	63.0	64.0					15																	40916828		1826	4090	5916	SO:0001583	missense	57082	exon11			AAAAAAGGACAGA	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.4444G>A	15.37:g.40916828G>A	ENSP00000335463:p.Gly1482Arg	Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	87.0	46.0	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	37	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	G	10.18	1.278108	0.23307	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.05717	3.4;3.4	5.12	4.19	0.49359	.	0.138671	0.33327	N	0.005031	T	0.06416	0.0165	L	0.44542	1.39	0.20489	N	0.999892	P;P;P	0.37955	0.612;0.612;0.612	B;B;B	0.39503	0.203;0.203;0.301	T	0.26643	-1.0097	10	0.72032	D	0.01	.	4.5028	0.11872	0.1617:0.0:0.6445:0.1938	.	1456;1482;1456	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	R	1482;1456;1456	ENSP00000335463:G1482R;ENSP00000382576:G1456R	ENSP00000260369:G1456R	G	+	1	0	CASC5	38704120	0.989000	0.36119	0.970000	0.41538	0.049000	0.14656	1.630000	0.37081	2.539000	0.85634	0.603000	0.83216	GGA	.		0.328	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
CASP4	837	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	104819283	104819283	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:104819283A>G	ENST00000444739.2	-	6	1812	c.902T>C	c.(901-903)aTt>aCt	p.I301T	CASP4_ENST00000531333.1_5'Flank|CASP4_ENST00000393150.3_Missense_Mutation_p.I245T	NM_001225.3	NP_001216.1	P49662	CASP4_HUMAN	caspase 4, apoptosis-related cysteine peptidase	301					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)	AIM2 inflammasome complex (GO:0097169)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|IPAF inflammasome complex (GO:0072557)|membrane (GO:0016020)|mitochondrion (GO:0005739)|NLRP3 inflammasome complex (GO:0072559)	cysteine-type endopeptidase activity (GO:0004197)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(1)|skin(1)|urinary_tract(2)	23		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000854)|Epithelial(105;0.00879)|all cancers(92;0.0357)		GCAGAAAGCAATGAAGTCCTT	0.468																																					p.I301T		.											.	CASP4	660	0			c.T902C						.						162.0	117.0	132.0					11																	104819283		2202	4299	6501	SO:0001583	missense	837	exon6			AAAGCAATGAAGT	U25804	CCDS8327.1, CCDS41704.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000196954	ENSG00000196954		"""Caspases"""	1505	protein-coding gene	gene with protein product		602664	"""caspase 4, apoptosis-related cysteine protease"""			7797510, 9250871	Standard	NM_001225		Approved	ICE(rel)II, ICH-2, TX	uc001pid.1	P49662	OTTHUMG00000166078	ENST00000444739.2:c.902T>C	11.37:g.104819283A>G	ENSP00000388566:p.Ile301Thr	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	21.0	NM_001225	A2NHL8|A2NHM0	Missense_Mutation	SNP	ENST00000444739.2	37	CCDS8327.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.861050	0.71949	.	.	ENSG00000196954	ENST00000444739;ENST00000393150;ENST00000355546	T;T	0.27402	1.67;1.67	5.08	5.08	0.68730	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.177207	0.47093	D	0.000256	T	0.57577	0.2063	M	0.93016	3.37	0.40390	D	0.979531	P	0.51147	0.942	P	0.55222	0.771	T	0.70132	-0.4956	10	0.87932	D	0	.	12.7845	0.57496	1.0:0.0:0.0:0.0	.	301	P49662	CASP4_HUMAN	T	301;245;254	ENSP00000388566:I301T;ENSP00000376857:I245T	ENSP00000347741:I254T	I	-	2	0	CASP4	104324493	1.000000	0.71417	0.993000	0.49108	0.934000	0.57294	6.209000	0.72171	1.904000	0.55121	0.397000	0.26171	ATT	.		0.468	CASP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387751.1	NM_001225	
CASP5	838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	104872821	104872821	+	Silent	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:104872821C>A	ENST00000260315.3	-	5	650	c.651G>T	c.(649-651)gtG>gtT	p.V217V	CASP5_ENST00000531367.1_Silent_p.V75V|CASP5_ENST00000418434.1_Silent_p.V75V|CASP5_ENST00000393141.2_Silent_p.V230V|CASP5_ENST00000393139.2_3'UTR|CASP5_ENST00000526056.1_Silent_p.V230V|CASP5_ENST00000444749.2_Silent_p.V159V			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	217			V -> L (in dbSNP:rs3181326). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.7}.		apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		TTTTCATCCCCACGATGTCAT	0.493																																					p.V230V		.											.	CASP5	661	0			c.G690T						.						153.0	131.0	139.0					11																	104872821		2202	4299	6501	SO:0001819	synonymous_variant	838	exon5			CATCCCCACGATG		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.651G>T	11.37:g.104872821C>A		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	26.0	NM_001136112	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Silent	SNP	ENST00000260315.3	37	CCDS8328.2																																																																																			.		0.493	CASP5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109397.2	NM_004347	
CCDC168	643677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103388308	103388308	+	Silent	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr13:103388308G>A	ENST00000322527.2	-	1	851	c.852C>T	c.(850-852)tgC>tgT	p.C284C		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	284																	TCTTTCCATTGCATAGAAGTG	0.458																																					p.C4913C		.											.	.	.	0			c.C14739T						.						194.0	166.0	175.0					13																	103388308		692	1591	2283	SO:0001819	synonymous_variant	643677	exon4			TCCATTGCATAGA		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.852C>T	13.37:g.103388308G>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	8.0	NM_001146197	Q8N800	Silent	SNP	ENST00000322527.2	37																																																																																				.		0.458	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
CD36	948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	80295781	80295781	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:80295781C>G	ENST00000435819.1	+	11	1408	c.724C>G	c.(724-726)Cac>Gac	p.H242D	CD36_ENST00000309881.7_Missense_Mutation_p.H242D|CD36_ENST00000538969.1_Missense_Mutation_p.H182D|CD36_ENST00000447544.2_Missense_Mutation_p.H242D|CD36_ENST00000534394.1_Missense_Mutation_p.H166D|CD36_ENST00000544133.1_Missense_Mutation_p.H242D|CD36_ENST00000394788.3_Missense_Mutation_p.H242D|CD36_ENST00000433696.2_Intron|CD36_ENST00000432207.1_Missense_Mutation_p.H242D			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	242					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						TTGGGAAAGTCACTGCGACAT	0.338																																					p.H242D		.											.	CD36	69	0			c.C724G						.						152.0	144.0	147.0					7																	80295781		2203	4300	6503	SO:0001583	missense	948	exon6			GAAAGTCACTGCG	Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.724C>G	7.37:g.80295781C>G	ENSP00000399421:p.His242Asp	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	13.0	NM_001127444	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	ENST00000435819.1	37	CCDS34673.1	.	.	.	.	.	.	.	.	.	.	C	2.907	-0.226254	0.06022	.	.	ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000534394;ENST00000394788;ENST00000447544;ENST00000432207;ENST00000419819;ENST00000538969;ENST00000544133	T;T;T;T;T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55;-0.55	5.01	2.58	0.30949	.	0.116287	0.64402	D	0.000010	T	0.49150	0.1540	N	0.19112	0.55	0.20074	N	0.999938	B	0.22746	0.074	B	0.23852	0.049	T	0.26950	-1.0088	9	.	.	.	-11.1083	5.4882	0.16761	0.0:0.1496:0.2744:0.576	.	242	P16671	CD36_HUMAN	D	242;242;166;242;242;242;242;182;242	ENSP00000399421:H242D;ENSP00000308165:H242D;ENSP00000431296:H166D;ENSP00000378268:H242D;ENSP00000415743:H242D;ENSP00000411411:H242D;ENSP00000392298:H242D;ENSP00000439543:H182D;ENSP00000441956:H242D	.	H	+	1	0	CD36	80133717	0.965000	0.33210	0.196000	0.23383	0.746000	0.42486	1.614000	0.36911	0.313000	0.23062	-0.294000	0.09567	CAC	.		0.338	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339767.6	NM_001001547	
CDH7	1005	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	63547825	63547825	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr18:63547825G>T	ENST00000397968.2	+	12	2479	c.2053G>T	c.(2053-2055)Gat>Tat	p.D685Y	CDH7_ENST00000323011.3_Missense_Mutation_p.D685Y	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	685					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GACCCGGAGGGATGTGACTCC	0.478																																					p.D685Y		.											.	CDH7	94	0			c.G2053T						.						79.0	82.0	81.0					18																	63547825		2203	4300	6503	SO:0001583	missense	1005	exon12			CGGAGGGATGTGA	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.2053G>T	18.37:g.63547825G>T	ENSP00000381058:p.Asp685Tyr	Somatic	186.0	1.0		WXS	Illumina HiSeq	Phase_I	162.0	29.0	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	37	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856309	0.71834	.	.	ENSG00000081138	ENST00000323011;ENST00000397966;ENST00000397968	T;T	0.79247	-1.25;-1.25	5.37	5.37	0.77165	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.90896	0.7139	M	0.92169	3.28	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	D	0.92896	0.6335	10	0.87932	D	0	.	19.1123	0.93321	0.0:0.0:1.0:0.0	.	685	Q9ULB5	CADH7_HUMAN	Y	685	ENSP00000319166:D685Y;ENSP00000381058:D685Y	ENSP00000319166:D685Y	D	+	1	0	CDH7	61698805	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	9.476000	0.97823	2.515000	0.84797	0.655000	0.94253	GAT	.		0.478	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
CEACAM8	1088	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	43098936	43098936	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:43098936C>T	ENST00000244336.5	-	1	146	c.45G>A	c.(43-45)tgG>tgA	p.W15*	LIPE-AS1_ENST00000594624.2_RNA|CEACAM8_ENST00000599005.1_Nonsense_Mutation_p.W15*|LIPE-AS1_ENST00000594688.1_RNA	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	15					immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				GGAGCCCCTGCCAGGGGATGC	0.622																																					p.W15X		.											.	CEACAM8	91	0			c.G45A						.						102.0	94.0	97.0					19																	43098936		2203	4300	6503	SO:0001587	stop_gained	1088	exon1			CCCCTGCCAGGGG	D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.45G>A	19.37:g.43098936C>T	ENSP00000244336:p.Trp15*	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	8.0	NM_001816	O60399|Q16574	Nonsense_Mutation	SNP	ENST00000244336.5	37	CCDS12610.1	.	.	.	.	.	.	.	.	.	.	c	15.64	2.892220	0.52014	.	.	ENSG00000124469	ENST00000244336	.	.	.	1.4	1.4	0.22301	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.1898	0.20518	0.0:1.0:0.0:0.0	.	.	.	.	X	15	.	ENSP00000244336:W15X	W	-	3	0	CEACAM8	47790776	0.033000	0.19621	0.020000	0.16555	0.016000	0.09150	0.359000	0.20233	1.063000	0.40649	0.313000	0.20887	TGG	.		0.622	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321430.1		
CELSR3	1951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48697293	48697293	+	Silent	SNP	C	C	T	rs200302496		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:48697293C>T	ENST00000164024.4	-	1	3055	c.2775G>A	c.(2773-2775)gtG>gtA	p.V925V	CELSR3_ENST00000544264.1_Silent_p.V925V	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	925	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GGGTGTAGGTCACCTGGTCCT	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		23452	0.001		0.0	False		,,,				2504	0.0				p.V925V		.											.	CELSR3	523	0			c.G2775A						.						149.0	129.0	136.0					3																	48697293		2203	4300	6503	SO:0001819	synonymous_variant	1951	exon1			GTAGGTCACCTGG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2775G>A	3.37:g.48697293C>T		Somatic	203.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	77.0	NM_001407	O75092	Silent	SNP	ENST00000164024.4	37	CCDS2775.1																																																																																			C|0.999;T|0.000		0.517	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
CHDH	55349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	53851839	53851839	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:53851839C>T	ENST00000315251.6	-	9	2187	c.1750G>A	c.(1750-1752)Gtc>Atc	p.V584I		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	584					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	GGCTTGTAGACAGGGACATCT	0.592																																					p.V584I		.											.	CHDH	91	0			c.G1750A						.						74.0	59.0	64.0					3																	53851839		2203	4300	6503	SO:0001583	missense	55349	exon9			TGTAGACAGGGAC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.1750G>A	3.37:g.53851839C>T	ENSP00000319851:p.Val584Ile	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	16.0	NM_018397	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.762909	0.49574	.	.	ENSG00000016391	ENST00000315251	T	0.22743	1.94	5.54	3.76	0.43208	.	0.143052	0.46758	N	0.000264	T	0.14313	0.0346	N	0.19112	0.55	0.54753	D	0.999983	B	0.22003	0.063	B	0.21917	0.037	T	0.05099	-1.0906	10	0.42905	T	0.14	-39.1715	11.7443	0.51811	0.0:0.8587:0.0:0.1413	.	584	Q8NE62	CHDH_HUMAN	I	584	ENSP00000319851:V584I	ENSP00000319851:V584I	V	-	1	0	CHDH	53826879	0.983000	0.35010	0.938000	0.37757	0.974000	0.67602	2.298000	0.43602	0.719000	0.32188	0.655000	0.94253	GTC	.		0.592	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
CHMP4C	92421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	82670408	82670408	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:82670408A>T	ENST00000297265.4	+	4	708	c.515A>T	c.(514-516)gAa>gTa	p.E172V		NM_152284.3	NP_689497.1	Q96CF2	CHM4C_HUMAN	charged multivesicular body protein 4C	172	Intramolecular interaction with N- terminus. {ECO:0000250}.				abscission (GO:0009838)|cytokinesis checkpoint (GO:0031565)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of cytokinesis (GO:0032466)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|membrane (GO:0016020)|midbody (GO:0030496)	protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	10						GAAGAATTGGAACAGGAGGAA	0.418																																					p.E172V		.											.	CHMP4C	92	0			c.A515T						.						107.0	107.0	107.0					8																	82670408		2203	4300	6503	SO:0001583	missense	92421	exon4			AATTGGAACAGGA	AK000049	CCDS6233.1	8q21.13	2011-09-21	2011-09-21		ENSG00000164695	ENSG00000164695		"""Charged multivesicular body proteins"""	30599	protein-coding gene	gene with protein product	"""Snf7 homologue associated with Alix 3"""	610899	"""chromatin modifying protein 4C"""			12860994 , 14678797	Standard	NM_152284		Approved	MGC22825, Shax3, VPS32C	uc003ycl.3	Q96CF2	OTTHUMG00000164726	ENST00000297265.4:c.515A>T	8.37:g.82670408A>T	ENSP00000297265:p.Glu172Val	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	18.0	NM_152284	B2RBZ1	Missense_Mutation	SNP	ENST00000297265.4	37	CCDS6233.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.417224	0.83449	.	.	ENSG00000164695	ENST00000297265	T	0.74106	-0.81	6.17	6.17	0.99709	.	0.042099	0.85682	D	0.000000	D	0.88058	0.6335	M	0.92367	3.3	0.80722	D	1	P	0.51057	0.941	P	0.58210	0.835	D	0.90135	0.4209	10	0.59425	D	0.04	-31.8189	16.8222	0.85835	1.0:0.0:0.0:0.0	.	172	Q96CF2	CHM4C_HUMAN	V	172	ENSP00000297265:E172V	ENSP00000297265:E172V	E	+	2	0	CHMP4C	82832963	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.078000	0.76821	2.371000	0.80710	0.533000	0.62120	GAA	.		0.418	CHMP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379927.1	NM_152284	
CHRM2	1129	ucsc.edu;mdanderson.org	37	7	136701545	136701545	+	3'UTR	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:136701545G>T	ENST00000445907.2	+	0	2461				hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_3'UTR|CHRM2_ENST00000402486.3_3'UTR|CHRM2_ENST00000401861.1_3'UTR|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000592183.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TTTTGTTACGGTCCTATTTAG	0.348																																					.		.											.	CHRM2	94	0			.						.																																			SO:0001624	3_prime_UTR_variant	1129	.			GTTACGGTCCTAT		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.*532G>T	7.37:g.136701545G>T		Somatic	85.0	0.0		WXS	Illumina HiSeq	.	64.0	29.0	.	Q4VBK6|Q9P1X9	RNA	SNP	ENST00000445907.2	37	CCDS5843.1																																																																																			.		0.348	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
CIDEA	1149	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	12277129	12277129	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr18:12277129C>A	ENST00000320477.9	+	5	585	c.520C>A	c.(520-522)Ctg>Atg	p.L174M	CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a	174					apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						CAGGAGTCTGCTGCGGTTCCT	0.562																																					p.L174M		.											.	CIDEA	91	0			c.C520A						.						98.0	83.0	88.0					18																	12277129		2203	4300	6503	SO:0001583	missense	1149	exon5			AGTCTGCTGCGGT	AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.520C>A	18.37:g.12277129C>A	ENSP00000320209:p.Leu174Met	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	32.0	NM_001279	B0YIY7|Q6UPR7	Missense_Mutation	SNP	ENST00000320477.9	37	CCDS11856.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940687	0.34283	.	.	ENSG00000176194	ENST00000320477	D	0.84223	-1.82	4.87	2.69	0.31865	.	0.095899	0.42420	D	0.000701	D	0.90741	0.7094	M	0.86028	2.79	0.36724	D	0.88132	D;D	0.76494	0.999;0.998	D;D	0.66716	0.946;0.928	D	0.91596	0.5291	10	0.72032	D	0.01	-24.1273	7.7978	0.29158	0.0:0.7729:0.0:0.2271	.	208;174	Q8N5P9;O60543	.;CIDEA_HUMAN	M	174	ENSP00000320209:L174M	ENSP00000320209:L174M	L	+	1	2	CIDEA	12267129	0.990000	0.36364	0.990000	0.47175	0.270000	0.26580	-0.019000	0.12546	1.035000	0.39972	0.462000	0.41574	CTG	.		0.562	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254599.2	NM_001279	
CLDN17	26285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	31538834	31538834	+	Silent	SNP	A	A	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr21:31538834A>C	ENST00000286808.3	-	1	137	c.102T>G	c.(100-102)gcT>gcG	p.A34A		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	34					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						TGCCAACAAAAGCTGATACTC	0.502																																					p.A34A		.											.	CLDN17	92	0			c.T102G						.						68.0	71.0	70.0					21																	31538834		2203	4300	6503	SO:0001819	synonymous_variant	26285	exon1			AACAAAAGCTGAT	AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.102T>G	21.37:g.31538834A>C		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	14.0	NM_012131	Q3MJB5|Q6UY37	Silent	SNP	ENST00000286808.3	37	CCDS13586.1																																																																																			.		0.502	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000182261.1	NM_012131	
CLPTM1L	81037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	1330438	1330438	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr5:1330438C>G	ENST00000320895.5	-	9	1294	c.1037G>C	c.(1036-1038)aGc>aCc	p.S346T	CLPTM1L_ENST00000320927.6_Intron|CLPTM1L_ENST00000507807.1_Intron	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	346					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CACCAGCAGGCTCGTCTGCTC	0.642																																					p.S346T		.											.	CLPTM1L	153	0			c.G1037C						.						84.0	78.0	80.0					5																	1330438		2203	4299	6502	SO:0001583	missense	81037	exon9			AGCAGGCTCGTCT	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.1037G>C	5.37:g.1330438C>G	ENSP00000313854:p.Ser346Thr	Somatic	221.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	9.0	NM_030782	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	37	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.908983	0.92107	.	.	ENSG00000049656	ENST00000320895	T	0.59083	0.29	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.80994	0.4731	M	0.90922	3.16	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.85161	0.0992	10	0.54805	T	0.06	-33.4482	16.7303	0.85433	0.0:1.0:0.0:0.0	.	346	Q96KA5	CLP1L_HUMAN	T	346	ENSP00000313854:S346T	ENSP00000313854:S346T	S	-	2	0	CLPTM1L	1383438	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	7.254000	0.78329	2.213000	0.71641	0.655000	0.94253	AGC	.		0.642	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782	
CNGA3	1261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99013018	99013018	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:99013018A>G	ENST00000272602.2	+	7	1424	c.1385A>G	c.(1384-1386)gAc>gGc	p.D462G	CNGA3_ENST00000409937.1_Missense_Mutation_p.D466G|CNGA3_ENST00000436404.2_Missense_Mutation_p.D444G|CNGA3_ENST00000393504.1_Missense_Mutation_p.D462G			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	462					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						AGCCTCCCAGACAAGCTGAAG	0.577																																					p.D462G		.											.	CNGA3	96	0			c.A1385G						.						62.0	56.0	58.0					2																	99013018		2203	4300	6503	SO:0001583	missense	1261	exon8			TCCCAGACAAGCT	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.1385A>G	2.37:g.99013018A>G	ENSP00000272602:p.Asp462Gly	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	17.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	37	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	A	18.48	3.633103	0.67015	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.96716	-4.1;-4.1;-4.1;-4.1	4.92	4.92	0.64577	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.98220	0.9411	M	0.93062	3.375	0.80722	D	1	D;D;P	0.63046	0.983;0.992;0.681	P;D;B	0.63703	0.889;0.917;0.189	D	0.98745	1.0718	10	0.52906	T	0.07	.	13.7295	0.62779	1.0:0.0:0.0:0.0	.	466;444;462	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	G	462;444;462;466	ENSP00000377140:D462G;ENSP00000410070:D444G;ENSP00000272602:D462G;ENSP00000386761:D466G	ENSP00000272602:D462G	D	+	2	0	CNGA3	98379450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.758000	0.91663	2.076000	0.62316	0.456000	0.33151	GAC	.		0.577	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
CNOT1	23019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	58589731	58589731	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr16:58589731C>A	ENST00000317147.5	-	20	2893	c.2561G>T	c.(2560-2562)cGa>cTa	p.R854L	CNOT1_ENST00000569732.1_5'UTR|CNOT1_ENST00000569240.1_Missense_Mutation_p.R849L|CNOT1_ENST00000441024.2_Missense_Mutation_p.R854L	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	854	Interaction with ZFP36.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		ATTATATATTCGCTGGAAATA	0.403																																					p.R854L		.											.	CNOT1	95	0			c.G2561T						.						209.0	165.0	180.0					16																	58589731		2198	4300	6498	SO:0001583	missense	23019	exon20			TATATTCGCTGGA	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.2561G>T	16.37:g.58589731C>A	ENSP00000320949:p.Arg854Leu	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	13.0	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	37	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	C	36	5.869921	0.97049	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.52754	0.7;0.65	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.75459	0.3852	M	0.88105	2.93	0.80722	D	1	D;P;P	0.63046	0.992;0.91;0.929	D;P;P	0.72982	0.979;0.492;0.82	T	0.79090	-0.1946	10	0.72032	D	0.01	.	20.0308	0.97536	0.0:1.0:0.0:0.0	.	854;854;849	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	L	854;283;849;854	ENSP00000320949:R854L;ENSP00000413113:R854L	ENSP00000320949:R854L	R	-	2	0	CNOT1	57147232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.732000	0.93576	0.585000	0.79938	CGA	.		0.403	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CRTC2	200186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	153920605	153920605	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:153920605G>T	ENST00000368633.1	-	14	2189	c.2062C>A	c.(2062-2064)Cgc>Agc	p.R688S	CRTC2_ENST00000368630.3_Missense_Mutation_p.R368S|DENND4B_ENST00000361217.4_5'Flank	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	688					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CGGTCACTGCGGAATGACTCC	0.602																																					p.R688S		.											.	CRTC2	228	0			c.C2062A						.						83.0	71.0	75.0					1																	153920605		2203	4300	6503	SO:0001583	missense	200186	exon14			CACTGCGGAATGA	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.2062C>A	1.37:g.153920605G>T	ENSP00000357622:p.Arg688Ser	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	14.0	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	37	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156510	0.78114	.	.	ENSG00000160741	ENST00000368630;ENST00000368633	D;T	0.81659	-1.52;0.45	4.65	4.65	0.58169	Transducer of regulated CREB activity, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.85741	0.5767	M	0.64170	1.965	0.46609	D	0.999124	D;D	0.89917	1.0;0.967	D;P	0.87578	0.998;0.777	D	0.87363	0.2345	10	0.87932	D	0	-13.0267	15.0504	0.71865	0.0:0.0:1.0:0.0	.	688;368	Q53ET0;Q5T4K5	CRTC2_HUMAN;.	S	368;688	ENSP00000357619:R368S;ENSP00000357622:R688S	ENSP00000357619:R368S	R	-	1	0	CRTC2	152187229	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.454000	0.73493	2.419000	0.82065	0.462000	0.41574	CGC	.		0.602	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
CRB1	23418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197404289	197404289	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:197404289C>A	ENST00000367400.3	+	9	3431	c.3296C>A	c.(3295-3297)aCa>aAa	p.T1099K	CRB1_ENST00000535699.1_Missense_Mutation_p.T1075K|CRB1_ENST00000367397.1_Missense_Mutation_p.T480K|RP11-75C23.1_ENST00000422250.1_RNA|CRB1_ENST00000367399.2_Missense_Mutation_p.T987K|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000544212.1_Missense_Mutation_p.T580K	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1099	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.		T -> K (in RP12). {ECO:0000269|PubMed:21987686}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGTCTAAGTACAATAGAAATC	0.358																																					p.T1099K		.											.	CRB1	161	0			c.C3296A						.						59.0	64.0	62.0					1																	197404289		2203	4300	6503	SO:0001583	missense	23418	exon9			TAAGTACAATAGA		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3296C>A	1.37:g.197404289C>A	ENSP00000356370:p.Thr1099Lys	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	14.0	NM_201253	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837562	0.50951	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.79269	0.4417	M	0.70595	2.14	0.45777	D	0.998664	D;D;D;D	0.89917	1.0;1.0;0.992;0.982	D;D;P;P	0.85130	0.997;0.996;0.73;0.824	T	0.76743	-0.2847	9	0.32370	T	0.25	.	13.0831	0.59125	0.0:0.9268:0.0:0.0732	.	1075;987;748;1099	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	K	1075;1099;987;580;480;748	ENSP00000438786:T1075K;ENSP00000356370:T1099K;ENSP00000356369:T987K;ENSP00000444556:T580K;ENSP00000356367:T480K	ENSP00000356367:T480K	T	+	2	0	CRB1	195670912	1.000000	0.71417	0.995000	0.50966	0.345000	0.29048	4.441000	0.59981	2.681000	0.91329	0.650000	0.86243	ACA	.		0.358	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113326812	113326812	+	Silent	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:113326812A>G	ENST00000297405.5	-	48	7639	c.7395T>C	c.(7393-7395)tcT>tcC	p.S2465S	CSMD3_ENST00000352409.3_Silent_p.S2395S|CSMD3_ENST00000455883.2_Silent_p.S2361S|CSMD3_ENST00000343508.3_Silent_p.S2425S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2465	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGACTCCAGTAGAATCTAGCC	0.388										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S2465S		.											.	CSMD3	1132	0			c.T7395C						.						64.0	62.0	63.0					8																	113326812		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon48			TCCAGTAGAATCT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7395T>C	8.37:g.113326812A>G		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	13.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.388	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
CTIF	9811	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	46287965	46287965	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr18:46287965A>G	ENST00000256413.3	+	9	1571	c.1276A>G	c.(1276-1278)Agc>Ggc	p.S426G	CTIF_ENST00000382998.4_Missense_Mutation_p.S428G	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	426	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GTCCGACCGCAGCTTCGCCTT	0.597																																					p.S428G		.											.	CTIF	156	0			c.A1282G						.						124.0	96.0	106.0					18																	46287965		2203	4300	6503	SO:0001583	missense	9811	exon10			GACCGCAGCTTCG	AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.1276A>G	18.37:g.46287965A>G	ENSP00000256413:p.Ser426Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	29.0	NM_001142397	B3KTR8|Q8IVD5	Missense_Mutation	SNP	ENST00000256413.3	37	CCDS11935.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.702561	0.88924	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.24908	1.83;1.83	5.75	5.75	0.90469	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.082208	0.85682	D	0.000000	T	0.43411	0.1246	L	0.45581	1.43	0.58432	D	0.999998	D;D	0.69078	0.993;0.997	P;D	0.65140	0.888;0.932	T	0.27872	-1.0061	10	0.59425	D	0.04	-14.5574	15.7442	0.77926	1.0:0.0:0.0:0.0	.	428;426	O43310-2;O43310	.;CTIF_HUMAN	G	426;428;378	ENSP00000256413:S426G;ENSP00000372459:S428G	ENSP00000256413:S426G	S	+	1	0	CTIF	44541963	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.927000	0.92846	2.194000	0.70268	0.533000	0.62120	AGC	.		0.597	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255907.1	NM_014772	
