#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA4	24	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	94543350	94543350	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:94543350T>C	ENST00000370225.3	-	11	1536	c.1450A>G	c.(1450-1452)Aag>Gag	p.K484E	ABCA4_ENST00000535735.1_Missense_Mutation_p.K484E	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	484					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.K484E(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CGAGGGCCCTTGTAGAGGAAG	0.498																																					p.K484E		.											.	ABCA4	162	1	Substitution - Missense(1)	lung(1)	c.A1450G						.						172.0	167.0	169.0					1																	94543350		2203	4300	6503	SO:0001583	missense	24	exon11			GGCCCTTGTAGAG	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1450A>G	1.37:g.94543350T>C	ENSP00000359245:p.Lys484Glu	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	37.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	37	CCDS747.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.166960	0.38217	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.85171	-1.95;-1.95	5.24	5.24	0.73138	.	0.471455	0.23813	N	0.044308	T	0.70988	0.3287	L	0.39147	1.195	0.18873	N	0.999983	P;B	0.39940	0.696;0.001	B;B	0.41412	0.356;0.003	T	0.65331	-0.6194	10	0.19590	T	0.45	.	15.3047	0.73982	0.0:0.0:0.0:1.0	.	484;484	F5H6E5;P78363	.;ABCA4_HUMAN	E	484	ENSP00000359245:K484E;ENSP00000437682:K484E	ENSP00000359245:K484E	K	-	1	0	ABCA4	94315938	0.910000	0.30920	0.007000	0.13788	0.318000	0.28184	5.572000	0.67411	2.202000	0.70862	0.533000	0.62120	AAG	.		0.498	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
ABCC2	1244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	101556936	101556936	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:101556936G>T	ENST00000370449.4	+	7	828	c.715G>T	c.(715-717)Gtg>Ttg	p.V239L	ABCC2_ENST00000370434.1_Missense_Mutation_p.V239L	NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	239					cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	CAAGACATTAGTGAGCAAGTT	0.517																																					p.V239L		.											.	ABCC2	91	0			c.G715T						.						78.0	77.0	77.0					10																	101556936		2203	4300	6503	SO:0001583	missense	1244	exon7			ACATTAGTGAGCA	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.715G>T	10.37:g.101556936G>T	ENSP00000359478:p.Val239Leu	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	32.0	NM_000392	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	ENST00000370449.4	37	CCDS7484.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.070020	0.36566	.	.	ENSG00000023839	ENST00000370449;ENST00000370434	D;D	0.88586	-2.4;-2.4	5.62	-2.54	0.06307	.	1.373150	0.04252	N	0.338734	T	0.80412	0.4618	L	0.39245	1.2	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.60306	-0.7289	10	0.28530	T	0.3	-12.4658	0.7802	0.01039	0.2073:0.2454:0.1552:0.3921	.	239	Q92887	MRP2_HUMAN	L	239	ENSP00000359478:V239L;ENSP00000359463:V239L	ENSP00000359463:V239L	V	+	1	0	ABCC2	101546926	0.000000	0.05858	0.061000	0.19648	0.018000	0.09664	-0.030000	0.12308	0.016000	0.14998	-0.397000	0.06425	GTG	.		0.517	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049825.1	NM_000392	
ABCG1	9619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43646020	43646020	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr21:43646020G>T	ENST00000361802.2	+	2	427	c.282G>T	c.(280-282)aaG>aaT	p.K94N	ABCG1_ENST00000462050.1_3'UTR|ABCG1_ENST00000398457.2_Missense_Mutation_p.K96N|ABCG1_ENST00000398449.3_Missense_Mutation_p.K94N|ABCG1_ENST00000343687.3_Missense_Mutation_p.K105N|ABCG1_ENST00000347800.2_Missense_Mutation_p.K91N	NM_004915.3	NP_004906.3	P45844	ABCG1_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 1	94	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				amyloid precursor protein catabolic process (GO:0042987)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|detection of hormone stimulus (GO:0009720)|glycoprotein transport (GO:0034436)|high-density lipoprotein particle remodeling (GO:0034375)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of cholesterol efflux (GO:0010875)|regulation of cholesterol esterification (GO:0010872)|regulation of transcription, DNA-templated (GO:0006355)|response to high density lipoprotein particle (GO:0055099)|response to lipid (GO:0033993)|response to organic substance (GO:0010033)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|glycoprotein transporter activity (GO:0034437)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sterol-transporting ATPase activity (GO:0034041)|toxin transporter activity (GO:0019534)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(3)|prostate(2)|stomach(1)	29					Adenosine triphosphate(DB00171)	GGTGGAGGAAGAAAGGTAGGG	0.567																																					p.K105N		.											.	ABCG1	92	0			c.G315T						.						58.0	66.0	63.0					21																	43646020		2203	4300	6503	SO:0001583	missense	9619	exon2			GAGGAAGAAAGGT	U34919	CCDS13681.1, CCDS13682.1, CCDS13683.1, CCDS42937.1, CCDS42938.1	21q22.3	2012-03-14			ENSG00000160179	ENSG00000160179		"""ATP binding cassette transporters / subfamily G"""	73	protein-coding gene	gene with protein product	"""ATP-binding cassette transporter 8"""	603076				8659545, 16870176	Standard	NM_016818		Approved	ABC8	uc002zaq.3	P45844	OTTHUMG00000086791	ENST00000361802.2:c.282G>T	21.37:g.43646020G>T	ENSP00000354995:p.Lys94Asn	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	24.0	NM_207174	Q86SU8|Q96L76|Q9BXK6|Q9BXK7|Q9BXK8|Q9BXK9|Q9BXL0|Q9BXL1|Q9BXL2|Q9BXL3|Q9BXL4	Missense_Mutation	SNP	ENST00000361802.2	37	CCDS13682.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220676	0.58560	.	.	ENSG00000160179	ENST00000398457;ENST00000347800;ENST00000450121;ENST00000398449;ENST00000361802;ENST00000343687	D;D;D;D;D;D	0.86627	-2.15;-2.14;-1.84;-2.14;-2.11;-2.15	4.99	4.11	0.48088	ABC transporter-like (1);	.	.	.	.	T	0.78780	0.4337	L	0.33245	0.995	0.80722	D	1	P;B;B;B;B;B	0.36660	0.564;0.081;0.301;0.065;0.071;0.081	B;B;B;B;B;B	0.34242	0.168;0.02;0.178;0.03;0.073;0.094	T	0.74509	-0.3642	8	.	.	.	.	10.8834	0.46953	0.1525:0.0:0.8475:0.0	.	105;105;94;94;91;96	B4DPT7;P45844-2;P45844;P45844-4;P45844-5;P45844-3	.;.;ABCG1_HUMAN;.;.;.	N	96;91;94;94;94;105	ENSP00000381475:K96N;ENSP00000291524:K91N;ENSP00000414541:K94N;ENSP00000381467:K94N;ENSP00000354995:K94N;ENSP00000339744:K105N	.	K	+	3	2	ABCG1	42519089	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.261000	0.58841	1.234000	0.43709	0.561000	0.74099	AAG	.		0.567	ABCG1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195318.2	NM_207174	
ADAMDEC1	27299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	24254913	24254913	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:24254913A>G	ENST00000256412.4	+	6	791	c.571A>G	c.(571-573)Agc>Ggc	p.S191G	ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.S112G|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.S112G|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	191					immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		TGGTGTGAAGAGCACTGACGG	0.443																																					p.S191G	Ovarian(147;687 1849 3699 25981 31337)	.											.	ADAMDEC1	228	0			c.A571G						.						213.0	206.0	208.0					8																	24254913		2203	4300	6503	SO:0001583	missense	27299	exon6			GTGAAGAGCACTG	Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.571A>G	8.37:g.24254913A>G	ENSP00000256412:p.Ser191Gly	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	34.0	NM_014479	B7ZAK5	Missense_Mutation	SNP	ENST00000256412.4	37	CCDS6044.1	.	.	.	.	.	.	.	.	.	.	A	10.04	1.240511	0.22711	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.02863	4.13;4.13;4.13	5.53	0.121	0.14695	.	1.186920	0.05939	N	0.636654	T	0.01523	0.0049	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.09377	0.004	T	0.48843	-0.8999	10	0.16896	T	0.51	-9.9204	2.1959	0.03911	0.3917:0.3701:0.0917:0.1466	.	191	O15204	ADEC1_HUMAN	G	191;112;112	ENSP00000256412:S191G;ENSP00000442592:S112G;ENSP00000428993:S112G	ENSP00000256412:S191G	S	+	1	0	ADAMDEC1	24310858	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.938000	0.28965	0.071000	0.16664	0.455000	0.32223	AGC	.		0.443	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215149.2	NM_014479	
ADAM32	203102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	39018462	39018462	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:39018462A>G	ENST00000379907.4	+	7	699	c.572A>G	c.(571-573)cAt>cGt	p.H191R	ADAM32_ENST00000519315.1_Missense_Mutation_p.H191R|ADAM32_ENST00000437682.2_Missense_Mutation_p.H198R	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	191	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CTAGAAATGCATATTGTGGTG	0.303																																					p.H191R		.											.	ADAM32	227	0			c.A572G						.						151.0	130.0	136.0					8																	39018462		1819	4078	5897	SO:0001583	missense	203102	exon7			AAATGCATATTGT	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.572A>G	8.37:g.39018462A>G	ENSP00000369238:p.His191Arg	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	31.0	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	37	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	A	17.69	3.452154	0.63290	.	.	ENSG00000197140	ENST00000399831;ENST00000437682;ENST00000519315;ENST00000379907;ENST00000399826	T;T;T;T	0.63096	2.65;-0.02;-0.02;2.97	5.6	3.21	0.36854	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.769546	0.10651	N	0.649899	T	0.75788	0.3897	M	0.85542	2.76	0.22240	N	0.999267	P;D;D	0.58970	0.888;0.984;0.969	P;D;D	0.65010	0.762;0.917;0.931	T	0.59984	-0.7351	10	0.27082	T	0.32	.	5.6166	0.17434	0.7389:0.173:0.0882:0.0	.	198;191;191	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	R	150;198;191;191;192	ENSP00000382727:H150R;ENSP00000405978:H198R;ENSP00000429422:H191R;ENSP00000369238:H191R	ENSP00000369238:H191R	H	+	2	0	ADAM32	39137619	0.306000	0.24490	0.756000	0.31282	0.766000	0.43426	0.771000	0.26633	0.408000	0.25621	0.533000	0.62120	CAT	.		0.303	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
ADAMTS7	11173	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	79059245	79059245	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:79059245G>T	ENST00000388820.4	-	19	3218	c.3008C>A	c.(3007-3009)cCt>cAt	p.P1003H	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1003					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGAGCCTTCAGGGCCCAGTGT	0.667																																					p.P1003H		.											.	ADAMTS7	226	0			c.C3008A						.						19.0	20.0	19.0					15																	79059245		2185	4278	6463	SO:0001583	missense	11173	exon19			CCTTCAGGGCCCA	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.3008C>A	15.37:g.79059245G>T	ENSP00000373472:p.Pro1003His	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	21.0	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159885	0.57368	.	.	ENSG00000136378	ENST00000388820	T	0.59906	0.23	4.83	2.95	0.34219	.	0.824928	0.11097	N	0.600108	T	0.63224	0.2493	M	0.64997	1.995	0.09310	N	1	D	0.65815	0.995	P	0.53185	0.72	T	0.50898	-0.8773	10	0.52906	T	0.07	.	7.7336	0.28802	0.2653:0.0:0.7347:0.0	.	1003	Q9UKP4	ATS7_HUMAN	H	1003	ENSP00000373472:P1003H	ENSP00000373472:P1003H	P	-	2	0	ADAMTS7	76846300	0.001000	0.12720	0.026000	0.17262	0.153000	0.21895	0.955000	0.29188	0.457000	0.26962	-0.205000	0.12727	CCT	.		0.667	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
ADAMTSL3	57188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	84568428	84568428	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:84568428T>A	ENST00000286744.5	+	15	1869	c.1645T>A	c.(1645-1647)Tgg>Agg	p.W549R	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.W549R	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	549						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AAAATTGCCTTGGCTGAAACA	0.383																																					p.W549R		.											.	ADAMTSL3	1153	0			c.T1645A						.						115.0	95.0	102.0					15																	84568428		2203	4300	6503	SO:0001583	missense	57188	exon15			TTGCCTTGGCTGA	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.1645T>A	15.37:g.84568428T>A	ENSP00000286744:p.Trp549Arg	Somatic	232.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	66.0	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	37	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.295405	0.81025	.	.	ENSG00000156218	ENST00000286744	T	0.64085	-0.08	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.70237	0.3201	L	0.32530	0.975	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.997	T	0.73717	-0.3895	10	0.72032	D	0.01	.	14.3507	0.66699	0.0:0.0:0.0:1.0	.	549;549	P82987-2;P82987	.;ATL3_HUMAN	R	549	ENSP00000286744:W549R	ENSP00000286744:W549R	W	+	1	0	ADAMTSL3	82359432	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.007000	0.76335	1.985000	0.57927	0.519000	0.50382	TGG	.		0.383	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
ADAR	103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	154569745	154569745	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:154569745T>C	ENST00000368474.4	-	5	2134		c.e5-2		ADAR_ENST00000368471.3_Splice_Site|ADAR_ENST00000292205.5_Splice_Site	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific						adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TATTGGAACCTGACAGGAGAT	0.512																																					.		.											.	ADAR	157	0			c.1935-2A>G	GRCh37	CS090036	ADAR	S		.						62.0	61.0	61.0					1																	154569745		2203	4300	6503	SO:0001630	splice_region_variant	103	exon6			GGAACCTGACAGG	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.1935-2A>G	1.37:g.154569745T>C		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	36.0	NM_015840	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Splice_Site	SNP	ENST00000368474.4	37	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	T	12.01	1.810656	0.32053	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3898	0.74735	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAR	152836369	1.000000	0.71417	0.995000	0.50966	0.075000	0.17131	7.384000	0.79751	2.270000	0.75569	0.533000	0.62120	.	.		0.512	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	Intron
ADCY8	114	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	131797638	131797638	+	Silent	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:131797638A>T	ENST00000286355.5	-	16	5236	c.3144T>A	c.(3142-3144)ccT>ccA	p.P1048P	ADCY8_ENST00000377928.3_Silent_p.P917P	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	1048					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCTGTTTTTCAGGTGACAGGC	0.502										HNSCC(32;0.087)																											p.P1048P		.											.	ADCY8	157	0			c.T3144A						.						107.0	88.0	94.0					8																	131797638		2203	4300	6503	SO:0001819	synonymous_variant	114	exon16			TTTTTCAGGTGAC	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.3144T>A	8.37:g.131797638A>T		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	6.0	NM_001115		Silent	SNP	ENST00000286355.5	37	CCDS6363.1																																																																																			.		0.502	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ADCY8	114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	131848557	131848557	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:131848557A>G	ENST00000286355.5	-	12	4733	c.2641T>C	c.(2641-2643)Ttt>Ctt	p.F881L	ADCY8_ENST00000377928.3_Missense_Mutation_p.F750L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	881			F -> L (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TAACGCAGAAAGAGGCCTGCG	0.532										HNSCC(32;0.087)																											p.F881L		.											ADCY8,rectum,carcinoma,+2	ADCY8	157	0			c.T2641C						.						149.0	119.0	129.0					8																	131848557		2203	4300	6503	SO:0001583	missense	114	exon12			GCAGAAAGAGGCC	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2641T>C	8.37:g.131848557A>G	ENSP00000286355:p.Phe881Leu	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	46.0	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	A	17.76	3.469130	0.63625	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.80480	-1.38;-1.38	5.29	5.29	0.74685	.	0.058536	0.64402	D	0.000002	D	0.83792	0.5331	L	0.50333	1.59	0.35480	D	0.798077	D;P	0.67145	0.996;0.93	P;P	0.58721	0.844;0.449	D	0.86288	0.1672	10	0.31617	T	0.26	.	14.4064	0.67086	1.0:0.0:0.0:0.0	.	750;881	E7EVL1;P40145	.;ADCY8_HUMAN	L	881;750	ENSP00000286355:F881L;ENSP00000367161:F750L	ENSP00000286355:F881L	F	-	1	0	ADCY8	131917739	1.000000	0.71417	0.999000	0.59377	0.203000	0.24098	8.691000	0.91279	2.000000	0.58554	0.459000	0.35465	TTT	.		0.532	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ADGB	79747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	147067116	147067116	+	Missense_Mutation	SNP	G	G	A	rs554299523		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:147067116G>A	ENST00000397944.3	+	26	3312	c.3236G>A	c.(3235-3237)cGa>cAa	p.R1079Q	ADGB_ENST00000367493.3_Missense_Mutation_p.R498Q	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1079					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GCAGCCTCACGATGGAAACTG	0.438													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13586	0.0		0.0	False		,,,				2504	0.0				p.R1079Q		.											.	.	.	0			c.G3236A						.						105.0	99.0	101.0					6																	147067116		692	1591	2283	SO:0001583	missense	79747	exon26			CCTCACGATGGAA	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.3236G>A	6.37:g.147067116G>A	ENSP00000381036:p.Arg1079Gln	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	16.0	NM_024694	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	G	17.17	3.321992	0.60634	.	.	ENSG00000118492	ENST00000397944;ENST00000367493;ENST00000367490	T;T	0.43294	1.52;0.95	5.52	3.36	0.38483	.	.	.	.	.	T	0.17831	0.0428	L	0.57536	1.79	0.09310	N	1	B;B	0.31705	0.336;0.286	B;B	0.20955	0.005;0.032	T	0.12066	-1.0562	9	0.59425	D	0.04	.	7.0686	0.25165	0.3701:0.0:0.6299:0.0	.	1079;128	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	Q	1079;498;141	ENSP00000381036:R1079Q;ENSP00000356460:R141Q	ENSP00000356460:R141Q	R	+	2	0	C6orf103	147108809	0.431000	0.25546	0.022000	0.16811	0.385000	0.30292	2.175000	0.42491	1.472000	0.48140	0.563000	0.77884	CGA	.		0.438	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
AGO3	192669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	36439043	36439043	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:36439043A>T	ENST00000373191.4	+	5	938	c.589A>T	c.(589-591)Agg>Tgg	p.R197W	AGO3_ENST00000324350.5_Missense_Mutation_p.R197W|AGO3_ENST00000397828.2_Missense_Mutation_p.R197W|AGO3_ENST00000246314.6_Intron	NM_024852.3	NP_079128.2	Q9H9G7	AGO3_HUMAN	argonaute RISC catalytic component 3	197					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of stem cell proliferation (GO:0072091)	cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)										GGGAGGGGGCAGGGAAGTGTG	0.453																																					p.R197W		.											.	.	.	0			c.A589T						.						162.0	163.0	162.0					1																	36439043		2203	4300	6503	SO:0001583	missense	192669	exon5			GGGGGCAGGGAAG	AB046787	CCDS399.1, CCDS400.1	1p34	2013-06-03	2013-02-15	2013-02-15	ENSG00000126070	ENSG00000126070		"""Argonaute/PIWI family"""	18421	protein-coding gene	gene with protein product	"""argonaute 3"""	607355	"""eukaryotic translation initiation factor 2C, 3"""	EIF2C3		12906857	Standard	NM_024852		Approved	hAGO3, FLJ12765	uc001bzp.3	Q9H9G7	OTTHUMG00000184172	ENST00000373191.4:c.589A>T	1.37:g.36439043A>T	ENSP00000362287:p.Arg197Trp	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	27.0	NM_024852	B1ALI0|Q5TA55|Q9H1U6	Missense_Mutation	SNP	ENST00000373191.4	37	CCDS399.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.251485	0.80135	.	.	ENSG00000126070	ENST00000324350;ENST00000373191;ENST00000397828	T	0.10099	2.91	5.62	4.45	0.53987	Domain of unknown function DUF1785 (1);	0.000000	0.85682	D	0.000000	T	0.37489	0.1005	M	0.88450	2.955	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.984	T	0.38650	-0.9651	10	0.72032	D	0.01	.	12.2039	0.54340	0.7355:0.2645:0.0:0.0	.	197;197	Q9H9G7;Q5TA56	AGO3_HUMAN;.	W	197	ENSP00000362287:R197W	ENSP00000317425:R197W	R	+	1	2	EIF2C3	36211630	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	3.335000	0.52105	2.141000	0.66446	0.460000	0.39030	AGG	.		0.453	AGO3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019831.4	NM_024852	
AGPAT6	137964	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	41469773	41469773	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:41469773G>A	ENST00000396987.3	+	7	1703	c.776G>A	c.(775-777)aGc>aAc	p.S259N	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	259					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			ATCTTGGCCAGCGATGGCTAT	0.498																																					p.S259N		.											.	AGPAT6	90	0			c.G776A						.						145.0	126.0	132.0					8																	41469773		2203	4300	6503	SO:0001583	missense	137964	exon7			TGGCCAGCGATGG	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.776G>A	8.37:g.41469773G>A	ENSP00000380184:p.Ser259Asn	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	33.0	NM_178819	Q86V89	Missense_Mutation	SNP	ENST00000396987.3	37	CCDS6117.1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.612688	0.46631	.	.	ENSG00000158669	ENST00000396987	D	0.97232	-4.3	5.03	5.03	0.67393	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.92583	0.7644	N	0.11651	0.15	0.80722	D	1	B	0.11235	0.004	B	0.20384	0.029	D	0.88395	0.3011	10	0.33940	T	0.23	.	17.5492	0.87871	0.0:0.0:1.0:0.0	.	259	Q86UL3	GPAT4_HUMAN	N	259	ENSP00000380184:S259N	ENSP00000380184:S259N	S	+	2	0	AGPAT6	41588930	1.000000	0.71417	0.986000	0.45419	0.962000	0.63368	7.816000	0.86201	2.620000	0.88729	0.655000	0.94253	AGC	.		0.498	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105408806	105408806	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr14:105408806C>T	ENST00000333244.5	-	7	13101	c.12982G>A	c.(12982-12984)Gtg>Atg	p.V4328M	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4328						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCAGCCTCCACCTTCAGCGCA	0.602																																					p.V4328M		.											.	AHNAK2	47	0			c.G12982A						.						163.0	177.0	172.0					14																	105408806		1970	4141	6111	SO:0001583	missense	113146	exon7			CCTCCACCTTCAG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12982G>A	14.37:g.105408806C>T	ENSP00000353114:p.Val4328Met	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	54.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	c	10.48	1.363160	0.24684	.	.	ENSG00000185567	ENST00000333244	T	0.00932	5.53	3.16	1.19	0.21007	.	0.685869	0.10634	U	0.651821	T	0.02156	0.0067	M	0.63208	1.945	0.09310	N	1	P	0.44776	0.843	P	0.53006	0.715	T	0.46091	-0.9216	10	0.30078	T	0.28	.	4.1107	0.10057	0.1836:0.614:0.0:0.2023	.	4328	Q8IVF2	AHNK2_HUMAN	M	4328	ENSP00000353114:V4328M	ENSP00000353114:V4328M	V	-	1	0	AHNAK2	104479851	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.525000	0.06214	-0.086000	0.12550	-0.665000	0.03846	GTG	.		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AKAP4	8852	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	49958228	49958228	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:49958228A>G	ENST00000376056.2	-	5	1259	c.1109T>C	c.(1108-1110)gTg>gCg	p.V370A	AKAP4_ENST00000358526.2_Missense_Mutation_p.V379A|AKAP4_ENST00000376064.3_Missense_Mutation_p.V370A|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CAAATCGGACACAATCTCCTT	0.463																																					p.V379A		.											.	AKAP4	540	0			c.T1136C						.						70.0	59.0	63.0					X																	49958228		2203	4300	6503	SO:0001583	missense	8852	exon5			TCGGACACAATCT	AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1109T>C	X.37:g.49958228A>G	ENSP00000365224:p.Val370Ala	Somatic	46.0	1.0		WXS	Illumina HiSeq	Phase_I	27.0	11.0	NM_003886		Missense_Mutation	SNP	ENST00000376056.2	37	CCDS14330.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.309704	0.40895	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.13089	2.62;2.62;2.62	4.8	4.8	0.61643	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.44483	D	0.000455	T	0.35158	0.0922	M	0.77820	2.39	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.08911	-1.0699	9	.	.	.	-13.9969	9.82	0.40876	1.0:0.0:0.0:0.0	.	379	Q5JQC9	AKAP4_HUMAN	A	370;379;370	ENSP00000365224:V370A;ENSP00000351327:V379A;ENSP00000365232:V370A	.	V	-	2	0	AKAP4	49844968	0.999000	0.42202	1.000000	0.80357	0.554000	0.35429	5.194000	0.65125	1.581000	0.49865	0.381000	0.24937	GTG	.		0.463	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056552.1	NM_003886	
AKR1D1	6718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	137776523	137776523	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:137776523A>G	ENST00000242375.3	+	3	313	c.271A>G	c.(271-273)Aca>Gca	p.T91A	RN7SKP223_ENST00000410582.1_RNA|AKR1D1_ENST00000468877.2_Intron|AKR1D1_ENST00000411726.2_Missense_Mutation_p.T91A|AKR1D1_ENST00000432161.1_Missense_Mutation_p.T91A	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	91					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)			endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	GCTATGGGCTACAAATCATGT	0.448																																					p.T91A		.											.	AKR1D1	91	0			c.A271G						.						96.0	93.0	94.0					7																	137776523		2203	4300	6503	SO:0001583	missense	6718	exon3			TGGGCTACAAATC	Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.271A>G	7.37:g.137776523A>G	ENSP00000242375:p.Thr91Ala	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	14.0	NM_001190907	A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	ENST00000242375.3	37	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.956940	0.73902	.	.	ENSG00000122787	ENST00000432161;ENST00000411726;ENST00000242375;ENST00000438242	T;T;T;T	0.51325	1.93;1.93;1.93;0.71	5.4	5.4	0.78164	NADP-dependent oxidoreductase domain (3);	0.000000	0.85682	D	0.000000	T	0.63236	0.2494	L	0.54965	1.715	0.58432	D	0.999999	D;D;D	0.69078	0.997;0.996;0.982	D;D;P	0.76575	0.988;0.943;0.768	T	0.65734	-0.6096	10	0.72032	D	0.01	.	13.4313	0.61057	1.0:0.0:0.0:0.0	.	91;91;91	B4DPN8;B4DPN3;P51857	.;.;AK1D1_HUMAN	A	91;91;91;35	ENSP00000389197:T91A;ENSP00000402374:T91A;ENSP00000242375:T91A;ENSP00000397042:T35A	ENSP00000242375:T91A	T	+	1	0	AKR1D1	137427063	1.000000	0.71417	0.680000	0.29994	0.701000	0.40568	8.184000	0.89702	2.271000	0.75665	0.533000	0.62120	ACA	.		0.448	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989	
ALPP	250	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	233243696	233243696	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:233243696C>A	ENST00000392027.2	+	2	361	c.92C>A	c.(91-93)cCg>cAg	p.P31Q	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	31					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GAGGAGAACCCGGACTTCTGG	0.642																																					p.P31Q		.											.	ALPP	91	0			c.C92A						.						68.0	84.0	79.0					2																	233243696		2203	4300	6503	SO:0001583	missense	250	exon2			AGAACCCGGACTT	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.92C>A	2.37:g.233243696C>A	ENSP00000375881:p.Pro31Gln	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	16.0	NM_001632	P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	37	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	.	14.32	2.498901	0.44455	.	.	ENSG00000163283	ENST00000392027	T	0.64438	-0.1	2.32	2.32	0.28847	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.170635	0.52532	D	0.000070	T	0.81307	0.4795	M	0.91090	3.175	0.54753	D	0.999989	D	0.69078	0.997	D	0.76071	0.987	D	0.85840	0.1397	10	0.87932	D	0	.	13.0087	0.58720	0.0:1.0:0.0:0.0	.	31	P05187	PPB1_HUMAN	Q	31	ENSP00000375881:P31Q	ENSP00000375881:P31Q	P	+	2	0	ALPP	232951940	0.998000	0.40836	0.226000	0.23910	0.417000	0.31264	7.107000	0.77047	1.294000	0.44707	0.306000	0.20318	CCG	.		0.642	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
AMFR	267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	56435757	56435757	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:56435757T>A	ENST00000290649.5	-	8	1185		c.e8-2			NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase						aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						ACTGCAAACCTGTGGAAACAA	0.522																																					.	Pancreas(2;144 323 39528)	.											.	AMFR	1009	0			c.975-2A>T						.						73.0	69.0	70.0					16																	56435757		2198	4300	6498	SO:0001630	splice_region_variant	267	exon9			CAAACCTGTGGAA	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.975-2A>T	16.37:g.56435757T>A		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	8.0	NM_001144	P26442|Q8IZ70	Splice_Site	SNP	ENST00000290649.5	37	CCDS10758.1	.	.	.	.	.	.	.	.	.	.	T	19.28	3.796699	0.70567	.	.	ENSG00000159461	ENST00000290649	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8526	0.78943	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	AMFR	54993258	1.000000	0.71417	0.993000	0.49108	0.853000	0.48598	7.862000	0.87013	2.141000	0.66446	0.528000	0.53228	.	.		0.522	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256978.2		Intron
AP2B1	163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	33921086	33921086	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:33921086G>T	ENST00000262325.7	+	2	590	c.37G>T	c.(37-39)Gga>Tga	p.G13*	AP2B1_ENST00000537622.2_Splice_Site_p.G13*|AP2B1_ENST00000592545.1_Splice_Site_p.G13*|AP2B1_ENST00000538556.1_5'UTR|AP2B1_ENST00000589344.1_Splice_Site_p.G13*|AP2B1_ENST00000312678.8_Splice_Site_p.G13*	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	13					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		CAATAAAAAAGGTAAGTATGA	0.353																																					p.G13X		.											.	AP2B1	91	0			c.G37T						.						48.0	44.0	45.0					17																	33921086		2196	4297	6493	SO:0001630	splice_region_variant	163	exon2			AAAAAAGGTAAGT	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.37+1G>T	17.37:g.33921086G>T		Somatic	338.0	0.0		WXS	Illumina HiSeq	Phase_I	314.0	59.0	NM_001282	A6NJP3|P21851|Q7Z451|Q96J19	Nonsense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	G	38	6.654516	0.97739	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000537622	.	.	.	4.28	4.28	0.50868	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.2509	15.8086	0.78538	0.0:0.0:1.0:0.0	.	.	.	.	X	13	.	ENSP00000262325:G13X	G	+	1	0	AP2B1	30945199	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.362000	0.90100	2.380000	0.81148	0.467000	0.42956	GGA	.		0.353	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		Nonsense_Mutation
AQP10	89872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154296109	154296109	+	Silent	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:154296109G>C	ENST00000324978.3	+	5	574	c.534G>C	c.(532-534)ctG>ctC	p.L178L	ATP8B2_ENST00000368487.3_5'Flank|AQP10_ENST00000355197.4_3'UTR|AQP10_ENST00000484864.1_Silent_p.L178L	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	178					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGGCCATCCTGGACAGACGGA	0.617																																					p.L178L		.											.	AQP10	90	0			c.G534C						.						141.0	145.0	144.0					1																	154296109		2203	4300	6503	SO:0001819	synonymous_variant	89872	exon5			CATCCTGGACAGA	AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.534G>C	1.37:g.154296109G>C		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	16.0	NM_080429	Q5VYD3|Q5VYD4|Q8NG70	Silent	SNP	ENST00000324978.3	37	CCDS1065.1																																																																																			.		0.617	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087661.1	NM_080429	
ARHGAP22	58504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	49687731	49687731	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:49687731C>T	ENST00000249601.4	-	4	695	c.399G>A	c.(397-399)atG>atA	p.M133I	ARHGAP22_ENST00000417912.2_Missense_Mutation_p.M133I|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.M139I|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.M43I|ARHGAP22_ENST00000374170.1_Missense_Mutation_p.M43I|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.M8I	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	133	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCCAGTCCTCCATGTCACGCT	0.677																																					p.M139I		.											.	ARHGAP22	228	0			c.G417A						.						30.0	29.0	30.0					10																	49687731		2202	4299	6501	SO:0001583	missense	58504	exon4			GTCCTCCATGTCA	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.399G>A	10.37:g.49687731C>T	ENSP00000249601:p.Met133Ile	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	21.0	NM_001256025	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	C	32	5.151917	0.94645	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T	0.76316	-1.01;2.21;2.21;2.21;-1.01;-1.01	4.71	4.71	0.59529	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.049134	0.85682	D	0.000000	D	0.89438	0.6715	M	0.89287	3.02	0.80722	D	1	P;P;D;P	0.69078	0.738;0.906;0.997;0.72	P;D;D;P	0.87578	0.869;0.973;0.998;0.537	D	0.89692	0.3898	10	0.39692	T	0.17	.	16.8225	0.85922	0.0:1.0:0.0:0.0	.	139;133;133;43	B4DED8;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3	.;.;RHG22_HUMAN;.	I	133;8;43;43;139;133	ENSP00000249601:M133I;ENSP00000363287:M8I;ENSP00000363285:M43I;ENSP00000410054:M43I;ENSP00000416701:M139I;ENSP00000412461:M133I	ENSP00000249601:M133I	M	-	3	0	ARHGAP22	49357737	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.500000	0.81588	2.456000	0.83038	0.655000	0.94253	ATG	.		0.677	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
ARHGAP39	80728	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145758592	145758592	+	Missense_Mutation	SNP	C	C	T	rs144988605		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:145758592C>T	ENST00000276826.5	-	7	2914	c.2713G>A	c.(2713-2715)Gag>Aag	p.E905K	ARHGAP39_ENST00000540274.1_Missense_Mutation_p.E905K|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.E936K			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	905	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						AGCTGGCGCTCGGGGTAGCGC	0.657																																					p.E936K		.											.	ARHGAP39	90	0			c.G2806A						.						71.0	66.0	67.0					8																	145758592		2203	4300	6503	SO:0001583	missense	80728	exon10			GGCGCTCGGGGTA		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2713G>A	8.37:g.145758592C>T	ENSP00000276826:p.Glu905Lys	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	24.0	NM_025251	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	37		.	.	.	.	.	.	.	.	.	.	C	19.87	3.906975	0.72868	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.68181	-0.31;-0.08;-0.31	4.94	4.94	0.65067	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.275541	0.38111	N	0.001802	T	0.48114	0.1482	N	0.21142	0.635	0.38315	D	0.943359	B;B	0.30526	0.069;0.283	B;B	0.22152	0.009;0.038	T	0.50457	-0.8826	10	0.07482	T	0.82	-22.2584	16.014	0.80422	0.0:1.0:0.0:0.0	.	905;936	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	K	905;936;905	ENSP00000276826:E905K;ENSP00000366522:E936K;ENSP00000445075:E905K	ENSP00000276826:E905K	E	-	1	0	ARHGAP39	145729400	0.996000	0.38824	0.355000	0.25773	0.728000	0.41692	5.999000	0.70665	2.448000	0.82819	0.563000	0.77884	GAG	C|1.000;G|0.000		0.657	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
ARHGAP39	80728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	145806392	145806392	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:145806392C>T	ENST00000276826.5	-	2	551	c.350G>A	c.(349-351)cGc>cAc	p.R117H	ARHGAP39_ENST00000540274.1_Missense_Mutation_p.R117H|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.R117H			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	117					axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CGCCGAGGCGCGCGGGGACTC	0.711																																					p.R117H		.											.	ARHGAP39	90	0			c.G350A						.						10.0	11.0	11.0					8																	145806392		2181	4268	6449	SO:0001583	missense	80728	exon4			GAGGCGCGCGGGG		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.350G>A	8.37:g.145806392C>T	ENSP00000276826:p.Arg117His	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	23.0	NM_025251	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	37		.	.	.	.	.	.	.	.	.	.	C	16.60	3.168355	0.57584	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.03242	4.0;4.0;4.0	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000006	T	0.09113	0.0225	L	0.34521	1.04	0.25764	N	0.984919	D;D	0.76494	0.998;0.999	P;D	0.63877	0.781;0.919	T	0.15235	-1.0444	10	0.41790	T	0.15	-30.7916	12.4416	0.55627	0.0:0.8309:0.1691:0.0	.	117;117	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	H	117	ENSP00000276826:R117H;ENSP00000366522:R117H;ENSP00000445075:R117H	ENSP00000276826:R117H	R	-	2	0	ARHGAP39	145777200	0.324000	0.24652	0.309000	0.25155	0.030000	0.12068	3.676000	0.54612	2.526000	0.85167	0.557000	0.71058	CGC	.		0.711	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
ARMCX6	54470	hgsc.bcm.edu;bcgsc.ca	37	X	100871178	100871178	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:100871178C>A	ENST00000361910.4	-	3	777	c.433G>T	c.(433-435)Gcg>Tcg	p.A145S	ARMCX6_ENST00000497931.1_Intron|ARMCX6_ENST00000539247.1_Missense_Mutation_p.A145S|ARMCX6_ENST00000538627.1_Missense_Mutation_p.A145S	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	145						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						GGAAAGCCCGCATCCTTGGGC	0.478																																					p.A145S		.											.	ARMCX6	130	0			c.G433T						.						38.0	42.0	40.0					X																	100871178		2201	4293	6494	SO:0001583	missense	54470	exon4			AGCCCGCATCCTT	BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.433G>T	X.37:g.100871178C>A	ENSP00000354708:p.Ala145Ser	Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	67.0	NM_001184768	Q9NWJ3	Missense_Mutation	SNP	ENST00000361910.4	37	CCDS14488.1	.	.	.	.	.	.	.	.	.	.	.	10.31	1.314640	0.23908	.	.	ENSG00000198960	ENST00000361910;ENST00000539247;ENST00000538627	T;T;T	0.37058	1.22;1.22;1.22	3.91	2.12	0.27331	.	0.000000	0.49916	D	0.000128	T	0.53302	0.1788	M	0.79258	2.445	0.09310	N	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.37150	-0.9718	10	0.44086	T	0.13	-6.8423	5.782	0.18312	0.0:0.748:0.0:0.252	.	145	Q7L4S7	ARMX6_HUMAN	S	145	ENSP00000354708:A145S;ENSP00000444537:A145S;ENSP00000440648:A145S	ENSP00000354708:A145S	A	-	1	0	ARMCX6	100757834	0.051000	0.20477	0.005000	0.12908	0.027000	0.11550	0.978000	0.29488	0.449000	0.26747	0.476000	0.43555	GCG	.		0.478	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057562.1	NM_019007	
ASAP3	55616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	23762387	23762387	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:23762387T>G	ENST00000336689.3	-	17	1750	c.1706A>C	c.(1705-1707)aAt>aCt	p.N569T	ASAP3_ENST00000495646.1_Missense_Mutation_p.N73T|ASAP3_ENST00000437606.2_Missense_Mutation_p.N560T	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	569					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						GTCCTGCCCATTGGCAAAGGC	0.582																																					p.N569T		.											.	ASAP3	155	0			c.A1706C						.						105.0	110.0	108.0					1																	23762387		2203	4300	6503	SO:0001583	missense	55616	exon17			TGCCCATTGGCAA	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.1706A>C	1.37:g.23762387T>G	ENSP00000338769:p.Asn569Thr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	21.0	NM_017707	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	ENST00000336689.3	37	CCDS235.1	.	.	.	.	.	.	.	.	.	.	T	12.97	2.097053	0.37048	.	.	ENSG00000088280	ENST00000538685;ENST00000495646;ENST00000336689;ENST00000437606	T;T;T	0.52983	2.1;0.64;0.65	3.88	0.193	0.15139	Ankyrin repeat-containing domain (1);	0.289987	0.32204	N	0.006424	T	0.38134	0.1029	L	0.52011	1.625	0.27052	N	0.963765	B;B;B;B	0.18461	0.024;0.028;0.004;0.012	B;B;B;B	0.23419	0.014;0.046;0.046;0.024	T	0.37126	-0.9719	10	0.87932	D	0	.	7.4275	0.27107	0.0:0.4004:0.0:0.5996	.	560;438;92;569	Q8TDY4-3;B4DRP2;Q9NXH7;Q8TDY4	.;.;.;ASAP3_HUMAN	T	92;73;569;560	ENSP00000436150:N73T;ENSP00000338769:N569T;ENSP00000408826:N560T	ENSP00000338769:N569T	N	-	2	0	ASAP3	23634974	0.999000	0.42202	0.958000	0.39756	0.936000	0.57629	3.110000	0.50352	-0.063000	0.13065	0.363000	0.22086	AAT	.		0.582	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
ASCC1	51008	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	73892879	73892879	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:73892879T>C	ENST00000342444.4	-	9	992	c.891A>G	c.(889-891)aaA>aaG	p.K297K	ASCC1_ENST00000545550.1_Silent_p.K291K|ASCC1_ENST00000394915.3_Silent_p.K297K|ASCC1_ENST00000394919.1_Silent_p.K269K|ASCC1_ENST00000317126.4_Silent_p.K269K|ASCC1_ENST00000317168.6_Silent_p.K269K	NM_001198799.2	NP_001185728.1	Q8N9N2	ASCC1_HUMAN	activating signal cointegrator 1 complex subunit 1	297					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|transcription factor complex (GO:0005667)	catalytic activity (GO:0003824)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	7						TATTCCACTCTTTCACTATTA	0.398																																					p.K297K		.											.	ASCC1	226	0			c.A891G						.						131.0	121.0	124.0					10																	73892879		2203	4300	6503	SO:0001819	synonymous_variant	51008	exon9			CCACTCTTTCACT	AY013290	CCDS31219.1, CCDS55713.1	10q22.1	2012-09-20			ENSG00000138303	ENSG00000138303			24268	protein-coding gene	gene with protein product		614215				10810093, 12077347	Standard	NM_001198799		Approved	CGI-18, ASC1p50, Em:AC022392.3	uc001jst.2	Q8N9N2	OTTHUMG00000018434	ENST00000342444.4:c.891A>G	10.37:g.73892879T>C		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	23.0	NM_001198799	Q5SW06|Q5SW07|Q96EI8|Q9Y307	Silent	SNP	ENST00000342444.4	37	CCDS55713.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.822|9.822	1.185968|1.185968	0.21870|0.21870	.|.	.|.	ENSG00000138303|ENSG00000138303	ENST00000530394;ENST00000525286|ENST00000486689	T|.	0.63744|.	-0.06|.	5.75|5.75	0.849|0.849	0.18972|0.18972	.|.	0.046120|.	0.85682|.	D|.	0.000000|.	T|T	0.55561|0.55561	0.1928|0.1928	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49123|0.49123	-0.8972|-0.8972	7|4	0.19590|.	T|.	0.45|.	.|.	8.6068|8.6068	0.33778|0.33778	0.0:0.3013:0.0:0.6987|0.0:0.3013:0.0:0.6987	.|.	.|.	.|.	.|.	R|G	67;126|201	ENSP00000436409:K67R|.	ENSP00000435147:K126R|.	K|R	-|-	2|1	0|2	ASCC1|ASCC1	73562885|73562885	0.809000|0.809000	0.29036|0.29036	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	-0.323000|-0.323000	0.07997|0.07997	0.418000|0.418000	0.25898|0.25898	0.533000|0.533000	0.62120|0.62120	AAG|AGA	.		0.398	ASCC1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048573.2	NM_015947	
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197102525	197102525	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:197102525T>A	ENST00000367409.4	-	6	2630	c.2374A>T	c.(2374-2376)Agg>Tgg	p.R792W	ASPM_ENST00000367408.1_Missense_Mutation_p.R42W|ASPM_ENST00000294732.7_Missense_Mutation_p.R792W	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	792					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ATTAACCGCCTAGCTTCAATT	0.348																																					p.R792W		.											.	ASPM	615	0			c.A2374T						.						73.0	73.0	73.0					1																	197102525		2203	4300	6503	SO:0001583	missense	259266	exon6			ACCGCCTAGCTTC	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.2374A>T	1.37:g.197102525T>A	ENSP00000356379:p.Arg792Trp	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	175.0	62.0	NM_001206846	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	T	17.57	3.422176	0.62622	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	T;T;T	0.60040	0.22;0.22;0.22	5.27	0.922	0.19408	Calponin homology domain (1);	0.224829	0.38837	N	0.001549	T	0.64929	0.2643	L	0.53249	1.67	0.09310	N	1	D;D	0.76494	0.993;0.999	P;D	0.66497	0.849;0.944	T	0.57093	-0.7870	10	0.66056	D	0.02	.	8.8774	0.35354	0.0:0.0922:0.5359:0.3719	.	792;792	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	W	792;792;42	ENSP00000356379:R792W;ENSP00000294732:R792W;ENSP00000356378:R42W	ENSP00000294732:R792W	R	-	1	2	ASPM	195369148	0.991000	0.36638	0.012000	0.15200	0.972000	0.66771	1.131000	0.31406	-0.031000	0.13781	0.528000	0.53228	AGG	.		0.348	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
ATCAY	85300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3918830	3918830	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:3918830T>C	ENST00000450849.2	+	11	1495	c.1028T>C	c.(1027-1029)cTg>cCg	p.L343P	ATCAY_ENST00000301260.6_Missense_Mutation_p.L343P|ATCAY_ENST00000398448.3_Missense_Mutation_p.L349P|RN7SL202P_ENST00000584410.1_RNA|ATCAY_ENST00000600960.1_Missense_Mutation_p.L343P	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	343	Mediates interaction with GLS.				apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)			breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		GAGTTTGTGCTGCCCAGGTCT	0.617																																					p.L343P		.											.	ATCAY	67	0			c.T1028C						.						60.0	64.0	63.0					19																	3918830		2037	4198	6235	SO:0001583	missense	85300	exon11			TTGTGCTGCCCAG		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.1028T>C	19.37:g.3918830T>C	ENSP00000390941:p.Leu343Pro	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	38.0	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	T	2.902	-0.227324	0.06022	.	.	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.38240	1.18;1.17;1.15	2.89	1.86	0.25419	.	2.793970	0.01702	N	0.027256	T	0.27098	0.0664	L	0.27053	0.805	0.30623	N	0.758292	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.21930	-1.0231	10	0.35671	T	0.21	-14.2741	4.6217	0.12455	0.0:0.153:0.0:0.847	.	349;343;343	B4DS11;Q86WG3-3;Q86WG3	.;.;ATCAY_HUMAN	P	343;343;343;349;321	ENSP00000390941:L343P;ENSP00000301260:L343P;ENSP00000381466:L349P	ENSP00000301260:L343P	L	+	2	0	ATCAY	3869830	0.799000	0.28903	0.394000	0.26270	0.015000	0.08874	0.783000	0.26802	0.513000	0.28278	0.459000	0.35465	CTG	.		0.617	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
ATF6B	1388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32085719	32085719	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:32085719T>A	ENST00000375203.3	-	12	1373	c.1341A>T	c.(1339-1341)ccA>ccT	p.P447P	ATF6B_ENST00000375201.4_Silent_p.P444P	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	447					response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						CTCCCTGAACTGGCTCTTGCT	0.607																																					p.P447P		.											.	ATF6B	90	0			c.A1341T						.						47.0	49.0	48.0					6																	32085719		2203	4300	6503	SO:0001819	synonymous_variant	1388	exon12			CTGAACTGGCTCT		CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.1341A>T	6.37:g.32085719T>A		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	32.0	NM_004381	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	Silent	SNP	ENST00000375203.3	37	CCDS4737.1																																																																																			.		0.607	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076638.2		
ATP12A	479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25284608	25284608	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr13:25284608A>G	ENST00000381946.3	+	20	2941	c.2774A>G	c.(2773-2775)cAg>cGg	p.Q925R	ATP12A_ENST00000218548.6_Missense_Mutation_p.Q931R			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	925					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		ACAAGGTACCAGAGGGAATAC	0.453																																					p.Q931R	Pancreas(156;1582 1935 18898 22665 26498)	.											.	ATP12A	137	0			c.A2792G						.						89.0	87.0	88.0					13																	25284608		2203	4300	6503	SO:0001583	missense	479	exon20			GGTACCAGAGGGA	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2774A>G	13.37:g.25284608A>G	ENSP00000371372:p.Gln925Arg	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	39.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	37	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.863029	0.51482	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.88431	-2.38;-2.38	5.19	5.19	0.71726	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95519	0.8544	M	0.93283	3.4	0.58432	D	0.999996	D;D	0.64830	0.994;0.99	D;D	0.72625	0.978;0.947	D	0.96223	0.9162	10	0.62326	D	0.03	.	13.3136	0.60394	1.0:0.0:0.0:0.0	.	931;925	P54707-2;P54707	.;AT12A_HUMAN	R	931;925	ENSP00000218548:Q931R;ENSP00000371372:Q925R	ENSP00000218548:Q931R	Q	+	2	0	ATP12A	24182608	1.000000	0.71417	0.996000	0.52242	0.047000	0.14425	8.892000	0.92491	2.076000	0.62316	0.533000	0.62120	CAG	.		0.453	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
ATP1A2	477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160098468	160098468	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:160098468C>A	ENST00000361216.3	+	9	1133	c.1044C>A	c.(1042-1044)cgC>cgA	p.R348R	ATP1A2_ENST00000392233.3_Silent_p.R348R	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	348					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CAGCCAAGCGCATGGCACGGA	0.577																																					p.R348R		.											.	ATP1A2	518	0			c.C1044A						.						96.0	88.0	91.0					1																	160098468		2203	4300	6503	SO:0001819	synonymous_variant	477	exon9			CAAGCGCATGGCA	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1044C>A	1.37:g.160098468C>A		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	154.0	31.0	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Silent	SNP	ENST00000361216.3	37	CCDS1196.1	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311026	0.23821	.	.	ENSG00000018625	ENST00000447527	.	.	.	4.77	2.76	0.32466	.	.	.	.	.	T	0.42381	0.1200	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35276	-0.9795	4	.	.	.	.	7.3329	0.26592	0.2651:0.6483:0.0:0.0866	.	.	.	.	E	59	.	.	A	+	2	0	ATP1A2	158365092	0.190000	0.23276	1.000000	0.80357	0.966000	0.64601	-0.427000	0.06999	1.135000	0.42183	0.561000	0.74099	GCA	.		0.577	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	
ATP2B2	491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10382000	10382000	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:10382000T>A	ENST00000352432.4	-	20	3232	c.3163A>T	c.(3163-3165)Agc>Tgc	p.S1055C	ATP2B2_ENST00000397077.1_Missense_Mutation_p.S1010C|ATP2B2_ENST00000383800.4_Missense_Mutation_p.S1010C|ATP2B2_ENST00000360273.2_Missense_Mutation_p.S1055C|ATP2B2_ENST00000343816.4_Missense_Mutation_p.S1041C			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	1055					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GGAGAGCAGCTGAATGGCTTC	0.567																																					p.S1055C	Ovarian(125;1619 1709 15675 19819 38835)	.											.	ATP2B2	95	0			c.A3163T						.						91.0	81.0	84.0					3																	10382000		2203	4300	6503	SO:0001583	missense	491	exon21			AGCAGCTGAATGG	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.3163A>T	3.37:g.10382000T>A	ENSP00000324172:p.Ser1055Cys	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	16.0	NM_001001331	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.211153	0.79240	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52;-2.52	4.08	4.08	0.47627	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.95249	0.8459	M	0.93062	3.375	0.80722	D	1	D;B;B	0.76494	0.999;0.057;0.372	D;B;B	0.80764	0.994;0.152;0.371	D	0.95814	0.8844	10	0.62326	D	0.03	-23.103	13.0807	0.59112	0.0:0.0:0.0:1.0	.	990;1022;1055	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	C	1055;1010;1010;1055;1041;990;244;911;1055	ENSP00000324172:S1055C;ENSP00000373311:S1010C;ENSP00000380267:S1010C;ENSP00000353414:S1055C;ENSP00000344677:S1041C;ENSP00000414854:S911C	ENSP00000342954:S1055C	S	-	1	0	ATP2B2	10357000	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.792000	0.85828	1.487000	0.48415	0.460000	0.39030	AGC	.		0.567	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
ATP9A	10079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50255968	50255968	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:50255968T>C	ENST00000338821.5	-	15	1846	c.1582A>G	c.(1582-1584)Acc>Gcc	p.T528A	ATP9A_ENST00000311637.5_Missense_Mutation_p.T392A|ATP9A_ENST00000402822.1_Missense_Mutation_p.T407A	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	528					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TCGCCAGGGGTCCTCAGCTGC	0.532											OREG0026043	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T528A		.											.	ATP9A	94	0			c.A1582G						.						153.0	126.0	135.0					20																	50255968		2203	4300	6503	SO:0001583	missense	10079	exon15			CAGGGGTCCTCAG	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1582A>G	20.37:g.50255968T>C	ENSP00000342481:p.Thr528Ala	Somatic	147.0	0.0	968	WXS	Illumina HiSeq	Phase_I	144.0	18.0	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	T	15.65	2.896052	0.52121	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	T;T;T	0.77877	-1.08;-1.13;-1.08	5.32	5.32	0.75619	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.82001	0.4942	L	0.33137	0.985	0.80722	D	1	D;B	0.56035	0.974;0.005	D;B	0.70487	0.969;0.014	T	0.82633	-0.0361	10	0.46703	T	0.11	-41.2446	15.2837	0.73810	0.0:0.0:0.0:1.0	.	407;528	O75110-2;O75110	.;ATP9A_HUMAN	A	392;528;407	ENSP00000309086:T392A;ENSP00000342481:T528A;ENSP00000385875:T407A	ENSP00000309086:T392A	T	-	1	0	ATP9A	49689375	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.937000	0.87672	2.013000	0.59113	0.533000	0.62120	ACC	.		0.532	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
ATP9B	374868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	76966943	76966943	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr18:76966943A>T	ENST00000426216.2	+	10	978	c.961A>T	c.(961-963)Agt>Tgt	p.S321C	ATP9B_ENST00000307671.7_Missense_Mutation_p.S321C	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	321					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		ACAGGAAGACAGTGACCCGCC	0.408																																					p.S321C		.											.	ATP9B	93	0			c.A961T						.						113.0	102.0	105.0					18																	76966943		2203	4300	6503	SO:0001583	missense	374868	exon10			GAAGACAGTGACC	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.961A>T	18.37:g.76966943A>T	ENSP00000398076:p.Ser321Cys	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	17.0	NM_198531	O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	ENST00000426216.2	37	CCDS12014.1	.	.	.	.	.	.	.	.	.	.	A	12.21	1.868232	0.32977	.	.	ENSG00000166377	ENST00000426216;ENST00000307671	T;T	0.67345	-0.23;-0.26	5.42	2.93	0.34026	ATPase, P-type, ATPase-associated domain (1);	0.476053	0.23270	N	0.050021	T	0.58779	0.2146	L	0.54323	1.7	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.51841	-0.8654	10	0.42905	T	0.14	.	9.728	0.40344	0.7031:0.0:0.0:0.2969	.	321;321	O43861;O43861-2	ATP9B_HUMAN;.	C	321	ENSP00000398076:S321C;ENSP00000304500:S321C	ENSP00000304500:S321C	S	+	1	0	ATP9B	75067931	1.000000	0.71417	0.998000	0.56505	0.772000	0.43724	2.073000	0.41519	0.314000	0.23086	0.374000	0.22700	AGT	.		0.408	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
AZGP1	563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99569527	99569527	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:99569527C>A	ENST00000292401.4	-	2	315	c.179G>T	c.(178-180)aGa>aTa	p.R60I	AZGP1_ENST00000411734.1_Missense_Mutation_p.R57I	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	60					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					ACTGTTGTATCTAAAGAACTG	0.517																																					p.R60I		.											.	AZGP1	515	0			c.G179T						.						115.0	109.0	111.0					7																	99569527		2203	4300	6503	SO:0001583	missense	563	exon2			TTGTATCTAAAGA	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.179G>T	7.37:g.99569527C>A	ENSP00000292401:p.Arg60Ile	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	18.0	NM_001185	D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	ENST00000292401.4	37	CCDS5680.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.14|11.14	1.552511|1.552511	0.27739|0.27739	.|.	.|.	ENSG00000160862|ENSG00000160862	ENST00000419575|ENST00000292401;ENST00000411734	.|T;T	.|0.00940	.|5.52;5.52	1.51|1.51	-2.16|-2.16	0.07080|0.07080	.|MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.|0.983094	.|0.08225	.|U	.|0.978571	T|T	0.02012|0.02012	0.0063|0.0063	M|M	0.90082|0.90082	3.085|3.085	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.27971	.|0.196	.|B	.|0.23852	.|0.049	T|T	0.30060|0.30060	-0.9991|-0.9991	5|10	.|0.87932	.|D	.|0	.|.	5.346|5.346	0.16010|0.16010	0.0:0.1966:0.0:0.8034|0.0:0.1966:0.0:0.8034	.|.	.|60	.|P25311	.|ZA2G_HUMAN	Y|I	31|60;57	.|ENSP00000292401:R60I;ENSP00000396093:R57I	.|ENSP00000292401:R60I	D|R	-|-	1|2	0|0	AZGP1|AZGP1	99407463|99407463	0.341000|0.341000	0.24801|0.24801	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-0.417000|-0.417000	0.07088|0.07088	-0.371000|-0.371000	0.08004|0.08004	-1.745000|-1.745000	0.00682|0.00682	GAT|AGA	.		0.517	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059387.4	NM_001185	
BAI3	577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	70092727	70092727	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:70092727T>C	ENST00000370598.1	+	31	5101	c.4280T>C	c.(4279-4281)gTc>gCc	p.V1427A	BAI3_ENST00000238918.8_Missense_Mutation_p.V633A|BAI3_ENST00000546190.1_Missense_Mutation_p.V391A	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1427					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V1427G(1)		NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTGCAGAAGGTCATGCATACA	0.328																																					p.V1427A		.											.	BAI3	1148	1	Substitution - Missense(1)	lung(1)	c.T4280C						.						98.0	97.0	97.0					6																	70092727		2203	4300	6503	SO:0001583	missense	577	exon31			AGAAGGTCATGCA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.4280T>C	6.37:g.70092727T>C	ENSP00000359630:p.Val1427Ala	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	26.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	37	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.515019	0.85389	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.15017	2.46;2.46;2.46	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.27419	0.0673	L	0.52573	1.65	0.51233	D	0.999918	P;D	0.69078	0.924;0.997	P;D	0.72625	0.857;0.978	T	0.02646	-1.1129	10	0.87932	D	0	.	15.708	0.77602	0.0:0.0:0.0:1.0	.	633;1427	B7Z356;O60242	.;BAI3_HUMAN	A	1427;633;391	ENSP00000359630:V1427A;ENSP00000238918:V633A;ENSP00000441821:V391A	ENSP00000238918:V633A	V	+	2	0	BAI3	70149448	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.668000	0.83897	2.104000	0.64026	0.482000	0.46254	GTC	.		0.328	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
BDKRB2	624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96707630	96707630	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr14:96707630A>G	ENST00000306005.3	+	3	1161	c.965A>G	c.(964-966)tAc>tGc	p.Y322C	BDKRB2_ENST00000542454.2_Missense_Mutation_p.Y295C|RP11-404P21.8_ENST00000553811.1_Intron|BDKRB2_ENST00000554311.1_Missense_Mutation_p.Y322C|BDKRB2_ENST00000539359.1_Missense_Mutation_p.Y295C	NM_000623.3	NP_000614.1	P30411	BKRB2_HUMAN	bradykinin receptor B2	322					arachidonic acid secretion (GO:0050482)|blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress by p53 class mediator (GO:1902239)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of vascular permeability (GO:0043114)|regulation of vasoconstriction (GO:0019229)|response to salt stress (GO:0009651)|smooth muscle contraction (GO:0006939)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bradykinin receptor activity (GO:0004947)|phosphatidylinositol phospholipase C activity (GO:0004435)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(5)|lung(7)|ovary(3)|skin(1)	24		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)	Icatibant(DB06196)	TTCATGGCCTACAGCAACAGC	0.582																																					p.Y322C		.											.	BDKRB2	662	0			c.A965G						.						81.0	70.0	74.0					14																	96707630		2203	4300	6503	SO:0001583	missense	624	exon3			TGGCCTACAGCAA	S56772	CCDS9942.1	14q32.1-q32.2	2012-08-08				ENSG00000168398		"""GPCR / Class A : Bradykinin receptors"""	1030	protein-coding gene	gene with protein product		113503				7916737	Standard	NM_000623		Approved	BK-2	uc010avm.1	P30411		ENST00000306005.3:c.965A>G	14.37:g.96707630A>G	ENSP00000307713:p.Tyr322Cys	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	7.0	NM_000623		Missense_Mutation	SNP	ENST00000306005.3	37	CCDS9942.1	.	.	.	.	.	.	.	.	.	.	A	9.295	1.051571	0.19827	.	.	ENSG00000168398	ENST00000542454;ENST00000554311;ENST00000306005;ENST00000539359	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	4.62	2.13	0.27403	GPCR, rhodopsin-like superfamily (1);	0.285276	0.34580	N	0.003860	T	0.24774	0.0601	M	0.80422	2.495	0.38013	D	0.934619	B	0.20459	0.045	B	0.27076	0.076	T	0.09975	-1.0650	10	0.54805	T	0.06	-21.3378	5.3404	0.15981	0.5878:0.0:0.0835:0.3286	.	322	P30411	BKRB2_HUMAN	C	295;322;322;295	ENSP00000439459:Y295C;ENSP00000450482:Y322C;ENSP00000307713:Y322C;ENSP00000438376:Y295C	ENSP00000307713:Y322C	Y	+	2	0	BDKRB2	95777383	0.824000	0.29247	0.991000	0.47740	0.527000	0.34593	1.515000	0.35845	0.597000	0.29811	0.459000	0.35465	TAC	.		0.582	BDKRB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413294.1		