CYP39A1	51302	hgsc.bcm.edu;broad.mit.edu	37	6	46609971	46609971	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:46609971C>T	ENST00000275016.2	-	2	445	c.242G>A	c.(241-243)gGa>gAa	p.G81E		NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	81					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)		EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						CACATTAATTCCTTCTTCTTC	0.308																																					p.G81E		.											.	CYP39A1	91	0			c.G242A						.						70.0	72.0	72.0					6																	46609971		2203	4295	6498	SO:0001583	missense	51302	exon2			TTAATTCCTTCTT	AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.242G>A	6.37:g.46609971C>T	ENSP00000275016:p.Gly81Glu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	4.0	NM_016593	Q5VTT0|Q96FW5	Missense_Mutation	SNP	ENST00000275016.2	37	CCDS4916.1	.	.	.	.	.	.	.	.	.	.	C	18.85	3.711223	0.68730	.	.	ENSG00000146233	ENST00000275016	T	0.68624	-0.34	4.7	4.7	0.59300	.	0.066550	0.64402	D	0.000014	T	0.76154	0.3948	M	0.70275	2.135	0.49483	D	0.999797	D;D	0.76494	0.999;0.999	D;D	0.68621	0.959;0.959	T	0.78290	-0.2261	10	0.54805	T	0.06	-10.742	16.7908	0.85589	0.0:1.0:0.0:0.0	.	81;81	B7Z786;Q9NYL5	.;CP39A_HUMAN	E	81	ENSP00000275016:G81E	ENSP00000275016:G81E	G	-	2	0	CYP39A1	46717930	0.977000	0.34250	1.000000	0.80357	0.980000	0.70556	2.232000	0.43018	2.321000	0.78463	0.563000	0.77884	GGA	.		0.308	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040787.1		
BRINP1	1620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	121930349	121930349	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:121930349G>C	ENST00000265922.3	-	8	1760	c.1299C>G	c.(1297-1299)aaC>aaG	p.N433K	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	433					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											CGCAGCTGTTGTTCCCGCCTA	0.632																																					p.N433K		.											.	DBC1	582	0			c.C1299G						.						29.0	29.0	29.0					9																	121930349		2203	4300	6503	SO:0001583	missense	1620	exon8			GCTGTTGTTCCCG	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1299C>G	9.37:g.121930349G>C	ENSP00000265922:p.Asn433Lys	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	13.0	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.233538	0.79688	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.52754	0.65	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.49558	0.1564	L	0.36672	1.1	0.80722	D	1	D	0.53885	0.963	P	0.47402	0.546	T	0.52003	-0.8633	10	0.72032	D	0.01	-34.6636	19.8211	0.96595	0.0:0.0:1.0:0.0	.	433	O60477	DBC1_HUMAN	K	433	ENSP00000265922:N433K	ENSP00000265922:N433K	N	-	3	2	DBC1	120970170	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.771000	0.98977	2.687000	0.91594	0.655000	0.94253	AAC	.		0.632	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
BRINP1	1620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	121976358	121976358	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:121976358C>T	ENST00000265922.3	-	6	1222	c.761G>A	c.(760-762)gGg>gAg	p.G254E	BRINP1_ENST00000373964.2_Missense_Mutation_p.G254E	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	254					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											CTCCCCCTCCCCATTGCACAT	0.517																																					p.G254E		.											.	DBC1	582	0			c.G761A						.						114.0	94.0	101.0					9																	121976358		2203	4300	6503	SO:0001583	missense	1620	exon6			CCCTCCCCATTGC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.761G>A	9.37:g.121976358C>T	ENSP00000265922:p.Gly254Glu	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	40.0	NM_014618	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	ENST00000265922.3	37	CCDS6822.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.290940	0.59976	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.47869	2.41;0.83	5.59	4.68	0.58851	.	0.048659	0.85682	D	0.000000	T	0.55273	0.1910	L	0.42245	1.32	0.80722	D	1	P;D	0.71674	0.918;0.998	P;P	0.56823	0.604;0.807	T	0.57318	-0.7832	10	0.52906	T	0.07	-13.9737	14.8812	0.70534	0.1445:0.8555:0.0:0.0	.	254;254	O60477-2;O60477	.;DBC1_HUMAN	E	254	ENSP00000265922:G254E;ENSP00000363075:G254E	ENSP00000265922:G254E	G	-	2	0	DBC1	121016179	1.000000	0.71417	0.715000	0.30552	0.986000	0.74619	7.482000	0.81143	1.337000	0.45525	0.558000	0.71614	GGG	.		0.517	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055440.2	NM_014618	
DCDC2	51473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	24278324	24278324	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:24278324T>A	ENST00000378454.3	-	7	1176	c.875A>T	c.(874-876)aAa>aTa	p.K292I		NM_001195610.1|NM_016356.3	NP_001182539.1|NP_057440.2	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	292					cellular defense response (GO:0006968)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|neuron migration (GO:0001764)|visual learning (GO:0008542)					breast(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32		Ovarian(999;0.101)				TACATTTTGTTTCAATTTCGT	0.328																																					p.K292I		.											.	DCDC2	91	0			c.A875T						.						143.0	138.0	140.0					6																	24278324		2203	4300	6503	SO:0001583	missense	51473	exon8			TTTTGTTTCAATT	AB032980	CCDS4550.1	6p22.1	2008-02-05			ENSG00000146038	ENSG00000146038			18141	protein-coding gene	gene with protein product		605755				10601354, 10574461	Standard	NM_001195610		Approved	RU2, KIAA1154, DCDC2A	uc003ndx.3	Q9UHG0	OTTHUMG00000016275	ENST00000378454.3:c.875A>T	6.37:g.24278324T>A	ENSP00000367715:p.Lys292Ile	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	13.0	NM_001195610	Q5VTR8|Q5VTR9|Q86W35|Q9UFD1|Q9UHG1|Q9ULR6	Missense_Mutation	SNP	ENST00000378454.3	37	CCDS4550.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.205264	0.58234	.	.	ENSG00000146038	ENST00000378454	T	0.02890	4.12	4.75	4.75	0.60458	.	0.339687	0.34700	N	0.003748	T	0.03220	0.0094	L	0.39397	1.21	0.80722	D	1	D	0.58970	0.984	P	0.55161	0.77	T	0.56798	-0.7919	10	0.44086	T	0.13	0.0289	12.5327	0.56124	0.0:0.0:0.0:1.0	.	292	Q9UHG0	DCDC2_HUMAN	I	292	ENSP00000367715:K292I	ENSP00000367715:K292I	K	-	2	0	DCDC2	24386303	1.000000	0.71417	0.891000	0.34965	0.432000	0.31715	4.054000	0.57434	2.120000	0.65058	0.533000	0.62120	AAA	.		0.328	DCDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043604.1	NM_016356	
DCHS1	8642	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6644337	6644337	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:6644337G>T	ENST00000299441.3	-	21	8981	c.8570C>A	c.(8569-8571)cCc>cAc	p.P2857H	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2857	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCAAAATAGGGGGAAGAGGT	0.637																																					p.P2857H		.											.	DCHS1	73	0			c.C8570A						.						32.0	30.0	31.0					11																	6644337		2201	4294	6495	SO:0001583	missense	8642	exon21			AAATAGGGGGAAG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.8570C>A	11.37:g.6644337G>T	ENSP00000299441:p.Pro2857His	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	17.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.130236	0.56721	.	.	ENSG00000166341	ENST00000299441	T	0.64991	-0.13	4.97	4.97	0.65823	Cadherin (3);Cadherin-like (1);	0.000000	0.39146	N	0.001444	T	0.79381	0.4436	M	0.82132	2.575	0.58432	D	0.999997	D	0.89917	1.0	D	0.76071	0.987	T	0.78094	-0.2338	10	0.33141	T	0.24	.	16.9706	0.86298	0.0:0.0:1.0:0.0	.	2857	Q96JQ0	PCD16_HUMAN	H	2857	ENSP00000299441:P2857H	ENSP00000299441:P2857H	P	-	2	0	DCHS1	6600913	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.860000	0.86993	2.587000	0.87381	0.655000	0.94253	CCC	.		0.637	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
DIDO1	11083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61522428	61522428	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr20:61522428C>T	ENST00000266070.4	-	15	3750	c.3425G>A	c.(3424-3426)aGc>aAc	p.S1142N	DIDO1_ENST00000395335.2_Missense_Mutation_p.S1142N|DIDO1_ENST00000395340.1_Missense_Mutation_p.S1142N|DIDO1_ENST00000395343.1_Missense_Mutation_p.S1142N	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1142					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GCGGCCACGGCTGCTGAAATA	0.552																																					p.S1142N	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1	96	0			c.G3425A						.						98.0	97.0	97.0					20																	61522428		2203	4300	6503	SO:0001583	missense	11083	exon15			CCACGGCTGCTGA	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3425G>A	20.37:g.61522428C>T	ENSP00000266070:p.Ser1142Asn	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	16.0	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	35	5.441265	0.96187	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.16597	2.65;2.65;2.33;2.33	5.31	5.31	0.75309	Spen paralogue and orthologue SPOC, C-terminal (1);	0.000000	0.51477	D	0.000090	T	0.40546	0.1121	L	0.56124	1.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.14531	-1.0469	10	0.87932	D	0	-39.6478	19.3406	0.94339	0.0:1.0:0.0:0.0	.	1142;1142	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	N	1142	ENSP00000266070:S1142N;ENSP00000378752:S1142N;ENSP00000378749:S1142N;ENSP00000378744:S1142N	ENSP00000266070:S1142N	S	-	2	0	DIDO1	60992873	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.624000	0.83124	2.636000	0.89361	0.655000	0.94253	AGC	.		0.552	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
DLG5	9231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	79569437	79569437	+	Silent	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr10:79569437G>A	ENST00000372391.2	-	24	4520	c.4515C>T	c.(4513-4515)atC>atT	p.I1505I	DLG5_ENST00000459739.1_5'UTR|DLG5_ENST00000372388.2_Silent_p.I1165I	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1505	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GGGACTTTTTGATGAAGACAA	0.542																																					p.I1505I		.											.	DLG5	98	0			c.C4515T						.						190.0	190.0	190.0					10																	79569437		2203	4300	6503	SO:0001819	synonymous_variant	9231	exon24			CTTTTTGATGAAG	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.4515C>T	10.37:g.79569437G>A		Somatic	240.0	0.0		WXS	Illumina HiSeq	Phase_I	207.0	55.0	NM_004747	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Silent	SNP	ENST00000372391.2	37	CCDS7353.2																																																																																			.		0.542	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048900.2		
DNAH6	1768	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84775472	84775472	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:84775472A>T	ENST00000237449.6	+	7	1255	c.1247A>T	c.(1246-1248)tAt>tTt	p.Y416F	DNAH6_ENST00000389394.3_Missense_Mutation_p.Y416F|DNAH6_ENST00000398278.2_Missense_Mutation_p.Y416F			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	416	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TTGCCCACTTATGGAGACTCT	0.373																																					p.Y416F		.											.	DNAH6	69	0			c.A1247T						.						118.0	116.0	116.0					2																	84775472		2203	4300	6503	SO:0001583	missense	1768	exon8			CCACTTATGGAGA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.1247A>T	2.37:g.84775472A>T	ENSP00000237449:p.Tyr416Phe	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	19.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	6.679	0.493778	0.12702	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.24538	1.85;1.99;1.85	4.92	-0.481	0.12082	.	.	.	.	.	T	0.10594	0.0259	N	0.15975	0.35	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36040	-0.9764	9	0.13470	T	0.59	.	2.5006	0.04632	0.4652:0.3124:0.0827:0.1396	.	416	Q9C0G6	DYH6_HUMAN	F	416	ENSP00000374045:Y416F;ENSP00000381326:Y416F;ENSP00000237449:Y416F	ENSP00000237449:Y416F	Y	+	2	0	DNAH6	84628983	0.042000	0.20092	0.000000	0.03702	0.078000	0.17371	0.430000	0.21428	-0.225000	0.09913	0.482000	0.46254	TAT	.		0.373	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DNAJB6	10049	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	157155965	157155965	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:157155965G>T	ENST00000262177.4	+	3	380		c.e3+1		DNAJB6_ENST00000429029.2_Splice_Site|DNAJB6_ENST00000443280.1_Splice_Site|DNAJB6_ENST00000452797.2_Intron	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6						intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		CTGTCGGATGGTGAGTGACAG	0.517																																					.	Esophageal Squamous(46;195 967 1350 20350 43814)	.											.	DNAJB6	93	0			c.175+1G>T						.						53.0	50.0	51.0					7																	157155965		2203	4299	6502	SO:0001630	splice_region_variant	10049	exon3			CGGATGGTGAGTG	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.175+1G>T	7.37:g.157155965G>T		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	14.0	NM_005494	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Splice_Site	SNP	ENST00000262177.4	37	CCDS5946.1	.	.	.	.	.	.	.	.	.	.	G	14.27	2.485859	0.44147	.	.	ENSG00000105993	ENST00000441561;ENST00000429029;ENST00000262177;ENST00000417758;ENST00000443280;ENST00000421417;ENST00000437030;ENST00000412557;ENST00000453383	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5382	0.87840	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAJB6	156848726	1.000000	0.71417	0.997000	0.53966	0.233000	0.25261	8.947000	0.93000	2.217000	0.71921	0.557000	0.71058	.	.		0.517	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		Intron
DNAJC22	79962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49743205	49743205	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:49743205C>G	ENST00000549441.2	+	3	1754	c.550C>G	c.(550-552)Cgt>Ggt	p.R184G	DNAJC22_ENST00000395069.3_Missense_Mutation_p.R184G			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	184						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						GCGGCTCTATCGTCTGGGCTT	0.577																																					p.R184G		.											.	DNAJC22	159	0			c.C550G						.						76.0	74.0	75.0					12																	49743205		2203	4300	6503	SO:0001583	missense	79962	exon2			CTCTATCGTCTGG	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.550C>G	12.37:g.49743205C>G	ENSP00000446830:p.Arg184Gly	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	19.0	NM_024902	B3KP54	Missense_Mutation	SNP	ENST00000549441.2	37	CCDS8785.1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.501000	0.44455	.	.	ENSG00000178401	ENST00000549441;ENST00000395069	T;T	0.46451	0.87;0.87	4.87	2.03	0.26663	.	0.095437	0.64402	D	0.000001	T	0.35770	0.0943	M	0.66939	2.045	0.48696	D	0.999699	P	0.44578	0.838	B	0.40199	0.322	T	0.07731	-1.0757	10	0.41790	T	0.15	-3.595	5.5044	0.16846	0.1384:0.6221:0.0:0.2395	.	184	Q8N4W6	DJC22_HUMAN	G	184	ENSP00000446830:R184G;ENSP00000378508:R184G	ENSP00000378508:R184G	R	+	1	0	DNAJC22	48029472	0.653000	0.27358	0.991000	0.47740	0.775000	0.43874	0.700000	0.25601	0.203000	0.20529	0.561000	0.74099	CGT	.		0.577	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
DNAJC6	9829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	65874377	65874377	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:65874377A>T	ENST00000395325.3	+	17	2531	c.2374A>T	c.(2374-2376)Aat>Tat	p.N792Y	DNAJC6_ENST00000263441.7_Missense_Mutation_p.N779Y|DNAJC6_ENST00000371069.4_Missense_Mutation_p.N849Y	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	792					cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TCAAGGTTTCAATGCTCACAA	0.388																																					p.N849Y		.											.	DNAJC6	272	0			c.A2545T						.						90.0	94.0	92.0					1																	65874377		2203	4300	6503	SO:0001583	missense	9829	exon17			GGTTTCAATGCTC	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2374A>T	1.37:g.65874377A>T	ENSP00000378735:p.Asn792Tyr	Somatic	361.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	71.0	NM_001256864	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	ENST00000395325.3	37	CCDS30739.1	.	.	.	.	.	.	.	.	.	.	A	19.02	3.745735	0.69418	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	T;T;T	0.23754	1.89;1.89;1.89	5.37	5.37	0.77165	Heat shock protein DnaJ, N-terminal (2);	0.225310	0.46442	D	0.000283	T	0.32793	0.0841	L	0.44542	1.39	0.47153	D	0.999337	D;D	0.60575	0.988;0.961	D;P	0.65874	0.939;0.784	T	0.08973	-1.0696	10	0.72032	D	0.01	.	15.5421	0.76062	1.0:0.0:0.0:0.0	.	849;792	O75061-2;O75061	.;AUXI_HUMAN	Y	779;792;849	ENSP00000263441:N779Y;ENSP00000378735:N792Y;ENSP00000360108:N849Y	ENSP00000263441:N779Y	N	+	1	0	DNAJC6	65646965	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.549000	0.45803	2.254000	0.74563	0.460000	0.39030	AAT	.		0.388	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025134.1		
DNHD1	144132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6550235	6550235	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:6550235T>A	ENST00000527990.2	+	10	2231	c.2231T>A	c.(2230-2232)gTg>gAg	p.V744E	DNHD1_ENST00000254579.6_Missense_Mutation_p.V744E			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	744					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		AAGAACTACGTGACGCTGGTG	0.522																																					p.V744E		.											.	DNHD1	24	0			c.T2231A						.						150.0	139.0	142.0					11																	6550235		692	1591	2283	SO:0001583	missense	144132	exon12			ACTACGTGACGCT	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.2231T>A	11.37:g.6550235T>A	ENSP00000436180:p.Val744Glu	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	14.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	37	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	T	12.70	2.017813	0.35606	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000534210	T;T	0.25414	1.8;1.8	5.54	0.0919	0.14470	.	.	.	.	.	T	0.12518	0.0304	L	0.32530	0.975	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.37820	-0.9689	9	0.02654	T	1	.	2.489	0.04606	0.1418:0.0809:0.2942:0.4831	.	744	Q96M86	DNHD1_HUMAN	E	744;744;10	ENSP00000254579:V744E;ENSP00000436180:V744E	ENSP00000254579:V744E	V	+	2	0	DNHD1	6506811	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.332000	0.07904	-0.242000	0.09667	0.528000	0.53228	GTG	.		0.522	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
DSG2	1829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	29126582	29126582	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr18:29126582G>C	ENST00000261590.8	+	15	3442	c.3233G>C	c.(3232-3234)gGa>gCa	p.G1078A	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	1078					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			ACGGTGTCTGGAGCTGGAGTC	0.478																																					p.G1078A		.											.	DSG2	563	0			c.G3233C						.						87.0	84.0	85.0					18																	29126582		1899	4140	6039	SO:0001583	missense	1829	exon15			TGTCTGGAGCTGG	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.3233G>C	18.37:g.29126582G>C	ENSP00000261590:p.Gly1078Ala	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	15.0	NM_001943	Q4KKU6	Missense_Mutation	SNP	ENST00000261590.8	37	CCDS42423.1	.	.	.	.	.	.	.	.	.	.	G	2.670	-0.277769	0.05679	.	.	ENSG00000046604	ENST00000261590	T	0.63417	-0.04	4.4	0.393	0.16294	.	0.493791	0.18306	N	0.145241	T	0.42177	0.1191	N	0.24115	0.695	0.09310	N	0.999998	B	0.14012	0.009	B	0.12156	0.007	T	0.21449	-1.0245	10	0.24483	T	0.36	.	9.0184	0.36184	0.0838:0.4231:0.4931:0.0	.	1078	Q14126	DSG2_HUMAN	A	1078	ENSP00000261590:G1078A	ENSP00000261590:G1078A	G	+	2	0	DSG2	27380580	0.003000	0.15002	0.000000	0.03702	0.067000	0.16453	1.094000	0.30951	0.057000	0.16193	-0.229000	0.12294	GGA	.		0.478	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102508727	102508727	+	Silent	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr14:102508727G>A	ENST00000360184.4	+	68	12446	c.12282G>A	c.(12280-12282)gtG>gtA	p.V4094V	RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	4094	AAA 6. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GCAGGTGGGTGATGCTGAAGA	0.562																																					p.V4094V		.											.	DYNC1H1	98	0			c.G12282A						.						93.0	82.0	86.0					14																	102508727		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon68			GTGGGTGATGCTG	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.12282G>A	14.37:g.102508727G>A		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	14.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1																																																																																			.		0.562	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
EIF2B4	8890	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27590910	27590910	+	Silent	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:27590910C>A	ENST00000347454.4	-	7	858	c.687G>T	c.(685-687)ctG>ctT	p.L229L	SNX17_ENST00000537606.1_5'Flank|SNX17_ENST00000543024.1_5'Flank|EIF2B4_ENST00000493344.2_Silent_p.L250L|SNX17_ENST00000233575.2_5'Flank|AC074117.10_ENST00000412749.1_RNA|EIF2B4_ENST00000445933.2_Silent_p.L228L|EIF2B4_ENST00000451130.2_Silent_p.L249L	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	229					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGCACGAAGCAGGGCAATAC	0.582																																					p.L249L		.											.	EIF2B4	90	0			c.G747T						.						33.0	32.0	32.0					2																	27590910		2201	4295	6496	SO:0001819	synonymous_variant	8890	exon6			ACGAAGCAGGGCA	AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.687G>T	2.37:g.27590910C>A		Somatic	97.0	2.0		WXS	Illumina HiSeq	Phase_I	99.0	9.0	NM_172195	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Silent	SNP	ENST00000347454.4	37	CCDS33164.1																																																																																			.		0.582	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324448.1		
ERC1	23085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	1192448	1192448	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:1192448C>G	ENST00000397203.2	+	3	1194	c.788C>G	c.(787-789)aCa>aGa	p.T263R	ERC1_ENST00000360905.4_Missense_Mutation_p.T263R|ERC1_ENST00000546231.2_Missense_Mutation_p.T263R|ERC1_ENST00000589028.1_Missense_Mutation_p.T263R|ERC1_ENST00000543086.3_Missense_Mutation_p.T263R|ERC1_ENST00000355446.5_Missense_Mutation_p.T263R			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	263					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			GCAGAGCTGACAGAGGAGAAC	0.517																																					p.T263R		.											.	ERC1	660	0			c.C788G						.						85.0	77.0	79.0					12																	1192448		2203	4300	6503	SO:0001583	missense	23085	exon3			AGCTGACAGAGGA	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.788C>G	12.37:g.1192448C>G	ENSP00000380386:p.Thr263Arg	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	13.0	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Missense_Mutation	SNP	ENST00000397203.2	37	CCDS8508.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168205	0.78339	.	.	ENSG00000082805	ENST00000347735;ENST00000397203;ENST00000454194;ENST00000537890;ENST00000543086;ENST00000542302;ENST00000546231;ENST00000355446;ENST00000360905;ENST00000440394;ENST00000538971	T;T;T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89;0.89;0.89	5.62	5.62	0.85841	.	0.050212	0.85682	D	0.000000	T	0.60741	0.2292	L	0.59436	1.845	0.58432	D	0.99999	D;D;D;D	0.76494	0.995;0.982;0.994;0.999	D;P;P;D	0.76071	0.962;0.837;0.84;0.987	T	0.49341	-0.8950	10	0.15066	T	0.55	-15.5413	20.0247	0.97519	0.0:1.0:0.0:0.0	.	39;263;263;263	F5H327;Q8IUD2-2;Q8IUD2-3;Q8IUD2	.;.;.;RB6I2_HUMAN	R	263;263;263;263;263;263;263;263;263;263;39	ENSP00000340054:T263R;ENSP00000380386:T263R;ENSP00000438546:T263R;ENSP00000445336:T263R;ENSP00000442739:T263R;ENSP00000347621:T263R;ENSP00000354158:T263R;ENSP00000410064:T263R	ENSP00000340054:T263R	T	+	2	0	ERC1	1062709	1.000000	0.71417	0.965000	0.40720	0.955000	0.61496	4.759000	0.62227	2.804000	0.96469	0.655000	0.94253	ACA	.		0.517	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	65622636	65622636	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:65622636T>A	ENST00000370621.3	-	16	2908	c.2382A>T	c.(2380-2382)cgA>cgT	p.R794R	EYS_ENST00000370616.2_Splice_Site_p.R794R|EYS_ENST00000503581.1_Splice_Site_p.R794R			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	794	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TACACTCACATCTGaaataaa	0.318																																					p.R794R		.											.	EYS	660	0			c.A2382T						.						80.0	62.0	67.0					6																	65622636		692	1591	2283	SO:0001630	splice_region_variant	346007	exon16			CTCACATCTGAAA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2382-1A>T	6.37:g.65622636T>A		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	5.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	37																																																																																				.		0.318	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	Silent
FAM171A1	221061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	15290660	15290660	+	Silent	SNP	C	C	A	rs151163427	byFrequency	TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr10:15290660C>A	ENST00000378116.4	-	5	738	c.732G>T	c.(730-732)gcG>gcT	p.A244A	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	244						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						CAAACCGCCACGCCGCGACAT	0.552																																					p.A244A		.											.	FAM171A1	138	0			c.G732T						.						78.0	72.0	74.0					10																	15290660		2203	4300	6503	SO:0001819	synonymous_variant	221061	exon5			CCGCCACGCCGCG	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.732G>T	10.37:g.15290660C>A		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	26.0	NM_001010924	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	ENST00000378116.4	37	CCDS31154.1																																																																																			C|1.000;T|0.000		0.552	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046984.1	XM_167709	
FBXO30	84085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	146127013	146127013	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:146127013C>G	ENST00000237281.4	-	2	695	c.529G>C	c.(529-531)Gaa>Caa	p.E177Q		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	177							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		CCATAAGATTCTTCATCAACA	0.378																																					p.E177Q		.											.	FBXO30	291	0			c.G529C						.						170.0	168.0	169.0					6																	146127013		2203	4300	6503	SO:0001583	missense	84085	exon2			AAGATTCTTCATC	AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.529G>C	6.37:g.146127013C>G	ENSP00000237281:p.Glu177Gln	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	21.0	NM_032145	Q9BXZ7	Missense_Mutation	SNP	ENST00000237281.4	37	CCDS5208.1	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701985	0.30232	.	.	ENSG00000118496	ENST00000237281	T	0.20598	2.06	5.82	4.96	0.65561	.	0.146153	0.64402	D	0.000008	T	0.08133	0.0203	L	0.33485	1.01	0.46749	D	0.99918	B	0.20052	0.041	B	0.17433	0.018	T	0.08743	-1.0707	10	0.26408	T	0.33	-16.8672	15.2103	0.73219	0.0:0.9321:0.0:0.0679	.	177	Q8TB52	FBX30_HUMAN	Q	177	ENSP00000237281:E177Q	ENSP00000237281:E177Q	E	-	1	0	FBXO30	146168706	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.751000	0.68720	1.460000	0.47911	0.591000	0.81541	GAA	.		0.378	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042570.2		
FBXO43	286151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	101153047	101153047	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:101153047G>A	ENST00000428847.2	-	2	1751	c.1435C>T	c.(1435-1437)Cag>Tag	p.Q479*		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	479					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			AGTATACACTGCAGTACAGCT	0.363																																					p.Q479X		.											.	FBXO43	226	0			c.C1435T						.						213.0	199.0	203.0					8																	101153047		1836	4099	5935	SO:0001587	stop_gained	286151	exon2			TACACTGCAGTAC	BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.1435C>T	8.37:g.101153047G>A	ENSP00000403293:p.Gln479*	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	24.0	NM_001029860		Nonsense_Mutation	SNP	ENST00000428847.2	37	CCDS47904.1	.	.	.	.	.	.	.	.	.	.	G	37	6.049687	0.97236	.	.	ENSG00000156509	ENST00000428847	.	.	.	5.06	1.76	0.24704	.	0.410465	0.26140	N	0.026107	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	-2.092	6.8315	0.23913	0.0:0.3179:0.3124:0.3697	.	.	.	.	X	479	.	ENSP00000403293:Q479X	Q	-	1	0	FBXO43	101222223	0.004000	0.15560	0.224000	0.23877	0.799000	0.45148	0.532000	0.23067	0.569000	0.29329	0.655000	0.94253	CAG	.		0.363	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380380.1	XM_209918	