BOC	91653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113004363	113004363	+	Silent	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:113004363C>T	ENST00000495514.1	+	19	3812	c.3108C>T	c.(3106-3108)gcC>gcT	p.A1036A	BOC_ENST00000355385.3_Silent_p.A1036A|BOC_ENST00000273395.4_Silent_p.A1037A			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	1036					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TGAGGAGAGCCCCCGACAGTC	0.622																																					p.A1036A		.											.	BOC	157	0			c.C3108T						.						44.0	42.0	42.0					3																	113004363		2203	4300	6503	SO:0001819	synonymous_variant	91653	exon19			GAGAGCCCCCGAC	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.3108C>T	3.37:g.113004363C>T		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	69.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	37	CCDS2971.1																																																																																			.		0.622	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
BOD1L1	259282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	13616094	13616094	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:13616094T>C	ENST00000040738.5	-	4	1035	c.900A>G	c.(898-900)ttA>ttG	p.L300L		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	300						nucleus (GO:0005634)	DNA binding (GO:0003677)										TTAGCAGAATTAAATTATTAT	0.388																																					p.L300L		.											.	.	.	0			c.A900G						.						73.0	69.0	70.0					4																	13616094		2203	4300	6503	SO:0001819	synonymous_variant	259282	exon4			CAGAATTAAATTA	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.900A>G	4.37:g.13616094T>C		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	21.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	37	CCDS3411.2																																																																																			.		0.388	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
BSN	8927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49698355	49698355	+	Missense_Mutation	SNP	C	C	G	rs141830771		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:49698355C>G	ENST00000296452.4	+	6	9191	c.9077C>G	c.(9076-9078)aCc>aGc	p.T3026S		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3026					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		CAGGGCTGCACCACTCCCGCT	0.662																																					p.T3026S		.											.	BSN	97	0			c.C9077G						.						49.0	45.0	46.0					3																	49698355		2203	4300	6503	SO:0001583	missense	8927	exon6			GCTGCACCACTCC	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.9077C>G	3.37:g.49698355C>G	ENSP00000296452:p.Thr3026Ser	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	13.0	NM_003458	O43161|Q7LGH3	Missense_Mutation	SNP	ENST00000296452.4	37	CCDS2800.1	.	.	.	.	.	.	.	.	.	.	C	5.711	0.315736	0.10789	.	.	ENSG00000164061	ENST00000296452	T	0.16743	2.32	4.61	4.61	0.57282	.	0.578373	0.16382	N	0.216857	T	0.08802	0.0218	N	0.03608	-0.345	0.35544	D	0.803308	B	0.12630	0.006	B	0.14578	0.011	T	0.22347	-1.0219	10	0.30078	T	0.28	-1.447	13.9181	0.63914	0.0:0.8465:0.1535:0.0	.	3026	Q9UPA5	BSN_HUMAN	S	3026	ENSP00000296452:T3026S	ENSP00000296452:T3026S	T	+	2	0	BSN	49673359	0.164000	0.22935	0.004000	0.12327	0.039000	0.13416	3.871000	0.56077	2.120000	0.65058	0.561000	0.74099	ACC	C|1.000;T|0.000		0.662	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
BTLA	151888	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	112185077	112185077	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:112185077C>A	ENST00000334529.5	-	5	950	c.748G>T	c.(748-750)Gaa>Taa	p.E250*	BTLA_ENST00000383680.4_Nonsense_Mutation_p.E202*|BTLA_ENST00000474965.1_5'UTR	NM_181780.3	NP_861445	Q7Z6A9	BTLA_HUMAN	B and T lymphocyte associated	250					immune response-regulating cell surface receptor signaling pathway (GO:0002768)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of B cell proliferation (GO:0030889)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|cervix(2)|large_intestine(1)|lung(5)|prostate(1)	11		Acute lymphoblastic leukemia(4;1.34e-07)|all_hematologic(4;0.000361)				GGTTTGTTTTCTTCCAGGCAT	0.413																																					p.E250X		.											.	BTLA	90	0			c.G748T						.						125.0	120.0	122.0					3																	112185077		2203	4300	6503	SO:0001587	stop_gained	151888	exon5			TGTTTTCTTCCAG	AY293286	CCDS33819.1, CCDS43130.1	3q13.2	2013-01-11			ENSG00000186265	ENSG00000186265		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21087	protein-coding gene	gene with protein product		607925				12796776	Standard	NM_001085357		Approved	BTLA1, CD272	uc003dza.4	Q7Z6A9	OTTHUMG00000159255	ENST00000334529.5:c.748G>T	3.37:g.112185077C>A	ENSP00000333919:p.Glu250*	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	21.0	NM_181780	Q3B831|Q3HS85|Q6ZNH9	Nonsense_Mutation	SNP	ENST00000334529.5	37	CCDS33819.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.624481	0.66901	.	.	ENSG00000186265	ENST00000334529;ENST00000383680	.	.	.	5.13	3.32	0.38043	.	0.426359	0.19352	N	0.116375	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-5.4371	7.885	0.29644	0.0:0.8117:0.0:0.1883	.	.	.	.	X	250;202	.	ENSP00000333919:E250X	E	-	1	0	BTLA	113667767	0.038000	0.19896	0.342000	0.25602	0.263000	0.26337	0.427000	0.21379	0.725000	0.32318	0.591000	0.81541	GAA	.		0.413	BTLA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354101.1	NM_181780	
PERM1	84808	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	914384	914384	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:914384G>A	ENST00000341290.2	-	3	1719	c.1684C>T	c.(1684-1686)Ccg>Tcg	p.P562S	C1orf170_ENST00000433179.2_Missense_Mutation_p.P582S			Q5SV97	PERM1_HUMAN		676					regulation of transcription, DNA-templated (GO:0006355)|response to muscle activity (GO:0014850)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGGACAGCCGGCCCCAGCACG	0.701																																					.		.											.	C1orf170	68	0			.						.																																			SO:0001583	missense	84808	.			CAGCCGGCCCCAG																												ENST00000341290.2:c.1684C>T	1.37:g.914384G>A	ENSP00000343864:p.Pro562Ser	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	16.0	.	Q6ZVZ7|Q9BRF2|S5G239	RNA	SNP	ENST00000341290.2	37		.	.	.	.	.	.	.	.	.	.	.	8.996	0.978923	0.18812	.	.	ENSG00000187642	ENST00000433179;ENST00000341290	T	0.69561	-0.41	4.79	1.82	0.25136	.	0.210963	0.26700	N	0.022942	T	0.64271	0.2583	.	.	.	0.09310	N	1	D	0.53462	0.96	P	0.52217	0.693	T	0.54636	-0.8264	9	0.33141	T	0.24	-2.4158	7.3978	0.26946	0.0907:0.319:0.5904:0.0	.	582	Q5SV97	CA170_HUMAN	S	582;562	ENSP00000414022:P582S	ENSP00000343864:P562S	P	-	1	0	C1orf170	904247	0.005000	0.15991	0.000000	0.03702	0.003000	0.03518	0.834000	0.27518	0.170000	0.19704	-0.455000	0.05494	CCG	.		0.701	C1orf170-001	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000097943.2		
C2CD5	9847	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	22676443	22676443	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:22676443T>A	ENST00000333957.4	-	7	972	c.717A>T	c.(715-717)atA>atT	p.I239I	C2CD5_ENST00000540703.1_5'UTR|C2CD5_ENST00000396028.2_Silent_p.I239I|C2CD5_ENST00000446597.1_Silent_p.I239I|C2CD5_ENST00000536386.1_Silent_p.I239I|C2CD5_ENST00000544930.1_Silent_p.I41I|C2CD5_ENST00000542676.1_Silent_p.I239I|C2CD5_ENST00000545552.1_Silent_p.I239I	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	239					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										ACGCCGTTCCTATGGCTCGCA	0.453																																					p.I239I		.											.	.	.	0			c.A717T						.						132.0	121.0	124.0					12																	22676443		2203	4300	6503	SO:0001819	synonymous_variant	9847	exon7			CGTTCCTATGGCT	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.717A>T	12.37:g.22676443T>A		Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	19.0	NM_014802	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	ENST00000333957.4	37	CCDS31758.1																																																																																			.		0.453	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402257.1	NM_014802	
C3orf17	25871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	112736436	112736436	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:112736436T>A	ENST00000314400.5	-	2	311	c.120A>T	c.(118-120)gcA>gcT	p.A40A	RP11-572M11.4_ENST00000496389.1_RNA|C3orf17_ENST00000383675.2_Silent_p.A40A|RP11-572M11.4_ENST00000460707.1_RNA|RP11-572M11.4_ENST00000470313.1_RNA|RP11-572M11.4_ENST00000467342.1_RNA|C3orf17_ENST00000393857.2_Intron	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	40					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						TAATTACAGCTGCAATGCAAA	0.353																																					p.A40A		.											.	C3orf17	90	0			c.A120T						.						151.0	135.0	141.0					3																	112736436		2203	4300	6503	SO:0001819	synonymous_variant	25871	exon2			TACAGCTGCAATG	AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.120A>T	3.37:g.112736436T>A		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	42.0	NM_015412	D3DN69|Q68DM6|Q9H7U0|Q9UFM4	Silent	SNP	ENST00000314400.5	37	CCDS33824.1																																																																																			.		0.353	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3	NM_015412	
C4orf47	441054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	186361844	186361844	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:186361844A>G	ENST00000378850.4	+	5	707	c.685A>G	c.(685-687)Act>Gct	p.T229A		NM_001114357.1	NP_001107829.1	A7E2U8	CD047_HUMAN	chromosome 4 open reading frame 47	229										breast(2)|endometrium(1)	3						AATTTCAAATACTTTTAAACC	0.289																																					p.T229A		.											.	.	.	0			c.A685G						.						34.0	29.0	30.0					4																	186361844		692	1589	2281	SO:0001583	missense	441054	exon5			TCAAATACTTTTA	AY947525, BC127739, BC141967	CCDS47169.1	4q35.1	2008-07-18			ENSG00000205129	ENSG00000205129			34346	protein-coding gene	gene with protein product						12477932	Standard	NM_001114357		Approved	LOC441054	uc003ixt.2	A7E2U8	OTTHUMG00000160458	ENST00000378850.4:c.685A>G	4.37:g.186361844A>G	ENSP00000368127:p.Thr229Ala	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	63.0	NM_001114357	Q5BLP7	Missense_Mutation	SNP	ENST00000378850.4	37	CCDS47169.1	.	.	.	.	.	.	.	.	.	.	A	5.561	0.288430	0.10513	.	.	ENSG00000205129	ENST00000378850	.	.	.	5.49	2.77	0.32553	.	.	.	.	.	T	0.22437	0.0541	N	0.08118	0	0.22896	N	0.998598	B	0.18310	0.027	B	0.15052	0.012	T	0.20273	-1.0280	7	.	.	.	-2.6959	11.5758	0.50860	0.1361:0.6205:0.2434:0.0	.	229	A7E2U8	CD047_HUMAN	A	229	.	.	T	+	1	0	C4orf47	186598838	0.634000	0.27190	0.119000	0.21687	0.014000	0.08584	1.147000	0.31602	0.262000	0.21774	-1.701000	0.00721	ACT	.		0.289	C4orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360667.1	NM_001114357	
C6orf57	135154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	71289154	71289154	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:71289154T>G	ENST00000370474.3	+	2	126	c.102T>G	c.(100-102)agT>agG	p.S34R		NM_145267.2	NP_660310.2	Q5VUM1	SDHF4_HUMAN	chromosome 6 open reading frame 57	34					innate immune response (GO:0045087)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)				kidney(1)|lung(1)|skin(1)	3						GGAAAACAAGTTCTTCTCAAG	0.393																																					p.S34R		.											.	C6orf57	90	0			c.T102G						.						100.0	99.0	99.0					6																	71289154		2203	4300	6503	SO:0001583	missense	135154	exon2			AACAAGTTCTTCT	BC018085	CCDS4972.1	6q12	2011-12-13			ENSG00000154079	ENSG00000154079			20957	protein-coding gene	gene with protein product							Standard	NM_145267		Approved		uc003pfq.1	Q5VUM1	OTTHUMG00000014992	ENST00000370474.3:c.102T>G	6.37:g.71289154T>G	ENSP00000359505:p.Ser34Arg	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	30.0	NM_145267	E1P532	Missense_Mutation	SNP	ENST00000370474.3	37	CCDS4972.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.958672	0.34565	.	.	ENSG00000154079	ENST00000370474	T	0.33654	1.4	4.47	3.3	0.37823	.	0.811929	0.11927	N	0.516110	T	0.09642	0.0237	N	0.24115	0.695	0.29679	N	0.841869	P	0.48911	0.917	B	0.38655	0.278	T	0.07009	-1.0795	10	0.52906	T	0.07	-0.7049	5.2358	0.15445	0.0:0.2001:0.0:0.7999	.	34	Q5VUM1	CF057_HUMAN	R	34	ENSP00000359505:S34R	ENSP00000359505:S34R	S	+	3	2	C6orf57	71345875	0.998000	0.40836	0.985000	0.45067	0.672000	0.39443	0.267000	0.18552	1.768000	0.52137	0.472000	0.43445	AGT	.		0.393	C6orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041140.1	NM_145267	
C8orf22	492307	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	49986888	49986888	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:49986888A>G	ENST00000303202.8	+	4	402	c.229A>G	c.(229-231)Act>Gct	p.T77A	C8orf22_ENST00000399653.4_Missense_Mutation_p.T77A|C8orf22_ENST00000517663.1_Missense_Mutation_p.T77A|C8orf22_ENST00000522267.1_Missense_Mutation_p.T77A	NM_001256598.1	NP_001243527.1	Q8WWR9	PDPFL_HUMAN	chromosome 8 open reading frame 22	77					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)					large_intestine(1)|lung(7)|prostate(1)	9		all_cancers(86;0.0452)|all_epithelial(80;0.000863)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				TCTGTCTGCTACTGGGTGAGT	0.398																																					p.T77A		.											.	.	.	0			c.A229G						.						73.0	69.0	70.0					8																	49986888		1891	4112	6003	SO:0001583	missense	492307	exon4			TCTGCTACTGGGT	BC017981	CCDS47854.1, CCDS59101.1, CCDS59102.1	8q11.21	2012-04-11			ENSG00000168333	ENSG00000168333			31745	protein-coding gene	gene with protein product							Standard	NM_001007176		Approved		uc031tba.1	Q8WWR9	OTTHUMG00000164217	ENST00000303202.8:c.229A>G	8.37:g.49986888A>G	ENSP00000304926:p.Thr77Ala	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	17.0	NM_001256598	G3V137|Q8WVI1	Missense_Mutation	SNP	ENST00000303202.8	37	CCDS59101.1	.	.	.	.	.	.	.	.	.	.	A	0.567	-0.842714	0.02671	.	.	ENSG00000168333	ENST00000517663;ENST00000522267;ENST00000399653;ENST00000303202	.	.	.	4.15	-3.47	0.04753	.	0.737822	0.11828	U	0.525484	T	0.15262	0.0368	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.21724	-1.0237	7	.	.	.	-16.8682	3.0681	0.06221	0.3377:0.0:0.3175:0.3448	.	77	Q8WWR9-2	.	A	77	.	.	T	+	1	0	C8orf22	50149441	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	0.250000	0.18235	-0.237000	0.09739	0.421000	0.28195	ACT	.		0.398	C8orf22-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377837.1	NM_001007176	
C9orf172	389813	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	139740383	139740383	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:139740383T>C	ENST00000436881.1	+	1	1517	c.1517T>C	c.(1516-1518)cTg>cCg	p.L506P	PHPT1_ENST00000545326.1_5'Flank|PHPT1_ENST00000371661.1_5'Flank	NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	506										endometrium(2)|large_intestine(1)|lung(6)	9						TACGCCGCACTGTCCCTGTCC	0.711																																					p.L506P		.											.	.	.	0			c.T1517C						.						7.0	8.0	8.0					9																	139740383		1957	4063	6020	SO:0001583	missense	389813	exon1			CCGCACTGTCCCT		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.1517T>C	9.37:g.139740383T>C	ENSP00000412388:p.Leu506Pro	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	26.0	NM_001080482		Missense_Mutation	SNP	ENST00000436881.1	37	CCDS48059.1	.	.	.	.	.	.	.	.	.	.	.	17.66	3.445762	0.63178	.	.	ENSG00000232434	ENST00000436881	.	.	.	3.84	2.66	0.31614	.	.	.	.	.	T	0.62368	0.2422	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60890	-0.7173	8	0.87932	D	0	-9.1052	8.4829	0.33054	0.1738:0.0:0.0:0.8262	.	506	C9J069	CI172_HUMAN	P	506	.	ENSP00000412388:L506P	L	+	2	0	C9orf172	138860204	1.000000	0.71417	0.298000	0.25002	0.906000	0.53458	5.598000	0.67585	0.339000	0.23719	0.387000	0.25754	CTG	.		0.711	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
CA1	759	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	86250479	86250479	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:86250479A>T	ENST00000523953.1	-	4	1282		c.e4+1		CA1_ENST00000432364.2_Splice_Site|CA1_ENST00000431316.1_Splice_Site|CA1_ENST00000256119.5_Splice_Site|CA1_ENST00000522389.1_Intron|CA1_ENST00000518341.1_Splice_Site|CA1_ENST00000542576.1_Splice_Site|CA1_ENST00000523022.1_Splice_Site			P00915	CAH1_HUMAN	carbonic anhydrase I						bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	13		all_lung(136;4.89e-06)			Acetazolamide(DB00819)|Amlodipine(DB00381)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methocarbamol(DB00423)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	CTTTCAGCTCACCTGATCGGT	0.388																																					.		.											.	CA1	91	0			c.235+2T>A						.						165.0	167.0	166.0					8																	86250479		2203	4300	6503	SO:0001630	splice_region_variant	759	exon5			CAGCTCACCTGAT	M33987	CCDS6237.1	8q21.2	2006-03-10				ENSG00000133742	4.2.1.1	"""Carbonic anhydrases"""	1368	protein-coding gene	gene with protein product		114800				1916821	Standard	NM_001164830		Approved	Car1	uc003ydi.3	P00915		ENST00000523953.1:c.235+1T>A	8.37:g.86250479A>T		Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	13.0	NM_001738		Splice_Site	SNP	ENST00000523953.1	37	CCDS6237.1	.	.	.	.	.	.	.	.	.	.	A	10.84	1.462683	0.26248	.	.	ENSG00000133742	ENST00000523953;ENST00000256119;ENST00000431316;ENST00000542576;ENST00000432364;ENST00000523022;ENST00000521679;ENST00000517618;ENST00000517590;ENST00000521846;ENST00000522579;ENST00000522814;ENST00000522662;ENST00000523858	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1693	0.65497	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CA1	86437731	1.000000	0.71417	0.868000	0.34077	0.066000	0.16364	8.123000	0.89586	2.020000	0.59435	0.482000	0.46254	.	.		0.388	CA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381067.1	NM_001738	Intron
CAD	790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	27455440	27455440	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:27455440A>G	ENST00000403525.1	+	17	2725	c.2581A>G	c.(2581-2583)Acc>Gcc	p.T861A	CAD_ENST00000264705.4_Missense_Mutation_p.T924A|CAD_ENST00000464159.1_3'UTR			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTATTGGGGCACCACCCATGA	0.522																																					p.T924A		.											.	CAD	295	0			c.A2770G						.						205.0	138.0	161.0					2																	27455440		2203	4300	6503	SO:0001583	missense	790	exon18			TGGGGCACCACCC	D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.2581A>G	2.37:g.27455440A>G	ENSP00000384510:p.Thr861Ala	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	82.0	NM_004341	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000403525.1	37		.	.	.	.	.	.	.	.	.	.	A	8.423	0.846812	0.17034	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.97328	-4.34;-4.34	5.37	5.37	0.77165	Pre-ATP-grasp fold (1);Carbamoyl-phosphate synthetase, large subunit, oligomerisation (1);	0.245691	0.47455	D	0.000238	D	0.93481	0.7920	L	0.41573	1.285	0.36886	D	0.88966	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	D	0.90860	0.4738	10	0.25751	T	0.34	0.0865	9.4816	0.38904	0.9176:0.0:0.0824:0.0	.	861;924	F8VPD4;P27708	.;PYR1_HUMAN	A	924;861	ENSP00000264705:T924A;ENSP00000384510:T861A	ENSP00000264705:T924A	T	+	1	0	CAD	27308944	0.992000	0.36948	0.994000	0.49952	0.099000	0.18886	2.807000	0.47955	2.256000	0.74724	0.528000	0.53228	ACC	.		0.522	CAD-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000324970.1		
CAND1	55832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	67691234	67691234	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:67691234T>C	ENST00000545606.1	+	5	976	c.539T>C	c.(538-540)cTa>cCa	p.L180P		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	180					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CTGACCTGTCTACTTCCCCAG	0.378																																					p.L180P		.											.	CAND1	516	0			c.T539C						.						136.0	138.0	137.0					12																	67691234		2203	4300	6503	SO:0001583	missense	55832	exon5			CCTGTCTACTTCC		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.539T>C	12.37:g.67691234T>C	ENSP00000442318:p.Leu180Pro	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	51.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	37	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.279023	0.80692	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000540047	T	0.75367	-0.93	5.34	5.34	0.76211	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88742	0.6519	M	0.91663	3.23	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.91254	0.5031	9	.	.	.	-5.6922	15.3337	0.74234	0.0:0.0:0.0:1.0	.	180	Q86VP6	CAND1_HUMAN	P	180;180;22	ENSP00000442318:L180P	.	L	+	2	0	CAND1	65977501	1.000000	0.71417	0.926000	0.36857	0.980000	0.70556	7.809000	0.86057	2.030000	0.59900	0.533000	0.62120	CTA	.		0.378	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
CCDC151	115948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11545698	11545698	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:11545698G>T	ENST00000356392.4	-	1	227	c.140C>A	c.(139-141)gCg>gAg	p.A47E	PRKCSH_ENST00000592741.1_5'Flank|PRKCSH_ENST00000589838.1_5'Flank|CCDC151_ENST00000586836.1_Intron|PRKCSH_ENST00000587327.1_5'Flank|PRKCSH_ENST00000591462.1_5'Flank|PRKCSH_ENST00000252455.2_5'Flank|CCDC151_ENST00000591179.1_Missense_Mutation_p.A47E|PRKCSH_ENST00000412601.1_5'Flank|CCDC151_ENST00000545100.1_Intron	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	47										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						TGGGGTCCACGCCTGGGCTGT	0.617											OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A47E		.											.	CCDC151	91	0			c.C140A						.						63.0	68.0	67.0					19																	11545698		1970	4143	6113	SO:0001583	missense	115948	exon1			GTCCACGCCTGGG		CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.140C>A	19.37:g.11545698G>T	ENSP00000348757:p.Ala47Glu	Somatic	79.0	0.0	673	WXS	Illumina HiSeq	Phase_I	31.0	22.0	NM_145045	B4DXT0|Q96CG5	Missense_Mutation	SNP	ENST00000356392.4	37	CCDS42501.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486550	0.63962	.	.	ENSG00000198003	ENST00000356392;ENST00000543934	T	0.16073	2.37	4.54	0.89	0.19218	.	0.200197	0.25011	N	0.033831	T	0.26085	0.0636	L	0.60455	1.87	0.58432	D	0.999998	D;D	0.67145	0.989;0.996	P;D	0.63192	0.865;0.912	T	0.08452	-1.0721	10	0.22706	T	0.39	-8.6531	6.2124	0.20636	0.1021:0.3662:0.5317:0.0	.	47;47	B3KPH7;A5D8V7	.;CC151_HUMAN	E	47;26	ENSP00000348757:A47E	ENSP00000348757:A47E	A	-	2	0	CCDC151	11406698	0.998000	0.40836	0.805000	0.32314	0.002000	0.02628	1.709000	0.37909	0.592000	0.29728	-0.165000	0.13383	GCG	.		0.617	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458800.1	NM_145045	
CCDC30	728621	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	1	43110399	43110399	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:43110399A>T	ENST00000340612.4	+	12	1811	c.1811A>T	c.(1810-1812)cAg>cTg	p.Q604L	CCDC30_ENST00000390640.4_Missense_Mutation_p.Q393L|CCDC30_ENST00000428554.2_Missense_Mutation_p.Q604L|CCDC30_ENST00000507855.1_Missense_Mutation_p.Q393L|CCDC30_ENST00000342022.4_Missense_Mutation_p.Q604L			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	604						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						AAGCAATTACAGGAAAATAGT	0.368																																					p.Q604L		.											.	CCDC30	90	0			c.A1811T						.						105.0	96.0	99.0					1																	43110399		2203	4300	6503	SO:0001583	missense	728621	exon13			AATTACAGGAAAA	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1811A>T	1.37:g.43110399A>T	ENSP00000340378:p.Gln604Leu	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	9.0	NM_001080850	Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	37	CCDS30690.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.073588	0.36566	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.36	4.23	0.50019	.	0.184752	0.48767	D	0.000176	T	0.33059	0.0850	N	0.24115	0.695	0.36838	D	0.887249	P;B	0.39250	0.665;0.027	B;B	0.43728	0.429;0.015	T	0.38887	-0.9640	10	0.72032	D	0.01	.	8.3208	0.32128	0.9094:0.0:0.0906:0.0	.	604;393	Q5VVM6;Q5VVM6-2	CCD30_HUMAN;.	L	604;393;604;604;393	ENSP00000397035:Q604L;ENSP00000426711:Q393L;ENSP00000340378:Q604L;ENSP00000339280:Q604L;ENSP00000375051:Q393L	ENSP00000340378:Q604L	Q	+	2	0	CCDC30	42882986	1.000000	0.71417	0.554000	0.28268	0.752000	0.42762	2.432000	0.44784	0.963000	0.38082	0.533000	0.62120	CAG	.		0.368	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030	
CCDC88B	283234	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64111953	64111953	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:64111953A>G	ENST00000356786.5	+	14	1984	c.1940A>G	c.(1939-1941)gAg>gGg	p.E647G	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	647						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAGGGCCCTGAGCACAAGCCA	0.662																																					p.E647G		.											.	CCDC88B	94	0			c.A1940G						.						22.0	27.0	26.0					11																	64111953		2193	4296	6489	SO:0001583	missense	283234	exon14			GCCCTGAGCACAA	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.1940A>G	11.37:g.64111953A>G	ENSP00000349238:p.Glu647Gly	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	22.0	NM_032251	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	a	9.992	1.231216	0.22626	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.25579	1.79	3.45	-1.24	0.09435	.	.	.	.	.	T	0.10937	0.0267	N	0.08118	0	0.30548	N	0.765723	B;B;B	0.12630	0.0;0.006;0.0	B;B;B	0.14578	0.001;0.011;0.001	T	0.18903	-1.0322	9	0.49607	T	0.09	.	4.3185	0.11005	0.5934:0.1696:0.237:0.0	.	647;296;647	B2RTU8;A6NC98-3;A6NC98	.;.;CC88B_HUMAN	G	647	ENSP00000349238:E647G	ENSP00000349238:E647G	E	+	2	0	CCDC88B	63868529	0.000000	0.05858	0.006000	0.13384	0.376000	0.30014	-0.378000	0.07446	-0.334000	0.08463	0.249000	0.18162	GAG	.		0.662	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
CCDC92	80212	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124427315	124427315	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:124427315T>C	ENST00000238156.3	-	4	553	c.199A>G	c.(199-201)Aca>Gca	p.T67A	CCDC92_ENST00000544798.1_5'UTR|CCDC92_ENST00000545891.1_Missense_Mutation_p.T50A|CCDC92_ENST00000545135.1_Missense_Mutation_p.T50A	NM_025140.1	NP_079416.1	Q53HC0	CCD92_HUMAN	coiled-coil domain containing 92	67						centriole (GO:0005814)				large_intestine(5)|lung(2)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.0002)|OV - Ovarian serous cystadenocarcinoma(86;0.000222)|all cancers(50;0.00129)|BRCA - Breast invasive adenocarcinoma(302;0.242)		CTTTTGACTGTCAGCTCATAT	0.383																																					p.T67A		.											.	CCDC92	90	0			c.A199G						.						182.0	164.0	170.0					12																	124427315		2203	4300	6503	SO:0001583	missense	80212	exon4			TGACTGTCAGCTC	AK026124	CCDS9256.1	12q24.31	2011-09-02			ENSG00000119242	ENSG00000119242			29563	protein-coding gene	gene with protein product	"""limkain beta 2"""					12477932	Standard	NM_025140		Approved	FLJ22471	uc001ufw.1	Q53HC0	OTTHUMG00000168725	ENST00000238156.3:c.199A>G	12.37:g.124427315T>C	ENSP00000238156:p.Thr67Ala	Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	71.0	16.0	NM_025140	B3KNQ0|Q9H697	Missense_Mutation	SNP	ENST00000238156.3	37	CCDS9256.1	.	.	.	.	.	.	.	.	.	.	T	15.78	2.934789	0.52866	.	.	ENSG00000119242	ENST00000238156;ENST00000545135;ENST00000545891;ENST00000539761;ENST00000535556;ENST00000539551	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	5.76	5.76	0.90799	.	0.256282	0.44902	D	0.000409	T	0.34861	0.0912	L	0.49126	1.545	0.53005	D	0.999969	B	0.28419	0.211	B	0.22601	0.04	T	0.18493	-1.0335	10	0.07175	T	0.84	0.63	15.7457	0.77939	0.0:0.0:0.0:1.0	.	67	Q53HC0	CCD92_HUMAN	A	67;50;50;67;50;67	ENSP00000238156:T67A;ENSP00000439526:T50A;ENSP00000440024:T50A;ENSP00000439441:T67A;ENSP00000438281:T50A;ENSP00000442369:T67A	ENSP00000238156:T67A	T	-	1	0	CCDC92	122993268	1.000000	0.71417	0.997000	0.53966	0.953000	0.61014	7.388000	0.79795	2.191000	0.70037	0.533000	0.62120	ACA	.		0.383	CCDC92-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400780.2	NM_025140	
CD109	135228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	74407156	74407156	+	Silent	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:74407156C>T	ENST00000287097.5	+	2	220	c.108C>T	c.(106-108)atC>atT	p.I36I	CD109_ENST00000437994.2_Silent_p.I36I|RP11-553A21.3_ENST00000428865.2_RNA|CD109_ENST00000422508.2_Silent_p.I36I			Q6YHK3	CD109_HUMAN	CD109 molecule	36					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAGGGATCATCAGGCCCGGAG	0.507																																					p.I36I		.											.	CD109	155	0			c.C108T						.						112.0	111.0	111.0					6																	74407156		2203	4300	6503	SO:0001819	synonymous_variant	135228	exon2			GATCATCAGGCCC	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.108C>T	6.37:g.74407156C>T		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	23.0	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	ENST00000287097.5	37	CCDS4982.1																																																																																			.		0.507	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
CDCP1	64866	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	3	45187699	45187699	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:45187699T>A	ENST00000296129.1	-	1	215	c.81A>T	c.(79-81)gcA>gcT	p.A27A	CDCP1_ENST00000425231.2_Splice_Site_p.A27A	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	27						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GGCACTCACCTGCCCCGCGCG	0.731																																					p.A27A		.											.	CDCP1	117	0			c.A81T						.						12.0	14.0	14.0					3																	45187699		2184	4268	6452	SO:0001630	splice_region_variant	64866	exon1			CTCACCTGCCCCG	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.82+1A>T	3.37:g.45187699T>A		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	14.0	NM_178181	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	ENST00000296129.1	37	CCDS2727.1																																																																																			.		0.731	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	Silent
CELSR3	1951	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	3	48689876	48689876	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:48689876G>T	ENST00000164024.4	-	11	6025	c.5745C>A	c.(5743-5745)tgC>tgA	p.C1915*	CELSR3_ENST00000544264.1_Nonsense_Mutation_p.C1915*	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1915	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCACCTGGATGCAGCCAACCA	0.622																																					p.C1915X		.											.	CELSR3	523	0			c.C5745A						.						71.0	67.0	68.0					3																	48689876		2203	4300	6503	SO:0001587	stop_gained	1951	exon11			CTGGATGCAGCCA	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.5745C>A	3.37:g.48689876G>T	ENSP00000164024:p.Cys1915*	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	11.0	NM_001407	O75092	Nonsense_Mutation	SNP	ENST00000164024.4	37	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	G	47	13.866750	0.99767	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	.	.	.	5.1	0.298	0.15766	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.2746	0.31864	0.4053:0.0:0.5947:0.0	.	.	.	.	X	1915	.	ENSP00000164024:C1915X	C	-	3	2	CELSR3	48664880	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.428000	0.44749	0.309000	0.22966	-0.367000	0.07326	TGC	.		0.622	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
CDHR4	389118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49832413	49832413	+	Silent	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:49832413A>T	ENST00000412678.2	-	9	1160	c.1152T>A	c.(1150-1152)ccT>ccA	p.P384P	CDHR4_ENST00000462108.1_5'Flank	NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	384	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						AGAGGCTGGCAGGGTTGGAAG	0.612																																					p.P384P		.											.	.	.	0			c.T1152A						.						47.0	58.0	54.0					3																	49832413		692	1591	2283	SO:0001819	synonymous_variant	389118	exon9			GCTGGCAGGGTTG		CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.1152T>A	3.37:g.49832413A>T		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	34.0	NM_001007540	Q6UXT0	Silent	SNP	ENST00000412678.2	37	CCDS46829.1																																																																																			.		0.612	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350387.1	NM_001007540	
CEP152	22995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	49033896	49033896	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:49033896T>A	ENST00000380950.2	-	26	4182	c.3995A>T	c.(3994-3996)gAg>gTg	p.E1332V	CEP152_ENST00000325747.5_Missense_Mutation_p.E1239V|CEP152_ENST00000399334.3_Missense_Mutation_p.E1276V	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1332					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		AATCTTTTTCTCAGCCCTGTG	0.383																																					p.E1332V		.											.	CEP152	70	0			c.A3995T						.						149.0	137.0	141.0					15																	49033896		1807	4077	5884	SO:0001583	missense	22995	exon26			TTTTTCTCAGCCC	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3995A>T	15.37:g.49033896T>A	ENSP00000370337:p.Glu1332Val	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	10.0	NM_001194998	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552871	0.65425	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.66638	0.05;-0.03;-0.22	5.87	5.87	0.94306	.	0.065981	0.64402	D	0.000015	T	0.79678	0.4487	M	0.68593	2.085	0.80722	D	1	D;D;D	0.67145	0.992;0.996;0.996	P;D;D	0.64410	0.894;0.925;0.925	T	0.81835	-0.0750	10	0.87932	D	0	-15.8868	16.2774	0.82651	0.0:0.0:0.0:1.0	.	1239;1332;1276	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	V	1332;1239;1276	ENSP00000370337:E1332V;ENSP00000321000:E1239V;ENSP00000382271:E1276V	ENSP00000321000:E1239V	E	-	2	0	CEP152	46821188	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.451000	0.80668	2.247000	0.74100	0.482000	0.46254	GAG	.		0.383	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
CES5A	221223	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	16	55897346	55897346	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:55897346T>A	ENST00000290567.9	-	6	845	c.724A>T	c.(724-726)Aaa>Taa	p.K242*	CES5A_ENST00000521992.1_Nonsense_Mutation_p.K271*|CES5A_ENST00000518005.1_Nonsense_Mutation_p.K136*|CES5A_ENST00000319165.9_Nonsense_Mutation_p.K242*|CES5A_ENST00000520435.1_Nonsense_Mutation_p.K212*|CES5A_ENST00000541580.1_5'UTR	NM_001143685.1	NP_001137157.1	Q6NT32	EST5A_HUMAN	carboxylesterase 5A	242						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						AATAAGCCTTTGGCCATGGGA	0.488																																					p.K271X		.											.	CES5A	94	0			c.A811T						.						140.0	112.0	121.0					16																	55897346		2198	4300	6498	SO:0001587	stop_gained	221223	exon7			AGCCTTTGGCCAT	AK090997	CCDS10755.1, CCDS45490.1, CCDS54012.1	16q13	2010-10-12	2010-10-12	2010-10-12	ENSG00000159398	ENSG00000159398	3.1.1.1	"""Carboxylesterases"""	26459	protein-coding gene	gene with protein product			"""carboxylesterase 7"""	CES7		20931200	Standard	NM_145024		Approved	FLJ31547, CES4C1, CES5, CAUXIN	uc021tir.1	Q6NT32	OTTHUMG00000133236	ENST00000290567.9:c.724A>T	16.37:g.55897346T>A	ENSP00000290567:p.Lys242*	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	15.0	NM_001190158	B7Z252|B7ZLB6|Q8NBC8|Q96DN9	Nonsense_Mutation	SNP	ENST00000290567.9	37	CCDS45490.1	.	.	.	.	.	.	.	.	.	.	T	20.5	3.994017	0.74703	.	.	ENSG00000159398	ENST00000521992;ENST00000319165;ENST00000518005;ENST00000290567;ENST00000520435;ENST00000541580	.	.	.	5.28	-0.599	0.11645	.	1.749360	0.02591	N	0.099945	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4339	0.21813	0.0:0.1824:0.1302:0.6875	.	.	.	.	X	271;242;136;242;212;23	.	ENSP00000290567:K242X	K	-	1	0	CES5A	54454847	0.002000	0.14202	0.008000	0.14137	0.384000	0.30261	0.809000	0.27168	-0.222000	0.09958	-1.078000	0.02229	AAA	.		0.488	CES5A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256975.3	NM_145024	
CFTR	1080	hgsc.bcm.edu;broad.mit.edu	37	7	117175426	117175426	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:117175426T>C	ENST00000003084.6	+	6	836	c.704T>C	c.(703-705)cTt>cCt	p.L235P	CFTR_ENST00000454343.1_Missense_Mutation_p.L235P	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	235	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GTCCTTGCCCTTTTTCAGGCT	0.438									Cystic Fibrosis																												p.L235P		.											.	CFTR	518	0			c.T704C						.						128.0	119.0	122.0					7																	117175426		2203	4300	6503	SO:0001583	missense	1080	exon6	Familial Cancer Database	CF	TTGCCCTTTTTCA	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.704T>C	7.37:g.117175426T>C	ENSP00000003084:p.Leu235Pro	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	4.0	NM_000492	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.849389	0.32699	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.91351	-2.83;-2.83;-2.83	5.37	4.2	0.49525	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.563956	0.20074	N	0.099787	T	0.77025	0.4070	N	0.01438	-0.865	0.22982	N	0.998476	B	0.16166	0.016	B	0.25884	0.064	T	0.66180	-0.5988	10	0.34782	T	0.22	-0.328	12.4979	0.55940	0.0:0.0:0.1397:0.8603	.	235	P13569	CFTR_HUMAN	P	235;235;205	ENSP00000003084:L235P;ENSP00000403677:L235P;ENSP00000389119:L205P	ENSP00000003084:L235P	L	+	2	0	CFTR	116962662	0.900000	0.30661	0.016000	0.15963	0.989000	0.77384	4.475000	0.60210	0.864000	0.35578	0.528000	0.53228	CTT	.		0.438	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
CHAT	1103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50873041	50873041	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:50873041A>G	ENST00000337653.2	+	15	2349	c.2196A>G	c.(2194-2196)ccA>ccG	p.P732P	CHAT_ENST00000455728.2_Intron|CHAT_ENST00000339797.1_Silent_p.P614P|CHAT_ENST00000395562.2_Silent_p.P650P|CHAT_ENST00000395559.2_Silent_p.P614P|CHAT_ENST00000351556.3_Silent_p.P614P	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	732					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	AGAGCAAGCCATTGGCAACAA	0.527																																					p.P732P		.											.	CHAT	514	0			c.A2196G						.						87.0	86.0	86.0					10																	50873041		2203	4300	6503	SO:0001819	synonymous_variant	1103	exon15			CAAGCCATTGGCA	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.2196A>G	10.37:g.50873041A>G		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	45.0	NM_020549	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Silent	SNP	ENST00000337653.2	37	CCDS7232.1																																																																																			.		0.527	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
CHD5	26038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	6206301	6206301	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:6206301C>T	ENST00000262450.3	-	11	1872	c.1773G>A	c.(1771-1773)tgG>tgA	p.W591*	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GAATCATCATCCACTCTGGCT	0.577																																					p.W591X		.											.	CHD5	719	0			c.G1773A						.						137.0	134.0	135.0					1																	6206301		2203	4300	6503	SO:0001587	stop_gained	26038	exon11			CATCATCCACTCT	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1773G>A	1.37:g.6206301C>T	ENSP00000262450:p.Trp591*	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	15.0	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Nonsense_Mutation	SNP	ENST00000262450.3	37	CCDS57.1	.	.	.	.	.	.	.	.	.	.	C	37	6.243051	0.97408	.	.	ENSG00000116254	ENST00000262450;ENST00000378006	.	.	.	3.85	3.85	0.44370	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.8543	16.3262	0.82983	0.0:1.0:0.0:0.0	.	.	.	.	X	591;107	.	ENSP00000262450:W591X	W	-	3	0	CHD5	6128888	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.600000	0.82769	2.138000	0.66242	0.462000	0.41574	TGG	.		0.577	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
C19orf44	84167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16634007	16634007	+	IGR	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:16634007G>A	ENST00000221671.3	+	0	3427				CHERP_ENST00000198939.6_Silent_p.F623F|CHERP_ENST00000546361.2_Silent_p.F612F|CTD-3222D19.2_ENST00000409035.1_Intron|CHERP_ENST00000544299.1_5'UTR	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44											endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						GGGGAGGGCCGAAGTCAGGGT	0.672																																					p.F612F		.											.	CHERP	92	0			c.C1836T						.						43.0	55.0	51.0					19																	16634007		2129	4242	6371	SO:0001628	intergenic_variant	10523	exon11			AGGGCCGAAGTCA	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5			19.37:g.16634007G>A		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	27.0	NM_006387	Q8N6Y7	Silent	SNP	ENST00000221671.3	37	CCDS12345.1																																																																																			.		0.672	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207	
CHMP5	51510	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33271184	33271184	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:33271184A>G	ENST00000223500.8	+	5	487	c.350A>G	c.(349-351)aAg>aGg	p.K117R	CHMP5_ENST00000419016.2_Missense_Mutation_p.K117R	NM_016410.5	NP_057494.3	Q9NZZ3	CHMP5_HUMAN	charged multivesicular body protein 5	117					endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of receptor recycling (GO:0001919)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10			LUSC - Lung squamous cell carcinoma(29;0.00506)			AAGGAAATGAAGAAGGCATAC	0.363																																					p.K117R		.											.	CHMP5	91	0			c.A350G						.						170.0	149.0	156.0					9																	33271184		2203	4300	6503	SO:0001583	missense	51510	exon5			AAATGAAGAAGGC	AF132968	CCDS6537.1, CCDS56569.1	9p13.3	2011-09-21	2011-09-21	2005-08-09	ENSG00000086065	ENSG00000086065		"""Charged multivesicular body proteins"""	26942	protein-coding gene	gene with protein product		610900	"""chromosome 9 open reading frame 83"", ""chromatin modifying protein 5"""	C9orf83, SNF7DC2		15644320, 11559748	Standard	NM_016410		Approved	HSPC177, CGI-34, Vps60	uc003zsm.4	Q9NZZ3	OTTHUMG00000019765	ENST00000223500.8:c.350A>G	9.37:g.33271184A>G	ENSP00000223500:p.Lys117Arg	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	25.0	NM_016410	B2RD95|B4DIR6|Q5VXW2|Q96AV2|Q9HB68|Q9NYS4|Q9Y323	Missense_Mutation	SNP	ENST00000223500.8	37	CCDS6537.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.656726	0.88154	.	.	ENSG00000086065	ENST00000223500;ENST00000419016	T;T	0.77750	-1.12;-1.12	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.83677	0.5306	M	0.81802	2.56	0.58432	D	0.999995	P;P	0.50066	0.931;0.763	P;P	0.50659	0.647;0.529	D	0.85690	0.1306	10	0.56958	D	0.05	-8.693	14.049	0.64725	1.0:0.0:0.0:0.0	.	117;117	B4DIR6;Q9NZZ3	.;CHMP5_HUMAN	R	117	ENSP00000223500:K117R;ENSP00000442725:K117R	ENSP00000223500:K117R	K	+	2	0	CHMP5	33261184	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.879000	0.92398	2.259000	0.74868	0.529000	0.55759	AAG	.		0.363	CHMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052040.3	NM_016410	
CHRM2	1129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	136700208	136700208	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:136700208T>C	ENST00000445907.2	+	3	1124	c.596T>C	c.(595-597)gTg>gCg	p.V199A	CHRM2_ENST00000397608.3_Missense_Mutation_p.V199A|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000401861.1_Missense_Mutation_p.V199A|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.V199A|CHRM2_ENST00000453373.1_Missense_Mutation_p.V199A|hsa-mir-490_ENST00000592183.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.V199A	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	199					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TATTTGCCAGTGATCATCATG	0.488																																					p.V199A		.											.	CHRM2	94	0			c.T596C						.						72.0	64.0	67.0					7																	136700208		2203	4300	6503	SO:0001583	missense	1129	exon3			TGCCAGTGATCAT		CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.596T>C	7.37:g.136700208T>C	ENSP00000399745:p.Val199Ala	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	30.0	NM_001006632	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	ENST00000445907.2	37	CCDS5843.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.027227	0.75390	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15	5.51	5.51	0.81932	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.57636	0.2067	M	0.70842	2.15	0.80722	D	1	D	0.64830	0.994	D	0.64237	0.923	T	0.60073	-0.7334	10	0.52906	T	0.07	-5.7288	15.6399	0.76989	0.0:0.0:0.0:1.0	.	199	P08172	ACM2_HUMAN	A	199	ENSP00000399745:V199A;ENSP00000415386:V199A;ENSP00000319984:V199A;ENSP00000380733:V199A;ENSP00000384937:V199A;ENSP00000384401:V199A	ENSP00000319984:V199A	V	+	2	0	CHRM2	136350748	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.991000	0.88244	2.103000	0.63969	0.533000	0.62120	GTG	.		0.488	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341010.1		
CLCN1	1180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143021573	143021573	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:143021573A>G	ENST00000343257.2	+	7	928	c.841A>G	c.(841-843)Aca>Gca	p.T281A	CLCN1_ENST00000495612.1_Intron	NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	281					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTGTTTTGGGACACCACTTGG	0.527																																					p.T281A		.											.	CLCN1	156	0			c.A841G						.						194.0	148.0	164.0					7																	143021573		2203	4300	6503	SO:0001583	missense	1180	exon7			TTTGGGACACCAC	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.841A>G	7.37:g.143021573A>G	ENSP00000339867:p.Thr281Ala	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	29.0	NM_000083	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	.	7.025	0.559449	0.13436	.	.	ENSG00000188037	ENST00000343257	D	0.89485	-2.52	4.61	4.61	0.57282	Chloride channel, core (2);	0.147082	0.64402	N	0.000012	T	0.64360	0.2591	N	0.00380	-1.58	0.46416	D	0.99903	B	0.15473	0.013	B	0.22386	0.039	T	0.68074	-0.5505	10	0.02654	T	1	.	14.0642	0.64819	1.0:0.0:0.0:0.0	.	281	P35523	CLCN1_HUMAN	A	281	ENSP00000339867:T281A	ENSP00000339867:T281A	T	+	1	0	CLCN1	142731695	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.919000	0.92770	1.738000	0.51689	0.454000	0.30748	ACA	.		0.527	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
CLPTM1	1209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45480646	45480646	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:45480646A>G	ENST00000337392.5	+	5	665	c.515A>G	c.(514-516)aAg>aGg	p.K172R	CLPTM1_ENST00000541297.2_Missense_Mutation_p.K158R|CLPTM1_ENST00000546079.1_Missense_Mutation_p.K70R	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	172					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.K172R(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		TACTTCACCAAGAGTGGCTTC	0.617																																					p.K172R		.											.	CLPTM1	91	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.A515G						.						119.0	119.0	119.0					19																	45480646		2203	4300	6503	SO:0001583	missense	1209	exon5			TCACCAAGAGTGG	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.515A>G	19.37:g.45480646A>G	ENSP00000336994:p.Lys172Arg	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	11.0	NM_001294	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	ENST00000337392.5	37	CCDS12651.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.943858	0.73672	.	.	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392;ENST00000347493	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.41719	0.1171	N	0.20483	0.58	0.80722	D	1	P;B;B	0.44627	0.839;0.363;0.363	P;B;B	0.46452	0.517;0.434;0.434	T	0.21930	-1.0231	9	0.10377	T	0.69	-33.936	13.5943	0.61979	1.0:0.0:0.0:0.0	.	158;172;172	F5H8J3;B3KQH2;O96005	.;.;CLPT1_HUMAN	R	70;158;172;172	.	ENSP00000336994:K172R	K	+	2	0	CLPTM1	50172486	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.646000	0.91053	2.099000	0.63709	0.456000	0.33151	AAG	.		0.617	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294	
CLSTN2	64084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	140281142	140281142	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:140281142C>A	ENST00000458420.3	+	13	2394	c.2204C>A	c.(2203-2205)tCc>tAc	p.S735Y		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	735					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GCAGGCTACTCCATCTACGGT	0.552										HNSCC(16;0.037)																											p.S735Y	GBM(45;858 913 3709 36904 37282)	.											.	CLSTN2	157	0			c.C2204A						.						106.0	97.0	100.0					3																	140281142		2203	4300	6503	SO:0001583	missense	64084	exon13			GCTACTCCATCTA	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2204C>A	3.37:g.140281142C>A	ENSP00000402460:p.Ser735Tyr	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	20.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663967	0.67700	.	.	ENSG00000158258	ENST00000458420	T	0.30448	1.53	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.57403	0.2051	M	0.74258	2.255	0.58432	D	0.999999	D	0.76494	0.999	D	0.83275	0.996	T	0.54892	-0.8225	9	.	.	.	-25.8184	17.5547	0.87887	0.0:1.0:0.0:0.0	.	735	Q9H4D0	CSTN2_HUMAN	Y	735	ENSP00000402460:S735Y	.	S	+	2	0	CLSTN2	141763832	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.227000	0.78070	2.755000	0.94549	0.655000	0.94253	TCC	.		0.552	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
CMIP	80790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	81691394	81691394	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:81691394C>A	ENST00000537098.3	+	5	726	c.654C>A	c.(652-654)acC>acA	p.T218T	CMIP_ENST00000539778.2_Silent_p.T124T|CMIP_ENST00000398040.4_Silent_p.T65T|CMIP_ENST00000566513.1_3'UTR	NM_198390.2	NP_938204.2	Q8IY22	CMIP_HUMAN	c-Maf inducing protein	218						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(5)|kidney(1)|lung(7)	13						CAAACTTGACCACCCAGGAGC	0.453																																					p.T218T		.											.	.	.	0			c.C654A						.						64.0	62.0	63.0					16																	81691394		1915	4130	6045	SO:0001819	synonymous_variant	80790	exon5			CTTGACCACCCAG	AB051481	CCDS54044.1, CCDS54045.1	16q23	2011-08-04			ENSG00000153815	ENSG00000153815			24319	protein-coding gene	gene with protein product		610112				11214970, 12939343	Standard	NM_030629		Approved		uc002fgp.3	Q8IY22		ENST00000537098.3:c.654C>A	16.37:g.81691394C>A		Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	25.0	NM_198390	Q9C0G9	Silent	SNP	ENST00000537098.3	37	CCDS54044.1																																																																																			.		0.453	CMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432399.2	NM_030629	
CRHR1	1394	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	43910820	43910820	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:43910820C>A	ENST00000398285.3	+	11	933	c.933C>A	c.(931-933)atC>atA	p.I311I	CRHR1_ENST00000314537.5_Silent_p.I282I|CRHR1_ENST00000352855.5_Silent_p.I242I|CRHR1_ENST00000577353.1_Silent_p.I282I|CRHR1_ENST00000339069.5_Silent_p.I181I|CRHR1_ENST00000293493.7_Silent_p.I107I	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	311	Important for antagonist binding.				activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		AATTGCAGATCAATTTCATCT	0.567																																					p.I311I	Ovarian(110;57 1568 10207 38216 49865)	.											.	CRHR1	522	0			c.C933A						.						122.0	126.0	125.0					17																	43910820		2145	4251	6396	SO:0001819	synonymous_variant	1394	exon11			GCAGATCAATTTC	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.933C>A	17.37:g.43910820C>A		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	19.0	NM_001145146	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Silent	SNP	ENST00000398285.3	37	CCDS45712.1																																																																																			.		0.567	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		
ARFGEF1	10565	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68107738	68107738	+	IGR	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:68107738C>T	ENST00000262215.3	-	0	7225				CSPP1_ENST00000262210.5_Silent_p.F1192F|CSPP1_ENST00000521168.1_3'UTR|ARFGEF1_ENST00000517955.1_5'Flank|CSPP1_ENST00000412460.1_Silent_p.F847F|ARFGEF1_ENST00000520381.1_Intron	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)						endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TGAAACGTTTCATGGCAGAGC	0.517																																					p.F1192F		.											.	CSPP1	138	0			c.C3576T						.						96.0	96.0	96.0					8																	68107738		2001	4187	6188	SO:0001628	intergenic_variant	79848	exon29			ACGTTTCATGGCA	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626		8.37:g.68107738C>T		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	89.0	NM_024790	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	37	CCDS6199.1																																																																																			.		0.517	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
CTDP1	9150	broad.mit.edu;mdanderson.org	37	18	77455996	77455996	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr18:77455996A>T	ENST00000299543.7	+	3	565	c.418A>T	c.(418-420)Aag>Tag	p.K140*	CTDP1_ENST00000075430.7_Nonsense_Mutation_p.K140*	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	140					exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		TAAGAACGGGAAGCAGCAGGT	0.607																																					p.K140X		.											.	CTDP1	90	0			c.A418T						.						81.0	63.0	69.0					18																	77455996		2203	4300	6503	SO:0001587	stop_gained	9150	exon3			AACGGGAAGCAGC	AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.418A>T	18.37:g.77455996A>T	ENSP00000299543:p.Lys140*	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	5.0	NM_004715	A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Nonsense_Mutation	SNP	ENST00000299543.7	37	CCDS12017.1	.	.	.	.	.	.	.	.	.	.	A	18.74	3.688576	0.68271	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	.	.	.	4.55	-0.829	0.10796	.	0.790854	0.11824	N	0.525875	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.4426	8.4754	0.33009	0.4713:0.4534:0.0753:0.0	.	.	.	.	X	140	.	ENSP00000075430:K140X	K	+	1	0	CTDP1	75556984	0.995000	0.38212	0.019000	0.16419	0.014000	0.08584	1.657000	0.37366	-0.314000	0.08716	0.533000	0.62120	AAG	.		0.607	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256432.1	NM_004715	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	T	rs121913396|rs121913416		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:41266098A>T	ENST00000349496.5	+	3	375	c.95A>T	c.(94-96)gAc>gTc	p.D32V	CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32V|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25V|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32V	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1	CTNNB1	24361	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95T						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>T	3.37:g.41266098A>T	ENSP00000344456:p.Asp32Val	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	34.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184569	0.78677	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.74325	-0.3702	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	V	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25V;ENSP00000385604:D32V;ENSP00000412219:D32V;ENSP00000379486:D32V;ENSP00000344456:D32V;ENSP00000411226:D25V;ENSP00000379488:D32V;ENSP00000409302:D32V;ENSP00000401599:D32V	ENSP00000344456:D32V	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CXorf30	645090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	36403105	36403105	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:36403105T>C	ENST00000378657.4	+	18	2534	c.1886T>C	c.(1885-1887)tTg>tCg	p.L629S	RP11-87M18.2_ENST00000455438.2_RNA	NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30	629										breast(1)|lung(2)|stomach(1)	4						GGTGCTCCTTTGGTGAAGAAT	0.353																																					p.L629S		.											.	CXorf30	62	0			c.T1886C						.						84.0	67.0	72.0					X																	36403105		692	1591	2283	SO:0001583	missense	645090	exon19			CTCCTTTGGTGAA		CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.1886T>C	X.37:g.36403105T>C	ENSP00000367926:p.Leu629Ser	Somatic	239.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	138.0	NM_001098843		Missense_Mutation	SNP	ENST00000378657.4	37	CCDS55396.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.429715	0.25726	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	T;T	0.37235	1.21;1.23	5.74	3.35	0.38373	.	0.099149	0.43416	N	0.000565	T	0.44664	0.1304	L	0.39898	1.24	0.21652	N	0.999605	D	0.69078	0.997	D	0.63597	0.916	T	0.28396	-1.0045	10	0.87932	D	0	-10.6693	8.6534	0.34049	0.0:0.1566:0.0:0.8434	.	629	A6PW82	CX030_HUMAN	S	914;629	ENSP00000367922:L914S;ENSP00000367926:L629S	ENSP00000367922:L914S	L	+	2	0	CXorf30	36313026	0.997000	0.39634	0.011000	0.14972	0.000000	0.00434	1.820000	0.39032	0.291000	0.22468	-1.155000	0.01812	TTG	.		0.353	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NP_001092313	
CYLC1	1538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	83128470	83128470	+	Nonsense_Mutation	SNP	G	G	T	rs146830604	byFrequency	TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:83128470G>T	ENST00000329312.4	+	4	791	c.754G>T	c.(754-756)Gga>Tga	p.G252*		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	252					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						CATGTTAGTGGGACAGTCTGA	0.308																																					p.G252X		.											.	CYLC1	112	0			c.G754T						.						40.0	37.0	38.0					X																	83128470		2195	4291	6486	SO:0001587	stop_gained	1538	exon4			TTAGTGGGACAGT	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.754G>T	X.37:g.83128470G>T	ENSP00000331556:p.Gly252*	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	98.0	NM_021118	A0AVQ8|Q5JQQ9	Nonsense_Mutation	SNP	ENST00000329312.4	37	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	g	16.29	3.082382	0.55861	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	.	.	.	4.92	-1.13	0.09775	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-1.018	4.3552	0.11174	0.3748:0.3054:0.3198:0.0	.	.	.	.	X	252	.	ENSP00000331556:G252X	G	+	1	0	CYLC1	83015126	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.148000	0.10219	-0.537000	0.06290	0.600000	0.82982	GGA	G|0.999;A|0.001		0.308	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
CYP3A5	1577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	99272195	99272195	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:99272195A>C	ENST00000222982.4	-	3	278	c.179T>G	c.(178-180)tTt>tGt	p.F60C	CYP3A5_ENST00000343703.5_Missense_Mutation_p.F50C|CYP3A5_ENST00000480723.1_5'UTR|CYP3A5_ENST00000339843.2_3'UTR|CYP3A5_ENST00000439761.1_Missense_Mutation_p.F60C	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	60					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	CTCTGTGTCAAATTTCCAGAG	0.408																																					p.F60C		.											.	CYP3A5	90	0			c.T179G						.						80.0	77.0	78.0					7																	99272195		2203	4300	6503	SO:0001583	missense	1577	exon3			GTGTCAAATTTCC	L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.179T>G	7.37:g.99272195A>C	ENSP00000222982:p.Phe60Cys	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	22.0	NM_001190484	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Missense_Mutation	SNP	ENST00000222982.4	37	CCDS5672.1	.	.	.	.	.	.	.	.	.	.	A	14.96	2.691428	0.48097	.	.	ENSG00000106258	ENST00000222982;ENST00000343703;ENST00000439761	T;T;T	0.70399	-0.48;-0.48;-0.48	3.48	0.667	0.17907	.	0.220302	0.47093	N	0.000252	T	0.81446	0.4824	M	0.91612	3.225	0.80722	D	1	D;B;D	0.57257	0.974;0.418;0.979	P;B;P	0.61328	0.82;0.383;0.887	T	0.77544	-0.2548	10	0.72032	D	0.01	.	4.8896	0.13721	0.6254:0.1906:0.0:0.184	.	50;60;60	F5H4S0;B7Z5I7;P20815	.;.;CP3A5_HUMAN	C	60;50;60	ENSP00000222982:F60C;ENSP00000342969:F50C;ENSP00000401269:F60C	ENSP00000222982:F60C	F	-	2	0	CYP3A5	99110131	1.000000	0.71417	0.005000	0.12908	0.028000	0.11728	4.534000	0.60622	-0.095000	0.12351	0.379000	0.24179	TTT	.		0.408	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1		
CYP4F22	126410	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15636153	15636153	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:15636153G>A	ENST00000269703.3	+	3	205	c.6G>A	c.(4-6)ctG>ctA	p.L2L	CYP4F22_ENST00000601005.2_Silent_p.L2L	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	2						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						CCAGGATGCTGCCCATCACAG	0.602																																					p.L2L		.											.	CYP4F22	92	0			c.G6A						.						87.0	58.0	68.0					19																	15636153		2203	4300	6503	SO:0001819	synonymous_variant	126410	exon3			GATGCTGCCCATC		CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.6G>A	19.37:g.15636153G>A		Somatic	34.0	0.0		WXS	Illumina HiSeq	Phase_I	28.0	7.0	NM_173483	Q8N8H4	Silent	SNP	ENST00000269703.3	37	CCDS12331.1																																																																																			.		0.602	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461338.2	NM_173483	
DCDC1	341019	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	30946867	30946867	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:30946867T>C	ENST00000597505.1	-	21	2985	c.2986A>G	c.(2986-2988)Aga>Gga	p.R996G	DCDC1_ENST00000339794.5_Missense_Mutation_p.R75G|DCDC1_ENST00000406071.2_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	231					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					AGTTCATCTCTTTGCAGGTCT	0.343																																					p.R103G		.											.	DCDC5	23	0			c.A307G						.						138.0	145.0	143.0					11																	30946867		2201	4299	6500	SO:0001583	missense	100506627	exon4			CATCTCTTTGCAG	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2986A>G	11.37:g.30946867T>C	ENSP00000472625:p.Arg996Gly	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	25.0	NM_020869	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000597505.1	37		.	.	.	.	.	.	.	.	.	.	T	13.49	2.253137	0.39797	.	.	ENSG00000170959	ENST00000339794	D	0.93426	-3.22	5.42	2.89	0.33648	Doublecortin domain (3);	0.201505	0.34291	N	0.004095	D	0.92922	0.7748	M	0.64404	1.975	0.22457	N	0.999081	D	0.54047	0.964	P	0.50314	0.637	D	0.86936	0.2076	10	0.72032	D	0.01	-14.1656	10.4824	0.44702	0.0:0.0:0.309:0.691	.	75	Q6ZRR9	DCDC5_HUMAN	G	75	ENSP00000341700:R75G	ENSP00000341700:R75G	R	-	1	2	DCDC5	30903443	0.993000	0.37304	0.810000	0.32431	0.827000	0.46813	1.623000	0.37008	0.969000	0.38237	0.533000	0.62120	AGA	.		0.343	DCDC1-010	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000463167.1	NM_181807	
DDI1	414301	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	103908140	103908140	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:103908140G>T	ENST00000302259.3	+	1	833	c.590G>T	c.(589-591)aGg>aTg	p.R197M	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	197							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GAGCAAGAGAGGCTTCGTCTC	0.522																																					p.R197M		.											.	DDI1	137	0			c.G590T						.						64.0	70.0	68.0					11																	103908140		2202	4299	6501	SO:0001583	missense	414301	exon1			AAGAGAGGCTTCG		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.590G>T	11.37:g.103908140G>T	ENSP00000302805:p.Arg197Met	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	5.0	NM_001001711	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	37	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	G	9.613	1.131692	0.21041	.	.	ENSG00000170967	ENST00000302259	T	0.26067	1.76	5.02	3.09	0.35607	.	0.045020	0.85682	N	0.000000	T	0.22781	0.0550	L	0.51422	1.61	0.36668	D	0.87832	B	0.21606	0.058	B	0.26770	0.073	T	0.11348	-1.0591	10	0.45353	T	0.12	-21.5192	7.7979	0.29158	0.0869:0.0:0.746:0.1671	.	197	Q8WTU0	DDI1_HUMAN	M	197	ENSP00000302805:R197M	ENSP00000302805:R197M	R	+	2	0	DDI1	103413350	1.000000	0.71417	0.382000	0.26119	0.045000	0.14185	3.487000	0.53222	0.777000	0.33496	0.655000	0.94253	AGG	.		0.522	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
DDN	23109	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	49391094	49391094	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:49391094T>A	ENST00000421952.2	-	2	1586	c.1565A>T	c.(1564-1566)cAg>cTg	p.Q522L	RP11-386G11.5_ENST00000552284.1_RNA|RP11-386G11.5_ENST00000552933.1_RNA|RP11-386G11.5_ENST00000547395.1_RNA|RP11-386G11.3_ENST00000549516.1_RNA|RP11-386G11.5_ENST00000547866.1_RNA	NM_015086.1	NP_055901.2	O94850	DEND_HUMAN	dendrin	522	Interaction with CD2AP and NPHS1. {ECO:0000250}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	8						cccgccgggcTGGTGTAAAAG	0.687																																					p.Q522L		.											.	DDN	90	0			c.A1565T						.						8.0	10.0	9.0					12																	49391094		2172	4222	6394	SO:0001583	missense	23109	exon2			CCGGGCTGGTGTA	AB018292	CCDS31791.2	12q13	2008-02-05			ENSG00000181418	ENSG00000181418			24458	protein-coding gene	gene with protein product		610588					Standard	NM_015086		Approved	KIAA0749	uc001rsv.1	O94850	OTTHUMG00000156183	ENST00000421952.2:c.1565A>T	12.37:g.49391094T>A	ENSP00000390590:p.Gln522Leu	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	89.0	NM_015086		Missense_Mutation	SNP	ENST00000421952.2	37	CCDS31791.2	.	.	.	.	.	.	.	.	.	.	T	8.484	0.860409	0.17178	.	.	ENSG00000181418	ENST00000421952	T	0.56275	0.47	3.68	-0.121	0.13535	.	0.631666	0.13163	N	0.408907	T	0.33962	0.0881	L	0.32530	0.975	0.09310	N	1	P	0.36535	0.557	B	0.33750	0.169	T	0.19647	-1.0299	10	0.62326	D	0.03	-2.0503	3.8991	0.09152	0.0:0.3649:0.2045:0.4306	.	522	O94850	DEND_HUMAN	L	522	ENSP00000390590:Q522L	ENSP00000390590:Q522L	Q	-	2	0	DDN	47677361	0.001000	0.12720	0.001000	0.08648	0.249000	0.25844	0.160000	0.16462	-0.020000	0.14032	0.402000	0.26972	CAG	.		0.687	DDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343335.1		
DEFB113	245927	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	49937328	49937328	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:49937328A>C	ENST00000398718.1	-	1	10	c.11T>G	c.(10-12)cTt>cGt	p.L4R		NM_001037729.1	NP_001032818.1	Q30KQ7	DB113_HUMAN	defensin, beta 113	4					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	7	Lung NSC(77;0.042)					AAAAATACAAAGTATCTTCAT	0.343																																					p.L4R		.											.	DEFB113	90	0			c.T11G						.						104.0	103.0	103.0					6																	49937328		1857	4087	5944	SO:0001583	missense	245927	exon1			ATACAAAGTATCT	DQ012017	CCDS43472.1	6p12.3	2010-03-30			ENSG00000214642	ENSG00000214642		"""Defensins, beta"""	18094	protein-coding gene	gene with protein product						11854508, 16033865	Standard	NM_001037729		Approved	DEFB-13	uc011dwq.2	Q30KQ7	OTTHUMG00000160210	ENST00000398718.1:c.11T>G	6.37:g.49937328A>C	ENSP00000381703:p.Leu4Arg	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	8.0	NM_001037729		Missense_Mutation	SNP	ENST00000398718.1	37	CCDS43472.1	.	.	.	.	.	.	.	.	.	.	A	12.04	1.820101	0.32145	.	.	ENSG00000214642	ENST00000398718	.	.	.	4.06	4.06	0.47325	.	.	.	.	.	T	0.38719	0.1051	.	.	.	0.09310	N	1	D	0.58970	0.984	P	0.57371	0.819	T	0.12682	-1.0538	6	.	.	.	-2.1036	9.5877	0.39526	1.0:0.0:0.0:0.0	.	4	Q30KQ7	DB113_HUMAN	R	4	.	.	L	-	2	0	DEFB113	50045287	0.173000	0.23056	0.015000	0.15790	0.347000	0.29111	3.461000	0.53035	1.834000	0.53371	0.482000	0.46254	CTT	.		0.343	DEFB113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359666.1		
DHX8	1659	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41582013	41582013	+	Splice_Site	SNP	G	G	A	rs145241921	byFrequency	TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:41582013G>A	ENST00000262415.3	+	12	1620	c.1548G>A	c.(1546-1548)gcG>gcA	p.A516A	DHX8_ENST00000540306.1_Splice_Site_p.A516A	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	516					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CCTTTCCAGCGGAAGGCAGAC	0.478																																					p.A516A	NSCLC(56;1548 1661 49258 49987)	.											.	DHX8	229	0			c.G1548A						.	G		0,4406		0,0,2203	205.0	208.0	207.0		1548	3.8	1.0	17	dbSNP_134	207	4,8596	3.7+/-12.6	0,4,4296	yes	coding-synonymous-near-splice	DHX8	NM_004941.1		0,4,6499	AA,AG,GG		0.0465,0.0,0.0308		516/1221	41582013	4,13002	2203	4300	6503	SO:0001630	splice_region_variant	1659	exon12			TCCAGCGGAAGGC	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1547-1G>A	17.37:g.41582013G>A		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	28.0	NM_004941		Silent	SNP	ENST00000262415.3	37	CCDS11464.1																																																																																			G|1.000;A|0.000		0.478	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		Silent
DIDO1	11083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61512777	61512777	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:61512777T>C	ENST00000266070.4	-	16	4856	c.4531A>G	c.(4531-4533)Atg>Gtg	p.M1511V	DIDO1_ENST00000395343.1_Missense_Mutation_p.M1511V	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1511					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					AAGTGGGCCATGGAGACCCCG	0.577																																					p.M1511V	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1	96	0			c.A4531G						.						95.0	94.0	94.0					20																	61512777		2203	4300	6503	SO:0001583	missense	11083	exon16			GGGCCATGGAGAC	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4531A>G	20.37:g.61512777T>C	ENSP00000266070:p.Met1511Val	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	5.0	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.392700	0.83011	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09163	3.01;3.01	5.69	5.69	0.88448	.	0.000000	0.52532	D	0.000073	T	0.26593	0.0650	M	0.77820	2.39	0.80722	D	1	D	0.56521	0.976	P	0.52109	0.69	T	0.01869	-1.1257	10	0.52906	T	0.07	-43.8188	15.9481	0.79809	0.0:0.0:0.0:1.0	.	1511	Q9BTC0	DIDO1_HUMAN	V	1511	ENSP00000266070:M1511V;ENSP00000378752:M1511V	ENSP00000266070:M1511V	M	-	1	0	DIDO1	60983222	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	5.771000	0.68881	2.153000	0.67306	0.533000	0.62120	ATG	.		0.577	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	32481605	32481605	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:32481605T>A	ENST00000357033.4	-	25	3589	c.3383A>T	c.(3382-3384)gAg>gTg	p.E1128V	DMD_ENST00000378677.2_Missense_Mutation_p.E1124V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1128					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GAGTTCTGTCTCAAGTCTCGA	0.428																																					p.E1128V		.											.	DMD	265	0			c.A3383T						.						260.0	167.0	199.0					X																	32481605		2202	4300	6502	SO:0001583	missense	1756	exon25			TCTGTCTCAAGTC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3383A>T	X.37:g.32481605T>A	ENSP00000354923:p.Glu1128Val	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	20.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	9.032	0.987577	0.18966	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.53640	0.61;0.61	5.43	5.43	0.79202	.	0.446950	0.15801	U	0.243978	T	0.41834	0.1176	L	0.36672	1.1	0.58432	D	0.999997	B;B;B	0.20368	0.023;0.044;0.029	B;B;B	0.27608	0.049;0.077;0.081	T	0.31194	-0.9952	10	0.56958	D	0.05	.	11.8017	0.52130	0.0:0.0:0.1441:0.8559	.	1120;1128;1124	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	V	1120;1124;1128;1128;1005	ENSP00000367948:E1124V;ENSP00000354923:E1128V	ENSP00000354923:E1128V	E	-	2	0	DMD	32391526	1.000000	0.71417	0.184000	0.23157	0.028000	0.11728	6.110000	0.71535	1.825000	0.53177	0.356000	0.21956	GAG	.		0.428	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DMRTB1	63948	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	53932266	53932266	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:53932266A>T	ENST00000371445.3	+	4	1016		c.e4-1			NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						TGTCCTTCACAGATGACCAGG	0.468																																					.		.											.	DMRTB1	92	0			c.962-2A>T						.						164.0	179.0	174.0					1																	53932266		2203	4300	6503	SO:0001630	splice_region_variant	63948	exon4			CTTCACAGATGAC	AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.962-1A>T	1.37:g.53932266A>T		Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	233.0	112.0	NM_033067	Q96SD2	Splice_Site	SNP	ENST00000371445.3	37	CCDS581.1	.	.	.	.	.	.	.	.	.	.	A	14.95	2.688133	0.48097	.	.	ENSG00000143006	ENST00000371445	.	.	.	4.63	3.52	0.40303	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3459	0.21349	0.8914:0.0:0.1086:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DMRTB1	53704854	0.998000	0.40836	0.649000	0.29536	0.444000	0.32077	1.392000	0.34486	2.075000	0.62263	0.459000	0.35465	.	.		0.468	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022110.1		Intron
DMXL1	1657	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	118513717	118513717	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:118513717A>T	ENST00000311085.8	+	28	6993	c.6913A>T	c.(6913-6915)Aat>Tat	p.N2305Y	DMXL1_ENST00000539542.1_Missense_Mutation_p.N2305Y	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2305										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TCGACTTTTGAATTCTTCTGG	0.373																																					p.N2305Y		.											.	DMXL1	92	0			c.A6913T						.						67.0	67.0	67.0					5																	118513717		2202	4300	6502	SO:0001583	missense	1657	exon28			CTTTTGAATTCTT	AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.6913A>T	5.37:g.118513717A>T	ENSP00000309690:p.Asn2305Tyr	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	15.0	NM_005509		Missense_Mutation	SNP	ENST00000311085.8	37	CCDS4125.1	.	.	.	.	.	.	.	.	.	.	A	17.61	3.433327	0.62844	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.10005	2.92;2.92	5.72	5.72	0.89469	.	0.117593	0.85682	D	0.000000	T	0.23886	0.0578	M	0.72479	2.2	0.53688	D	0.999979	D;D	0.54397	0.963;0.966	P;P	0.50440	0.632;0.641	T	0.00899	-1.1522	10	0.72032	D	0.01	-21.876	16.0205	0.80486	1.0:0.0:0.0:0.0	.	2305;2305	F5H269;Q9Y485	.;DMXL1_HUMAN	Y	2305	ENSP00000309690:N2305Y;ENSP00000439479:N2305Y	ENSP00000309690:N2305Y	N	+	1	0	DMXL1	118541616	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.194000	0.70268	0.533000	0.62120	AAT	.		0.373	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250862.1	NM_005509	
DNA2	1763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70190319	70190319	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:70190319T>C	ENST00000358410.3	-	14	2132	c.2082A>G	c.(2080-2082)atA>atG	p.I694M	DNA2_ENST00000399179.2_Intron|DNA2_ENST00000399180.2_Missense_Mutation_p.I780M	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	694	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GCAAAAATCCTATTTTAAACT	0.383																																					p.I694M		.											.	.	.	0			c.A2082G						.						75.0	70.0	71.0					10																	70190319		1825	4087	5912	SO:0001583	missense	1763	exon14			AAATCCTATTTTA	D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2082A>G	10.37:g.70190319T>C	ENSP00000351185:p.Ile694Met	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	23.0	NM_001080449	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	ENST00000358410.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.73|17.73	3.460855|3.460855	0.63513|0.63513	.|.	.|.	ENSG00000138346|ENSG00000138346	ENST00000399180;ENST00000358410|ENST00000440722	D;D|.	0.82711|.	-1.64;-1.64|.	5.61|5.61	-6.98|-6.98	0.01611|0.01611	.|.	0.314198|.	0.33875|.	N|.	0.004477|.	T|T	0.44871|0.44871	0.1314|0.1314	L|L	0.37466|0.37466	1.105|1.105	0.80722|0.80722	D|D	1|1	P|.	0.49307|.	0.922|.	P|.	0.51866|.	0.682|.	T|T	0.47736|0.47736	-0.9094|-0.9094	10|5	0.51188|.	T|.	0.08|.	.|.	8.0606|8.0606	0.30631|0.30631	0.4912:0.0:0.2817:0.2271|0.4912:0.0:0.2817:0.2271	.|.	694|.	P51530|.	DNA2L_HUMAN|.	M|G	780;694|16	ENSP00000382133:I780M;ENSP00000351185:I694M|.	ENSP00000351185:I694M|.	I|R	-|-	3|1	3|2	DNA2|DNA2	69860325|69860325	0.005000|0.005000	0.15991|0.15991	0.940000|0.940000	0.37924|0.37924	0.988000|0.988000	0.76386|0.76386	-1.356000|-1.356000	0.02609|0.02609	-1.035000|-1.035000	0.03291|0.03291	0.529000|0.529000	0.55759|0.55759	ATA|AGG	.		0.383	DNA2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000048334.2		
DNAH12	201625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57394214	57394214	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:57394214C>A	ENST00000351747.2	-	40	6192	c.6012G>T	c.(6010-6012)ctG>ctT	p.L2004L		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2004	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TTGCAGCAATCAGCTCTATGT	0.388																																					p.L2004L		.											.	DNAH12	47	0			c.G6012T						.						84.0	75.0	78.0					3																	57394214		692	1591	2283	SO:0001819	synonymous_variant	201625	exon40			AGCAATCAGCTCT	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.6012G>T	3.37:g.57394214C>A		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	67.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	ENST00000351747.2	37																																																																																				.		0.388	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
DNAH17	8632	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76446801	76446801	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:76446801T>A	ENST00000585328.1	-	67	10971	c.10847A>T	c.(10846-10848)gAg>gTg	p.E3616V	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.E3607V	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3607	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CTTGGTGGTCTCCAGATTCTC	0.607																																					p.E3621V		.											.	DNAH17	142	0			c.A10862T						.						81.0	67.0	72.0					17																	76446801		2203	4300	6503	SO:0001583	missense	8632	exon67			GTGGTCTCCAGAT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10847A>T	17.37:g.76446801T>A	ENSP00000465516:p.Glu3616Val	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	35.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	T	31	5.067709	0.93950	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.69040	-0.37	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000005	D	0.89245	0.6660	H	0.98833	4.345	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.93562	0.6896	10	0.87932	D	0	.	15.3576	0.74440	0.0:0.0:0.0:1.0	.	3616	E7EUM8	.	V	3616;3607	ENSP00000374490:E3607V	ENSP00000300671:E3616V	E	-	2	0	DNAH17	73958396	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.848000	0.86902	2.018000	0.59344	0.528000	0.53228	GAG	.		0.607	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	83862023	83862023	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:83862023A>G	ENST00000349129.2	+	30	6326	c.6066A>G	c.(6064-6066)gcA>gcG	p.A2022A	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Silent_p.A2013A|DOPEY1_ENST00000237163.5_Intron	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2022					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TATCACCTGCAATGGAAACCG	0.318																																					p.A2022A		.											.	DOPEY1	155	0			c.A6066G						.						62.0	62.0	62.0					6																	83862023		2203	4294	6497	SO:0001819	synonymous_variant	23033	exon30			ACCTGCAATGGAA	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6066A>G	6.37:g.83862023A>G		Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	36.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Silent	SNP	ENST00000349129.2	37	CCDS4996.1																																																																																			.		0.318	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	83862028	83862028	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:83862028A>C	ENST00000349129.2	+	30	6331	c.6071A>C	c.(6070-6072)gAa>gCa	p.E2024A	DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000369739.3_Missense_Mutation_p.E2015A|DOPEY1_ENST00000237163.5_Intron	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2024					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CCTGCAATGGAAACCGCAAAC	0.328																																					p.E2024A		.											.	DOPEY1	155	0			c.A6071C						.						64.0	64.0	64.0					6																	83862028		2203	4294	6497	SO:0001583	missense	23033	exon30			CAATGGAAACCGC	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6071A>C	6.37:g.83862028A>C	ENSP00000195654:p.Glu2024Ala	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	37.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	A	2.077	-0.411745	0.04799	.	.	ENSG00000083097	ENST00000349129	T	0.24151	1.87	6.06	4.89	0.63831	.	0.145312	0.64402	D	0.000011	T	0.07818	0.0196	L	0.43152	1.355	0.80722	D	1	P;B;B	0.41080	0.737;0.278;0.278	B;B;B	0.31290	0.127;0.057;0.057	T	0.13980	-1.0489	10	0.21014	T	0.42	.	10.7188	0.46028	0.9282:0.0:0.0718:0.0	.	1915;2015;2024	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	A	2024	ENSP00000195654:E2024A	ENSP00000195654:E2024A	E	+	2	0	DOPEY1	83918747	1.000000	0.71417	1.000000	0.80357	0.194000	0.23727	6.600000	0.74132	1.105000	0.41606	0.533000	0.62120	GAA	.		0.328	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
DSE	29940	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	116757490	116757490	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:116757490A>G	ENST00000331677.3	+	7	2303	c.1859A>G	c.(1858-1860)gAc>gGc	p.D620G	DSE_ENST00000537543.1_Missense_Mutation_p.D639G|DSE_ENST00000452085.3_Missense_Mutation_p.D620G|DSE_ENST00000359564.2_Missense_Mutation_p.D620G			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	620					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TACTGGATGGACGATACTGGC	0.473																																					p.D620G		.											.	DSE	91	0			c.A1859G						.						131.0	116.0	121.0					6																	116757490		2203	4300	6503	SO:0001583	missense	29940	exon6			GGATGGACGATAC	AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1859A>G	6.37:g.116757490A>G	ENSP00000332151:p.Asp620Gly	Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	100.0	23.0	NM_001080976	Q5R3K6	Missense_Mutation	SNP	ENST00000331677.3	37	CCDS5107.1	.	.	.	.	.	.	.	.	.	.	A	18.64	3.668522	0.67814	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	T	0.76772	0.4034	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78656	-0.2119	10	0.56958	D	0.05	-22.3585	16.5285	0.84344	1.0:0.0:0.0:0.0	.	639;620	B7Z765;Q9UL01	.;DSE_HUMAN	G	620;639;620;620	ENSP00000404049:D620G;ENSP00000441152:D639G;ENSP00000332151:D620G;ENSP00000352567:D620G	ENSP00000332151:D620G	D	+	2	0	DSE	116864183	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	2.307000	0.77673	0.528000	0.53228	GAC	.		0.473	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041940.2	NM_013352	
EFTUD2	9343	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	42949889	42949889	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:42949889C>T	ENST00000426333.2	-	11	1216	c.919G>A	c.(919-921)Gtc>Atc	p.V307I	EFTUD2_ENST00000402521.3_Missense_Mutation_p.V272I|EFTUD2_ENST00000591382.1_Missense_Mutation_p.V307I|EFTUD2_ENST00000592576.1_Missense_Mutation_p.V297I	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	307	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				GAGAAGCAGACGTTACCCAGG	0.557																																					p.V307I	Ovarian(10;65 485 10258 29980 30707)	.											.	EFTUD2	91	0			c.G919A						.						187.0	164.0	172.0					17																	42949889		2203	4300	6503	SO:0001583	missense	9343	exon11			AGCAGACGTTACC	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.919G>A	17.37:g.42949889C>T	ENSP00000392094:p.Val307Ile	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	49.0	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	37	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	C	36	5.771722	0.96922	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.76448	-1.02;-1.02	5.94	5.94	0.96194	Protein synthesis factor, GTP-binding (1);	0.000000	0.85682	D	0.000000	D	0.86678	0.5990	M	0.78801	2.425	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.55923	0.787;0.787	D	0.86809	0.1997	10	0.59425	D	0.04	-33.336	20.3736	0.98901	0.0:1.0:0.0:0.0	.	297;307	B4DMC0;Q15029	.;U5S1_HUMAN	I	307;297;272	ENSP00000392094:V307I;ENSP00000385873:V272I	ENSP00000262414:V297I	V	-	1	0	EFTUD2	40305415	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.820000	0.97059	0.650000	0.86243	GTC	.		0.557	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
EIF3A	8661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	120819149	120819149	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:120819149C>T	ENST00000369144.3	-	10	1535	c.1408G>A	c.(1408-1410)Gcc>Acc	p.A470T	SNORA19_ENST00000384737.1_RNA|EIF3A_ENST00000541549.1_Missense_Mutation_p.A436T|SNORA19_ENST00000410656.1_RNA	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TCTACTATGGCCCGTTCCAGT	0.463																																					p.A470T		.											.	EIF3A	226	0			c.G1408A						.						94.0	86.0	89.0					10																	120819149		2203	4300	6503	SO:0001583	missense	8661	exon10			CTATGGCCCGTTC	U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.1408G>A	10.37:g.120819149C>T	ENSP00000358140:p.Ala470Thr	Somatic	281.0	0.0		WXS	Illumina HiSeq	Phase_I	256.0	63.0	NM_003750	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	ENST00000369144.3	37	CCDS7608.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501556	0.64298	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.30981	1.51;1.51	5.78	5.78	0.91487	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.000000	0.39083	N	0.001474	T	0.19644	0.0472	N	0.22421	0.69	0.40110	D	0.976476	P	0.34462	0.454	B	0.31946	0.138	T	0.07309	-1.0779	10	0.28530	T	0.3	-12.2681	10.7099	0.45977	0.1334:0.7973:0.0:0.0693	.	470	Q14152	EIF3A_HUMAN	T	470;436	ENSP00000358140:A470T;ENSP00000438178:A436T	ENSP00000358140:A470T	A	-	1	0	EIF3A	120809139	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.251000	0.43187	2.730000	0.93505	0.655000	0.94253	GCC	.		0.463	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050634.1	NM_003750	
ELL2	22936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	95236690	95236690	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:95236690T>C	ENST00000237853.4	-	6	1185	c.836A>G	c.(835-837)gAc>gGc	p.D279G	ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	279					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		TGACCGTCTGTCTATTTCACT	0.328																																					p.D279G		.											.	ELL2	90	0			c.A836G						.						86.0	92.0	90.0					5																	95236690		2203	4299	6502	SO:0001583	missense	22936	exon6			CGTCTGTCTATTT	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.836A>G	5.37:g.95236690T>C	ENSP00000237853:p.Asp279Gly	Somatic	217.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	73.0	NM_012081	B4DNK7	Missense_Mutation	SNP	ENST00000237853.4	37	CCDS4080.1	.	.	.	.	.	.	.	.	.	.	T	20.4	3.991118	0.74703	.	.	ENSG00000118985	ENST00000237853;ENST00000513343	T;T	0.37058	1.22;1.22	5.52	5.52	0.82312	.	0.044252	0.85682	D	0.000000	T	0.61198	0.2328	M	0.79475	2.455	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.66528	-0.5901	10	0.87932	D	0	-4.9508	15.2931	0.73882	0.0:0.0:0.0:1.0	.	279	O00472	ELL2_HUMAN	G	279;97	ENSP00000237853:D279G;ENSP00000423915:D97G	ENSP00000237853:D279G	D	-	2	0	ELL2	95262446	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	7.115000	0.77110	2.086000	0.62901	0.459000	0.35465	GAC	.		0.328	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242846.1	NM_012081	
ELSPBP1	64100	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48523032	48523032	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:48523032A>T	ENST00000339841.2	+	5	590	c.412A>T	c.(412-414)Aat>Tat	p.N138Y	ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	138	Fibronectin type-II 3. {ECO:0000255|PROSITE-ProRule:PRU00479}.				single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CTACAGAAATAATGTGGTCTC	0.473																																					p.N138Y		.											.	ELSPBP1	90	0			c.A412T						.						96.0	87.0	90.0					19																	48523032		2203	4300	6503	SO:0001583	missense	64100	exon5			AGAAATAATGTGG	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.412A>T	19.37:g.48523032A>T	ENSP00000340660:p.Asn138Tyr	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	28.0	NM_022142	Q96RT0|Q9H4C8	Missense_Mutation	SNP	ENST00000339841.2	37	CCDS12708.1	.	.	.	.	.	.	.	.	.	.	A	1.906	-0.451955	0.04540	.	.	ENSG00000169393	ENST00000339841	T	0.50548	0.74	3.76	0.191	0.15130	Fibronectin, type II, collagen-binding (4);Kringle-like fold (1);	1.385230	0.04759	N	0.425942	T	0.37705	0.1013	L	0.52905	1.665	0.09310	N	1	P	0.36392	0.551	B	0.31614	0.133	T	0.30937	-0.9961	10	0.72032	D	0.01	.	1.0922	0.01665	0.5097:0.1922:0.1121:0.1859	.	138	Q96BH3	ESPB1_HUMAN	Y	138	ENSP00000340660:N138Y	ENSP00000340660:N138Y	N	+	1	0	ELSPBP1	53214844	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-0.462000	0.06704	-0.170000	0.10816	0.459000	0.35465	AAT	.		0.473	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465207.1		
ELTD1	64123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	79411969	79411969	+	Silent	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:79411969G>T	ENST00000370742.3	-	3	378	c.315C>A	c.(313-315)acC>acA	p.T105T		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	105	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CTATACAGACGGTTCCATCAT	0.358																																					p.T105T		.											.	ELTD1	24	0			c.C315A						.						94.0	89.0	90.0					1																	79411969		1871	4106	5977	SO:0001819	synonymous_variant	64123	exon3			ACAGACGGTTCCA	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.315C>A	1.37:g.79411969G>T		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	54.0	NM_022159	B1AR71|Q5KU34	Silent	SNP	ENST00000370742.3	37	CCDS41352.1																																																																																			.		0.358	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
EPHA4	2043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	222301134	222301134	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:222301134T>A	ENST00000281821.2	-	13	2372	c.2331A>T	c.(2329-2331)gcA>gcT	p.A777A	EPHA4_ENST00000409938.1_Silent_p.A777A|EPHA4_ENST00000392071.4_Silent_p.A726A|EPHA4_ENST00000409854.1_Silent_p.A777A	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	777	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TGGTGTAAGCTGCTTCCGGAT	0.488																																					p.A777A		.											.	EPHA4	1441	0			c.A2331T						.						81.0	65.0	71.0					2																	222301134		2203	4300	6503	SO:0001819	synonymous_variant	2043	exon13			GTAAGCTGCTTCC	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2331A>T	2.37:g.222301134T>A		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	23.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Silent	SNP	ENST00000281821.2	37	CCDS2447.1																																																																																			.		0.488	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
EPHA8	2046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	22895781	22895781	+	Splice_Site	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:22895781G>A	ENST00000166244.3	+	2	166		c.e2-1		EPHA8_ENST00000374644.4_Splice_Site|EPHA8_ENST00000538803.1_Splice_Site	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CTGTTTTACAGTGAATTTGCT	0.602																																					.		.											.	EPHA8	1380	0			c.95-1G>A						.						137.0	129.0	132.0					1																	22895781		2203	4300	6503	SO:0001630	splice_region_variant	2046	exon2			TTTACAGTGAATT	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.95-1G>A	1.37:g.22895781G>A		Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	11.0	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Splice_Site	SNP	ENST00000166244.3	37	CCDS225.1	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711469	0.48517	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	.	.	.	3.58	3.58	0.41010	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.043	0.58910	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EPHA8	22768368	1.000000	0.71417	0.997000	0.53966	0.551000	0.35334	8.840000	0.92125	1.999000	0.58509	0.297000	0.19635	.	.		0.602	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	Intron
EPHB3	2049	broad.mit.edu;bcgsc.ca	37	3	184298848	184298848	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:184298848T>G	ENST00000330394.2	+	14	3079	c.2627T>G	c.(2626-2628)gTg>gGg	p.V876G	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	876	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			GACTGCTGGGTGCGGGACCGG	0.602																																					p.V876G		.											.	EPHB3	1455	0			c.T2627G						.						68.0	72.0	71.0					3																	184298848		2203	4300	6503	SO:0001583	missense	2049	exon14			GCTGGGTGCGGGA	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.2627T>G	3.37:g.184298848T>G	ENSP00000332118:p.Val876Gly	Somatic	96.0	1.0		WXS	Illumina HiSeq	Phase_I	75.0	6.0	NM_004443	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	37	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	T	16.54	3.151351	0.57151	.	.	ENSG00000182580	ENST00000330394	D	0.82344	-1.6	3.99	3.99	0.46301	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.136114	0.48767	D	0.000172	T	0.82070	0.4957	N	0.19112	0.55	0.80722	D	1	D	0.60160	0.987	P	0.60682	0.878	D	0.84752	0.0757	10	0.87932	D	0	.	12.786	0.57504	0.0:0.0:0.0:1.0	.	876	P54753	EPHB3_HUMAN	G	876	ENSP00000332118:V876G	ENSP00000332118:V876G	V	+	2	0	EPHB3	185781542	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.108000	0.57817	1.779000	0.52309	0.448000	0.29417	GTG	.		0.602	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
EYA1	2138	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	72229893	72229893	+	Silent	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:72229893A>T	ENST00000340726.3	-	7	1089	c.450T>A	c.(448-450)ggT>ggA	p.G150G	EYA1_ENST00000388742.4_Silent_p.G150G|EYA1_ENST00000388740.3_Silent_p.G117G|EYA1_ENST00000303824.7_Silent_p.G144G|EYA1_ENST00000419131.1_Silent_p.G145G|EYA1_ENST00000388743.2_Silent_p.G149G|EYA1_ENST00000388741.2_Silent_p.G116G	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	150					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			GTGACAATCCACCTTCAGTCT	0.443																																					p.G150G		.											.	EYA1	652	0			c.T450A						.						281.0	256.0	264.0					8																	72229893		2203	4300	6503	SO:0001819	synonymous_variant	2138	exon7			CAATCCACCTTCA	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.450T>A	8.37:g.72229893A>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	23.0	NM_000503	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Silent	SNP	ENST00000340726.3	37	CCDS34906.1																																																																																			.		0.443	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
FAM114A2	10827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	153413430	153413430	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:153413430T>C	ENST00000351797.4	-	4	400	c.324A>G	c.(322-324)tcA>tcG	p.S108S	FAM114A2_ENST00000520313.1_Silent_p.S38S|FAM114A2_ENST00000522858.1_Silent_p.S108S|FAM114A2_ENST00000520667.1_Silent_p.S108S	NM_018691.2	NP_061161.2	Q9NRY5	F1142_HUMAN	family with sequence similarity 114, member A2	108							purine nucleotide binding (GO:0017076)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|skin(1)|urinary_tract(1)	18						CGATGACATTTGAAATGCCTT	0.333																																					p.S108S		.											.	FAM114A2	90	0			c.A324G						.						80.0	75.0	77.0					5																	153413430		2202	4300	6502	SO:0001819	synonymous_variant	10827	exon4			GACATTTGAAATG	AF159700	CCDS4323.1	5q31-q33	2008-06-13	2008-06-13	2008-06-13	ENSG00000055147	ENSG00000055147			1333	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 3"""	C5orf3		10843801	Standard	XM_005268359		Approved	133K02	uc003lvc.3	Q9NRY5	OTTHUMG00000130147	ENST00000351797.4:c.324A>G	5.37:g.153413430T>C		Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	41.0	NM_018691	B2R8D8|Q9H7E0	Silent	SNP	ENST00000351797.4	37	CCDS4323.1																																																																																			.		0.333	FAM114A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252455.1	NM_018691	
FAM179B	23116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45433642	45433642	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr14:45433642A>T	ENST00000361577.3	+	1	2232	c.2018A>T	c.(2017-2019)cAg>cTg	p.Q673L	KLHL28_ENST00000396128.4_5'Flank|KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000382233.2_Missense_Mutation_p.Q673L|FAM179B_ENST00000361462.2_Missense_Mutation_p.Q673L	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	673										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						GGAGAAAACCAGACCTCCACT	0.393																																					p.Q673L		.											.	FAM179B	93	0			c.A2018T						.						46.0	46.0	46.0					14																	45433642		2203	4300	6503	SO:0001583	missense	23116	exon1			AAAACCAGACCTC	AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2018A>T	14.37:g.45433642A>T	ENSP00000355045:p.Gln673Leu	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	25.0	NM_015091	Q68D66|Q6PG27	Missense_Mutation	SNP	ENST00000361577.3	37	CCDS9681.1	.	.	.	.	.	.	.	.	.	.	A	9.494	1.101480	0.20632	.	.	ENSG00000198718	ENST00000429476;ENST00000361577;ENST00000361462;ENST00000382233	T;T;T	0.05717	3.4;3.4;3.4	5.01	-0.416	0.12351	Armadillo-type fold (1);	0.671044	0.13208	N	0.405422	T	0.03390	0.0098	N	0.14661	0.345	0.24132	N	0.995768	B;B;B;B	0.23990	0.095;0.066;0.039;0.095	B;B;B;B	0.20955	0.032;0.032;0.032;0.032	T	0.44375	-0.9332	10	0.30078	T	0.28	-0.0656	7.1182	0.25429	0.5096:0.3812:0.1091:0.0	.	673;673;673;673	Q9Y4F4-3;G3XAE9;Q9Y4F4;Q9Y4F4-2	.;.;F179B_HUMAN;.	L	673	ENSP00000355045:Q673L;ENSP00000354917:Q673L;ENSP00000371668:Q673L	ENSP00000354917:Q673L	Q	+	2	0	FAM179B	44503392	0.281000	0.24258	0.978000	0.43139	0.759000	0.43091	0.496000	0.22499	0.337000	0.23665	0.379000	0.24179	CAG	.		0.393	FAM179B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276791.1	XM_113781	
FAM161B	145483	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74411141	74411141	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr14:74411141C>G	ENST00000534936.1	-	3	927	c.822G>C	c.(820-822)caG>caC	p.Q274H	FAM161B_ENST00000286544.3_Missense_Mutation_p.Q337H			Q96MY7	F161B_HUMAN	family with sequence similarity 161, member B	274										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)	21						CCAAGTCTCTCTGTCGAGCAG	0.552																																					p.Q337H		.											.	FAM161B	91	0			c.G1011C						.						82.0	83.0	82.0					14																	74411141		2203	4300	6503	SO:0001583	missense	145483	exon3			GTCTCTCTGTCGA	AA356453	CCDS9822.1, CCDS9822.2	14q24.2	2008-06-05	2008-06-05	2008-06-05		ENSG00000156050			19854	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 44"""	C14orf44			Standard	NM_152445		Approved	FLJ31697	uc001xpd.3	Q96MY7		ENST00000534936.1:c.822G>C	14.37:g.74411141C>G	ENSP00000445326:p.Gln274His	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	13.0	NM_152445	B7Z882|J3KNA2	Missense_Mutation	SNP	ENST00000534936.1	37		.	.	.	.	.	.	.	.	.	.	C	13.27	2.186049	0.38609	.	.	ENSG00000156050	ENST00000286544;ENST00000534936	T;T	0.25085	1.82;1.82	5.12	2.26	0.28386	.	0.262495	0.32518	N	0.005986	T	0.18882	0.0453	L	0.49350	1.555	0.32345	N	0.559188	B	0.22003	0.063	B	0.25759	0.063	T	0.17684	-1.0361	10	0.54805	T	0.06	-3.458	0.6848	0.00881	0.1807:0.3764:0.1765:0.2665	.	274	Q96MY7	F161B_HUMAN	H	337;274	ENSP00000286544:Q337H;ENSP00000445326:Q274H	ENSP00000286544:Q337H	Q	-	3	2	FAM161B	73480894	0.068000	0.21057	0.975000	0.42487	0.981000	0.71138	0.360000	0.20250	0.295000	0.22570	0.563000	0.77884	CAG	.		0.552	FAM161B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_152445	
FAM196A	642938	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	128973670	128973670	+	Silent	SNP	C	C	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:128973670C>G	ENST00000522781.1	-	4	1545	c.990G>C	c.(988-990)ggG>ggC	p.G330G	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Silent_p.G330G	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	330										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						GGTTCCCCAGCCCCGGCGGGG	0.622																																					p.G330G		.											.	FAM196A	70	0			c.G990C						.						82.0	91.0	88.0					10																	128973670		2203	4300	6503	SO:0001819	synonymous_variant	642938	exon4			CCCCAGCCCCGGC		CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.990G>C	10.37:g.128973670C>G		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	9.0	NM_001039762	B2RNT4|B7ZME7	Silent	SNP	ENST00000522781.1	37	CCDS31312.1																																																																																			.		0.622	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762	
BRINP2	57795	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	177250137	177250137	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:177250137A>C	ENST00000361539.4	+	8	2137	c.1825A>C	c.(1825-1827)Agc>Cgc	p.S609R	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	609					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											GAATGAGGGCAGCTTTCCTGA	0.537																																					p.S609R		.											.	FAM5B	28	0			c.A1825C						.						74.0	70.0	71.0					1																	177250137		2203	4300	6503	SO:0001583	missense	57795	exon8			GAGGGCAGCTTTC		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1825A>C	1.37:g.177250137A>C	ENSP00000354481:p.Ser609Arg	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	13.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	ENST00000361539.4	37	CCDS1320.1	.	.	.	.	.	.	.	.	.	.	A	9.572	1.121187	0.20877	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.14893	2.47	5.25	-4.17	0.03857	.	0.792587	0.12706	N	0.445980	T	0.09468	0.0233	N	0.14661	0.345	0.09310	N	1	B;B	0.33266	0.404;0.037	B;B	0.36335	0.222;0.01	T	0.30238	-0.9985	10	0.62326	D	0.03	-1.3116	9.5077	0.39058	0.4115:0.1097:0.4788:0.0	.	504;609	Q9C0B6-2;Q9C0B6	.;FAM5B_HUMAN	R	362;609	ENSP00000354481:S609R	ENSP00000354481:S609R	S	+	1	0	FAM5B	175516760	0.000000	0.05858	0.029000	0.17559	0.947000	0.59692	-0.159000	0.10056	-0.554000	0.06150	0.260000	0.18958	AGC	.		0.537	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
FARP2	9855	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242380934	242380934	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:242380934C>A	ENST00000264042.3	+	13	1544	c.1374C>A	c.(1372-1374)gcC>gcA	p.A458A	FARP2_ENST00000373287.4_Silent_p.A458A|FARP2_ENST00000545004.1_Silent_p.A458A	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	458	Pro-rich.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		CACCATCGGCCCAGCCCCTCG	0.642																																					p.A458A		.											.	FARP2	93	0			c.C1374A						.						29.0	32.0	31.0					2																	242380934		2203	4300	6503	SO:0001819	synonymous_variant	9855	exon13			ATCGGCCCAGCCC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1374C>A	2.37:g.242380934C>A		Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	77.0	41.0	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	37	CCDS33424.1																																																																																			.		0.642	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
FBXO10	26267	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	37541574	37541574	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:37541574T>C	ENST00000432825.2	-	2	240	c.192A>G	c.(190-192)ccA>ccG	p.P64P	RP11-613M10.8_ENST00000544475.1_5'UTR|RP11-613M10.8_ENST00000537239.2_3'UTR|FBXO10_ENST00000541829.1_Intron	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	64					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GCTCCACATCTGGCTGGTTGG	0.567																																					p.P64P		.											.	FBXO10	637	0			c.A192G						.						47.0	48.0	47.0					9																	37541574		2007	4171	6178	SO:0001819	synonymous_variant	26267	exon2			CACATCTGGCTGG	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.192A>G	9.37:g.37541574T>C		Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	36.0	NM_012166	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	37	CCDS47966.1																																																																																			.		0.567	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3		
FBXW10	10517	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	18653121	18653121	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:18653121G>A	ENST00000395665.4	+	3	978	c.757G>A	c.(757-759)Gat>Aat	p.D253N	FBXW10_ENST00000395667.1_Missense_Mutation_p.D253N|FBXW10_ENST00000301938.4_Missense_Mutation_p.D253N|FBXW10_ENST00000308799.4_Missense_Mutation_p.D253N			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	253										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GCCAGGGTACGATCCCTGCAA	0.483																																					p.D253N		.											.	FBXW10	91	0			c.G757A						.						182.0	140.0	155.0					17																	18653121		2203	4300	6503	SO:0001583	missense	10517	exon3			GGGTACGATCCCT	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.757G>A	17.37:g.18653121G>A	ENSP00000379025:p.Asp253Asn	Somatic	315.0	0.0		WXS	Illumina HiSeq	Phase_I	344.0	15.0	NM_001267585	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	ENST00000395665.4	37	CCDS11199.3	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727553	0.48833	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	2.49	-1.02	0.10135	.	1.171610	0.06794	U	0.787558	T	0.17789	0.0427	L	0.29908	0.895	0.09310	N	1	P;P;P;P	0.47106	0.89;0.89;0.824;0.89	B;B;B;B	0.37047	0.24;0.173;0.121;0.24	T	0.20306	-1.0279	10	0.48119	T	0.1	.	4.1575	0.10268	0.2727:0.1998:0.5275:0.0	.	253;253;253;253	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	N	253	ENSP00000379026:D253N;ENSP00000310382:D253N;ENSP00000306937:D253N;ENSP00000379025:D253N	ENSP00000306937:D253N	D	+	1	0	FBXW10	18593846	0.000000	0.05858	0.000000	0.03702	0.955000	0.61496	-0.250000	0.08830	-0.029000	0.13827	0.405000	0.27470	GAT	.		0.483	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313531.2	NM_031456	
FER1L5	90342	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	2	97335890	97335890	+	RNA	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:97335890A>T	ENST00000457909.1	+	0	0							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						GGTTTAGCTTATCGAGGCCGA	0.468																																					p.Y461F		.											.	FER1L5	23	0			c.A1382T						.						143.0	113.0	122.0					2																	97335890		692	1591	2283			90342	exon17			TAGCTTATCGAGG	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97335890A>T		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	35.0	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	A	15.56	2.870933	0.51695	.	.	ENSG00000214272	ENST00000414152;ENST00000436930	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	T	0.62648	0.2445	L	0.50333	1.59	.	.	.	D	0.67145	0.996	D	0.63381	0.914	T	0.73585	-0.3936	7	0.87932	D	0	.	10.8235	0.46619	1.0:0.0:0.0:0.0	.	461	A0AVI2	FR1L5_HUMAN	F	461;454	.	ENSP00000444148:Y461F	Y	+	2	0	FER1L5	96699617	1.000000	0.71417	0.958000	0.39756	0.961000	0.63080	5.685000	0.68204	2.057000	0.61298	0.528000	0.53228	TAT	.		0.468	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
FGA	2243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155507589	155507589	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:155507589G>T	ENST00000302053.3	-	5	1070	c.992C>A	c.(991-993)aCt>aAt	p.T331N	FGA_ENST00000403106.3_Missense_Mutation_p.T331N	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	331			T -> A (in dbSNP:rs6050). {ECO:0000269|PubMed:10391209, ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CCAGCTTCCAGTACTTCCAGG	0.577																																					p.T331N	NSCLC(143;340 1922 20892 22370 48145)	.											.	FGA	93	0			c.C992A						.						91.0	99.0	96.0					4																	155507589		2203	4300	6503	SO:0001583	missense	2243	exon5			CTTCCAGTACTTC		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.992C>A	4.37:g.155507589G>T	ENSP00000306361:p.Thr331Asn	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	16.0	NM_000508	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	ENST00000302053.3	37	CCDS3787.1	.	.	.	.	.	.	.	.	.	.	G	9.600	1.128378	0.21041	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.72051	-0.62;-0.62	4.95	2.0	0.26442	.	3.217810	0.01539	N	0.019120	T	0.61185	0.2327	L	0.47190	1.495	0.09310	N	1	B;P	0.39216	0.218;0.664	B;B	0.35353	0.124;0.201	T	0.47058	-0.9146	10	0.29301	T	0.29	.	3.162	0.06523	0.0923:0.1295:0.418:0.3602	.	331;331	P02671-2;P02671	.;FIBA_HUMAN	N	331	ENSP00000306361:T331N;ENSP00000385981:T331N	ENSP00000306361:T331N	T	-	2	0	FGA	155727039	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.576000	0.05854	0.485000	0.27652	0.650000	0.86243	ACT	.		0.577	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317593.1	NM_000508	
FGFR2	2263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	123276887	123276887	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:123276887C>A	ENST00000358487.5	-	8	1302	c.1030G>T	c.(1030-1032)Gcg>Tcg	p.A344S	FGFR2_ENST00000346997.2_Missense_Mutation_p.A344S|FGFR2_ENST00000369061.4_Intron|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000457416.2_Intron|FGFR2_ENST00000478859.1_Missense_Mutation_p.A116S|FGFR2_ENST00000356226.4_Missense_Mutation_p.A229S|FGFR2_ENST00000369059.1_Intron|FGFR2_ENST00000369056.1_Intron|FGFR2_ENST00000360144.3_Intron|FGFR2_ENST00000357555.5_Missense_Mutation_p.A255S|FGFR2_ENST00000351936.6_Missense_Mutation_p.A344S|FGFR2_ENST00000369060.4_Intron	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	344	Ig-like C2-type 3.		A -> G (in CS and JWS). {ECO:0000269|PubMed:7581378, ECO:0000269|PubMed:7874170}.|A -> P (in CS and PS). {ECO:0000269|PubMed:8644708}.		angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	GAATTACCCGCCAAGCACGTA	0.438		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																												p.A344S		.		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	.	FGFR2	2607	0			c.G1030T	GRCh37	CM960649	FGFR2	M		.						128.0	113.0	118.0					10																	123276887		2203	4300	6503	SO:0001583	missense	2263	exon8	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	TACCCGCCAAGCA	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1030G>T	10.37:g.123276887C>A	ENSP00000351276:p.Ala344Ser	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	22.0	NM_000141	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	ENST00000358487.5	37	CCDS31298.1	.	.	.	.	.	.	.	.	.	.	C	34	5.360031	0.95877	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000358487;ENST00000356226;ENST00000346997;ENST00000351936;ENST00000336553	T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	5.86	5.86	0.93980	.	.	.	.	.	D	0.89942	0.6861	M	0.84683	2.71	0.80722	D	1	P;D;B;D;P	0.69078	0.9;0.996;0.087;0.997;0.64	D;D;B;D;P	0.79784	0.916;0.993;0.444;0.942;0.716	D	0.90539	0.4501	9	0.87932	D	0	.	20.1865	0.98220	0.0:1.0:0.0:0.0	.	229;344;363;255;229	B5A963;B5A960;D3DRD5;P21802-21;P21802-20	.;.;.;.;.	S	255;347;344;229;344;344;255	ENSP00000350166:A255S;ENSP00000351276:A344S;ENSP00000348559:A229S;ENSP00000263451:A344S;ENSP00000309878:A344S;ENSP00000337665:A255S	ENSP00000337665:A255S	A	-	1	0	FGFR2	123266877	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.764000	0.85297	2.775000	0.95449	0.655000	0.94253	GCG	.		0.438	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000050715.1	NM_022976, NM_000141	
FIG4	9896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	110081565	110081565	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:110081565A>T	ENST00000230124.3	+	11	1374	c.1250A>T	c.(1249-1251)gAc>gTc	p.D417V	FIG4_ENST00000441478.2_Missense_Mutation_p.D140V	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	417	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		ATTCCCTGGGACATGGCCAAG	0.413																																					p.D417V		.											.	FIG4	69	0			c.A1250T						.						184.0	147.0	160.0					6																	110081565		2203	4300	6503	SO:0001583	missense	9896	exon11			CCTGGGACATGGC	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1250A>T	6.37:g.110081565A>T	ENSP00000230124:p.Asp417Val	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	20.0	NM_014845	Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.116988	0.77323	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.77750	-1.12;-1.12	5.49	4.34	0.51931	Synaptojanin, N-terminal (2);	0.107962	0.64402	D	0.000009	D	0.89001	0.6591	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91111	0.4922	10	0.87932	D	0	-25.2145	11.11	0.48226	0.9276:0.0:0.0724:0.0	.	140;417	F5H8L9;Q92562	.;FIG4_HUMAN	V	140;417	ENSP00000399443:D140V;ENSP00000230124:D417V	ENSP00000230124:D417V	D	+	2	0	FIG4	110188258	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	5.979000	0.70508	0.926000	0.37118	0.460000	0.39030	GAC	.		0.413	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845	
FIGNL1	63979	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	50514059	50514060	+	Frame_Shift_Ins	INS	-	-	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:50514059_50514060insT	ENST00000419119.1	-	2	2479_2480	c.926_927insA	c.(925-927)aagfs	p.K309fs	FIGNL1_ENST00000395556.2_Frame_Shift_Ins_p.K309fs|FIGNL1_ENST00000356889.4_Frame_Shift_Ins_p.K309fs|FIGNL1_ENST00000433017.1_Frame_Shift_Ins_p.K309fs			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	309	Necessary and sufficient for interaction with RAD51.				ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				GTTGGTGGTACTTTTTTTGCTG	0.426																																					p.K309fs		.											.	FIGNL1	93	0			c.927_928insA						.																																			SO:0001589	frameshift_variant	63979	exon4			GTGGTACTTTTTT	AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.927dupA	7.37:g.50514066_50514066dupT	ENSP00000410811:p.Lys309fs	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	28.0	NM_022116	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Frame_Shift_Ins	INS	ENST00000419119.1	37	CCDS5510.1																																																																																			.		0.426	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342579.1	NM_001042762	
FLG2	388698	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	152326656	152326656	+	Silent	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:152326656G>T	ENST00000388718.5	-	3	3678	c.3606C>A	c.(3604-3606)tcC>tcA	p.S1202S	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1202	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAAATCCAGTGGACTGACCTG	0.483																																					p.S1202S		.											.	FLG2	151	0			c.C3606A						.						116.0	114.0	115.0					1																	152326656		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			TCCAGTGGACTGA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3606C>A	1.37:g.152326656G>T		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	26.0	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	37	CCDS30861.1																																																																																			.		0.483	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
MACROD1	28992	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	63883947	63883947	+	Intron	SNP	C	C	A	rs139162750		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:63883947C>A	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Silent_p.R70R	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						CTGCAACGACCGGGGACTCAC	0.607																																					p.R70R		.											.	FLRT1	90	0			c.C208A						.						124.0	80.0	95.0					11																	63883947		2201	4297	6498	SO:0001627	intron_variant	23769	exon2			AACGACCGGGGAC	AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+34763G>T	11.37:g.63883947C>A		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	18.0	NM_013280	Q9UH96	Silent	SNP	ENST00000255681.6	37	CCDS8056.1																																																																																			C|1.000;T|0.000		0.607	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396570.1	NM_014067	
FNDC1	84624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	159650876	159650876	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:159650876A>C	ENST00000297267.9	+	10	1410	c.1210A>C	c.(1210-1212)Aaa>Caa	p.K404Q	FNDC1_ENST00000340366.6_Intron	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	404	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CCCGGCTCTCAAACCATTTGG	0.493																																					p.K404Q		.											.	FNDC1	138	0			c.A1210C						.						164.0	169.0	168.0					6																	159650876		1911	4117	6028	SO:0001583	missense	84624	exon10			GCTCTCAAACCAT	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1210A>C	6.37:g.159650876A>C	ENSP00000297267:p.Lys404Gln	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	22.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.674920	0.67928	.	.	ENSG00000164694	ENST00000297267	T	0.53206	0.63	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.61198	0.2328	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.62656	-0.6808	10	0.45353	T	0.12	-21.3403	16.1814	0.81903	1.0:0.0:0.0:0.0	.	404	Q4ZHG4	FNDC1_HUMAN	Q	404	ENSP00000297267:K404Q	ENSP00000297267:K404Q	K	+	1	0	FNDC1	159570864	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.004000	0.76317	2.234000	0.73211	0.533000	0.62120	AAA	.		0.493	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
FOXK1	221937	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	4801902	4801902	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:4801902A>T	ENST00000328914.4	+	9	2009	c.2009A>T	c.(2008-2010)aAg>aTg	p.K670M	FOXK1_ENST00000446823.1_Missense_Mutation_p.K507M	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GTGGGGCCCAAGGAGCCAGCA	0.692																																					p.K670M		.											.	FOXK1	516	0			c.A2009T						.						23.0	18.0	20.0					7																	4801902		2039	4004	6043	SO:0001583	missense	221937	exon9			GGCCCAAGGAGCC	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.2009A>T	7.37:g.4801902A>T	ENSP00000328720:p.Lys670Met	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	37.0	NM_001037165		Missense_Mutation	SNP	ENST00000328914.4	37	CCDS34591.1	.	.	.	.	.	.	.	.	.	.	a	17.31	3.357941	0.61403	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.95821	-3.46;-3.82	4.82	4.82	0.62117	.	0.342066	0.26765	N	0.022618	D	0.89808	0.6822	N	0.08118	0	0.28571	N	0.910627	P;B	0.44195	0.828;0.101	B;B	0.43155	0.41;0.015	D	0.86762	0.1967	10	0.87932	D	0	.	12.1388	0.53986	1.0:0.0:0.0:0.0	.	670;507	P85037;P85037-2	FOXK1_HUMAN;.	M	507;426;670;553	ENSP00000394442:K507M;ENSP00000328720:K670M	ENSP00000328720:K670M	K	+	2	0	FOXK1	4768428	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	6.730000	0.74780	1.812000	0.52913	0.454000	0.30748	AAG	.		0.692	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323729.2		
FSCN1	6624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	5643005	5643005	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:5643005T>A	ENST00000382361.3	+	2	1064	c.950T>A	c.(949-951)cTg>cAg	p.L317Q	FSCN1_ENST00000340250.6_Missense_Mutation_p.L296Q	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	317					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		TACTGGACGCTGACGGCCACC	0.652																																					p.L317Q		.											.	FSCN1	91	0			c.T950A						.						82.0	59.0	67.0					7																	5643005		2203	4300	6503	SO:0001583	missense	6624	exon2			GGACGCTGACGGC	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.950T>A	7.37:g.5643005T>A	ENSP00000371798:p.Leu317Gln	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	10.0	NM_003088	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	ENST00000382361.3	37	CCDS5342.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.411012	0.83340	.	.	ENSG00000075618	ENST00000340250;ENST00000382361;ENST00000444748;ENST00000447103;ENST00000405801;ENST00000535097	T;T	0.51071	0.72;1.3	4.75	4.75	0.60458	Fascin domain (1);Actin cross-linking (1);	0.000000	0.64402	D	0.000006	T	0.72301	0.3443	M	0.88906	2.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.78534	-0.2167	10	0.87932	D	0	-4.2061	13.0869	0.59146	0.0:0.0:0.0:1.0	.	296;317	B3KTA3;Q16658	.;FSCN1_HUMAN	Q	296;317;39;39;39;39	ENSP00000339729:L296Q;ENSP00000371798:L317Q	ENSP00000339729:L296Q	L	+	2	0	FSCN1	5609531	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	7.997000	0.88414	1.764000	0.52075	0.459000	0.35465	CTG	.		0.652	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	NM_003088	