FBXO32	114907	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	124553194	124553194	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:124553194C>T	ENST00000517956.1	-	1	252	c.61G>A	c.(61-63)Ggc>Agc	p.G21S	FBXO32_ENST00000443022.2_Missense_Mutation_p.G21S	NM_058229.3|NM_148177.2	NP_478136.1|NP_680482.1	Q969P5	FBX32_HUMAN	F-box protein 32	21					cellular response to dexamethasone stimulus (GO:0071549)|protein ubiquitination (GO:0016567)|response to denervation involved in regulation of muscle adaptation (GO:0014894)	nucleolus (GO:0005730)|Z disc (GO:0030018)				autonomic_ganglia(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)|stomach(1)	21	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CGCTTCCAGCCGTCGGCCGTC	0.672																																					p.G21S		.											.	FBXO32	660	0			c.G61A						.						36.0	38.0	37.0					8																	124553194		2203	4300	6503	SO:0001583	missense	114907	exon1			TCCAGCCGTCGGC	AJ420108	CCDS6345.1, CCDS56553.1	8q24.13	2008-01-28	2004-06-15		ENSG00000156804	ENSG00000156804		"""F-boxes /  ""other"""""	16731	protein-coding gene	gene with protein product		606604	"""F-box only protein 32"""			11679633, 11717410	Standard	NM_058229		Approved	MAFbx, ATROGIN1, Fbx32	uc003yqr.3	Q969P5	OTTHUMG00000164981	ENST00000517956.1:c.61G>A	8.37:g.124553194C>T	ENSP00000428205:p.Gly21Ser	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	29.0	NM_001242463	A4KYM0	Missense_Mutation	SNP	ENST00000517956.1	37	CCDS6345.1	.	.	.	.	.	.	.	.	.	.	C	37	6.009963	0.97200	.	.	ENSG00000156804	ENST00000517956;ENST00000443022	T;T	0.23950	1.88;1.88	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.54224	0.1845	M	0.80982	2.52	0.42809	D	0.993959	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.987	T	0.62473	-0.6847	10	0.72032	D	0.01	-1.3489	16.9246	0.86173	0.0:1.0:0.0:0.0	.	21;21	A4KYM0;Q969P5	.;FBX32_HUMAN	S	21	ENSP00000428205:G21S;ENSP00000390790:G21S	ENSP00000390790:G21S	G	-	1	0	FBXO32	124622375	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.957000	0.76019	2.319000	0.78375	0.561000	0.74099	GGC	.		0.672	FBXO32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381281.1		
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152276077	152276077	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:152276077G>T	ENST00000368799.1	-	3	11320	c.11285C>A	c.(11284-11286)cCg>cAg	p.P3762Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3762	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTTGACCCCGGGTGTCCACG	0.602									Ichthyosis																												p.P3762Q		.											.	FLG	106	0			c.C11285A						.						354.0	348.0	350.0					1																	152276077		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GACCCCGGGTGTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.11285C>A	1.37:g.152276077G>T	ENSP00000357789:p.Pro3762Gln	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	25.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	9.136	1.012635	0.19277	.	.	ENSG00000143631	ENST00000368799	T	0.01647	4.71	3.25	2.28	0.28536	.	.	.	.	.	T	0.02193	0.0068	M	0.75447	2.3	0.09310	N	1	D	0.71674	0.998	P	0.61201	0.885	T	0.43909	-0.9362	9	0.15066	T	0.55	.	8.2723	0.31851	0.0:0.2459:0.7541:0.0	.	3762	P20930	FILA_HUMAN	Q	3762	ENSP00000357789:P3762Q	ENSP00000357789:P3762Q	P	-	2	0	FLG	150542701	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.054000	0.11826	0.659000	0.30945	0.552000	0.68991	CCG	.		0.602	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLNC	2318	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128485033	128485033	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:128485033G>A	ENST00000325888.8	+	21	3775	c.3514G>A	c.(3514-3516)Gag>Aag	p.E1172K	FLNC_ENST00000346177.6_Missense_Mutation_p.E1172K	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1172					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CAAGGTCGGTGAGGCAGCCAC	0.652																																					p.E1172K		.											.	FLNC	141	0			c.G3514A						.						41.0	48.0	45.0					7																	128485033		2167	4261	6428	SO:0001583	missense	2318	exon21			GTCGGTGAGGCAG	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3514G>A	7.37:g.128485033G>A	ENSP00000327145:p.Glu1172Lys	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	22.0	NM_001127487	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	ENST00000325888.8	37	CCDS43644.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873070	0.91664	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.86297	-2.1;-2.1	5.56	5.56	0.83823	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91925	0.7443	L	0.52759	1.655	0.80722	D	1	D;P	0.76494	0.999;0.923	D;P	0.85130	0.997;0.836	D	0.91049	0.4877	10	0.44086	T	0.13	.	19.5273	0.95212	0.0:0.0:1.0:0.0	.	1172;1172	Q14315-2;Q14315	.;FLNC_HUMAN	K	1172	ENSP00000327145:E1172K;ENSP00000344002:E1172K	ENSP00000327145:E1172K	E	+	1	0	FLNC	128272269	1.000000	0.71417	0.964000	0.40570	0.835000	0.47333	6.690000	0.74567	2.615000	0.88500	0.555000	0.69702	GAG	.		0.652	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059948.3		
FOCAD	54914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	20944661	20944661	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:20944661C>T	ENST00000380249.1	+	31	3807	c.3443C>T	c.(3442-3444)tCc>tTc	p.S1148F	FOCAD_ENST00000605086.1_Missense_Mutation_p.S584F|FOCAD_ENST00000338382.6_Missense_Mutation_p.S1148F	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	1148						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											CTTGTTCTGTCCCTCATGAGC	0.502																																					p.S1148F		.											.	.	.	0			c.C3443T						.						139.0	119.0	126.0					9																	20944661		2203	4300	6503	SO:0001583	missense	54914	exon31			TTCTGTCCCTCAT	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.3443C>T	9.37:g.20944661C>T	ENSP00000369599:p.Ser1148Phe	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	12.0	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.338875	0.81911	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.70399	-0.48;-0.48	5.73	4.82	0.62117	Armadillo-type fold (1);	0.476902	0.24732	N	0.036046	T	0.80686	0.4670	M	0.69823	2.125	0.52501	D	0.999954	D	0.58970	0.984	P	0.56700	0.804	D	0.83669	0.0165	10	0.87932	D	0	-11.97	16.8704	0.86039	0.0:0.8622:0.1378:0.0	.	1148	Q5VW36	K1797_HUMAN	F	1148	ENSP00000369599:S1148F;ENSP00000344307:S1148F	ENSP00000344307:S1148F	S	+	2	0	KIAA1797	20934661	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.039000	0.49791	1.500000	0.48636	0.655000	0.94253	TCC	.		0.502	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
FREM2	341640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	39422758	39422758	+	Silent	SNP	T	T	C	rs112083916	byFrequency	TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr13:39422758T>C	ENST00000280481.7	+	8	6546	c.6330T>C	c.(6328-6330)ctT>ctC	p.L2110L	FREM2_ENST00000482551.1_3'UTR	NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2110					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACGCAGCCCTTGGCGAGCCCA	0.433																																					p.L2110L		.											.	FREM2	100	0			c.T6330C						.						88.0	86.0	87.0					13																	39422758		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon8			AGCCCTTGGCGAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6330T>C	13.37:g.39422758T>C		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	16.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	37	CCDS31960.1																																																																																			T|0.995;G|0.005		0.433	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
FUCA2	2519	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	143828467	143828467	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:143828467A>T	ENST00000002165.6	-	2	374	c.319T>A	c.(319-321)Ttt>Att	p.F107I	RP1-20N2.6_ENST00000589563.1_RNA|RP1-20N2.6_ENST00000590703.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA|RP1-20N2.6_ENST00000591892.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000593045.1_RNA|FUCA2_ENST00000367585.1_5'UTR|RP1-20N2.6_ENST00000593175.1_RNA|FUCA2_ENST00000438118.2_Missense_Mutation_p.F107I|RP1-20N2.6_ENST00000591189.1_RNA	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	107					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		TTTGCTGTAAATAGTGGTCCA	0.363																																					p.F107I		.											.	FUCA2	91	0			c.T319A						.						103.0	117.0	112.0					6																	143828467		2203	4300	6503	SO:0001583	missense	2519	exon2			CTGTAAATAGTGG	BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.319T>A	6.37:g.143828467A>T	ENSP00000002165:p.Phe107Ile	Somatic	101.0	1.0		WXS	Illumina HiSeq	Phase_I	84.0	12.0	NM_032020	E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	ENST00000002165.6	37	CCDS5200.1	.	.	.	.	.	.	.	.	.	.	A	32	5.125932	0.94429	.	.	ENSG00000001036	ENST00000002165;ENST00000438118;ENST00000367585	T;T;T	0.76060	-0.99;-0.99;-0.99	5.21	5.21	0.72293	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.91459	0.7304	H	0.99525	4.61	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95002	0.8144	10	0.87932	D	0	-24.5471	15.2415	0.73474	1.0:0.0:0.0:0.0	.	107	Q9BTY2	FUCO2_HUMAN	I	107	ENSP00000002165:F107I;ENSP00000394151:F107I;ENSP00000356557:F107I	ENSP00000002165:F107I	F	-	1	0	FUCA2	143870160	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	8.761000	0.91691	2.179000	0.69175	0.533000	0.62120	TTT	.		0.363	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042521.2	NM_032020	
FUT1	2523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49253562	49253562	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:49253562G>C	ENST00000310160.3	-	4	1951	c.977C>G	c.(976-978)gCc>gGc	p.A326G	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	326					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		GGTGAAGTTGGCCAGGTAGAC	0.572																																					p.A326G		.											.	FUT1	227	0			c.C977G						.						100.0	76.0	84.0					19																	49253562		2203	4300	6503	SO:0001583	missense	2523	exon4			AAGTTGGCCAGGT		CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.977C>G	19.37:g.49253562G>C	ENSP00000312021:p.Ala326Gly	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	27.0	NM_000148	O14505|O14506|O14507	Missense_Mutation	SNP	ENST00000310160.3	37	CCDS12733.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932742	0.73442	.	.	ENSG00000174951	ENST00000310160;ENST00000539428	D	0.97553	-4.43	4.5	4.5	0.54988	.	0.102806	0.43260	D	0.000584	D	0.98068	0.9363	M	0.73430	2.235	0.35613	D	0.808809	D	0.89917	1.0	D	0.91635	0.999	D	0.99954	1.1593	10	0.49607	T	0.09	-5.5389	15.0977	0.72247	0.0:0.0:1.0:0.0	.	326	P19526	FUT1_HUMAN	G	326;316	ENSP00000312021:A326G	ENSP00000312021:A326G	A	-	2	0	FUT1	53945374	1.000000	0.71417	0.999000	0.59377	0.889000	0.51656	5.751000	0.68720	2.517000	0.84864	0.561000	0.74099	GCC	.		0.572	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466194.1	NM_000148	
FUT9	10690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	96651384	96651384	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:96651384C>A	ENST00000302103.5	+	3	679	c.353C>A	c.(352-354)aCa>aAa	p.T118K		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	118					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		TGGGATCTGACAAATTTACCT	0.463																																					p.T118K	Melanoma(98;1369 1476 6592 22940 26587)	.											.	FUT9	95	0			c.C353A						.						116.0	103.0	107.0					6																	96651384		2203	4300	6503	SO:0001583	missense	10690	exon3			ATCTGACAAATTT	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.353C>A	6.37:g.96651384C>A	ENSP00000302599:p.Thr118Lys	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	17.0	NM_006581	Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	37	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	C	12.76	2.034890	0.35893	.	.	ENSG00000172461	ENST00000302103	T	0.21361	2.01	5.3	5.3	0.74995	.	0.098721	0.64402	D	0.000001	T	0.07413	0.0187	N	0.26042	0.785	0.54753	D	0.999986	B	0.13594	0.008	B	0.19666	0.026	T	0.11567	-1.0582	10	0.09084	T	0.74	-15.1735	18.3049	0.90177	0.0:1.0:0.0:0.0	.	118	Q9Y231	FUT9_HUMAN	K	118	ENSP00000302599:T118K	ENSP00000302599:T118K	T	+	2	0	FUT9	96758105	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	5.705000	0.68355	2.643000	0.89663	0.655000	0.94253	ACA	.		0.463	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581	
FXYD3	5349	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35614352	35614352	+	Silent	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:35614352C>T	ENST00000344013.6	+	9	451	c.255C>T	c.(253-255)gcC>gcT	p.A85A	FXYD3_ENST00000604621.1_Silent_p.A85A|LGI4_ENST00000493050.1_5'Flank|FXYD3_ENST00000604404.1_Silent_p.A85A|FXYD3_ENST00000535103.1_Silent_p.A142A|FXYD3_ENST00000603524.1_Silent_p.A114A|FXYD3_ENST00000435734.2_Silent_p.A111A|FXYD3_ENST00000603181.1_Silent_p.A85A|FXYD3_ENST00000604804.1_Silent_p.A114A|FXYD3_ENST00000406988.1_Silent_p.A85A|FXYD3_ENST00000604255.1_Silent_p.A142A|FXYD3_ENST00000346446.5_Silent_p.A111A			Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3	85					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of catalytic activity (GO:0050790)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			endometrium(1)|lung(2)|prostate(1)	4	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CAGGCTCAGCCCAAAGCTGAT	0.517																																					p.A142A		.											.	FXYD3	90	0			c.C426T						.						132.0	112.0	119.0					19																	35614352		2203	4300	6503	SO:0001819	synonymous_variant	5349	exon11			CTCAGCCCAAAGC	X93036	CCDS12442.1, CCDS12443.1, CCDS46048.1, CCDS46049.1, CCDS46050.1	19q13.11-q13.12	2008-05-14	2002-01-14			ENSG00000089356			4027	protein-coding gene	gene with protein product		604996	"""FXYD domain-containing ion transport regulator 3"""	PLML		7836447, 10950925	Standard	NM_005971		Approved	MAT-8	uc010xsm.2	Q14802		ENST00000344013.6:c.255C>T	19.37:g.35614352C>T		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	10.0	NM_001136007	A6NDE0|C9JDU2|F5H174|F8WB34|Q13211|Q6IB59	Silent	SNP	ENST00000344013.6	37	CCDS12442.1																																																																																			.		0.517	FXYD3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000468985.1	NM_021910	
GALNT13	114805	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	155098670	155098670	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:155098670C>A	ENST00000392825.3	+	5	1006	c.439C>A	c.(439-441)Ctc>Atc	p.L147I	GALNT13_ENST00000409237.1_Missense_Mutation_p.L147I	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	147	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						ACACTATCTACTCTCAGAGGT	0.353																																					p.L147I		.											.	GALNT13	95	0			c.C439A						.						128.0	118.0	121.0					2																	155098670		2203	4300	6503	SO:0001583	missense	114805	exon5			TATCTACTCTCAG	AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.439C>A	2.37:g.155098670C>A	ENSP00000376570:p.Leu147Ile	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	31.0	NM_052917	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	ENST00000392825.3	37	CCDS2199.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.257670	0.39896	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.61510	0.1;0.1	5.56	5.56	0.83823	Glycosyl transferase, family 2 (1);	0.130565	0.50627	D	0.000108	T	0.51432	0.1674	L	0.49455	1.56	0.58432	D	0.999998	B;B	0.33755	0.424;0.224	B;B	0.37015	0.239;0.239	T	0.44360	-0.9333	10	0.19590	T	0.45	.	11.5969	0.50979	0.0:0.918:0.0:0.082	.	147;147	Q08ER7;Q8IUC8	.;GLT13_HUMAN	I	147	ENSP00000376570:L147I;ENSP00000387239:L147I	ENSP00000376570:L147I	L	+	1	0	GALNT13	154806916	1.000000	0.71417	0.970000	0.41538	0.974000	0.67602	4.819000	0.62664	2.621000	0.88768	0.579000	0.79373	CTC	.		0.353	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254870.2	NM_052917	
GLIS3	169792	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	4117860	4117860	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:4117860C>G	ENST00000324333.10	-	3	1346	c.1153G>C	c.(1153-1155)Ggt>Cgt	p.G385R	GLIS3_ENST00000381971.3_Missense_Mutation_p.G540R	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	385					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		CGAGGGCAACCGGCCCAGAAG	0.577																																					p.G540R		.											.	GLIS3	91	0			c.G1618C						.						150.0	136.0	141.0					9																	4117860		2203	4300	6503	SO:0001583	missense	169792	exon4			GGCAACCGGCCCA	BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1153G>C	9.37:g.4117860C>G	ENSP00000325494:p.Gly385Arg	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	262.0	232.0	NM_001042413	B1AL19|Q1PHK5	Missense_Mutation	SNP	ENST00000324333.10	37	CCDS6451.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.401272	0.83120	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	D;T	0.93859	-3.3;2.41	5.51	5.51	0.81932	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.52532	D	0.000066	D	0.97108	0.9055	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D	0.89917	0.991;0.999;0.999;1.0;1.0	P;D;D;D;D	0.77557	0.801;0.935;0.974;0.99;0.99	D	0.97502	1.0061	10	0.87932	D	0	.	19.4269	0.94746	0.0:1.0:0.0:0.0	.	48;53;53;540;385	Q1PHK4;Q1PHK2;Q1PHK3;Q8NEA6-2;Q8NEA6	.;.;.;.;GLIS3_HUMAN	R	385;540	ENSP00000325494:G385R;ENSP00000371398:G540R	ENSP00000325494:G385R	G	-	1	0	GLIS3	4107860	1.000000	0.71417	0.912000	0.35992	0.613000	0.37349	7.792000	0.85828	2.595000	0.87683	0.655000	0.94253	GGT	.		0.577	GLIS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051559.1	NM_152629	
GNE	10020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	36223377	36223377	+	Silent	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:36223377C>T	ENST00000539815.1	-	7	1444	c.1404G>A	c.(1402-1404)ttG>ttA	p.L468L	GNE_ENST00000377902.5_Silent_p.L468L|GNE_ENST00000543356.2_Silent_p.L463L|GNE_ENST00000396594.3_Silent_p.L499L|GNE_ENST00000447283.2_Silent_p.L468L|GNE_ENST00000539208.1_Silent_p.L358L			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	468	N-acetylmannosamine kinase.				carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			TACCTACTCCCAAAATTCTGC	0.358																																					p.L499L	GBM(184;106 2118 20004 35750 50727)	.											.	GNE	115	0			c.G1497A						.						100.0	104.0	103.0					9																	36223377		2202	4299	6501	SO:0001819	synonymous_variant	10020	exon8			TACTCCCAAAATT	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.1404G>A	9.37:g.36223377C>T		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	15.0	NM_001128227	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Silent	SNP	ENST00000539815.1	37	CCDS6602.1																																																																																			.		0.358	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476	
GPHN	10243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	67647566	67647566	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr14:67647566G>C	ENST00000315266.5	+	22	3244	c.2123G>C	c.(2122-2124)gGa>gCa	p.G708A	GPHN_ENST00000543237.1_Missense_Mutation_p.G754A|GPHN_ENST00000478722.1_Missense_Mutation_p.G741A|GPHN_ENST00000305960.9_Missense_Mutation_p.G677A|GPHN_ENST00000544752.2_3'UTR	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	708	MPT adenylyltransferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		AGTGCCAATGGATTGTTGATG	0.478			T	MLL	AL																																p.G741A		.		Dom	yes		14	14q24	10243	gephyrin (GPH)		L	.	GPHN	228	0			c.G2222C						.						172.0	134.0	147.0					14																	67647566		2203	4300	6503	SO:0001583	missense	10243	exon23			CCAATGGATTGTT	AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.2123G>C	14.37:g.67647566G>C	ENSP00000312771:p.Gly708Ala	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	10.0	NM_020806	Q9H4E9|Q9P2G2	Missense_Mutation	SNP	ENST00000315266.5	37	CCDS32103.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.232|5.232	0.228381|0.228381	0.09916|0.09916	.|.	.|.	ENSG00000171723|ENSG00000171723	ENST00000556240|ENST00000315266;ENST00000478722;ENST00000543237;ENST00000305960	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|MoeA, C-terminal, domain IV (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.34803|0.34803	0.0910|0.0910	N|N	0.04090|0.04090	-0.28|-0.28	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.24186	.|0.047;0.099;0.058;0.099	.|B;B;B;B	.|0.19391	.|0.017;0.025;0.018;0.019	T|T	0.38735|0.38735	-0.9647|-0.9647	5|9	.|0.02654	.|T	.|1	-10.6074|-10.6074	20.1307|20.1307	0.97998|0.97998	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|677;754;708;741	.|F8W7D6;F5H039;Q9NQX3;Q9NQX3-2	.|.;.;GEPH_HUMAN;.	H|A	1|708;741;754;677	.|.	.|ENSP00000303019:G677A	D|G	+|+	1|2	0|0	GPHN|GPHN	66717319|66717319	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.713000|9.713000	0.98740|0.98740	2.768000|2.768000	0.95171|0.95171	0.467000|0.467000	0.42956|0.42956	GAT|GGA	.		0.478	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000074299.2	NM_020806	
GPR125	166647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	22425952	22425952	+	Silent	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr4:22425952A>G	ENST00000334304.5	-	11	1736	c.1467T>C	c.(1465-1467)atT>atC	p.I489I	GPR125_ENST00000508133.1_Silent_p.I263I|GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000502482.1_Silent_p.I489I	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	489					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				TGTTACTTGCAATGTCAACCA	0.448																																					p.I489I		.											.	GPR125	91	0			c.T1467C						.						137.0	121.0	126.0					4																	22425952		2203	4300	6503	SO:0001819	synonymous_variant	166647	exon11			ACTTGCAATGTCA	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1467T>C	4.37:g.22425952A>G		Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	100.0	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	37	CCDS33964.1																																																																																			.		0.448	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
GPR84	53831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54757483	54757483	+	Silent	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:54757483G>C	ENST00000551809.1	-	1	788	c.153C>G	c.(151-153)ctC>ctG	p.L51L	GPR84_ENST00000267015.3_Silent_p.L51L|RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						ATCGGGTACGGAGCTTGGGCT	0.587																																					p.L51L		.											.	GPR84	523	0			c.C153G						.						185.0	157.0	166.0					12																	54757483		2203	4300	6503	SO:0001819	synonymous_variant	53831	exon2			GGTACGGAGCTTG	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.153C>G	12.37:g.54757483G>C		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	23.0	NM_020370	B6V9G7	Silent	SNP	ENST00000551809.1	37	CCDS8878.1																																																																																			.		0.587	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
GPRC5B	51704	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	19883202	19883202	+	Silent	SNP	C	C	T	rs199935784		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr16:19883202C>T	ENST00000300571.2	-	2	1157	c.966G>A	c.(964-966)gaG>gaA	p.E322E	GPRC5B_ENST00000569847.1_Silent_p.E322E|GPRC5B_ENST00000535671.1_Silent_p.E322E|GPRC5B_ENST00000537135.1_Silent_p.E348E|GPRC5B_ENST00000569479.1_Silent_p.E322E	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	322					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GCTGCACGTCCTCCTCGAAGG	0.627																																					p.E322E		.											.	GPRC5B	523	0			c.G966A						.						78.0	73.0	74.0					16																	19883202		2197	4300	6497	SO:0001819	synonymous_variant	51704	exon2			CACGTCCTCCTCG	AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.966G>A	16.37:g.19883202C>T		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	19.0	NM_016235	D2DFB0|O75205|Q8NBZ8	Silent	SNP	ENST00000300571.2	37	CCDS10581.1																																																																																			C|0.999;G|0.000		0.627	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254285.1		
GPRC6A	222545	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	117128020	117128020	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:117128020A>T	ENST00000310357.3	-	3	869	c.848T>A	c.(847-849)gTt>gAt	p.V283D	GPRC6A_ENST00000368549.3_Missense_Mutation_p.V283D|GPRC6A_ENST00000530250.1_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	283					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V283A(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		GAGATCAAAAACATGGAATTG	0.348																																					p.V283D		.											.	GPRC6A	96	1	Substitution - Missense(1)	lung(1)	c.T848A						.						85.0	89.0	87.0					6																	117128020		2203	4299	6502	SO:0001583	missense	222545	exon3			TCAAAAACATGGA	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.848T>A	6.37:g.117128020A>T	ENSP00000309493:p.Val283Asp	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	12.0	NM_148963	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.002811	0.54254	.	.	ENSG00000173612	ENST00000310357;ENST00000368549	D;D	0.84070	-1.8;-1.8	6.17	6.17	0.99709	Extracellular ligand-binding receptor (1);	0.136963	0.32769	N	0.005669	D	0.89146	0.6632	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.965;0.998	D	0.89911	0.4052	10	0.62326	D	0.03	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	283;283	Q5T6X5-3;Q5T6X5	.;GPC6A_HUMAN	D	283	ENSP00000309493:V283D;ENSP00000357537:V283D	ENSP00000309493:V283D	V	-	2	0	GPRC6A	117234713	0.760000	0.28428	0.995000	0.50966	0.336000	0.28762	4.900000	0.63252	2.371000	0.80710	0.533000	0.62120	GTT	.		0.348	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
GREB1L	80000	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	19098035	19098035	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr18:19098035T>A	ENST00000580732.2	+	31	5693	c.5312T>A	c.(5311-5313)aTc>aAc	p.I1771N	GREB1L_ENST00000424526.1_Missense_Mutation_p.I1771N|GREB1L_ENST00000400483.4_3'UTR|GREB1L_ENST00000269218.6_Missense_Mutation_p.I1662N			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	1771						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						CTTCAATACATCTGTGCTCCC	0.498																																					p.I1771N		.											.	.	.	0			c.T5312A						.						95.0	82.0	86.0					18																	19098035		692	1591	2283	SO:0001583	missense	80000	exon31			AATACATCTGTGC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.5312T>A	18.37:g.19098035T>A	ENSP00000464162:p.Ile1771Asn	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	48.0	NM_001142966	A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.682562	0.88542	.	.	ENSG00000141449	ENST00000424526;ENST00000269218	T;T	0.10668	2.85;2.86	5.75	5.75	0.90469	.	.	.	.	.	T	0.14056	0.0340	L	0.36672	1.1	0.80722	D	1	P	0.35481	0.504	B	0.40101	0.319	T	0.01998	-1.1232	9	0.87932	D	0	-9.2428	16.0487	0.80740	0.0:0.0:0.0:1.0	.	1771	Q9C091	GRB1L_HUMAN	N	1771;1662	ENSP00000412060:I1771N;ENSP00000269218:I1662N	ENSP00000269218:I1662N	I	+	2	0	GREB1L	17352033	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	7.698000	0.84413	2.189000	0.69895	0.533000	0.62120	ATC	.		0.498	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
GRIK4	2900	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	120811107	120811107	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:120811107G>T	ENST00000527524.2	+	14	1815	c.1528G>T	c.(1528-1530)Gtg>Ttg	p.V510L	GRIK4_ENST00000438375.2_Missense_Mutation_p.V510L	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	510					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		ACGGGAGAAGGTGATTGATTT	0.443																																					p.V510L		.											.	GRIK4	92	0			c.G1528T						.						104.0	104.0	104.0					11																	120811107		2203	4299	6502	SO:0001583	missense	2900	exon12			GAGAAGGTGATTG	S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1528G>T	11.37:g.120811107G>T	ENSP00000435648:p.Val510Leu	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	15.0	NM_014619	A8K9L1	Missense_Mutation	SNP	ENST00000527524.2	37	CCDS8433.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267073	0.80469	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.12465	2.68;2.68	5.56	5.56	0.83823	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.23688	0.0573	M	0.77616	2.38	0.80722	D	1	B;B	0.31026	0.304;0.199	B;B	0.29785	0.107;0.093	T	0.03374	-1.1043	10	0.87932	D	0	.	19.1145	0.93332	0.0:0.0:1.0:0.0	.	510;510	A6H8K8;Q16099	.;GRIK4_HUMAN	L	510	ENSP00000435648:V510L;ENSP00000404063:V510L	ENSP00000404063:V510L	V	+	1	0	GRIK4	120316317	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.626000	0.88956	0.655000	0.94253	GTG	.		0.443	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109760.4	NM_014619	
HCFC2	29915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104480666	104480666	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:104480666A>G	ENST00000229330.4	+	8	1209	c.1105A>G	c.(1105-1107)Act>Gct	p.T369A		NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	369	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GATCAAAGCCACTACCAACTC	0.408																																					p.T369A	Esophageal Squamous(184;1814 2036 4771 6974 15702)	.											.	HCFC2	92	0			c.A1105G						.						171.0	151.0	158.0					12																	104480666		2203	4300	6503	SO:0001583	missense	29915	exon8			AAAGCCACTACCA	AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.1105A>G	12.37:g.104480666A>G	ENSP00000229330:p.Thr369Ala	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	28.0	NM_013320	B2R8Q5|C0H5X3	Missense_Mutation	SNP	ENST00000229330.4	37	CCDS9097.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.243258	0.79912	.	.	ENSG00000111727	ENST00000229330	T	0.56941	0.43	5.43	5.43	0.79202	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.52661	0.1748	L	0.53249	1.67	0.42186	D	0.991704	D	0.55172	0.97	P	0.48627	0.584	T	0.51364	-0.8715	10	0.08837	T	0.75	-19.468	15.4817	0.75534	1.0:0.0:0.0:0.0	.	369	Q9Y5Z7	HCFC2_HUMAN	A	369	ENSP00000229330:T369A	ENSP00000229330:T369A	T	+	1	0	HCFC2	103004796	1.000000	0.71417	0.997000	0.53966	0.958000	0.62258	7.919000	0.87513	2.054000	0.61138	0.528000	0.53228	ACT	.		0.408	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320	