FUT3	2525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5843806	5843806	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:5843806T>A	ENST00000303225.6	-	3	1679	c.1045A>T	c.(1045-1047)Agg>Tgg	p.R349W	FUT3_ENST00000589620.1_Missense_Mutation_p.R349W|FUT3_ENST00000458379.2_Missense_Mutation_p.R349W|FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000589918.1_Missense_Mutation_p.R349W	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	349					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						GTCTGGTACCTGGATTCCTGC	0.637																																					p.R349W	Esophageal Squamous(82;745 1728 24593 44831)	.											.	FUT3	90	0			c.A1045T						.						61.0	64.0	63.0					19																	5843806		2203	4300	6503	SO:0001583	missense	2525	exon3			GGTACCTGGATTC		CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.1045A>T	19.37:g.5843806T>A	ENSP00000305603:p.Arg349Trp	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	70.0	NM_001097640	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	ENST00000303225.6	37	CCDS12153.1	.	.	.	.	.	.	.	.	.	.	T	16.76	3.212015	0.58452	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.26067	1.76;1.76	2.29	1.2	0.21068	.	4.574480	0.01087	N	0.005103	T	0.53802	0.1819	M	0.86651	2.83	0.09310	N	1	D;D;D;D	0.67145	0.987;0.996;0.996;0.996	D;D;D;D	0.66602	0.945;0.926;0.926;0.926	T	0.04976	-1.0914	10	0.72032	D	0.01	.	4.7674	0.13139	0.0:0.332:0.0:0.668	.	349;349;349;349	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	W	349	ENSP00000305603:R349W;ENSP00000416443:R349W	ENSP00000305603:R349W	R	-	1	2	FUT3	5794806	0.000000	0.05858	0.120000	0.21714	0.559000	0.35586	-1.868000	0.01644	0.112000	0.17975	0.163000	0.16589	AGG	.		0.637	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
FUT9	10690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	96651917	96651917	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:96651917A>T	ENST00000302103.5	+	3	1212	c.886A>T	c.(886-888)Agt>Tgt	p.S296C		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	296					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		TAACTCTCCCAGTGAGCTAGC	0.388																																					p.S296C	Melanoma(98;1369 1476 6592 22940 26587)	.											.	FUT9	95	0			c.A886T						.						69.0	68.0	68.0					6																	96651917		2203	4300	6503	SO:0001583	missense	10690	exon3			TCTCCCAGTGAGC	AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.886A>T	6.37:g.96651917A>T	ENSP00000302599:p.Ser296Cys	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	8.0	NM_006581	Q5T0W4	Missense_Mutation	SNP	ENST00000302103.5	37	CCDS5033.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302826	0.60195	.	.	ENSG00000172461	ENST00000302103	T	0.26518	1.73	5.5	4.35	0.52113	.	0.134780	0.64402	D	0.000002	T	0.23572	0.0570	L	0.56199	1.76	0.32758	N	0.505442	P	0.45240	0.854	P	0.52627	0.704	T	0.05666	-1.0871	10	0.87932	D	0	-15.2491	10.0915	0.42449	0.9217:0.0:0.0783:0.0	.	296	Q9Y231	FUT9_HUMAN	C	296	ENSP00000302599:S296C	ENSP00000302599:S296C	S	+	1	0	FUT9	96758638	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.049000	0.64244	2.091000	0.63221	0.383000	0.25322	AGT	.		0.388	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041554.2	NM_006581	
GABRA4	2557	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	46967019	46967019	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:46967019G>A	ENST00000264318.3	-	8	2084	c.1102C>T	c.(1102-1104)Cag>Tag	p.Q368*		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	368					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TTCTCTCTCTGCACTGGAGCA	0.423																																					p.Q368X	Ovarian(6;283 369 8234 12290 33402)	.											.	GABRA4	156	0			c.C1102T						.						89.0	96.0	93.0					4																	46967019		2203	4299	6502	SO:0001587	stop_gained	2557	exon8			CTCTCTGCACTGG		CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1102C>T	4.37:g.46967019G>A	ENSP00000264318:p.Gln368*	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	16.0	NM_000809	Q8IYR7	Nonsense_Mutation	SNP	ENST00000264318.3	37	CCDS3473.1	.	.	.	.	.	.	.	.	.	.	G	43	9.996373	0.99313	.	.	ENSG00000109158	ENST00000264318	.	.	.	4.81	3.97	0.46021	.	2.531910	0.01013	N	0.003874	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	11.8776	0.52556	0.0836:0.0:0.9164:0.0	.	.	.	.	X	368	.	ENSP00000264318:Q368X	Q	-	1	0	GABRA4	46661776	0.336000	0.24757	0.173000	0.22940	0.003000	0.03518	2.576000	0.46033	1.238000	0.43771	0.591000	0.81541	CAG	.		0.423	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216893.1		
GALNT11	63917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151810421	151810421	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:151810421G>C	ENST00000434507.1	+	10	1608	c.1171G>C	c.(1171-1173)Ggc>Cgc	p.G391R	GALNT11_ENST00000452146.2_Missense_Mutation_p.G310R|GALNT11_ENST00000430044.2_Missense_Mutation_p.G391R|GALNT11_ENST00000320311.2_Missense_Mutation_p.G391R			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	391					cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		ATCTCCCGAAGGCCAGGACAC	0.468																																					p.G391R		.											.	GALNT11	90	0			c.G1171C						.						166.0	155.0	159.0					7																	151810421		2203	4300	6503	SO:0001583	missense	63917	exon8			CCCGAAGGCCAGG	AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.1171G>C	7.37:g.151810421G>C	ENSP00000416787:p.Gly391Arg	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	14.0	NM_022087	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	ENST00000434507.1	37	CCDS5930.1	.	.	.	.	.	.	.	.	.	.	G	32	5.109135	0.94292	.	.	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000320311	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.59	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.72293	0.3442	M	0.87456	2.885	0.80722	D	1	D;D;D	0.59357	0.985;0.967;0.985	P;P;P	0.59643	0.861;0.597;0.861	T	0.77464	-0.2578	10	0.62326	D	0.03	.	14.8638	0.70399	0.07:0.0:0.93:0.0	.	310;391;391	B7Z5G5;B3KWF4;Q8NCW6	.;.;GLT11_HUMAN	R	391;310;391;391;391	ENSP00000395122:G391R;ENSP00000393399:G310R;ENSP00000416787:G391R;ENSP00000315835:G391R	ENSP00000315835:G391R	G	+	1	0	GALNT11	151441354	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.770000	0.98971	2.622000	0.88805	0.561000	0.74099	GGC	.		0.468	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348184.1	NM_022087	
GAS6	2621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	114535616	114535616	+	Missense_Mutation	SNP	T	T	A	rs200744856		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr13:114535616T>A	ENST00000327773.6	-	9	1090	c.944A>T	c.(943-945)cAg>cTg	p.Q315L	GAS6_ENST00000355761.4_Missense_Mutation_p.Q261L|GAS6_ENST00000357389.3_Missense_Mutation_p.Q358L|GAS6_ENST00000450766.1_Missense_Mutation_p.Q42L|GAS6_ENST00000418959.3_Missense_Mutation_p.Q16L|GAS6-AS1_ENST00000458001.1_RNA	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	358					activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				CCTGGTGGGCTGCAGCCTCTT	0.632																																					p.Q315L		.											.	GAS6	650	0			c.A944T						.						99.0	82.0	88.0					13																	114535616		2197	4290	6487	SO:0001583	missense	2621	exon9			GTGGGCTGCAGCC		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.944A>T	13.37:g.114535616T>A	ENSP00000331831:p.Gln315Leu	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	4.0	NM_000820	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	37	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.382482	0.82792	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000450766;ENST00000418959;ENST00000327773	T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09	4.75	4.75	0.60458	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.80138	0.4568	M	0.65975	2.015	0.50313	D	0.999868	P;B;D	0.56746	0.875;0.231;0.977	B;B;P	0.48488	0.375;0.068;0.579	T	0.82544	-0.0404	9	0.56958	D	0.05	-37.6214	14.2588	0.66070	0.0:0.0:0.0:1.0	.	358;42;315	Q14393;B3KVL4;Q14393-2	GAS6_HUMAN;.;.	L	358;261;42;16;315	ENSP00000349962:Q358L;ENSP00000348003:Q261L;ENSP00000416498:Q42L;ENSP00000400117:Q16L;ENSP00000331831:Q315L	ENSP00000331831:Q315L	Q	-	2	0	GAS6	113578327	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.386000	0.73186	1.761000	0.52028	0.379000	0.24179	CAG	T|0.999;C|0.000		0.632	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045946.2	NM_000820	
GCC1	79571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	127222729	127222729	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:127222729A>T	ENST00000321407.2	-	2	2091	c.1667T>A	c.(1666-1668)cTg>cAg	p.L556Q	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	556					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CAGCCGGGCCAGCTCCTGCTT	0.627																																					p.L556Q		.											.	GCC1	92	0			c.T1667A						.						31.0	34.0	33.0					7																	127222729		2202	4299	6501	SO:0001583	missense	79571	exon2			CGGGCCAGCTCCT	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1667T>A	7.37:g.127222729A>T	ENSP00000318821:p.Leu556Gln	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	5.0	NM_024523	Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	37	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.935037	0.52866	.	.	ENSG00000179562	ENST00000321407	T	0.15256	2.44	5.5	4.32	0.51571	.	0.485370	0.22030	N	0.065603	T	0.17831	0.0428	L	0.50333	1.59	0.38342	D	0.944104	P	0.49961	0.93	P	0.44732	0.459	T	0.09100	-1.0690	10	0.17369	T	0.5	-6.5626	11.051	0.47889	0.8442:0.1558:0.0:0.0	.	556	Q96CN9	GCC1_HUMAN	Q	556	ENSP00000318821:L556Q	ENSP00000318821:L556Q	L	-	2	0	GCC1	127009965	0.946000	0.32159	1.000000	0.80357	0.960000	0.62799	2.563000	0.45922	0.983000	0.38602	0.533000	0.62120	CTG	.		0.627	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523	
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120575521	120575521	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:120575521T>C	ENST00000300648.6	-	49	6503	c.6491A>G	c.(6490-6492)gAg>gGg	p.E2164G		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	2164					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CATGCCCACCTCAGGGCTGCG	0.597																																					p.E2164G		.											.	GCN1L1	94	0			c.A6491G						.						40.0	47.0	45.0					12																	120575521		2122	4239	6361	SO:0001583	missense	10985	exon49			CCCACCTCAGGGC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.6491A>G	12.37:g.120575521T>C	ENSP00000300648:p.Glu2164Gly	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	10.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	T	17.84	3.487321	0.63962	.	.	ENSG00000089154	ENST00000300648	T	0.65732	-0.17	5.26	5.26	0.73747	Armadillo-like helical (1);Armadillo-type fold (1);	0.056886	0.64402	D	0.000002	T	0.55337	0.1914	L	0.40543	1.245	0.54753	D	0.999984	B	0.19445	0.036	B	0.18263	0.021	T	0.54695	-0.8255	10	0.59425	D	0.04	.	15.1699	0.72862	0.0:0.0:0.0:1.0	.	2164	Q92616	GCN1L_HUMAN	G	2164	ENSP00000300648:E2164G	ENSP00000300648:E2164G	E	-	2	0	GCN1L1	119059904	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.484000	0.81180	1.968000	0.57251	0.460000	0.39030	GAG	.		0.597	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
GH2	2689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	61958465	61958465	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:61958465T>G	ENST00000423893.2	-	3	276	c.215A>C	c.(214-216)cAg>cCg	p.Q72P	GH2_ENST00000456543.2_Missense_Mutation_p.Q72P|GH2_ENST00000332800.7_Missense_Mutation_p.Q72P|GH2_ENST00000449787.2_Splice_Site			P01242	SOM2_HUMAN	growth hormone 2	72					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						CTGGGGGTTCTGCAGGAATGA	0.517																																					p.Q72P		.											.	GH2	93	0			c.A215C						.						198.0	210.0	206.0					17																	61958465		2203	4300	6503	SO:0001583	missense	2689	exon3			GGGTTCTGCAGGA	J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.215A>C	17.37:g.61958465T>G	ENSP00000409294:p.Gln72Pro	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	35.0	NM_022557	B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	ENST00000423893.2	37	CCDS11647.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|t	1.542|1.542	-0.541618|-0.541618	0.04053|0.04053	.|.	.|.	ENSG00000136487|ENSG00000136487	ENST00000449787|ENST00000332800;ENST00000456543;ENST00000423893	.|D;D;D	.|0.88896	.|-2.44;-2.44;-2.44	3.1|3.1	2.0|2.0	0.26442|0.26442	.|Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	.|0.164006	.|0.51477	.|D	.|0.000091	.|D	.|0.91284	.|0.7252	M|M	0.68593|0.68593	2.085|2.085	0.28790|0.28790	N|N	0.899386|0.899386	.|D;D;D;D	.|0.69078	.|0.994;0.981;0.997;0.994	.|D;P;D;D	.|0.67900	.|0.954;0.797;0.947;0.954	.|D	.|0.84799	.|0.0783	.|10	.|0.72032	.|D	.|0.01	.|.	6.6537|6.6537	0.22977|0.22977	0.0:0.1241:0.0:0.8759|0.0:0.1241:0.0:0.8759	.|.	.|72;72;72;72	.|P01242;O14644;B1A4H7;B1A4H5	.|SOM2_HUMAN;.;.;.	.|P	-1|72	.|ENSP00000333157:Q72P;ENSP00000394122:Q72P;ENSP00000409294:Q72P	.|ENSP00000333157:Q72P	.|Q	-|-	.|2	.|0	GH2|GH2	59312197|59312197	1.000000|1.000000	0.71417|0.71417	0.180000|0.180000	0.23079|0.23079	0.004000|0.004000	0.04260|0.04260	2.960000|2.960000	0.49161|0.49161	0.392000|0.392000	0.25172|0.25172	-0.611000|-0.611000	0.04053|0.04053	.|CAG	.		0.517	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417665.1	NM_002059	
GIMAP8	155038	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150164267	150164267	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:150164267T>A	ENST00000307271.3	+	2	1055	c.481T>A	c.(481-483)Tat>Aat	p.Y161N		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	161	AIG1-type G 1.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GGTTCAAGACTATGAGGGCCG	0.438																																					p.Y161N		.											.	GIMAP8	95	0			c.T481A						.						116.0	110.0	112.0					7																	150164267		2203	4300	6503	SO:0001583	missense	155038	exon2			CAAGACTATGAGG	AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.481T>A	7.37:g.150164267T>A	ENSP00000305107:p.Tyr161Asn	Somatic	65.0	1.0		WXS	Illumina HiSeq	Phase_I	85.0	21.0	NM_175571		Missense_Mutation	SNP	ENST00000307271.3	37	CCDS34777.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.315183	0.23908	.	.	ENSG00000171115	ENST00000307271	T	0.59364	0.27	4.38	0.654	0.17833	AIG1 (1);	1.103280	0.06992	N	0.821807	T	0.46870	0.1415	L	0.46157	1.445	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33979	-0.9847	10	0.41790	T	0.15	.	3.9265	0.09265	0.3182:0.0:0.2605:0.4213	.	161	Q8ND71	GIMA8_HUMAN	N	161	ENSP00000305107:Y161N	ENSP00000305107:Y161N	Y	+	1	0	GIMAP8	149795200	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.640000	0.24705	-0.037000	0.13646	0.477000	0.44152	TAT	.		0.438	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350701.1	NM_175571	
GLP2R	9340	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	9739777	9739777	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:9739777C>T	ENST00000262441.5	+	3	880	c.367C>T	c.(367-369)Cct>Tct	p.P123S	GLP2R_ENST00000574745.1_5'UTR	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	123					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)			endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	TTCATACTTACCTTGGTGGAG	0.443																																					p.P123S		.											.	GLP2R	524	0			c.C367T						.						263.0	238.0	246.0					17																	9739777		2203	4300	6503	SO:0001583	missense	9340	exon3			TACTTACCTTGGT	AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.367C>T	17.37:g.9739777C>T	ENSP00000262441:p.Pro123Ser	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	26.0	NM_004246	Q4VAT3	Missense_Mutation	SNP	ENST00000262441.5	37	CCDS11150.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777862	0.90195	.	.	ENSG00000065325	ENST00000396206;ENST00000304773;ENST00000262441	T	0.54071	0.59	5.48	5.48	0.80851	GPCR, family 2, extracellular hormone receptor domain (2);	0.000000	0.37857	N	0.001916	T	0.68869	0.3048	L	0.50919	1.6	0.58432	D	0.999999	D	0.71674	0.998	D	0.83275	0.996	T	0.70200	-0.4937	10	0.66056	D	0.02	.	18.1188	0.89565	0.0:1.0:0.0:0.0	.	123	O95838	GLP2R_HUMAN	S	123;98;123	ENSP00000262441:P123S	ENSP00000262441:P123S	P	+	1	0	GLP2R	9680502	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.114000	0.64648	2.582000	0.87167	0.563000	0.77884	CCT	.		0.443	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252601.4		
GOLGA7B	401647	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	99623744	99623744	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:99623744G>A	ENST00000370602.1	+	3	261	c.196G>A	c.(196-198)Gct>Act	p.A66T		NM_001010917.2	NP_001010917.1	Q2TAP0	GOG7B_HUMAN	golgin A7 family, member B	66						Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|prostate(1)	5						TTACGCAGAGGCTGAGAAGAT	0.587																																					p.A66T		.											.	GOLGA7B	90	0			c.G196A						.						56.0	59.0	58.0					10																	99623744		2203	4300	6503	SO:0001583	missense	401647	exon3			GCAGAGGCTGAGA	BC008047	CCDS31265.1	10q24.2	2011-10-25	2010-02-12	2008-10-03	ENSG00000155265	ENSG00000155265			31668	protein-coding gene	gene with protein product		614189	"""chromosome 10 open reading frame 133"", ""chromosome 10 open reading frame 132"", ""golgi autoantigen, golgin subfamily a, 7B"""	C10orf133, C10orf132			Standard	NM_001010917		Approved	bA459F3.4, bA451M19.3	uc001kos.3	Q2TAP0	OTTHUMG00000018869	ENST00000370602.1:c.196G>A	10.37:g.99623744G>A	ENSP00000359634:p.Ala66Thr	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	15.0	NM_001010917	Q5T4F5	Missense_Mutation	SNP	ENST00000370602.1	37	CCDS31265.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062979	0.76187	.	.	ENSG00000155265	ENST00000370602	.	.	.	5.18	5.18	0.71444	Golgin subfamily A member 7/ERF4 (1);	0.000000	0.85682	D	0.000000	D	0.84624	0.5513	M	0.88450	2.955	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.86875	0.2038	9	0.62326	D	0.03	-28.5351	17.6285	0.88099	0.0:0.0:1.0:0.0	.	66	Q2TAP0	GOG7B_HUMAN	T	66	.	ENSP00000359634:A66T	A	+	1	0	GOLGA7B	99613734	1.000000	0.71417	0.981000	0.43875	0.049000	0.14656	9.657000	0.98554	2.711000	0.92665	0.563000	0.77884	GCT	.		0.587	GOLGA7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049752.1	NM_001010917	
GPR116	221395	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46828555	46828555	+	Missense_Mutation	SNP	G	G	A	rs375753155		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:46828555G>A	ENST00000283296.7	-	16	2564	c.2276C>T	c.(2275-2277)gCg>gTg	p.A759V	GPR116_ENST00000545669.1_Missense_Mutation_p.A188V|GPR116_ENST00000265417.7_Missense_Mutation_p.A759V|GPR116_ENST00000362015.4_Missense_Mutation_p.A759V|GPR116_ENST00000456426.2_Missense_Mutation_p.A617V	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	759					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TTCATGTTCCGCTTTGTCTAT	0.428																																					p.A759V	NSCLC(59;410 1274 8751 36715 50546)	.											.	GPR116	91	0			c.C2276T						.	G	VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	128.0	124.0	126.0		2276,2276	-4.1	0.0	6		126	0,8600		0,0,4300	no	missense,missense	GPR116	NM_001098518.1,NM_015234.4	64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	759/1347,759/1347	46828555	1,13005	2203	4300	6503	SO:0001583	missense	221395	exon16			TGTTCCGCTTTGT	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2276C>T	6.37:g.46828555G>A	ENSP00000283296:p.Ala759Val	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	37.0	NM_015234	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	ENST00000283296.7	37	CCDS4919.1	.	.	.	.	.	.	.	.	.	.	G	4.745	0.138528	0.09083	2.27E-4	0.0	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.27402	1.73;2.11;1.73;1.73;1.67	5.68	-4.13	0.03904	.	1.380720	0.04734	N	0.421705	T	0.02304	0.0071	N	0.01576	-0.805	0.09310	N	1	B;B;B;B;B	0.15719	0.0;0.0;0.001;0.014;0.001	B;B;B;B;B	0.11329	0.001;0.001;0.0;0.006;0.0	T	0.28202	-1.0051	10	0.26408	T	0.33	-0.3707	0.8708	0.01213	0.4398:0.1117:0.165:0.2835	.	188;314;759;617;759	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	V	759;759;759;617;130;759;188	ENSP00000283296:A759V;ENSP00000354563:A759V;ENSP00000412866:A617V;ENSP00000265417:A759V;ENSP00000441581:A188V	ENSP00000265417:A759V	A	-	2	0	GPR116	46936514	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.357000	0.07651	-0.490000	0.06707	-1.119000	0.02030	GCG	.		0.428	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
GPR3	2827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	27720703	27720703	+	Missense_Mutation	SNP	G	G	C	rs372066479		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:27720703G>C	ENST00000374024.3	+	2	500	c.401G>C	c.(400-402)cGc>cCc	p.R134P		NM_005281.3	NP_005272.1	P46089	GPR3_HUMAN	G protein-coupled receptor 3	134					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|regulation of meiosis (GO:0040020)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(3)|ovary(1)|skin(1)	8		Breast(348;1.53e-05)|Ovarian(437;0.0606)|all_lung(284;0.157)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.81e-26)|Colorectal(126;1.24e-08)|KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;4.45e-06)|Lung(427;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|LUSC - Lung squamous cell carcinoma(448;0.008)|READ - Rectum adenocarcinoma(331;0.0419)		ACTGTCGACCGCTACCTTTCT	0.577																																					p.R134P		.											.	GPR3	91	0			c.G401C						.						150.0	138.0	142.0					1																	27720703		2203	4300	6503	SO:0001583	missense	2827	exon2			TCGACCGCTACCT	BC032702	CCDS303.1	1p36.1-p35	2012-08-21			ENSG00000181773	ENSG00000181773		"""GPCR / Class A : Orphans"""	4484	protein-coding gene	gene with protein product		600241				7851889	Standard	NM_005281		Approved	ACCA	uc001bod.4	P46089	OTTHUMG00000003397	ENST00000374024.3:c.401G>C	1.37:g.27720703G>C	ENSP00000363136:p.Arg134Pro	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	13.0	NM_005281	A8K570	Missense_Mutation	SNP	ENST00000374024.3	37	CCDS303.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005142	0.74932	.	.	ENSG00000181773	ENST00000374024	D	0.97161	-4.27	5.46	5.46	0.80206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.99165	0.9711	H	0.98111	4.15	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.98979	1.0804	10	0.87932	D	0	.	18.9204	0.92523	0.0:0.0:1.0:0.0	.	134	P46089	GPR3_HUMAN	P	134	ENSP00000363136:R134P	ENSP00000363136:R134P	R	+	2	0	GPR3	27593290	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.866000	0.99616	2.561000	0.86390	0.462000	0.41574	CGC	.		0.577	GPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009522.1	NM_005281	
GPR161	23432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	168054803	168054803	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:168054803T>G	ENST00000367838.1	-	8	1869	c.1556A>C	c.(1555-1557)gAa>gCa	p.E519A	GPR161_ENST00000361697.2_Missense_Mutation_p.E519A|GPR161_ENST00000367835.1_Missense_Mutation_p.E519A|GPR161_ENST00000546300.1_Missense_Mutation_p.E405A|GPR161_ENST00000367836.1_Missense_Mutation_p.E387A|GPR161_ENST00000539777.1_Missense_Mutation_p.E441A|GPR161_ENST00000271357.5_Missense_Mutation_p.E519A|GPR161_ENST00000537209.1_Missense_Mutation_p.E539A	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	519					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					ATCTCCTTCTTCGATGCTCTG	0.657																																					p.E539A		.											.	GPR161	90	0			c.A1616C						.						52.0	61.0	58.0					1																	168054803		2203	4300	6503	SO:0001583	missense	23432	exon7			CCTTCTTCGATGC	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.1556A>C	1.37:g.168054803T>G	ENSP00000356812:p.Glu519Ala	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	67.0	NM_001267609	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	37	CCDS1268.1	.	.	.	.	.	.	.	.	.	.	t	11.37	1.618595	0.28801	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;D;T;T;T;T;T	0.82344	-0.13;-0.13;-1.6;-0.13;-1.14;-1.12;-0.05;-0.13	5.75	1.89	0.25635	.	0.269080	0.40728	N	0.001024	T	0.57359	0.2048	N	0.22421	0.69	0.23758	N	0.996924	B;B;B;B;B	0.15141	0.0;0.0;0.001;0.0;0.012	B;B;B;B;B	0.15870	0.002;0.001;0.004;0.001;0.014	T	0.40040	-0.9584	9	0.51188	T	0.08	4.0E-4	13.125	0.59349	0.0:0.0:0.3801:0.6199	.	539;405;441;539;519	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8	.;.;.;.;GP161_HUMAN	A	519;519;387;519;405;441;539;519	ENSP00000356812:E519A;ENSP00000271357:E519A;ENSP00000356810:E387A;ENSP00000356809:E519A;ENSP00000444348:E405A;ENSP00000437576:E441A;ENSP00000441039:E539A;ENSP00000355194:E519A	ENSP00000271357:E519A	E	-	2	0	GPR161	166321427	0.999000	0.42202	0.008000	0.14137	0.257000	0.26127	3.938000	0.56583	0.052000	0.16007	0.524000	0.50904	GAA	.		0.657	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
GSE1	23199	broad.mit.edu;mdanderson.org	37	16	85667714	85667714	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:85667714G>A	ENST00000253458.7	+	2	378	c.202G>A	c.(202-204)Gcc>Acc	p.A68T	GSE1_ENST00000393243.1_Intron|GSE1_ENST00000405402.2_Intron	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	68																	GCGCAAGCTCGCCAAACAGGC	0.771																																					p.A68T		.											.	.	.	0			c.G202A						.						6.0	8.0	8.0					16																	85667714		1744	3587	5331	SO:0001583	missense	23199	exon2			AAGCTCGCCAAAC	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.202G>A	16.37:g.85667714G>A	ENSP00000253458:p.Ala68Thr	Somatic	21.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_014615	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	ENST00000253458.7	37	CCDS10952.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766732	0.90020	.	.	ENSG00000131149	ENST00000253458	T	0.62232	0.04	4.36	4.36	0.52297	.	0.000000	0.85682	U	0.000000	T	0.68943	0.3056	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.74548	-0.3629	10	0.87932	D	0	-19.3684	16.4885	0.84191	0.0:0.0:1.0:0.0	.	68	Q14687	GSE1_HUMAN	T	68	ENSP00000253458:A68T	ENSP00000253458:A68T	A	+	1	0	KIAA0182	84225215	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.679000	0.84048	1.975000	0.57531	0.313000	0.20887	GCC	.		0.771	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
GZMB	3002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	25101298	25101298	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr14:25101298T>A	ENST00000216341.4	-	4	472	c.366A>T	c.(364-366)agA>agT	p.R122S	GZMB_ENST00000382540.1_Missense_Mutation_p.R77S|GZMB_ENST00000382542.1_Missense_Mutation_p.R156S|GZMB_ENST00000415355.3_Missense_Mutation_p.R110S|RP11-104E19.1_ENST00000555300.1_RNA|RP11-104E19.1_ENST00000557736.1_RNA|GZMB_ENST00000526004.1_Missense_Mutation_p.E77V			P10144	GRAB_HUMAN	granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1)	122	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				apoptotic process (GO:0006915)|cytolysis (GO:0019835)|intrinsic apoptotic signaling pathway (GO:0097193)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(1)|lung(4)|stomach(4)|urinary_tract(2)	13				GBM - Glioblastoma multiforme(265;0.028)		GCTGCACAGCTCTGGTCCGCT	0.637																																					p.R122S		.											.	GZMB	514	0			c.A366T						.						53.0	51.0	52.0					14																	25101298		2203	4300	6503	SO:0001583	missense	3002	exon4			CACAGCTCTGGTC	BC030195	CCDS9633.1	14q11.2	2008-08-13			ENSG00000100453	ENSG00000100453			4709	protein-coding gene	gene with protein product	"""fragmentin 2"", ""cytotoxic serine protease B"", ""cathepsin G-like 1"", ""T-cell serine protease 1-3E"""	123910		CTLA1, CSPB		2323780	Standard	NM_004131		Approved	CCPI, CGL-1, CSP-B, CGL1, CTSGL1, HLP, SECT	uc001wps.2	P10144	OTTHUMG00000029369	ENST00000216341.4:c.366A>T	14.37:g.25101298T>A	ENSP00000216341:p.Arg122Ser	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	16.0	NM_004131	Q8N1D2|Q9UCC1	Missense_Mutation	SNP	ENST00000216341.4	37	CCDS9633.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	9.891|9.891	1.204238|1.204238	0.22205|0.22205	.|.	.|.	ENSG00000100453|ENSG00000100453	ENST00000526004|ENST00000415355;ENST00000216341;ENST00000382542;ENST00000382540;ENST00000382539	T|T;D;D;T	0.79554|0.92397	-1.28|0.37;-3.03;-3.03;1.66	5.3|5.3	-1.58|-1.58	0.08479|0.08479	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.|1.940520	.|0.03235	.|N	.|0.179487	T|T	0.78966|0.78966	0.4367|0.4367	N|N	0.10945|0.10945	0.07|0.07	0.18873|0.18873	N|N	0.999989|0.999989	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.06405	.|0.002;0.001	T|T	0.70037|0.70037	-0.4982|-0.4982	7|10	0.66056|0.07644	D|T	0.02|0.81	.|.	1.0882|1.0882	0.01658|0.01658	0.1426:0.2469:0.1479:0.4626|0.1426:0.2469:0.1479:0.4626	.|.	.|110;122	.|Q6XGZ4;P10144	.|.;GRAB_HUMAN	V|S	77|110;122;156;77;27	ENSP00000434213:E77V|ENSP00000387385:R110S;ENSP00000216341:R122S;ENSP00000371982:R156S;ENSP00000371980:R77S	ENSP00000434213:E77V|ENSP00000216341:R122S	E|R	-|-	2|3	0|2	GZMB|GZMB	24171138|24171138	0.000000|0.000000	0.05858|0.05858	0.024000|0.024000	0.17045|0.17045	0.019000|0.019000	0.09904|0.09904	-2.083000|-2.083000	0.01364|0.01364	-0.414000|-0.414000	0.07495|0.07495	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.		0.637	GZMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276540.3	NM_004131	
HERC1	8925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	63970246	63970246	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:63970246C>A	ENST00000443617.2	-	37	6955	c.6868G>T	c.(6868-6870)Gac>Tac	p.D2290Y	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2290					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TCTGAGAGGTCAGCGAGGCCA	0.527																																					p.D2290Y		.											.	HERC1	666	0			c.G6868T						.						148.0	156.0	153.0					15																	63970246		2084	4200	6284	SO:0001583	missense	8925	exon37			AGAGGTCAGCGAG	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.6868G>T	15.37:g.63970246C>A	ENSP00000390158:p.Asp2290Tyr	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	28.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109313	0.56398	.	.	ENSG00000103657	ENST00000443617	T	0.25912	1.77	5.6	5.6	0.85130	.	0.127571	0.50627	D	0.000102	T	0.28466	0.0704	L	0.34521	1.04	0.58432	D	0.999997	B	0.31790	0.34	B	0.37091	0.241	T	0.07328	-1.0778	10	0.87932	D	0	.	19.605	0.95577	0.0:1.0:0.0:0.0	.	2290	Q15751	HERC1_HUMAN	Y	2290	ENSP00000390158:D2290Y	ENSP00000390158:D2290Y	D	-	1	0	HERC1	61757299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.739000	0.62080	2.635000	0.89317	0.655000	0.94253	GAC	.		0.527	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HERC2P3	283755	broad.mit.edu;mdanderson.org	37	15	20644343	20644343	+	RNA	SNP	T	T	G	rs556053098	byFrequency	TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:20644343T>G	ENST00000428453.1	-	0	3220							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CAGCGAGGCCTGCGGGCACAC	0.652																																					.		.											.	HERC2P3	92	0			.						.						4.0	4.0	4.0					15																	20644343		1885	3589	5474			283755	.			GAGGCCTGCGGGC	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644343T>G		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	16.0	.		RNA	SNP	ENST00000428453.1	37																																																																																				.		0.652	HERC2P3-014	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000347772.2	NG_008269	
HERC1	8925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	63986548	63986548	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:63986548T>A	ENST00000443617.2	-	29	5530	c.5443A>T	c.(5443-5445)Agt>Tgt	p.S1815C	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1815					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AACCTTGTACTGGCCACTTTC	0.463																																					p.S1815C		.											.	HERC1	666	0			c.A5443T						.						64.0	62.0	62.0					15																	63986548		1945	4140	6085	SO:0001583	missense	8925	exon29			TTGTACTGGCCAC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.5443A>T	15.37:g.63986548T>A	ENSP00000390158:p.Ser1815Cys	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	13.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461780	0.63513	.	.	ENSG00000103657	ENST00000443617	T	0.34472	1.36	5.92	5.92	0.95590	.	0.190841	0.45867	D	0.000332	T	0.36082	0.0954	N	0.20986	0.625	0.58432	D	0.999991	D	0.56287	0.975	P	0.49708	0.62	T	0.10730	-1.0617	10	0.45353	T	0.12	.	16.3662	0.83325	0.0:0.0:0.0:1.0	.	1815	Q15751	HERC1_HUMAN	C	1815	ENSP00000390158:S1815C	ENSP00000390158:S1815C	S	-	1	0	HERC1	61773601	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.184000	0.72008	2.274000	0.75844	0.533000	0.62120	AGT	.		0.463	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HIST1H3I	8354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27839739	27839739	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:27839739T>G	ENST00000328488.2	-	1	360	c.355A>C	c.(355-357)Act>Cct	p.T119P		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	119					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGCATAATAGTGACGCGTTTG	0.572																																					p.T119P		.											.	HIST1H3I	91	0			c.A355C						.						131.0	142.0	138.0					6																	27839739		2203	4300	6503	SO:0001583	missense	8354	exon1			TAATAGTGACGCG	X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.355A>C	6.37:g.27839739T>G	ENSP00000329554:p.Thr119Pro	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	39.0	NM_003533	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000328488.2	37	CCDS4636.1	.	.	.	.	.	.	.	.	.	.	T	11.96	1.795799	0.31777	.	.	ENSG00000182572	ENST00000328488	T	0.75367	-0.93	4.12	4.12	0.48240	.	.	.	.	.	T	0.77485	0.4137	.	.	.	0.42515	D	0.992982	.	.	.	.	.	.	T	0.81337	-0.0978	6	0.87932	D	0	.	13.3331	0.60500	0.0:0.0:0.0:1.0	.	.	.	.	P	119	ENSP00000329554:T119P	ENSP00000329554:T119P	T	-	1	0	HIST1H3I	27947718	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	7.579000	0.82511	2.086000	0.62901	0.528000	0.53228	ACT	.		0.572	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1	NM_003533	
HIVEP2	3097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	143090697	143090697	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:143090697A>G	ENST00000367604.1	-	4	5818	c.5179T>C	c.(5179-5181)Ttt>Ctt	p.F1727L	HIVEP2_ENST00000367603.2_Missense_Mutation_p.F1727L|HIVEP2_ENST00000012134.2_Missense_Mutation_p.F1727L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1727					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		ACCTGAGTAAACTGCTTCCAA	0.388																																					p.F1727L	Esophageal Squamous(107;843 1510 13293 16805 42198)	.											.	HIVEP2	95	0			c.T5179C						.						93.0	85.0	88.0					6																	143090697		1864	4120	5984	SO:0001583	missense	3097	exon5			GAGTAAACTGCTT	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.5179T>C	6.37:g.143090697A>G	ENSP00000356576:p.Phe1727Leu	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	52.0	NM_006734	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	37	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	A	0.678	-0.799165	0.02841	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02280	4.36;4.36;4.36	5.79	4.65	0.58169	.	0.136027	0.64402	D	0.000002	T	0.00666	0.0022	N	0.21583	0.68	0.44373	D	0.997278	B	0.10296	0.003	B	0.09377	0.004	T	0.49214	-0.8963	10	0.10636	T	0.68	-15.9816	10.1907	0.43024	0.8691:0.0:0.1309:0.0	.	1727	P31629	ZEP2_HUMAN	L	1727	ENSP00000356576:F1727L;ENSP00000356575:F1727L;ENSP00000012134:F1727L	ENSP00000012134:F1727L	F	-	1	0	HIVEP2	143132390	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	4.327000	0.59247	2.208000	0.71279	0.533000	0.62120	TTT	.		0.388	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
HORMAD1	84072	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	150676627	150676627	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:150676627delT	ENST00000361824.2	-	12	1020	c.915delA	c.(913-915)aaafs	p.K305fs	RNU6-1042P_ENST00000384204.1_RNA|HORMAD1_ENST00000368993.2_Frame_Shift_Del_p.K305fs|HORMAD1_ENST00000368995.4_Frame_Shift_Del_p.K225fs|HORMAD1_ENST00000322343.7_Frame_Shift_Del_p.K298fs	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	305				K -> E (in Ref. 1; CAG38536). {ECO:0000305}.	blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			CTGGACTTTCTTTAGACCTCA	0.318																																					p.K305fs		.											.	HORMAD1	92	0			c.915delA						.						33.0	33.0	33.0					1																	150676627		2198	4294	6492	SO:0001589	frameshift_variant	84072	exon12			ACTTTCTTTAGAC	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.915delA	1.37:g.150676627delT	ENSP00000355167:p.Lys305fs	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	28.0	NM_032132	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Frame_Shift_Del	DEL	ENST00000361824.2	37	CCDS967.1																																																																																			.		0.318	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132	
HOXA11	3207	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	27224509	27224509	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:27224509C>A	ENST00000006015.3	-	1	326	c.255G>T	c.(253-255)gcG>gcT	p.A85A	RP1-170O19.14_ENST00000523331.1_lincRNA|HOXA11-AS_ENST00000520395.1_RNA|HOXA11-AS_ENST00000522674.1_RNA|HOXA11-AS_ENST00000479766.1_RNA|HOXA11-AS_ENST00000522863.1_RNA|HOXA11-AS_ENST00000520360.1_RNA	NM_005523.5	NP_005514.1	P31270	HXA11_HUMAN	homeobox A11	85					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal joint morphogenesis (GO:0060272)|male gonad development (GO:0008584)|mesodermal cell fate specification (GO:0007501)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|single fertilization (GO:0007338)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)	nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	16						CGAGCTCCTCCGCGGAGTAGC	0.677			T	NUP98	CML																																p.A85A		.		Dom	yes		7	7p15-p14.2	3207	homeo box A11		L	.	HOXA11	1082	0			c.G255T						.						40.0	46.0	44.0					7																	27224509		2203	4300	6503	SO:0001819	synonymous_variant	3207	exon1			CTCCTCCGCGGAG		CCDS5411.1	7p15.2	2014-09-17	2005-12-22		ENSG00000005073	ENSG00000005073		"""Homeoboxes / ANTP class : HOXL subclass"""	5101	protein-coding gene	gene with protein product		142958	"""homeo box A11"""	HOX1I, HOX1		1973146, 1358459	Standard	NM_005523		Approved		uc003syx.3	P31270	OTTHUMG00000023437	ENST00000006015.3:c.255G>T	7.37:g.27224509C>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	37.0	NM_005523	A4D190	Silent	SNP	ENST00000006015.3	37	CCDS5411.1	.	.	.	.	.	.	.	.	.	.	C	11.96	1.795895	0.31777	.	.	ENSG00000005073	ENST00000517402	.	.	.	5.49	0.966	0.19667	.	.	.	.	.	T	0.52370	0.1730	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40001	-0.9586	4	.	.	.	.	6.2155	0.20653	0.0:0.4812:0.2695:0.2493	.	.	.	.	L	55	.	.	R	-	2	0	HOXA11	27191034	0.994000	0.37717	1.000000	0.80357	0.996000	0.88848	0.344000	0.19962	0.249000	0.21456	0.650000	0.86243	CGG	.		0.677	HOXA11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000358754.1		
HPN	3249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35551262	35551262	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:35551262A>T	ENST00000262626.2	+	8	1291	c.466A>T	c.(466-468)Agg>Tgg	p.R156W	HPN-AS1_ENST00000392227.2_RNA|HPN_ENST00000392226.1_Missense_Mutation_p.R156W|HPN_ENST00000597419.1_Intron	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	156					basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	CTGTGGCCGCAGGAAGCTGCC	0.692																																					p.R156W		.											.	HPN	515	0			c.A466T						.						33.0	38.0	36.0					19																	35551262		2203	4298	6501	SO:0001583	missense	3249	exon8			GGCCGCAGGAAGC		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.466A>T	19.37:g.35551262A>T	ENSP00000262626:p.Arg156Trp	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	4.0	NM_182983	B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	37	CCDS32993.1	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727960	0.69074	.	.	ENSG00000105707	ENST00000262626;ENST00000392226;ENST00000541345	T;T	0.63744	-0.06;-0.06	4.68	1.25	0.21368	Peptidase cysteine/serine, trypsin-like (1);Speract/scavenger receptor-related (1);Hepsin, SRCR (1);	0.053179	0.64402	D	0.000001	T	0.67524	0.2902	L	0.36672	1.1	0.48901	D	0.999728	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.997	T	0.66089	-0.6010	10	0.87932	D	0	.	11.001	0.47604	0.5381:0.4619:0.0:0.0	.	128;156;156	B7Z1L4;B2ZDQ2;P05981	.;.;HEPS_HUMAN	W	156;156;128	ENSP00000262626:R156W;ENSP00000376060:R156W	ENSP00000262626:R156W	R	+	1	2	HPN	40243102	0.253000	0.23982	0.524000	0.27887	0.987000	0.75469	0.870000	0.28010	-0.024000	0.13941	0.454000	0.30748	AGG	.		0.692	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151	
HTR1B	3351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	78172967	78172967	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:78172967G>T	ENST00000369947.2	-	1	523	c.154C>A	c.(154-156)Ctg>Atg	p.L52M		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	52					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	AGCATAACCAGCAGTACTTTC	0.547																																					p.L52M		.											.	HTR1B	90	0			c.C154A						.						233.0	208.0	216.0					6																	78172967		2203	4300	6503	SO:0001583	missense	3351	exon1			TAACCAGCAGTAC	BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.154C>A	6.37:g.78172967G>T	ENSP00000358963:p.Leu52Met	Somatic	162.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	95.0	NM_000863	Q4VAY7	Missense_Mutation	SNP	ENST00000369947.2	37	CCDS4986.1	.	.	.	.	.	.	.	.	.	.	G	5.405	0.259832	0.10239	.	.	ENSG00000135312	ENST00000369947	T	0.00551	6.65	4.88	2.12	0.27331	.	0.179711	0.37095	N	0.002248	T	0.00178	0.0005	N	0.24115	0.695	0.46798	D	0.999205	P	0.36065	0.535	B	0.42959	0.403	T	0.71220	-0.4657	9	.	.	.	.	4.9734	0.14127	0.2463:0.1543:0.5994:0.0	.	52	P28222	5HT1B_HUMAN	M	52	ENSP00000358963:L52M	.	L	-	1	2	HTR1B	78229686	0.997000	0.39634	0.248000	0.24265	0.353000	0.29299	1.508000	0.35769	0.269000	0.21961	0.561000	0.74099	CTG	.		0.547	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041292.1	NM_000863	
IGFN1	91156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201196213	201196213	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:201196213G>T	ENST00000335211.4	+	23	11120	c.10990G>T	c.(10990-10992)Gac>Tac	p.D3664Y	IGFN1_ENST00000295591.8_3'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	1207						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTACAGCACTGACCTGCTGGG	0.652																																					p.D3664Y		.											.	IGFN1	71	0			c.G10990T						.						71.0	48.0	55.0					1																	201196213		2203	4300	6503	SO:0001583	missense	91156	exon23			AGCACTGACCTGC	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10990G>T	1.37:g.201196213G>T	ENSP00000334714:p.Asp3664Tyr	Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	225.0	72.0	NM_001164586	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.17|10.17	1.276300|1.276300	0.23307|0.23307	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000335211|ENST00000412892	T|.	0.66099|.	-0.19|.	5.06|5.06	2.14|2.14	0.27477|0.27477	.|.	0.115963|.	0.56097|.	D|.	0.000024|.	T|.	0.40347|.	0.1113|.	L|L	0.27944|0.27944	0.81|0.81	0.45676|0.45676	D|D	0.998599|0.998599	D|.	0.69078|.	0.997|.	D|.	0.79108|.	0.992|.	T|.	0.07385|.	-1.0775|.	10|.	0.87932|.	D|.	0|.	.|.	7.2076|7.2076	0.25915|0.25915	0.381:0.0:0.619:0.0|0.381:0.0:0.619:0.0	.|.	3664|.	F8WAI1|.	.|.	Y|L	3664|1081	ENSP00000334714:D3664Y|.	ENSP00000334714:D3664Y|.	D|X	+|+	1|2	0|2	IGFN1|IGFN1	199462836|199462836	0.936000|0.936000	0.31750|0.31750	0.009000|0.009000	0.14445|0.14445	0.014000|0.014000	0.08584|0.08584	1.765000|1.765000	0.38481|0.38481	0.173000|0.173000	0.19788|0.19788	0.561000|0.561000	0.74099|0.74099	GAC|TGA	.		0.652	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
IGLON5	402665	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51830988	51830988	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:51830988T>A	ENST00000270642.8	+	7	770	c.770T>A	c.(769-771)cTg>cAg	p.L257Q		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	257	Ig-like C2-type 3.					extracellular region (GO:0005576)				large_intestine(5)|lung(6)|prostate(1)	12						CCTGGCAGGCTGAGCAGCGGC	0.692																																					p.L257Q		.											.	.	.	0			c.T770A						.						8.0	8.0	8.0					19																	51830988		1912	4062	5974	SO:0001583	missense	402665	exon7			GCAGGCTGAGCAG		CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.770T>A	19.37:g.51830988T>A	ENSP00000270642:p.Leu257Gln	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_001101372		Missense_Mutation	SNP	ENST00000270642.8	37	CCDS46158.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.974130	0.92919	.	.	ENSG00000142549	ENST00000270642	T	0.18016	2.24	5.2	5.2	0.72013	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.392349	0.26549	N	0.023753	T	0.46698	0.1406	M	0.87328	2.875	0.44302	D	0.997171	D	0.89917	1.0	D	0.83275	0.996	T	0.53301	-0.8458	10	0.62326	D	0.03	-12.171	13.0257	0.58814	0.0:0.0:0.0:1.0	.	257	A6NGN9	IGLO5_HUMAN	Q	257	ENSP00000270642:L257Q	ENSP00000270642:L257Q	L	+	2	0	IGLON5	56522800	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.553000	0.67287	1.982000	0.57802	0.455000	0.32223	CTG	.		0.692	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335149.1	NM_001101372	
IGSF3	3321	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	117142910	117142910	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:117142910G>C	ENST00000369486.3	-	7	2447	c.1682C>G	c.(1681-1683)tCc>tGc	p.S561C	IGSF3_ENST00000369483.1_Missense_Mutation_p.S581C|IGSF3_ENST00000318837.6_Missense_Mutation_p.S581C	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	561	Ig-like C2-type 5.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CAAGTCAAAGGAGTCGCTGTA	0.592																																					p.S581C		.											.	IGSF3	92	0			c.C1742G						.						29.0	34.0	32.0					1																	117142910		2203	4298	6501	SO:0001583	missense	3321	exon8			TCAAAGGAGTCGC	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.1682C>G	1.37:g.117142910G>C	ENSP00000358498:p.Ser561Cys	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	19.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	37	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963270	0.74016	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.03272	3.99;3.99;3.99	4.57	4.57	0.56435	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.062103	0.64402	D	0.000003	T	0.06962	0.0177	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.984;0.999;0.991	T	0.24693	-1.0153	10	0.87932	D	0	-40.0587	14.8994	0.70666	0.0:0.0:1.0:0.0	.	581;561;581	O75054-2;O75054;A6NJZ6	.;IGSF3_HUMAN;.	C	561;581;581	ENSP00000358498:S561C;ENSP00000358495:S581C;ENSP00000321184:S581C	ENSP00000321184:S581C	S	-	2	0	IGSF3	116944433	1.000000	0.71417	0.980000	0.43619	0.861000	0.49209	9.017000	0.93651	2.354000	0.79902	0.455000	0.32223	TCC	.		0.592	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
IGSF6	10261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	21654919	21654919	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:21654919A>T	ENST00000268389.4	-	4	596	c.535T>A	c.(535-537)Tca>Aca	p.S179T	METTL9_ENST00000358154.3_Intron|RNU6-1005P_ENST00000384519.1_RNA|RNU6-196P_ENST00000384315.1_RNA|METTL9_ENST00000396014.4_Intron	NM_005849.3	NP_005840.2	O95976	IGSF6_HUMAN	immunoglobulin superfamily, member 6	179					cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)	integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(48;0.066)		TTGGATTTTGACTGCCAAGAA	0.318																																					p.S179T		.											.	IGSF6	68	0			c.T535A						.						105.0	94.0	98.0					16																	21654919		2199	4298	6497	SO:0001630	splice_region_variant	10261	exon4			ATTTTGACTGCCA	AJ223183	CCDS10599.1	16p12.2	2013-01-11			ENSG00000140749	ENSG00000140749		"""Immunoglobulin superfamily / V-set domain containing"""	5953	protein-coding gene	gene with protein product		606222				9809579	Standard	NM_005849		Approved	DORA	uc002djg.2	O95976	OTTHUMG00000090709	ENST00000268389.4:c.535-1T>A	16.37:g.21654919A>T		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	14.0	NM_005849	Q8WWD8	Missense_Mutation	SNP	ENST00000268389.4	37	CCDS10599.1	.	.	.	.	.	.	.	.	.	.	A	9.480	1.097861	0.20552	.	.	ENSG00000140749	ENST00000268389	T	0.24350	1.86	5.53	1.84	0.25277	.	0.995451	0.08146	N	0.990877	T	0.21631	0.0521	L	0.46157	1.445	0.28520	N	0.913107	B	0.28082	0.2	B	0.28385	0.089	T	0.33624	-0.9861	10	0.23302	T	0.38	-24.8375	6.3715	0.21483	0.5051:0.3483:0.0:0.1466	.	179	O95976	IGSF6_HUMAN	T	179	ENSP00000268389:S179T	ENSP00000268389:S179T	S	-	1	0	IGSF6	21562420	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	1.170000	0.31883	0.088000	0.17205	0.528000	0.53228	TCA	.		0.318	IGSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207400.1		Missense_Mutation
IL12RB1	3594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18186614	18186614	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:18186614C>A	ENST00000600835.2	-	8	943	c.645G>T	c.(643-645)ctG>ctT	p.L215L	IL12RB1_ENST00000593993.2_Silent_p.L215L|IL12RB1_ENST00000322153.7_Silent_p.L215L			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	215	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						CTTGGCTCCCCAGCTGCCGTC	0.582																																					p.L215L		.											.	IL12RB1	91	0			c.G645T	GRCh37	CI067578	IL12RB1	I		.						59.0	61.0	60.0					19																	18186614		2203	4300	6503	SO:0001819	synonymous_variant	3594	exon7			GCTCCCCAGCTGC	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.645G>T	19.37:g.18186614C>A		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	7.0	NM_153701	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Silent	SNP	ENST00000600835.2	37	CCDS54232.1																																																																																			.		0.582	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		
IL13RA2	3598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	114244204	114244204	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:114244204A>G	ENST00000371936.1	-	8	981	c.732T>C	c.(730-732)ctT>ctC	p.L244L	IL13RA2_ENST00000243213.1_Silent_p.L244L			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	244	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						GAGTAAAAGTAAGATAGACTG	0.398																																					p.L244L		.											.	IL13RA2	132	0			c.T732C						.						73.0	67.0	69.0					X																	114244204		2203	4300	6503	SO:0001819	synonymous_variant	3598	exon7			AAAAGTAAGATAG	X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.732T>C	X.37:g.114244204A>G		Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	25.0	NM_000640	A8K7E2|O00667	Silent	SNP	ENST00000371936.1	37	CCDS14565.1																																																																																			.		0.398	IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057966.1	NM_000640	
IL36G	56300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113742493	113742493	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:113742493G>T	ENST00000259205.4	+	5	446	c.377G>T	c.(376-378)aGg>aTg	p.R126M	IL36G_ENST00000376489.2_Missense_Mutation_p.R91M	NM_019618.2	NP_062564.1	Q9NZH8	IL36G_HUMAN	interleukin 36, gamma	126					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						AAGACTGGTAGGACCTCCACC	0.522																																					p.R126M		.											.	IL36G	91	0			c.G377T						.						142.0	126.0	131.0					2																	113742493		2203	4300	6503	SO:0001583	missense	56300	exon5			CTGGTAGGACCTC	AF200492	CCDS2108.1, CCDS62992.1	2q12-q21	2011-07-14	2011-06-06	2011-06-06	ENSG00000136688	ENSG00000136688		"""Interleukins and interleukin receptors"""	15741	protein-coding gene	gene with protein product	"""interleukin-1 homolog 1"", ""interleukin 1-related protein 2"", ""interleukin-1 epsilon"""	605542	"""interleukin 1 family, member 9"""	IL1F9		10860666, 10744718, 11991722, 11991723	Standard	NM_019618		Approved	IL-1H1, IL-1RP2, IL-1F9, IL1H1, IL1E	uc002tio.1	Q9NZH8	OTTHUMG00000131336	ENST00000259205.4:c.377G>T	2.37:g.113742493G>T	ENSP00000259205:p.Arg126Met	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	43.0	NM_019618	Q56B91|Q6UVX7|Q7RTZ9	Missense_Mutation	SNP	ENST00000259205.4	37	CCDS2108.1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745572	0.49151	.	.	ENSG00000136688	ENST00000376489;ENST00000259205	T;T	0.18016	2.24;2.27	4.52	0.409	0.16382	.	1.005840	0.07990	N	0.987024	T	0.31136	0.0787	L	0.59436	1.845	0.09310	N	1	D;D	0.61080	0.989;0.972	P;P	0.60345	0.769;0.873	T	0.21415	-1.0246	10	0.52906	T	0.07	-3.4433	7.9277	0.29885	0.0926:0.475:0.4323:0.0	.	91;126	Q9NZH8-2;Q9NZH8	.;IL36G_HUMAN	M	91;126	ENSP00000365672:R91M;ENSP00000259205:R126M	ENSP00000259205:R126M	R	+	2	0	IL36G	113458964	0.000000	0.05858	0.014000	0.15608	0.144000	0.21451	-0.118000	0.10692	-0.037000	0.13646	0.561000	0.74099	AGG	.		0.522	IL36G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330713.2	NM_019618	
IMPA1	3612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	82572837	82572837	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:82572837T>C	ENST00000256108.5	-	8	1097	c.632A>G	c.(631-633)tAt>tGt	p.Y211C	IMPA1_ENST00000523710.1_5'UTR|IMPA1_ENST00000449740.2_Missense_Mutation_p.Y270C|IMPA1_ENST00000311489.4_Missense_Mutation_p.I175V	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1	211					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	CATTTCATAATATGCATCTGC	0.413																																					p.Y270C		.											.	IMPA1	226	0			c.A809G						.						97.0	88.0	91.0					8																	82572837		2203	4299	6502	SO:0001583	missense	3612	exon9			TCATAATATGCAT		CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.632A>G	8.37:g.82572837T>C	ENSP00000256108:p.Tyr211Cys	Somatic	290.0	0.0		WXS	Illumina HiSeq	Phase_I	453.0	53.0	NM_001144878	B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Missense_Mutation	SNP	ENST00000256108.5	37	CCDS6231.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	19.47|19.47|19.47	3.834114|3.834114|3.834114	0.71373|0.71373|0.71373	.|.|.	.|.|.	ENSG00000133731|ENSG00000133731|ENSG00000133731	ENST00000523942|ENST00000311489|ENST00000256108;ENST00000449740	.|T|T;T	.|0.52295|0.60424	.|0.67|0.19;0.19	4.23|4.23|4.23	4.23|4.23|4.23	0.50019|0.50019|0.50019	.|.|.	.|.|0.127142	.|.|0.56097	.|.|D	.|.|0.000038	T|T|T	0.74756|0.74756|0.74756	0.3758|0.3758|0.3758	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|B|D;D	.|0.19331|0.89917	.|0.035|1.0;1.0	.|B|D;D	.|0.27380|0.75484	.|0.079|0.986;0.98	T|T|T	0.78229|0.78229|0.78229	-0.2285|-0.2285|-0.2285	4|8|9	.|0.25751|0.59425	.|T|D	.|0.34|0.04	-25.0445|-25.0445|-25.0445	13.5125|13.5125|13.5125	0.61522|0.61522|0.61522	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	.|175|270;211	.|B4DLN3|B7Z6Q4;P29218	.|.|.;IMPA1_HUMAN	M|V|C	235|175|211;270	.|ENSP00000311803:I175V|ENSP00000256108:Y211C;ENSP00000408526:Y270C	.|ENSP00000311803:I175V|ENSP00000256108:Y211C	I|I|Y	-|-|-	3|1|2	3|0|0	IMPA1|IMPA1|IMPA1	82735392|82735392|82735392	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.952000|0.952000|0.952000	0.39060|0.39060|0.39060	0.981000|0.981000|0.981000	0.71138|0.71138|0.71138	4.450000|4.450000|4.450000	0.60041|0.60041|0.60041	1.764000|1.764000|1.764000	0.52075|0.52075|0.52075	0.445000|0.445000|0.445000	0.29226|0.29226|0.29226	ATA|ATT|TAT	.		0.413	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379723.1		
IMPG2	50939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	100948247	100948247	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:100948247C>A	ENST00000193391.7	-	17	3797	c.3610G>T	c.(3610-3612)Gag>Tag	p.E1204*		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	1204					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TCACTGCTCTCATACATCTGT	0.537																																					p.E1204X		.											.	IMPG2	93	0			c.G3610T						.						159.0	138.0	145.0					3																	100948247		2203	4300	6503	SO:0001587	stop_gained	50939	exon17			TGCTCTCATACAT	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.3610G>T	3.37:g.100948247C>A	ENSP00000193391:p.Glu1204*	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	9.0	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Nonsense_Mutation	SNP	ENST00000193391.7	37	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	42	9.699379	0.99241	.	.	ENSG00000081148	ENST00000193391	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-13.6036	19.8965	0.96963	0.0:1.0:0.0:0.0	.	.	.	.	X	1204	.	ENSP00000193391:E1204X	E	-	1	0	IMPG2	102430937	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.451000	0.44952	2.717000	0.92951	0.655000	0.94253	GAG	.		0.537	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
IMPG2	50939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	100976471	100976471	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:100976471C>A	ENST00000193391.7	-	10	1242	c.1055G>T	c.(1054-1056)aGt>aTt	p.S352I		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	352	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	TCTGAAGTTACTGATTGTATA	0.433																																					p.S352I		.											.	IMPG2	93	0			c.G1055T						.						106.0	106.0	106.0					3																	100976471		2203	4300	6503	SO:0001583	missense	50939	exon10			AAGTTACTGATTG	AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1055G>T	3.37:g.100976471C>A	ENSP00000193391:p.Ser352Ile	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	60.0	NM_016247	A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	ENST00000193391.7	37	CCDS2940.1	.	.	.	.	.	.	.	.	.	.	C	17.54	3.415402	0.62511	.	.	ENSG00000081148	ENST00000193391	T	0.26223	1.75	5.51	1.45	0.22620	.	0.190595	0.47093	D	0.000247	T	0.23965	0.0580	L	0.56769	1.78	0.30623	N	0.758262	P;P	0.50272	0.933;0.933	B;B	0.42882	0.401;0.401	T	0.24584	-1.0156	10	0.72032	D	0.01	-2.9849	7.7492	0.28888	0.0:0.6073:0.2496:0.143	.	352;352	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	I	352	ENSP00000193391:S352I	ENSP00000193391:S352I	S	-	2	0	IMPG2	102459161	0.970000	0.33590	0.997000	0.53966	0.963000	0.63663	1.156000	0.31712	0.671000	0.31185	0.462000	0.41574	AGT	.		0.433	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353256.3		
INPPL1	3636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	71948760	71948760	+	Silent	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:71948760C>T	ENST00000298229.2	+	26	3676	c.3472C>T	c.(3472-3474)Ctg>Ttg	p.L1158L	PHOX2A_ENST00000544057.1_5'Flank|INPPL1_ENST00000538751.1_Silent_p.L916L|INPPL1_ENST00000541756.1_Silent_p.L916L	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1158					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CCCCCGGGGACTGCCCTCGGA	0.697																																					p.L1158L		.											.	INPPL1	660	0			c.C3472T						.						10.0	12.0	12.0					11																	71948760		2150	4245	6395	SO:0001819	synonymous_variant	3636	exon26			CGGGGACTGCCCT	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3472C>T	11.37:g.71948760C>T		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	25.0	NM_001567	B2RTX5|Q13577|Q13578	Silent	SNP	ENST00000298229.2	37	CCDS8213.1																																																																																			.		0.697	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	
ITIH6	347365	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	54783989	54783989	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:54783989G>C	ENST00000218436.6	-	8	2547	c.2518C>G	c.(2518-2520)Ctg>Gtg	p.L840V		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	840	Pro-rich.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CCAGGCCCCAGGTGTGGCATG	0.493																																					p.L840V		.											.	.	.	0			c.C2518G						.						107.0	101.0	103.0					X																	54783989		2203	4300	6503	SO:0001583	missense	347365	exon8			GCCCCAGGTGTGG	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.2518C>G	X.37:g.54783989G>C	ENSP00000218436:p.Leu840Val	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	47.0	NM_198510	A6NN03	Missense_Mutation	SNP	ENST00000218436.6	37	CCDS14361.1	.	.	.	.	.	.	.	.	.	.	G	0.045	-1.268525	0.01433	.	.	ENSG00000102313	ENST00000218436	T	0.02395	4.31	3.91	2.1	0.27182	.	9.083100	0.01492	U	0.017158	T	0.01976	0.0062	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.44982	-0.9292	10	0.16896	T	0.51	.	4.129	0.10141	0.2151:0.0:0.6028:0.1822	.	840	Q6UXX5	ITH5L_HUMAN	V	840	ENSP00000218436:L840V	ENSP00000218436:L840V	L	-	1	2	ITIH5L	54800714	0.051000	0.20477	0.001000	0.08648	0.013000	0.08279	0.962000	0.29280	0.061000	0.16311	0.466000	0.42574	CTG	.		0.493	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