HECTD2	143279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	93252211	93252211	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr10:93252211C>G	ENST00000298068.5	+	13	1496	c.1402C>G	c.(1402-1404)Cta>Gta	p.L468V	HECTD2_ENST00000536715.1_Missense_Mutation_p.L57V|HECTD2_ENST00000446394.1_Missense_Mutation_p.L472V|HECTD2_ENST00000371667.1_Missense_Mutation_p.L118V	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	468	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GTTCCTTCTTCTAATTCGCCA	0.338																																					p.L468V	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2	658	0			c.C1402G						.						112.0	110.0	111.0					10																	93252211		2203	4299	6502	SO:0001583	missense	143279	exon13			CTTCTTCTAATTC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1402C>G	10.37:g.93252211C>G	ENSP00000298068:p.Leu468Val	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	39.0	NM_182765	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154727	0.78114	.	.	ENSG00000165338	ENST00000446394;ENST00000298068;ENST00000536715;ENST00000371667	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.28	4.37	0.52481	HECT (4);	0.000000	0.64402	D	0.000002	T	0.64046	0.2563	L	0.61218	1.895	0.54753	D	0.999986	P;D	0.71674	0.844;0.998	P;D	0.69307	0.842;0.963	T	0.66196	-0.5984	10	0.51188	T	0.08	.	14.4632	0.67465	0.0:0.9284:0.0:0.0716	.	472;468	E7ERR3;Q5U5R9	.;HECD2_HUMAN	V	472;468;57;118	ENSP00000401023:L472V;ENSP00000298068:L468V;ENSP00000439687:L57V;ENSP00000360731:L118V	ENSP00000298068:L468V	L	+	1	2	HECTD2	93242191	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.134000	0.57990	1.359000	0.45940	0.655000	0.94253	CTA	.		0.338	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
HIST1H4C	8364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26104441	26104441	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:26104441A>G	ENST00000377803.2	+	1	338	c.266A>G	c.(265-267)tAt>tGt	p.Y89C		NM_003542.3	NP_003533.1	P62805	H4_HUMAN	histone cluster 1, H4c	89					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7						GATGTAGTATATGCCCTAAAA	0.478																																					p.Y89C		.											.	HIST1H4C	68	0			c.A266G						.						65.0	58.0	61.0					6																	26104441		2203	4300	6503	SO:0001583	missense	8364	exon1			TAGTATATGCCCT	X60486	CCDS4583.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000197061	ENSG00000197061		"""Histones / Replication-dependent"""	4787	protein-coding gene	gene with protein product		602827	"""H4 histone family, member G"", ""histone 1, H4c"""	H4FG		9119399, 12408966	Standard	NM_003542		Approved	H4/g, dJ221C16.1	uc003ngi.3	P62805	OTTHUMG00000014429	ENST00000377803.2:c.266A>G	6.37:g.26104441A>G	ENSP00000367034:p.Tyr89Cys	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	16.0	NM_003542	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377803.2	37	CCDS4583.1	.	.	.	.	.	.	.	.	.	.	.	15.35	2.807103	0.50421	.	.	ENSG00000197061	ENST00000377803	T	0.68025	-0.3	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000001	T	0.70430	0.3223	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75207	-0.3399	7	0.66056	D	0.02	.	13.5381	0.61657	1.0:0.0:0.0:0.0	.	.	.	.	C	89	ENSP00000367034:Y89C	ENSP00000367034:Y89C	Y	+	2	0	HIST1H4C	26212420	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	9.139000	0.94554	2.049000	0.60858	0.454000	0.30748	TAT	.		0.478	HIST1H4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040092.2	NM_003542	
IL17RD	54756	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57139919	57139919	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:57139919T>C	ENST00000296318.7	-	7	801	c.713A>G	c.(712-714)cAc>cGc	p.H238R	IL17RD_ENST00000320057.5_Missense_Mutation_p.H94R|IL17RD_ENST00000463523.1_Missense_Mutation_p.H94R|IL17RD_ENST00000427856.2_Missense_Mutation_p.H214R	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	238					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		AGGTCCTTCGTGCTTGAGCTT	0.517																																					p.H238R		.											.	IL17RD	500	0			c.A713G						.						60.0	55.0	57.0					3																	57139919		2203	4300	6503	SO:0001583	missense	54756	exon7			CCTTCGTGCTTGA	AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.713A>G	3.37:g.57139919T>C	ENSP00000296318:p.His238Arg	Somatic	134.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	34.0	NM_017563	Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	ENST00000296318.7	37	CCDS2880.2	.	.	.	.	.	.	.	.	.	.	T	14.82	2.648187	0.47258	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.10288	2.89;2.9;2.9;2.9	5.81	5.81	0.92471	.	0.199214	0.53938	D	0.000056	T	0.09024	0.0223	L	0.29908	0.895	0.49130	D	0.999752	P;P;P	0.41475	0.751;0.651;0.646	B;B;B	0.39152	0.24;0.115;0.292	T	0.29243	-1.0018	10	0.31617	T	0.26	-23.4862	11.236	0.48940	0.0:0.0707:0.0:0.9293	.	94;238;214	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	R	238;94;214;94	ENSP00000296318:H238R;ENSP00000322250:H94R;ENSP00000399209:H214R;ENSP00000417516:H94R	ENSP00000296318:H238R	H	-	2	0	IL17RD	57114959	1.000000	0.71417	0.962000	0.40283	0.659000	0.38960	4.854000	0.62918	2.210000	0.71456	0.533000	0.62120	CAC	.		0.517	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316680.1	NM_017563	
IL1RL2	8808	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	102808473	102808473	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:102808473T>A	ENST00000264257.2	+	4	508	c.382T>A	c.(382-384)Tta>Ata	p.L128I	IL1RL2_ENST00000441515.2_Intron|IL1RL2_ENST00000539491.1_Missense_Mutation_p.L128I|IL1RL2_ENST00000481806.1_Intron	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	128	Ig-like C2-type 2.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TTTACCAAATTTATCAGATGA	0.378																																					p.L128I		.											.	IL1RL2	92	0			c.T382A						.						103.0	100.0	101.0					2																	102808473		2203	4300	6503	SO:0001583	missense	8808	exon4			CCAAATTTATCAG	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.382T>A	2.37:g.102808473T>A	ENSP00000264257:p.Leu128Ile	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	42.0	NM_003854	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	ENST00000264257.2	37	CCDS2056.1	.	.	.	.	.	.	.	.	.	.	T	14.74	2.625992	0.46840	.	.	ENSG00000115598	ENST00000264257;ENST00000421464;ENST00000539491	T;T;T	0.17854	2.25;2.25;2.25	5.4	1.56	0.23342	Immunoglobulin-like (1);	1.365760	0.05222	N	0.508661	T	0.16471	0.0396	L	0.44542	1.39	0.09310	N	1	P	0.41420	0.749	B	0.41691	0.364	T	0.26224	-1.0109	10	0.21540	T	0.41	.	6.0967	0.20025	0.0:0.0881:0.3321:0.5798	.	128	Q9HB29	ILRL2_HUMAN	I	128	ENSP00000264257:L128I;ENSP00000387611:L128I;ENSP00000442184:L128I	ENSP00000264257:L128I	L	+	1	2	IL1RL2	102174905	0.000000	0.05858	0.003000	0.11579	0.594000	0.36715	-0.377000	0.07456	0.403000	0.25479	0.533000	0.62120	TTA	.		0.378	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
IQCB1	9657	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	3	121514404	121514404	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:121514404G>A	ENST00000310864.6	-	10	1100	c.886C>T	c.(886-888)Caa>Taa	p.Q296*	IQCB1_ENST00000349820.6_Intron	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	296	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		CATGCTGCTTGATGTAGTTTC	0.358																																					p.Q296X		.											.	IQCB1	90	0			c.C886T						.						59.0	60.0	60.0					3																	121514404		2203	4298	6501	SO:0001587	stop_gained	9657	exon10			CTGCTTGATGTAG	D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.886C>T	3.37:g.121514404G>A	ENSP00000311505:p.Gln296*	Somatic	231.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	14.0	NM_001023570	Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Nonsense_Mutation	SNP	ENST00000310864.6	37	CCDS33837.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386735	0.82902	.	.	ENSG00000173226	ENST00000310864;ENST00000460108	.	.	.	4.71	1.65	0.23941	.	0.465951	0.21437	N	0.074556	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	-0.6546	12.0879	0.53708	0.0:0.0:0.3142:0.6858	.	.	.	.	X	296;112	.	ENSP00000311505:Q296X	Q	-	1	0	IQCB1	122997094	1.000000	0.71417	0.995000	0.50966	0.946000	0.59487	1.372000	0.34261	0.208000	0.20626	0.467000	0.42956	CAA	.		0.358	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250573.1	NM_014642	
IRF2BP2	359948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	234743411	234743411	+	Silent	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:234743411G>A	ENST00000366609.3	-	2	1266	c.1236C>T	c.(1234-1236)acC>acT	p.T412T	IRF2BP2_ENST00000491430.1_5'UTR|RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Silent_p.T396T	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CAGGCGGTGTGGTCCGGTTGG	0.587																																					p.T412T		.											.	IRF2BP2	90	0			c.C1236T						.						95.0	102.0	100.0					1																	234743411		2203	4300	6503	SO:0001819	synonymous_variant	359948	exon2			CGGTGTGGTCCGG	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1236C>T	1.37:g.234743411G>A		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	19.0	NM_182972	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Silent	SNP	ENST00000366609.3	37	CCDS1602.1																																																																																			.		0.587	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000092705.1	NM_182972	
ITPR2	3709	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	26752255	26752255	+	Silent	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:26752255C>T	ENST00000381340.3	-	30	4241	c.3825G>A	c.(3823-3825)cgG>cgA	p.R1275R		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1275					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TGAAGATGTGCCGCATGGTTT	0.433																																					p.R1275R		.											.	ITPR2	542	0			c.G3825A						.						185.0	169.0	174.0					12																	26752255		1981	4183	6164	SO:0001819	synonymous_variant	3709	exon30			GATGTGCCGCATG	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.3825G>A	12.37:g.26752255C>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	14.0	NM_002223	O94773	Silent	SNP	ENST00000381340.3	37	CCDS41764.1																																																																																			.		0.433	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
JPH3	57338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	87723913	87723913	+	Silent	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr16:87723913C>A	ENST00000284262.2	+	4	2189	c.1947C>A	c.(1945-1947)ggC>ggA	p.G649G	JPH3_ENST00000563609.1_3'UTR	NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	649					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		AGGACCGGGGCTTCGGGGTGC	0.687																																					p.G649G		.											.	JPH3	92	0			c.C1947A						.						9.0	11.0	10.0					16																	87723913		2165	4270	6435	SO:0001819	synonymous_variant	57338	exon4			CCGGGGCTTCGGG	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.1947C>A	16.37:g.87723913C>A		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	52.0	NM_020655	D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Silent	SNP	ENST00000284262.2	37	CCDS10962.1																																																																																			.		0.687	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2		
KCNQ2	3785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	62044867	62044867	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr20:62044867C>A	ENST00000359125.2	-	15	1873	c.1699G>T	c.(1699-1701)Gtc>Ttc	p.V567F	KCNQ2_ENST00000354587.3_Missense_Mutation_p.V539F|KCNQ2_ENST00000359689.1_Missense_Mutation_p.V567F|KCNQ2_ENST00000344462.4_Missense_Mutation_p.V536F|KCNQ2_ENST00000357249.2_Missense_Mutation_p.V549F|KCNQ2_ENST00000370224.1_Missense_Mutation_p.V539F|KCNQ2_ENST00000360480.3_Missense_Mutation_p.V539F	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	567					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TGCTCGATGACGTCCATCACG	0.637																																					p.V567F		.											.	KCNQ2	92	0			c.G1699T						.						111.0	99.0	103.0					20																	62044867		2203	4300	6503	SO:0001583	missense	3785	exon15			CGATGACGTCCAT	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1699G>T	20.37:g.62044867C>A	ENSP00000352035:p.Val567Phe	Somatic	235.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	35.0	NM_172107	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	c	28.3	4.905377	0.92107	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224;ENST00000370222	D;D;D;D;D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	4.99	4.99	0.66335	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.142336	0.46442	D	0.000283	D	0.99871	0.9939	M	0.87381	2.88	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96360	0.9265	10	0.87932	D	0	-18.2624	18.2551	0.90017	0.0:1.0:0.0:0.0	.	539;549;536;567	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	F	549;567;537;539;567;536;539;527;539;539	ENSP00000349789:V549F;ENSP00000352035:V567F;ENSP00000359246:V537F;ENSP00000346601:V539F;ENSP00000352718:V567F;ENSP00000399612:V536F;ENSP00000353668:V539F;ENSP00000339611:V527F;ENSP00000359244:V539F;ENSP00000359242:V539F	ENSP00000339611:V527F	V	-	1	0	KCNQ2	61515311	1.000000	0.71417	0.995000	0.50966	0.823000	0.46562	7.581000	0.82535	2.323000	0.78572	0.556000	0.70494	GTC	.		0.637	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
KLHL21	9903	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	6661948	6661948	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:6661948C>A	ENST00000377658.4	-	1	981	c.930G>T	c.(928-930)caG>caT	p.Q310H	KLHL21_ENST00000377663.3_Missense_Mutation_p.Q310H|KLHL21_ENST00000463043.1_Intron|KLHL21_ENST00000467612.1_Intron	NM_014851.2	NP_055666.2	Q9UJP4	KLH21_HUMAN	kelch-like family member 21	310					chromosome passenger complex localization to spindle midzone (GO:0035853)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|regulation of cytokinesis (GO:0032465)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|polar microtubule (GO:0005827)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|prostate(2)	8	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.36e-07)|COAD - Colon adenocarcinoma(227;1.4e-05)|Kidney(185;4.95e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000528)|KIRC - Kidney renal clear cell carcinoma(229;0.000927)|STAD - Stomach adenocarcinoma(132;0.0172)|READ - Rectum adenocarcinoma(331;0.0644)		ACTGACCCGTCTGCGGGTTGT	0.662																																					p.Q310H		.											.	KLHL21	514	0			c.G930T						.						23.0	23.0	23.0					1																	6661948		2190	4284	6474	SO:0001583	missense	9903	exon1			ACCCGTCTGCGGG	AK090472	CCDS30575.1	1p36	2013-01-30	2013-01-30		ENSG00000162413	ENSG00000162413		"""Kelch-like"", ""BTB/POZ domain containing"""	29041	protein-coding gene	gene with protein product			"""kelch-like 21 (Drosophila)"""				Standard	XM_005263542		Approved	KIAA0469	uc001aoa.3	Q9UJP4	OTTHUMG00000001437	ENST00000377658.4:c.930G>T	1.37:g.6661948C>A	ENSP00000366886:p.Gln310His	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	31.0	NM_014851	B3KQP2|O75057|Q5SY26|Q5SY28|Q8N4I6|Q8NF10	Missense_Mutation	SNP	ENST00000377658.4	37	CCDS30575.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.351149	0.41599	.	.	ENSG00000162413	ENST00000377658;ENST00000377663	T;T	0.77877	-1.13;-1.13	4.55	4.55	0.56014	Galactose oxidase, beta-propeller (1);	0.064498	0.64402	D	0.000005	T	0.70439	0.3224	L	0.31157	0.91	0.80722	D	1	P;P	0.48998	0.918;0.899	P;P	0.49301	0.606;0.568	T	0.71297	-0.4635	10	0.54805	T	0.06	.	6.8845	0.24191	0.0:0.7103:0.1941:0.0955	.	310;310	Q9UJP4;Q9UJP4-2	KLH21_HUMAN;.	H	310	ENSP00000366886:Q310H;ENSP00000366891:Q310H	ENSP00000366886:Q310H	Q	-	3	2	KLHL21	6584535	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	0.623000	0.24447	2.517000	0.84864	0.561000	0.74099	CAG	.		0.662	KLHL21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004188.1	NM_014851	
KRT32	3882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	39622138	39622138	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr17:39622138T>C	ENST00000225899.3	-	3	698	c.595A>G	c.(595-597)Atc>Gtc	p.I199V	RNU2-32P_ENST00000411193.1_RNA	NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	199	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				AGGCCATTGATGTCGGCCTCC	0.577																																					p.I199V		.											.	KRT32	90	0			c.A595G						.						77.0	68.0	71.0					17																	39622138		2203	4300	6503	SO:0001583	missense	3882	exon3			CATTGATGTCGGC	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.595A>G	17.37:g.39622138T>C	ENSP00000225899:p.Ile199Val	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	12.0	NM_002278		Missense_Mutation	SNP	ENST00000225899.3	37	CCDS11393.1	.	.	.	.	.	.	.	.	.	.	T	12.61	1.988642	0.35131	.	.	ENSG00000108759	ENST00000225899	D	0.89050	-2.46	4.93	3.85	0.44370	Filament (1);	0.397757	0.18265	N	0.146516	D	0.90249	0.6951	M	0.69523	2.12	0.25084	N	0.990903	B	0.29716	0.255	B	0.43194	0.411	D	0.83606	0.0131	10	0.48119	T	0.1	.	10.083	0.42401	0.0:0.0797:0.0:0.9203	.	199	Q14532	K1H2_HUMAN	V	199	ENSP00000225899:I199V	ENSP00000225899:I199V	I	-	1	0	KRT32	36875664	1.000000	0.71417	0.992000	0.48379	0.221000	0.24807	5.159000	0.64923	0.858000	0.35431	0.456000	0.33151	ATC	.		0.577	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278	
LARP4	113251	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	50869325	50869325	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:50869325G>T	ENST00000398473.2	+	16	1965	c.1853G>T	c.(1852-1854)aGt>aTt	p.S618I	LARP4_ENST00000347328.5_Missense_Mutation_p.S547I|LARP4_ENST00000429001.3_Missense_Mutation_p.S624I|LARP4_ENST00000518444.1_Missense_Mutation_p.S617I|LARP4_ENST00000293618.8_Missense_Mutation_p.S547I	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	618					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						CGAAAGTTAAGTTATGCTGAA	0.378																																					p.S618I		.											.	LARP4	91	0			c.G1853T						.						201.0	200.0	200.0					12																	50869325		1812	4087	5899	SO:0001583	missense	113251	exon16			AGTTAAGTTATGC	AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1853G>T	12.37:g.50869325G>T	ENSP00000381490:p.Ser618Ile	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	14.0	NM_052879	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	ENST00000398473.2	37	CCDS41782.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153560	0.78114	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000518444;ENST00000520064;ENST00000347328	T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.74344	0.3704	M	0.75777	2.31	0.80722	D	1	P;B;P;D;D;B;B	0.89917	0.468;0.117;0.766;1.0;1.0;0.134;0.178	P;B;P;D;D;B;B	0.85130	0.453;0.082;0.527;0.997;0.997;0.124;0.173	T	0.76476	-0.2945	10	0.87932	D	0	.	19.6351	0.95728	0.0:0.0:1.0:0.0	.	499;28;617;547;547;618;624	Q71RC2-2;Q8WVX5;Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;.;.;LARP4_HUMAN;.	I	547;624;618;617;499;547	ENSP00000293618:S547I;ENSP00000415464:S624I;ENSP00000381490:S618I;ENSP00000429077:S617I;ENSP00000340901:S547I	ENSP00000293618:S547I	S	+	2	0	LARP4	49155592	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.089000	0.94137	2.728000	0.93425	0.643000	0.83706	AGT	.		0.378	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374981.1	NM_052879	
LACRT	90070	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	55024698	55024698	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:55024698C>T	ENST00000257867.4	-	5	448	c.395G>A	c.(394-396)aGt>aAt	p.S132N	LACRT_ENST00000547511.1_Missense_Mutation_p.S121N	NM_033277.1	NP_150593.1	Q9GZZ8	LACRT_HUMAN	lacritin	132					calcineurin-NFAT signaling cascade (GO:0033173)|calcium-mediated signaling (GO:0019722)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of secretion (GO:0051047)|protein localization to Golgi apparatus (GO:0034067)|tear secretion (GO:0070075)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule (GO:0030141)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|growth factor activity (GO:0008083)|laminin-1 binding (GO:0043237)|protein N-terminus binding (GO:0047485)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(1)	10						TTTTAATAGACTGAATTTCTT	0.413																																					p.S132N		.											.	LACRT	90	0			c.G395A						.						148.0	123.0	132.0					12																	55024698		2203	4300	6503	SO:0001583	missense	90070	exon5			AATAGACTGAATT	AF238867	CCDS8883.1	12q13.2	2014-06-13			ENSG00000135413				16430	protein-coding gene	gene with protein product		607360				11419941	Standard	NM_033277		Approved	LACRITIN	uc001sgi.1	Q9GZZ8	OTTHUMG00000169936	ENST00000257867.4:c.395G>A	12.37:g.55024698C>T	ENSP00000257867:p.Ser132Asn	Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	13.0	NM_033277		Missense_Mutation	SNP	ENST00000257867.4	37	CCDS8883.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.755326	0.00663	.	.	ENSG00000135413	ENST00000547511;ENST00000257867	.	.	.	2.79	-5.58	0.02512	.	9.302310	0.00166	N	0.000008	T	0.18676	0.0448	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.30534	-0.9975	9	0.87932	D	0	.	3.3959	0.07305	0.4706:0.3363:0.0884:0.1047	.	132	Q9GZZ8	LACRT_HUMAN	N	121;132	.	ENSP00000257867:S132N	S	-	2	0	LACRT	53310965	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.838000	0.00052	-5.554000	0.00012	-0.471000	0.05019	AGT	.		0.413	LACRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406615.1	NM_033277	
LCMT2	9836	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43622597	43622597	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr15:43622597C>T	ENST00000305641.5	-	1	206	c.91G>A	c.(91-93)Ggg>Agg	p.G31R	LCMT2_ENST00000544735.1_5'UTR|ADAL_ENST00000389651.4_5'Flank|ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_Splice_Site_p.G31R|ADAL_ENST00000422466.2_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	31					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)	p.G31W(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	TGCACGTACCCGCGCGCGGCC	0.716																																					p.G31R		.											.	LCMT2	90	1	Substitution - Missense(1)	lung(1)	c.G91A						.						19.0	23.0	22.0					15																	43622597		2110	4118	6228	SO:0001583	missense	9836	exon1			CGTACCCGCGCGC	AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.91G>A	15.37:g.43622597C>T	ENSP00000307214:p.Gly31Arg	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	4.0	NM_014793	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	ENST00000305641.5	37	CCDS10094.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.037875	0.75617	.	.	ENSG00000168806	ENST00000305641	T	0.26373	1.74	5.55	5.55	0.83447	.	0.057403	0.64402	D	0.000002	T	0.47764	0.1463	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.67725	0.953	T	0.31696	-0.9934	10	0.51188	T	0.08	.	14.877	0.70501	0.0:1.0:0.0:0.0	.	31	O60294	LCMT2_HUMAN	R	31	ENSP00000307214:G31R	ENSP00000307214:G31R	G	-	1	0	LCMT2	41409889	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	3.788000	0.55446	2.894000	0.99253	0.655000	0.94253	GGG	.		0.716	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253205.1	NM_014793	
LHFPL3	375612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	104377307	104377307	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:104377307G>C	ENST00000401970.2	+	2	711	c.589G>C	c.(589-591)Ggt>Cgt	p.G197R	LHFPL3-AS1_ENST00000433514.1_RNA|LHFPL3_ENST00000543266.1_Missense_Mutation_p.G211R|LHFPL3_ENST00000424859.1_Missense_Mutation_p.G197R|LHFPL3-AS1_ENST00000449764.1_RNA|LHFPL3_ENST00000535008.1_Missense_Mutation_p.G211R			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	211						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)	9						ATTTGTGCTTGGTAATCGACA	0.448																																					p.G211R		.											.	.	.	0			c.G631C						.						69.0	67.0	67.0					7																	104377307		1931	4158	6089	SO:0001583	missense	375612	exon2			GTGCTTGGTAATC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.589G>C	7.37:g.104377307G>C	ENSP00000385374:p.Gly197Arg	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	16.0	NM_199000	A1L383|A4D0Q5	Missense_Mutation	SNP	ENST00000401970.2	37		.	.	.	.	.	.	.	.	.	.	G	28.1	4.895096	0.91962	.	.	ENSG00000187416	ENST00000424859;ENST00000535008;ENST00000401970;ENST00000543266	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.87529	0.6200	M	0.88450	2.955	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.88720	0.3229	10	0.72032	D	0.01	-36.019	20.0845	0.97795	0.0:0.0:1.0:0.0	.	211;211	A1L384;A4D0Q5	.;.	R	197;211;197;211	ENSP00000393128:G197R;ENSP00000444350:G211R;ENSP00000385374:G197R;ENSP00000445976:G211R	ENSP00000385374:G197R	G	+	1	0	LHFPL3	104164543	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.813000	0.99286	2.821000	0.97095	0.650000	0.86243	GGT	.		0.448	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000348284.1	NM_199000	
TIMP2	7077	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76887993	76887993	+	Intron	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr17:76887993G>A	ENST00000262768.7	-	2	429				TIMP2_ENST00000536189.2_Intron|DDC8_ENST00000322630.2_Missense_Mutation_p.A198V	NM_003255.4	NP_003246.1	P16035	TIMP2_HUMAN	TIMP metallopeptidase inhibitor 2						aging (GO:0007568)|cellular response to organic substance (GO:0071310)|central nervous system development (GO:0007417)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of proteolysis (GO:0045861)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|regulation of Rap protein signal transduction (GO:0032487)|response to cytokine (GO:0034097)|response to drug (GO:0042493)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.194)			TGGACTCGCTGCTGTCTTCCG	0.582																																					p.A198V		.											.	.	.	0			c.C593T						.																																			SO:0001627	intron_variant	0	exon3			CTCGCTGCTGTCT		CCDS11758.1	17q25	2008-07-18	2005-08-08		ENSG00000035862	ENSG00000035862			11821	protein-coding gene	gene with protein product		188825	"""tissue inhibitor of metalloproteinase 2"""			1427908	Standard	NM_003255		Approved	CSC-21K	uc002jwf.3	P16035	OTTHUMG00000154517	ENST00000262768.7:c.131-17992C>T	17.37:g.76887993G>A		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	71.0	NM_001243540	Q16121|Q93006|Q9UDF7	Missense_Mutation	SNP	ENST00000262768.7	37	CCDS11758.1	.	.	.	.	.	.	.	.	.	.	G	14.78	2.637884	0.47049	.	.	ENSG00000178404	ENST00000322630	T	0.37915	1.17	3.7	-0.712	0.11226	.	1.168870	0.06562	N	0.746940	T	0.26448	0.0646	.	.	.	0.09310	N	1	B	0.23937	0.094	B	0.17433	0.018	T	0.34625	-0.9821	9	0.87932	D	0	-0.4755	6.3152	0.21186	0.5042:0.0:0.4958:0.0	.	198	Q96MC4	.	V	198	ENSP00000312767:A198V	ENSP00000312767:A198V	A	-	2	0	AC100788.1	74399588	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.557000	0.23454	-0.082000	0.12640	-0.367000	0.07326	GCA	.		0.582	TIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335662.1	NM_003255	
LRFN5	145581	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	42356467	42356467	+	Silent	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr14:42356467C>T	ENST00000298119.4	+	3	1828	c.639C>T	c.(637-639)gaC>gaT	p.D213D	LRFN5_ENST00000554171.1_Silent_p.D213D|LRFN5_ENST00000554120.1_Silent_p.D213D	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	213						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TACCACCTGACCCTCTCTTTC	0.428										HNSCC(30;0.082)																											p.D213D		.											.	LRFN5	97	0			c.C639T						.						72.0	70.0	71.0					14																	42356467		2203	4300	6503	SO:0001819	synonymous_variant	145581	exon3			ACCTGACCCTCTC	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.639C>T	14.37:g.42356467C>T		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	28.0	NM_152447	B3KU78|Q86XL2	Silent	SNP	ENST00000298119.4	37	CCDS9678.1																																																																																			.		0.428	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
LRPPRC	10128	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	44176800	44176800	+	Splice_Site	SNP	T	T	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:44176800T>G	ENST00000260665.7	-	16	1735		c.e16-2			NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing						mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTCTGTTATCTGGTAAGACAG	0.398																																					.		.											.	LRPPRC	93	0			c.1678-2A>C						.						67.0	60.0	63.0					2																	44176800		2203	4300	6503	SO:0001630	splice_region_variant	10128	exon17			GTTATCTGGTAAG	M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1678-2A>C	2.37:g.44176800T>G		Somatic	105.0	1.0		WXS	Illumina HiSeq	Phase_I	108.0	39.0	NM_133259	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Splice_Site	SNP	ENST00000260665.7	37	CCDS33189.1	.	.	.	.	.	.	.	.	.	.	T	18.15	3.560274	0.65538	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0885	0.81076	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRPPRC	44030304	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.328000	0.72915	2.192000	0.70111	0.533000	0.62120	.	.		0.398	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327823.1	NM_133259	Intron
LRRC3B	116135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	26751375	26751375	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:26751375T>A	ENST00000396641.2	+	2	804	c.212T>A	c.(211-213)cTg>cAg	p.L71Q	LRRC3B_ENST00000456208.2_Missense_Mutation_p.L71Q|AC114877.3_ENST00000446601.1_lincRNA|LRRC3B_ENST00000417744.1_Missense_Mutation_p.L71Q	NM_052953.2	NP_443185.1	Q96PB8	LRC3B_HUMAN	leucine rich repeat containing 3B	71						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	21						TTACTGTATCTGGACTCCAAT	0.398																																					p.L71Q		.											.	LRRC3B	94	0			c.T212A						.						91.0	88.0	89.0					3																	26751375		2203	4300	6503	SO:0001583	missense	116135	exon2			TGTATCTGGACTC	AF396933	CCDS2644.1	3p24	2004-07-12			ENSG00000179796	ENSG00000179796			28105	protein-coding gene	gene with protein product							Standard	NM_052953		Approved	LRP15	uc003cdp.3	Q96PB8	OTTHUMG00000130572	ENST00000396641.2:c.212T>A	3.37:g.26751375T>A	ENSP00000379880:p.Leu71Gln	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	19.0	NM_052953	Q5M8T0	Missense_Mutation	SNP	ENST00000396641.2	37	CCDS2644.1	.	.	.	.	.	.	.	.	.	.	T	19.01	3.743233	0.69418	.	.	ENSG00000179796	ENST00000396641;ENST00000432040;ENST00000417744;ENST00000456208	D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.99020	0.9665	H	0.99026	4.405	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99198	1.0872	10	0.87932	D	0	-7.7357	16.0034	0.80327	0.0:0.0:0.0:1.0	.	71	Q96PB8	LRC3B_HUMAN	Q	71	ENSP00000379880:L71Q;ENSP00000398184:L71Q;ENSP00000406370:L71Q;ENSP00000394940:L71Q	ENSP00000379880:L71Q	L	+	2	0	LRRC3B	26726379	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	CTG	.		0.398	LRRC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252997.2	NM_052953	
LRRCC1	85444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	86041583	86041583	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:86041583A>G	ENST00000360375.3	+	10	1744	c.1595A>G	c.(1594-1596)gAg>gGg	p.E532G	LRRCC1_ENST00000414626.2_Missense_Mutation_p.E512G	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	532					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						GAAAAAATGGAGAGACAAAAA	0.333																																					p.E532G		.											.	LRRCC1	90	0			c.A1595G						.						89.0	93.0	92.0					8																	86041583		1848	4094	5942	SO:0001583	missense	85444	exon10			AAATGGAGAGACA	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.1595A>G	8.37:g.86041583A>G	ENSP00000353538:p.Glu532Gly	Somatic	291.0	0.0		WXS	Illumina HiSeq	Phase_I	289.0	105.0	NM_033402	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.413291	0.83449	.	.	ENSG00000133739	ENST00000360375;ENST00000414626	T;T	0.38887	1.11;1.11	5.58	5.58	0.84498	.	0.000000	0.39759	N	0.001274	T	0.65344	0.2682	M	0.73598	2.24	0.54753	D	0.999986	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.972	T	0.67707	-0.5601	10	0.54805	T	0.06	-19.004	16.0742	0.80958	1.0:0.0:0.0:0.0	.	439;512;439;532	B4DV06;Q9C099-2;E9PE41;Q9C099	.;.;.;LRCC1_HUMAN	G	532;512	ENSP00000353538:E532G;ENSP00000394695:E512G	ENSP00000353538:E532G	E	+	2	0	LRRCC1	86228835	1.000000	0.71417	0.995000	0.50966	0.943000	0.58893	6.317000	0.72862	2.259000	0.74868	0.528000	0.53228	GAG	.		0.333	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	
LRRC69	100130742	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	92213018	92213018	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:92213018A>T	ENST00000448384.2	+	7	931	c.931A>T	c.(931-933)Aag>Tag	p.K311*	LRRC69_ENST00000343709.3_Nonsense_Mutation_p.K155*	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69	311										endometrium(1)	1						TCCTCCACCAAAGGTAAATGA	0.358																																					p.K311X		.											.	.	.	0			c.A931T						.						220.0	182.0	194.0					8																	92213018		692	1591	2283	SO:0001587	stop_gained	100130742	exon7			CCACCAAAGGTAA	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.931A>T	8.37:g.92213018A>T	ENSP00000400803:p.Lys311*	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	46.0	NM_001129890		Nonsense_Mutation	SNP	ENST00000448384.2	37		.	.	.	.	.	.	.	.	.	.	A	11.69	1.713062	0.30413	.	.	ENSG00000214954	ENST00000343709;ENST00000448384	.	.	.	5.29	2.76	0.32466	.	0.000000	0.53938	U	0.000047	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.2439	4.8047	0.13314	0.7127:0.1903:0.097:0.0	.	.	.	.	X	155;311	.	ENSP00000343221:K155X	K	+	1	0	LRRC69	92282194	0.979000	0.34478	0.996000	0.52242	0.063000	0.16089	2.770000	0.47662	0.856000	0.35383	0.459000	0.35465	AAG	.		0.358	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000415207.1	NM_001129890	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	40740721	40740721	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:40740721A>T	ENST00000298910.7	+	42	6334	c.6276A>T	c.(6274-6276)ttA>ttT	p.L2092F		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2092	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AAGGAAAATTACCTGGTAAGT	0.299																																					p.L2092F		.											.	LRRK2	533	0			c.A6276T						.						49.0	51.0	50.0					12																	40740721		2203	4300	6503	SO:0001583	missense	120892	exon42			AAAATTACCTGGT	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6276A>T	12.37:g.40740721A>T	ENSP00000298910:p.Leu2092Phe	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	17.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	A	17.93	3.509423	0.64522	.	.	ENSG00000188906	ENST00000298910	T	0.66099	-0.19	5.6	-2.78	0.05859	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70081	0.3183	L	0.59436	1.845	0.46203	D	0.998924	P;D	0.76494	0.914;0.999	P;D	0.75484	0.685;0.986	T	0.66917	-0.5802	10	0.41790	T	0.15	.	12.8915	0.58073	0.4936:0.0:0.5064:0.0	.	2092;2092	Q17RV3;Q5S007	.;LRRK2_HUMAN	F	2092	ENSP00000298910:L2092F	ENSP00000298910:L2092F	L	+	3	2	LRRK2	39026988	0.985000	0.35326	0.965000	0.40720	0.986000	0.74619	0.277000	0.18734	-0.788000	0.04504	-0.269000	0.10298	TTA	.		0.299	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
MACROD2	140733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	13983050	13983050	+	Splice_Site	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr20:13983050G>A	ENST00000310348.4	+	2	163	c.163G>A	c.(163-165)Gaa>Aaa	p.E55K	MACROD2_ENST00000217246.4_Splice_Site_p.E55K			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2	55					brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				CCAAAATGATGGTAAGTTTCT	0.373																																					p.E55K		.											.	MACROD2	22	0			c.G163A						.						134.0	134.0	134.0					20																	13983050		2203	4300	6503	SO:0001630	splice_region_variant	140733	exon2			AATGATGGTAAGT	BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.163+1G>A	20.37:g.13983050G>A		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	45.0	NM_080676	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	Missense_Mutation	SNP	ENST00000310348.4	37	CCDS13120.2	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358541	0.41801	.	.	ENSG00000172264	ENST00000217246;ENST00000310348	T;T	0.42900	0.96;0.96	5.87	5.87	0.94306	.	0.483364	0.20494	N	0.091228	T	0.28234	0.0697	N	0.16602	0.42	0.80722	D	1	P;B	0.40970	0.734;0.02	B;B	0.37731	0.257;0.023	T	0.07404	-1.0774	10	0.07813	T	0.8	-6.426	18.8026	0.92023	0.0:0.0:1.0:0.0	.	55;55	A1Z1Q3;A1Z1Q3-2	MACD2_HUMAN;.	K	55	ENSP00000217246:E55K;ENSP00000309809:E55K	ENSP00000217246:E55K	E	+	1	0	MACROD2	13931050	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.377000	0.73145	2.770000	0.95276	0.650000	0.86243	GAA	.		0.373	MACROD2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_080676	Missense_Mutation
MARCH6	10299	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	10415698	10415698	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr5:10415698A>G	ENST00000274140.5	+	21	2197	c.2065A>G	c.(2065-2067)Ata>Gta	p.I689V	MARCH6_ENST00000503788.1_Missense_Mutation_p.I584V|MARCH6_ENST00000510792.1_Missense_Mutation_p.I387V|MARCH6_ENST00000449913.2_Missense_Mutation_p.I641V	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	689					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						CTGGCTAACCATAAGGGCTGT	0.493																																					p.I689V		.											.	MARCH6	501	0			c.A2065G						.						246.0	217.0	227.0					5																	10415698		2203	4300	6503	SO:0001583	missense	10299	exon21			CTAACCATAAGGG	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.2065A>G	5.37:g.10415698A>G	ENSP00000274140:p.Ile689Val	Somatic	95.0	1.0		WXS	Illumina HiSeq	Phase_I	93.0	40.0	NM_005885	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	ENST00000274140.5	37	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	A	6.789	0.514643	0.12944	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.39997	2.04;1.06;2.04;1.05	5.72	1.97	0.26223	.	0.140023	0.64402	N	0.000008	T	0.29556	0.0737	L	0.42245	1.32	0.53688	D	0.999974	B;B;B;B	0.19331	0.035;0.013;0.0;0.013	B;B;B;B	0.18561	0.022;0.004;0.001;0.003	T	0.07888	-1.0749	10	0.13108	T	0.6	-9.3484	9.0179	0.36182	0.7803:0.0:0.2197:0.0	.	584;641;269;689	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	V	641;584;689;387	ENSP00000414643:I641V;ENSP00000425930:I584V;ENSP00000274140:I689V;ENSP00000424512:I387V	ENSP00000274140:I689V	I	+	1	0	MARCH6	10468698	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	3.600000	0.54052	0.092000	0.17331	0.460000	0.39030	ATA	.		0.493	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	
MEI1	150365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	42177763	42177763	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr22:42177763G>A	ENST00000401548.3	+	24	3041	c.3001G>A	c.(3001-3003)Gca>Aca	p.A1001T	MEI1_ENST00000476893.1_3'UTR|MEI1_ENST00000540880.1_3'UTR|MEI1_ENST00000300398.4_Missense_Mutation_p.A9T|MEI1_ENST00000400107.1_Missense_Mutation_p.A334T	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CTTGGCAAAGGCAGATTCTCC	0.602																																					p.A1001T		.											.	MEI1	70	0			c.G3001A						.						49.0	50.0	50.0					22																	42177763		2060	4239	6299	SO:0001583	missense	150365	exon24			GCAAAGGCAGATT	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.3001G>A	22.37:g.42177763G>A	ENSP00000384115:p.Ala1001Thr	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	77.0	NM_152513		Missense_Mutation	SNP	ENST00000401548.3	37	CCDS46718.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.312490	0.23908	.	.	ENSG00000167077	ENST00000401548;ENST00000400107;ENST00000300398;ENST00000419798;ENST00000403492	T;T;T;T	0.64803	-0.12;-0.12;0.0;0.0	6.03	-2.42	0.06542	.	1.419210	0.04213	N	0.332173	T	0.38612	0.1047	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.001;0.001;0.001	B;B;B;B;B;B;B	0.10450	0.005;0.003;0.002;0.002;0.002;0.005;0.002	T	0.25152	-1.0140	10	0.08179	T	0.78	-3.206	7.7499	0.28890	0.2335:0.2441:0.5223:0.0	.	15;111;334;111;244;369;1001	B7Z735;Q6ZRK7;Q5TIA1-3;E9PB79;Q5TIA1-5;Q5TIA1-2;Q5TIA1	.;.;.;.;.;.;MEI1_HUMAN	T	1001;334;9;111;9	ENSP00000384115:A1001T;ENSP00000382978:A334T;ENSP00000300398:A9T;ENSP00000385298:A9T	ENSP00000300398:A9T	A	+	1	0	MEI1	40507709	0.000000	0.05858	0.000000	0.03702	0.144000	0.21451	0.123000	0.15708	-0.135000	0.11495	0.655000	0.94253	GCA	.		0.602	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000074937.3	NM_152513	
MFSD12	126321	broad.mit.edu;bcgsc.ca	37	19	3544813	3544813	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:3544813G>C	ENST00000355415.2	-	9	1583	c.1414C>G	c.(1414-1416)Cga>Gga	p.R472G	MFSD12_ENST00000398558.4_Missense_Mutation_p.R472G|AC005786.7_ENST00000589360.1_RNA|MFSD12_ENST00000389395.3_Missense_Mutation_p.R472G	NM_174983.3	NP_778148.2	Q6NUT3	MFS12_HUMAN	major facilitator superfamily domain containing 12	472					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				cervix(1)|endometrium(2)|lung(4)|urinary_tract(2)	9						TCACAGCGTCGCAGGCGGGTC	0.672											OREG0025153	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R472G		.											.	.	.	0			c.C1414G						.						35.0	46.0	42.0					19																	3544813		2178	4264	6442	SO:0001583	missense	126321	exon9			AGCGTCGCAGGCG	AF218008	CCDS42465.1, CCDS74256.1	19p13.3	2012-03-09	2011-11-24	2011-11-24	ENSG00000161091	ENSG00000161091			28299	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 28"""	C19orf28		12477932	Standard	NM_174983		Approved	MGC20700, PP3501	uc002lxw.3	Q6NUT3		ENST00000355415.2:c.1414C>G	19.37:g.3544813G>C	ENSP00000347583:p.Arg472Gly	Somatic	24.0	0.0	612	WXS	Illumina HiSeq	Phase_I	24.0	4.0	NM_001042680	A8MXP7|D6W615|E9PAJ8|Q8N459	Missense_Mutation	SNP	ENST00000355415.2	37	CCDS42465.1	.	.	.	.	.	.	.	.	.	.	G	11.13	1.547133	0.27652	.	.	ENSG00000161091	ENST00000389395;ENST00000398558;ENST00000355415	T;T;D	0.82526	2.0;2.03;-1.62	4.48	4.48	0.54585	Major facilitator superfamily domain, general substrate transporter (1);	0.158738	0.42821	D	0.000641	T	0.82240	0.4994	L	0.56769	1.78	0.44175	D	0.996986	P;P;P	0.40794	0.589;0.712;0.729	B;B;B	0.41666	0.131;0.363;0.314	D	0.84838	0.0806	10	0.59425	D	0.04	-11.8761	16.157	0.81675	0.0:0.0:1.0:0.0	.	472;463;472	Q6NUT3;Q6NUT3-2;A8MXP7	CS028_HUMAN;.;.	G	472	ENSP00000374046:R472G;ENSP00000381566:R472G;ENSP00000347583:R472G	ENSP00000347583:R472G	R	-	1	2	C19orf28	3495813	1.000000	0.71417	0.681000	0.30009	0.027000	0.11550	6.535000	0.73838	2.061000	0.61500	0.436000	0.28706	CGA	.		0.672	MFSD12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000452949.2	NM_174983	
MSH5	4439	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31726650	31726650	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:31726650C>G	ENST00000375755.3	+	15	1610	c.1324C>G	c.(1324-1326)Ctg>Gtg	p.L442V	MSH5_ENST00000375703.3_Missense_Mutation_p.L442V|MSH5_ENST00000431848.2_Missense_Mutation_p.L141V|MSH5_ENST00000534153.4_Missense_Mutation_p.L459V|MSH5_ENST00000375750.3_Missense_Mutation_p.L442V|MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.L459V|MSH5_ENST00000375742.3_Missense_Mutation_p.L459V|MSH5_ENST00000375740.3_Missense_Mutation_p.L459V|RNU6-850P_ENST00000516934.1_RNA|MSH5_ENST00000395853.1_Missense_Mutation_p.L116V	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	442					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						CTACATCCCTCTGGTGAGGGC	0.493								Direct reversal of damage;Mismatch excision repair (MMR)																													p.L459V		.											.	MSH5	661	0			c.C1375G						.						82.0	78.0	79.0					6																	31726650		2203	4300	6503	SO:0001583	missense	4439	exon15			ATCCCTCTGGTGA	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1324C>G	6.37:g.31726650C>G	ENSP00000364908:p.Leu442Val	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	22.0	NM_025259	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	ENST00000375755.3	37	CCDS4720.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631813	0.46944	.	.	ENSG00000204410	ENST00000375755;ENST00000375742;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000450148;ENST00000431848;ENST00000395853	D;D;D;D;D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47	5.42	3.29	0.37713	DNA mismatch repair protein MutS, clamp (1);DNA mismatch repair protein MutS, core (3);	0.000000	0.64402	D	0.000005	T	0.75852	0.3906	L	0.53249	1.67	0.45390	D	0.998374	P;P;P;B;P	0.39071	0.498;0.475;0.531;0.02;0.658	B;B;P;B;P	0.45428	0.211;0.259;0.479;0.07;0.48	T	0.73594	-0.3933	9	0.02654	T	1	-18.1329	7.6032	0.28087	0.0:0.7142:0.0:0.2858	.	127;459;442;442;459	Q59EC5;O43196-4;O43196;O43196-2;O43196-3	.;.;MSH5_HUMAN;.;.	V	442;459;442;459;442;459;284;141;116	ENSP00000364908:L442V;ENSP00000364894:L459V;ENSP00000364903:L442V;ENSP00000431693:L459V;ENSP00000364855:L442V;ENSP00000364892:L459V;ENSP00000394971:L284V;ENSP00000416784:L141V;ENSP00000379194:L116V	ENSP00000364855:L442V	L	+	1	2	MSH5	31834629	0.972000	0.33761	1.000000	0.80357	0.982000	0.71751	0.692000	0.25482	1.293000	0.44690	0.591000	0.81541	CTG	.		0.493	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4		
MTO1	25821	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	74202034	74202034	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:74202034A>G	ENST00000370300.4	+	11	1880	c.1790A>G	c.(1789-1791)tAt>tGt	p.Y597C	MTO1_ENST00000370305.1_Missense_Mutation_p.Y523C|MTO1_ENST00000498286.1_Missense_Mutation_p.Y572C|RP11-505P4.6_ENST00000423099.1_RNA|MTO1_ENST00000415954.2_Missense_Mutation_p.Y612C	NM_012123.3|NM_133645.2	NP_036255.2|NP_598400.1	Q9Y2Z2	MTO1_HUMAN	mitochondrial tRNA translation optimization 1	597					mitochondrial tRNA wobble uridine modification (GO:0070899)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)	27						TTGAAGAAGTATACTAAATGT	0.348																																					p.Y612C		.											.	MTO1	96	0			c.A1835G						.						81.0	83.0	82.0					6																	74202034		2203	4300	6503	SO:0001583	missense	25821	exon11			AGAAGTATACTAA	AF132937	CCDS4979.1, CCDS34485.1, CCDS47452.1	6q14.1	2013-05-07	2013-05-07		ENSG00000135297	ENSG00000135297			19261	protein-coding gene	gene with protein product		614667	"""mitochondrial translation optimization 1 homolog (S. cerevisiae)"""			12011058, 22608499	Standard	NM_012123		Approved		uc003pgy.4	Q9Y2Z2	OTTHUMG00000015032	ENST00000370300.4:c.1790A>G	6.37:g.74202034A>G	ENSP00000359323:p.Tyr597Cys	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	21.0	NM_001123226	B3KQB5|Q5SWL2|Q5SWL3|Q5SWL4|Q8NDN7|Q8WZ57|Q96FE6|Q9BS06	Missense_Mutation	SNP	ENST00000370300.4	37	CCDS4979.1	.	.	.	.	.	.	.	.	.	.	A	12.92	2.083815	0.36758	.	.	ENSG00000135297	ENST00000415954;ENST00000498286;ENST00000357845;ENST00000370305;ENST00000370300;ENST00000521156	.	.	.	5.39	4.17	0.49024	.	0.201325	0.34986	N	0.003537	T	0.34221	0.0890	L	0.39898	1.24	0.32282	N	0.567452	D;D;P;P	0.61697	0.967;0.99;0.893;0.9	P;P;P;P	0.55161	0.77;0.73;0.694;0.593	T	0.23797	-1.0178	9	0.40728	T	0.16	-14.812	7.7139	0.28694	0.669:0.0:0.0:0.331	.	612;475;572;597	Q9Y2Z2-6;Q9Y2Z2-2;Q9Y2Z2-4;Q9Y2Z2	.;.;.;MTO1_HUMAN	C	612;572;475;523;597;127	.	ENSP00000350506:Y475C	Y	+	2	0	MTO1	74258755	0.996000	0.38824	0.930000	0.37139	0.136000	0.21042	3.524000	0.53495	2.035000	0.60131	0.477000	0.44152	TAT	.		0.348	MTO1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041215.2	NM_012123	
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100677761	100677761	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:100677761T>A	ENST00000306151.4	+	3	3128	c.3064T>A	c.(3064-3066)Tca>Aca	p.S1022T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1022	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TGAAGCCAGTTCACCTCCTCC	0.527																																					p.S1022T		.											.	MUC17	95	0			c.T3064A						.						471.0	378.0	409.0					7																	100677761		2203	4300	6503	SO:0001583	missense	140453	exon3			GCCAGTTCACCTC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3064T>A	7.37:g.100677761T>A	ENSP00000302716:p.Ser1022Thr	Somatic	205.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	34.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.020498	0.00418	.	.	ENSG00000169876	ENST00000306151	T	0.02498	4.27	0.74	-1.48	0.08745	.	.	.	.	.	T	0.01661	0.0053	L	0.27053	0.805	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.49588	-0.8924	9	0.09338	T	0.73	.	0.8792	0.01230	0.1724:0.1616:0.3449:0.321	.	1022	Q685J3	MUC17_HUMAN	T	1022	ENSP00000302716:S1022T	ENSP00000302716:S1022T	S	+	1	0	MUC17	100464481	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-3.018000	0.00644	-3.296000	0.00193	-1.668000	0.00747	TCA	.		0.527	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MVK	4598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	110032905	110032905	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:110032905C>A	ENST00000228510.3	+	10	1034	c.958C>A	c.(958-960)Cag>Aag	p.Q320K	MVK_ENST00000392727.3_Missense_Mutation_p.Q268K|MVK_ENST00000541384.1_Missense_Mutation_p.Q126K|MVK_ENST00000539575.1_Missense_Mutation_p.Q268K|MVK_ENST00000539696.1_Missense_Mutation_p.Q39K	NM_000431.2|NM_001114185.1	NP_000422.1|NP_001107657.1	Q03426	KIME_HUMAN	mevalonate kinase	320					cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|negative regulation of inflammatory response (GO:0050728)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|mevalonate kinase activity (GO:0004496)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8						CCAGCTCTGCCAGGTGACCAG	0.627																																					p.Q320K		.											.	MVK	115	0			c.C958A						.						83.0	78.0	80.0					12																	110032905		2203	4300	6503	SO:0001583	missense	4598	exon10			CTCTGCCAGGTGA	M88468	CCDS9132.1, CCDS73522.1	12q24	2014-09-17	2008-01-30		ENSG00000110921	ENSG00000110921	2.7.1.36		7530	protein-coding gene	gene with protein product	"""LH receptor mRNA-binding protein"", ""mevalonic aciduria"""	251170	"""mevalonate kinase (mevalonic aciduria)"""			1377680	Standard	XM_005253883		Approved	LRBP, MK	uc001toy.4	Q03426	OTTHUMG00000169256	ENST00000228510.3:c.958C>A	12.37:g.110032905C>A	ENSP00000228510:p.Gln320Lys	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	7.0	NM_000431		Missense_Mutation	SNP	ENST00000228510.3	37	CCDS9132.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.958252	0.53400	.	.	ENSG00000110921	ENST00000539696;ENST00000228510;ENST00000392727;ENST00000539575;ENST00000541384;ENST00000540353	D;D;D;D;D	0.89939	-2.59;-2.59;-2.59;-2.59;-2.59	4.51	4.51	0.55191	GHMP kinase, C-terminal (1);	0.196139	0.43747	D	0.000527	T	0.77260	0.4104	N	0.17345	0.48	0.34003	D	0.650532	B;B	0.26744	0.002;0.158	B;B	0.21151	0.007;0.033	T	0.75470	-0.3306	10	0.09338	T	0.73	-11.6459	12.577	0.56369	0.0:1.0:0.0:0.0	.	268;320	F5H8H2;Q03426	.;KIME_HUMAN	K	39;320;268;268;126;39	ENSP00000439134:Q39K;ENSP00000228510:Q320K;ENSP00000376487:Q268K;ENSP00000443551:Q268K;ENSP00000443182:Q126K	ENSP00000228510:Q320K	Q	+	1	0	MVK	108517288	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.668000	0.61568	2.340000	0.79590	0.563000	0.77884	CAG	.		0.627	MVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403143.1	NM_000431	
MYO3A	53904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	26455035	26455035	+	Silent	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr10:26455035C>G	ENST00000265944.5	+	27	3205	c.3039C>G	c.(3037-3039)cgC>cgG	p.R1013R	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1013	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						AGGAGCCCCGCATGAGCCCTG	0.448																																					p.R1013R		.											.	MYO3A	1007	0			c.C3039G						.						158.0	171.0	166.0					10																	26455035		2203	4300	6503	SO:0001819	synonymous_variant	53904	exon27			GCCCCGCATGAGC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3039C>G	10.37:g.26455035C>G		Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	19.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Silent	SNP	ENST00000265944.5	37	CCDS7148.1																																																																																			.		0.448	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
NKAPL	222698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28227197	28227197	+	Silent	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:28227197T>C	ENST00000343684.3	+	1	100	c.48T>C	c.(46-48)tcT>tcC	p.S16S	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	16										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						TCGTGGGCTCTCGGAGAAGGC	0.662																																					p.S16S		.											.	NKAPL	70	0			c.T48C						.						32.0	30.0	30.0					6																	28227197		2201	4295	6496	SO:0001819	synonymous_variant	222698	exon1			GGGCTCTCGGAGA	BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.48T>C	6.37:g.28227197T>C		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	19.0	NM_001007531	Q3MIV1|Q9H4Q7	Silent	SNP	ENST00000343684.3	37	CCDS34353.1																																																																																			.		0.662	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040185.1		
NLRP3	114548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	247587376	247587376	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:247587376C>A	ENST00000336119.3	+	3	1377	c.631C>A	c.(631-633)Ccc>Acc	p.P211T	NLRP3_ENST00000391827.2_Missense_Mutation_p.P211T|NLRP3_ENST00000391828.3_Missense_Mutation_p.P211T|NLRP3_ENST00000366497.2_Missense_Mutation_p.P211T|NLRP3_ENST00000366496.2_Missense_Mutation_p.P211T|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000348069.2_Missense_Mutation_p.P211T	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	211					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GCTGTTTGACCCCGATGATGA	0.587																																					p.P211T		.											.	NLRP3	674	0			c.C631A						.						92.0	82.0	86.0					1																	247587376		2203	4300	6503	SO:0001583	missense	114548	exon3			TTTGACCCCGATG	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.631C>A	1.37:g.247587376C>A	ENSP00000337383:p.Pro211Thr	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	24.0	NM_183395	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	37	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	C	7.627	0.678092	0.14841	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.78003	-1.06;-1.07;-1.06;-1.14;-1.07;-1.1	4.27	3.34	0.38264	.	0.131978	0.35555	N	0.003123	D	0.84804	0.5553	M	0.72894	2.215	0.20764	N	0.999852	B;P;D;P;P	0.76494	0.35;0.937;0.999;0.896;0.914	B;P;D;P;P	0.72625	0.071;0.543;0.978;0.66;0.517	T	0.75317	-0.3360	10	0.66056	D	0.02	.	9.9683	0.41738	0.0:0.7671:0.2329:0.0	.	211;211;211;211;211	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	T	211	ENSP00000375704:P211T;ENSP00000355453:P211T;ENSP00000337383:P211T;ENSP00000294752:P211T;ENSP00000355452:P211T;ENSP00000375703:P211T	ENSP00000337383:P211T	P	+	1	0	NLRP3	245653999	0.000000	0.05858	0.046000	0.18839	0.008000	0.06430	-0.046000	0.11983	1.362000	0.46000	0.655000	0.94253	CCC	.		0.587	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
NOTCH3	4854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15298796	15298796	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:15298796C>A	ENST00000263388.2	-	10	1577	c.1502G>T	c.(1501-1503)gGc>gTc	p.G501V		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	501	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			ACACGTGGAGCCGCTGAAGCC	0.642																																					p.G501V		.											.	NOTCH3	855	0			c.G1502T						.						20.0	15.0	17.0					19																	15298796		1900	3592	5492	SO:0001583	missense	4854	exon10			GTGGAGCCGCTGA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1502G>T	19.37:g.15298796C>A	ENSP00000263388:p.Gly501Val	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	38.0	NM_000435	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	ENST00000263388.2	37	CCDS12326.1	.	.	.	.	.	.	.	.	.	.	c	25.3	4.628567	0.87560	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.98249	-4.82	4.87	4.87	0.63330	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.32703	N	0.005745	D	0.99513	0.9826	H	0.99746	4.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97622	1.0136	10	0.87932	D	0	.	16.7979	0.85607	0.0:1.0:0.0:0.0	.	504;501	Q59FL3;Q9UM47	.;NOTC3_HUMAN	V	501;503	ENSP00000263388:G501V	ENSP00000263388:G501V	G	-	2	0	NOTCH3	15159796	0.990000	0.36364	1.000000	0.80357	0.855000	0.48748	6.019000	0.70818	2.258000	0.74832	0.306000	0.20318	GGC	.		0.642	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
NT5DC1	221294	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	116439079	116439079	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:116439079A>G	ENST00000319550.4	+	6	582	c.500A>G	c.(499-501)cAa>cGa	p.Q167R		NM_152729.2	NP_689942.2	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase domain containing 1	167							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|stomach(1)	8		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		GCTGCTATACAACACAATTAT	0.308																																					p.Q167R	Colon(128;1440 1664 38087 41475 42869)	.											.	NT5DC1	226	0			c.A500G						.						95.0	96.0	96.0					6																	116439079		2203	4298	6501	SO:0001583	missense	221294	exon6			CTATACAACACAA	BC015138	CCDS5104.1	6q22.31	2008-02-05	2006-01-27	2006-01-27	ENSG00000178425	ENSG00000178425			21556	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic II-like 1"""	NT5C2L1			Standard	NM_152729		Approved	dJ486I3.1, MGC24302	uc003pwj.3	Q5TFE4	OTTHUMG00000015428	ENST00000319550.4:c.500A>G	6.37:g.116439079A>G	ENSP00000326858:p.Gln167Arg	Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	55.0	10.0	NM_152729	B2RND9|B3KR35|Q6XYD5	Missense_Mutation	SNP	ENST00000319550.4	37	CCDS5104.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.45|14.45	2.539202|2.539202	0.45176|0.45176	.|.	.|.	ENSG00000178425|ENSG00000178425	ENST00000417846|ENST00000368618;ENST00000319550;ENST00000419791	.|T;T	.|0.21543	.|2.0;2.0	5.52|5.52	5.52|5.52	0.82312|0.82312	.|HAD-like domain (1);	.|0.281307	.|0.39687	.|N	.|0.001297	T|T	0.06735|0.06735	0.0172|0.0172	N|N	0.21373|0.21373	0.66|0.66	0.48040|0.48040	D|D	0.999573|0.999573	.|B;B;P	.|0.44344	.|0.04;0.147;0.833	.|B;B;B	.|0.38755	.|0.105;0.281;0.229	T|T	0.22382|0.22382	-1.0218|-1.0218	5|10	.|0.13853	.|T	.|0.58	-3.232|-3.232	15.9355|15.9355	0.79704|0.79704	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|117;167;167	.|B3KR35;A8K2Z3;Q5TFE4	.|.;.;NT5D1_HUMAN	D|R	81|167	.|ENSP00000326858:Q167R;ENSP00000393578:Q167R	.|ENSP00000326858:Q167R	N|Q	+|+	1|2	0|0	NT5DC1|NT5DC1	116545772|116545772	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.173000|8.173000	0.89680|0.89680	2.234000|2.234000	0.73211|0.73211	0.533000|0.533000	0.62120|0.62120	AAC|CAA	.		0.308	NT5DC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041931.3	NM_152729	