JAKMIP1	152789	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6058425	6058425	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:6058425T>A	ENST00000282924.5	-	12	2191	c.1706A>T	c.(1705-1707)aAg>aTg	p.K569M	JAKMIP1_ENST00000409021.3_Splice_Site_p.K569M|JAKMIP1_ENST00000410077.2_Splice_Site_p.K404M|JAKMIP1_ENST00000409831.1_Splice_Site_p.K569M|JAKMIP1_ENST00000409371.3_Splice_Site_p.K384M	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	569	Mediates interaction with TYK2 and GABBR1.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GTCACGCACCTTTTCCAGCAA	0.552																																					p.K569M		.											.	JAKMIP1	292	0			c.A1706T						.						151.0	128.0	136.0					4																	6058425		2203	4300	6503	SO:0001630	splice_region_variant	152789	exon12			CGCACCTTTTCCA	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.1707+1A>T	4.37:g.6058425T>A		Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	6.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000282924.5	37	CCDS3385.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.546701	0.86022	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.41400	1.42;1.01;1.43;1.43;1.0	5.02	5.02	0.67125	.	0.000000	0.64402	D	0.000001	T	0.65995	0.2745	M	0.79926	2.475	0.53005	D	0.999967	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.87578	0.998;0.997;0.998;0.939	T	0.71636	-0.4533	10	0.87932	D	0	.	13.9543	0.64137	0.0:0.0:0.0:1.0	.	404;384;569;569	B4DHZ8;Q96N16-5;Q96N16-2;Q96N16	.;.;.;JKIP1_HUMAN	M	569;384;461;569;569;404	ENSP00000386711:K569M;ENSP00000387042:K384M;ENSP00000282924:K569M;ENSP00000386925:K569M;ENSP00000386745:K404M	ENSP00000282924:K569M	K	-	2	0	JAKMIP1	6109326	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.334000	0.79224	1.891000	0.54761	0.460000	0.39030	AAG	.		0.552	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246816.2	NM_144720	Missense_Mutation
JAKMIP2	9832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	147030071	147030071	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:147030071G>A	ENST00000265272.5	-	4	1134	c.667C>T	c.(667-669)Ctg>Ttg	p.L223L	JAKMIP2_ENST00000333010.6_Silent_p.L181L|JAKMIP2_ENST00000507386.1_Silent_p.L223L	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	223						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTTTTCCAGGGAAAAGATG	0.413																																					p.L223L		.											.	JAKMIP2	154	0			c.C667T						.						88.0	86.0	86.0					5																	147030071		2203	4300	6503	SO:0001819	synonymous_variant	9832	exon4			TTTCCAGGGAAAA	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.667C>T	5.37:g.147030071G>A		Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	51.0	NM_001270941	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Silent	SNP	ENST00000265272.5	37	CCDS4285.1																																																																																			.		0.413	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
JARID2	3720	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	15501254	15501254	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:15501254A>G	ENST00000341776.2	+	8	2306	c.2062A>G	c.(2062-2064)Aga>Gga	p.R688G	JARID2_ENST00000541660.1_Missense_Mutation_p.R650G|JARID2_ENST00000397311.3_Missense_Mutation_p.R516G	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	688	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.			R -> K (in Ref. 1; AAC50822). {ECO:0000305}.	central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GCGCATCCCCAGAACTGCCCA	0.582																																					p.R688G		.											.	JARID2	228	0			c.A2062G						.						71.0	80.0	77.0					6																	15501254		2203	4300	6503	SO:0001583	missense	3720	exon8			ATCCCCAGAACTG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.2062A>G	6.37:g.15501254A>G	ENSP00000341280:p.Arg688Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	9.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	37	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	A	15.22	2.767569	0.49574	.	.	ENSG00000008083	ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.62498	0.02;0.02;0.02	5.15	5.15	0.70609	ARID/BRIGHT DNA-binding domain (5);	0.138580	0.64402	D	0.000005	T	0.38241	0.1033	L	0.48642	1.525	0.32039	N	0.598512	P;B	0.36465	0.554;0.175	B;B	0.26770	0.073;0.037	T	0.52624	-0.8551	10	0.72032	D	0.01	-2.5951	14.9738	0.71254	1.0:0.0:0.0:0.0	.	650;688	F5H590;Q92833	.;JARD2_HUMAN	G	688;516;650	ENSP00000341280:R688G;ENSP00000380478:R516G;ENSP00000444623:R650G	ENSP00000341280:R688G	R	+	1	2	JARID2	15609233	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.836000	0.69375	1.941000	0.56285	0.459000	0.35465	AGA	.		0.582	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
KAL1	3730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	8503725	8503725	+	Silent	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:8503725A>T	ENST00000262648.3	-	12	1898	c.1749T>A	c.(1747-1749)acT>acA	p.T583T	KAL1_ENST00000481896.1_5'UTR	NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	583	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						CTTGAAACCCAGTCATGGGCT	0.502																																					p.T583T		.											.	KAL1	134	0			c.T1749A						.						121.0	92.0	102.0					X																	8503725		2203	4299	6502	SO:0001819	synonymous_variant	3730	exon12			AAACCCAGTCATG		CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.1749T>A	X.37:g.8503725A>T		Somatic	170.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	37.0	NM_000216	B2RPF8	Silent	SNP	ENST00000262648.3	37	CCDS14130.1																																																																																			.		0.502	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	
KCNJ14	3770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48967700	48967700	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:48967700T>C	ENST00000391884.1	+	2	1453	c.977T>C	c.(976-978)cTc>cCc	p.L326P	KCNJ14_ENST00000342291.2_Missense_Mutation_p.L326P|CTC-273B12.5_ENST00000596497.1_RNA|CTC-273B12.5_ENST00000600650.1_RNA|CTC-273B12.5_ENST00000593476.1_RNA|CTC-273B12.5_ENST00000600529.1_RNA|CTC-273B12.6_ENST00000597574.1_lincRNA|CTC-273B12.7_ENST00000595676.1_5'Flank			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14	326					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	GGTGAACTGCTCTGGGGCCAT	0.587																																					p.D326A	NSCLC(148;170 3504 35216)	.											.	KCNJ14	91	0			c.A977C						.						88.0	73.0	78.0					19																	48967700		2203	4300	6503	SO:0001583	missense	3770	exon3			AACTGCTCTGGGG	BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.977T>C	19.37:g.48967700T>C	ENSP00000375756:p.Leu326Pro	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	11.0	NM_013348		Missense_Mutation	SNP	ENST00000391884.1	37	CCDS12721.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.292364	0.80914	.	.	ENSG00000182324	ENST00000342291;ENST00000391884	D;D	0.95482	-3.72;-3.72	5.24	5.24	0.73138	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98372	0.9459	H	0.96015	3.755	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.99418	1.0932	10	0.87932	D	0	.	13.733	0.62799	0.0:0.0:0.0:1.0	.	326	Q9UNX9	IRK14_HUMAN	P	326	ENSP00000341479:L326P;ENSP00000375756:L326P	ENSP00000341479:L326P	L	+	2	0	KCNJ14	53659512	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.345000	0.52182	2.288000	0.76882	0.533000	0.62120	CTC	.		0.587	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466127.1	NM_013348	
KCNT1	57582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	138642869	138642869	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:138642869C>A	ENST00000263604.3	+	4	359	c.359C>A	c.(358-360)cCg>cAg	p.P120Q	KCNT1_ENST00000487664.1_Missense_Mutation_p.P91Q|KCNT1_ENST00000298480.5_Missense_Mutation_p.P139Q|KCNT1_ENST00000488444.2_Missense_Mutation_p.P120Q|KCNT1_ENST00000371757.2_Missense_Mutation_p.P139Q|KCNT1_ENST00000486577.2_Missense_Mutation_p.P100Q|KCNT1_ENST00000490355.2_Missense_Mutation_p.P120Q|KCNT1_ENST00000491806.2_Missense_Mutation_p.P106Q			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	120					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CTCGATGACCCGGCCCTGGGC	0.692																																					p.P139Q		.											.	KCNT1	137	0			c.C416A						.						74.0	66.0	69.0					9																	138642869		2203	4300	6503	SO:0001583	missense	57582	exon4			ATGACCCGGCCCT	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.359C>A	9.37:g.138642869C>A	ENSP00000263604:p.Pro120Gln	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	10.0	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	37		.	.	.	.	.	.	.	.	.	.	.	14.40	2.523120	0.44866	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T;T	0.44482	1.92;1.86;1.86;0.92;1.9	4.68	4.68	0.58851	.	0.070231	0.64402	D	0.000019	T	0.57080	0.2029	L	0.60455	1.87	0.80722	D	1	P;D	0.54601	0.935;0.967	P;D	0.63381	0.535;0.914	T	0.52358	-0.8586	10	0.23302	T	0.38	-34.6371	16.5626	0.84570	0.0:1.0:0.0:0.0	.	139;91	B9EGP2;G5E9V0	.;.	Q	91;139;139;86;100;106;120;120;120	ENSP00000417851:P91Q;ENSP00000298480:P139Q;ENSP00000360822:P139Q;ENSP00000420764:P86Q;ENSP00000263604:P120Q	ENSP00000263604:P120Q	P	+	2	0	KCNT1	137782690	0.997000	0.39634	0.920000	0.36463	0.014000	0.08584	3.610000	0.54125	2.149000	0.67028	0.561000	0.74099	CCG	.		0.692	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
KHSRP	8570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6416517	6416517	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:6416517A>G	ENST00000398148.3	-	14	1564	c.1472T>C	c.(1471-1473)aTc>aCc	p.I491T	MIR3940_ENST00000579148.1_RNA	NM_003685.2	NP_003676.2	Q92945	FUBP2_HUMAN	KH-type splicing regulatory protein	491	Gly-rich.|KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of miRNA metabolic process (GO:2000628)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|transcription, DNA-templated (GO:0006351)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|liver(1)|lung(6)|skin(1)|soft_tissue(1)	17						CTTTTCCTCGATAAGCTGCTT	0.582																																					p.I491T	Colon(55;593 1006 2067 9135 22980)	.											.	KHSRP	226	0			c.T1472C						.						30.0	32.0	32.0					19																	6416517		1887	4107	5994	SO:0001583	missense	8570	exon14			TCCTCGATAAGCT	U94832	CCDS45936.1	19p13.3	2010-11-23	2008-02-04		ENSG00000088247	ENSG00000088247			6316	protein-coding gene	gene with protein product	"""FUSE binding protein 2"""	603445				9136930, 8940189	Standard	NM_003685		Approved	KSRP, FBP2, FUBP2	uc002mer.4	Q92945		ENST00000398148.3:c.1472T>C	19.37:g.6416517A>G	ENSP00000381216:p.Ile491Thr	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	24.0	NM_003685	O00301|Q59EZ9|Q5U4P6|Q9UNT5|Q9UQH5	Missense_Mutation	SNP	ENST00000398148.3	37	CCDS45936.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.967133	0.53507	.	.	ENSG00000088247	ENST00000398148;ENST00000201886	T	0.74737	-0.87	5.21	5.21	0.72293	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.89801	0.6820	H	0.95780	3.72	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.92670	0.6149	10	0.87932	D	0	.	14.0772	0.64897	1.0:0.0:0.0:0.0	.	491	Q92945	FUBP2_HUMAN	T	491	ENSP00000381216:I491T	ENSP00000201886:I491T	I	-	2	0	KHSRP	6367517	1.000000	0.71417	0.952000	0.39060	0.766000	0.43426	9.022000	0.93678	1.963000	0.57068	0.533000	0.62120	ATC	.		0.582	KHSRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453305.1		
KEAP1	9817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10602745	10602745	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:10602745G>A	ENST00000171111.5	-	3	1380	c.833C>T	c.(832-834)cCg>cTg	p.P278L	KEAP1_ENST00000393623.2_Missense_Mutation_p.P278L|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'UTR	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	278	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CAGGAAGTTCGGCGTCAACGA	0.612																																					p.P278L		.											.	KEAP1	637	0			c.C833T						.						61.0	60.0	61.0					19																	10602745		2203	4300	6503	SO:0001583	missense	9817	exon3			AAGTTCGGCGTCA	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.833C>T	19.37:g.10602745G>A	ENSP00000171111:p.Pro278Leu	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	17.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	31	5.103735	0.94245	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.70516	-0.49;-0.49	5.61	5.61	0.85477	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	D	0.82595	0.5071	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	D	0.84027	0.0357	10	0.87932	D	0	.	17.1459	0.86766	0.0:0.0:1.0:0.0	.	278	Q14145	KEAP1_HUMAN	L	278	ENSP00000171111:P278L;ENSP00000377245:P278L	ENSP00000171111:P278L	P	-	2	0	KEAP1	10463745	1.000000	0.71417	0.951000	0.38953	0.987000	0.75469	7.675000	0.84002	2.656000	0.90262	0.561000	0.74099	CCG	.		0.612	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
KIAA1109	84162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	123185451	123185451	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:123185451A>C	ENST00000264501.4	+	45	7559	c.7186A>C	c.(7186-7188)Aac>Cac	p.N2396H	KIAA1109_ENST00000388738.3_Missense_Mutation_p.N2396H|KIAA1109_ENST00000455637.1_Missense_Mutation_p.N2396H			Q2LD37	K1109_HUMAN	KIAA1109	2396					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CTCAGATTTCAACACTGTCTT	0.398																																					p.N2396H		.											.	KIAA1109	80	0			c.A7186C						.						104.0	101.0	102.0					4																	123185451		1918	4132	6050	SO:0001583	missense	84162	exon43			GATTTCAACACTG	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.7186A>C	4.37:g.123185451A>C	ENSP00000264501:p.Asn2396His	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	16.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	ENST00000264501.4	37	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.3|26.3	4.724386|4.724386	0.89298|0.89298	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000419325	T;T;T|.	0.26518|.	2.33;2.33;1.73|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.000000|.	0.56097|.	U|.	0.000040|.	T|T	0.52108|0.52108	0.1714|0.1714	N|N	0.19112|0.19112	0.55|0.55	0.51767|0.51767	D|D	0.999937|0.999937	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.83275|.	0.996;0.996;0.994|.	T|T	0.49021|0.49021	-0.8982|-0.8982	10|5	0.42905|.	T|.	0.14|.	.|.	16.3782|16.3782	0.83418|0.83418	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	2396;2395;2396|.	Q2LD37-6;Q2LD37-2;Q2LD37|.	.;.;K1109_HUMAN|.	H|P	2396|353	ENSP00000264501:N2396H;ENSP00000373390:N2396H;ENSP00000389925:N2396H|.	ENSP00000264501:N2396H|.	N|Q	+|+	1|2	0|0	KIAA1109|KIAA1109	123404901|123404901	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.117000|9.117000	0.94347|0.94347	2.277000|2.277000	0.76020|0.76020	0.528000|0.528000	0.53228|0.53228	AAC|CAA	.		0.398	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
KIAA1211L	343990	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	99449345	99449345	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:99449345C>A	ENST00000397899.2	-	4	686	c.355G>T	c.(355-357)Gat>Tat	p.D119Y	KIAA1211L_ENST00000462314.1_Intron	NM_207362.2	NP_997245.2	Q6NV74	K121L_HUMAN	KIAA1211-like	119																	TTAATCCGATCACACACATTT	0.478																																					p.D119Y		.											.	.	.	0			c.G355T						.						224.0	234.0	231.0					2																	99449345		1916	4140	6056	SO:0001583	missense	343990	exon4			TCCGATCACACAC	BC068277	CCDS42720.1	2q11.2	2012-08-03	2012-08-03	2012-08-03	ENSG00000196872	ENSG00000196872			33454	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 55"""	C2orf55			Standard	NM_207362		Approved	MGC42367	uc002szf.1	Q6NV74	OTTHUMG00000153171	ENST00000397899.2:c.355G>T	2.37:g.99449345C>A	ENSP00000380996:p.Asp119Tyr	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	12.0	NM_207362		Missense_Mutation	SNP	ENST00000397899.2	37	CCDS42720.1	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890353	0.72524	.	.	ENSG00000196872	ENST00000397899;ENST00000423771;ENST00000428096;ENST00000415261	T	0.53640	0.61	4.96	4.96	0.65561	.	0.000000	0.49305	D	0.000155	T	0.66752	0.2821	M	0.63843	1.955	0.33945	D	0.643781	D	0.89917	1.0	D	0.81914	0.995	T	0.76291	-0.3013	10	0.72032	D	0.01	-13.0498	17.3797	0.87401	0.0:1.0:0.0:0.0	.	119	Q6NV74	CB055_HUMAN	Y	119;147;133;133	ENSP00000380996:D119Y	ENSP00000380996:D119Y	D	-	1	0	C2orf55	98815777	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.508000	0.67006	2.556000	0.86216	0.655000	0.94253	GAT	.		0.478	KIAA1211L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329933.1	NM_207362	
KIF26B	55083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	245850812	245850812	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:245850812C>A	ENST00000407071.2	+	12	4967	c.4527C>A	c.(4525-4527)gtC>gtA	p.V1509V	KIF26B_ENST00000366518.4_Silent_p.V1128V	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1509					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TCAGGAGGGTCGTGGATGGGT	0.637																																					p.V1509V		.											.	KIF26B	25	0			c.C4527A						.						31.0	37.0	35.0					1																	245850812		2120	4217	6337	SO:0001819	synonymous_variant	55083	exon12			GAGGGTCGTGGAT	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.4527C>A	1.37:g.245850812C>A		Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	117.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	ENST00000407071.2	37	CCDS44342.1																																																																																			.		0.637	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
KRT1	3848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	53073703	53073703	+	Missense_Mutation	SNP	C	C	A	rs557388955		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:53073703C>A	ENST00000252244.3	-	1	488	c.430G>T	c.(430-432)Ggt>Tgt	p.G144C		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	144	Gly/Phe/Ser-rich.|Head.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						CAGACAGGACCATAACCACCC	0.547													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15897	0.0		0.0	False		,,,				2504	0.0				p.G144C		.											.	KRT1	92	0			c.G430T						.						356.0	325.0	336.0					12																	53073703		2203	4300	6503	SO:0001583	missense	3848	exon1			CAGGACCATAACC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.430G>T	12.37:g.53073703C>A	ENSP00000252244:p.Gly144Cys	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	26.0	NM_006121	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732565	0.30684	.	.	ENSG00000167768	ENST00000252244	D	0.95821	-3.82	4.33	3.42	0.39159	.	.	.	.	.	D	0.97526	0.9190	M	0.86420	2.815	0.36679	D	0.878936	D	0.89917	1.0	D	0.77557	0.99	D	0.98630	1.0671	9	0.38643	T	0.18	.	13.1255	0.59351	0.0:0.8374:0.1626:0.0	.	144	P04264	K2C1_HUMAN	C	144	ENSP00000252244:G144C	ENSP00000252244:G144C	G	-	1	0	KRT1	51359970	0.028000	0.19301	0.470000	0.27216	0.793000	0.44817	1.691000	0.37721	0.941000	0.37499	0.448000	0.29417	GGT	.		0.547	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
KNTC1	9735	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123086099	123086099	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:123086099A>G	ENST00000333479.7	+	45	4757	c.4580A>G	c.(4579-4581)tAt>tGt	p.Y1527C	KNTC1_ENST00000436959.3_5'Flank|KNTC1_ENST00000450485.2_Intron|KNTC1_ENST00000537348.1_5'Flank|KNTC1_ENST00000545065.1_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1527					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		CCTTATGACTATGAAATGATT	0.254																																					p.Y1527C		.											.	KNTC1	543	0			c.A4580G						.						49.0	45.0	47.0					12																	123086099		1547	3476	5023	SO:0001583	missense	9735	exon45			ATGACTATGAAAT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.4580A>G	12.37:g.123086099A>G	ENSP00000328236:p.Tyr1527Cys	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	4.0	NM_014708	A7E2C4|B3KSG2	Missense_Mutation	SNP	ENST00000333479.7	37	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.035899	0.75617	.	.	ENSG00000184445	ENST00000333479;ENST00000423927	T;T	0.73152	-0.72;-0.25	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.82250	0.4996	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84046	0.0367	10	0.87932	D	0	-19.0405	15.1478	0.72671	1.0:0.0:0.0:0.0	.	1527	P50748	KNTC1_HUMAN	C	1527;86	ENSP00000328236:Y1527C;ENSP00000397140:Y86C	ENSP00000328236:Y1527C	Y	+	2	0	KNTC1	121652052	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.386000	0.79775	2.230000	0.72887	0.528000	0.53228	TAT	.		0.254	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		
KRT31	3881	hgsc.bcm.edu;mdanderson.org	37	17	39553767	39553767	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:39553767T>A	ENST00000251645.2	-	1	77	c.25A>T	c.(25-27)Agc>Tgc	p.S9C		NM_002277.2	NP_002268.2	Q15323	K1H1_HUMAN	keratin 31	9	Head.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	31		Breast(137;0.000496)				CAGCTCAGGCTGGGCAGGCAG	0.652																																					p.S9C		.											.	KRT31	90	0			c.A25T						.						15.0	18.0	17.0					17																	39553767		2192	4286	6478	SO:0001583	missense	3881	exon1			TCAGGCTGGGCAG	X86570	CCDS11391.1	17q21.2	2014-05-20	2006-07-17	2006-07-17	ENSG00000094796	ENSG00000094796		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6448	protein-coding gene	gene with protein product	"""hard keratin type I 1"""	601077	"""keratin, hair, acidic, 1"""	KRTHA1		7578244, 16831889	Standard	NM_002277		Approved	Ha-1	uc002hwn.3	Q15323	OTTHUMG00000133423	ENST00000251645.2:c.25A>T	17.37:g.39553767T>A	ENSP00000251645:p.Ser9Cys	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	16.0	NM_002277	Q9UE12	Missense_Mutation	SNP	ENST00000251645.2	37	CCDS11391.1	.	.	.	.	.	.	.	.	.	.	t	11.12	1.546548	0.27652	.	.	ENSG00000094796	ENST00000251645	D	0.83335	-1.71	5.82	3.62	0.41486	.	0.710043	0.14100	N	0.341450	D	0.83376	0.5241	M	0.76170	2.325	0.21105	N	0.999784	B	0.33448	0.412	B	0.40101	0.319	T	0.75679	-0.3234	10	0.87932	D	0	.	7.2684	0.26242	0.0:0.3291:0.0:0.6709	.	9	Q15323	K1H1_HUMAN	C	9	ENSP00000251645:S9C	ENSP00000251645:S9C	S	-	1	0	KRT31	36807293	0.634000	0.27190	0.818000	0.32626	0.345000	0.29048	0.815000	0.27253	0.493000	0.27837	0.533000	0.62120	AGC	.		0.652	KRT31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257286.1	NM_002277	
KRT19	3880	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	39684180	39684180	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:39684180T>C	ENST00000361566.3	-	1	380	c.320A>G	c.(319-321)gAg>gGg	p.E107G		NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	107	Coil 1A.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				CACCTCTAGCTCGCCGTTGGC	0.652																																					p.E107G		.											.	KRT19	90	0			c.A320G						.						47.0	54.0	51.0					17																	39684180		2203	4299	6502	SO:0001583	missense	3880	exon1			TCTAGCTCGCCGT		CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.320A>G	17.37:g.39684180T>C	ENSP00000355124:p.Glu107Gly	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	18.0	NM_002276	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Missense_Mutation	SNP	ENST00000361566.3	37	CCDS11399.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.337675	0.60963	.	.	ENSG00000171345	ENST00000361566;ENST00000455635	D;D	0.89415	-2.51;-2.12	4.83	4.83	0.62350	Filament (1);	0.274046	0.25759	N	0.028491	D	0.86952	0.6057	M	0.66297	2.02	0.27078	N	0.963164	B	0.10296	0.003	B	0.13407	0.009	T	0.80750	-0.1243	10	0.62326	D	0.03	.	10.8182	0.46589	0.0:0.0777:0.0:0.9223	.	107	P08727	K1C19_HUMAN	G	107	ENSP00000355124:E107G;ENSP00000408759:E107G	ENSP00000355124:E107G	E	-	2	0	KRT19	36937706	0.548000	0.26473	1.000000	0.80357	0.991000	0.79684	3.253000	0.51469	1.933000	0.56026	0.379000	0.24179	GAG	.		0.652	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257285.1	NM_002276	
KRT71	112802	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	52938508	52938508	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:52938508A>C	ENST00000267119.5	-	9	1449	c.1380T>G	c.(1378-1380)agT>agG	p.S460R		NM_033448.2	NP_258259.1	Q3SY84	K2C71_HUMAN	keratin 71	460	Tail.				hair follicle morphogenesis (GO:0031069)|intermediate filament organization (GO:0045109)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	22				BRCA - Breast invasive adenocarcinoma(357;0.194)		CACTGCCGCCACTGGTGCTGC	0.627																																					p.S460R		.											.	KRT71	92	0			c.T1380G						.						18.0	16.0	17.0					12																	52938508		2163	4240	6403	SO:0001583	missense	112802	exon9			GCCGCCACTGGTG	AJ308600	CCDS8831.1	12q13.13	2013-01-16			ENSG00000139648	ENSG00000139648		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28927	protein-coding gene	gene with protein product		608245				11982755, 12648212, 16831889	Standard	NM_033448		Approved	KRT6IRS, KRT6IRS1, K6IRS1	uc001sao.3	Q3SY84	OTTHUMG00000167831	ENST00000267119.5:c.1380T>G	12.37:g.52938508A>C	ENSP00000267119:p.Ser460Arg	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	22.0	7.0	NM_033448	B3KVC1|Q3SY85|Q96DU2	Missense_Mutation	SNP	ENST00000267119.5	37	CCDS8831.1	.	.	.	.	.	.	.	.	.	.	A	12.58	1.979847	0.34942	.	.	ENSG00000139648	ENST00000267119	D	0.81659	-1.52	4.16	-4.95	0.03048	.	0.000000	0.43579	U	0.000544	T	0.74053	0.3666	L	0.53249	1.67	0.31237	N	0.695594	D	0.56746	0.977	P	0.50192	0.634	T	0.75587	-0.3266	10	0.09338	T	0.73	.	12.419	0.55510	0.8442:0.0:0.1558:0.0	.	460	Q3SY84	K2C71_HUMAN	R	460	ENSP00000267119:S460R	ENSP00000267119:S460R	S	-	3	2	KRT71	51224775	0.009000	0.17119	0.314000	0.25224	0.630000	0.37929	-0.695000	0.05109	-0.772000	0.04602	-0.232000	0.12228	AGT	.		0.627	KRT71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396487.1	NM_033448	
L3MBTL3	84456	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	130415451	130415451	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:130415451T>C	ENST00000529410.1	+	20	2154	c.1675T>C	c.(1675-1677)Tca>Cca	p.S559P	L3MBTL3_ENST00000361794.2_Missense_Mutation_p.S559P|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.S534P|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.S534P|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.S559P|L3MBTL3_ENST00000526019.1_Missense_Mutation_p.S534P			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	559					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		TGGTGGATGCTCAACCCCGGG	0.448																																					p.S559P		.											.	L3MBTL3	96	0			c.T1675C						.						83.0	80.0	81.0					6																	130415451		2203	4300	6503	SO:0001583	missense	84456	exon18			GGATGCTCAACCC	AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1675T>C	6.37:g.130415451T>C	ENSP00000431962:p.Ser559Pro	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	10.0	NM_032438	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	37	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	T	5.288	0.238493	0.10023	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.11385	2.81;2.78;2.81;2.78;2.78;2.81	5.81	-2.75	0.05914	.	0.171080	0.52532	N	0.000067	T	0.00384	0.0012	N	0.00143	-2	0.25394	N	0.988506	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35699	-0.9778	10	0.02654	T	1	.	3.9649	0.09426	0.4596:0.3132:0.0:0.2272	.	534;559	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	P	559;534;559;534;534;559	ENSP00000431962:S559P;ENSP00000437185:S534P;ENSP00000354526:S559P;ENSP00000357121:S534P;ENSP00000436706:S534P;ENSP00000357118:S559P	ENSP00000354526:S559P	S	+	1	0	L3MBTL3	130457144	0.997000	0.39634	0.950000	0.38849	0.840000	0.47671	0.544000	0.23253	-0.101000	0.12219	0.528000	0.53228	TCA	.		0.448	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074	
LAMA5	3911	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	60890246	60890246	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:60890246T>C	ENST00000252999.3	-	59	7951	c.7885A>G	c.(7885-7887)Atc>Gtc	p.I2629V		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2629	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCATGTGCGATCTTCTTGCTT	0.637																																					p.I2629V		.											.	LAMA5	93	0			c.A7885G						.						36.0	37.0	36.0					20																	60890246		2196	4288	6484	SO:0001583	missense	3911	exon59			GTGCGATCTTCTT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7885A>G	20.37:g.60890246T>C	ENSP00000252999:p.Ile2629Val	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	8.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	t	15.63	2.891056	0.52014	.	.	ENSG00000130702	ENST00000252999	T	0.20200	2.09	4.02	2.87	0.33458	.	0.113197	0.56097	U	0.000025	T	0.17152	0.0412	L	0.44542	1.39	0.80722	D	1	B	0.26363	0.147	B	0.24701	0.055	T	0.04413	-1.0953	10	0.39692	T	0.17	.	9.2461	0.37527	0.0:0.0:0.183:0.817	.	2629	O15230	LAMA5_HUMAN	V	2629	ENSP00000252999:I2629V	ENSP00000252999:I2629V	I	-	1	0	LAMA5	60323641	0.016000	0.18221	0.963000	0.40424	0.649000	0.38597	0.544000	0.23253	0.403000	0.25479	0.375000	0.23000	ATC	.		0.637	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
LAMB2	3913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49166551	49166551	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:49166551G>C	ENST00000418109.1	-	14	1797	c.1633C>G	c.(1633-1635)Cag>Gag	p.Q545E	LAMB2_ENST00000305544.4_Missense_Mutation_p.Q545E	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	545	Laminin EGF-like 5; truncated. {ECO:0000255|PROSITE-ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACCATGTGCTGGCGGCAGTGG	0.582																																					p.Q545E		.											.	LAMB2	93	0			c.C1633G						.						73.0	67.0	69.0					3																	49166551		2203	4300	6503	SO:0001583	missense	3913	exon13			TGTGCTGGCGGCA		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1633C>G	3.37:g.49166551G>C	ENSP00000388325:p.Gln545Glu	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	26.0	NM_002292	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	9.192	1.026250	0.19512	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.59906	0.23;0.23	5.27	4.34	0.51931	EGF-like, laminin (3);EGF-like region, conserved site (1);	0.296128	0.33217	N	0.005144	T	0.22126	0.0533	N	0.00677	-1.265	0.30083	N	0.809	B	0.21309	0.054	B	0.19148	0.024	T	0.15037	-1.0451	10	0.09843	T	0.71	.	11.178	0.48612	0.0:0.0:0.6447:0.3553	.	545	P55268	LAMB2_HUMAN	E	545	ENSP00000388325:Q545E;ENSP00000307156:Q545E	ENSP00000307156:Q545E	Q	-	1	0	LAMB2	49141555	0.854000	0.29725	0.999000	0.59377	0.985000	0.73830	1.538000	0.36094	2.465000	0.83290	0.655000	0.94253	CAG	.		0.582	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
LATS2	26524	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	21549409	21549409	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr13:21549409T>A	ENST00000382592.4	-	8	3272	c.2867A>T	c.(2866-2868)gAc>gTc	p.D956V	LATS2_ENST00000542899.1_Missense_Mutation_p.D956V	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CAGGCGGTGGTCTGCGGAGCA	0.627																																					p.D956V		.											.	LATS2	1404	0			c.A2867T						.						46.0	48.0	47.0					13																	21549409		2203	4300	6503	SO:0001583	missense	26524	exon8			CGGTGGTCTGCGG	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.2867A>T	13.37:g.21549409T>A	ENSP00000372035:p.Asp956Val	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	25.0	NM_014572		Missense_Mutation	SNP	ENST00000382592.4	37	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461274	0.43736	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.64438	-0.1;-0.1	5.96	5.96	0.96718	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.255793	0.32593	N	0.005898	T	0.57125	0.2032	L	0.28274	0.84	0.80722	D	1	P	0.45212	0.853	P	0.45138	0.471	T	0.62895	-0.6757	10	0.87932	D	0	.	16.4338	0.83864	0.0:0.0:0.0:1.0	.	956	Q9NRM7	LATS2_HUMAN	V	956	ENSP00000372035:D956V;ENSP00000441817:D956V	ENSP00000372035:D956V	D	-	2	0	LATS2	20447409	1.000000	0.71417	0.242000	0.24170	0.239000	0.25481	6.198000	0.72106	2.270000	0.75569	0.533000	0.62120	GAC	.		0.627	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044102.1		
LFNG	3955	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2565185	2565185	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:2565185T>A	ENST00000222725.5	+	4	739	c.719T>A	c.(718-720)gTc>gAc	p.V240D	MIR4648_ENST00000580107.1_RNA|LFNG_ENST00000338732.3_Missense_Mutation_p.V111D|LFNG_ENST00000402506.1_Missense_Mutation_p.V169D|LFNG_ENST00000359574.3_Missense_Mutation_p.V240D|LFNG_ENST00000402045.1_Missense_Mutation_p.V111D	NM_001040167.1	NP_001035257.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	240					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		ATGGAGCGGGTCAGCGAGAAC	0.726																																					p.V240D		.											.	LFNG	636	0			c.T719A						.						33.0	33.0	33.0					7																	2565185		2199	4298	6497	SO:0001583	missense	3955	exon4			AGCGGGTCAGCGA	BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	ENST00000222725.5:c.719T>A	7.37:g.2565185T>A	ENSP00000222725:p.Val240Asp	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	13.0	NM_001040167	B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Missense_Mutation	SNP	ENST00000222725.5	37	CCDS34587.1	.	.	.	.	.	.	.	.	.	.	T	11.68	1.712092	0.30322	.	.	ENSG00000106003	ENST00000402506;ENST00000402045;ENST00000338732;ENST00000222725;ENST00000359574	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04	4.95	4.95	0.65309	.	0.386317	0.28343	N	0.015682	T	0.58850	0.2151	L	0.56199	1.76	0.58432	D	0.999998	B;B	0.24721	0.08;0.11	B;B	0.28553	0.017;0.091	T	0.56189	-0.8020	10	0.30854	T	0.27	-17.9401	14.6327	0.68668	0.0:0.0:0.0:1.0	.	240;240	Q8NES3-3;Q8NES3	.;LFNG_HUMAN	D	169;111;111;240;240	ENSP00000385764:V169D;ENSP00000384786:V111D;ENSP00000343095:V111D;ENSP00000222725:V240D;ENSP00000352579:V240D	ENSP00000222725:V240D	V	+	2	0	LFNG	2531711	1.000000	0.71417	0.032000	0.17829	0.679000	0.39708	7.463000	0.80869	1.871000	0.54225	0.459000	0.35465	GTC	.		0.726	LFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325021.1	NM_002304	
LIPE	3991	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	42906917	42906917	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:42906917C>T	ENST00000244289.4	-	9	3085	c.2809G>A	c.(2809-2811)Gtc>Atc	p.V937I	LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000599276.1_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	937					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				GCGGCACGGACGCCCAGGCCT	0.602																																					p.V937I		.											.	LIPE	154	0			c.G2809A						.						73.0	61.0	65.0					19																	42906917		2203	4300	6503	SO:0001583	missense	3991	exon9			CACGGACGCCCAG	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.2809G>A	19.37:g.42906917C>T	ENSP00000244289:p.Val937Ile	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	4.0	NM_005357	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	C	13.86	2.363307	0.41902	.	.	ENSG00000079435	ENST00000244289	T	0.03330	3.97	5.31	-7.28	0.01456	.	1.475450	0.04620	N	0.401831	T	0.01800	0.0057	N	0.14661	0.345	0.09310	N	1	B	0.19583	0.037	B	0.15052	0.012	T	0.45848	-0.9233	10	0.30078	T	0.28	-4.8299	0.3575	0.00359	0.2233:0.1814:0.2458:0.3495	.	937	Q05469	LIPS_HUMAN	I	937	ENSP00000244289:V937I	ENSP00000244289:V937I	V	-	1	0	LIPE	47598757	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.972000	0.03802	-0.856000	0.04120	0.591000	0.81541	GTC	.		0.602	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1	NM_005357	
LIPI	149998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	15537598	15537598	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr21:15537598T>A	ENST00000536861.1	-	6	846	c.847A>T	c.(847-849)Act>Tct	p.T283S	LIPI_ENST00000344577.2_Missense_Mutation_p.T304S			Q6XZB0	LIPI_HUMAN	lipase, member I	283					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		CATAAGCTAGTCTTGTAATCT	0.338																																					p.T304S		.											.	LIPI	70	0			c.A910T						.						95.0	92.0	93.0					21																	15537598		2203	4300	6503	SO:0001583	missense	149998	exon6			AGCTAGTCTTGTA	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.847A>T	21.37:g.15537598T>A	ENSP00000440381:p.Thr283Ser	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	32.0	NM_198996	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.301|8.301	0.819954|0.819954	0.16678|0.16678	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000400211|ENST00000344577;ENST00000536861;ENST00000382981	.|D;D	.|0.89746	.|-2.56;-2.56	5.73|5.73	-0.758|-0.758	0.11049|0.11049	.|.	.|1.158660	.|0.06041	.|N	.|0.654905	T|T	0.71736|0.71736	0.3375|0.3375	N|N	0.02665|0.02665	-0.54|-0.54	0.09310|0.09310	N|N	1|1	.|B;B	.|0.10296	.|0.003;0.001	.|B;B	.|0.11329	.|0.006;0.006	T|T	0.58233|0.58233	-0.7672|-0.7672	5|10	.|0.10636	.|T	.|0.68	.|.	9.3844|9.3844	0.38333|0.38333	0.0:0.3968:0.0:0.6032|0.0:0.3968:0.0:0.6032	.|.	.|253;304	.|G1JSG6;Q6XZB0-2	.|.;.	V|S	132|304;283;148	.|ENSP00000343331:T304S;ENSP00000440381:T283S	.|ENSP00000343331:T304S	D|T	-|-	2|1	0|0	LIPI|LIPI	14459469|14459469	0.003000|0.003000	0.15002|0.15002	0.206000|0.206000	0.23566|0.23566	0.911000|0.911000	0.54048|0.54048	0.568000|0.568000	0.23623|0.23623	-0.276000|-0.276000	0.09206|0.09206	-0.274000|-0.274000	0.10170|0.10170	GAC|ACT	.		0.338	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
LIPI	149998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	15537634	15537634	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr21:15537634T>G	ENST00000536861.1	-	6	810	c.811A>C	c.(811-813)Att>Ctt	p.I271L	LIPI_ENST00000344577.2_Missense_Mutation_p.I292L			Q6XZB0	LIPI_HUMAN	lipase, member I	271					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|phospholipase activity (GO:0004620)			endometrium(1)|kidney(13)|large_intestine(9)|liver(3)|lung(24)|ovary(3)|urinary_tract(1)	54				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.0015)|Colorectal(24;0.00693)|Lung(58;0.166)		GGAAATGAAATAAAATTGCAG	0.353																																					p.I292L		.											.	LIPI	70	0			c.A874C						.						86.0	86.0	86.0					21																	15537634		2203	4299	6502	SO:0001583	missense	149998	exon6			ATGAAATAAAATT	BC028732	CCDS13564.1	21q11.2	2012-07-31			ENSG00000188992	ENSG00000188992			18821	protein-coding gene	gene with protein product	"""membrane-associated phospholipase A1 beta"", ""cancer/testis antigen 17"""	609252				12719377	Standard	XM_005260924		Approved	PRED5, LPDL, CT17, mPA-PLA1beta, PLA1C	uc002yjm.3	Q6XZB0	OTTHUMG00000074258	ENST00000536861.1:c.811A>C	21.37:g.15537634T>G	ENSP00000440381:p.Ile271Leu	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	38.0	NM_198996	G1JSG3|G1JSG4|G1JSG5|G1JSG6|G1JSG7|G1JSG8|G1JSG9	Missense_Mutation	SNP	ENST00000536861.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.17|14.17	2.456127|2.456127	0.43634|0.43634	.|.	.|.	ENSG00000188992|ENSG00000188992	ENST00000344577;ENST00000536861;ENST00000382981|ENST00000400211	D;D|.	0.90324|.	-2.65;-2.65|.	5.73|5.73	2.22|2.22	0.28083|0.28083	.|.	0.360153|.	0.32563|.	N|.	0.005923|.	T|T	0.25865|0.25865	0.0630|0.0630	N|N	0.25890|0.25890	0.77|0.77	0.20307|0.20307	N|N	0.999916|0.999916	B;B|.	0.31383|.	0.321;0.321|.	B;B|.	0.34652|.	0.187;0.132|.	T|T	0.23154|0.23154	-1.0196|-1.0196	10|5	0.14656|.	T|.	0.56|.	.|.	7.4006|7.4006	0.26962|0.26962	0.0:0.2458:0.0:0.7542|0.0:0.2458:0.0:0.7542	.|.	241;292|.	G1JSG6;Q6XZB0-2|.	.;.|.	L|S	292;271;136|120	ENSP00000343331:I292L;ENSP00000440381:I271L|.	ENSP00000343331:I292L|.	I|Y	-|-	1|2	0|0	LIPI|LIPI	14459505|14459505	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.067000|1.067000	0.30616|0.30616	0.204000|0.204000	0.20548|0.20548	0.528000|0.528000	0.53228|0.53228	ATT|TAT	.		0.353	LIPI-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_198996	
LMX1B	4010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	129458665	129458665	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:129458665C>A	ENST00000373474.4	+	8	1151	c.1144C>A	c.(1144-1146)Cag>Aag	p.Q382K	LMX1B_ENST00000526117.1_Missense_Mutation_p.Q375K|LMX1B_ENST00000425646.2_Missense_Mutation_p.Q352K|LMX1B_ENST00000355497.5_Missense_Mutation_p.Q386K|LMX1B_ENST00000561065.1_Missense_Mutation_p.Q363K			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	382					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						GGGCTCCCTGCAGGCCCGCGT	0.647									Nail-Patella Syndrome																												p.Q386K	Pancreas(110;1796 2278 18357 20466)	.											.	LMX1B	90	0			c.C1156A						.						106.0	109.0	108.0					9																	129458665		2203	4300	6503	SO:0001583	missense	4010	exon8	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	TCCCTGCAGGCCC	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.1144C>A	9.37:g.129458665C>A	ENSP00000362573:p.Gln382Lys	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	35.0	NM_001174146	F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	ENST00000373474.4	37	CCDS55342.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.055847	0.76074	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.77082	0.4078	M	0.61703	1.905	0.80722	D	1	B;P;P	0.44429	0.415;0.745;0.835	B;B;B	0.41691	0.194;0.298;0.364	T	0.77381	-0.2609	10	0.34782	T	0.22	.	17.6964	0.88282	0.0:1.0:0.0:0.0	.	363;359;375	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	K	375;382;386;352	ENSP00000436930:Q375K;ENSP00000362573:Q382K;ENSP00000347684:Q386K;ENSP00000390923:Q352K	ENSP00000347684:Q386K	Q	+	1	0	LMX1B	128498486	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.469000	0.80959	2.420000	0.82092	0.561000	0.74099	CAG	.		0.647	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
LPO	4025	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	56343575	56343575	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:56343575delT	ENST00000262290.4	+	11	1897	c.1581delT	c.(1579-1581)aatfs	p.N527fs	LPO_ENST00000421678.2_Frame_Shift_Del_p.N444fs|LPO_ENST00000543544.1_Frame_Shift_Del_p.N468fs|LPO_ENST00000582328.1_Frame_Shift_Del_p.N444fs	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	527					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						TGAAACAGAATAAAATGATGA	0.547																																					p.N527fs		.											.	LPO	91	0			c.1581delT						.						64.0	58.0	60.0					17																	56343575		2203	4300	6503	SO:0001589	frameshift_variant	4025	exon11			ACAGAATAAAATG	M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1581delT	17.37:g.56343575delT	ENSP00000262290:p.Asn527fs	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	27.0	NM_006151	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Frame_Shift_Del	DEL	ENST00000262290.4	37	CCDS32689.1																																																																																			.		0.547	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443961.1		
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	141459798	141459798	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:141459798C>A	ENST00000389484.3	-	39	7185	c.6214G>T	c.(6214-6216)Gga>Tga	p.G2072*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2072					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CGATTCCCTCCAGTCTCAAGG	0.403										TSP Lung(27;0.18)																											p.G2072X	Colon(99;50 2074 2507 20106)	.											.	LRP1B	311	0			c.G6214T						.						199.0	175.0	183.0					2																	141459798		2203	4300	6503	SO:0001587	stop_gained	53353	exon39			TCCCTCCAGTCTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6214G>T	2.37:g.141459798C>A	ENSP00000374135:p.Gly2072*	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	263.0	60.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	53	20.898001	0.99935	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.49	5.49	0.81192	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	19.3684	0.94473	0.0:1.0:0.0:0.0	.	.	.	.	X	2072;2010	.	ENSP00000374135:G2072X	G	-	1	0	LRP1B	141176268	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.710000	0.84655	2.582000	0.87167	0.557000	0.71058	GGA	.		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
LRRC38	126755	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	13839949	13839949	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:13839949A>G	ENST00000376085.3	-	1	594	c.140T>C	c.(139-141)cTg>cCg	p.L47P	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	47	LRRNT.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CACGCTGGGCAGCCCGCGGTC	0.721																																					p.L47P		.											.	.	.	0			c.T140C						.																																			SO:0001583	missense	126755	exon1			CTGGGCAGCCCGC	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.140T>C	1.37:g.13839949A>G	ENSP00000365253:p.Leu47Pro	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	19.0	NM_001010847	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	37	CCDS53269.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.079488	0.76528	.	.	ENSG00000162494	ENST00000376085	D	0.99479	-5.98	4.14	4.14	0.48551	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.64402	D	0.000003	D	0.99670	0.9877	H	0.97540	4.025	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97664	1.0162	10	0.87932	D	0	.	11.9844	0.53138	1.0:0.0:0.0:0.0	.	47	Q5VT99	LRC38_HUMAN	P	47	ENSP00000365253:L47P	ENSP00000365253:L47P	L	-	2	0	LRRC38	13712536	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	9.031000	0.93731	1.498000	0.48600	0.247000	0.18012	CTG	.		0.721	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
LRRC56	115399	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	552109	552109	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:552109A>T	ENST00000270115.7	+	12	1558	c.1058A>T	c.(1057-1059)cAg>cTg	p.Q353L		NM_198075.3	NP_932341.1	Q8IYG6	LRC56_HUMAN	leucine rich repeat containing 56	353										kidney(1)|lung(4)|skin(1)	6		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCCCCCGAGCAGCTGCCCCAA	0.672																																					p.Q353L		.											.	LRRC56	91	0			c.A1058T						.						37.0	46.0	43.0					11																	552109		2201	4300	6501	SO:0001583	missense	115399	exon12			CCGAGCAGCTGCC		CCDS7700.1	11p15.5	2005-10-18			ENSG00000161328	ENSG00000161328			25430	protein-coding gene	gene with protein product						12477932	Standard	NM_198075		Approved	FLJ00101, DKFZp761L1518	uc010qvz.2	Q8IYG6	OTTHUMG00000132003	ENST00000270115.7:c.1058A>T	11.37:g.552109A>T	ENSP00000270115:p.Gln353Leu	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	37.0	NM_198075	Q8N3Q4	Missense_Mutation	SNP	ENST00000270115.7	37	CCDS7700.1	.	.	.	.	.	.	.	.	.	.	A	10.36	1.327543	0.24080	.	.	ENSG00000161328	ENST00000270115	T	0.09255	3.0	4.38	-0.874	0.10631	.	0.158927	0.30068	N	0.010483	T	0.04363	0.0120	L	0.27053	0.805	0.09310	N	1	B	0.33694	0.421	B	0.27500	0.08	T	0.43426	-0.9392	10	0.08179	T	0.78	-22.0255	4.9868	0.14194	0.4647:0.1657:0.3696:0.0	.	353	Q8IYG6	LRC56_HUMAN	L	353	ENSP00000270115:Q353L	ENSP00000270115:Q353L	Q	+	2	0	LRRC56	542109	0.238000	0.23825	0.057000	0.19452	0.079000	0.17450	-0.068000	0.11561	-0.242000	0.09667	0.459000	0.35465	CAG	.		0.672	LRRC56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254969.1	NM_198075	
LRRK1	79705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	101562141	101562141	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:101562141C>A	ENST00000388948.3	+	14	2190	c.1831C>A	c.(1831-1833)Cct>Act	p.P611T	LRRK1_ENST00000284395.5_Missense_Mutation_p.P608T	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			CAGCAATGTGCCTGCAGAAAT	0.577																																					p.P611T		.											.	LRRK1	602	0			c.C1831A						.						52.0	56.0	55.0					15																	101562141		2044	4195	6239	SO:0001583	missense	79705	exon14			AATGTGCCTGCAG	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1831C>A	15.37:g.101562141C>A	ENSP00000373600:p.Pro611Thr	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	18.0	NM_024652		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542835	0.86022	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.77877	-1.13;-1.13	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.90383	0.6990	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88877	0.3337	10	0.27785	T	0.31	.	18.9334	0.92576	0.0:1.0:0.0:0.0	.	611	Q38SD2	LRRK1_HUMAN	T	611;608	ENSP00000373600:P611T;ENSP00000284395:P608T	ENSP00000284395:P608T	P	+	1	0	LRRK1	99379664	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	7.535000	0.82014	2.782000	0.95742	0.655000	0.94253	CCT	.		0.577	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
LRTM1	57408	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	54952542	54952542	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:54952542T>C	ENST00000273286.5	-	3	1144	c.982A>G	c.(982-984)Acc>Gcc	p.T328A	CACNA2D3_ENST00000474759.1_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.T252A|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000415676.2_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	328						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		GGATCATTGGTTTGAGCCAAG	0.507																																					p.T328A		.											.	LRTM1	90	0			c.A982G						.						164.0	157.0	160.0					3																	54952542		2203	4300	6503	SO:0001583	missense	57408	exon3			CATTGGTTTGAGC	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.982A>G	3.37:g.54952542T>C	ENSP00000273286:p.Thr328Ala	Somatic	145.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	38.0	NM_020678	Q8IUU2	Missense_Mutation	SNP	ENST00000273286.5	37	CCDS2876.1	.	.	.	.	.	.	.	.	.	.	T	2.869	-0.234511	0.05983	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;T	0.46819	0.86;1.2	5.48	-1.74	0.08056	.	0.817548	0.11312	N	0.576991	T	0.22322	0.0538	N	0.12887	0.27	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.25779	-1.0122	10	0.12766	T	0.61	.	6.4576	0.21938	0.1194:0.409:0.0:0.4716	.	328	Q9HBL6	LRTM1_HUMAN	A	328;252	ENSP00000273286:T328A;ENSP00000419772:T252A	ENSP00000273286:T328A	T	-	1	0	LRTM1	54927582	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.085000	0.14912	-0.223000	0.09943	-0.441000	0.05720	ACC	.		0.507	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351399.1	NM_020678	
MAGEC1	9947	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	140996543	140996543	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:140996543T>C	ENST00000285879.4	+	4	3639	c.3353T>C	c.(3352-3354)aTt>aCt	p.I1118T	MAGEC1_ENST00000406005.2_Missense_Mutation_p.I185T	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1118										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGCCATAATTGACACCACA	0.473										HNSCC(15;0.026)																											p.I1118T		.											.	MAGEC1	133	0			c.T3353C						.						100.0	86.0	91.0					X																	140996543		2203	4300	6503	SO:0001583	missense	9947	exon4			CCATAATTGACAC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3353T>C	X.37:g.140996543T>C	ENSP00000285879:p.Ile1118Thr	Somatic	52.0	1.0		WXS	Illumina HiSeq	Phase_I	23.0	20.0	NM_005462	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	t	0.968	-0.701081	0.03255	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.04758	4.45;3.56	1.06	-2.12	0.07165	.	.	.	.	.	T	0.06371	0.0164	L	0.53249	1.67	0.09310	N	1	P	0.44006	0.824	P	0.46208	0.507	T	0.18116	-1.0347	9	0.66056	D	0.02	.	2.1445	0.03783	0.0:0.2774:0.33:0.3925	.	1118	O60732	MAGC1_HUMAN	T	1118;185	ENSP00000285879:I1118T;ENSP00000385500:I185T	ENSP00000285879:I1118T	I	+	2	0	MAGEC1	140824209	0.001000	0.12720	0.001000	0.08648	0.078000	0.17371	-0.884000	0.04166	-0.854000	0.04131	0.231000	0.17811	ATT	.		0.473	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MAN2A1	4124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	109049407	109049407	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:109049407T>G	ENST00000261483.4	+	2	1374	c.322T>G	c.(322-324)Tcc>Gcc	p.S108A		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	108					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		CTCACAATTATCCCTCTCAGT	0.443																																					p.S108A		.											.	MAN2A1	92	0			c.T322G						.						140.0	127.0	132.0					5																	109049407		2202	4300	6502	SO:0001583	missense	4124	exon2			CAATTATCCCTCT		CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.322T>G	5.37:g.109049407T>G	ENSP00000261483:p.Ser108Ala	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	23.0	NM_002372	Q16767	Missense_Mutation	SNP	ENST00000261483.4	37	CCDS34209.1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.447905	0.26074	.	.	ENSG00000112893	ENST00000261483	T	0.76709	-1.04	5.26	-0.755	0.11061	.	0.899783	0.09637	N	0.775522	T	0.64136	0.2571	L	0.42245	1.32	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.44682	-0.9312	10	0.11485	T	0.65	-0.188	7.0347	0.24987	0.0:0.2008:0.2567:0.5425	.	108	Q16706	MA2A1_HUMAN	A	108	ENSP00000261483:S108A	ENSP00000261483:S108A	S	+	1	0	MAN2A1	109077306	0.000000	0.05858	0.000000	0.03702	0.968000	0.65278	0.181000	0.16880	-0.017000	0.14103	0.378000	0.23410	TCC	.		0.443	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370680.1		
MARK4	57787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45783689	45783689	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:45783689A>T	ENST00000262891.4	+	11	1395	c.1064A>T	c.(1063-1065)cAg>cTg	p.Q355L	MARK4_ENST00000300843.4_Missense_Mutation_p.Q355L	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	355	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TTGACCAGCCAGAAGTACAAC	0.597																																					p.Q355L		.											.	MARK4	782	0			c.A1064T						.						137.0	133.0	134.0					19																	45783689		2203	4300	6503	SO:0001583	missense	57787	exon11			CCAGCCAGAAGTA	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1064A>T	19.37:g.45783689A>T	ENSP00000262891:p.Gln355Leu	Somatic	226.0	0.0		WXS	Illumina HiSeq	Phase_I	277.0	22.0	NM_001199867	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	.	.	.	.	.	.	.	.	.	.	A	19.03	3.748242	0.69533	.	.	ENSG00000007047	ENST00000262893;ENST00000262891;ENST00000300843	T;T	0.22134	1.97;1.97	5.16	5.16	0.70880	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.33265	0.0857	M	0.79805	2.47	0.58432	D	0.999997	B;P;P	0.52170	0.359;0.951;0.891	B;P;B	0.47573	0.182;0.55;0.295	T	0.14839	-1.0458	10	0.31617	T	0.26	.	12.9784	0.58549	1.0:0.0:0.0:0.0	.	221;355;355	Q8N2N5;Q96L34;Q96L34-2	.;MARK4_HUMAN;.	L	385;355;355	ENSP00000262891:Q355L;ENSP00000300843:Q355L	ENSP00000262891:Q355L	Q	+	2	0	MARK4	50475529	0.388000	0.25197	1.000000	0.80357	0.998000	0.95712	1.332000	0.33805	2.174000	0.68829	0.459000	0.35465	CAG	.		0.597	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417	
MARVELD2	153562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	68715680	68715680	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:68715680G>A	ENST00000325631.5	+	2	542	c.468G>A	c.(466-468)cgG>cgA	p.R156R	MARVELD2_ENST00000413223.2_Silent_p.R156R	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	156					cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		TGTTTCCCCGGGATCCCTATG	0.522																																					p.R156R		.											.	MARVELD2	22	0			c.G468A						.						63.0	64.0	64.0					5																	68715680		2203	4300	6503	SO:0001819	synonymous_variant	153562	exon2			TCCCCGGGATCCC	AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.468G>A	5.37:g.68715680G>A		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	39.0	NM_001244734	A1BQX0|A1BQX1|A8KA97|Q96NM9	Silent	SNP	ENST00000325631.5	37	CCDS34175.1																																																																																			.		0.522	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369583.1	NM_144724	
MEF2A	4205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	100214726	100214726	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:100214726A>G	ENST00000557785.1	+	6	868	c.519A>G	c.(517-519)acA>acG	p.T173T	MEF2A_ENST00000354410.5_Silent_p.T175T|MEF2A_ENST00000338042.6_Silent_p.T173T|MEF2A_ENST00000449277.2_Silent_p.T105T|MEF2A_ENST00000557942.1_Silent_p.T173T|MEF2A_ENST00000453228.2_Silent_p.T173T|MEF2A_ENST00000558812.1_Silent_p.T105T	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	175	Ser/Thr-rich.				apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			CAACGTTAACAGATTCAAGCA	0.498																																					p.T175T		.											.	MEF2A	455	0			c.A525G						.						196.0	187.0	190.0					15																	100214726		1953	4153	6106	SO:0001819	synonymous_variant	4205	exon6			GTTAACAGATTCA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.519A>G	15.37:g.100214726A>G		Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	39.0	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Silent	SNP	ENST00000557785.1	37	CCDS53978.1																																																																																			.		0.498	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
MEFV	4210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3304779	3304779	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:3304779G>C	ENST00000219596.1	-	2	328	c.289C>G	c.(289-291)Caa>Gaa	p.Q97E	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	97					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CCGTTTTCTTGTGTGGAATAT	0.547																																					p.Q97E		.											.	MEFV	228	0			c.C289G						.						47.0	52.0	50.0					16																	3304779		2146	4213	6359	SO:0001583	missense	4210	exon2			TTTCTTGTGTGGA	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.289C>G	16.37:g.3304779G>C	ENSP00000219596:p.Gln97Glu	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	10.0	NM_000243	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	CCDS10498.1	.	.	.	.	.	.	.	.	.	.	G	1.208	-0.630620	0.03584	.	.	ENSG00000103313	ENST00000545159;ENST00000219596	T	0.62788	-0.0	3.75	0.58	0.17402	.	0.673936	0.13268	N	0.400749	T	0.35422	0.0931	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20672	-1.0268	10	0.09338	T	0.73	-37.9873	7.0377	0.25002	0.0:0.3807:0.4379:0.1814	.	97	O15553	MEFV_HUMAN	E	97	ENSP00000219596:Q97E	ENSP00000219596:Q97E	Q	-	1	0	MEFV	3244780	0.025000	0.19082	0.020000	0.16555	0.007000	0.05969	0.187000	0.16998	0.170000	0.19704	-0.257000	0.10917	CAA	.		0.547	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42853717	42853717	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:42853717G>T	ENST00000251268.6	+	14	2365	c.2365G>T	c.(2365-2367)Gct>Tct	p.A789S	MEGF8_ENST00000334370.4_Missense_Mutation_p.A722S	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	789					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCCTGGGTCTGCTCGCCTCTT	0.657																																					p.A789S		.											.	MEGF8	23	0			c.G2365T						.						38.0	43.0	41.0					19																	42853717		2203	4299	6502	SO:0001583	missense	1954	exon14			GGGTCTGCTCGCC	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2365G>T	19.37:g.42853717G>T	ENSP00000251268:p.Ala789Ser	Somatic	39.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	10.0	NM_001271938	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	G	9.706	1.155671	0.21454	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.20738	2.05;2.06	4.64	-0.0615	0.13784	.	0.949193	0.08752	N	0.898904	T	0.06735	0.0172	N	0.02539	-0.55	0.09310	N	0.999992	B;B	0.21381	0.001;0.055	B;B	0.12156	0.001;0.007	T	0.37454	-0.9705	10	0.06236	T	0.91	.	8.1339	0.31043	0.3519:0.0:0.6481:0.0	.	789;722	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	S	722;789	ENSP00000334219:A722S;ENSP00000251268:A789S	ENSP00000251268:A789S	A	+	1	0	MEGF8	47545557	0.001000	0.12720	0.115000	0.21578	0.943000	0.58893	0.445000	0.21677	-0.162000	0.10964	0.491000	0.48974	GCT	.		0.657	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000463854.1	NM_001410	
MFAP5	8076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8800721	8800721	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:8800721T>C	ENST00000359478.2	-	10	675	c.488A>G	c.(487-489)gAa>gGa	p.E163G	MFAP5_ENST00000540087.1_Missense_Mutation_p.E153G|MFAP5_ENST00000543369.1_Missense_Mutation_p.E141G|MFAP5_ENST00000535336.1_Missense_Mutation_p.E99G|MFAP5_ENST00000396549.2_Missense_Mutation_p.E153G|MFAP5_ENST00000433590.2_Missense_Mutation_p.E138G	NM_003480.2	NP_003471.1	Q13361	MFAP5_HUMAN	microfibrillar associated protein 5	163					extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|skin(1)	13	Lung SC(5;0.184)					ATCCACATTTTCACAGGGAGG	0.473																																					p.E163G		.											.	MFAP5	577	0			c.A488G						.						90.0	87.0	88.0					12																	8800721		2203	4300	6503	SO:0001583	missense	8076	exon10			ACATTTTCACAGG	AK124368	CCDS8595.1, CCDS73437.1	12p13.1-p12.3	2004-04-05				ENSG00000197614			29673	protein-coding gene	gene with protein product		601103				9792630, 8557636	Standard	XM_005253485		Approved	MAGP2, MP25	uc001qut.1	Q13361		ENST00000359478.2:c.488A>G	12.37:g.8800721T>C	ENSP00000352455:p.Glu163Gly	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	70.0	NM_003480	B0AZL6|D3DUV1|Q7Z490	Missense_Mutation	SNP	ENST00000359478.2	37	CCDS8595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.18|17.18	3.322561|3.322561	0.60634|0.60634	.|.	.|.	ENSG00000197614|ENSG00000197614	ENST00000543467;ENST00000359478;ENST00000433590;ENST00000396549;ENST00000543369;ENST00000535336;ENST00000540087|ENST00000535411	.|.	.|.	.|.	4.79|4.79	4.79|4.79	0.61399|0.61399	.|.	0.572443|.	0.18358|.	N|.	0.143656|.	T|T	0.38772|0.38772	0.1053|0.1053	N|N	0.24115|0.24115	0.695|0.695	0.32269|0.32269	N|N	0.569079|0.569079	P;P;P|.	0.46395|.	0.792;0.877;0.877|.	B;B;B|.	0.37731|.	0.257;0.257;0.257|.	T|T	0.47315|0.47315	-0.9127|-0.9127	9|5	0.72032|.	D|.	0.01|.	-3.4876|-3.4876	10.894|10.894	0.47012|0.47012	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	138;163;153|.	B3KW70;Q13361;Q7Z490|.	.;MFAP5_HUMAN;.|.	G|E	69;163;138;153;141;99;153|153	.|.	ENSP00000352455:E163G|.	E|K	-|-	2|1	0|0	MFAP5|MFAP5	8691988|8691988	0.922000|0.922000	0.31269|0.31269	0.926000|0.926000	0.36857|0.36857	0.930000|0.930000	0.56654|0.56654	2.337000|2.337000	0.43947|0.43947	2.138000|2.138000	0.66242|0.66242	0.460000|0.460000	0.39030|0.39030	GAA|AAA	.		0.473	MFAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400656.2	NM_003480	