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	228474027	228474027	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:228474027G>T	ENST00000422127.1	+	34	9297	c.9253G>T	c.(9253-9255)Gcc>Tcc	p.A3085S	OBSCN_ENST00000366707.4_Missense_Mutation_p.A204S|OBSCN_ENST00000570156.2_Missense_Mutation_p.A3514S|OBSCN_ENST00000366709.4_Missense_Mutation_p.A204S|OBSCN_ENST00000284548.11_Missense_Mutation_p.A3085S|OBSCN_ENST00000359599.6_Missense_Mutation_p.A1932S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3085	Ig-like 30.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGACCAGCGGGCCTCGGCCGC	0.657																																					p.A3514S		.											.	OBSCN	403	0			c.G10540T						.						10.0	13.0	12.0					1																	228474027		1983	4140	6123	SO:0001583	missense	84033	exon39			CAGCGGGCCTCGG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9253G>T	1.37:g.228474027G>T	ENSP00000409493:p.Ala3085Ser	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	15.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.435484	0.43224	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97	5.67	-5.2	0.02823	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.597925	0.16713	N	0.202571	T	0.14356	0.0347	N	0.02985	-0.445	0.09310	N	0.999995	B;B	0.11235	0.004;0.002	B;B	0.26310	0.068;0.048	T	0.19031	-1.0318	10	0.27785	T	0.31	.	5.772	0.18259	0.515:0.0:0.1789:0.3061	.	3085;3085	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	3085;3085;204;204;1932	ENSP00000284548:A3085S;ENSP00000409493:A3085S;ENSP00000355668:A204S;ENSP00000355670:A204S;ENSP00000352613:A1932S	ENSP00000284548:A3085S	A	+	1	0	OBSCN	226540650	0.993000	0.37304	0.258000	0.24420	0.122000	0.20287	0.348000	0.20031	-0.812000	0.04363	0.561000	0.74099	GCC	.		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OR4P4	81300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55405983	55405983	+	Silent	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:55405983C>A	ENST00000314612.2	+	1	150	c.150C>A	c.(148-150)acC>acA	p.T50T		NM_001004124.1	NP_001004124.1	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P, member 4	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(4)|large_intestine(4)|lung(28)|ovary(1)|upper_aerodigestive_tract(1)	40						TCACGTGCACCCAGCTCATTC	0.388																																					p.T50T		.											.	OR4P4	68	0			c.C150A						.						180.0	156.0	164.0					11																	55405983		2180	4035	6215	SO:0001819	synonymous_variant	81300	exon1			GTGCACCCAGCTC	AB065775	CCDS31504.1	11q11	2012-08-09			ENSG00000181927	ENSG00000181927		"""GPCR / Class A : Olfactory receptors"""	15180	protein-coding gene	gene with protein product				OR4P3P			Standard	NM_001004124		Approved		uc010rij.2	Q8NGL7	OTTHUMG00000165300	ENST00000314612.2:c.150C>A	11.37:g.55405983C>A		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	24.0	NM_001004124		Silent	SNP	ENST00000314612.2	37	CCDS31504.1																																																																																			.		0.388	OR4P4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383356.1	NM_001004124	
OR7A17	26333	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	14991644	14991644	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:14991644G>A	ENST00000327462.2	-	1	620	c.524C>T	c.(523-525)cCc>cTc	p.P175L		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					GAAAAAGTGGGGGATTTCCAA	0.483																																					p.P175L		.											.	OR7A17	68	0			c.C524T						.						91.0	86.0	88.0					19																	14991644		2203	4300	6503	SO:0001583	missense	26333	exon1			AAGTGGGGGATTT	X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.524C>T	19.37:g.14991644G>A	ENSP00000328144:p.Pro175Leu	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	25.0	NM_030901	Q6IFQ6|Q96R98	Missense_Mutation	SNP	ENST00000327462.2	37	CCDS12319.1	.	.	.	.	.	.	.	.	.	.	g	12.15	1.851824	0.32699	.	.	ENSG00000185385	ENST00000327462	T	0.37752	1.18	3.37	-2.81	0.05805	GPCR, rhodopsin-like superfamily (1);	0.200782	0.24594	U	0.037186	T	0.50616	0.1626	M	0.67569	2.06	0.09310	N	1	D	0.69078	0.997	D	0.79108	0.992	T	0.48210	-0.9055	10	0.66056	D	0.02	.	11.233	0.48923	0.0:0.0:0.2462:0.7537	.	175	O14581	OR7AH_HUMAN	L	175	ENSP00000328144:P175L	ENSP00000328144:P175L	P	-	2	0	OR7A17	14852644	0.000000	0.05858	0.640000	0.29408	0.420000	0.31355	0.068000	0.14531	-0.090000	0.12462	0.454000	0.30748	CCC	.		0.483	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466523.1	NM_030901	
PAMR1	25891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	35513688	35513688	+	Missense_Mutation	SNP	C	C	A	rs377041707		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:35513688C>A	ENST00000378880.2	-	3	729	c.284G>T	c.(283-285)cGa>cTa	p.R95L	PAMR1_ENST00000532848.1_Missense_Mutation_p.R55L|PAMR1_ENST00000534803.1_5'UTR|PAMR1_ENST00000278360.3_Missense_Mutation_p.R95L|PAMR1_ENST00000378878.3_Missense_Mutation_p.R95L	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	95						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						TGAGCCATTTCGGCAGCTCTT	0.522																																					p.R95L		.											.	PAMR1	70	0			c.G284T						.						186.0	181.0	183.0					11																	35513688		2202	4298	6500	SO:0001583	missense	25891	exon3			CCATTTCGGCAGC		CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.284G>T	11.37:g.35513688C>A	ENSP00000368158:p.Arg95Leu	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	25.0	NM_001001991	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Missense_Mutation	SNP	ENST00000378880.2	37	CCDS31460.1	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644264	0.67244	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605;ENST00000529303	D;D;D;D;D;D	0.90620	-2.27;-2.31;-2.47;-2.28;-2.27;-2.7	5.25	4.33	0.51752	Epidermal growth factor-like (1);	0.459441	0.22469	N	0.059650	D	0.82481	0.5046	N	0.14661	0.345	0.23620	N	0.997279	P;D;P	0.54207	0.533;0.965;0.477	B;B;B	0.43123	0.097;0.409;0.061	T	0.76124	-0.3074	10	0.87932	D	0	.	10.0175	0.42022	0.0:0.8448:0.0:0.1552	.	95;95;95	A8MQ58;Q6UXH9;Q6UXH9-2	.;PAMR1_HUMAN;.	L	95;95;95;55;55;95	ENSP00000278360:R95L;ENSP00000368158:R95L;ENSP00000368156:R95L;ENSP00000433868:R55L;ENSP00000432591:R55L;ENSP00000433024:R95L	ENSP00000278360:R95L	R	-	2	0	PAMR1	35470264	0.992000	0.36948	0.953000	0.39169	0.882000	0.50991	2.398000	0.44486	1.212000	0.43366	0.491000	0.48974	CGA	.		0.522	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389177.1	NM_015430	
PCDHA11	56138	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140250482	140250482	+	Silent	SNP	G	G	A	rs372076650		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr5:140250482G>A	ENST00000398640.2	+	1	1794	c.1794G>A	c.(1792-1794)gcG>gcA	p.A598A	PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	598	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGTGGATGCGGACTCAGGCT	0.667													.|||	1	0.000199681	0.0008	0.0	5008	,	,		17747	0.0		0.0	False		,,,				2504	0.0				p.A598A		.											.	PCDHA11	67	0			c.G1794A						.	G	,,,,,,,,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	76.0	87.0	84.0		,,1794,,,,,,,,,,,,1794	-9.6	0.0	5		84	0,8598		0,0,4299	no	intron,intron,coding-synonymous,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,intron,coding-synonymous	PCDHA9,PCDHA11,PCDHA10,PCDHA8,PCDHA7,PCDHA6,PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018901.2,NM_018902.3,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_018909.2,NM_018910.2,NM_018911.2,NM_031411.1,NM_031849.1,NM_031857.1,NM_031860.1,NM_031861.1	,,,,,,,,,,,,,,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,,,,,,,,	,,598/950,,,,,,,,,,,,598/811	140250482	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	56138	exon1			GGATGCGGACTCA	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1794G>A	5.37:g.140250482G>A		Somatic	46.0	1.0		WXS	Illumina HiSeq	Phase_I	23.0	8.0	NM_018902	B2RN58|O75279	Silent	SNP	ENST00000398640.2	37	CCDS47284.1																																																																																			.		0.667	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
PCDHGB7	56099	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140798922	140798922	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr5:140798922G>A	ENST00000398594.2	+	1	1496	c.1496G>A	c.(1495-1497)cGa>cAa	p.R499Q	PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA7_ENST00000518325.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	499	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGAGTCACGAACGCTGTCG	0.652																																					p.R499Q		.											.	PCDHGB7	29	0			c.G1496A						.						71.0	79.0	76.0					5																	140798922		2147	4243	6390	SO:0001583	missense	56099	exon1			AGTCACGAACGCT	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1496G>A	5.37:g.140798922G>A	ENSP00000381594:p.Arg499Gln	Somatic	97.0	1.0		WXS	Illumina HiSeq	Phase_I	67.0	15.0	NM_018927	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	37	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	0.887	-0.726944	0.03158	.	.	ENSG00000254122	ENST00000398594	T	0.60672	0.17	4.67	-4.18	0.03846	Cadherin (4);Cadherin-like (1);	1.839940	0.04740	U	0.422636	T	0.28067	0.0692	N	0.05199	-0.095	0.09310	N	1	B;B	0.34161	0.439;0.326	B;B	0.32677	0.15;0.092	T	0.08126	-1.0737	10	0.25106	T	0.35	.	2.0256	0.03518	0.4185:0.097:0.3208:0.1637	.	499;499	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	Q	499	ENSP00000381594:R499Q	ENSP00000381594:R499Q	R	+	2	0	PCDHGB7	140779106	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.273000	0.08548	-0.643000	0.05473	-1.174000	0.01732	CGA	.		0.652	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
PDE9A	5152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	44108091	44108091	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr21:44108091G>A	ENST00000291539.6	+	3	265	c.205G>A	c.(205-207)Gcg>Acg	p.A69T	PDE9A_ENST00000335440.6_Missense_Mutation_p.R45H|PDE9A_ENST00000398229.3_Missense_Mutation_p.A28T|PDE9A_ENST00000398236.3_Intron|PDE9A_ENST00000335512.4_Missense_Mutation_p.A69T|PDE9A_ENST00000398232.3_Intron|PDE9A_ENST00000380328.2_Missense_Mutation_p.A69T|PDE9A_ENST00000398234.3_Missense_Mutation_p.A28T|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000398225.3_Missense_Mutation_p.A28T|PDE9A_ENST00000398227.3_Intron|PDE9A_ENST00000539837.1_Missense_Mutation_p.A34T|PDE9A_ENST00000328862.6_Intron|PDE9A_ENST00000349112.3_Intron|PDE9A_ENST00000398224.3_Intron	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	69					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	CACCATGCCCGCGAATTCAGA	0.577																																					p.A69T		.											.	PDE9A	92	0			c.G205A						.						83.0	69.0	73.0					21																	44108091		2203	4300	6503	SO:0001583	missense	5152	exon3			ATGCCCGCGAATT	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.205G>A	21.37:g.44108091G>A	ENSP00000291539:p.Ala69Thr	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	12.0	NM_001001570	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	ENST00000291539.6	37	CCDS13690.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	7.029|7.029	0.560319|0.560319	0.13498|0.13498	.|.	.|.	ENSG00000160191|ENSG00000160191	ENST00000335512;ENST00000539837;ENST00000291539;ENST00000380328;ENST00000398234;ENST00000398225;ENST00000398229|ENST00000335440	T;T;T;T;T;T;T|T	0.69306|0.70282	-0.35;-0.32;-0.36;-0.35;-0.33;-0.38;-0.39|-0.47	4.98|4.98	4.08|4.08	0.47627|0.47627	.|.	0.599027|.	0.17297|.	N|.	0.179402|.	T|T	0.47192|0.47192	0.1432|0.1432	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B|P	0.31485|0.40660	0.021;0.265;0.1;0.037;0.325;0.282|0.726	B;B;B;B;B;B|B	0.24269|0.32465	0.009;0.03;0.016;0.009;0.052;0.016|0.146	T|T	0.21621|0.21621	-1.0240|-1.0240	9|8	0.26408|0.13108	T|T	0.33|0.6	.|.	9.8363|9.8363	0.40971|0.40971	0.1003:0.0:0.8997:0.0|0.1003:0.0:0.8997:0.0	.|.	28;28;69;28;69;69|45	O76083-6;O76083-14;O76083-2;O76083-11;O76083-5;O76083|O76083-12	.;.;.;.;.;PDE9A_HUMAN|.	T|H	69;34;69;69;28;28;28|45	ENSP00000335242:A69T;ENSP00000441899:A34T;ENSP00000291539:A69T;ENSP00000369685:A69T;ENSP00000381289:A28T;ENSP00000381281:A28T;ENSP00000381285:A28T|ENSP00000335365:R45H	ENSP00000291539:A69T|ENSP00000335365:R45H	A|R	+|+	1|2	0|0	PDE9A|PDE9A	42981160|42981160	0.855000|0.855000	0.29742|0.29742	0.097000|0.097000	0.21041|0.21041	0.104000|0.104000	0.19210|0.19210	1.672000|1.672000	0.37523|0.37523	2.467000|2.467000	0.83353|0.83353	0.655000|0.655000	0.94253|0.94253	GCG|CGC	.		0.577	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		
PDZD3	79849	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	119059407	119059407	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:119059407G>C	ENST00000531114.1	+	7	1865	c.1316G>C	c.(1315-1317)gGc>gCc	p.G439A	PDZD3_ENST00000392817.2_Missense_Mutation_p.G439A|PDZD3_ENST00000355547.5_Missense_Mutation_p.G373A|PDZD3_ENST00000525131.1_Missense_Mutation_p.G360A|PDZD3_ENST00000322712.4_Missense_Mutation_p.G359A			Q86UT5	NHRF4_HUMAN	PDZ domain containing 3	439					cGMP-mediated signaling (GO:0019934)|ion transport (GO:0006811)|negative regulation of cGMP biosynthetic process (GO:0030827)|negative regulation of guanylate cyclase activity (GO:0031283)|receptor guanylyl cyclase signaling pathway (GO:0007168)|response to toxic substance (GO:0009636)|water transport (GO:0006833)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|subapical complex (GO:0035003)	guanylate cyclase inhibitor activity (GO:0030251)|ion channel inhibitor activity (GO:0008200)|protein C-terminus binding (GO:0008022)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	14	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		TCGCCCCGGGGCAGCAGCTCA	0.607																																					p.G373A		.											.	PDZD3	153	0			c.G1118C						.						62.0	57.0	59.0					11																	119059407		2200	4295	6495	SO:0001583	missense	79849	exon9			CCCGGGGCAGCAG	AK091966	CCDS8417.1, CCDS53719.1	11q23.3	2008-02-05	2006-01-24	2006-01-24	ENSG00000172367	ENSG00000172367			19891	protein-coding gene	gene with protein product		607146	"""PDZ domain containing 2"""	PDZK2		11950846	Standard	NM_024791		Approved	FLJ22756, IKEPP	uc001pvz.3	Q86UT5	OTTHUMG00000166224	ENST00000531114.1:c.1316G>C	11.37:g.119059407G>C	ENSP00000431164:p.Gly439Ala	Somatic	178.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	44.0	NM_001168468	Q8N6R4|Q8NAW7|Q8NEX7|Q9H5Z3	Missense_Mutation	SNP	ENST00000531114.1	37		.	.	.	.	.	.	.	.	.	.	G	3.342	-0.134380	0.06711	.	.	ENSG00000172367	ENST00000525131;ENST00000531114;ENST00000355547;ENST00000322712;ENST00000454065;ENST00000392817	T;T;T;T;T	0.72725	1.68;1.64;1.68;-0.68;1.64	5.21	0.106	0.14540	PDZ/DHR/GLGF (1);	2.366130	0.01524	N	0.018466	T	0.49236	0.1545	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.001;0.0	T	0.23226	-1.0194	10	0.07990	T	0.79	-2.0671	0.9742	0.01422	0.4383:0.142:0.2639:0.1558	.	360;439;373;359	E9PPZ1;Q86UT5;Q86UT5-2;B0YJ61	.;NHRF4_HUMAN;.;.	A	360;439;373;359;373;439	ENSP00000434559:G360A;ENSP00000431164:G439A;ENSP00000347742:G373A;ENSP00000327107:G359A;ENSP00000376564:G439A	ENSP00000327107:G359A	G	+	2	0	PDZD3	118564617	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.103000	0.15292	-0.238000	0.09724	-0.302000	0.09304	GGC	.		0.607	PDZD3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388471.1	NM_024791	
PNPLA8	50640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	108113028	108113028	+	Silent	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:108113028A>G	ENST00000422087.1	-	12	2572	c.2166T>C	c.(2164-2166)agT>agC	p.S722S	PNPLA8_ENST00000436062.1_Silent_p.S722S|PNPLA8_ENST00000257694.8_Silent_p.S722S|PNPLA8_ENST00000453144.1_Silent_p.S622S|PNPLA8_ENST00000388728.5_Silent_p.S660S|PNPLA8_ENST00000426128.2_Silent_p.S660S	NM_015723.3	NP_056538.1	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	722					arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|cell death (GO:0008219)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|linoleic acid metabolic process (GO:0043651)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylcholine catabolic process (GO:0034638)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylethanolamine catabolic process (GO:0046338)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)			breast(5)|endometrium(1)|kidney(3)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(3)	29						TTTCATTTCGACTTTCATCTA	0.338																																					p.S722S		.											.	PNPLA8	135	0			c.T2166C						.						64.0	66.0	65.0					7																	108113028		2203	4300	6503	SO:0001819	synonymous_variant	50640	exon10			ATTTCGACTTTCA	AF217519	CCDS34733.1, CCDS59075.1, CCDS59508.1	7q31	2012-07-31			ENSG00000135241	ENSG00000135241		"""Patatin-like phospholipase domain containing"""	28900	protein-coding gene	gene with protein product		612123				10744668, 10833412, 16799181, 19029121	Standard	NM_015723		Approved	IPLA2G, IPLA2-2, iPLA2gamma	uc003vfj.2	Q9NP80	OTTHUMG00000154870	ENST00000422087.1:c.2166T>C	7.37:g.108113028A>G		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	15.0	NM_001256008	A4D0S1|C9JZI4|O95035|Q8N3I3|Q9H7T5|Q9NR17|Q9NUN2|Q9NZ79	Silent	SNP	ENST00000422087.1	37	CCDS34733.1																																																																																			.		0.338	PNPLA8-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337475.1	NM_015723	
PPP2R3A	5523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	135721147	135721147	+	Silent	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:135721147T>C	ENST00000264977.3	+	2	1424	c.807T>C	c.(805-807)gaT>gaC	p.D269D	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	269					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GTGGTAATGATACAATTTCTA	0.343																																					p.D269D		.											.	PPP2R3A	662	0			c.T807C						.						72.0	74.0	73.0					3																	135721147		2203	4300	6503	SO:0001819	synonymous_variant	5523	exon2			TAATGATACAATT	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.807T>C	3.37:g.135721147T>C		Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	25.0	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	ENST00000264977.3	37	CCDS3087.1																																																																																			.		0.343	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
RANBP17	64901	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170668124	170668124	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr5:170668124C>T	ENST00000523189.1	+	23	2779	c.2615C>T	c.(2614-2616)tCa>tTa	p.S872L	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	872					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ATGCTGCTGTCAGTGTCCCAC	0.433			T	TRD@	ALL																																p.S872L		.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17	524	0			c.C2615T						.						149.0	140.0	143.0					5																	170668124		2203	4300	6503	SO:0001583	missense	64901	exon23			TGCTGTCAGTGTC	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2615C>T	5.37:g.170668124C>T	ENSP00000427975:p.Ser872Leu	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	7.0	NM_022897	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.841863	0.91197	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.51325	0.71	5.56	4.69	0.59074	Armadillo-like helical (1);Armadillo-type fold (1);	0.144353	0.32231	N	0.006392	T	0.66703	0.2816	M	0.91768	3.24	0.47905	D	0.999548	D;D	0.58620	0.983;0.983	P;P	0.56788	0.806;0.806	T	0.72127	-0.4384	10	0.09590	T	0.72	-4.9965	14.4038	0.67068	0.0:0.9291:0.0:0.0709	.	872;872	Q546R4;Q9H2T7	.;RBP17_HUMAN	L	872;302	ENSP00000427975:S872L	ENSP00000427975:S872L	S	+	2	0	RANBP17	170600729	1.000000	0.71417	0.946000	0.38457	0.997000	0.91878	7.818000	0.86416	1.357000	0.45904	0.650000	0.86243	TCA	.		0.433	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
RANBP6	26953	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	6015579	6015579	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:6015579G>A	ENST00000259569.5	-	1	39	c.29C>T	c.(28-30)cCg>cTg	p.P10L	RANBP6_ENST00000485372.1_5'UTR	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	10					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.P10L(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		CACGGTCGCCGGCACCCCTGC	0.567																																					p.P10L		.											.	RANBP6	229	1	Substitution - Missense(1)	endometrium(1)	c.C29T						.						39.0	45.0	43.0					9																	6015579		2203	4299	6502	SO:0001583	missense	26953	exon1			GTCGCCGGCACCC	AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.29C>T	9.37:g.6015579G>A	ENSP00000259569:p.Pro10Leu	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	56.0	NM_001243203	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	ENST00000259569.5	37	CCDS6467.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049115	0.55110	.	.	ENSG00000137040	ENST00000259569	T	0.09350	2.99	4.54	4.54	0.55810	.	0.654725	0.13929	N	0.353051	T	0.06645	0.0170	N	0.03608	-0.345	0.41703	D	0.98941	B	0.13594	0.008	B	0.12156	0.007	T	0.38499	-0.9658	10	0.72032	D	0.01	-0.2399	15.5945	0.76569	0.0:0.0:1.0:0.0	.	10	O60518	RNBP6_HUMAN	L	10	ENSP00000259569:P10L	ENSP00000259569:P10L	P	-	2	0	RANBP6	6005579	0.998000	0.40836	0.885000	0.34714	0.457000	0.32468	5.100000	0.64560	2.813000	0.96785	0.561000	0.74099	CCG	.		0.567	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051650.1	NM_012416	
RHAG	6005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49583450	49583450	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:49583450G>T	ENST00000371175.4	-	4	553	c.527C>A	c.(526-528)gCc>gAc	p.A176D	RHAG_ENST00000229810.7_Missense_Mutation_p.A176D	NM_000324.2	NP_000315.2	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	176					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|bicarbonate transport (GO:0015701)|carbon dioxide transport (GO:0015670)|cellular ion homeostasis (GO:0006873)|erythrocyte development (GO:0048821)|multicellular organismal iron ion homeostasis (GO:0060586)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	39	Lung NSC(77;0.0255)					GGCCCCAAAGGCATGGATCGT	0.468																																					p.A176D	Ovarian(176;476 2003 7720 43408 44749)	.											.	RHAG	154	0			c.C527A						.						117.0	110.0	113.0					6																	49583450		2203	4300	6503	SO:0001583	missense	6005	exon4			CCAAAGGCATGGA		CCDS4927.1	6p12.3	2014-07-19	2006-02-23		ENSG00000112077	ENSG00000112077		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	10006	protein-coding gene	gene with protein product		180297	"""Rhesus blood group-associated glycoprotein"""			9479501	Standard	NM_000324		Approved	RH50A, CD241, SLC42A1	uc003ozk.4	Q02094	OTTHUMG00000016377	ENST00000371175.4:c.527C>A	6.37:g.49583450G>T	ENSP00000360217:p.Ala176Asp	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	20.0	NM_000324	B2R8T8|O43514|O43515|Q7L8L3|Q9H454	Missense_Mutation	SNP	ENST00000371175.4	37	CCDS4927.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778013	0.90195	.	.	ENSG00000112077	ENST00000371175;ENST00000229810;ENST00000418071;ENST00000539403	T;T	0.25250	1.81;1.81	5.76	5.76	0.90799	Ammonium transporter AmtB-like (3);	0.091506	0.85682	D	0.000000	T	0.52322	0.1727	M	0.91196	3.185	0.80722	D	1	D;P;P	0.52996	0.957;0.87;0.87	P;P;P	0.60345	0.873;0.824;0.824	T	0.62440	-0.6854	10	0.87932	D	0	-8.7584	18.9695	0.92709	0.0:0.0:1.0:0.0	.	176;176;176	O43515;Q9UHG9;Q02094	.;.;RHAG_HUMAN	D	176	ENSP00000360217:A176D;ENSP00000229810:A176D	ENSP00000229810:A176D	A	-	2	0	RHAG	49691409	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	9.410000	0.97335	2.726000	0.93360	0.655000	0.94253	GCC	.		0.468	RHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043806.1		
RNF150	57484	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	141888999	141888999	+	Silent	SNP	A	A	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr4:141888999A>G	ENST00000515673.2	-	2	546	c.513T>C	c.(511-513)atT>atC	p.I171I	RNF150_ENST00000420921.2_Silent_p.I30I|RNF150_ENST00000507500.1_Silent_p.I171I|RNF150_ENST00000379512.2_Silent_p.I30I|RNF150_ENST00000515057.1_5'UTR|RNF150_ENST00000306799.3_Silent_p.I171I			Q9ULK6	RN150_HUMAN	ring finger protein 150	171	PA.					integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					TTGGCTCAGGAATCATTATGG	0.473																																					p.I171I		.											.	RNF150	227	0			c.T513C						.						217.0	185.0	196.0					4																	141888999		2203	4300	6503	SO:0001819	synonymous_variant	57484	exon2			CTCAGGAATCATT	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.513T>C	4.37:g.141888999A>G		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	25.0	NM_020724	Q3T1D0|Q6ZNW6	Silent	SNP	ENST00000515673.2	37	CCDS34065.1																																																																																			.		0.473	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364739.2	XM_291090	
SCIN	85477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	12666242	12666242	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:12666242A>C	ENST00000297029.5	+	8	1116	c.1015A>C	c.(1015-1017)Atc>Ctc	p.I339L	SCIN_ENST00000473722.1_3'UTR|SCIN_ENST00000519209.1_Missense_Mutation_p.I92L|SCIN_ENST00000445618.2_Missense_Mutation_p.I92L	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	339	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TGAAACACCAATCTTCAAACA	0.328																																					p.I339L		.											.	SCIN	24	0			c.A1015C						.						38.0	34.0	35.0					7																	12666242		1750	3908	5658	SO:0001583	missense	85477	exon8			ACACCAATCTTCA	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1015A>C	7.37:g.12666242A>C	ENSP00000297029:p.Ile339Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	51.0	NM_001112706	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	37	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	A	4.200	0.035872	0.08148	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.55234	0.53;0.53;0.53	5.94	0.056	0.14317	Gelsolin domain (1);	0.156002	0.56097	D	0.000027	T	0.20659	0.0497	N	0.04768	-0.165	0.34707	D	0.727358	B	0.06786	0.001	B	0.13407	0.009	T	0.35325	-0.9793	10	0.02654	T	1	-8.572	5.822	0.18532	0.5879:0.25:0.1621:0.0	.	339	Q9Y6U3	ADSV_HUMAN	L	339;92;92	ENSP00000297029:I339L;ENSP00000430997:I92L;ENSP00000390189:I92L	ENSP00000297029:I339L	I	+	1	0	SCIN	12632767	0.788000	0.28762	0.988000	0.46212	0.986000	0.74619	1.593000	0.36686	0.377000	0.24735	0.460000	0.39030	ATC	.		0.328	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
SCN11A	11280	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38938564	38938564	+	Silent	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:38938564A>T	ENST00000302328.3	-	14	2373	c.2175T>A	c.(2173-2175)cgT>cgA	p.R725R	SCN11A_ENST00000444237.2_Silent_p.R725R|SCN11A_ENST00000450244.1_Silent_p.R725R|SCN11A_ENST00000456224.3_Silent_p.R725R	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	725					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATTGAAGCTACGGCCAAAAA	0.502																																					p.R725R		.											.	SCN11A	99	0			c.T2175A						.						88.0	82.0	84.0					3																	38938564		2203	4300	6503	SO:0001819	synonymous_variant	11280	exon14			GAAGCTACGGCCA	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2175T>A	3.37:g.38938564A>T		Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	46.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	ENST00000302328.3	37	CCDS33737.1																																																																																			.		0.502	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
SCN8A	6334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52056683	52056683	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:52056683C>T	ENST00000354534.6	+	2	260	c.82C>T	c.(82-84)Cgc>Tgc	p.R28C	SCN8A_ENST00000545061.1_Missense_Mutation_p.R28C|SCN8A_ENST00000550891.1_Missense_Mutation_p.R28C	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	28					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CATTGAGAGGCGCATTGCTGA	0.572																																					p.R28C		.											.	SCN8A	29	0			c.C82T						.						106.0	107.0	107.0					12																	52056683		2029	4205	6234	SO:0001583	missense	6334	exon2			GAGAGGCGCATTG	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.82C>T	12.37:g.52056683C>T	ENSP00000346534:p.Arg28Cys	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	20.0	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	37	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	C	32	5.150210	0.94645	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133	D;D;D;D	0.97772	-4.51;-4.53;-4.49;-4.39	4.97	4.97	0.65823	.	.	.	.	.	D	0.98692	0.9561	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	P	0.54706	0.759	D	0.99751	1.1018	9	0.87932	D	0	.	18.7994	0.92010	0.0:1.0:0.0:0.0	.	28	Q9UQD0	SCN8A_HUMAN	C	28	ENSP00000448415:R28C;ENSP00000346534:R28C;ENSP00000440360:R28C;ENSP00000347255:R28C	ENSP00000346534:R28C	R	+	1	0	SCN8A	50342950	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.651000	0.83577	2.760000	0.94817	0.655000	0.94253	CGC	.		0.572	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
SCUBE1	80274	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	43608598	43608598	+	Splice_Site	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr22:43608598C>A	ENST00000360835.4	-	17	2180	c.2054G>T	c.(2053-2055)gGc>gTc	p.G685V	Z82214.3_ENST00000420269.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	685					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				AGAACACTGGCCTGAAAGTCA	0.701																																					p.G685V		.											.	SCUBE1	93	0			c.G2054T						.						29.0	31.0	30.0					22																	43608598		2182	4274	6456	SO:0001630	splice_region_variant	80274	exon17			CACTGGCCTGAAA		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2054-1G>T	22.37:g.43608598C>A		Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	13.0	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	37	CCDS14048.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586109	0.86851	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	T	0.62364	0.03	4.3	4.3	0.51218	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.72471	0.3464	L	0.43701	1.375	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.76418	-0.2966	10	0.87932	D	0	.	17.3317	0.87267	0.0:1.0:0.0:0.0	.	685	Q8IWY4	SCUB1_HUMAN	V	685;315	ENSP00000354080:G685V	ENSP00000354080:G685V	G	-	2	0	SCUBE1	41938542	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.378000	0.66190	2.390000	0.81377	0.655000	0.94253	GGC	.		0.701	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	Missense_Mutation
SERPINB8	5271	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	61645627	61645627	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr18:61645627T>C	ENST00000397985.2	+	2	341	c.85T>C	c.(85-87)Ttc>Ctc	p.F29L	SERPINB8_ENST00000397988.3_Missense_Mutation_p.F29L|HMSD_ENST00000481726.1_3'UTR|SERPINB8_ENST00000542677.1_Intron|SERPINB8_ENST00000353706.2_Missense_Mutation_p.F29L	NM_001276490.1	NP_001263419.1	P50452	SPB8_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 8	29					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|kidney(1)|large_intestine(4)|lung(9)|skin(1)	17		Esophageal squamous(42;0.129)				AAGAAACGTATTCTTCTCTCC	0.493																																					p.F29L		.											.	SERPINB8	226	0			c.T85C						.						100.0	88.0	92.0					18																	61645627		2203	4300	6503	SO:0001583	missense	5271	exon2			AACGTATTCTTCT	L40377	CCDS11991.1, CCDS42442.1, CCDS62460.1	18q22.1	2014-02-18	2005-08-18		ENSG00000166401	ENSG00000166401		"""Serine (or cysteine) peptidase inhibitors"""	8952	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase 2"""	601697	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8"""	PI8		8530382, 9268635, 24172014	Standard	NM_198833		Approved	CAP2	uc002lju.3	P50452	OTTHUMG00000060596	ENST00000397985.2:c.85T>C	18.37:g.61645627T>C	ENSP00000381072:p.Phe29Leu	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	6.0	NM_001031848	B4DTW2|Q7Z2V6|Q8N178	Missense_Mutation	SNP	ENST00000397985.2	37	CCDS11991.1	.	.	.	.	.	.	.	.	.	.	T	12.72	2.021314	0.35701	.	.	ENSG00000166401	ENST00000397985;ENST00000353706;ENST00000397988;ENST00000448851;ENST00000441827	D;D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9;-1.9	5.03	3.81	0.43845	Serpin domain (3);	0.090413	0.85682	D	0.000000	D	0.82949	0.5148	M	0.72624	2.21	0.80722	D	1	B;P	0.38250	0.367;0.624	B;B	0.37144	0.242;0.242	D	0.84560	0.0649	10	0.54805	T	0.06	.	11.3882	0.49798	0.0:0.0:0.1507:0.8493	.	29;29	P50452;Q8N178	SPB8_HUMAN;.	L	29	ENSP00000381072:F29L;ENSP00000331368:F29L;ENSP00000381075:F29L;ENSP00000414580:F29L;ENSP00000393456:F29L	ENSP00000331368:F29L	F	+	1	0	SERPINB8	59796607	1.000000	0.71417	0.147000	0.22382	0.025000	0.11179	3.751000	0.55165	2.108000	0.64289	0.533000	0.62120	TTC	.		0.493	SERPINB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134014.1	NM_001031848	
SIK1	150094	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	44845966	44845966	+	Silent	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr21:44845966C>T	ENST00000270162.6	-	2	225	c.93G>A	c.(91-93)cgG>cgA	p.R31R		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	31	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	TGCCCAGGGTCCGCTCGATGT	0.682																																					p.R31R		.											.	SIK1	346	0			c.G93A						.						23.0	25.0	24.0					21																	44845966		2200	4296	6496	SO:0001819	synonymous_variant	150094	exon2			CAGGGTCCGCTCG	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.93G>A	21.37:g.44845966C>T		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	15.0	NM_173354	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Silent	SNP	ENST00000270162.6	37	CCDS33575.1																																																																																			.		0.682	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
SIN3A	25942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	75705145	75705145	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr15:75705145C>T	ENST00000394947.3	-	5	1029	c.715G>A	c.(715-717)Gcc>Acc	p.A239T	SIN3A_ENST00000360439.4_Missense_Mutation_p.A239T|SIN3A_ENST00000394949.4_Missense_Mutation_p.A239T	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						gctggctgggcaggagctggg	0.562																																					p.A239T		.											.	SIN3A	230	0			c.G715A						.						93.0	82.0	86.0					15																	75705145		2197	4294	6491	SO:0001583	missense	25942	exon5			GCTGGGCAGGAGC	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.715G>A	15.37:g.75705145C>T	ENSP00000378402:p.Ala239Thr	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	44.0	NM_001145358		Missense_Mutation	SNP	ENST00000394947.3	37	CCDS10279.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575316	0.45902	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.44083	0.93;0.93;0.93	6.04	6.04	0.98038	.	0.057302	0.64402	D	0.000002	T	0.26846	0.0657	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10590	-1.0623	10	0.17369	T	0.5	-1.2736	19.5674	0.95401	0.0:1.0:0.0:0.0	.	239	Q96ST3	SIN3A_HUMAN	T	239	ENSP00000378402:A239T;ENSP00000378403:A239T;ENSP00000353622:A239T	ENSP00000353622:A239T	A	-	1	0	SIN3A	73492198	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.327000	0.52045	2.873000	0.98535	0.561000	0.74099	GCC	.		0.562	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286469.1	NM_015477	
SLC17A1	6568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	25799088	25799088	+	Silent	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr6:25799088G>C	ENST00000244527.4	-	12	1444	c.1329C>G	c.(1327-1329)ggC>ggG	p.G443G	SLC17A1_ENST00000427328.1_Silent_p.G389G|SLC17A1_ENST00000476801.1_Silent_p.G443G|SLC17A1_ENST00000468082.1_Silent_p.G389G	NM_005074.3	NP_005065.2	Q14916	NPT1_HUMAN	solute carrier family 17 (organic anion transporter), member 1	443					ion transport (GO:0006811)|phosphate ion transport (GO:0006817)|sodium ion transport (GO:0006814)|sodium-dependent phosphate transport (GO:0044341)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	36						AGAAAATTAGGCCAGTCACAT	0.388																																					p.G443G		.											.	SLC17A1	94	0			c.C1329G						.						94.0	92.0	93.0					6																	25799088		2203	4300	6503	SO:0001819	synonymous_variant	6568	exon12			AATTAGGCCAGTC		CCDS4565.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124568	ENSG00000124568		"""Solute carriers"""	10929	protein-coding gene	gene with protein product		182308	"""solute carrier family 17 (sodium phosphate), member 1"""	NPT1		8288239	Standard	NM_005074		Approved	NAPI-1	uc003nfh.4	Q14916	OTTHUMG00000016297	ENST00000244527.4:c.1329C>G	6.37:g.25799088G>C		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	13.0	NM_005074	A8K418|O60761|Q13783|Q3MIP5|Q5MJP8|Q5TB83|Q96KL8	Silent	SNP	ENST00000244527.4	37	CCDS4565.1																																																																																			.		0.388	SLC17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043647.2		
SLC2A7	155184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	9078428	9078428	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:9078428G>C	ENST00000400906.1	-	5	442	c.443C>G	c.(442-444)tCc>tGc	p.S148C		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	148					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		GGCGCTGTAGGAGATGCCTGG	0.542																																					p.S148C		.											.	SLC2A7	514	0			c.C443G						.						72.0	64.0	67.0					1																	9078428		2203	4300	6503	SO:0001583	missense	155184	exon5			CTGTAGGAGATGC	AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.443C>G	1.37:g.9078428G>C	ENSP00000383698:p.Ser148Cys	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	14.0	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	37	CCDS98.2	.	.	.	.	.	.	.	.	.	.	G	18.28	3.590181	0.66105	.	.	ENSG00000197241	ENST00000400906	T	0.74315	-0.83	4.51	3.58	0.41010	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Sugar transporter, conserved site (1);	0.220221	0.38959	N	0.001501	T	0.80949	0.4722	L	0.48986	1.54	0.30630	N	0.757569	D	0.76494	0.999	D	0.73708	0.981	T	0.78922	-0.2013	10	0.37606	T	0.19	.	13.5965	0.61994	0.0:0.157:0.843:0.0	.	148	Q6PXP3	GTR7_HUMAN	C	148	ENSP00000383698:S148C	ENSP00000383698:S148C	S	-	2	0	SLC2A7	9001015	0.996000	0.38824	0.977000	0.42913	0.988000	0.76386	4.926000	0.63433	1.080000	0.41073	0.561000	0.74099	TCC	.		0.542	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
SLC6A11	6538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10970961	10970961	+	Missense_Mutation	SNP	G	G	A	rs202136147		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:10970961G>A	ENST00000254488.2	+	10	1373	c.1307G>A	c.(1306-1308)cGg>cAg	p.R436Q		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	436					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	GGTTACCGGCGGGAGCTGCTC	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		19508	0.0		0.001	False		,,,				2504	0.0				p.R436Q		.											.	SLC6A11	132	0			c.G1307A						.						209.0	200.0	203.0					3																	10970961		2203	4300	6503	SO:0001583	missense	6538	exon10			ACCGGCGGGAGCT	S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1307G>A	3.37:g.10970961G>A	ENSP00000254488:p.Arg436Gln	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	35.0	NM_014229	B2R6U6|Q8IYC9	Missense_Mutation	SNP	ENST00000254488.2	37	CCDS2602.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	36	5.599779	0.96614	.	.	ENSG00000132164	ENST00000254488	D	0.81821	-1.54	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.91805	0.7407	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93471	0.6819	10	0.87932	D	0	.	18.5779	0.91162	0.0:0.0:1.0:0.0	.	436	P48066	S6A11_HUMAN	Q	436	ENSP00000254488:R436Q	ENSP00000254488:R436Q	R	+	2	0	SLC6A11	10945961	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.637000	0.98443	2.376000	0.81061	0.462000	0.41574	CGG	G|0.999;A|0.000		0.557	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251927.1	NM_014229	
SLC6A5	9152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	20622906	20622906	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:20622906T>A	ENST00000525748.1	+	2	508	c.235T>A	c.(235-237)Tct>Act	p.S79T		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	79					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	AGGAGTGGGGTCTTGCAAACT	0.726																																					p.S79T		.											.	SLC6A5	156	0			c.T235A						.						6.0	8.0	7.0					11																	20622906		2157	4220	6377	SO:0001583	missense	9152	exon2			GTGGGGTCTTGCA	AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.235T>A	11.37:g.20622906T>A	ENSP00000434364:p.Ser79Thr	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	7.0	NM_004211	O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	ENST00000525748.1	37	CCDS7854.1	.	.	.	.	.	.	.	.	.	.	T	9.749	1.166952	0.21621	.	.	ENSG00000165970	ENST00000525748	T	0.70986	-0.53	5.7	2.15	0.27550	.	1.035280	0.07660	N	0.933577	T	0.47801	0.1465	N	0.08118	0	0.20403	N	0.999904	B	0.02656	0.0	B	0.01281	0.0	T	0.33420	-0.9869	10	0.33141	T	0.24	.	5.0054	0.14286	0.1471:0.0:0.359:0.4938	.	79	Q9Y345	SC6A5_HUMAN	T	79	ENSP00000434364:S79T	ENSP00000298923:S79T	S	+	1	0	SLC6A5	20579482	0.606000	0.26949	0.332000	0.25469	0.993000	0.82548	0.764000	0.26532	0.611000	0.30052	0.379000	0.24179	TCT	.		0.726	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387497.2	NM_004211	
SMURF1	57154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	98645348	98645348	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:98645348C>A	ENST00000361125.1	-	11	1508	c.1189G>T	c.(1189-1191)Ggt>Tgt	p.G397C	AC004893.11_ENST00000482799.2_RNA|AC004893.11_ENST00000468960.2_RNA|SMURF1_ENST00000361368.2_Missense_Mutation_p.G371C	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	397					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CGGCAATGACCAGCTTGGGGC	0.512																																					p.G397C		.											.	SMURF1	661	0			c.G1189T						.						113.0	110.0	111.0					7																	98645348		2203	4300	6503	SO:0001583	missense	57154	exon11			AATGACCAGCTTG	AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.1189G>T	7.37:g.98645348C>A	ENSP00000354621:p.Gly397Cys	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	20.0	NM_020429	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	ENST00000361125.1	37	CCDS34690.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.859752	0.91433	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	T;T	0.46063	0.88;0.88	5.44	5.44	0.79542	HECT (1);	0.000000	0.85682	D	0.000000	T	0.71204	0.3312	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.76656	-0.2879	10	0.87932	D	0	.	19.2699	0.94004	0.0:1.0:0.0:0.0	.	371;397;371	Q9HCE7-2;Q9HCE7;B9EGV3	.;SMUF1_HUMAN;.	C	371;397	ENSP00000355326:G371C;ENSP00000354621:G397C	ENSP00000354621:G397C	G	-	1	0	SMURF1	98483284	1.000000	0.71417	0.769000	0.31535	0.843000	0.47879	7.814000	0.86154	2.527000	0.85204	0.563000	0.77884	GGT	.		0.512	SMURF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000335001.2	NM_020429	
SNTB1	6641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	121706115	121706115	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:121706115T>C	ENST00000395601.3	-	3	1019	c.605A>G	c.(604-606)aAg>aGg	p.K202R	SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Missense_Mutation_p.K202R	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	202	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			GGATCCTTTCTTCACATAGGG	0.522																																					p.K202R		.											.	SNTB1	228	0			c.A605G						.						87.0	92.0	90.0					8																	121706115		2203	4300	6503	SO:0001583	missense	6641	exon2			CCTTTCTTCACAT	AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.605A>G	8.37:g.121706115T>C	ENSP00000378965:p.Lys202Arg	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	17.0	NM_021021	A8K9E0|O14912|Q4KMG8	Missense_Mutation	SNP	ENST00000395601.3	37	CCDS6334.1	.	.	.	.	.	.	.	.	.	.	T	19.74	3.883690	0.72410	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	T;T	0.58506	0.33;0.33	5.44	3.03	0.35002	PDZ/DHR/GLGF (1);Pleckstrin homology domain (2);	0.047720	0.85682	D	0.000000	T	0.42426	0.1202	L	0.35723	1.085	0.54753	D	0.999988	B;B	0.27166	0.076;0.17	B;B	0.23419	0.034;0.046	T	0.15549	-1.0433	10	0.27785	T	0.31	.	8.4	0.32581	0.0:0.0682:0.1324:0.7994	.	202;202	Q13884;Q13884-2	SNTB1_HUMAN;.	R	202	ENSP00000378965:K202R;ENSP00000431124:K202R	ENSP00000378965:K202R	K	-	2	0	SNTB1	121775296	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.452000	0.60054	0.484000	0.27630	0.533000	0.62120	AAG	.		0.522	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381535.1	NM_021021	
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16256548	16256548	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:16256548A>C	ENST00000375759.3	+	11	4017	c.3813A>C	c.(3811-3813)gaA>gaC	p.E1271D		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1271					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CCTTCCATGAAGATGAGGATC	0.478																																					p.E1271D		.											.	SPEN	298	0			c.A3813C						.						86.0	90.0	88.0					1																	16256548		2203	4300	6503	SO:0001583	missense	23013	exon11			CCATGAAGATGAG		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3813A>C	1.37:g.16256548A>C	ENSP00000364912:p.Glu1271Asp	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	22.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	9.043	0.990191	0.18966	.	.	ENSG00000065526	ENST00000375759	T	0.10477	2.87	5.02	-6.46	0.01908	.	.	.	.	.	T	0.04048	0.0113	N	0.17082	0.46	0.31076	N	0.71248	B	0.06786	0.001	B	0.04013	0.001	T	0.45396	-0.9264	9	0.13853	T	0.58	-22.692	2.9756	0.05936	0.3566:0.195:0.3521:0.0963	.	1271	Q96T58	MINT_HUMAN	D	1271	ENSP00000364912:E1271D	ENSP00000364912:E1271D	E	+	3	2	SPEN	16129135	0.000000	0.05858	0.883000	0.34634	0.980000	0.70556	-1.681000	0.01937	-1.017000	0.03367	0.455000	0.32223	GAA	.		0.478	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SPTBN2	6712	ucsc.edu;bcgsc.ca	37	11	66472170	66472170	+	Silent	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:66472170G>A	ENST00000533211.1	-	15	2908	c.2577C>T	c.(2575-2577)agC>agT	p.S859S	SPTBN2_ENST00000309996.2_Silent_p.S859S|SPTBN2_ENST00000529997.1_Silent_p.S859S			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	859					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CCCCGGCCTCGCTGAGCATGG	0.706																																					p.S859S		.											.	SPTBN2	155	0			c.C2577T						.						14.0	13.0	13.0					11																	66472170		2195	4292	6487	SO:0001819	synonymous_variant	6712	exon14			GGCCTCGCTGAGC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.2577C>T	11.37:g.66472170G>A		Somatic	62.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_006946	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																			.		0.706	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
SRSF8	10929	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94801037	94801037	+	RNA	SNP	T	T	C	rs573470678	byFrequency	TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr11:94801037T>C	ENST00000529911.1	+	0	677					NM_032102.3	NP_115285.1	Q9BRL6	SRSF8_HUMAN	serine/arginine-rich splicing factor 8						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										GGTCCTCCACTAGCTCTCGCT	0.567													T|||	3	0.000599042	0.0	0.0	5008	,	,		18415	0.003		0.0	False		,,,				2504	0.0				.		.											.	.	.	0			.						.						99.0	108.0	105.0					11																	94801037		2169	4283	6452			10929	.			CTCCACTAGCTCT	AF031166	CCDS73370.1	11q21	2014-05-06	2010-06-22	2010-06-22	ENSG00000180771	ENSG00000263465		"""Serine/arginine-rich splicing factors"""	16988	protein-coding gene	gene with protein product	"""SR splicing factor 8"""	603269	"""splicing factor, arginine/serine-rich 2B"""	SFRS2B		9671500, 20516191	Standard	NM_032102		Approved	SRP46	uc001pff.3	Q9BRL6	OTTHUMG00000188534		11.37:g.94801037T>C		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	38.0	.	B2R6B8|Q6PF01|Q96TA3	RNA	SNP	ENST00000529911.1	37																																																																																				.		0.567	SRSF8-002	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000390962.3	NM_032102	
SSR3	6747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	156271447	156271447	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:156271447T>G	ENST00000265044.2	-	2	351	c.257A>C	c.(256-258)cAc>cCc	p.H86P	SSR3_ENST00000476217.1_Missense_Mutation_p.H86P|SSR3_ENST00000463503.1_Missense_Mutation_p.H34P|SSR3_ENST00000496050.1_Missense_Mutation_p.H34P|SSR3_ENST00000467789.1_Missense_Mutation_p.H86P|SSR3_ENST00000478842.1_5'Flank	NM_007107.3	NP_009038.1	Q9UNL2	SSRG_HUMAN	signal sequence receptor, gamma (translocon-associated protein gamma)	86					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	integral component of endoplasmic reticulum membrane (GO:0030176)|Sec61 translocon complex (GO:0005784)				endometrium(1)|prostate(2)	3			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TACTTACTTGTGCTTGAGAAC	0.313																																					p.H86P		.											.	SSR3	90	0			c.A257C						.						104.0	96.0	98.0					3																	156271447		2203	4300	6503	SO:0001583	missense	6747	exon2			TACTTGTGCTTGA	BC017203	CCDS3176.1	3q25.31	2004-02-27			ENSG00000114850	ENSG00000114850			11325	protein-coding gene	gene with protein product		606213					Standard	NM_007107		Approved	TRAPG	uc003fau.3	Q9UNL2	OTTHUMG00000158632	ENST00000265044.2:c.257A>C	3.37:g.156271447T>G	ENSP00000265044:p.His86Pro	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	21.0	NM_007107	B2R7D0|B4E2P2|D3DNK5|Q549M4	Missense_Mutation	SNP	ENST00000265044.2	37	CCDS3176.1	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451855	0.63290	.	.	ENSG00000114850	ENST00000265044;ENST00000467789;ENST00000476217;ENST00000463503;ENST00000496050	.	.	.	5.03	5.03	0.67393	.	0.141527	0.64402	D	0.000005	T	0.72391	0.3454	M	0.89095	3.005	0.80722	D	1	B;B	0.16802	0.019;0.018	B;B	0.19391	0.022;0.025	T	0.72030	-0.4413	9	0.40728	T	0.16	.	15.0687	0.72017	0.0:0.0:0.0:1.0	.	86;86	B4E2P2;Q9UNL2	.;SSRG_HUMAN	P	86;86;86;34;34	.	ENSP00000265044:H86P	H	-	2	0	SSR3	157754141	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.758000	0.85224	2.017000	0.59298	0.528000	0.53228	CAC	.		0.313	SSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351521.1	NM_007107	
SYNE2	23224	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	64491167	64491167	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr14:64491167C>G	ENST00000344113.4	+	39	6042	c.5830C>G	c.(5830-5832)Cag>Gag	p.Q1944E	SYNE2_ENST00000358025.3_Missense_Mutation_p.Q1944E|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Missense_Mutation_p.Q1944E	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1944					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CTCCTTGCAGCAGCTACTGAG	0.438																																					p.Q1944E		.											.	SYNE2	164	0			c.C5830G						.						55.0	53.0	54.0					14																	64491167		1890	4120	6010	SO:0001583	missense	23224	exon39			TTGCAGCAGCTAC	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.5830C>G	14.37:g.64491167C>G	ENSP00000341781:p.Gln1944Glu	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	9.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	37	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	7.103	0.574529	0.13623	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.35789	1.29;1.29;1.29	5.14	5.14	0.70334	.	0.000000	0.50627	D	0.000118	T	0.27278	0.0669	L	0.29908	0.895	0.80722	D	1	B;B	0.21905	0.037;0.062	B;B	0.26969	0.034;0.075	T	0.06445	-1.0826	10	0.06625	T	0.88	.	16.776	0.85550	0.0:1.0:0.0:0.0	.	1944;1944	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	E	1944	ENSP00000350719:Q1944E;ENSP00000341781:Q1944E;ENSP00000452570:Q1944E	ENSP00000261678:Q1944E	Q	+	1	0	SYNE2	63560920	1.000000	0.71417	0.987000	0.45799	0.004000	0.04260	3.168000	0.50801	2.386000	0.81285	0.585000	0.79938	CAG	.		0.438	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SZT2	23334	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	43896050	43896050	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:43896050G>A	ENST00000562955.1	+	30	4299	c.4299G>A	c.(4297-4299)atG>atA	p.M1433I	SZT2_ENST00000372442.1_Missense_Mutation_p.M591I	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1490					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CTGAGCTTATGGGAGAAGAAG	0.522																																					p.M1433I		.											.	SZT2	144	0			c.G4299A						.						125.0	124.0	124.0					1																	43896050		2203	4300	6503	SO:0001583	missense	23334	exon30			GCTTATGGGAGAA	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.4299G>A	1.37:g.43896050G>A	ENSP00000457168:p.Met1433Ile	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	16.0	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	37	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	G	8.120	0.780663	0.16120	.	.	ENSG00000198198	ENST00000372442	.	.	.	6.07	-2.47	0.06442	.	0.923284	0.09352	N	0.814025	T	0.13628	0.0330	N	0.02011	-0.69	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.32666	-0.9898	9	0.17369	T	0.5	.	12.4571	0.55710	0.695:0.0:0.305:0.0	.	1433	Q5T011-5	.	I	591	.	ENSP00000361519:M591I	M	+	3	0	SZT2	43668637	0.944000	0.32072	0.094000	0.20943	0.890000	0.51754	0.410000	0.21098	-0.342000	0.08363	-0.136000	0.14681	ATG	.		0.522	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
TMEM132D	121256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130015669	130015669	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr12:130015669A>T	ENST00000422113.2	-	3	1376	c.1050T>A	c.(1048-1050)gaT>gaA	p.D350E		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	350					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TTCCAGTATAATCCGTGCGCT	0.517																																					p.D350E		.											.	TMEM132D	106	0			c.T1050A						.						112.0	101.0	105.0					12																	130015669		2203	4300	6503	SO:0001583	missense	121256	exon3			AGTATAATCCGTG	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1050T>A	12.37:g.130015669A>T	ENSP00000408581:p.Asp350Glu	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	13.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	37	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	A	0.168	-1.074855	0.01903	.	.	ENSG00000151952	ENST00000422113	T	0.13089	2.62	5.09	-2.54	0.06307	.	0.339943	0.24559	N	0.037482	T	0.07593	0.0191	N	0.25890	0.77	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.34054	-0.9844	9	.	.	.	-5.9146	9.9494	0.41630	0.2388:0.6065:0.1547:0.0	.	350	Q14C87	T132D_HUMAN	E	350	ENSP00000408581:D350E	.	D	-	3	2	TMEM132D	128581622	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-0.802000	0.04545	-0.827000	0.04278	-0.290000	0.09829	GAT	.		0.517	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V157F	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,head_neck,carcinoma,0	TP53	70225	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	c.G469T						.						50.0	52.0	51.0					17																	7578461		2202	4300	6502	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGCGGACGCGGGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	17.37:g.7578461C>A	ENSP00000269305:p.Val157Phe	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	39.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	.		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP53BP2	7159	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	223983912	223983912	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr1:223983912G>C	ENST00000343537.7	-	13	2620	c.2329C>G	c.(2329-2331)Cca>Gca	p.P777A	TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391879.2_Missense_Mutation_p.P10A|TP53BP2_ENST00000391878.2_Missense_Mutation_p.P648A	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	771					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GACTTGGATGGGTATGATGGG	0.483																																					p.P777A		.											.	TP53BP2	229	0			c.C2329G						.						154.0	162.0	159.0					1																	223983912		2203	4300	6503	SO:0001583	missense	7159	exon13			TGGATGGGTATGA	U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2329C>G	1.37:g.223983912G>C	ENSP00000341957:p.Pro777Ala	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	6.0	NM_001031685	B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	ENST00000343537.7	37	CCDS44319.1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920866	0.33908	.	.	ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879	T;T;T	0.49720	0.82;1.0;0.77	5.47	2.02	0.26589	.	0.200971	0.53938	D	0.000052	T	0.32556	0.0833	L	0.36672	1.1	0.41222	D	0.986515	B;B	0.28055	0.199;0.0	B;B	0.23716	0.048;0.001	T	0.14309	-1.0477	10	0.54805	T	0.06	.	6.7283	0.23369	0.0783:0.1279:0.6623:0.1314	.	777;771	B4DG66;Q13625	.;ASPP2_HUMAN	A	648;777;10	ENSP00000375750:P648A;ENSP00000341957:P777A;ENSP00000375751:P10A	ENSP00000341957:P777A	P	-	1	0	TP53BP2	222050535	1.000000	0.71417	0.183000	0.23137	0.997000	0.91878	2.982000	0.49337	0.661000	0.30985	0.655000	0.94253	CCA	.		0.483	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090985.3	NM_001031685, NM_005426	