MFSD6	54842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	191362167	191362167	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:191362167A>G	ENST00000392328.1	+	7	2218	c.1894A>G	c.(1894-1896)Aag>Gag	p.K632E	MFSD6_ENST00000535751.1_Missense_Mutation_p.K94E|MFSD6_ENST00000281416.7_Missense_Mutation_p.K632E	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	632					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						CTCTCCAGACAAGACAATGTT	0.373																																					p.K632E		.											.	MFSD6	92	0			c.A1894G						.						116.0	113.0	114.0					2																	191362167		2203	4300	6503	SO:0001583	missense	54842	exon7			CCAGACAAGACAA		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.1894A>G	2.37:g.191362167A>G	ENSP00000376141:p.Lys632Glu	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	14.0	NM_017694	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	ENST00000392328.1	37	CCDS2306.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.11|10.11	1.261132|1.261132	0.23051|0.23051	.|.	.|.	ENSG00000151690|ENSG00000151690	ENST00000392328;ENST00000281416;ENST00000444317;ENST00000542423;ENST00000535751|ENST00000434582	T;T;T;T|.	0.58210|.	0.35;0.35;0.35;0.35|.	5.98|5.98	5.98|5.98	0.97165|0.97165	Major facilitator superfamily domain, general substrate transporter (1);|.	0.198371|.	0.56097|.	D|.	0.000034|.	T|T	0.44095|0.44095	0.1277|0.1277	N|N	0.22421|0.22421	0.69|0.69	0.37982|0.37982	D|D	0.933614|0.933614	B|.	0.20164|.	0.042|.	B|.	0.25405|.	0.06|.	T|T	0.48234|0.48234	-0.9053|-0.9053	10|5	0.22109|.	T|.	0.4|.	-25.9069|-25.9069	10.0367|10.0367	0.42133|0.42133	0.9258:0.0:0.0742:0.0|0.9258:0.0:0.0742:0.0	.|.	632|.	Q6ZSS7|.	MFSD6_HUMAN|.	E|R	632;632;94;94;94|167	ENSP00000376141:K632E;ENSP00000281416:K632E;ENSP00000406837:K94E;ENSP00000440917:K94E|.	ENSP00000281416:K632E|.	K|Q	+|+	1|2	0|0	MFSD6|MFSD6	191070412|191070412	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	5.019000|5.019000	0.64060|0.64060	2.288000|2.288000	0.76882|0.76882	0.528000|0.528000	0.53228|0.53228	AAG|CAA	.		0.373	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
MICAL1	64780	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	109766714	109766714	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:109766714T>A	ENST00000358807.3	-	21	3003	c.2692A>T	c.(2692-2694)Aag>Tag	p.K898*	MICAL1_ENST00000358577.3_Nonsense_Mutation_p.K812*|MICAL1_ENST00000368952.4_Nonsense_Mutation_p.K917*	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	898					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		CCTGAGGTCTTGGCAAAGGTC	0.567																																					p.K898X		.											.	MICAL1	154	0			c.A2692T						.						70.0	71.0	70.0					6																	109766714		2203	4300	6503	SO:0001587	stop_gained	64780	exon21			AGGTCTTGGCAAA	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2692A>T	6.37:g.109766714T>A	ENSP00000351664:p.Lys898*	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	26.0	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Nonsense_Mutation	SNP	ENST00000358807.3	37	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	T	37	6.495916	0.97612	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957;ENST00000335266	.	.	.	5.51	0.524	0.17066	.	0.952738	0.08798	N	0.892250	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.3632	0.26758	0.0:0.3601:0.0:0.6399	.	.	.	.	X	898;917;812;422;154	.	ENSP00000335372:K154X	K	-	1	0	MICAL1	109873407	0.996000	0.38824	0.009000	0.14445	0.029000	0.11900	1.132000	0.31418	0.078000	0.16900	-0.256000	0.11100	AAG	.		0.567	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
MIPEP	4285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	24410481	24410481	+	Silent	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr13:24410481C>T	ENST00000382172.3	-	14	1649	c.1551G>A	c.(1549-1551)agG>agA	p.R517R		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	517					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CAGTAGGGCACCTGGTCCCTA	0.343																																					p.R517R		.											.	MIPEP	90	0			c.G1551A						.						78.0	80.0	79.0					13																	24410481		2203	4300	6503	SO:0001819	synonymous_variant	4285	exon14			AGGGCACCTGGTC		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1551G>A	13.37:g.24410481C>T		Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	16.0	NM_005932	Q5JV15|Q5T9Q9|Q96G65	Silent	SNP	ENST00000382172.3	37	CCDS9303.1																																																																																			.		0.343	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1		
ZNF766	90321	ucsc.edu;mdanderson.org	37	19	52785121	52785121	+	Intron	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:52785121A>G	ENST00000439461.1	+	2	61				ZNF766_ENST00000593612.1_Intron|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Intron|ZNF766_ENST00000600821.1_Intron|MIR643_ENST00000385267.1_RNA|ZNF766_ENST00000599581.1_Intron	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		CTTGTATGCTAGCTCAGGTAG	0.328																																					.		.											.	.	.	0			.						.						37.0	32.0	33.0					19																	52785121		1566	3582	5148	SO:0001627	intron_variant	693228	.			TATGCTAGCTCAG	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.19-243A>G	19.37:g.52785121A>G		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	78.0	15.0	.	B2RNE0|Q7Z326	RNA	SNP	ENST00000439461.1	37	CCDS46163.1																																																																																			.		0.328	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462764.1	NM_001010851	
MITF	4286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	70008478	70008478	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:70008478A>G	ENST00000448226.2	+	9	1213	c.1086A>G	c.(1084-1086)cgA>cgG	p.R362R	MITF_ENST00000472437.1_Silent_p.R304R|MITF_ENST00000531774.1_Silent_p.R193R|MITF_ENST00000314589.5_Silent_p.R340R|MITF_ENST00000394355.2_Silent_p.R331R|MITF_ENST00000352241.4_Silent_p.R356R|MITF_ENST00000394351.3_Silent_p.R255R|MITF_ENST00000328528.6_Silent_p.R355R|MITF_ENST00000314557.6_Silent_p.R249R			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	362	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		ACTATATCCGAAAGTTGCAAC	0.453			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.R356R	Melanoma(29;269 969 31479 41502 42961)	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	524	0			c.A1068G						.						89.0	80.0	83.0					3																	70008478		2203	4300	6503	SO:0001819	synonymous_variant	4286	exon9			TATCCGAAAGTTG		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1086A>G	3.37:g.70008478A>G		Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	32.0	NM_198159	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	ENST00000448226.2	37																																																																																				.		0.453	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
MLC1	23209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50506909	50506909	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr22:50506909T>G	ENST00000311597.5	-	10	1453	c.847A>C	c.(847-849)Atc>Ctc	p.I283L	MLC1_ENST00000431262.2_Missense_Mutation_p.I253L|MLC1_ENST00000538737.1_Missense_Mutation_p.I249L|MLC1_ENST00000535444.1_Missense_Mutation_p.I204L|MLC1_ENST00000450140.2_Missense_Mutation_p.I231L|MLC1_ENST00000395876.2_Missense_Mutation_p.I283L|MLC1_ENST00000483836.1_5'UTR	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	283					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		ATTCTCATGATGCTGAATGAC	0.502																																					p.I283L		.											.	MLC1	91	0			c.A847C						.						117.0	117.0	117.0					22																	50506909		2203	4300	6503	SO:0001583	missense	23209	exon10			TCATGATGCTGAA	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.847A>C	22.37:g.50506909T>G	ENSP00000310375:p.Ile283Leu	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	34.0	NM_015166	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	ENST00000311597.5	37	CCDS14083.1	.	.	.	.	.	.	.	.	.	.	T	8.730	0.916523	0.17907	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140	D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	4.63	-5.71	0.02413	.	0.350237	0.27595	N	0.018673	T	0.79482	0.4453	L	0.48642	1.525	0.09310	N	0.999999	B;B;B;B	0.15930	0.015;0.015;0.015;0.004	B;B;B;B	0.15870	0.012;0.012;0.014;0.012	T	0.64888	-0.6301	10	0.66056	D	0.02	-14.5954	12.7472	0.57287	0.0:0.1848:0.0:0.8152	.	249;253;231;283	F5H1B9;B7Z659;B7Z1X1;Q15049	.;.;.;MLC1_HUMAN	L	283;283;249;253;204;231	ENSP00000379216:I283L;ENSP00000310375:I283L;ENSP00000445805:I249L;ENSP00000415877:I253L;ENSP00000438910:I204L;ENSP00000412448:I231L	ENSP00000310375:I283L	I	-	1	0	MLC1	48849036	0.991000	0.36638	0.006000	0.13384	0.002000	0.02628	0.691000	0.25467	-0.903000	0.03881	-1.006000	0.02489	ATC	.		0.502	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316979.2	NM_015166	
MLLT4	4301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	168352222	168352222	+	Silent	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:168352222A>T	ENST00000447894.2	+	29	4167	c.4167A>T	c.(4165-4167)ccA>ccT	p.P1389P	MLLT4_ENST00000351017.4_Silent_p.P1396P|MLLT4_ENST00000366806.2_Silent_p.P1389P|MLLT4_ENST00000344191.4_Silent_p.P1389P|MLLT4_ENST00000400822.3_Silent_p.P1388P|MLLT4_ENST00000392112.1_Silent_p.P1372P|MLLT4_ENST00000392108.3_Silent_p.P1389P			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1389	Pro-rich.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TGCCTCTCCCACCACCCCCTT	0.587			T	MLL	AL																																p.P1389P		.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	685	0			c.A4167T						.						76.0	84.0	82.0					6																	168352222		2203	4300	6503	SO:0001819	synonymous_variant	4301	exon29			TCTCCCACCACCC	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.4167A>T	6.37:g.168352222A>T		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	7.0	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	ENST00000447894.2	37																																																																																				.		0.587	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
MMP27	64066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	102573828	102573828	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:102573828A>T	ENST00000260229.4	-	3	454	c.363T>A	c.(361-363)gaT>gaA	p.D121E		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	121					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CTCGTGCCATATCCGGAGTAT	0.353																																					p.D121E		.											.	MMP27	229	0			c.T363A						.						73.0	70.0	71.0					11																	102573828		2203	4299	6502	SO:0001583	missense	64066	exon3			TGCCATATCCGGA	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.363T>A	11.37:g.102573828A>T	ENSP00000260229:p.Asp121Glu	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	34.0	NM_022122	Q6UWK6	Missense_Mutation	SNP	ENST00000260229.4	37	CCDS8319.1	.	.	.	.	.	.	.	.	.	.	A	13.78	2.338976	0.41398	.	.	ENSG00000137675	ENST00000260229	T	0.53857	0.6	5.11	-2.76	0.05896	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.110120	0.40908	D	0.000999	T	0.64371	0.2592	M	0.86953	2.85	0.52099	D	0.999947	D	0.53885	0.963	P	0.58454	0.839	T	0.64123	-0.6481	10	0.72032	D	0.01	.	6.9973	0.24789	0.4854:0.0:0.4007:0.1139	.	121	Q9H306	MMP27_HUMAN	E	121	ENSP00000260229:D121E	ENSP00000260229:D121E	D	-	3	2	MMP27	102079038	0.991000	0.36638	0.412000	0.26496	0.017000	0.09413	0.514000	0.22786	-0.737000	0.04824	-1.258000	0.01471	GAT	.		0.353	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122	
MPO	4353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56349142	56349142	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:56349142C>A	ENST00000225275.3	-	11	2080	c.1904G>T	c.(1903-1905)gGc>gTc	p.G635V	MPO_ENST00000340482.3_Missense_Mutation_p.G667V	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	635					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GTTGGGCGTGCCATACTGCTC	0.627																																					p.G635V		.											.	MPO	156	0			c.G1904T						.						126.0	85.0	99.0					17																	56349142		2203	4300	6503	SO:0001583	missense	4353	exon11			GGCGTGCCATACT		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1904G>T	17.37:g.56349142C>A	ENSP00000225275:p.Gly635Val	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	22.0	NM_000250	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274898	0.80580	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.77358	-1.09;-1.09	5.16	4.2	0.49525	.	0.162930	0.56097	D	0.000037	D	0.89213	0.6651	M	0.90252	3.1	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.90874	0.4748	10	0.87932	D	0	-24.8157	12.7965	0.57562	0.0:0.9214:0.0:0.0786	.	635	P05164	PERM_HUMAN	V	667;635	ENSP00000344419:G667V;ENSP00000225275:G635V	ENSP00000225275:G635V	G	-	2	0	MPO	53704141	0.955000	0.32602	0.918000	0.36340	0.902000	0.53008	4.039000	0.57325	1.193000	0.43086	0.563000	0.77884	GGC	.		0.627	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1		
MRPS21	54460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150266814	150266814	+	Missense_Mutation	SNP	A	A	T	rs376189902		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:150266814A>T	ENST00000369084.5	+	1	475	c.28A>T	c.(28-30)Agg>Tgg	p.R10W	MRPS21_ENST00000309092.7_Missense_Mutation_p.R10W	NM_018997.3	NP_061870.1	P82921	RT21_HUMAN	mitochondrial ribosomal protein S21	10					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(1)|pancreas(1)	4	Lung NSC(24;5.57e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTTCATCGCCAGGACTGTGAT	0.473																																					p.R10W		.											.	MRPS21	90	0			c.A28T						.						110.0	96.0	100.0					1																	150266814		2203	4300	6503	SO:0001583	missense	54460	exon1			ATCGCCAGGACTG	AB051353	CCDS950.1	1q21	2012-09-13			ENSG00000187145			"""Mitochondrial ribosomal proteins / small subunits"""	14046	protein-coding gene	gene with protein product		611984					Standard	NM_031901		Approved		uc001euk.3	P82921	OTTHUMG00000012544	ENST00000369084.5:c.28A>T	1.37:g.150266814A>T	ENSP00000358080:p.Arg10Trp	Somatic	196.0	0.0		WXS	Illumina HiSeq	Phase_I	309.0	27.0	NM_018997	Q5TB11|Q9BST6	Missense_Mutation	SNP	ENST00000369084.5	37	CCDS950.1	.	.	.	.	.	.	.	.	.	.	A	18.72	3.684518	0.68157	.	.	ENSG00000187145	ENST00000309092;ENST00000369084	T;T	0.38077	1.16;1.16	5.41	4.25	0.50352	.	.	.	.	.	T	0.30039	0.0752	.	.	.	0.49051	D	0.999745	P	0.48764	0.915	P	0.49226	0.603	T	0.15665	-1.0429	8	0.87932	D	0	.	9.623	0.39732	0.6576:0.3424:0.0:0.0	.	10	P82921	RT21_HUMAN	W	10	ENSP00000312395:R10W;ENSP00000358080:R10W	ENSP00000312395:R10W	R	+	1	2	MRPS21	148533438	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.643000	0.37217	1.030000	0.39839	0.533000	0.62120	AGG	.		0.473	MRPS21-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035813.1	NM_018997	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9065588	9065588	+	Silent	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:9065588A>T	ENST00000397910.4	-	3	22061	c.21858T>A	c.(21856-21858)tcT>tcA	p.S7286S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	7288	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGTTCTGCTAGAGGAGGTGA	0.478																																					p.S7286S		.											.	MUC16	566	0			c.T21858A						.						130.0	125.0	127.0					19																	9065588		1976	4152	6128	SO:0001819	synonymous_variant	94025	exon3			TCTGCTAGAGGAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.21858T>A	19.37:g.9065588A>T		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	11.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			.		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195507996	195507996	+	Missense_Mutation	SNP	G	G	T	rs577732202	byFrequency	TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:195507996G>T	ENST00000463781.3	-	2	10914	c.10455C>A	c.(10453-10455)caC>caA	p.H3485Q	MUC4_ENST00000475231.1_Missense_Mutation_p.H3485Q|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGTGTGACCTGTAG	0.592																																					p.H3485Q		.											.	MUC4	90	0			c.C10455A						.						28.0	25.0	25.0					3																	195507996		671	1574	2245	SO:0001583	missense	4585	exon2			GGTGGTGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10455C>A	3.37:g.195507996G>T	ENSP00000417498:p.His3485Gln	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	15.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	G	4.034	0.003802	0.07866	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.55;1.51	0.743	-0.725	0.11174	.	.	.	.	.	T	0.16811	0.0404	N	0.14661	0.345	0.09310	N	1	P	0.36438	0.553	B	0.40741	0.339	T	0.24905	-1.0147	8	.	.	.	.	4.4534	0.11631	0.33:0.0:0.67:0.0	.	3357	E7ESK3	.	Q	3485	ENSP00000417498:H3485Q;ENSP00000420243:H3485Q	.	H	-	3	2	MUC4	196992775	0.000000	0.05858	0.019000	0.16419	0.019000	0.09904	-0.487000	0.06505	0.088000	0.17205	0.089000	0.15464	CAC	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	195509863	195509863	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:195509863G>T	ENST00000463781.3	-	2	9047	c.8588C>A	c.(8587-8589)aCc>aAc	p.T2863N	MUC4_ENST00000475231.1_Missense_Mutation_p.T2863N|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGAGAGGTGGCGTGACC	0.602																																					p.T2863N		.											.	MUC4	90	0			c.C8588A						.						38.0	29.0	32.0					3																	195509863		678	1573	2251	SO:0001583	missense	4585	exon2			AGAGAGGTGGCGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8588C>A	3.37:g.195509863G>T	ENSP00000417498:p.Thr2863Asn	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	12.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	7.866	0.727125	0.15439	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30182	1.54;1.54	.	.	.	.	.	.	.	.	T	0.32194	0.0821	N	0.19112	0.55	0.20563	N	0.999888	D	0.61697	0.99	D	0.69142	0.962	T	0.21759	-1.0236	7	.	.	.	.	6.8646	0.24086	1.0E-4:0.0:0.9999:0.0	.	2735	E7ESK3	.	N	2863	ENSP00000417498:T2863N;ENSP00000420243:T2863N	.	T	-	2	0	MUC4	196994642	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.192000	0.17096	-0.000000	0.14550	0.000000	0.15137	ACC	.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	195515685	195515685	+	Silent	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:195515685G>T	ENST00000463781.3	-	2	3225	c.2766C>A	c.(2764-2766)atC>atA	p.I922I	MUC4_ENST00000475231.1_Silent_p.I922I|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	927	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACGCCAGGCTGATAGTGTCAG	0.582																																					p.I922I		.											.	MUC4	90	0			c.C2766A						.						190.0	189.0	189.0					3																	195515685		2131	4224	6355	SO:0001819	synonymous_variant	4585	exon2			CAGGCTGATAGTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2766C>A	3.37:g.195515685G>T		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	27.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			.		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MXRA5	25878	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	3240280	3240280	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:3240280C>A	ENST00000217939.6	-	5	3600	c.3446G>T	c.(3445-3447)aGg>aTg	p.R1149M		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1149						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GTTGGGTCTCCTTCGAGAAGG	0.512																																					p.R1149M		.											.	MXRA5	136	0			c.G3446T						.						121.0	112.0	115.0					X																	3240280		2203	4300	6503	SO:0001583	missense	25878	exon5			GGTCTCCTTCGAG	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.3446G>T	X.37:g.3240280C>A	ENSP00000217939:p.Arg1149Met	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	65.0	NM_015419	Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	ENST00000217939.6	37	CCDS14124.1	.	.	.	.	.	.	.	.	.	.	c	10.65	1.408504	0.25378	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.70749	-0.51	3.61	0.371	0.16168	.	0.159238	0.28659	U	0.014570	T	0.58452	0.2123	N	0.19112	0.55	0.09310	N	1	D	0.63046	0.992	P	0.49561	0.615	T	0.56727	-0.7931	10	0.66056	D	0.02	.	8.6847	0.34229	0.0:0.6362:0.0:0.3638	.	1149	Q9NR99	MXRA5_HUMAN	M	1149	ENSP00000217939:R1149M	ENSP00000217939:R1149M	R	-	2	0	MXRA5	3250280	0.797000	0.28877	0.000000	0.03702	0.003000	0.03518	0.262000	0.18460	-0.429000	0.07329	0.519000	0.50382	AGG	.		0.512	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055655.2	NM_015419	
MXRA8	54587	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	1290242	1290242	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:1290242G>T	ENST00000309212.6	-	5	799	c.769C>A	c.(769-771)Ctg>Atg	p.L257M	MXRA8_ENST00000342753.4_Missense_Mutation_p.L156M|MXRA8_ENST00000445648.2_Missense_Mutation_p.L257M|MXRA8_ENST00000477278.2_Missense_Mutation_p.L248M	NM_001282582.1|NM_032348.2	NP_001269511.1|NP_115724.1	Q9BRK3	MXRA8_HUMAN	matrix-remodelling associated 8	257	Ig-like V-type 2.				establishment of glial blood-brain barrier (GO:0060857)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCGATACGCAGTGAGAAGTCA	0.677																																					p.L257M		.											.	MXRA8	90	0			c.C769A						.						21.0	24.0	23.0					1																	1290242		2194	4291	6485	SO:0001583	missense	54587	exon5			TACGCAGTGAGAA	BC006213	CCDS24.1, CCDS59950.1, CCDS59951.1, CCDS59952.1	1p36.33	2013-01-11			ENSG00000162576	ENSG00000162576		"""Immunoglobulin superfamily / V-set domain containing"""	7542	protein-coding gene	gene with protein product	"""limitrin"""					14603461	Standard	XM_005244758		Approved	DKFZp586E2023	uc001aew.3	Q9BRK3	OTTHUMG00000002973	ENST00000309212.6:c.769C>A	1.37:g.1290242G>T	ENSP00000307887:p.Leu257Met	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	49.0	NM_032348	B3KTR6|B4DE34|Q5TA39|Q96KC3	Missense_Mutation	SNP	ENST00000309212.6	37	CCDS24.1	.	.	.	.	.	.	.	.	.	.	.	15.93	2.976807	0.53720	.	.	ENSG00000162576	ENST00000309212;ENST00000378864;ENST00000342753;ENST00000445648	T;T;T	0.67865	-0.29;-0.29;-0.29	4.24	3.3	0.37823	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	U	0.000001	T	0.77896	0.4199	M	0.67625	2.065	0.58432	D	0.999993	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;0.999;0.999;0.999	T	0.80067	-0.1537	10	0.72032	D	0.01	-1.1561	11.4826	0.50335	0.092:0.0:0.908:0.0	.	248;156;235;257;257	B3KTR6;B4DE34;B4E385;Q9BRK3-2;Q9BRK3	.;.;.;.;MXRA8_HUMAN	M	257;248;156;257	ENSP00000307887:L257M;ENSP00000344998:L156M;ENSP00000399229:L257M	ENSP00000307887:L257M	L	-	1	2	MXRA8	1280105	1.000000	0.71417	0.978000	0.43139	0.307000	0.27823	4.615000	0.61190	1.897000	0.54924	0.298000	0.19748	CTG	.		0.677	MXRA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008282.2	NM_032348	
MYH10	4628	broad.mit.edu;bcgsc.ca	37	17	8383601	8383604	+	Frame_Shift_Del	DEL	GCGC	GCGC	-			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	GCGC	GCGC	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:8383601_8383604delGCGC	ENST00000269243.4	-	38	5466_5469	c.5328_5331delGCGC	c.(5326-5331)gagcgcfs	p.ER1776fs	MYH10_ENST00000396239.1_Frame_Shift_Del_p.ER1797fs|MYH10_ENST00000360416.3_Frame_Shift_Del_p.ER1807fs|MYH10_ENST00000379980.4_Frame_Shift_Del_p.ER1792fs|NDEL1_ENST00000299734.7_Intron	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1776					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GGGCGGCGCTGCGCTCGGCTGCTA	0.613																																					p.1807_1808del		.											.	MYH10	92	0			c.5421_5424del						.																																			SO:0001589	frameshift_variant	4628	exon40			GGCGCTGCGCTCG	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5328_5331delGCGC	17.37:g.8383601_8383604delGCGC	ENSP00000269243:p.Glu1776fs	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	7.0	4.0	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Frame_Shift_Del	DEL	ENST00000269243.4	37	CCDS11144.1																																																																																			.		0.613	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
MYH10	4628	broad.mit.edu;bcgsc.ca	37	17	8383607	8383624	+	In_Frame_Del	DEL	GGCTGCTAGCTCGGCGTT	GGCTGCTAGCTCGGCGTT	-	rs149073296|rs201995528		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	GGCTGCTAGCTCGGCGTT	GGCTGCTAGCTCGGCGTT	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:8383607_8383624delGGCTGCTAGCTCGGCGTT	ENST00000269243.4	-	38	5446_5463	c.5308_5325delAACGCCGAGCTAGCAGCC	c.(5308-5325)aacgccgagctagcagccdel	p.NAELAA1770del	MYH10_ENST00000396239.1_In_Frame_Del_p.NAELAA1791del|MYH10_ENST00000360416.3_In_Frame_Del_p.NAELAA1801del|MYH10_ENST00000379980.4_In_Frame_Del_p.NAELAA1786del|NDEL1_ENST00000299734.7_Intron	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1770					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CGCTGCGCTCGGCTGCTAGCTCGGCGTTCAGTGTGTCC	0.619																																					p.1801_1806del		.											.	MYH10	92	0			c.5401_5418del						.																																			SO:0001651	inframe_deletion	4628	exon40			GCGCTCGGCTGCT	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5308_5325delAACGCCGAGCTAGCAGCC	17.37:g.8383607_8383624delGGCTGCTAGCTCGGCGTT	ENSP00000269243:p.Asn1770_Ala1775del	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	6.0	4.0	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	In_Frame_Del	DEL	ENST00000269243.4	37	CCDS11144.1																																																																																			.		0.619	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
NAV1	89796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201757764	201757764	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:201757764A>G	ENST00000367296.4	+	10	3584	c.3164A>G	c.(3163-3165)gAt>gGt	p.D1055G	NAV1_ENST00000367295.1_Missense_Mutation_p.D664G|NAV1_ENST00000367297.4_Missense_Mutation_p.D1055G|NAV1_ENST00000295624.6_Missense_Mutation_p.D1055G|NAV1_ENST00000367302.1_Intron|NAV1_ENST00000469130.1_3'UTR|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367300.3_Intron	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1055					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CCCACGGACGATGGTGAGACT	0.602																																					p.D1055G		.											.	NAV1	228	0			c.A3164G						.						104.0	81.0	89.0					1																	201757764		2203	4300	6503	SO:0001583	missense	89796	exon10			CGGACGATGGTGA	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.3164A>G	1.37:g.201757764A>G	ENSP00000356265:p.Asp1055Gly	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	12.0	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	A	19.61	3.860703	0.71834	.	.	ENSG00000134369	ENST00000367296;ENST00000295624;ENST00000367297;ENST00000391966;ENST00000367295	T;T;T;T	0.09538	2.99;3.02;2.97;3.02	5.54	5.54	0.83059	.	0.056958	0.64402	D	0.000002	T	0.26231	0.0640	L	0.46157	1.445	0.80722	D	1	B;B;P;D;B	0.67145	0.181;0.099;0.669;0.996;0.181	B;B;B;D;B	0.67103	0.074;0.041;0.175;0.949;0.041	T	0.00630	-1.1636	10	0.87932	D	0	-25.0053	15.3514	0.74389	1.0:0.0:0.0:0.0	.	1055;664;1055;563;1055	Q8NEY1-6;Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.;.;NAV1_HUMAN;.;.	G	1055;1055;1055;563;664	ENSP00000356265:D1055G;ENSP00000295624:D1055G;ENSP00000356266:D1055G;ENSP00000356264:D664G	ENSP00000295624:D1055G	D	+	2	0	NAV1	200024387	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	7.259000	0.78381	2.098000	0.63641	0.533000	0.62120	GAT	.		0.602	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
NAV3	89795	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	78362415	78362415	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:78362415C>A	ENST00000397909.2	+	5	777	c.604C>A	c.(604-606)Cga>Aga	p.R202R	NAV3_ENST00000266692.7_Silent_p.R202R|NAV3_ENST00000228327.6_Silent_p.R202R|NAV3_ENST00000536525.2_Silent_p.R202R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	202						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.R202*(1)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						ACTTCAGCAGCGAGTTACTCA	0.473										HNSCC(70;0.22)																											p.R202R		.											.	NAV3	279	1	Substitution - Nonsense(1)	prostate(1)	c.C604A						.						74.0	78.0	77.0					12																	78362415		1989	4177	6166	SO:0001819	synonymous_variant	89795	exon5			CAGCAGCGAGTTA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.604C>A	12.37:g.78362415C>A		Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	87.0	NM_014903	Q8NFW7|Q9Y2E7	Silent	SNP	ENST00000397909.2	37		.	.	.	.	.	.	.	.	.	.	C	4.797	0.148139	0.09134	.	.	ENSG00000067798	ENST00000550503	.	.	.	5.7	-1.95	0.07548	.	.	.	.	.	T	0.55924	0.1951	.	.	.	0.50467	D	0.999871	.	.	.	.	.	.	T	0.52830	-0.8523	4	.	.	.	-1.6834	10.8941	0.47012	0.4901:0.3039:0.206:0.0	.	.	.	.	E	48	.	.	A	+	2	0	NAV3	76886546	1.000000	0.71417	0.051000	0.19133	0.485000	0.33311	1.317000	0.33631	-0.313000	0.08728	0.637000	0.83480	GCG	.		0.473	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
NCAM1	4684	hgsc.bcm.edu;broad.mit.edu	37	11	113102431	113102431	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:113102431T>C	ENST00000533760.1	+	9	1369	c.770T>C	c.(769-771)aTc>aCc	p.I257T	NCAM1_ENST00000401611.2_Missense_Mutation_p.I384T|NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Missense_Mutation_p.I375T	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	385	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CTGAAGAGCATCCAGTACACT	0.582																																					p.I411T		.											.	NCAM1	23	0			c.T1232C						.						79.0	83.0	82.0					11																	113102431		2174	4280	6454	SO:0001583	missense	4684	exon12			AGAGCATCCAGTA		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.770T>C	11.37:g.113102431T>C	ENSP00000473281:p.Ile257Thr	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	4.0	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	T	18.85	3.712183	0.68730	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.70164	-0.46;-0.46	4.71	4.71	0.59529	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.145674	0.46442	U	0.000282	T	0.65544	0.2701	.	.	.	0.80722	D	1	P;P;P;P	0.43094	0.692;0.799;0.536;0.551	B;B;B;B	0.42738	0.364;0.364;0.396;0.364	T	0.71434	-0.4594	9	0.72032	D	0.01	-38.685	14.6379	0.68702	0.0:0.0:0.0:1.0	.	385;375;385;375	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	T	257;384;375	ENSP00000384055:I384T;ENSP00000318472:I375T	ENSP00000318472:I375T	I	+	2	0	NCAM1	112607641	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.796000	0.85898	2.110000	0.64415	0.402000	0.26972	ATC	.		0.582	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
NCOA2	10499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	71036125	71036125	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:71036125G>A	ENST00000452400.2	-	21	4468	c.4287C>T	c.(4285-4287)ccC>ccT	p.P1429P	NCOA2_ENST00000267974.4_Silent_p.P517P	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	1429					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TCACCTGCTCGGGACCCATGG	0.507			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.P1429P		.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	639	0			c.C4287T						.						74.0	72.0	73.0					8																	71036125		2113	4231	6344	SO:0001819	synonymous_variant	10499	exon21			CTGCTCGGGACCC	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.4287C>T	8.37:g.71036125G>A		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	34.0	NM_006540	Q14CD2	Silent	SNP	ENST00000452400.2	37	CCDS47872.1	.	.	.	.	.	.	.	.	.	.	G	9.294	1.051388	0.19827	.	.	ENSG00000140396	ENST00000518363	.	.	.	5.8	-0.043	0.13861	.	0.102095	0.64402	D	0.000002	T	0.56920	0.2018	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54417	-0.8297	6	0.87932	D	0	.	3.9919	0.09541	0.3857:0.0:0.3562:0.2581	.	.	.	.	L	530	.	ENSP00000429132:P530L	P	-	2	0	NCOA2	71198679	0.183000	0.23186	0.999000	0.59377	0.995000	0.86356	-0.353000	0.07691	0.040000	0.15660	0.655000	0.94253	CCG	.		0.507	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
NEB	4703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152512686	152512686	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:152512686A>G	ENST00000172853.10	-	49	6623	c.6476T>C	c.(6475-6477)aTg>aCg	p.M2159T	NEB_ENST00000604864.1_Missense_Mutation_p.M2159T|NEB_ENST00000603639.1_Missense_Mutation_p.M2159T|NEB_ENST00000427231.2_Missense_Mutation_p.M2159T|NEB_ENST00000409198.1_Missense_Mutation_p.M2159T|NEB_ENST00000397345.3_Missense_Mutation_p.M2159T			P20929	NEBU_HUMAN	nebulin	2159					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TATGCGATTCATATTCCTGGT	0.448																																					p.M2159T		.											.	NEB	145	0			c.T6476C						.						394.0	384.0	387.0					2																	152512686		2069	4203	6272	SO:0001583	missense	4703	exon49			CGATTCATATTCC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.6476T>C	2.37:g.152512686A>G	ENSP00000172853:p.Met2159Thr	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	20.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37		.	.	.	.	.	.	.	.	.	.	A	15.88	2.964020	0.53507	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.83	5.83	0.93111	.	0.133804	0.64402	D	0.000004	T	0.41926	0.1180	L	0.47716	1.5	0.80722	D	1	P	0.51351	0.944	P	0.55455	0.776	T	0.08576	-1.0715	10	0.20046	T	0.44	.	16.194	0.82011	1.0:0.0:0.0:0.0	.	2159	P20929	NEBU_HUMAN	T	2159	ENSP00000386259:M2159T;ENSP00000380505:M2159T;ENSP00000416578:M2159T;ENSP00000172853:M2159T	ENSP00000172853:M2159T	M	-	2	0	NEB	152220932	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.220000	0.72237	2.225000	0.72522	0.460000	0.39030	ATG	.		0.448	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
NEDD1	121441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	97337446	97337446	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:97337446C>A	ENST00000266742.4	+	12	1742	c.1403C>A	c.(1402-1404)tCt>tAt	p.S468Y	NEDD1_ENST00000411739.2_Missense_Mutation_p.S379Y|NEDD1_ENST00000457368.2_Missense_Mutation_p.S379Y|NEDD1_ENST00000557644.1_Missense_Mutation_p.S475Y|NEDD1_ENST00000429527.2_Missense_Mutation_p.S468Y	NM_152905.3	NP_690869.1	Q8NHV4	NEDD1_HUMAN	neural precursor cell expressed, developmentally down-regulated 1	468					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	apical part of cell (GO:0045177)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|pericentriolar material (GO:0000242)|spindle pole (GO:0000922)				breast(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)	22						TTTATGGGATCTCCAGGGAAA	0.363																																					p.S475Y		.											.	NEDD1	90	0			c.C1424A						.						99.0	97.0	97.0					12																	97337446		2203	4300	6503	SO:0001583	missense	121441	exon11			TGGGATCTCCAGG		CCDS9063.1, CCDS44955.1, CCDS44956.1	12q23.1	2013-01-10			ENSG00000139350	ENSG00000139350		"""WD repeat domain containing"""	7723	protein-coding gene	gene with protein product		600372					Standard	NM_001135175		Approved	GCP-WD, TUBGCP7	uc001tev.4	Q8NHV4	OTTHUMG00000170604	ENST00000266742.4:c.1403C>A	12.37:g.97337446C>A	ENSP00000266742:p.Ser468Tyr	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	19.0	NM_001135175	B0AZN0|B4E145|G3V3F1|Q8NA30	Missense_Mutation	SNP	ENST00000266742.4	37	CCDS9063.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885104	0.51908	.	.	ENSG00000139350	ENST00000266742;ENST00000429527;ENST00000411739;ENST00000557644;ENST00000457368	T;T;T;T;T	0.50277	0.76;0.76;1.53;0.75;1.53	5.25	2.98	0.34508	.	0.389844	0.31909	N	0.006869	T	0.40347	0.1113	L	0.51422	1.61	0.39434	D	0.96712	P;P	0.42620	0.785;0.498	P;B	0.46253	0.509;0.312	T	0.42999	-0.9418	10	0.02654	T	1	.	9.2259	0.37407	0.1466:0.7667:0.0:0.0867	.	475;468	G3V3F1;Q8NHV4	.;NEDD1_HUMAN	Y	468;468;379;475;379	ENSP00000266742:S468Y;ENSP00000404978:S468Y;ENSP00000411307:S379Y;ENSP00000451211:S475Y;ENSP00000407964:S379Y	ENSP00000266742:S468Y	S	+	2	0	NEDD1	95861577	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	2.370000	0.44240	1.148000	0.42385	0.650000	0.86243	TCT	.		0.363	NEDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409792.1		
NF1	4763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29554603	29554603	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:29554603A>C	ENST00000358273.4	+	20	2771	c.2388A>C	c.(2386-2388)aaA>aaC	p.K796N	NF1_ENST00000356175.3_Missense_Mutation_p.K796N	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	796					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(4)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACTATCCAAAAGCCAAAATGG	0.353			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.K796N		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1	3353	12	Whole gene deletion(8)|Unknown(4)	soft_tissue(7)|autonomic_ganglia(2)|central_nervous_system(2)|lung(1)	c.A2388C						.						89.0	77.0	81.0					17																	29554603		2203	4300	6503	SO:0001583	missense	4763	exon20	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TCCAAAAGCCAAA		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2388A>C	17.37:g.29554603A>C	ENSP00000351015:p.Lys796Asn	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	18.0	NM_000267	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	ENST00000358273.4	37	CCDS42292.1	.	.	.	.	.	.	.	.	.	.	.	20.4	3.978953	0.74360	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.10573	3.02;3.16;2.86	4.83	2.52	0.30459	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.21550	0.0519	L	0.45352	1.415	0.80722	D	1	D;D;D	0.89917	1.0;0.989;0.998	D;D;D	0.91635	0.999;0.978;0.919	T	0.00327	-1.1814	10	0.72032	D	0.01	.	8.7724	0.34740	0.7526:0.0:0.2474:0.0	.	796;796;796	E1P657;P21359-2;P21359	.;.;NF1_HUMAN	N	796;796;462	ENSP00000351015:K796N;ENSP00000348498:K796N;ENSP00000389907:K462N	ENSP00000348498:K796N	K	+	3	2	NF1	26578729	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.752000	0.62176	0.258000	0.21686	0.528000	0.53228	AAA	.		0.353	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
NIPSNAP3B	55335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	9	107533137	107533137	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:107533137T>A	ENST00000374762.3	+	4	509	c.438T>A	c.(436-438)taT>taA	p.Y146*	NIPSNAP3B_ENST00000461177.1_3'UTR	NM_018376.2	NP_060846.2	Q9BS92	NPS3B_HUMAN	nipsnap homolog 3B (C. elegans)	146										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	11						TAGGAGTCTATGAACTAGCTG	0.378																																					p.Y146X		.											.	NIPSNAP3B	92	0			c.T438A						.						106.0	103.0	104.0					9																	107533137		2203	4300	6503	SO:0001587	stop_gained	55335	exon4			AGTCTATGAACTA	BC017914	CCDS6761.1	9q31.3	2003-11-27			ENSG00000165028	ENSG00000165028			23641	protein-coding gene	gene with protein product		608872				12477932	Standard	NM_018376		Approved	FLJ11275	uc004bci.3	Q9BS92	OTTHUMG00000020414	ENST00000374762.3:c.438T>A	9.37:g.107533137T>A	ENSP00000363894:p.Tyr146*	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	31.0	NM_018376	Q5VX30|Q9NUM2	Nonsense_Mutation	SNP	ENST00000374762.3	37	CCDS6761.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.397855	0.62177	.	.	ENSG00000165028	ENST00000374762	.	.	.	4.06	0.227	0.15359	.	0.067660	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2509	4.7884	0.13236	0.1383:0.159:0.0:0.7027	.	.	.	.	X	146	.	ENSP00000363894:Y146X	Y	+	3	2	NIPSNAP3B	106572958	1.000000	0.71417	0.987000	0.45799	0.509000	0.34042	0.501000	0.22578	-0.054000	0.13266	0.533000	0.62120	TAT	.		0.378	NIPSNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053486.1	NM_018376	
NKD2	85409	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	1036382	1036382	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:1036382A>T	ENST00000296849.5	+	9	899	c.670A>T	c.(670-672)Act>Tct	p.T224S	NKD2_ENST00000537972.1_Missense_Mutation_p.T224S|NKD2_ENST00000274150.4_Missense_Mutation_p.T224S|NKD2_ENST00000382730.2_5'Flank	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	224					exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			GAGGCCCAGTACTGACCCCCA	0.667																																					p.T224S		.											.	NKD2	226	0			c.A670T						.						44.0	39.0	41.0					5																	1036382		2202	4299	6501	SO:0001583	missense	85409	exon9			CCCAGTACTGACC	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.670A>T	5.37:g.1036382A>T	ENSP00000296849:p.Thr224Ser	Somatic	67.0	1.0		WXS	Illumina HiSeq	Phase_I	54.0	25.0	NM_001271082	Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	37	CCDS3859.1	.	.	.	.	.	.	.	.	.	.	A	2.287	-0.363262	0.05103	.	.	ENSG00000145506	ENST00000296849;ENST00000274150;ENST00000537972	T;T;T	0.62498	1.07;0.02;0.02	4.2	-3.43	0.04810	.	1.426870	0.04266	N	0.341177	T	0.34454	0.0898	N	0.11427	0.14	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.16289	0.015;0.005	T	0.28681	-1.0036	10	0.06365	T	0.9	-16.0234	5.3551	0.16057	0.5417:0.1576:0.3007:0.0	.	224;224	Q969F2-2;Q969F2	.;NKD2_HUMAN	S	224	ENSP00000296849:T224S;ENSP00000274150:T224S;ENSP00000440925:T224S	ENSP00000274150:T224S	T	+	1	0	NKD2	1089382	0.000000	0.05858	0.000000	0.03702	0.081000	0.17604	0.180000	0.16860	-0.327000	0.08551	-1.585000	0.00851	ACT	.		0.667	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120	
NOS2	4843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26089920	26089920	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:26089920T>A	ENST00000313735.6	-	22	2937	c.2704A>T	c.(2704-2706)Att>Ttt	p.I902F		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	902	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GGCTTCAGAATGGGGAGCTGG	0.602																																					p.I902F		.											.	NOS2	156	0			c.A2704T						.						28.0	26.0	27.0					17																	26089920		2202	4299	6501	SO:0001583	missense	4843	exon22			TCAGAATGGGGAG	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2704A>T	17.37:g.26089920T>A	ENSP00000327251:p.Ile902Phe	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	24.0	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	37	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.353507	0.41700	.	.	ENSG00000007171	ENST00000313735;ENST00000379105	T	0.33216	1.42	4.9	-0.729	0.11158	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.653207	0.14699	N	0.303707	T	0.18087	0.0434	N	0.22421	0.69	0.21527	N	0.999658	B	0.06786	0.001	B	0.14578	0.011	T	0.18461	-1.0336	10	0.51188	T	0.08	.	7.8613	0.29511	0.0:0.1889:0.5534:0.2577	.	902	P35228	NOS2_HUMAN	F	902;863	ENSP00000327251:I902F	ENSP00000327251:I902F	I	-	1	0	NOS2	23114047	0.001000	0.12720	0.054000	0.19295	0.952000	0.60782	0.254000	0.18314	-0.095000	0.12351	0.374000	0.22700	ATT	.		0.602	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
NOTCH4	4855	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	32163815	32163815	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:32163815G>A	ENST00000375023.3	-	30	5549	c.5411C>T	c.(5410-5412)gCg>gTg	p.A1804V	GPSM3_ENST00000375043.3_5'Flank|NOTCH4_ENST00000443903.2_Silent_p.G180G	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1804					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						AGCGACGTCCGCCGGCGCTAG	0.701																																					p.A1804V		.											.	NOTCH4	1321	0			c.C5411T						.						8.0	10.0	10.0					6																	32163815		1393	2625	4018	SO:0001583	missense	4855	exon30			ACGTCCGCCGGCG		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.5411C>T	6.37:g.32163815G>A	ENSP00000364163:p.Ala1804Val	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	13.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528618	0.27299	.	.	ENSG00000204301	ENST00000375023	T	0.70986	-0.53	4.71	-6.15	0.02105	Ankyrin repeat-containing domain (3);	1.684020	0.03641	N	0.239512	T	0.33990	0.0882	N	0.16833	0.445	0.09310	N	0.999995	B;P	0.37158	0.207;0.585	B;B	0.24848	0.056;0.036	T	0.32719	-0.9896	10	0.62326	D	0.03	.	18.8395	0.92177	0.0:0.1482:0.7799:0.0719	.	1804;1803	Q99466;B0S882	NOTC4_HUMAN;.	V	1804	ENSP00000364163:A1804V	ENSP00000364163:A1804V	A	-	2	0	NOTCH4	32271793	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	0.383000	0.20651	-0.972000	0.03559	-0.344000	0.07964	GCG	.		0.701	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
NOX3	50508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	155776020	155776020	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:155776020G>A	ENST00000159060.2	-	3	282	c.180C>T	c.(178-180)tgC>tgT	p.C60C		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	60	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TAAAATTCAGGCACAGTGCGG	0.368																																					p.C60C		.											.	NOX3	91	0			c.C180T						.						55.0	57.0	56.0					6																	155776020		2203	4300	6503	SO:0001819	synonymous_variant	50508	exon3			ATTCAGGCACAGT	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.180C>T	6.37:g.155776020G>A		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	32.0	NM_015718	Q9HBJ9	Silent	SNP	ENST00000159060.2	37	CCDS5250.1																																																																																			.		0.368	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
NPS	594857	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	129350903	129350903	+	Nonstop_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:129350903A>T	ENST00000398023.1	+	3	290	c.270A>T	c.(268-270)tgA>tgT	p.*90C		NM_001030013.1	NP_001025184.1	P0C0P6	NPS_HUMAN	neuropeptide S	0					neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|visual learning (GO:0008542)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						CAAAATCATGACTAAGTGTGC	0.408																																					p.X90C		.											.	NPS	22	0			c.A270T						.						103.0	101.0	102.0					10																	129350903		1873	4111	5984	SO:0001578	stop_lost	594857	exon3			ATCATGACTAAGT	BC148465	CCDS41577.1	10q26.2	2013-02-26			ENSG00000214285	ENSG00000214285		"""Endogenous ligands"""	33940	protein-coding gene	gene with protein product	"""prepro-neuropeptide S"""	609513				18181564, 15312648	Standard	NM_001030013		Approved		uc001ljx.1	P0C0P6		ENST00000398023.1:c.270A>T	10.37:g.129350903A>T	ENSP00000381105:p.*90Cysext*?	Somatic	89.0	1.0		WXS	Illumina HiSeq	Phase_I	76.0	16.0	NM_001030013		Missense_Mutation	SNP	ENST00000398023.1	37	CCDS41577.1	.	.	.	.	.	.	.	.	.	.	A	16.80	3.223848	0.58668	.	.	ENSG00000214285	ENST00000398023	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1579	0.42833	0.9256:0.0:0.0743:0.0	.	.	.	.	C	90	.	.	X	+	3	0	NPS	129240893	0.999000	0.42202	0.893000	0.35052	0.818000	0.46254	4.337000	0.59310	2.131000	0.65755	0.477000	0.44152	TGA	.		0.408	NPS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001030013	
NR1H3	10062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	47289839	47289839	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:47289839A>C	ENST00000467728.1	+	8	2368	c.1130A>C	c.(1129-1131)cAg>cCg	p.Q377P	MADD_ENST00000342922.4_5'Flank|MADD_ENST00000407859.3_5'Flank|MADD_ENST00000311027.5_5'Flank|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000402192.2_5'Flank|NR1H3_ENST00000481889.2_Missense_Mutation_p.Q396P|NR1H3_ENST00000529540.1_3'UTR|MADD_ENST00000349238.3_5'Flank|NR1H3_ENST00000405853.3_Missense_Mutation_p.Q317P|NR1H3_ENST00000395397.3_Missense_Mutation_p.Q332P|NR1H3_ENST00000527949.1_Missense_Mutation_p.Q226P|NR1H3_ENST00000405576.1_Missense_Mutation_p.Q272P|NR1H3_ENST00000407404.1_Missense_Mutation_p.Q317P|MADD_ENST00000395336.3_5'Flank|NR1H3_ENST00000441012.2_Missense_Mutation_p.Q377P|MADD_ENST00000395344.3_5'Flank|MADD_ENST00000402799.1_5'Flank|RP11-17G12.3_ENST00000543925.1_RNA|MADD_ENST00000406482.1_5'Flank			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	377	Ligand-binding. {ECO:0000255}.				apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						GACCAGCTCCAGGTAGAGAGG	0.552																																					p.Q383P		.											.	NR1H3	228	0			c.A1148C						.						99.0	83.0	88.0					11																	47289839		2201	4298	6499	SO:0001583	missense	10062	exon9			AGCTCCAGGTAGA	U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.1130A>C	11.37:g.47289839A>C	ENSP00000420656:p.Gln377Pro	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	27.0	NM_001251934	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	37	CCDS7929.1	.	.	.	.	.	.	.	.	.	.	A	19.47	3.833615	0.71258	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000407404;ENST00000441012;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;D;D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13;-4.13	5.4	5.4	0.78164	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.063133	0.64402	D	0.000003	D	0.94241	0.8151	N	0.11560	0.145	0.43421	D	0.995573	B;P;D;P;P	0.54047	0.032;0.847;0.964;0.799;0.892	B;P;P;P;P	0.62813	0.086;0.625;0.907;0.63;0.491	D	0.93652	0.6974	10	0.46703	T	0.11	.	9.4075	0.38471	0.7331:0.0:0.0:0.2669	.	383;272;377;396;317	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	P	332;272;396;317;377;377;317;226	ENSP00000378793:Q332P;ENSP00000385073:Q272P;ENSP00000433271:Q396P;ENSP00000385801:Q317P;ENSP00000387946:Q377P;ENSP00000420656:Q377P;ENSP00000384745:Q317P;ENSP00000432073:Q226P	ENSP00000378793:Q332P	Q	+	2	0	NR1H3	47246415	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.460000	0.73518	2.181000	0.69327	0.533000	0.62120	CAG	.		0.552	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3		
NRG1	3084	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	31498128	31498128	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:31498128G>A	ENST00000520407.1	+	1	858	c.628G>A	c.(628-630)Gag>Aag	p.E210K	NRG1_ENST00000519301.1_Intron	NM_013962.2	NP_039256.2	Q02297	NRG1_HUMAN	neuregulin 1	593	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTTCTTCATGGAGCCCGACGC	0.687																																					p.E210K		.											.	NRG1	525	0			c.G628A						.						15.0	19.0	17.0					8																	31498128		1995	4133	6128	SO:0001583	missense	3084	exon1			TTCATGGAGCCCG	L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000520407.1:c.628G>A	8.37:g.31498128G>A	ENSP00000434640:p.Glu210Lys	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	34.0	NM_013962	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	ENST00000520407.1	37	CCDS47836.1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291804	0.59976	.	.	ENSG00000157168	ENST00000520407;ENST00000523534	T;T	0.74632	-0.86;-0.65	4.53	4.53	0.55603	.	.	.	.	.	T	0.79046	0.4380	.	.	.	0.80722	D	1	D	0.61697	0.99	P	0.53313	0.723	T	0.80079	-0.1532	8	0.44086	T	0.13	.	14.7546	0.69554	0.0:0.0:1.0:0.0	.	210	Q02297-9	.	K	210;63	ENSP00000434640:E210K;ENSP00000429067:E63K	ENSP00000434640:E210K	E	+	1	0	NRG1	31617670	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.844000	0.69430	2.075000	0.62263	0.563000	0.77884	GAG	.		0.687	NRG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376412.2		
OBSCN	84033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	228550304	228550304	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:228550304A>C	ENST00000422127.1	+	80	18733	c.18689A>C	c.(18688-18690)gAg>gCg	p.E6230A	OBSCN_ENST00000570156.2_Missense_Mutation_p.E7187A|OBSCN_ENST00000366707.4_Missense_Mutation_p.E3864A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6230					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCGGACCAGGAGGTCACATCT	0.687																																					p.E7187A		.											.	OBSCN	403	0			c.A21560C						.						43.0	48.0	46.0					1																	228550304		1942	4141	6083	SO:0001583	missense	84033	exon91			ACCAGGAGGTCAC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18689A>C	1.37:g.228550304A>C	ENSP00000409493:p.Glu6230Ala	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	278.0	103.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	A	12.27	1.888321	0.33348	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.62105	0.05;0.08	4.06	1.55	0.23275	.	0.146689	0.43919	D	0.000514	T	0.37489	0.1005	N	0.24115	0.695	0.09310	N	1	B	0.12013	0.005	B	0.04013	0.001	T	0.16571	-1.0398	10	0.08837	T	0.75	.	5.5178	0.16916	0.6453:0.1812:0.0:0.1735	.	6230	Q5VST9	OBSCN_HUMAN	A	6230;3864	ENSP00000409493:E6230A;ENSP00000355668:E3864A	ENSP00000355668:E3864A	E	+	2	0	OBSCN	226616927	0.090000	0.21635	0.000000	0.03702	0.005000	0.04900	1.068000	0.30629	0.192000	0.20272	-0.619000	0.04042	GAG	.		0.687	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OGN	4969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	95148565	95148565	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:95148565A>T	ENST00000262551.4	-	6	1064	c.644T>A	c.(643-645)cTc>cAc	p.L215H	CENPP_ENST00000375587.3_Intron|OGN_ENST00000375561.5_Missense_Mutation_p.L215H	NM_033014.2	NP_148935.1	P20774	MIME_HUMAN	osteoglycin	215					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|negative regulation of smooth muscle cell proliferation (GO:0048662)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	13						GAGGAAGGTGAGGTTATTCAG	0.368																																					p.L215H		.											.	OGN	492	0			c.T644A						.						193.0	186.0	189.0					9																	95148565		2203	4300	6503	SO:0001583	missense	4969	exon6			AAGGTGAGGTTAT	AI424992	CCDS6695.1	9q22	2008-02-05	2007-02-16		ENSG00000106809	ENSG00000106809		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	8126	protein-coding gene	gene with protein product	"""mimecan proteoglycan"""	602383	"""osteoglycin (osteoinductive factor)"""			2372374	Standard	NM_033014		Approved	mimecan, OIF, SLRR3A	uc004asa.3	P20774	OTTHUMG00000020224	ENST00000262551.4:c.644T>A	9.37:g.95148565A>T	ENSP00000262551:p.Leu215His	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	29.0	NM_033014	Q6FIB0|Q9UF90|Q9UNK5	Missense_Mutation	SNP	ENST00000262551.4	37	CCDS6695.1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.993261	0.54041	.	.	ENSG00000106809	ENST00000262551;ENST00000375561	D;D	0.94897	-3.55;-3.55	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	D	0.98425	0.9476	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.99;0.994	D	0.99780	1.1027	10	0.87932	D	0	.	15.7668	0.78131	1.0:0.0:0.0:0.0	.	273;215	B4DI63;P20774	.;MIME_HUMAN	H	215	ENSP00000262551:L215H;ENSP00000364711:L215H	ENSP00000262551:L215H	L	-	2	0	OGN	94188386	1.000000	0.71417	0.580000	0.28601	0.082000	0.17680	8.606000	0.90888	2.266000	0.75297	0.533000	0.62120	CTC	.		0.368	OGN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053087.1	NM_024416	
OLFM3	118427	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	102269846	102269846	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:102269846A>T	ENST00000338858.5	-	6	1384	c.1385T>A	c.(1384-1386)gTg>gAg	p.V462E	OLFM3_ENST00000462354.1_5'UTR|OLFM3_ENST00000536598.1_3'UTR|OLFM3_ENST00000370103.4_Missense_Mutation_p.V442E			Q96PB7	NOE3_HUMAN	olfactomedin 3	462	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				eye photoreceptor cell development (GO:0042462)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)				breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(24)|ovary(3)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	43		all_epithelial(167;1.87e-06)|all_lung(203;8.12e-05)|Lung NSC(277;0.000189)		all cancers(265;0.0843)|Epithelial(280;0.0921)|COAD - Colon adenocarcinoma(174;0.145)		ATTGAACAGCACCTGGTGGCC	0.403																																					p.V442E		.											.	OLFM3	93	0			c.T1325A						.						153.0	145.0	148.0					1																	102269846		2203	4300	6503	SO:0001583	missense	118427	exon6			AACAGCACCTGGT	AF397392	CCDS30781.1, CCDS72832.1	1p22	2008-05-23			ENSG00000118733	ENSG00000118733			17990	protein-coding gene	gene with protein product	"""optimedin"""	607567				12019210, 16115881	Standard	NM_001288821		Approved	NOE3	uc001dug.2	Q96PB7	OTTHUMG00000010941	ENST00000338858.5:c.1385T>A	1.37:g.102269846A>T	ENSP00000345192:p.Val462Glu	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	33.0	NM_058170	Q5T3V6|Q6IMI7|Q6IMI8|Q6IMI9|Q6IMJ1|Q8TBG1|Q96PB2|Q96PB3|Q96PB4|Q96PB5|Q96PB6	Missense_Mutation	SNP	ENST00000338858.5	37		.	.	.	.	.	.	.	.	.	.	A	19.80	3.895036	0.72639	.	.	ENSG00000118733	ENST00000370103;ENST00000338858	D;D	0.90955	-2.76;-2.76	5.47	5.47	0.80525	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.95812	0.8637	M	0.91090	3.175	0.80722	D	1	D;D	0.76494	0.992;0.999	D;D	0.81914	0.961;0.995	D	0.96761	0.9561	10	0.87932	D	0	.	15.8388	0.78824	1.0:0.0:0.0:0.0	.	442;462	Q5T3V6;Q96PB7	.;NOE3_HUMAN	E	442;462	ENSP00000359121:V442E;ENSP00000345192:V462E	ENSP00000345192:V462E	V	-	2	0	OLFM3	102042434	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.910000	0.92685	2.202000	0.70862	0.528000	0.53228	GTG	.		0.403	OLFM3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000030142.1		
OR10H1	26539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15917916	15917916	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:15917916T>G	ENST00000334920.2	-	1	1020	c.932A>C	c.(931-933)tAc>tCc	p.Y311S		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						TTTTTCTGGGTAGAGTTTACT	0.443																																					p.Y311S		.											.	OR10H1	68	0			c.A932C						.						90.0	87.0	88.0					19																	15917916		2203	4300	6503	SO:0001583	missense	26539	exon1			TCTGGGTAGAGTT	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.932A>C	19.37:g.15917916T>G	ENSP00000335596:p.Tyr311Ser	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	9.0	NM_013940	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	37	CCDS12335.1	.	.	.	.	.	.	.	.	.	.	.	5.422	0.262931	0.10294	.	.	ENSG00000186723	ENST00000334920	T	0.35421	1.31	4.42	-3.51	0.04696	.	1.317390	0.05459	N	0.550803	T	0.10121	0.0248	N	0.01188	-0.97	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16158	-1.0412	10	0.22706	T	0.39	.	0.9319	0.01337	0.2696:0.3674:0.16:0.2031	.	311	Q9Y4A9	O10H1_HUMAN	S	311	ENSP00000335596:Y311S	ENSP00000335596:Y311S	Y	-	2	0	OR10H1	15778916	0.032000	0.19561	0.000000	0.03702	0.001000	0.01503	1.451000	0.35145	-0.170000	0.10816	-0.263000	0.10527	TAC	.		0.443	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
OR12D3	81797	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	29342442	29342442	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:29342442delG	ENST00000396806.3	-	1	626	c.623delC	c.(622-624)gctfs	p.A208fs	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						CAGAAAGAAAGCTCCCATGGA	0.453																																					p.A208fs		.											.	OR12D3	133	0			c.623delC						.						77.0	82.0	80.0					6																	29342442		1511	2709	4220	SO:0001589	frameshift_variant	81797	exon1			AAGAAAGCTCCCA		CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.623delC	6.37:g.29342442delG	ENSP00000380023:p.Ala208fs	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	16.0	NM_030959	A2BDZ1|Q5SQI8|Q6IF23	Frame_Shift_Del	DEL	ENST00000396806.3	37	CCDS4658.1																																																																																			.		0.453	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076056.3		
OR2B2	81697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27879561	27879561	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:27879561A>G	ENST00000303324.2	-	1	613	c.537T>C	c.(535-537)tgT>tgC	p.C179C		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	179						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						CAGGGACTTCACAGAAGAAGT	0.453																																					p.C179C		.											.	OR2B2	68	0			c.T537C						.						99.0	92.0	94.0					6																	27879561		2203	4300	6503	SO:0001819	synonymous_variant	81697	exon1			GACTTCACAGAAG	Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.537T>C	6.37:g.27879561A>G		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	28.0	NM_033057	B2RNH2|Q9GZL2|Q9Y299	Silent	SNP	ENST00000303324.2	37	CCDS4641.1																																																																																			.		0.453	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040163.1		
OR2L5	81466	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	248186105	248186105	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:248186105C>A	ENST00000355281.1	+	1	856	c.856C>A	c.(856-858)Ccc>Acc	p.P286T	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	286						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AATGCTCAACCCCATCATCTA	0.473																																					p.P286T		.											.	.	.	0			c.C856A						.																																			SO:0001583	missense	81466	exon1			CTCAACCCCATCA		CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.856C>A	1.37:g.248186105C>A	ENSP00000347428:p.Pro286Thr	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	34.0	NM_001258284	Q6IF04	Missense_Mutation	SNP	ENST00000355281.1	37	CCDS58068.1	.	.	.	.	.	.	.	.	.	.	.	15.59	2.877564	0.51801	.	.	ENSG00000197454	ENST00000355281	T	0.63913	-0.07	2.17	2.17	0.27698	.	.	.	.	.	T	0.69655	0.3135	.	.	.	0.39775	D	0.972219	.	.	.	.	.	.	T	0.74103	-0.3773	6	0.87932	D	0	.	11.056	0.47918	0.0:1.0:0.0:0.0	.	.	.	.	T	286	ENSP00000347428:P286T	ENSP00000347428:P286T	P	+	1	0	OR2L5	246252728	0.995000	0.38212	0.043000	0.18650	0.742000	0.42306	5.527000	0.67123	1.030000	0.39839	0.184000	0.17185	CCC	.		0.473	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096851.1		
OR3A1	4994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	3195335	3195335	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:3195335T>C	ENST00000323404.1	-	1	541	c.542A>G	c.(541-543)tAc>tGc	p.Y181C	RP11-64J4.2_ENST00000573491.1_RNA	NM_002550.2	NP_002541.2	P47881	OR3A1_HUMAN	olfactory receptor, family 3, subfamily A, member 1	181					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	20						GAGGTCACAGTAGAAGTGATT	0.547																																					p.Y181C	GBM(20;287 516 18743 28660 36594)	.											.	OR3A1	70	0			c.A542G						.						163.0	150.0	155.0					17																	3195335		2203	4300	6503	SO:0001583	missense	4994	exon1			TCACAGTAGAAGT	X80391	CCDS11023.1	17p13.3	2012-08-09			ENSG00000180090	ENSG00000180090		"""GPCR / Class A : Olfactory receptors"""	8282	protein-coding gene	gene with protein product						8921386, 8647456	Standard	NM_002550		Approved	OLFRA03, OR40, OR17-40	uc002fvh.1	P47881	OTTHUMG00000090642	ENST00000323404.1:c.542A>G	17.37:g.3195335T>C	ENSP00000313803:p.Tyr181Cys	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	62.0	NM_002550	Q4VB06|Q6IFM4	Missense_Mutation	SNP	ENST00000323404.1	37	CCDS11023.1	.	.	.	.	.	.	.	.	.	.	T	15.55	2.867826	0.51588	.	.	ENSG00000180090	ENST00000323404	T	0.00024	8.97	5.01	3.85	0.44370	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000329	T	0.00300	0.0009	M	0.62266	1.93	0.32648	N	0.519729	D	0.89917	1.0	D	0.83275	0.996	T	0.62426	-0.6857	10	0.87932	D	0	-30.8067	9.516	0.39106	0.199:0.0:0.0:0.801	.	181	P47881	OR3A1_HUMAN	C	181	ENSP00000313803:Y181C	ENSP00000313803:Y181C	Y	-	2	0	OR3A1	3142085	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	1.126000	0.31344	2.223000	0.72356	0.528000	0.53228	TAC	.		0.547	OR3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207302.2		
OR4F6	390648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	102346471	102346471	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:102346471A>G	ENST00000328882.4	+	1	570	c.549A>G	c.(547-549)cgA>cgG	p.R183R		NM_001005326.1	NP_001005326.1	Q8NGB9	OR4F6_HUMAN	olfactory receptor, family 4, subfamily F, member 6	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(1)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			ATCTTCCTCGATTTATCAAAC	0.363																																					p.R183R		.											.	OR4F6	69	0			c.A549G						.						183.0	180.0	181.0					15																	102346471		2203	4299	6502	SO:0001819	synonymous_variant	390648	exon1			TCCTCGATTTATC	AC025234	CCDS32341.1	15q26.3	2014-02-19	2002-02-28		ENSG00000184140	ENSG00000184140		"""GPCR / Class A : Olfactory receptors"""	15372	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily F, member 12"""	OR4F12			Standard	NM_001005326		Approved		uc010utr.2	Q8NGB9	OTTHUMG00000172267	ENST00000328882.4:c.549A>G	15.37:g.102346471A>G		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	34.0	NM_001005326	B9EH28|Q6IF95	Silent	SNP	ENST00000328882.4	37	CCDS32341.1																																																																																			.		0.363	OR4F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417593.1		
OR52A1	23538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5172674	5172674	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:5172674A>G	ENST00000380367.1	-	2	1343	c.926T>C	c.(925-927)aTg>aCg	p.M309T	OR52A1_ENST00000328942.1_Missense_Mutation_p.M309T			Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A, member 1	309					sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	19		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGAACAGAACATTTTTACCAC	0.338																																					p.M309T		.											.	OR52A1	114	0			c.T926C						.						118.0	128.0	125.0					11																	5172674		2201	4297	6498	SO:0001583	missense	23538	exon1			CAGAACATTTTTA	AF154673	CCDS31374.1	11p15.4	2012-08-09			ENSG00000182070	ENSG00000182070		"""GPCR / Class A : Olfactory receptors"""	8318	protein-coding gene	gene with protein product						10512676	Standard	NM_012375		Approved	HPFH1OR	uc010qyy.2	Q9UKL2	OTTHUMG00000066603	ENST00000380367.1:c.926T>C	11.37:g.5172674A>G	ENSP00000369725:p.Met309Thr	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	19.0	NM_012375	Q6IF31	Missense_Mutation	SNP	ENST00000380367.1	37	CCDS31374.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.000225	0.35320	.	.	ENSG00000182070	ENST00000380367;ENST00000328942	T;T	0.37235	1.21;1.21	5.36	5.36	0.76844	.	0.304873	0.28470	N	0.015226	T	0.28632	0.0709	L	0.29908	0.895	0.22468	N	0.999075	B	0.26120	0.142	B	0.20184	0.028	T	0.23547	-1.0185	10	0.54805	T	0.06	.	14.3327	0.66569	1.0:0.0:0.0:0.0	.	309	Q9UKL2	O52A1_HUMAN	T	309	ENSP00000369725:M309T;ENSP00000333684:M309T	ENSP00000333684:M309T	M	-	2	0	OR52A1	5129250	0.653000	0.27358	0.481000	0.27354	0.193000	0.23685	1.419000	0.34793	2.254000	0.74563	0.528000	0.53228	ATG	.		0.338	OR52A1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142810.2	NM_012375	
OR5B17	219965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	58126348	58126348	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:58126348A>G	ENST00000357377.3	-	1	194	c.195T>C	c.(193-195)tcT>tcC	p.S65S		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	65						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TGCCTGCAAGAGACAGGTTAC	0.468																																					p.S65S		.											.	OR5B17	71	0			c.T195C						.						76.0	73.0	74.0					11																	58126348		2201	4295	6496	SO:0001819	synonymous_variant	219965	exon1			TGCAAGAGACAGG	AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.195T>C	11.37:g.58126348A>G		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	10.0	NM_001005489	Q6IEX1	Silent	SNP	ENST00000357377.3	37	CCDS31548.1																																																																																			.		0.468	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394708.2	NM_001005489	
OTUD7A	161725	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	15	31776404	31776404	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:31776404A>C	ENST00000307050.4	-	11	1966	c.1874T>G	c.(1873-1875)cTg>cGg	p.L625R	OTUD7A_ENST00000382902.1_Missense_Mutation_p.L632R	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	625					protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		GGCGGCGCGCAGGATGTTGAG	0.672																																					p.L625R		.											.	OTUD7A	502	0			c.T1874G						.						17.0	17.0	17.0					15																	31776404		2198	4294	6492	SO:0001583	missense	161725	exon11			GCGCGCAGGATGT	AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.1874T>G	15.37:g.31776404A>C	ENSP00000305926:p.Leu625Arg	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	10.0	NM_130901	Q8IWK5	Missense_Mutation	SNP	ENST00000307050.4	37	CCDS10026.1	.	.	.	.	.	.	.	.	.	.	A	19.86	3.905257	0.72868	.	.	ENSG00000169918	ENST00000307050;ENST00000382902	T;T	0.38722	1.12;1.12	4.61	4.61	0.57282	.	0.148435	0.44902	D	0.000411	T	0.53222	0.1783	L	0.34521	1.04	0.43050	D	0.994653	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.58526	-0.7621	10	0.87932	D	0	-16.4006	14.0325	0.64624	1.0:0.0:0.0:0.0	.	632;625	Q8TE49-2;Q8TE49	.;OTU7A_HUMAN	R	625;632	ENSP00000305926:L625R;ENSP00000372358:L632R	ENSP00000305926:L625R	L	-	2	0	OTUD7A	29563696	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.379000	0.90146	1.693000	0.51124	0.459000	0.35465	CTG	.		0.672	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251393.2	NM_130901	
P4HA2	8974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	131552947	131552947	+	Missense_Mutation	SNP	G	G	A	rs370556720		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:131552947G>A	ENST00000401867.1	-	5	842	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	P4HA2_ENST00000166534.4_Missense_Mutation_p.R92W|P4HA2_ENST00000379086.1_Missense_Mutation_p.R92W|P4HA2_ENST00000379100.2_Missense_Mutation_p.R92W|P4HA2_ENST00000360568.3_Missense_Mutation_p.R92W|P4HA2_ENST00000379104.2_Missense_Mutation_p.R92W			O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha polypeptide II	92					peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|procollagen-proline 4-dioxygenase complex (GO:0016222)	electron carrier activity (GO:0009055)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	GTGTTTAGCCGCTTCACCAGT	0.567																																					p.R92W	Esophageal Squamous(68;117 1135 17362 19256 34242)	.											.	P4HA2	68	0			c.C274T						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	137.0	116.0	123.0		274,274,274,274,274	4.3	1.0	5		123	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense	P4HA2	NM_001017973.1,NM_001017974.1,NM_001142598.1,NM_001142599.1,NM_004199.2	101,101,101,101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	92/534,92/534,92/534,92/536,92/536	131552947	1,13005	2203	4300	6503	SO:0001583	missense	8974	exon4			TTAGCCGCTTCAC	U90441	CCDS4151.1, CCDS34230.1	5q31	2008-12-09	2008-12-09		ENSG00000072682	ENSG00000072682	1.14.11.2		8547	protein-coding gene	gene with protein product	"""4-PH alpha 2"", ""collagen prolyl 4-hydroxylase alpha(II)"""	600608	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide II"""			9211872, 9149945	Standard	NM_001142598		Approved	C-P4Halpha(II)	uc003kwl.3	O15460	OTTHUMG00000059647	ENST00000401867.1:c.274C>T	5.37:g.131552947G>A	ENSP00000384999:p.Arg92Trp	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	18.0	NM_001017974	D3DQ85|D3DQ86|Q8WWN0	Missense_Mutation	SNP	ENST00000401867.1	37	CCDS4151.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431817	0.83776	0.0	1.16E-4	ENSG00000072682	ENST00000401867;ENST00000379086;ENST00000166534;ENST00000360568;ENST00000379104;ENST00000379100;ENST00000417528;ENST00000431054;ENST00000439698;ENST00000395164;ENST00000453286;ENST00000428369;ENST00000418055;ENST00000416053	T;T;T;T;T;T	0.68181	-0.3;-0.31;-0.3;-0.31;-0.3;-0.31	6.17	4.35	0.52113	Prolyl 4-hydroxylase alpha-subunit, N-terminal (1);	0.046090	0.85682	D	0.000000	D	0.86644	0.5982	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89956	0.4083	10	0.87932	D	0	-2.9059	14.4187	0.67168	0.0:0.0:0.6133:0.3867	.	92;92	O15460;O15460-2	P4HA2_HUMAN;.	W	92;92;92;92;92;92;92;124;92;92;92;92;92;92	ENSP00000384999:R92W;ENSP00000368379:R92W;ENSP00000166534:R92W;ENSP00000353772:R92W;ENSP00000368398:R92W;ENSP00000368394:R92W	ENSP00000166534:R92W	R	-	1	2	P4HA2	131580846	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	3.972000	0.56838	0.873000	0.35799	0.655000	0.94253	CGG	.		0.567	P4HA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132653.4	NM_004199	
PCDHB1	29930	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140432008	140432008	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:140432008A>G	ENST00000306549.3	+	1	1030	c.953A>G	c.(952-954)gAc>gGc	p.D318G		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	318	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TACGACATTGACATTCAAGCT	0.473																																					p.D318G		.											.	PCDHB1	90	0			c.A953G						.						121.0	117.0	118.0					5																	140432008		2203	4300	6503	SO:0001583	missense	29930	exon1			ACATTGACATTCA	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.953A>G	5.37:g.140432008A>G	ENSP00000307234:p.Asp318Gly	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	22.0	NM_013340	Q2M257	Missense_Mutation	SNP	ENST00000306549.3	37	CCDS4243.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.823468	0.32237	.	.	ENSG00000171815	ENST00000306549	T	0.01685	4.69	6.17	5.0	0.66597	Cadherin (5);Cadherin-like (1);	0.000000	0.49916	D	0.000129	T	0.02156	0.0067	L	0.50919	1.6	0.09310	N	1	P	0.38677	0.642	B	0.34418	0.182	T	0.46830	-0.9163	10	0.49607	T	0.09	.	7.3612	0.26748	0.6223:0.1293:0.0:0.2484	.	318	Q9Y5F3	PCDB1_HUMAN	G	318	ENSP00000307234:D318G	ENSP00000307234:D318G	D	+	2	0	PCDHB1	140412192	0.000000	0.05858	0.998000	0.56505	0.997000	0.91878	0.036000	0.13819	1.120000	0.41904	0.533000	0.62120	GAC	.		0.473	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PCDHB8	56128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140558117	140558117	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:140558117A>G	ENST00000239444.2	+	1	747	c.502A>G	c.(502-504)Att>Gtt	p.I168V	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	168	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCAAAACAATATTGAGAACTA	0.468																																					p.I168V		.											.	PCDHB8	131	0			c.A502G						.						64.0	99.0	87.0					5																	140558117		2203	4300	6503	SO:0001583	missense	56128	exon1			AACAATATTGAGA	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.502A>G	5.37:g.140558117A>G	ENSP00000239444:p.Ile168Val	Somatic	512.0	0.0		WXS	Illumina HiSeq	Phase_I	352.0	71.0	NM_019120	B9EGV1	Missense_Mutation	SNP	ENST00000239444.2	37	CCDS4250.1	.	.	.	.	.	.	.	.	.	.	a	0.202	-1.043999	0.01997	.	.	ENSG00000120322	ENST00000239444	T	0.50001	0.76	4.25	-1.6	0.08426	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.19046	0.0457	N	0.03016	-0.435	0.09310	N	1	B	0.10296	0.003	B	0.17979	0.02	T	0.23261	-1.0193	9	0.25106	T	0.35	.	5.2872	0.15708	0.507:0.2613:0.2317:0.0	.	168	Q9UN66	PCDB8_HUMAN	V	168	ENSP00000239444:I168V	ENSP00000239444:I168V	I	+	1	0	PCDHB8	140538301	0.000000	0.05858	0.002000	0.10522	0.183000	0.23260	-2.354000	0.01089	0.076000	0.16826	0.477000	0.44152	ATT	.		0.468	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PDE11A	50940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	178769916	178769916	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:178769916T>A	ENST00000286063.6	-	3	1389		c.e3-2		PDE11A_ENST00000358450.4_Splice_Site|PDE11A_ENST00000497003.1_Splice_Site|PDE11A_ENST00000449286.2_Splice_Site|PDE11A_ENST00000409504.1_Splice_Site	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	CTGCATAACCTGGGACAAAGA	0.368									Primary Pigmented Nodular Adrenocortical Disease, Familial																												.		.											.	PDE11A	93	0			c.322-2A>T						.						92.0	81.0	85.0					2																	178769916		2203	4300	6503	SO:0001630	splice_region_variant	50940	exon5	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	ATAACCTGGGACA	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1072-2A>T	2.37:g.178769916T>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	14.0	NM_001077197	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Splice_Site	SNP	ENST00000286063.6	37	CCDS33334.1	.	.	.	.	.	.	.	.	.	.	T	18.30	3.593438	0.66219	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000431253	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.357	0.74434	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDE11A	178478162	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	7.646000	0.83445	2.033000	0.60031	0.460000	0.39030	.	.		0.368	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334313.2		Intron
PHTF1	10745	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	114240970	114240970	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:114240970T>A	ENST00000369604.1	-	18	2665	c.2182A>T	c.(2182-2184)Aat>Tat	p.N728Y	PHTF1_ENST00000369598.1_Missense_Mutation_p.N683Y|PHTF1_ENST00000393357.2_Missense_Mutation_p.N728Y|PHTF1_ENST00000369596.2_Missense_Mutation_p.N675Y|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000369600.1_Missense_Mutation_p.N675Y			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	728					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTAAGGGATTCATTGTCAGT	0.353																																					p.N728Y		.											.	PHTF1	91	0			c.A2182T						.						139.0	137.0	138.0					1																	114240970		2203	4300	6503	SO:0001583	missense	10745	exon17			AGGGATTCATTGT	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.2182A>T	1.37:g.114240970T>A	ENSP00000358617:p.Asn728Tyr	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	18.0	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Missense_Mutation	SNP	ENST00000369604.1	37	CCDS861.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.312855	0.81358	.	.	ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.71771	0.3379	M	0.65975	2.015	0.80722	D	1	D	0.71674	0.998	D	0.63488	0.915	T	0.75593	-0.3264	9	0.87932	D	0	-26.9547	16.8222	0.85835	0.0:0.0:0.0:1.0	.	728	Q9UMS5	PHTF1_HUMAN	Y	683;728;675;683;675;728	.	ENSP00000358609:N675Y	N	-	1	0	PHTF1	114042493	1.000000	0.71417	0.999000	0.59377	0.587000	0.36485	7.984000	0.88150	2.371000	0.80710	0.533000	0.62120	AAT	.		0.353	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	47870917	47870917	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:47870917T>C	ENST00000289672.2	-	42	6421	c.6371A>G	c.(6370-6372)cAg>cGg	p.Q2124R		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2124					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						CCTTGACCACTGGGGCATTAG	0.577																																					p.Q2124R		.											.	PKD1L1	145	0			c.A6371G						.						87.0	79.0	82.0					7																	47870917		2203	4300	6503	SO:0001583	missense	168507	exon42			GACCACTGGGGCA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.6371A>G	7.37:g.47870917T>C	ENSP00000289672:p.Gln2124Arg	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	36.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.797068	0.00617	.	.	ENSG00000158683	ENST00000289672	T	0.18810	2.19	5.1	-10.2	0.00374	.	5.626960	0.00397	N	0.000054	T	0.07279	0.0184	N	0.05441	-0.05	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.20571	-1.0271	10	0.02654	T	1	0.4993	5.7735	0.18267	0.0761:0.1292:0.2271:0.5676	.	2124	Q8TDX9	PK1L1_HUMAN	R	2124	ENSP00000289672:Q2124R	ENSP00000289672:Q2124R	Q	-	2	0	PKD1L1	47837442	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.200000	0.01237	-4.757000	0.00033	-2.497000	0.00192	CAG	.		0.577	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
PLA2G4D	283748	broad.mit.edu;mdanderson.org	37	15	42362276	42362276	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:42362276C>A	ENST00000290472.3	-	19	2155	c.2061G>T	c.(2059-2061)gaG>gaT	p.E687D		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	687	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		GGCAGTACAGCTCCGTCTGCT	0.682																																					p.E687D		.											.	PLA2G4D	136	0			c.G2061T						.						14.0	12.0	13.0					15																	42362276		2012	3884	5896	SO:0001583	missense	283748	exon19			GTACAGCTCCGTC	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.2061G>T	15.37:g.42362276C>A	ENSP00000290472:p.Glu687Asp	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	4.0	NM_178034	Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	C	2.271	-0.366937	0.05069	.	.	ENSG00000159337	ENST00000290472	T	0.16324	2.35	5.31	5.31	0.75309	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.208574	0.32518	N	0.005995	T	0.11580	0.0282	L	0.42632	1.34	0.32594	N	0.526753	P	0.42827	0.791	B	0.32677	0.15	T	0.09729	-1.0661	10	0.13853	T	0.58	-12.3124	11.4043	0.49889	0.1801:0.8199:0.0:0.0	.	687	Q86XP0	PA24D_HUMAN	D	687	ENSP00000290472:E687D	ENSP00000290472:E687D	E	-	3	2	PLA2G4D	40149568	0.021000	0.18746	0.962000	0.40283	0.447000	0.32167	1.167000	0.31847	2.765000	0.95021	0.655000	0.94253	GAG	.		0.682	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419317.1	NM_178034	
PLCB4	5332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9364907	9364907	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:9364907T>A	ENST00000378493.1	+	11	928	c.913T>A	c.(913-915)Ttc>Atc	p.F305I	PLCB4_ENST00000334005.3_Missense_Mutation_p.F305I|PLCB4_ENST00000378501.2_Missense_Mutation_p.F305I|PLCB4_ENST00000378473.3_Missense_Mutation_p.F305I|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000414679.2_Missense_Mutation_p.F305I|PLCB4_ENST00000278655.4_Missense_Mutation_p.F305I			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	305					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CGCCCCAGTCTTCCTAGATCG	0.433																																					p.F305I		.											.	PLCB4	274	0			c.T913A						.						178.0	169.0	172.0					20																	9364907		2203	4300	6503	SO:0001583	missense	5332	exon12			CCAGTCTTCCTAG		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.913T>A	20.37:g.9364907T>A	ENSP00000367754:p.Phe305Ile	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	23.0	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	T	32	5.166947	0.94768	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3	5.93	5.93	0.95920	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.42381	0.1200	M	0.78637	2.42	0.80722	D	1	D;P;D;D	0.71674	0.998;0.795;0.985;0.997	D;B;D;D	0.72338	0.959;0.443;0.977;0.931	T	0.21930	-1.0231	10	0.22706	T	0.39	.	16.3756	0.83387	0.0:0.0:0.0:1.0	.	305;152;305;305	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	I	305;305;305;305;305;141	ENSP00000334105:F305I;ENSP00000367734:F305I;ENSP00000278655:F305I;ENSP00000367754:F305I;ENSP00000367762:F305I;ENSP00000390616:F141I	ENSP00000278655:F305I	F	+	1	0	PLCB4	9312907	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.984000	0.70548	2.270000	0.75569	0.460000	0.39030	TTC	.		0.433	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PLEC	5339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145001890	145001890	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:145001890G>A	ENST00000322810.4	-	27	4024	c.3855C>T	c.(3853-3855)gcC>gcT	p.A1285A	PLEC_ENST00000354589.3_Silent_p.A1148A|PLEC_ENST00000398774.2_Silent_p.A1116A|PLEC_ENST00000436759.2_Silent_p.A1175A|PLEC_ENST00000356346.3_Silent_p.A1134A|PLEC_ENST00000357649.2_Silent_p.A1152A|PLEC_ENST00000354958.2_Silent_p.A1126A|PLEC_ENST00000345136.3_Silent_p.A1148A|PLEC_ENST00000527096.1_Silent_p.A1171A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1285	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CATCCCGCAGGGCGTCGAACG	0.731																																					p.A1285A		.											.	PLEC	141	0			c.C3855T						.						7.0	8.0	8.0					8																	145001890		2028	4131	6159	SO:0001819	synonymous_variant	5339	exon27			CCGCAGGGCGTCG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3855C>T	8.37:g.145001890G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	11.0	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			.		0.731	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLIN4	729359	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	4511838	4511838	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:4511838T>A	ENST00000301286.3	-	3	2091	c.2092A>T	c.(2092-2094)Aaa>Taa	p.K698*		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	698	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						ACAGTCCCTTTGGCGACATTC	0.597																																					p.K698X		.											.	PLIN4	68	0			c.A2092T						.						254.0	275.0	268.0					19																	4511838		2155	4248	6403	SO:0001587	stop_gained	729359	exon3			TCCCTTTGGCGAC	AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.2092A>T	19.37:g.4511838T>A	ENSP00000301286:p.Lys698*	Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	41.0	NM_001080400	A6NEI2	Nonsense_Mutation	SNP	ENST00000301286.3	37	CCDS45927.1	.	.	.	.	.	.	.	.	.	.	T	37	6.172217	0.97348	.	.	ENSG00000167676	ENST00000301286	.	.	.	5.31	4.26	0.50523	.	0.133397	0.33290	N	0.005066	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4698	11.2107	0.48797	0.0:0.0:0.1541:0.8459	.	.	.	.	X	698	.	ENSP00000301286:K698X	K	-	1	0	PLIN4	4462838	0.001000	0.12720	0.993000	0.49108	0.196000	0.23810	0.571000	0.23669	0.811000	0.34303	0.386000	0.25728	AAA	.		0.597	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395095.1	XM_170901	
PLIN3	10226	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4844773	4844773	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:4844773C>A	ENST00000221957.4	-	7	1043	c.867G>T	c.(865-867)aaG>aaT	p.K289N	PLIN3_ENST00000592528.1_Missense_Mutation_p.K277N|PLIN3_ENST00000585479.1_Missense_Mutation_p.K289N	NM_001164189.1|NM_001164194.1|NM_005817.4	NP_001157661.1|NP_001157666.1|NP_005808.3	O60664	PLIN3_HUMAN	perilipin 3	289					vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|membrane (GO:0016020)				cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9					Galsulfase(DB01279)|Idursulfase(DB01271)	CTTCCACCAGCTTCTGATCAA	0.607																																					p.K289N		.											.	PLIN3	90	0			c.G867T						.						40.0	32.0	35.0					19																	4844773		2203	4299	6502	SO:0001583	missense	10226	exon7			CACCAGCTTCTGA	AF051314	CCDS12137.1, CCDS59337.1, CCDS59338.1	19p13.3	2009-08-12	2009-08-12	2009-08-12		ENSG00000105355		"""Perilipins"""	16893	protein-coding gene	gene with protein product	"""cargo selection protein (mannose 6 phosphate receptor binding protein)"", ""placental protein 17"", ""MPR-BINDING PROTEIN, 47-KD"""	602702	"""mannose-6-phosphate receptor binding protein 1"""	M6PRBP1		9590177, 6856484, 19638644	Standard	NM_005817		Approved	TIP47, PP17	uc002mbj.2	O60664		ENST00000221957.4:c.867G>T	19.37:g.4844773C>A	ENSP00000221957:p.Lys289Asn	Somatic	46.0	1.0		WXS	Illumina HiSeq	Phase_I	26.0	15.0	NM_001164189	A8K4Y9|K7EQF4|Q53G77|Q9BS03|Q9UBD7|Q9UP92	Missense_Mutation	SNP	ENST00000221957.4	37	CCDS12137.1	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703515	0.48412	.	.	ENSG00000105355	ENST00000221957	T	0.06371	3.31	4.19	1.93	0.25924	.	0.347091	0.26851	U	0.022170	T	0.19406	0.0466	M	0.70275	2.135	0.25830	N	0.984177	D;D;D	0.63880	0.992;0.977;0.993	D;P;D	0.68039	0.925;0.787;0.955	T	0.01127	-1.1443	10	0.87932	D	0	-11.0951	10.8631	0.46837	0.0:0.8215:0.0:0.1785	.	289;106;289	O60664-3;O60664-2;O60664	.;.;PLIN3_HUMAN	N	289	ENSP00000221957:K289N	ENSP00000221957:K289N	K	-	3	2	PLIN3	4795773	0.998000	0.40836	1.000000	0.80357	0.498000	0.33706	0.595000	0.24029	0.980000	0.38523	0.561000	0.74099	AAG	.		0.607	PLIN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450436.1	NM_005817	
PLXNB1	5364	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48455150	48455150	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:48455150T>A	ENST00000358536.4	-	23	4733	c.4464A>T	c.(4462-4464)gcA>gcT	p.A1488A	PLXNB1_ENST00000358459.4_Silent_p.A1305A|PLXNB1_ENST00000448774.2_Silent_p.A99A|PLXNB1_ENST00000456774.1_Silent_p.A1305A|PLXNB1_ENST00000296440.6_Silent_p.A1488A|PLXNB1_ENST00000465117.1_5'Flank	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1488					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCACCTGGGCTGCCACAGGAA	0.617																																					p.A1488A		.											.	PLXNB1	293	0			c.A4464T						.						41.0	45.0	44.0					3																	48455150		2203	4300	6503	SO:0001819	synonymous_variant	5364	exon23			CTGGGCTGCCACA	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.4464A>T	3.37:g.48455150T>A		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	14.0	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Silent	SNP	ENST00000358536.4	37	CCDS2765.1																																																																																			.		0.617	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	
POLR2I	5438	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36604924	36604924	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:36604924C>T	ENST00000221859.4	-	5	797	c.308G>A	c.(307-309)cGg>cAg	p.R103Q	TBCB_ENST00000221855.3_5'Flank|TBCB_ENST00000586868.1_5'Flank|TBCB_ENST00000585746.1_5'Flank|TBCB_ENST00000589996.1_5'Flank	NM_006233.4	NP_006224.1	P36954	RPB9_HUMAN	polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa	103					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|maintenance of transcriptional fidelity during DNA-templated transcription elongation from RNA polymerase II promoter (GO:0001193)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)	3	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			TACCTCGGCCCGCGCACTGTG	0.612											OREG0025437	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R103Q		.											.	POLR2I	90	0			c.G308A						.						98.0	102.0	100.0					19																	36604924		2203	4300	6503	SO:0001583	missense	5438	exon5			TCGGCCCGCGCAC		CCDS12487.1	19q13.12	2013-10-17	2002-08-29		ENSG00000105258	ENSG00000105258	2.7.7.6	"""RNA polymerase subunits"""	9196	protein-coding gene	gene with protein product		180662	"""polymerase (RNA) II (DNA directed) polypeptide I (14.5kD)"""			8034326	Standard	NM_006233		Approved	RPB9, hRPB14.5	uc002ode.3	P36954	OTTHUMG00000181749	ENST00000221859.4:c.308G>A	19.37:g.36604924C>T	ENSP00000221859:p.Arg103Gln	Somatic	82.0	0.0	864	WXS	Illumina HiSeq	Phase_I	49.0	15.0	NM_006233	B2R5J2|Q6NW05	Missense_Mutation	SNP	ENST00000221859.4	37	CCDS12487.1	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759403	0.49468	.	.	ENSG00000105258	ENST00000221859	T	0.43294	0.95	5.0	3.96	0.45880	Zinc finger, TFIIS-type (4);	0.050022	0.85682	D	0.000000	T	0.54532	0.1864	M	0.77406	2.37	0.44168	D	0.996976	P	0.43633	0.813	P	0.50825	0.651	T	0.59478	-0.7447	10	0.56958	D	0.05	-27.055	11.5104	0.50490	0.0:0.9124:0.0:0.0876	.	103	P36954	RPB9_HUMAN	Q	103	ENSP00000221859:R103Q	ENSP00000221859:R103Q	R	-	2	0	POLR2I	41296764	1.000000	0.71417	0.993000	0.49108	0.071000	0.16799	3.460000	0.53028	1.474000	0.48178	-0.140000	0.14226	CGG	.		0.612	POLR2I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457442.1	NM_006233	
PPP2R5E	5529	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	63860613	63860613	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr14:63860613T>C	ENST00000337537.3	-	8	1376	c.774A>G	c.(772-774)gcA>gcG	p.A258A	PPP2R5E_ENST00000553266.1_5'UTR|PPP2R5E_ENST00000422769.2_Silent_p.A182A|PPP2R5E_ENST00000555899.1_Silent_p.A258A	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform	258					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		GTTTGTGTTCTGCCTTAAGAG	0.388																																					p.A258A		.											.	PPP2R5E	658	0			c.A774G						.						100.0	98.0	99.0					14																	63860613		2203	4300	6503	SO:0001819	synonymous_variant	5529	exon8			GTGTTCTGCCTTA	L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.774A>G	14.37:g.63860613T>C		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	13.0	NM_006246	A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	Silent	SNP	ENST00000337537.3	37	CCDS9758.1																																																																																			.		0.388	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276973.1	NM_006246	
PPP6C	5537	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	127920663	127920663	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:127920663T>A	ENST00000373547.4	-	4	337		c.e4-2		PPP6C_ENST00000415905.1_Splice_Site|PPP6C_ENST00000451402.1_Splice_Site|PPP6C_ENST00000373546.3_Intron	NM_002721.4	NP_002712.1	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit						G1/S transition of mitotic cell cycle (GO:0000082)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(3)	14						AAAATCACCCTGTGAAGTAAA	0.323																																					.		.											.	PPP6C	227	0			c.238-2A>T						.						100.0	105.0	103.0					9																	127920663		2203	4300	6503	SO:0001630	splice_region_variant	5537	exon5			TCACCCTGTGAAG	AF035158	CCDS6861.1, CCDS48018.1, CCDS48019.1	9q33.3	2010-03-17			ENSG00000119414	ENSG00000119414		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9323	protein-coding gene	gene with protein product		612725				9143513	Standard	NM_002721		Approved	PP6	uc004bpg.4	O00743	OTTHUMG00000020671	ENST00000373547.4:c.238-2A>T	9.37:g.127920663T>A		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	8.0	NM_002721	B2R5V6|B7Z2W9|B7Z5K9|Q5U0A2|Q9UIC9	Splice_Site	SNP	ENST00000373547.4	37	CCDS6861.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.420089	0.83559	.	.	ENSG00000119414	ENST00000373547;ENST00000451402;ENST00000415905;ENST00000456642	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8897	0.70600	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PPP6C	126960484	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.599000	0.82757	2.113000	0.64589	0.528000	0.53228	.	.		0.323	PPP6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054060.1	NM_016294	Intron
PRC1	9055	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	91522459	91522460	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr15:91522459_91522460insA	ENST00000361188.5	-	8	2246_2247	c.1035_1036insT	c.(1033-1038)tatgaafs	p.E346fs	PRC1_ENST00000394249.3_Frame_Shift_Ins_p.E346fs|PRC1_ENST00000361919.3_Frame_Shift_Ins_p.E346fs|PRC1_ENST00000442656.2_Frame_Shift_Ins_p.E305fs|Y_RNA_ENST00000363272.1_RNA|PRC1-AS1_ENST00000554388.1_RNA					protein regulator of cytokinesis 1											endometrium(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(3)|prostate(1)|skin(2)	25	Lung NSC(78;0.0987)|all_lung(78;0.175)					TTGTGAACTTCATAGTAGTTTT	0.406																																					p.E346_V347delinsX		.											.	PRC1	92	0			c.1036_1037insT						.																																			SO:0001589	frameshift_variant	9055	exon8			GAACTTCATAGTA	AF044588	CCDS32334.1, CCDS45352.1, CCDS45353.1, CCDS45353.2	15q26.1	2013-05-29		2006-07-07	ENSG00000198901	ENSG00000198901			9341	protein-coding gene	gene with protein product	"""anaphase spindle elongation 1 homolog (S. cerevisiae)"""	603484				9885575	Standard	NM_003981		Approved	ASE1	uc002bqm.4	O43663	OTTHUMG00000171685	ENST00000361188.5:c.1036dupT	15.37:g.91522460_91522460dupA	ENSP00000354679:p.Glu346fs	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	10.0	NM_199413		Nonsense_Mutation	INS	ENST00000361188.5	37	CCDS45352.1																																																																																			.		0.406	PRC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414760.1	NM_003981	
PRDM2	7799	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	14108238	14108238	+	Silent	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:14108238A>T	ENST00000235372.7	+	8	4804	c.3948A>T	c.(3946-3948)acA>acT	p.T1316T	PRDM2_ENST00000311066.5_Silent_p.T1316T|PRDM2_ENST00000343137.4_Silent_p.T1115T|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000413440.1_Silent_p.T1115T|PRDM2_ENST00000376048.5_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1316					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TTGGTGTGACAGCCACAAATT	0.468																																					p.T1316T		.											.	PRDM2	116	0			c.A3948T						.						137.0	132.0	134.0					1																	14108238		2203	4300	6503	SO:0001819	synonymous_variant	7799	exon8			TGTGACAGCCACA	U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.3948A>T	1.37:g.14108238A>T		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	38.0	NM_015866	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Silent	SNP	ENST00000235372.7	37	CCDS150.1																																																																																			.		0.468	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021792.2	NM_012231	
PREX1	57580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	47296240	47296240	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:47296240G>A	ENST00000371941.3	-	12	1510	c.1488C>T	c.(1486-1488)taC>taT	p.Y496Y	PREX1_ENST00000396220.1_Silent_p.Y496Y	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	496	DEP 1. {ECO:0000255|PROSITE- ProRule:PRU00066}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TGCCATCGTCGTAGCGGAAGC	0.607																																					p.Y496Y		.											.	PREX1	231	0			c.C1488T						.						184.0	139.0	154.0					20																	47296240		2203	4300	6503	SO:0001819	synonymous_variant	57580	exon12			ATCGTCGTAGCGG	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1488C>T	20.37:g.47296240G>A		Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	32.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	ENST00000371941.3	37	CCDS13410.1																																																																																			.		0.607	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
PRICKLE4	29964	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	41754595	41754596	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:41754595_41754596insGC	ENST00000394260.1	+	5	763_764	c.763_764insGC	c.(763-765)agcfs	p.S255fs	PRICKLE4_ENST00000394263.1_Frame_Shift_Ins_p.S295fs|TOMM6_ENST00000398881.3_5'Flank|TOMM6_ENST00000398884.3_5'Flank|PRICKLE4_ENST00000458694.1_Frame_Shift_Ins_p.S295fs			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)	255						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CGGCGGTTCCAGCCTGCAAACT	0.629											OREG0017435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S295fs		.											.	PRICKLE4	22	0			c.883_884insGC						.																																			SO:0001589	frameshift_variant	29964	exon8			GGTTCCAGCCTGC	AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.764_765dupGC	6.37:g.41754596_41754597dupGC	ENSP00000377803:p.Ser255fs	Somatic	57.0	0.0	903	WXS	Illumina HiSeq	Phase_I	76.0	39.0	NM_013397	A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	Frame_Shift_Ins	INS	ENST00000394260.1	37																																																																																				.		0.629	PRICKLE4-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000303948.1	NM_013397	
PRKAA1	5562	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	40763061	40763061	+	Missense_Mutation	SNP	T	T	C	rs373496949		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:40763061T>C	ENST00000397128.2	-	9	1507	c.1499A>G	c.(1498-1500)tAt>tGt	p.Y500C	PRKAA1_ENST00000354209.3_Missense_Mutation_p.Y515C	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	500					activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	GCAAGATCGATAGTTGCTAAC	0.408																																					p.Y515C		.											.	PRKAA1	792	0			c.A1544G						.	T	CYS/TYR,CYS/TYR	1,3751		0,1,1875	105.0	100.0	101.0		1499,1544	5.9	1.0	5		101	0,8228		0,0,4114	no	missense,missense	PRKAA1	NM_006251.5,NM_206907.3	194,194	0,1,5989	CC,CT,TT		0.0,0.0267,0.0083	possibly-damaging,possibly-damaging	500/560,515/575	40763061	1,11979	1876	4114	5990	SO:0001583	missense	5562	exon10			GATCGATAGTTGC		CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.1499A>G	5.37:g.40763061T>C	ENSP00000380317:p.Tyr500Cys	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	27.0	NM_206907	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Missense_Mutation	SNP	ENST00000397128.2	37	CCDS3932.2	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909502	0.72868	2.67E-4	0.0	ENSG00000132356	ENST00000397128;ENST00000354209	T;T	0.08807	3.05;3.05	5.93	5.93	0.95920	.	0.053936	0.85682	D	0.000000	T	0.15998	0.0385	L	0.36672	1.1	0.80722	D	1	P;D	0.58268	0.926;0.982	P;P	0.55345	0.599;0.774	T	0.00849	-1.1541	10	0.41790	T	0.15	-20.2903	16.3839	0.83495	0.0:0.0:0.0:1.0	.	500;515	Q13131;Q13131-2	AAPK1_HUMAN;.	C	500;515	ENSP00000380317:Y500C;ENSP00000346148:Y515C	ENSP00000346148:Y515C	Y	-	2	0	AC008810.1	40798818	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.964000	0.56780	2.258000	0.74832	0.533000	0.62120	TAT	.		0.408	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253833.2	NM_006251	
ZNF512B	57473	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	20	62612637	62612637	+	Intron	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:62612637G>T	ENST00000450537.1	-	2	56				PRPF6_ENST00000535781.1_Silent_p.A13A|ZNF512B_ENST00000217130.3_Intron|SAMD10_ENST00000498830.1_5'Flank|SAMD10_ENST00000369886.3_5'Flank			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGATGCCCGCGCCCCTCGGCT	0.677																																					p.A13A		.											.	PRPF6	70	0			c.G39T						.						20.0	20.0	20.0					20																	62612637		2191	4286	6477	SO:0001627	intron_variant	24148	exon1			GCCCGCGCCCCTC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-13329C>A	20.37:g.62612637G>T		Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	66.0	NM_012469	Q08AK9|Q9ULM4	Silent	SNP	ENST00000450537.1	37	CCDS13548.1																																																																																			.		0.677	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
PRR12	57479	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50118152	50118152	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:50118152A>T	ENST00000418929.2	+	8	4922	c.4910A>T	c.(4909-4911)gAt>gTt	p.D1637V		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	816							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		TATTTTGGGGATGCAAAAAAT	0.527																																					p.D1637V		.											.	PRR12	70	0			c.A4910T						.						61.0	60.0	60.0					19																	50118152		1881	4122	6003	SO:0001583	missense	57479	exon8			TTGGGGATGCAAA	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4910A>T	19.37:g.50118152A>T	ENSP00000394510:p.Asp1637Val	Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	104.0	21.0	NM_020719	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.806319	0.50421	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.38	4.38	0.52667	.	0.000000	0.44097	D	0.000481	T	0.75932	0.3917	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78964	-0.1996	9	0.87932	D	0	-25.4669	12.7187	0.57129	1.0:0.0:0.0:0.0	.	1637	Q9ULL5-3	.	V	1637;817;817	.	ENSP00000246798:D817V	D	+	2	0	PRR12	54809964	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	8.194000	0.89721	1.851000	0.53745	0.533000	0.62120	GAT	.		0.527	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
PRSS22	64063	broad.mit.edu;mdanderson.org	37	16	2903200	2903200	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:2903200G>T	ENST00000161006.3	-	6	913	c.848C>A	c.(847-849)tCc>tAc	p.S283Y	PRSS22_ENST00000574768.1_5'Flank|PRSS22_ENST00000571228.1_Missense_Mutation_p.S173Y	NM_022119.3	NP_071402.1	Q9GZN4	BSSP4_HUMAN	protease, serine, 22	283	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(2)|skin(2)	10						CTCCACCCAGGAGCGGTGCGC	0.741																																					p.S283Y		.											.	PRSS22	90	0			c.C848A						.						22.0	24.0	23.0					16																	2903200		2192	4285	6477	SO:0001583	missense	64063	exon6			ACCCAGGAGCGGT	AF321182	CCDS10481.1	16p13.3	2010-05-07			ENSG00000005001	ENSG00000005001		"""Serine peptidases / Serine peptidases"""	14368	protein-coding gene	gene with protein product	"""brain-specific serine protease 4"""	609343				11602603, 15701722	Standard	XM_005255473		Approved	hBSSP-4, BSSP-4, SP001LA	uc002cry.1	Q9GZN4	OTTHUMG00000128961	ENST00000161006.3:c.848C>A	16.37:g.2903200G>T	ENSP00000161006:p.Ser283Tyr	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	9.0	5.0	NM_022119	O43342|Q6UXE0	Missense_Mutation	SNP	ENST00000161006.3	37	CCDS10481.1	.	.	.	.	.	.	.	.	.	.	g	13.75	2.329626	0.41297	.	.	ENSG00000005001	ENST00000161006	D	0.82433	-1.61	3.81	3.81	0.43845	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.744739	0.11372	N	0.570801	D	0.89863	0.6838	M	0.86097	2.795	0.30034	N	0.813217	P	0.50710	0.938	P	0.55161	0.77	D	0.85907	0.1438	10	0.72032	D	0.01	.	13.6318	0.62200	0.0:0.0:1.0:0.0	.	283	Q9GZN4	BSSP4_HUMAN	Y	283	ENSP00000161006:S283Y	ENSP00000161006:S283Y	S	-	2	0	PRSS22	2843201	0.920000	0.31207	1.000000	0.80357	0.267000	0.26476	1.104000	0.31074	1.857000	0.53885	0.456000	0.33151	TCC	.		0.741	PRSS22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250943.1	NM_022119	
PSG2	5670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43576075	43576075	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:43576075T>C	ENST00000406487.1	-	4	839	c.741A>G	c.(739-741)tcA>tcG	p.S247S		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	247	Ig-like C2-type 2.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				AATTGGTGTATGAAGGGTGAA	0.483																																					p.S247S		.											.	PSG2	90	0			c.A741G						.						150.0	164.0	159.0					19																	43576075		2203	4299	6502	SO:0001819	synonymous_variant	5670	exon4			GGTGTATGAAGGG		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.741A>G	19.37:g.43576075T>C		Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	17.0	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Silent	SNP	ENST00000406487.1	37	CCDS12616.1																																																																																			C|0.570;A|0.430		0.483	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
PTBP2	58155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	97271990	97271990	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:97271990A>G	ENST00000426398.2	+	10	1103	c.1060A>G	c.(1060-1062)Agt>Ggt	p.S354G	PTBP2_ENST00000370197.1_Missense_Mutation_p.S359G|PTBP2_ENST00000541987.1_Intron|PTBP2_ENST00000394184.3_Missense_Mutation_p.S370G|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000609116.1_Missense_Mutation_p.S354G|PTBP2_ENST00000370198.1_Missense_Mutation_p.S359G	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	354	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		TACGCCCCAAAGTCTGTTTAC	0.388																																					p.S354G		.											.	PTBP2	90	0			c.A1060G						.						222.0	204.0	210.0					1																	97271990		2203	4300	6503	SO:0001583	missense	58155	exon10			CCCCAAAGTCTGT	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.1060A>G	1.37:g.97271990A>G	ENSP00000412788:p.Ser354Gly	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	23.0	NM_021190	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	37	CCDS754.1	.	.	.	.	.	.	.	.	.	.	A	9.628	1.135614	0.21123	.	.	ENSG00000117569	ENST00000236228;ENST00000543738;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184	T;T;T;T;T	0.46451	0.88;0.89;0.87;0.9;0.87	5.65	5.65	0.86999	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.21881	0.0527	L	0.35644	1.08	0.80722	D	1	B;P;P;B;B;B	0.40619	0.001;0.603;0.724;0.001;0.0;0.001	B;B;B;B;B;B	0.40534	0.006;0.178;0.332;0.006;0.008;0.008	T	0.03922	-1.0992	10	0.17832	T	0.49	.	15.8653	0.79060	1.0:0.0:0.0:0.0	.	362;370;359;354;354;359	B4DSU5;B4DSS8;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3	.;.;.;PTBP2_HUMAN;.;.	G	354;26;359;359;354;370	ENSP00000236228:S354G;ENSP00000359217:S359G;ENSP00000359216:S359G;ENSP00000412788:S354G;ENSP00000377738:S370G	ENSP00000236228:S354G	S	+	1	0	PTBP2	97044578	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.752000	0.68728	2.149000	0.67028	0.460000	0.39030	AGT	.		0.388	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1		
PTK2B	2185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	27293843	27293843	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:27293843A>G	ENST00000397501.1	+	20	2127	c.1319A>G	c.(1318-1320)tAt>tGt	p.Y440C	PTK2B_ENST00000420218.2_Missense_Mutation_p.Y440C|PTK2B_ENST00000338238.4_Missense_Mutation_p.Y440C|PTK2B_ENST00000346049.5_Missense_Mutation_p.Y440C|PTK2B_ENST00000544172.1_Missense_Mutation_p.Y440C|PTK2B_ENST00000397497.4_Missense_Mutation_p.Y186C|PTK2B_ENST00000517339.1_Missense_Mutation_p.Y440C	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	440	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	GGGGAGGTCTATGAAGGTGTC	0.493																																					p.Y440C		.											.	PTK2B	1378	0			c.A1319G						.						286.0	259.0	268.0					8																	27293843		2203	4300	6503	SO:0001583	missense	2185	exon20			AGGTCTATGAAGG	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.1319A>G	8.37:g.27293843A>G	ENSP00000380638:p.Tyr440Cys	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	12.0	NM_173174	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	37	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.573343	0.86542	.	.	ENSG00000120899	ENST00000397501;ENST00000539100;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339;ENST00000397497	T;T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.44	5.44	0.79542	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.115243	0.64402	D	0.000009	T	0.78541	0.4299	M	0.62723	1.935	0.80722	D	1	P;P;D;D	0.76494	0.646;0.787;0.999;0.999	B;P;D;D	0.71870	0.308;0.453;0.958;0.975	T	0.80888	-0.1181	10	0.87932	D	0	.	13.4604	0.61223	1.0:0.0:0.0:0.0	.	445;186;440;440	Q59GM4;E9PBI4;Q14289-2;Q14289	.;.;.;FAK2_HUMAN	C	440;445;440;440;440;440;440;186	ENSP00000380638:Y440C;ENSP00000342242:Y440C;ENSP00000440926:Y440C;ENSP00000332816:Y440C;ENSP00000391995:Y440C;ENSP00000427931:Y440C;ENSP00000380634:Y186C	ENSP00000342242:Y440C	Y	+	2	0	PTK2B	27349760	1.000000	0.71417	0.986000	0.45419	0.999000	0.98932	6.636000	0.74299	2.068000	0.61886	0.533000	0.62120	TAT	.		0.493	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219916.1	NM_004103	
PTK2	5747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	141889628	141889628	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:141889628T>C	ENST00000522684.1	-	4	533	c.304A>G	c.(304-306)Atg>Gtg	p.M102V	PTK2_ENST00000340930.3_Missense_Mutation_p.M102V|PTK2_ENST00000520892.1_Missense_Mutation_p.M102V|PTK2_ENST00000395218.2_Missense_Mutation_p.M102V|PTK2_ENST00000521059.1_Missense_Mutation_p.M102V|PTK2_ENST00000519881.1_Missense_Mutation_p.M102V|PTK2_ENST00000517887.1_Missense_Mutation_p.M146V|PTK2_ENST00000519419.1_Missense_Mutation_p.M146V|PTK2_ENST00000535192.1_Missense_Mutation_p.M102V	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	102	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			GAGACGCCCATATCCACGTGA	0.507																																					p.M124V		.											.	PTK2	1517	0			c.A370G						.						290.0	272.0	278.0					8																	141889628		2203	4300	6503	SO:0001583	missense	5747	exon4			CGCCCATATCCAC	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.304A>G	8.37:g.141889628T>C	ENSP00000429911:p.Met102Val	Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	92.0	NM_005607	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	ENST00000522684.1	37	CCDS6381.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.23|14.23	2.474467|2.474467	0.43942|0.43942	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000517887;ENST00000521059;ENST00000395218;ENST00000340930;ENST00000519419;ENST00000520828;ENST00000520475;ENST00000519881;ENST00000520892;ENST00000523803;ENST00000521907;ENST00000517453;ENST00000520045;ENST00000521395|ENST00000519654	T;T;T;T;T;T;T|.	0.75154|.	-0.89;-0.88;-0.91;-0.89;-0.88;-0.88;-0.91|.	5.36|5.36	5.36|5.36	0.76844|0.76844	Band 4.1 domain (1);FERM domain (1);|.	0.037553|.	0.85682|.	D|.	0.000000|.	T|T	0.69287|0.69287	0.3094|0.3094	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.13145|.	0.004;0.007;0.002;0.002|.	B;B;B;B|.	0.06405|.	0.002;0.002;0.001;0.0|.	T|T	0.67776|0.67776	-0.5583|-0.5583	10|5	0.42905|.	T|.	0.14|.	.|.	15.6584|15.6584	0.77162|0.77162	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	102;102;124;102|.	B4E2N6;Q05397;Q658W2;Q8IYN9|.	.;FAK1_HUMAN;.;.|.	V|C	102;102;146;102;102;102;146;1;102;102;102;102;102;102;102;102|112	ENSP00000429911:M102V;ENSP00000438009:M102V;ENSP00000429082:M146V;ENSP00000429474:M102V;ENSP00000378644:M102V;ENSP00000341189:M102V;ENSP00000429129:M146V|.	ENSP00000341189:M102V|.	M|Y	-|-	1|2	0|0	PTK2|PTK2	141958810|141958810	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.990000|0.990000	0.78478|0.78478	3.679000|3.679000	0.54634|0.54634	2.160000|2.160000	0.67779|0.67779	0.528000|0.528000	0.53228|0.53228	ATG|TAT	.		0.507	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378054.5	NM_005607	
PTPN14	5784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	214537999	214537999	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:214537999C>A	ENST00000366956.5	-	18	3485	c.3291G>T	c.(3289-3291)caG>caT	p.Q1097H	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	1097	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GACGGACCGACTGGATCTCCT	0.587																																					p.Q1097H	Colon(92;557 1424 24372 34121 40073)	.											.	PTPN14	290	0			c.G3291T						.						99.0	86.0	91.0					1																	214537999		2203	4300	6503	SO:0001583	missense	5784	exon18			GACCGACTGGATC	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.3291G>T	1.37:g.214537999C>A	ENSP00000355923:p.Gln1097His	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	36.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.928431	0.73327	.	.	ENSG00000152104	ENST00000366956	D	0.83673	-1.75	5.7	4.79	0.61399	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.061995	0.64402	D	0.000002	T	0.81592	0.4855	L	0.33753	1.03	0.80722	D	1	D	0.71674	0.998	P	0.55965	0.788	T	0.79778	-0.1660	10	0.35671	T	0.21	.	10.1845	0.42988	0.0:0.7924:0.1362:0.0714	.	1097	Q15678	PTN14_HUMAN	H	1097	ENSP00000355923:Q1097H	ENSP00000355923:Q1097H	Q	-	3	2	PTPN14	212604622	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.563000	0.60823	1.403000	0.46800	0.655000	0.94253	CAG	.		0.587	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
PTPRA	5786	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	2987988	2987988	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:2987988A>T	ENST00000216877.6	+	10	1202		c.e10-1		PTPRA_ENST00000358719.4_Splice_Site|PTPRA_ENST00000356147.3_Splice_Site|PTPRA_ENST00000399903.2_Splice_Site|PTPRA_ENST00000380393.3_Splice_Site|PTPRA_ENST00000425918.2_Splice_Site|PTPRA_ENST00000318266.5_Splice_Site	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A						axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TTTGTTTCCTAGATGACCACT	0.433																																					.		.											.	PTPRA	227	0			c.830-2A>T						.						155.0	146.0	149.0					20																	2987988		2203	4300	6503	SO:0001630	splice_region_variant	5786	exon15			TTTCCTAGATGAC		CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.803-1A>T	20.37:g.2987988A>T		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	9.0	NM_002836	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Splice_Site	SNP	ENST00000216877.6	37	CCDS13039.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.452151	0.84209	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000425918;ENST00000318266;ENST00000356147	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5026	0.75713	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPRA	2935988	1.000000	0.71417	0.964000	0.40570	0.875000	0.50365	8.058000	0.89460	2.202000	0.70862	0.533000	0.62120	.	.		0.433	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077682.3		Intron
PTPRZ1	5803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	121653534	121653534	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:121653534T>A	ENST00000393386.2	+	12	4845	c.4434T>A	c.(4432-4434)tcT>tcA	p.S1478S	PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	1478					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						ACTCACTATCTGAGAATTCTG	0.393																																					p.S1478S		.											.	PTPRZ1	699	0			c.T4434A						.						79.0	78.0	78.0					7																	121653534		2203	4300	6503	SO:0001819	synonymous_variant	5803	exon12			ACTATCTGAGAAT	M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.4434T>A	7.37:g.121653534T>A		Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	27.0	NM_002851	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	ENST00000393386.2	37	CCDS34740.1																																																																																			.		0.393	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347288.1	NM_002851	
QRICH1	54870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49095208	49095208	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:49095208T>A	ENST00000395443.2	-	3	897	c.425A>T	c.(424-426)cAg>cTg	p.Q142L	QRICH1_ENST00000424300.1_Missense_Mutation_p.Q142L|QRICH1_ENST00000357496.2_Missense_Mutation_p.Q142L|QRICH1_ENST00000479449.1_Intron	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	142	Gln-rich.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CTGTGGTGCCTGGCCTTGGAT	0.617																																					p.Q142L		.											.	QRICH1	91	0			c.A425T						.						182.0	156.0	165.0					3																	49095208		2203	4300	6503	SO:0001583	missense	54870	exon3			GGTGCCTGGCCTT		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.425A>T	3.37:g.49095208T>A	ENSP00000378830:p.Gln142Leu	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	18.0	NM_198880	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	37	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.045726	0.55110	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300	.	.	.	5.99	5.99	0.97316	.	0.159496	0.56097	D	0.000023	T	0.25232	0.0613	N	0.08118	0	0.53688	D	0.999976	P	0.43477	0.808	B	0.27887	0.084	T	0.25398	-1.0133	9	0.66056	D	0.02	-2.5159	15.7232	0.77732	0.0:0.0:0.0:1.0	.	142	Q2TAL8	QRIC1_HUMAN	L	142	.	ENSP00000350094:Q142L	Q	-	2	0	QRICH1	49070212	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.299000	0.33424	2.305000	0.77605	0.529000	0.55759	CAG	.		0.617	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
RAB18	22931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27822715	27822715	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:27822715A>G	ENST00000356940.6	+	5	413	c.311A>G	c.(310-312)aAt>aGt	p.N104S	RAB18_ENST00000465772.1_3'UTR|RAB18_ENST00000375802.3_Missense_Mutation_p.N59S|RAB18_ENST00000535776.1_Intron	NM_001256410.1|NM_001256415.1|NM_021252.4	NP_001243339.1|NP_001243344.1|NP_067075.1	Q9NP72	RAB18_HUMAN	RAB18, member RAS oncogene family	104					brain development (GO:0007420)|endoplasmic reticulum tubular network organization (GO:0071786)|eye development (GO:0001654)|GTP catabolic process (GO:0006184)|lipid particle organization (GO:0034389)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(1)|lung(1)	3						AATTGGTTAAATGAATTGGAA	0.303																																					p.N133S		.											.	RAB18	227	0			c.A398G						.						115.0	113.0	114.0					10																	27822715		2203	4298	6501	SO:0001583	missense	22931	exon6			GGTTAAATGAATT	AJ277145	CCDS7155.1, CCDS58073.1, CCDS73080.1, CCDS73081.1	10p12	2011-03-07			ENSG00000099246	ENSG00000099246		"""RAB, member RAS oncogene"""	14244	protein-coding gene	gene with protein product		602207				10648831	Standard	NM_021252		Approved		uc001itw.4	Q9NP72	OTTHUMG00000017861	ENST00000356940.6:c.311A>G	10.37:g.27822715A>G	ENSP00000349415:p.Asn104Ser	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	18.0	NM_001256410	B3KMC7|B7Z333|D3DRW1|Q53FX8|Q56UN9|Q6FIH1	Missense_Mutation	SNP	ENST00000356940.6	37	CCDS7155.1	.	.	.	.	.	.	.	.	.	.	A	11.89	1.773832	0.31411	.	.	ENSG00000099246	ENST00000356940;ENST00000540268;ENST00000375802	T;T	0.75938	-0.98;-0.98	5.87	3.48	0.39840	Small GTP-binding protein domain (1);	.	.	.	.	T	0.55689	0.1936	N	0.17764	0.52	0.80722	D	1	B;B;B	0.18013	0.019;0.025;0.001	B;B;B	0.24269	0.012;0.052;0.003	T	0.41378	-0.9512	9	0.14252	T	0.57	.	8.2976	0.31995	0.7979:0.1324:0.0696:0.0	.	104;133;104	B7Z4P9;Q56UN9;Q9NP72	.;.;RAB18_HUMAN	S	104;82;59	ENSP00000349415:N104S;ENSP00000364960:N59S	ENSP00000349415:N104S	N	+	2	0	RAB18	27862721	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.575000	0.46025	1.014000	0.39417	0.528000	0.53228	AAT	.		0.303	RAB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047326.2	NM_021252	
RACGAP1	29127	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	50388003	50388003	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:50388003G>A	ENST00000427314.2	-	14	1473	c.1250C>T	c.(1249-1251)gCt>gTt	p.A417V	RACGAP1_ENST00000551016.1_Missense_Mutation_p.A417V|RACGAP1_ENST00000548961.1_5'Flank|RACGAP1_ENST00000454520.2_Missense_Mutation_p.A417V|RACGAP1_ENST00000547061.1_5'Flank|RACGAP1_ENST00000312377.5_Missense_Mutation_p.A417V|RACGAP1_ENST00000434422.1_Missense_Mutation_p.A417V|RACGAP1_ENST00000547905.1_Missense_Mutation_p.A417V	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						GCTACAGATAGCATGGATATC	0.448																																					p.A417V		.											.	RACGAP1	227	0			c.C1250T						.						138.0	136.0	137.0					12																	50388003		2203	4300	6503	SO:0001583	missense	29127	exon14			CAGATAGCATGGA		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.1250C>T	12.37:g.50388003G>A	ENSP00000404190:p.Ala417Val	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	42.0	NM_013277		Missense_Mutation	SNP	ENST00000427314.2	37	CCDS8795.1	.	.	.	.	.	.	.	.	.	.	G	8.867	0.948407	0.18356	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000549342	T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22	5.35	4.44	0.53790	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.149779	0.64402	N	0.000013	T	0.07683	0.0193	N	0.04880	-0.145	0.58432	D	0.999994	B	0.12630	0.006	B	0.09377	0.004	T	0.13602	-1.0503	10	0.02654	T	1	-7.9733	14.4667	0.67490	0.0721:0.0:0.9279:0.0	.	417	Q9H0H5	RGAP1_HUMAN	V	417;417;417;417;417;417;153	ENSP00000404190:A417V;ENSP00000309871:A417V;ENSP00000413241:A417V;ENSP00000404808:A417V;ENSP00000449374:A417V;ENSP00000449370:A417V;ENSP00000449565:A153V	ENSP00000309871:A417V	A	-	2	0	RACGAP1	48674270	1.000000	0.71417	0.930000	0.37139	0.978000	0.69477	4.024000	0.57218	1.206000	0.43276	0.555000	0.69702	GCT	.		0.448	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277	