TP63	8626	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	189590736	189590736	+	Missense_Mutation	SNP	C	C	T	rs558374141		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr3:189590736C>T	ENST00000264731.3	+	10	1390	c.1301C>T	c.(1300-1302)aCg>aTg	p.T434M	TP63_ENST00000449992.1_Missense_Mutation_p.T255M|TP63_ENST00000392461.3_Missense_Mutation_p.T340M|TP63_ENST00000382063.4_Missense_Mutation_p.T349M|TP63_ENST00000440651.2_Missense_Mutation_p.T430M|TP63_ENST00000456148.1_Missense_Mutation_p.T336M|TP63_ENST00000437221.1_Missense_Mutation_p.T340M|TP63_ENST00000392460.3_Missense_Mutation_p.T434M|TP63_ENST00000392463.2_Missense_Mutation_p.T340M|TP63_ENST00000354600.5_Missense_Mutation_p.T340M|TP63_ENST00000418709.2_Missense_Mutation_p.T434M|TP63_ENST00000320472.5_Missense_Mutation_p.T434M	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	434	Oligomerization.				apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		ACAATTGAAACGTACAGGCAA	0.463										HNSCC(45;0.13)			C|||	1	0.000199681	0.0	0.0	5008	,	,		21745	0.0		0.0	False		,,,				2504	0.001				p.T434M		.											.	TP63	421	0			c.C1301T						.						184.0	149.0	161.0					3																	189590736		2203	4300	6503	SO:0001583	missense	8626	exon10			TTGAAACGTACAG	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1301C>T	3.37:g.189590736C>T	ENSP00000264731:p.Thr434Met	Somatic	288.0	0.0		WXS	Illumina HiSeq	Phase_I	297.0	117.0	NM_001114979	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152904	0.57259	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D;D;D	0.99680	-6.05;-6.32;-6.29;-6.29;-6.06;-6.37;-6.04;-6.32;-6.28;-6.28;-6.38;-6.04	5.81	4.94	0.65067	.	0.105498	0.64402	D	0.000002	D	0.99143	0.9704	L	0.34521	1.04	0.52099	D	0.999946	D;D;D;D;D;D;D;D;D	0.71674	0.996;0.996;0.996;0.993;0.997;0.977;0.996;0.994;0.998	P;P;P;P;P;P;P;P;D	0.64042	0.855;0.897;0.855;0.855;0.888;0.677;0.897;0.791;0.921	D	0.98400	1.0567	9	.	.	.	-19.9144	9.7402	0.40413	0.0:0.7865:0.1399:0.0736	.	255;434;340;340;340;340;434;434;434	Q9H3D4-10;Q9H3D4-7;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;P63_HUMAN;.	M	434;434;434;434;430;349;340;340;340;340;255;336	ENSP00000264731:T434M;ENSP00000407144:T434M;ENSP00000317510:T434M;ENSP00000376253:T434M;ENSP00000394337:T430M;ENSP00000371495:T349M;ENSP00000346614:T340M;ENSP00000392488:T340M;ENSP00000376256:T340M;ENSP00000376254:T340M;ENSP00000387839:T255M;ENSP00000389485:T336M	.	T	+	2	0	TP63	191073430	1.000000	0.71417	0.818000	0.32626	0.916000	0.54674	4.479000	0.60236	1.455000	0.47813	0.655000	0.94253	ACG	.		0.463	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
TSC2	7249	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	2138085	2138088	+	Frame_Shift_Del	DEL	TCGT	TCGT	-	rs397515227|rs45483700|rs45498401	byFrequency	TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	TCGT	TCGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr16:2138085_2138088delTCGT	ENST00000219476.3	+	40	5735_5738	c.5105_5108delTCGT	c.(5104-5109)atcgtgfs	p.IV1702fs	TSC2_ENST00000353929.4_Frame_Shift_Del_p.IV1659fs|TSC2_ENST00000401874.2_Frame_Shift_Del_p.IV1635fs|TSC2_ENST00000350773.4_Frame_Shift_Del_p.IV1679fs|TSC2_ENST00000568454.1_Frame_Shift_Del_p.IV1646fs|MIR1225_ENST00000408729.1_RNA|TSC2_ENST00000382538.6_Frame_Shift_Del_p.IV1587fs|TSC2_ENST00000439673.2_Frame_Shift_Del_p.IV1599fs	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1702	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GTGGCCAAGATCGTGTCTGACCGC	0.676			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.1702_1703del		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	1908	0			c.5105_5108del	GRCh37	CM010517	TSC2	M	rs45498401	.																																			SO:0001589	frameshift_variant	7249	exon40	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CCAAGATCGTGTC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.5105_5108delTCGT	16.37:g.2138085_2138088delTCGT	ENSP00000219476:p.Ile1702fs	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	12.0	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Frame_Shift_Del	DEL	ENST00000219476.3	37	CCDS10458.1																																																																																			.		0.676	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
TTC3	7267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	38461097	38461097	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr21:38461097A>T	ENST00000399017.2	+	5	3085		c.e5-1		TTC3_ENST00000354749.2_Splice_Site|TTC3_ENST00000355666.1_Splice_Site|TTC3_ENST00000479930.1_Splice_Site|TTC3_ENST00000540756.1_Intron|TTC3_ENST00000399010.1_Splice_Site	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TTTGTCTTTAAGCAATTCACG	0.284																																					.	Ovarian(38;194 1649 35661)	.											.	TTC3	590	0			c.339-2A>T						.						46.0	46.0	46.0					21																	38461097		2203	4300	6503	SO:0001630	splice_region_variant	7267	exon5			TCTTTAAGCAATT	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.339-1A>T	21.37:g.38461097A>T		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	22.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Splice_Site	SNP	ENST00000399017.2	37	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	A	18.53	3.643191	0.67244	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000399010;ENST00000399017;ENST00000354749	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5353	0.56138	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTC3	37382967	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.008000	0.63991	1.957000	0.56846	0.528000	0.53228	.	.		0.284	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		Intron
TTF1	7270	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	135276847	135276847	+	Silent	SNP	C	C	T	rs61741946	byFrequency	TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:135276847C>T	ENST00000334270.2	-	2	1401	c.1362G>A	c.(1360-1362)gcG>gcA	p.A454A		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	454					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		GTTACCTTGGCGCCTCTTGCA	0.458													c|||	2	0.000399361	0.0015	0.0	5008	,	,		13701	0.0		0.0	False		,,,				2504	0.0				p.A454A		.											.	TTF1	94	0			c.G1362A						.						99.0	99.0	99.0					9																	135276847		2203	4300	6503	SO:0001819	synonymous_variant	7270	exon2			CCTTGGCGCCTCT	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1362G>A	9.37:g.135276847C>T		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	50.0	NM_007344	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Silent	SNP	ENST00000334270.2	37	CCDS6948.1																																																																																			C|0.987;T|0.013		0.458	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054784.2	NM_007344	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	179604561	179604561	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:179604561delC	ENST00000591111.1	-	46	12672	c.12448delG	c.(12448-12450)gctfs	p.A4150fs	TTN_ENST00000589042.1_Frame_Shift_Del_p.A4467fs|TTN_ENST00000359218.5_Frame_Shift_Del_p.A4229fs|TTN_ENST00000460472.2_Frame_Shift_Del_p.A4104fs|TTN_ENST00000342175.6_Frame_Shift_Del_p.A4296fs|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAGGTTAGCCATTTGAGGA	0.413																																					p.A4467fs		.											.	TTN	636	0			c.13399delG						.						155.0	152.0	153.0					2																	179604561		1924	4145	6069	SO:0001589	frameshift_variant	7273	exon48			GGTTAGCCATTTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12448delG	2.37:g.179604561delC	ENSP00000465570:p.Ala4150fs	Somatic	123.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	25.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Frame_Shift_Del	DEL	ENST00000591111.1	37																																																																																				.		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TYMP	1890	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	50967719	50967743	+	Frame_Shift_Del	DEL	GTCTCCTCCAGATCCATGCCCCGAA	GTCTCCTCCAGATCCATGCCCCGAA	-	rs143789597|rs553915679	byFrequency	TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	GTCTCCTCCAGATCCATGCCCCGAA	GTCTCCTCCAGATCCATGCCCCGAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr22:50967719_50967743delGTCTCCTCCAGATCCATGCCCCGAA	ENST00000252029.3	-	3	401_425	c.239_263delTTCGGGGCATGGATCTGGAGGAGAC	c.(238-264)cttcggggcatggatctggaggagaccfs	p.LRGMDLEET80fs	TYMP_ENST00000395681.1_Frame_Shift_Del_p.LRGMDLEET80fs|SCO2_ENST00000543927.1_5'Flank|TYMP_ENST00000395678.3_Frame_Shift_Del_p.LRGMDLEET80fs|TYMP_ENST00000395680.1_Frame_Shift_Del_p.LRGMDLEET80fs	NM_001113755.2|NM_001113756.2|NM_001257988.1|NM_001257989.1|NM_001953.4	NP_001107227.1|NP_001107228.1|NP_001244917.1|NP_001244918.1|NP_001944.1	P19971	TYPH_HUMAN	thymidine phosphorylase	80					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)|DNA replication (GO:0006260)|mitochondrial genome maintenance (GO:0000002)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphorylase activity (GO:0004645)|platelet-derived growth factor receptor binding (GO:0005161)|pyrimidine-nucleoside phosphorylase activity (GO:0016154)|thymidine phosphorylase activity (GO:0009032)|transferase activity, transferring pentosyl groups (GO:0016763)			large_intestine(1)|lung(2)|ovary(1)|prostate(1)	5		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)	Capecitabine(DB01101)|Cidofovir(DB00369)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Trifluridine(DB00432)	CAGCACCGAGGTCTCCTCCAGATCCATGCCCCGAAGTCGGATGGC	0.68																																					p.80_88del		.											.	TYMP	23	0			c.239_263del	GRCh37	CM055158	TYMP	M		.																																			SO:0001589	frameshift_variant	1890	exon3			ACCGAGGTCTCCT	M63193	CCDS14096.1, CCDS58811.1	22q13	2014-09-17	2008-01-21	2008-01-21	ENSG00000025708	ENSG00000025708	2.4.2.4		3148	protein-coding gene	gene with protein product	"""gliostatin"""	131222	"""endothelial cell growth factor 1 (platelet-derived)"""	MNGIE, ECGF1		1590793, 11733540	Standard	NM_001113755		Approved		uc003bme.5	P19971	OTTHUMG00000150249	ENST00000252029.3:c.239_263delTTCGGGGCATGGATCTGGAGGAGAC	22.37:g.50967719_50967743delGTCTCCTCCAGATCCATGCCCCGAA	ENSP00000252029:p.Leu80fs	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	20.0	NM_001257989	A8MW15|H9KVA0|Q13390|Q8WVB7	Frame_Shift_Del	DEL	ENST00000252029.3	37	CCDS14096.1																																																																																			.		0.680	TYMP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317081.1	NM_001953	
UPRT	139596	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	74494412	74494412	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chrX:74494412C>T	ENST00000373383.4	+	1	490	c.323C>T	c.(322-324)gCg>gTg	p.A108V	UPRT_ENST00000531704.1_3'UTR|UPRT_ENST00000530743.1_5'Flank|UPRT_ENST00000373379.1_Missense_Mutation_p.A108V	NM_145052.3	NP_659489.1	Q96BW1	UPP_HUMAN	uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae)	108					female pregnancy (GO:0007565)|lactation (GO:0007595)|response to insulin (GO:0032868)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(4)|lung(4)	18						CAGATCGGGGCGCAGCTTAAG	0.557																																					p.A108V		.											.	UPRT	130	0			c.C323T						.						28.0	22.0	24.0					X																	74494412		2203	4300	6503	SO:0001583	missense	139596	exon1			TCGGGGCGCAGCT	BC015116	CCDS14429.1	Xq13.3	2009-01-14			ENSG00000094841	ENSG00000094841			28334	protein-coding gene	gene with protein product		300656				12477932	Standard	NM_145052		Approved	DKFZp781E1243, MGC23937, FUR1, RP11-311P8.3	uc004ecb.2	Q96BW1	OTTHUMG00000021864	ENST00000373383.4:c.323C>T	X.37:g.74494412C>T	ENSP00000362481:p.Ala108Val	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	88.0	NM_145052	Q5JRL1|Q5JRL3|Q68DN0|Q96MW2	Missense_Mutation	SNP	ENST00000373383.4	37	CCDS14429.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.299813	0.81136	.	.	ENSG00000094841	ENST00000373383;ENST00000373379	D;D	0.91521	-2.86;-2.86	5.38	2.51	0.30379	.	0.566544	0.18568	N	0.137402	T	0.81578	0.4852	L	0.35854	1.095	0.18873	N	0.999989	P;B;B	0.39022	0.655;0.145;0.145	B;B;B	0.28709	0.093;0.05;0.05	T	0.68538	-0.5382	10	0.34782	T	0.22	-7.9436	9.1085	0.36712	0.1541:0.5532:0.2927:0.0	.	108;108;108	Q96BW1-2;A8KAF9;Q96BW1	.;.;UPP_HUMAN	V	108	ENSP00000362481:A108V;ENSP00000362477:A108V	ENSP00000362471:A108V	A	+	2	0	UPRT	74411137	0.706000	0.27856	0.001000	0.08648	0.941000	0.58515	2.545000	0.45769	0.191000	0.20236	0.600000	0.82982	GCG	.		0.557	UPRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057278.1	NM_145052	
WDR60	55112	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	158734669	158734669	+	Silent	SNP	G	G	C	rs377386379		TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:158734669G>C	ENST00000407559.3	+	24	2990	c.2832G>C	c.(2830-2832)ccG>ccC	p.P944P		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	944					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		CCGCGTTTCCGCTCCTGCAGT	0.607																																					p.P944P		.											.	WDR60	92	0			c.G2832C						.						25.0	29.0	28.0					7																	158734669		2087	4203	6290	SO:0001819	synonymous_variant	55112	exon24			GTTTCCGCTCCTG		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.2832G>C	7.37:g.158734669G>C		Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	6.0	NM_018051	Q9NW58	Silent	SNP	ENST00000407559.3	37	CCDS47757.1																																																																																			.		0.607	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
XDH	7498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	31596741	31596741	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:31596741G>T	ENST00000379416.3	-	16	1732	c.1684C>A	c.(1684-1686)Caa>Aaa	p.Q562K		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	562					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GTACTCACTTGGAAGAGCTGG	0.483																																					p.Q562K	Colon(66;682 1445 30109 40147)	.											.	XDH	158	0			c.C1684A						.						48.0	45.0	46.0					2																	31596741		2203	4300	6503	SO:0001583	missense	7498	exon16			TCACTTGGAAGAG	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.1684C>A	2.37:g.31596741G>T	ENSP00000368727:p.Gln562Lys	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	9.0	NM_000379	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	37	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188959	0.57909	.	.	ENSG00000158125	ENST00000379416	T	0.10960	2.82	5.75	5.75	0.90469	Aldehyde oxidase/xanthine dehydrogenase, a/b hammerhead (1);	0.000000	0.85682	D	0.000000	T	0.24736	0.0600	M	0.88105	2.93	0.80722	D	1	B	0.18863	0.031	B	0.19148	0.024	T	0.06250	-1.0837	10	0.62326	D	0.03	.	19.5652	0.95390	0.0:0.0:1.0:0.0	.	562	P47989	XDH_HUMAN	K	562	ENSP00000368727:Q562K	ENSP00000368727:Q562K	Q	-	1	0	XDH	31450245	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	7.111000	0.77077	2.714000	0.92807	0.655000	0.94253	CAA	.		0.483	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
XPNPEP3	63929	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	41318489	41318489	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr22:41318489A>C	ENST00000357137.4	+	8	1292	c.1208A>C	c.(1207-1209)aAg>aCg	p.K403T	XPNPEP3_ENST00000544094.1_Missense_Mutation_p.K380T	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	403					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						GGGATCATGAAGAACATTAAG	0.443																																					p.K403T	Ovarian(145;306 1841 7037 21878 30110)	.											.	XPNPEP3	68	0			c.A1208C						.						204.0	201.0	202.0					22																	41318489		2203	4300	6503	SO:0001583	missense	63929	exon8			TCATGAAGAACAT		CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.1208A>C	22.37:g.41318489A>C	ENSP00000349658:p.Lys403Thr	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	6.0	NM_022098	B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Missense_Mutation	SNP	ENST00000357137.4	37	CCDS14007.1	.	.	.	.	.	.	.	.	.	.	A	14.70	2.613923	0.46631	.	.	ENSG00000196236	ENST00000357137;ENST00000544094	T;T	0.76968	-1.06;-1.06	5.59	-2.74	0.05932	Peptidase M24, structural domain (3);	0.783877	0.12363	N	0.475427	T	0.65112	0.2660	L	0.41124	1.26	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.54098	-0.8344	10	0.48119	T	0.1	-5.8035	8.6855	0.34234	0.5088:0.1106:0.3805:0.0	.	403	Q9NQH7	XPP3_HUMAN	T	403;380	ENSP00000349658:K403T;ENSP00000441942:K380T	ENSP00000349658:K403T	K	+	2	0	XPNPEP3	39648435	0.479000	0.25925	0.007000	0.13788	0.650000	0.38633	0.293000	0.19029	-0.399000	0.07668	0.533000	0.62120	AAG	.		0.443	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322201.2	NM_022098	
ZC3H7A	29066	hgsc.bcm.edu;broad.mit.edu	37	16	11876180	11876180	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr16:11876180T>C	ENST00000396516.2	-	1	228	c.31A>G	c.(31-33)Agg>Ggg	p.R11G	ZC3H7A_ENST00000575170.1_5'UTR|ZC3H7A_ENST00000355758.4_Missense_Mutation_p.R11G			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	11						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TTCTGCTGCCTTTTTCTTCTC	0.413																																					p.R11G		.											.	ZC3H7A	94	0			c.A31G						.						261.0	221.0	235.0					16																	11876180		2197	4300	6497	SO:0001583	missense	29066	exon2			GCTGCCTTTTTCT	AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.31A>G	16.37:g.11876180T>C	ENSP00000379773:p.Arg11Gly	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	4.0	NM_014153	D3DUG5|Q9NPE9	Missense_Mutation	SNP	ENST00000396516.2	37	CCDS10550.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.986262	0.74589	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.28454	1.61;1.61	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.54775	0.1879	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57464	-0.7807	10	0.56958	D	0.05	.	14.6773	0.68989	0.0:0.0:0.0:1.0	.	11	Q8IWR0	Z3H7A_HUMAN	G	11	ENSP00000347999:R11G;ENSP00000379773:R11G	ENSP00000347999:R11G	R	-	1	2	ZC3H7A	11783681	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.960000	0.56752	2.124000	0.65301	0.402000	0.26972	AGG	.		0.413	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437066.1	NM_014153	
ZDHHC2	51201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	17072756	17072756	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr8:17072756C>T	ENST00000262096.8	+	11	1656	c.961C>T	c.(961-963)Cat>Tat	p.H321Y		NM_016353.4	NP_057437.1	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2	321					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|recycling endosome membrane (GO:0055038)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|pancreas(1)|stomach(1)	8				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		TCTCGAAAACCATCAGTTTCC	0.378																																					p.H321Y		.											.	.	.	0			c.C961T						.						76.0	72.0	73.0					8																	17072756		1850	4101	5951	SO:0001583	missense	51201	exon11			GAAAACCATCAGT	AB023584	CCDS47810.1	8p22	2008-05-15			ENSG00000104219	ENSG00000104219		"""Zinc fingers, DHHC-type"""	18469	protein-coding gene	gene with protein product						10918388	Standard	NM_016353		Approved	ZNF372	uc003wxe.3	Q9UIJ5	OTTHUMG00000163860	ENST00000262096.8:c.961C>T	8.37:g.17072756C>T	ENSP00000262096:p.His321Tyr	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	30.0	NM_016353	D3DSP5	Missense_Mutation	SNP	ENST00000262096.8	37	CCDS47810.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023878	0.54683	.	.	ENSG00000104219	ENST00000262096	T	0.43688	0.94	5.53	5.53	0.82687	.	0.218907	0.47093	D	0.000259	T	0.45337	0.1337	M	0.65975	2.015	0.54753	D	0.999988	P	0.37781	0.608	B	0.37650	0.255	T	0.47849	-0.9085	10	0.56958	D	0.05	-3.1576	15.4426	0.75200	0.1394:0.8606:0.0:0.0	.	321	Q9UIJ5	ZDHC2_HUMAN	Y	321	ENSP00000262096:H321Y	ENSP00000262096:H321Y	H	+	1	0	ZDHHC2	17117127	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	6.455000	0.73497	2.773000	0.95371	0.585000	0.79938	CAT	.		0.378	ZDHHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376014.2	NM_016353	
ZFP36L2	678	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	43452474	43452474	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr2:43452474C>G	ENST00000282388.3	-	2	762	c.469G>C	c.(469-471)Gag>Cag	p.E157Q	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	157					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E157Q(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				CGGCACAGCTCGGTCTTGTAG	0.652																																					p.E157Q		.											.	ZFP36L2	226	1	Substitution - Missense(1)	lung(1)	c.G469C						.						37.0	37.0	37.0					2																	43452474		2202	4300	6502	SO:0001583	missense	678	exon2			ACAGCTCGGTCTT	X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.469G>C	2.37:g.43452474C>G	ENSP00000282388:p.Glu157Gln	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	7.0	NM_006887	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	ENST00000282388.3	37	CCDS1811.1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.861249	0.91433	.	.	ENSG00000152518	ENST00000282388	T	0.52526	0.66	4.76	4.76	0.60689	Zinc finger, CCCH-type (3);	0.063998	0.64402	D	0.000010	T	0.70736	0.3258	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76364	-0.2986	10	0.87932	D	0	-28.709	16.6213	0.84931	0.0:1.0:0.0:0.0	.	157	P47974	TISD_HUMAN	Q	157	ENSP00000282388:E157Q	ENSP00000282388:E157Q	E	-	1	0	ZFP36L2	43305978	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.308000	0.78929	2.202000	0.70862	0.555000	0.69702	GAG	.		0.652	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250513.2	NM_006887	
ZNF430	80264	broad.mit.edu;mdanderson.org	37	19	21216933	21216933	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:21216933G>C	ENST00000261560.5	+	4	446	c.265G>C	c.(265-267)Gag>Cag	p.E89Q	ZNF430_ENST00000599548.1_Missense_Mutation_p.E89Q|ZNF430_ENST00000595401.1_Missense_Mutation_p.E88Q	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	89	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						CACCTGTCTAGAGCAAGGAAA	0.423																																					p.E89Q		.											.	ZNF430	516	0			c.G265C						.						125.0	122.0	123.0					19																	21216933		2203	4300	6503	SO:0001583	missense	80264	exon4			TGTCTAGAGCAAG	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.265G>C	19.37:g.21216933G>C	ENSP00000261560:p.Glu89Gln	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	6.0	NM_025189	Q86V70	Missense_Mutation	SNP	ENST00000261560.5	37	CCDS32978.1	.	.	.	.	.	.	.	.	.	.	.	6.549	0.469630	0.12461	.	.	ENSG00000118620	ENST00000261560	T	0.01113	5.32	0.195	0.195	0.15151	Krueppel-associated box (3);	.	.	.	.	T	0.02888	0.0086	M	0.80332	2.49	0.09310	N	1	P;B	0.51449	0.945;0.158	P;B	0.48368	0.575;0.196	T	0.36040	-0.9764	8	0.62326	D	0.03	.	.	.	.	.	88;89	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	Q	89	ENSP00000261560:E89Q	ENSP00000261560:E89Q	E	+	1	0	ZNF430	21008773	0.012000	0.17670	0.167000	0.22817	0.171000	0.22731	1.504000	0.35726	0.300000	0.22699	0.306000	0.20318	GAG	.		0.423	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463539.1	NM_025189	
ZNF256	10172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58453067	58453067	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:58453067T>C	ENST00000282308.3	-	3	1305	c.1109A>G	c.(1108-1110)cAg>cGg	p.Q370R	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	370					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		GTGAACTCTCTGGTGTGTAAT	0.433																																					p.Q370R	NSCLC(55;1313 1552 8040 11996)	.											.	ZNF256	92	0			c.A1109G						.						74.0	68.0	70.0					19																	58453067		2203	4300	6503	SO:0001583	missense	10172	exon3			ACTCTCTGGTGTG	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.1109A>G	19.37:g.58453067T>C	ENSP00000282308:p.Gln370Arg	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	8.0	NM_005773	B2RA92|Q53Y85|Q9BV71	Missense_Mutation	SNP	ENST00000282308.3	37	CCDS12966.1	.	.	.	.	.	.	.	.	.	.	.	4.844	0.156988	0.09236	.	.	ENSG00000152454	ENST00000282308	T	0.17691	2.26	2.51	1.47	0.22746	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08133	0.0203	N	0.04355	-0.22	0.09310	N	1	P	0.44478	0.836	B	0.43018	0.405	T	0.21280	-1.0250	9	0.37606	T	0.19	.	5.6763	0.17751	0.0:0.1471:0.0:0.8529	.	370	Q9Y2P7	ZN256_HUMAN	R	370	ENSP00000282308:Q370R	ENSP00000282308:Q370R	Q	-	2	0	ZNF256	63144879	0.000000	0.05858	0.004000	0.12327	0.006000	0.05464	-0.442000	0.06871	0.214000	0.20742	-0.376000	0.06991	CAG	.		0.433	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
ZNF510	22869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	99525914	99525914	+	Splice_Site	SNP	C	C	T			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr9:99525914C>T	ENST00000375231.1	-	4	780	c.130G>A	c.(130-132)Gca>Aca	p.A44T	ZNF510_ENST00000223428.4_Splice_Site_p.A44T|ZNF510_ENST00000472201.1_5'UTR			Q9Y2H8	ZN510_HUMAN	zinc finger protein 510	44					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	21		Acute lymphoblastic leukemia(62;0.0527)				GACACTGATGCCTGTAACAGT	0.398																																					p.A44T		.											.	ZNF510	90	0			c.G130A						.						86.0	82.0	83.0					9																	99525914		2203	4300	6503	SO:0001630	splice_region_variant	22869	exon4			CTGATGCCTGTAA	AB023189	CCDS35074.1	9q22.33	2013-01-08			ENSG00000081386	ENSG00000081386		"""Zinc fingers, C2H2-type"", ""-"""	29161	protein-coding gene	gene with protein product						10231032	Standard	XM_005251807		Approved	KIAA0972	uc004awn.1	Q9Y2H8	OTTHUMG00000020303	ENST00000375231.1:c.130-1G>A	9.37:g.99525914C>T		Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	27.0	NM_014930	Q5SZP5	Missense_Mutation	SNP	ENST00000375231.1	37	CCDS35074.1	.	.	.	.	.	.	.	.	.	.	c	19.09	3.760827	0.69763	.	.	ENSG00000081386	ENST00000375231;ENST00000223428;ENST00000374641	T;T;T	0.00808	5.67;5.67;5.67	3.29	1.35	0.21983	Krueppel-associated box (1);	.	.	.	.	T	0.00608	0.0020	N	0.08118	0	0.09310	N	1	P	0.36065	0.535	B	0.34301	0.179	T	0.51585	-0.8687	9	0.39692	T	0.17	.	5.4816	0.16727	0.199:0.6869:0.0:0.1141	.	44	Q9Y2H8	ZN510_HUMAN	T	44	ENSP00000364379:A44T;ENSP00000223428:A44T;ENSP00000363772:A44T	ENSP00000223428:A44T	A	-	1	0	ZNF510	98565735	0.771000	0.28555	0.016000	0.15963	0.404000	0.30871	1.147000	0.31602	0.376000	0.24707	0.655000	0.94253	GCA	.		0.398	ZNF510-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053287.1	NM_014930	Missense_Mutation
ZNF586	54807	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58290133	58290133	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr19:58290133G>A	ENST00000396154.2	+	3	351	c.178G>A	c.(178-180)Ggg>Agg	p.G60R	ZNF586_ENST00000391702.3_Missense_Mutation_p.G17R|ZNF586_ENST00000598885.1_Intron|ZNF586_ENST00000396150.4_Silent_p.E17E|ZNF586_ENST00000598183.1_Intron|ZNF586_ENST00000599802.1_Intron	NM_017652.3	NP_060122.2	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)	15		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTGGCATGGAGGGGAAGATGA	0.443																																					p.G60R		.											.	ZNF586	92	0			c.G178A						.						70.0	67.0	68.0					19																	58290133		2042	4217	6259	SO:0001583	missense	54807	exon3			CATGGAGGGGAAG	AK095993	CCDS42640.1, CCDS56107.1, CCDS56108.1	19q13.43	2013-01-08				ENSG00000083828		"""Zinc fingers, C2H2-type"", ""-"""	25949	protein-coding gene	gene with protein product						12477932	Standard	NM_017652		Approved	FLJ20070	uc002qqd.3	Q9NXT0		ENST00000396154.2:c.178G>A	19.37:g.58290133G>A	ENSP00000379458:p.Gly60Arg	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	7.0	NM_017652	A0JLV8|A8MY63|B3KTS9|E7ERT1|G3XAH3	Missense_Mutation	SNP	ENST00000396154.2	37	CCDS42640.1	.	.	.	.	.	.	.	.	.	.	G	7.250	0.603058	0.13939	.	.	ENSG00000083828	ENST00000449441;ENST00000391702;ENST00000396154	T;T	0.09163	3.01;5.74	1.89	-0.389	0.12455	Krueppel-associated box (3);	.	.	.	.	T	0.08758	0.0217	.	.	.	0.09310	N	1	P	0.51057	0.941	B	0.43251	0.413	T	0.25328	-1.0135	8	0.59425	D	0.04	.	3.8261	0.08855	0.4528:0.0:0.5472:0.0	.	60	Q9NXT0	ZN586_HUMAN	R	60;17;60	ENSP00000375583:G17R;ENSP00000379458:G60R	ENSP00000375583:G17R	G	+	1	0	ZNF586	62981945	0.001000	0.12720	0.034000	0.17996	0.975000	0.68041	-0.032000	0.12266	0.115000	0.18071	-0.136000	0.14681	GGG	.		0.443	ZNF586-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466825.2	NM_017652	
ZNF716	441234	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	57529255	57529255	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IJ-01A-11D-A33Q-10	TCGA-CC-A7IJ-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	4daabef7-38d1-4a34-882c-1a78de6fe252	0d941ca8-539e-4a09-827d-7089b997f42e	g.chr7:57529255T>A	ENST00000420713.1	+	4	1200	c.1088T>A	c.(1087-1089)tTc>tAc	p.F363Y		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	363					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						GCCTTTACCTTCTCCTCAACT	0.413																																					p.F363Y		.											.	ZNF716	24	0			c.T1088A						.						63.0	64.0	64.0					7																	57529255		692	1591	2283	SO:0001583	missense	441234	exon4			TTACCTTCTCCTC	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1088T>A	7.37:g.57529255T>A	ENSP00000394248:p.Phe363Tyr	Somatic	116.0	1.0		WXS	Illumina HiSeq	Phase_I	99.0	35.0	NM_001159279		Missense_Mutation	SNP	ENST00000420713.1	37	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.288332	0.00019	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.13420	2.59	0.109	-0.218	0.13142	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03739	0.0106	N	0.02916	-0.46	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.34825	-0.9813	8	0.10377	T	0.69	.	.	.	.	.	351	A6NP11	ZN716_HUMAN	Y	363;351	ENSP00000394248:F363Y	ENSP00000387687:F351Y	F	+	2	0	ZNF716	57533197	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.170000	0.00281	-3.546000	0.00143	-3.666000	0.00025	TTC	.		0.413	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279	