RASA3	22821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	114766318	114766318	+	Silent	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr13:114766318G>T	ENST00000334062.7	-	19	1954	c.1833C>A	c.(1831-1833)acC>acA	p.T611T	RASA3_ENST00000389544.4_Silent_p.T579T	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	611	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			TTTTGTGGTAGGTAAATTCAT	0.512																																					p.T611T		.											.	RASA3	658	0			c.C1833A						.						128.0	122.0	124.0					13																	114766318		2203	4300	6503	SO:0001819	synonymous_variant	22821	exon19			GTGGTAGGTAAAT		CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1833C>A	13.37:g.114766318G>T		Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	37.0	NM_007368	A6NL15|F8W6X8|Q8IUY2	Silent	SNP	ENST00000334062.7	37	CCDS32016.1																																																																																			.		0.512	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045957.2	NM_007368	
RBM3	5935	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	48433627	48433627	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:48433627A>T	ENST00000376759.3	+	2	122	c.59A>T	c.(58-60)cAg>cTg	p.Q20L	RBM3_ENST00000376755.1_Missense_Mutation_p.Q20L|RBM3_ENST00000430348.2_De_novo_Start_OutOfFrame|RBM3_ENST00000466764.1_3'UTR|AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000354480.2_5'Flank	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3	20	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						ACCGACGAGCAGGCACTGGAA	0.527											OREG0019765	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q20L		.											.	RBM3	131	0			c.A59T						.						83.0	60.0	68.0					X																	48433627		2203	4300	6503	SO:0001583	missense	5935	exon2			ACGAGCAGGCACT	BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.59A>T	X.37:g.48433627A>T	ENSP00000365950:p.Gln20Leu	Somatic	57.0	0.0	954	WXS	Illumina HiSeq	Phase_I	30.0	13.0	NM_006743		Missense_Mutation	SNP	ENST00000376759.3	37	CCDS14301.1	.	.	.	.	.	.	.	.	.	.	A	18.07	3.540966	0.65085	.	.	ENSG00000102317	ENST00000376759;ENST00000376755	D;D	0.85773	-2.03;-2.03	4.74	3.58	0.41010	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.296885	0.22745	U	0.056144	D	0.85022	0.5602	L	0.37750	1.13	0.80722	D	1	D	0.55385	0.971	P	0.59357	0.856	D	0.83595	0.0125	10	0.66056	D	0.02	-5.2225	7.7588	0.28940	0.8983:0.0:0.1017:0.0	.	20	P98179	RBM3_HUMAN	L	20	ENSP00000365950:Q20L;ENSP00000365946:Q20L	ENSP00000365946:Q20L	Q	+	2	0	RBM3	48318571	1.000000	0.71417	0.995000	0.50966	0.335000	0.28730	5.446000	0.66600	0.752000	0.32923	0.417000	0.27973	CAG	.		0.527	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060755.1	NM_006743	
RCAN2	10231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46424645	46424645	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:46424645T>C	ENST00000371374.1	-	2	260	c.69A>G	c.(67-69)ggA>ggG	p.G23G	RCAN2_ENST00000405162.1_Silent_p.G23G|RCAN2_ENST00000306764.7_Silent_p.G23G	NM_001251974.1	NP_001238903.1	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	0					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						AGAAAAGTCCTCCATCTTCAG	0.498																																					p.G23G		.											.	RCAN2	90	0			c.A69G						.																																			SO:0001819	synonymous_variant	10231	exon2			AAGTCCTCCATCT	D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000371374.1:c.69A>G	6.37:g.46424645T>C		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	17.0	NM_001251973	A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Silent	SNP	ENST00000371374.1	37	CCDS59023.1																																																																																			.		0.498	RCAN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040783.1		
RCSD1	92241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	167659345	167659345	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:167659345T>A	ENST00000367854.3	+	4	589	c.258T>A	c.(256-258)atT>atA	p.I86I	RCSD1_ENST00000537350.1_Silent_p.I56I	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	86					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					CGCCTCTGATTGAGAAGCTTC	0.423																																					p.I86I		.											RCSD1,NS,carcinoma,+2	RCSD1	517	0			c.T258A						.						134.0	122.0	126.0					1																	167659345		2203	4300	6503	SO:0001819	synonymous_variant	92241	exon4			TCTGATTGAGAAG	BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.258T>A	1.37:g.167659345T>A		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	39.0	NM_052862	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Silent	SNP	ENST00000367854.3	37	CCDS1263.1																																																																																			.		0.423	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862	
REV1	51455	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	100058804	100058804	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:100058804T>C	ENST00000258428.3	-	5	706	c.478A>G	c.(478-480)Ata>Gta	p.I160V	REV1_ENST00000393445.3_Missense_Mutation_p.I160V|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	160					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGTTTGGCTATATTGCTTGGA	0.418								Direct reversal of damage																													p.I160V		.											.	REV1	92	0			c.A478G						.						95.0	88.0	90.0					2																	100058804		2203	4300	6503	SO:0001583	missense	51455	exon5			TGGCTATATTGCT	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.478A>G	2.37:g.100058804T>C	ENSP00000258428:p.Ile160Val	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	33.0	NM_001037872	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	ENST00000258428.3	37	CCDS2045.1	.	.	.	.	.	.	.	.	.	.	T	12.18	1.860774	0.32884	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.26810	1.71;1.71	5.28	0.229	0.15368	.	0.538788	0.22649	N	0.057348	T	0.21427	0.0516	M	0.61703	1.905	0.24908	N	0.992068	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.09377	0.002;0.001;0.004	T	0.32107	-0.9919	10	0.16896	T	0.51	.	9.1772	0.37118	0.0:0.2761:0.0:0.7239	.	139;160;160	Q9UBZ9-3;Q9UBZ9;Q9UBZ9-2	.;REV1_HUMAN;.	V	160	ENSP00000377091:I160V;ENSP00000258428:I160V	ENSP00000258428:I160V	I	-	1	0	REV1	99425236	0.999000	0.42202	0.781000	0.31783	0.996000	0.88848	0.765000	0.26546	-0.174000	0.10743	0.459000	0.35465	ATA	.		0.418	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
REV3L	5980	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	111696479	111696479	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:111696479C>A	ENST00000358835.3	-	14	3533	c.3079G>T	c.(3079-3081)Gtt>Ttt	p.V1027F	REV3L_ENST00000368802.3_Missense_Mutation_p.V1027F|REV3L_ENST00000435970.1_Missense_Mutation_p.V949F|REV3L_ENST00000368805.1_Missense_Mutation_p.V1027F			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1027					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GAGTCGGGAACTTTTGGCCAA	0.343								DNA polymerases (catalytic subunits)																													p.V1027F		.											.	REV3L	294	0			c.G3079T						.						118.0	117.0	117.0					6																	111696479		2203	4300	6503	SO:0001583	missense	5980	exon13			CGGGAACTTTTGG	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3079G>T	6.37:g.111696479C>A	ENSP00000351697:p.Val1027Phe	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	12.0	NM_002912	O43214|Q5TC33	Missense_Mutation	SNP	ENST00000358835.3	37	CCDS5091.2	.	.	.	.	.	.	.	.	.	.	C	16.78	3.218137	0.58560	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01787	4.74;4.74;4.74;4.64	5.84	5.84	0.93424	Ribonuclease H-like (1);	0.000000	0.64402	D	0.000001	T	0.05823	0.0152	L	0.56769	1.78	0.44825	D	0.997837	D	0.76494	0.999	D	0.68765	0.96	T	0.31336	-0.9947	10	0.87932	D	0	.	20.139	0.98050	0.0:1.0:0.0:0.0	.	1027	O60673	DPOLZ_HUMAN	F	1027;1027;1027;949	ENSP00000357792:V1027F;ENSP00000357795:V1027F;ENSP00000351697:V1027F;ENSP00000402003:V949F	ENSP00000351697:V1027F	V	-	1	0	REV3L	111803172	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.614000	0.67695	2.764000	0.94973	0.655000	0.94253	GTT	.		0.343	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
RFC1	5981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	39313096	39313096	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:39313096T>C	ENST00000381897.1	-	12	1590	c.1457A>G	c.(1456-1458)aAa>aGa	p.K486R	RFC1_ENST00000349703.2_Missense_Mutation_p.K486R	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	486	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						ATACTTGGATTTCTTGCCTGG	0.348																																					p.K486R	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	.											.	RFC1	230	0			c.A1457G						.						133.0	126.0	128.0					4																	39313096		2203	4300	6503	SO:0001583	missense	5981	exon12			TTGGATTTCTTGC	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.1457A>G	4.37:g.39313096T>C	ENSP00000371321:p.Lys486Arg	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	7.0	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	ENST00000381897.1	37	CCDS56329.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.769326	0.49680	.	.	ENSG00000035928	ENST00000381897;ENST00000349703;ENST00000504554	T;T;T	0.44083	2.6;2.59;0.93	5.71	4.49	0.54785	.	0.407857	0.28958	N	0.013594	T	0.27663	0.0680	L	0.28344	0.845	0.36907	D	0.890683	B;B	0.12630	0.0;0.006	B;B	0.20384	0.005;0.029	T	0.15492	-1.0435	10	0.16896	T	0.51	-9.0652	9.1711	0.37081	0.0:0.1419:0.0:0.8581	.	486;486	P35251;P35251-2	RFC1_HUMAN;.	R	486;486;118	ENSP00000371321:K486R;ENSP00000261424:K486R;ENSP00000422129:K118R	ENSP00000261424:K486R	K	-	2	0	RFC1	38989491	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	4.017000	0.57167	0.956000	0.37904	0.533000	0.62120	AAA	.		0.348	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
RLIM	51132	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	73812676	73812676	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:73812676T>C	ENST00000332687.6	-	4	692	c.474A>G	c.(472-474)ccA>ccG	p.P158P	RLIM_ENST00000349225.2_Silent_p.P158P	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	158					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTCTTGCAGATGGCTCATTTT	0.408																																					p.P158P	Esophageal Squamous(169;1899 1923 14997 18818 32118)	.											.	RLIM	228	0			c.A474G						.						143.0	132.0	135.0					X																	73812676		2203	4299	6502	SO:0001819	synonymous_variant	51132	exon5			TGCAGATGGCTCA	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.474A>G	X.37:g.73812676T>C		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	43.0	NM_183353	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																			.		0.408	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057268.1	NM_016120	
RNASE10	338879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	20979115	20979115	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr14:20979115A>T	ENST00000328444.5	+	1	504	c.485A>T	c.(484-486)aAg>aTg	p.K162M	RNASE10_ENST00000430083.1_Missense_Mutation_p.K190M	NM_001012975.1	NP_001012993.1	Q5GAN6	RNS10_HUMAN	ribonuclease, RNase A family, 10 (non-active)	162					epithelial cell morphogenesis (GO:0003382)|heterotypic cell-cell adhesion (GO:0034113)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of sperm motility (GO:1902093)|regulation of fertilization (GO:0080154)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)	extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	12	all_cancers(95;0.00123)		Epithelial(56;1.81e-07)|all cancers(55;1.86e-06)	GBM - Glioblastoma multiforme(265;0.022)|READ - Rectum adenocarcinoma(17;0.191)		TGTGAGCTCAAGGGGGGAAAA	0.478																																					p.K162M		.											.	RNASE10	90	0			c.A485T						.						100.0	82.0	88.0					14																	20979115		2203	4300	6503	SO:0001583	missense	338879	exon1			AGCTCAAGGGGGG		CCDS32035.1	14q11.1	2004-11-16				ENSG00000182545		"""Ribonucleases, RNase A"""	19275	protein-coding gene	gene with protein product						12920233	Standard	XM_005267584		Approved	RNASE9	uc010tlj.2	Q5GAN6		ENST00000328444.5:c.485A>T	14.37:g.20979115A>T	ENSP00000333358:p.Lys162Met	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	9.0	NM_001012975	A2RUQ3|B4DKY4	Missense_Mutation	SNP	ENST00000328444.5	37	CCDS32035.1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.879509	0.33162	.	.	ENSG00000182545	ENST00000430083;ENST00000328444	T;T	0.14893	2.47;2.47	4.71	3.54	0.40534	Ribonuclease A, domain (3);	0.283892	0.31577	N	0.007403	T	0.27027	0.0662	M	0.85099	2.735	0.30982	N	0.72239	P;D	0.53312	0.892;0.959	B;P	0.46389	0.377;0.515	T	0.36768	-0.9734	10	0.46703	T	0.11	-29.4925	7.8351	0.29365	0.8161:0.0:0.0:0.1838	.	162;190	Q5GAN6;B4DKY4	RNS10_HUMAN;.	M	190;162	ENSP00000392996:K190M;ENSP00000333358:K162M	ENSP00000333358:K162M	K	+	2	0	RNASE10	20048955	0.997000	0.39634	0.708000	0.30435	0.801000	0.45260	1.587000	0.36622	0.894000	0.36317	0.533000	0.62120	AAG	.		0.478	RNASE10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411088.1	XM_292225	
ROBO2	6092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	77666666	77666666	+	Missense_Mutation	SNP	A	A	G	rs372099694		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:77666666A>G	ENST00000461745.1	+	22	4196	c.3296A>G	c.(3295-3297)tAt>tGt	p.Y1099C	ROBO2_ENST00000469233.1_3'UTR|ROBO2_ENST00000332191.8_Missense_Mutation_p.Y1099C|ROBO2_ENST00000487694.3_Missense_Mutation_p.Y1115C	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1099					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AATTTCAGCTATGACAGTGAT	0.393													A|||	1	0.000199681	0.0	0.0014	5008	,	,		20664	0.0		0.0	False		,,,				2504	0.0				p.Y1099C		.											.	ROBO2	328	0			c.A3296G						.	A	CYS/TYR,CYS/TYR	1,3897		0,1,1948	114.0	101.0	105.0		3344,3296	5.6	1.0	3		105	0,8296		0,0,4148	no	missense,missense	ROBO2	NM_001128929.2,NM_002942.4	194,194	0,1,6096	GG,GA,AA		0.0,0.0257,0.0082	possibly-damaging,possibly-damaging	1115/1395,1099/1379	77666666	1,12193	1949	4148	6097	SO:0001583	missense	6092	exon22			TCAGCTATGACAG	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3296A>G	3.37:g.77666666A>G	ENSP00000417164:p.Tyr1099Cys	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	44.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.0|20.0	3.930858|3.930858	0.73327|0.73327	2.57E-4|2.57E-4	0.0|0.0	ENSG00000185008|ENSG00000185008	ENST00000490991|ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191	.|T;T;T	.|0.62941	.|-0.01;0.02;0.01	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.000000	.|0.41823	.|D	.|0.000813	T|T	0.73528|0.73528	0.3598|0.3598	L|L	0.52573|0.52573	1.65|1.65	.|.	.|.	.|.	.|D;D;D	.|0.76494	.|0.99;0.999;0.99	.|P;D;P	.|0.67382	.|0.73;0.951;0.693	T|T	0.77120|0.77120	-0.2705|-0.2705	4|9	.|0.52906	.|T	.|0.07	.|.	15.7589|15.7589	0.78063|0.78063	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1115;1099;1099	.|Q19AB5;F8W703;Q9HCK4	.|.;.;ROBO2_HUMAN	V|C	256|1115;1115;1099;1099	.|ENSP00000417335:Y1115C;ENSP00000417164:Y1099C;ENSP00000327536:Y1099C	.|ENSP00000327536:Y1099C	M|Y	+|+	1|2	0|0	ROBO2|ROBO2	77749356|77749356	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.883000|0.883000	0.51084|0.51084	8.962000|8.962000	0.93254|0.93254	2.120000|2.120000	0.65058|0.65058	0.533000|0.533000	0.62120|0.62120	ATG|TAT	.		0.393	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
RPAP3	79657	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	48064026	48064026	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr12:48064026T>A	ENST00000005386.3	-	13	1505	c.1390A>T	c.(1390-1392)Aat>Tat	p.N464Y	RPAP3_ENST00000432584.3_Missense_Mutation_p.N305Y|RPAP3_ENST00000380650.4_Missense_Mutation_p.N430Y	NM_024604.2	NP_078880.2	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3	464										endometrium(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Lung SC(27;0.192)					TTTGCTAGATTAATAGGATTA	0.388																																					p.N464Y		.											.	RPAP3	69	0			c.A1390T						.						142.0	138.0	139.0					12																	48064026		2203	4300	6503	SO:0001583	missense	79657	exon13			CTAGATTAATAGG	AK025561	CCDS8753.1, CCDS53782.1, CCDS53783.1	12q13.11	2013-01-10				ENSG00000005175		"""Tetratricopeptide (TTC) repeat domain containing"""	26151	protein-coding gene	gene with protein product		611477				17643375	Standard	NM_024604		Approved	FLJ21908, spag	uc001rpr.3	Q9H6T3	OTTHUMG00000169668	ENST00000005386.3:c.1390A>T	12.37:g.48064026T>A	ENSP00000005386:p.Asn464Tyr	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	20.0	NM_024604	B4DRW9|Q6PHR5	Missense_Mutation	SNP	ENST00000005386.3	37	CCDS8753.1	.	.	.	.	.	.	.	.	.	.	T	15.45	2.836414	0.50951	.	.	ENSG00000005175	ENST00000005386;ENST00000432584;ENST00000380650	T;T;T	0.15487	2.86;2.42;2.86	5.47	1.59	0.23543	.	1.972720	0.01659	N	0.024987	T	0.19485	0.0468	L	0.34521	1.04	0.09310	N	1	P;B	0.40875	0.731;0.412	B;B	0.44224	0.444;0.259	T	0.18524	-1.0334	10	0.49607	T	0.09	.	7.0278	0.24950	0.0:0.0753:0.2816:0.6432	.	430;464	Q9H6T3-2;Q9H6T3	.;RPAP3_HUMAN	Y	464;305;430	ENSP00000005386:N464Y;ENSP00000401823:N305Y;ENSP00000370024:N430Y	ENSP00000005386:N464Y	N	-	1	0	RPAP3	46350293	0.000000	0.05858	0.000000	0.03702	0.730000	0.41778	0.412000	0.21131	0.026000	0.15269	0.455000	0.32223	AAT	.		0.388	RPAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405340.1	NM_024604	
RPS6KA6	27330	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	83352788	83352788	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:83352788C>T	ENST00000262752.2	-	19	1852	c.1845G>A	c.(1843-1845)atG>atA	p.M615I	RPS6KA6_ENST00000495332.1_5'UTR|RPS6KA6_ENST00000543399.1_Missense_Mutation_p.M615I	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	615	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						ACCCAGCCAACATTGTGTAAA	0.303																																					p.M615I		.											.	RPS6KA6	615	0			c.G1845A						.						122.0	118.0	120.0					X																	83352788		2203	4293	6496	SO:0001583	missense	27330	exon19			AGCCAACATTGTG	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1845G>A	X.37:g.83352788C>T	ENSP00000262752:p.Met615Ile	Somatic	269.0	2.0		WXS	Illumina HiSeq	Phase_I	146.0	123.0	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	37	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	C	32	5.113361	0.94339	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.41758	0.99;0.99	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57359	0.2048	L	0.48986	1.54	0.80722	D	1	D;P	0.57899	0.981;0.931	P;P	0.59703	0.862;0.704	T	0.59989	-0.7350	10	0.72032	D	0.01	.	18.392	0.90486	0.0:1.0:0.0:0.0	.	615;615	B7ZL90;Q9UK32	.;KS6A6_HUMAN	I	615	ENSP00000262752:M615I;ENSP00000440830:M615I	ENSP00000262752:M615I	M	-	3	0	RPS6KA6	83239444	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.548000	0.82154	2.284000	0.76573	0.600000	0.82982	ATG	.		0.303	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
SAGE1	55511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	134986663	134986663	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chrX:134986663A>T	ENST00000370709.3	+	3	248	c.248A>T	c.(247-249)gAa>gTa	p.E83V	SAGE1_ENST00000537770.1_Missense_Mutation_p.E83V|SAGE1_ENST00000324447.3_Missense_Mutation_p.E83V|SAGE1_ENST00000535938.1_Missense_Mutation_p.E83V			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	83						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					AGCATTTGTGAAGAGAGGATA	0.468																																					p.E83V		.											.	SAGE1	133	0			c.A248T						.						176.0	143.0	154.0					X																	134986663		2203	4300	6503	SO:0001583	missense	55511	exon4			TTTGTGAAGAGAG	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.248A>T	X.37:g.134986663A>T	ENSP00000359743:p.Glu83Val	Somatic	197.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	53.0	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	37	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	A	12.90	2.075079	0.36566	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.36878	1.23;1.23;1.27;1.23	1.65	1.65	0.23941	.	0.204172	0.31531	U	0.007496	T	0.41119	0.1145	L	0.34521	1.04	0.09310	N	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.979;0.999	T	0.07214	-1.0784	10	0.87932	D	0	.	4.8128	0.13351	1.0:0.0:0.0:0.0	.	83;83	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	V	83	ENSP00000323191:E83V;ENSP00000445959:E83V;ENSP00000438276:E83V;ENSP00000359743:E83V	ENSP00000323191:E83V	E	+	2	0	SAGE1	134814329	0.539000	0.26402	0.081000	0.20488	0.013000	0.08279	2.529000	0.45632	0.891000	0.36235	0.235000	0.17854	GAA	.		0.468	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
SARS2	54938	broad.mit.edu;mdanderson.org	37	19	39416927	39416927	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:39416927T>G	ENST00000221431.6	-	2	440	c.281A>C	c.(280-282)cAg>cCg	p.Q94P	SARS2_ENST00000594171.1_5'UTR|SARS2_ENST00000448145.2_Missense_Mutation_p.Q94P|SARS2_ENST00000430193.3_Missense_Mutation_p.Q94P|CTC-360G5.8_ENST00000599996.1_Silent_p.A163A|SARS2_ENST00000600042.1_Missense_Mutation_p.Q94P	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	94					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CCTCAGCTCCTGCCATGTCGA	0.612																																					p.Q94P		.											.	SARS2	93	0			c.A281C						.						53.0	44.0	47.0					19																	39416927		2203	4300	6503	SO:0001583	missense	54938	exon2			AGCTCCTGCCATG	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.281A>C	19.37:g.39416927T>G	ENSP00000221431:p.Gln94Pro	Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	12.0	3.0	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	37	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436622	0.62955	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000448145;ENST00000455102	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	4.47	4.47	0.54385	tRNA-binding arm (1);Seryl-tRNA synthetase, class IIa, N-terminal (1);	0.222702	0.38217	N	0.001771	T	0.58807	0.2148	M	0.67953	2.075	.	.	.	D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.986	D;D;P;D;P	0.71656	0.974;0.964;0.894;0.964;0.857	T	0.70854	-0.4759	9	0.62326	D	0.03	.	10.4286	0.44393	0.0:0.0:0.0:1.0	.	94;94;94;94;94	B4DJP6;E7EX87;B4DE10;B4DXB9;Q9NP81	.;.;.;.;SYSM_HUMAN	P	94	ENSP00000406754:Q94P;ENSP00000221431:Q94P;ENSP00000399330:Q94P;ENSP00000414954:Q94P	ENSP00000221431:Q94P	Q	-	2	0	FBXO17	44108767	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	2.693000	0.47027	1.778000	0.52293	0.334000	0.21626	CAG	.		0.612	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
SDK2	54549	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	71348683	71348683	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:71348683T>G	ENST00000392650.3	-	41	5687	c.5687A>C	c.(5686-5688)tAt>tCt	p.Y1896S	SDK2_ENST00000388726.3_Missense_Mutation_p.Y1877S|SDK2_ENST00000410094.1_5'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1896	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CCGGAAGTCATAGCTCACGCC	0.617																																					p.Y1896S		.											.	SDK2	24	0			c.A5687C						.						101.0	77.0	85.0					17																	71348683		2203	4300	6503	SO:0001583	missense	54549	exon41			AAGTCATAGCTCA	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5687A>C	17.37:g.71348683T>G	ENSP00000376421:p.Tyr1896Ser	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	18.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	37	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.725783	0.89298	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	D;D;D	0.89343	-2.5;-2.5;-2.5	5.37	5.37	0.77165	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96815	0.8960	H	0.98594	4.275	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98448	1.0590	10	0.87932	D	0	.	15.3709	0.74564	0.0:0.0:0.0:1.0	.	1896;1877	Q58EX2;Q58EX2-3	SDK2_HUMAN;.	S	1520;1896;1877;1053;1896;237	ENSP00000376421:Y1896S;ENSP00000373378:Y1877S;ENSP00000407098:Y1053S	ENSP00000324967:Y1896S	Y	-	2	0	SDK2	68860278	1.000000	0.71417	0.938000	0.37757	0.992000	0.81027	7.903000	0.87398	2.031000	0.59945	0.533000	0.62120	TAT	.		0.617	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SEC14L5	9717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	5050737	5050737	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:5050737T>A	ENST00000251170.7	+	9	1232	c.1052T>A	c.(1051-1053)cTg>cAg	p.L351Q		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	351	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						GAGGCGCTGCTGCGGCATGTG	0.667																																					p.L351Q		.											.	.	.	0			c.T1052A						.						14.0	16.0	16.0					16																	5050737		2020	4134	6154	SO:0001583	missense	9717	exon9			CGCTGCTGCGGCA	AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1052T>A	16.37:g.5050737T>A	ENSP00000251170:p.Leu351Gln	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	23.0	NM_014692		Missense_Mutation	SNP	ENST00000251170.7	37	CCDS45403.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.277525	0.80580	.	.	ENSG00000103184	ENST00000251170	T	0.76839	-1.05	4.36	4.36	0.52297	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.000000	0.49916	D	0.000126	D	0.86686	0.5992	M	0.75150	2.29	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.88112	0.2826	10	0.62326	D	0.03	-23.454	13.7221	0.62735	0.0:0.0:0.0:1.0	.	351	O43304	S14L5_HUMAN	Q	351	ENSP00000251170:L351Q	ENSP00000251170:L351Q	L	+	2	0	SEC14L5	4990738	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	7.349000	0.79376	1.841000	0.53522	0.379000	0.24179	CTG	.		0.667	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434379.1		
SEC31A	22872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	83793196	83793196	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:83793196T>G	ENST00000395310.2	-	7	865	c.683A>C	c.(682-684)cAg>cCg	p.Q228P	SEC31A_ENST00000508502.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000513858.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000326950.5_Missense_Mutation_p.Q228P|SEC31A_ENST00000509142.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000436790.2_5'UTR|SEC31A_ENST00000348405.4_Missense_Mutation_p.Q228P|SEC31A_ENST00000500777.2_Missense_Mutation_p.Q228P|SEC31A_ENST00000443462.2_Missense_Mutation_p.Q223P|SEC31A_ENST00000505984.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000432794.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000311785.7_Missense_Mutation_p.Q228P|SEC31A_ENST00000448323.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000264405.5_5'Flank|SEC31A_ENST00000508479.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000505472.1_Missense_Mutation_p.Q228P|SEC31A_ENST00000355196.2_Missense_Mutation_p.Q228P	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	228	Interaction with SEC13.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				AAGGACCATCTGAGTAGCAAC	0.453																																					p.Q228P		.											.	SEC31A	268	0			c.A683C						.						117.0	91.0	100.0					4																	83793196		2203	4300	6503	SO:0001583	missense	22872	exon7			ACCATCTGAGTAG	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.683A>C	4.37:g.83793196T>G	ENSP00000378721:p.Gln228Pro	Somatic	212.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	41.0	NM_001077206	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	ENST00000395310.2	37	CCDS3596.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.779214	0.90195	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000505984;ENST00000508479;ENST00000503058	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.63913	1.64;1.64;1.64;1.55;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;1.64;-0.07	5.65	5.65	0.86999	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84247	0.5430	M	0.93197	3.39	0.80722	D	1	P;P;D;D;D;P;D;D;P	0.76494	0.897;0.93;0.986;0.976;0.992;0.864;0.999;0.958;0.885	P;P;P;P;D;P;D;P;P	0.75484	0.756;0.529;0.744;0.701;0.956;0.771;0.986;0.72;0.691	D	0.88582	0.3137	10	0.87932	D	0	-9.1846	15.8687	0.79091	0.0:0.0:0.0:1.0	.	223;228;228;228;228;228;228;228;228	B4DIW6;B7ZL00;O94979-5;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979	.;.;.;.;.;.;.;.;SC31A_HUMAN	P	228;228;228;223;228;228;228;228;228;228;228;228;228;228;228;199	ENSP00000337602:Q228P;ENSP00000426886:Q228P;ENSP00000378721:Q228P;ENSP00000408027:Q223P;ENSP00000426569:Q228P;ENSP00000407944:Q228P;ENSP00000400926:Q228P;ENSP00000325087:Q228P;ENSP00000309070:Q228P;ENSP00000421633:Q228P;ENSP00000421464:Q228P;ENSP00000424635:Q228P;ENSP00000347329:Q228P;ENSP00000424451:Q228P;ENSP00000425999:Q228P;ENSP00000425056:Q199P	ENSP00000309070:Q228P	Q	-	2	0	SEC31A	84012220	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.036000	0.88901	2.136000	0.66102	0.477000	0.44152	CAG	.		0.453	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	
SF3B4	10262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	149898428	149898428	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:149898428G>A	ENST00000271628.8	-	3	1130	c.546C>T	c.(544-546)tcC>tcT	p.S182S	MTMR11_ENST00000492824.1_5'Flank	NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	182					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GCTCACCCTTGGAGTCCTTCT	0.537																																					p.S182S		.											.	SF3B4	91	0			c.C546T						.						84.0	82.0	83.0					1																	149898428		2203	4300	6503	SO:0001819	synonymous_variant	10262	exon3			ACCCTTGGAGTCC	L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.546C>T	1.37:g.149898428G>A		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	135.0	25.0	NM_005850	Q5SZ63	Silent	SNP	ENST00000271628.8	37	CCDS941.1																																																																																			.		0.537	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033753.1	NM_005850	
SH2D3A	10045	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	6755179	6755180	+	Frame_Shift_Ins	INS	-	-	G	rs139813452		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:6755179_6755180insG	ENST00000245908.6	-	5	912_913	c.643_644insC	c.(643-645)cggfs	p.R215fs	SH2D3A_ENST00000437152.3_Frame_Shift_Ins_p.R93fs|SH2D3A_ENST00000599563.1_5'UTR	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	215					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						GGAGGGTGTCCGGGGGGGCTTC	0.653																																					p.R215fs		.											.	SH2D3A	290	0			c.644_645insC						.																																			SO:0001589	frameshift_variant	10045	exon5			GGTGTCCGGGGGG	AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.644dupC	19.37:g.6755186_6755186dupG	ENSP00000245908:p.Arg215fs	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	12.0	NM_005490	A8K9R6|B4DRS7|Q9Y2X4	Frame_Shift_Ins	INS	ENST00000245908.6	37	CCDS12173.1																																																																																			.		0.653	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458016.1	NM_005490	
SH3BP4	23677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	235951205	235951205	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:235951205G>T	ENST00000409212.1	+	4	2299	c.1792G>T	c.(1792-1794)Gag>Tag	p.E598*	SH3BP4_ENST00000392011.2_Nonsense_Mutation_p.E598*|SH3BP4_ENST00000344528.4_Nonsense_Mutation_p.E598*			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	598					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		GGACGACCAGGAGGCCATCCT	0.572																																					p.E598X		.											.	SH3BP4	94	0			c.G1792T						.						61.0	61.0	61.0					2																	235951205		2203	4300	6503	SO:0001587	stop_gained	23677	exon4			GACCAGGAGGCCA	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.1792G>T	2.37:g.235951205G>T	ENSP00000386862:p.Glu598*	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	94.0	NM_014521	O95082|Q309A3|Q53QD0|Q53TD1	Nonsense_Mutation	SNP	ENST00000409212.1	37	CCDS2513.1	.	.	.	.	.	.	.	.	.	.	G	43	10.258404	0.99370	.	.	ENSG00000130147	ENST00000392011;ENST00000409212;ENST00000344528	.	.	.	5.08	5.08	0.68730	.	0.252860	0.42053	D	0.000776	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-18.5127	17.0389	0.86483	0.0:0.0:1.0:0.0	.	.	.	.	X	598	.	ENSP00000340237:E598X	E	+	1	0	SH3BP4	235615944	1.000000	0.71417	0.993000	0.49108	0.963000	0.63663	9.458000	0.97634	2.354000	0.79902	0.655000	0.94253	GAG	.		0.572	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
SHD	56961	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	4280338	4280338	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:4280338T>A	ENST00000543264.2	+	1	1741	c.278T>A	c.(277-279)cTg>cAg	p.L93Q	SHD_ENST00000599689.1_Missense_Mutation_p.L93Q	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	93										breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGCCCTTCTGGGCGGCCCC	0.637																																					p.L93Q		.											.	SHD	90	0			c.T278A						.						8.0	9.0	8.0					19																	4280338		2157	4252	6409	SO:0001583	missense	56961	exon1			CCCTTCTGGGCGG	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.278T>A	19.37:g.4280338T>A	ENSP00000446058:p.Leu93Gln	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	15.0	NM_020209	Q96NC2	Missense_Mutation	SNP	ENST00000543264.2	37	CCDS12125.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.278260	0.80692	.	.	ENSG00000105251	ENST00000543264;ENST00000221852	T	0.39229	1.09	4.75	3.73	0.42828	.	0.485585	0.18019	U	0.154302	T	0.48822	0.1521	L	0.56769	1.78	0.38409	D	0.945878	B;P	0.46578	0.265;0.88	B;P	0.53313	0.229;0.723	T	0.49360	-0.8948	10	0.52906	T	0.07	-18.7318	7.1806	0.25770	0.0:0.1047:0.0:0.8953	.	7;93	Q9NPN8;Q96IW2	.;SHD_HUMAN	Q	93;8	ENSP00000446058:L93Q	ENSP00000221852:L8Q	L	+	2	0	SHD	4231338	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	1.985000	0.40668	0.773000	0.33404	0.397000	0.26171	CTG	.		0.637	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
SIGLEC10	89790	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51918290	51918290	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:51918290G>T	ENST00000339313.5	-	8	1519	c.1403C>A	c.(1402-1404)gCc>gAc	p.A468D	CTD-2616J11.2_ENST00000526996.1_RNA|SIGLEC10_ENST00000353836.5_Intron|SIGLEC10_ENST00000439889.2_Missense_Mutation_p.A410D|SIGLEC10_ENST00000525998.1_Intron|CTD-2616J11.2_ENST00000532688.1_RNA|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000436984.2_Intron|SIGLEC10_ENST00000432469.2_Intron|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.A468D			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	468					cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGCCGGGCTGGCCTGGGAGGA	0.701																																					p.A468D		.											.	SIGLEC10	91	0			c.C1403A						.						10.0	12.0	11.0					19																	51918290		2180	4253	6433	SO:0001583	missense	89790	exon8			GGGCTGGCCTGGG	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.1403C>A	19.37:g.51918290G>T	ENSP00000345243:p.Ala468Asp	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	7.0	NM_033130	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	37	CCDS12832.1	.	.	.	.	.	.	.	.	.	.	.	11.85	1.761401	0.31228	.	.	ENSG00000142512	ENST00000356298;ENST00000439889;ENST00000339313	D;D;D	0.85702	-2.02;-2.02;-2.02	4.83	3.78	0.43462	.	0.000000	0.56097	D	0.000028	D	0.92496	0.7617	M	0.88181	2.935	0.09310	N	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	D	0.85652	0.1283	10	0.87932	D	0	.	11.0884	0.48102	0.0:0.188:0.812:0.0	.	410;468	Q96LC7-3;Q96LC7	.;SIG10_HUMAN	D	468;410;468	ENSP00000348646:A468D;ENSP00000389132:A410D;ENSP00000345243:A468D	ENSP00000345243:A468D	A	-	2	0	SIGLEC10	56610102	0.686000	0.27661	0.126000	0.21872	0.004000	0.04260	2.994000	0.49433	1.020000	0.39573	0.561000	0.74099	GCC	.		0.701	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
SIGLEC1	6614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3674260	3674260	+	Silent	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:3674260C>A	ENST00000344754.4	-	13	3341	c.3342G>T	c.(3340-3342)ccG>ccT	p.P1114P	SIGLEC1_ENST00000202578.4_Silent_p.P1114P	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1114	Ig-like C2-type 11.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						TGAGCTGGGCCGGGTGAGTGG	0.657																																					p.P1114P		.											.	SIGLEC1	167	0			c.G3342T						.						72.0	50.0	58.0					20																	3674260		2203	4300	6503	SO:0001819	synonymous_variant	6614	exon13			CTGGGCCGGGTGA	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3342G>T	20.37:g.3674260C>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	8.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1																																																																																			.		0.657	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
SIN3B	23309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16973709	16973709	+	Silent	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:16973709A>C	ENST00000379803.1	+	10	1295	c.1281A>C	c.(1279-1281)acA>acC	p.T427T	SIN3B_ENST00000248054.5_Intron|SIN3B_ENST00000595541.1_5'Flank	NM_015260.2	NP_056075.1			SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						ACCATTGGACACTTCTCCAGG	0.473																																					p.T427T		.											.	SIN3B	228	0			c.A1281C						.						279.0	261.0	267.0					19																	16973709		2203	4300	6503	SO:0001819	synonymous_variant	23309	exon10			TTGGACACTTCTC	AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000379803.1:c.1281A>C	19.37:g.16973709A>C		Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	13.0	NM_015260		Silent	SNP	ENST00000379803.1	37	CCDS32946.1																																																																																			.		0.473	SIN3B-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462848.1	NM_015260	
SIGLEC9	27180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51630384	51630384	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:51630384T>A	ENST00000250360.3	+	4	913	c.846T>A	c.(844-846)ccT>ccA	p.P282P	SIGLEC9_ENST00000440804.3_Silent_p.P282P	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	282	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		GCAATCCCCCTGCCAGGCTGA	0.617																																					p.P282P		.											.	SIGLEC9	91	0			c.T846A						.						97.0	93.0	94.0					19																	51630384		2203	4300	6503	SO:0001819	synonymous_variant	27180	exon4			TCCCCCTGCCAGG	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.846T>A	19.37:g.51630384T>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	19.0	NM_001198558	Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	37	CCDS12825.1																																																																																			.		0.617	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
SLC12A2	6558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	127484507	127484507	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:127484507A>G	ENST00000262461.2	+	12	2132	c.1943A>G	c.(1942-1944)aAt>aGt	p.N648S	SLC12A2_ENST00000343225.4_Missense_Mutation_p.N648S	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	648					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TATGGGAAAAATAATGAACCT	0.308																																					p.N648S		.											.	SLC12A2	94	0			c.A1943G						.						178.0	181.0	180.0					5																	127484507		2203	4299	6502	SO:0001583	missense	6558	exon12			GGAAAAATAATGA		CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1943A>G	5.37:g.127484507A>G	ENSP00000262461:p.Asn648Ser	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	9.0	NM_001046	Q8N713|Q8WWH7	Missense_Mutation	SNP	ENST00000262461.2	37	CCDS4144.1	.	.	.	.	.	.	.	.	.	.	A	17.12	3.308423	0.60305	.	.	ENSG00000064651	ENST00000262461;ENST00000343225	D;D	0.98512	-4.97;-4.97	4.8	4.8	0.61643	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.97564	0.9202	L	0.43923	1.385	0.80722	D	1	P;D	0.53462	0.95;0.96	P;P	0.54210	0.628;0.745	D	0.98304	1.0520	10	0.87932	D	0	.	14.7822	0.69774	1.0:0.0:0.0:0.0	.	648;648	P55011-3;P55011	.;S12A2_HUMAN	S	648	ENSP00000262461:N648S;ENSP00000340878:N648S	ENSP00000262461:N648S	N	+	2	0	SLC12A2	127512406	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.268000	0.78473	2.142000	0.66516	0.477000	0.44152	AAT	.		0.308	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250972.1	NM_001046	
SLC25A24	29957	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	108742645	108742645	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:108742645A>T	ENST00000565488.1	-	1	335	c.116T>A	c.(115-117)gTg>gAg	p.V39E	RP11-483I13.5_ENST00000564063.1_RNA|SLC25A24_ENST00000569674.1_Missense_Mutation_p.V39E	NM_013386.4	NP_037518.3	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 24	39	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				ATP transport (GO:0015867)|cellular response to calcium ion (GO:0071277)|cellular response to oxidative stress (GO:0034599)|mitochondrial transport (GO:0006839)|regulation of cell death (GO:0010941)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP transmembrane transporter activity (GO:0005347)|calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		GCCGATGTCCACCACTCCGTC	0.721																																					p.V39E		.											.	SLC25A24	91	0			c.T116A						.						18.0	24.0	22.0					1																	108742645		2024	4168	6192	SO:0001583	missense	29957	exon1			ATGTCCACCACTC	AJ619961	CCDS786.1, CCDS41361.1	1p13.2	2013-05-22			ENSG00000085491	ENSG00000085491		"""Solute carriers"", ""EF-hand domain containing"""	20662	protein-coding gene	gene with protein product		608744				15123600	Standard	NM_013386		Approved	DKFZp586G0123, APC1	uc001dvn.5	Q6NUK1	OTTHUMG00000011013	ENST00000565488.1:c.116T>A	1.37:g.108742645A>T	ENSP00000457733:p.Val39Glu	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	63.0	NM_013386	B7ZAI9|Q5T331|Q5T485|Q6PJJ9|Q705K4|Q9P129	Missense_Mutation	SNP	ENST00000565488.1	37	CCDS41361.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.882113	0.91740	.	.	ENSG00000085491	ENST00000264128	T	0.73047	-0.71	4.65	4.65	0.58169	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.71443	0.3340	M	0.93898	3.47	0.52501	D	0.999957	B	0.18013	0.025	B	0.26969	0.075	T	0.77691	-0.2493	10	0.87932	D	0	-27.6067	13.4165	0.60972	1.0:0.0:0.0:0.0	.	39	Q6NUK1	SCMC1_HUMAN	E	39	ENSP00000264128:V39E	ENSP00000264128:V39E	V	-	2	0	SLC25A24	108544168	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	5.527000	0.67123	1.940000	0.56252	0.374000	0.22700	GTG	.		0.721	SLC25A24-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030280.2	NM_013386	
SLCO4C1	353189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	101631729	101631729	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:101631729G>C	ENST00000310954.6	-	1	524	c.238C>G	c.(238-240)Ctg>Gtg	p.L80V		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		AACTCGGACAGCGACAGTGAC	0.577																																					p.L80V		.											.	SLCO4C1	93	0			c.C238G						.						89.0	90.0	90.0					5																	101631729		2203	4300	6503	SO:0001583	missense	353189	exon1			CGGACAGCGACAG	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.238C>G	5.37:g.101631729G>C	ENSP00000309741:p.Leu80Val	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	29.0	NM_180991		Missense_Mutation	SNP	ENST00000310954.6	37	CCDS34205.1	.	.	.	.	.	.	.	.	.	.	G	3.319	-0.139058	0.06669	.	.	ENSG00000173930	ENST00000310954	T	0.38077	1.16	3.81	0.412	0.16397	.	1.188650	0.06781	N	0.785336	T	0.24890	0.0604	L	0.38531	1.155	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.25779	-1.0122	10	0.29301	T	0.29	.	3.1762	0.06569	0.106:0.4243:0.3049:0.1648	.	80	Q6ZQN7	SO4C1_HUMAN	V	80	ENSP00000309741:L80V	ENSP00000309741:L80V	L	-	1	2	SLCO4C1	101659628	0.000000	0.05858	0.003000	0.11579	0.060000	0.15804	0.563000	0.23547	0.295000	0.22570	0.591000	0.81541	CTG	.		0.577	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991	
SMAD5	4090	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	135496605	135496605	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:135496605T>G	ENST00000545279.1	+	4	824	c.464T>G	c.(463-465)gTt>gGt	p.V155G	SMAD5_ENST00000514641.2_3'UTR|SMAD5_ENST00000545620.1_Missense_Mutation_p.V155G	NM_001001419.1|NM_005903.5	NP_001001419.1|NP_005894.3	Q99717	SMAD5_HUMAN	SMAD family member 5	155					BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGCCTTCTGGTTCAGTTTAGG	0.418																																					.		.											.	SMAD5	278	0			.						.						217.0	225.0	223.0					5																	135496605		1949	4166	6115	SO:0001583	missense	4090	.			TTCTGGTTCAGTT	U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000545279.1:c.464T>G	5.37:g.135496605T>G	ENSP00000441954:p.Val155Gly	Somatic	208.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	80.0	.	O14688|Q15798|Q9UQA1	Missense_Mutation	SNP	ENST00000545279.1	37		.	.	.	.	.	.	.	.	.	.	T	11.98	1.801104	0.31869	.	.	ENSG00000113658	ENST00000545279;ENST00000545620	D;D	0.92446	-3.04;-3.04	5.59	5.59	0.84812	.	0.058029	0.64402	D	0.000002	D	0.85936	0.5813	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.16722	0.016	T	0.80533	-0.1340	10	0.27082	T	0.32	.	10.1603	0.42847	0.0:0.0744:0.0:0.9256	.	155	F5GWU7	.	G	155	ENSP00000441954:V155G;ENSP00000446474:V155G	ENSP00000425018:V155G	V	+	2	0	SMAD5	135524504	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	1.801000	0.38843	2.114000	0.64651	0.528000	0.53228	GTT	.		0.418	SMAD5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005903	
SLC36A3	285641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150678223	150678223	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:150678223G>T	ENST00000335230.3	-	2	561	c.150C>A	c.(148-150)caC>caA	p.H50Q	SLC36A3_ENST00000377713.3_Missense_Mutation_p.H50Q	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	50						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ATTTCAACAAGTGGATCAAAG	0.532																																					p.H50Q		.											.	SLC36A3	93	0			c.C150A						.						112.0	98.0	103.0					5																	150678223		2203	4300	6503	SO:0001583	missense	285641	exon2			CAACAAGTGGATC	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.150C>A	5.37:g.150678223G>T	ENSP00000334750:p.His50Gln	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	15.0	NM_181774	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	37	CCDS4314.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920714	0.52653	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02446	4.29;4.29	4.62	0.254	0.15557	.	0.000000	0.85682	D	0.000000	T	0.18425	0.0442	H	0.96048	3.76	0.38161	D	0.939034	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.02202	-1.1196	10	0.87932	D	0	.	7.0277	0.24950	0.4824:0.0:0.5176:0.0	.	50;50	Q495N2-3;Q495N2	.;S36A3_HUMAN	Q	50	ENSP00000334750:H50Q;ENSP00000366942:H50Q	ENSP00000334750:H50Q	H	-	3	2	SLC36A3	150658416	0.976000	0.34144	0.335000	0.25508	0.966000	0.64601	0.619000	0.24388	0.085000	0.17107	0.655000	0.94253	CAC	.		0.532	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
SMAP2	64744	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40882562	40882562	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:40882562A>G	ENST00000539317.1	+	9	911	c.718A>G	c.(718-720)Atg>Gtg	p.M240V		NM_001198980.1	NP_001185909.1	Q8WU79	SMAP2_HUMAN	small ArfGAP2	320					regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			central_nervous_system(3)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24	Lung NSC(20;1.56e-05)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;1.04e-17)			ACCAGTAGGCATGGTTGCTCA	0.592																																					p.M320V		.											.	SMAP2	68	0			c.A958G						.						61.0	54.0	56.0					1																	40882562		2203	4300	6503	SO:0001583	missense	64744	exon9			GTAGGCATGGTTG	AL137764	CCDS451.1, CCDS55592.1, CCDS55593.1, CCDS72763.1	1p35.3-p34.1	2008-09-22	2008-09-05	2008-01-09	ENSG00000084070	ENSG00000084070		"""ADP-ribosylation factor GTPase activating proteins"""	25082	protein-coding gene	gene with protein product			"""stromal membrane-associated protein 1-like"", ""stromal membrane-associated GTPase-activating protein 2"""	SMAP1L		16571680	Standard	NM_001198978		Approved		uc001cfj.3	Q8WU79	OTTHUMG00000007301	ENST00000539317.1:c.718A>G	1.37:g.40882562A>G	ENSP00000442835:p.Met240Val	Somatic	213.0	0.0		WXS	Illumina HiSeq	Phase_I	276.0	40.0	NM_022733	B2R7T1|B7Z5B5|B7Z8V2|D3DPV2|Q5QPL2|Q96C93|Q9NST2|Q9UJL8	Missense_Mutation	SNP	ENST00000539317.1	37	CCDS55593.1	.	.	.	.	.	.	.	.	.	.	A	7.556	0.663789	0.14710	.	.	ENSG00000084070	ENST00000372718;ENST00000372708;ENST00000539317	T;T;T	0.29917	2.25;2.26;1.55	6.02	4.9	0.64082	.	0.427371	0.31589	N	0.007389	T	0.12475	0.0303	N	0.03324	-0.35	0.45914	D	0.998756	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.16988	-1.0384	10	0.13853	T	0.58	-9.0976	9.6694	0.40004	0.9196:0.0:0.0804:0.0	.	290;320	Q8WU79-2;Q8WU79	.;SMAP2_HUMAN	V	320;290;240	ENSP00000361803:M320V;ENSP00000361793:M290V;ENSP00000442835:M240V	ENSP00000361793:M290V	M	+	1	0	SMAP2	40655149	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.407000	0.59754	2.311000	0.77944	0.533000	0.62120	ATG	.		0.592	SMAP2-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022733	
SORCS3	22986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	106924072	106924072	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:106924072C>G	ENST00000369701.3	+	12	1971	c.1744C>G	c.(1744-1746)Ccg>Gcg	p.P582A		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	582					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CAACATTGGCCCGGAGCTCTC	0.478																																					p.P582A	NSCLC(116;1497 1690 7108 13108 14106)	.											.	SORCS3	99	0			c.C1744G						.						110.0	97.0	101.0					10																	106924072		2203	4300	6503	SO:0001583	missense	22986	exon12			ATTGGCCCGGAGC	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1744C>G	10.37:g.106924072C>G	ENSP00000358715:p.Pro582Ala	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	46.0	6.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	37	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	C	9.548	1.115129	0.20795	.	.	ENSG00000156395	ENST00000369701;ENST00000393176	T;T	0.21543	2.0;2.0	6.17	-4.12	0.03916	VPS10 (1);	0.721094	0.14149	N	0.338102	T	0.07234	0.0183	N	0.11845	0.185	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.30208	-0.9986	9	.	.	.	.	2.5836	0.04825	0.1135:0.2532:0.1706:0.4626	.	582	Q9UPU3	SORC3_HUMAN	A	582;27	ENSP00000358715:P582A;ENSP00000376876:P27A	.	P	+	1	0	SORCS3	106914062	0.021000	0.18746	0.303000	0.25071	0.997000	0.91878	-0.549000	0.06041	-0.548000	0.06199	0.655000	0.94253	CCG	.		0.478	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
SOWAHB	345079	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	77818168	77818168	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:77818168G>A	ENST00000334306.2	-	1	834	c.835C>T	c.(835-837)Ccc>Tcc	p.P279S		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	279																	CGGGGAGCGGGGCCGGGCAGG	0.716																																					p.P279S		.											.	.	.	0			c.C835T						.						4.0	6.0	5.0					4																	77818168		1959	3964	5923	SO:0001583	missense	345079	exon1			GAGCGGGGCCGGG		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.835C>T	4.37:g.77818168G>A	ENSP00000334879:p.Pro279Ser	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	14.0	9.0	NM_001029870	B2RP29	Missense_Mutation	SNP	ENST00000334306.2	37	CCDS34017.1	.	.	.	.	.	.	.	.	.	.	G	9.796	1.179323	0.21787	.	.	ENSG00000186212	ENST00000334306	T	0.05382	3.45	4.32	0.521	0.17046	.	1.751880	0.03913	U	0.282258	T	0.03348	0.0097	N	0.12182	0.205	0.09310	N	1	B	0.30068	0.267	B	0.28139	0.086	T	0.37407	-0.9707	10	0.10111	T	0.7	-1.9297	2.9578	0.05882	0.1649:0.1407:0.5493:0.1451	.	279	A6NEL2	ANR56_HUMAN	S	279	ENSP00000334879:P279S	ENSP00000334879:P279S	P	-	1	0	ANKRD56	78037192	0.229000	0.23729	0.000000	0.03702	0.004000	0.04260	1.675000	0.37555	-0.136000	0.11475	0.561000	0.74099	CCC	.		0.716	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
SPARC	6678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	151045983	151045983	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:151045983T>A	ENST00000231061.4	-	8	986	c.673A>T	c.(673-675)Aac>Tac	p.N225Y	SPARC_ENST00000537849.1_5'Flank	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	225					blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)			central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		ATGTACATGTTATAGTTCTTC	0.562																																					p.N225Y		.											.	SPARC	514	0			c.A673T						.						87.0	80.0	82.0					5																	151045983		2203	4300	6503	SO:0001583	missense	6678	exon8			ACATGTTATAGTT		CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.673A>T	5.37:g.151045983T>A	ENSP00000231061:p.Asn225Tyr	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	46.0	NM_003118	D3DQH9|Q6IBK4	Missense_Mutation	SNP	ENST00000231061.4	37	CCDS4318.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.323168	0.81580	.	.	ENSG00000113140	ENST00000231061;ENST00000538026	T	0.24350	1.86	5.64	4.43	0.53597	SPARC/Testican, calcium-binding domain (1);EF-hand-like domain (1);	0.122706	0.85682	N	0.000000	T	0.39410	0.1077	M	0.78223	2.4	0.58432	D	0.999999	P	0.46784	0.884	P	0.47864	0.559	T	0.43327	-0.9398	10	0.59425	D	0.04	-25.2967	14.0277	0.64594	0.0:0.0:0.1341:0.8659	.	225	P09486	SPRC_HUMAN	Y	225;134	ENSP00000231061:N225Y	ENSP00000231061:N225Y	N	-	1	0	SPARC	151026176	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.602000	0.61098	2.143000	0.66587	0.533000	0.62120	AAC	.		0.562	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252430.1	NM_003118	
SPAST	6683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	32314626	32314626	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:32314626A>G	ENST00000315285.3	+	3	663	c.538A>G	c.(538-540)Aaa>Gaa	p.K180E	AL121655.1_ENST00000577299.1_RNA|SPAST_ENST00000345662.1_Missense_Mutation_p.K180E	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CCTTCAAGCTAAAATGATGAC	0.318																																					p.K180E		.											.	SPAST	153	0			c.A538G						.						107.0	103.0	104.0					2																	32314626		2203	4300	6503	SO:0001583	missense	6683	exon3			CAAGCTAAAATGA	AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.538A>G	2.37:g.32314626A>G	ENSP00000320885:p.Lys180Glu	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	26.0	NM_199436		Missense_Mutation	SNP	ENST00000315285.3	37	CCDS1778.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.671563	0.88348	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	T;T	0.77358	-1.09;-1.09	5.77	5.77	0.91146	MIT (2);	0.526955	0.23260	N	0.050148	D	0.87478	0.6187	M	0.80982	2.52	0.58432	D	0.999999	D;D	0.71674	0.984;0.998	P;D	0.66979	0.865;0.948	D	0.86378	0.1727	10	0.32370	T	0.25	-12.8061	15.8048	0.78491	1.0:0.0:0.0:0.0	.	180;180	E5KRP6;Q9UBP0	.;SPAST_HUMAN	E	180	ENSP00000340817:K180E;ENSP00000320885:K180E	ENSP00000320885:K180E	K	+	1	0	SPAST	32168130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.268000	0.78473	2.212000	0.71576	0.529000	0.55759	AAA	.		0.318	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436	
SPATA18	132671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	52943036	52943036	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:52943036A>T	ENST00000295213.4	+	7	1224	c.850A>T	c.(850-852)Agg>Tgg	p.R284W	SPATA18_ENST00000419395.2_Missense_Mutation_p.R252W	NM_145263.2	NP_660306.1	Q8TC71	MIEAP_HUMAN	spermatogenesis associated 18	284	Ser-rich.				cellular response to DNA damage stimulus (GO:0006974)|mitochondrial protein catabolic process (GO:0035694)|mitochondrion degradation by induced vacuole formation (GO:0035695)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(4;1.77e-13)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TGTCAAGGTCAGGAGACCGTC	0.667																																					p.R284W		.											.	SPATA18	72	0			c.A850T						.						56.0	48.0	51.0					4																	52943036		2203	4300	6503	SO:0001583	missense	132671	exon7			AAGGTCAGGAGAC	BC025396	CCDS3489.1, CCDS75124.1	4q11	2012-01-23	2012-01-23		ENSG00000163071	ENSG00000163071			29579	protein-coding gene	gene with protein product		612814	"""spermatogenesis associated 18 homolog (rat)"""			21300779	Standard	XR_245253		Approved	FLJ32906	uc003gzl.3	Q8TC71	OTTHUMG00000128698	ENST00000295213.4:c.850A>T	4.37:g.52943036A>T	ENSP00000295213:p.Arg284Trp	Somatic	264.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	67.0	NM_145263	B4E2R0|E5RLK1|Q8IY48|Q8N7D7	Missense_Mutation	SNP	ENST00000295213.4	37	CCDS3489.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.312873	0.40895	.	.	ENSG00000163071	ENST00000295213;ENST00000419395	T;T	0.23348	1.91;3.76	4.09	2.78	0.32641	.	0.178843	0.49916	D	0.000134	T	0.46814	0.1412	M	0.77103	2.36	0.50813	D	0.999899	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.46105	-0.9215	10	0.54805	T	0.06	-19.7729	8.6137	0.33817	0.807:0.1929:0.0:0.0	.	252;284;284	Q8TC71-2;Q8TC71;Q96M13	.;MIEAP_HUMAN;.	W	284;252	ENSP00000295213:R284W;ENSP00000415309:R252W	ENSP00000295213:R284W	R	+	1	2	SPATA18	52637793	0.676000	0.27567	0.090000	0.20809	0.004000	0.04260	0.793000	0.26944	1.783000	0.52377	0.379000	0.24179	AGG	.		0.667	SPATA18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250597.2	NM_145263	
SPICE1	152185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113187199	113187199	+	Silent	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:113187199T>C	ENST00000295872.4	-	10	1201	c.942A>G	c.(940-942)tcA>tcG	p.S314S		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	314					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						TGCTACCTGATGATATGTTTT	0.373																																					p.S314S		.											.	SPICE1	70	0			c.A942G						.						122.0	122.0	122.0					3																	113187199		2203	4300	6503	SO:0001819	synonymous_variant	152185	exon10			ACCTGATGATATG	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.942A>G	3.37:g.113187199T>C		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	24.0	NM_144718	D3DN72|Q8WUX6	Silent	SNP	ENST00000295872.4	37	CCDS2973.1																																																																																			.		0.373	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
SPOCD1	90853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32265012	32265012	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:32265012G>T	ENST00000360482.2	-	7	1987	c.1858C>A	c.(1858-1860)Cta>Ata	p.L620I	SPOCD1_ENST00000257100.3_Missense_Mutation_p.L113I|SPOCD1_ENST00000373648.2_Intron|SPOCD1_ENST00000533231.1_Missense_Mutation_p.L620I	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	620	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		CGAGTCCATAGTACCTCCTGC	0.622																																					p.L620I		.											.	SPOCD1	158	0			c.C1858A						.						72.0	49.0	57.0					1																	32265012		2202	4300	6502	SO:0001583	missense	90853	exon7			TCCATAGTACCTC	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.1858C>A	1.37:g.32265012G>T	ENSP00000353670:p.Leu620Ile	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	238.0	110.0	NM_144569	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	ENST00000360482.2	37	CCDS347.1	.	.	.	.	.	.	.	.	.	.	G	11.74	1.729591	0.30684	.	.	ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000533231;ENST00000449266;ENST00000529396	T;T;T	0.65364	-0.15;-0.15;-0.15	4.14	2.26	0.28386	Transcription elongation factor S-II, central domain (4);	.	.	.	.	T	0.64271	0.2583	M	0.83312	2.635	0.49299	D	0.999778	B;B	0.24043	0.078;0.096	B;B	0.34346	0.112;0.18	T	0.60959	-0.7159	9	0.48119	T	0.1	-0.8669	6.5776	0.22575	0.2205:0.0:0.7795:0.0	.	620;620	Q6ZMY3-2;Q6ZMY3	.;SPOC1_HUMAN	I	113;620;620;5;41	ENSP00000257100:L113I;ENSP00000353670:L620I;ENSP00000435851:L620I	ENSP00000257100:L113I	L	-	1	2	SPOCD1	32037599	0.779000	0.28652	0.633000	0.29310	0.321000	0.28281	0.752000	0.26362	0.524000	0.28502	0.544000	0.68410	CTA	.		0.622	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000381912.1	NM_144569	
SPRR4	163778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	152944448	152944448	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:152944448C>T	ENST00000328051.2	+	2	131	c.82C>T	c.(82-84)Cag>Tag	p.Q28*		NM_173080.1	NP_775103.1	Q96PI1	SPRR4_HUMAN	small proline-rich protein 4	28	Gln-rich.				keratinization (GO:0031424)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)				lung(1)|prostate(1)	2	Lung NSC(65;1.46e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCAGCCTTGTCAGCCACCCCC	0.572																																					p.Q28X		.											.	SPRR4	68	0			c.C82T						.						132.0	118.0	122.0					1																	152944448		2203	4300	6503	SO:0001587	stop_gained	163778	exon2			CCTTGTCAGCCAC	AF335109	CCDS1031.1	1q21.3	2008-02-05	2006-11-29		ENSG00000184148	ENSG00000184148			23173	protein-coding gene	gene with protein product						11719550, 11279051	Standard	NM_173080		Approved		uc001fav.1	Q96PI1	OTTHUMG00000012450	ENST00000328051.2:c.82C>T	1.37:g.152944448C>T	ENSP00000332163:p.Gln28*	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	238.0	69.0	NM_173080	Q2M1Y7|Q5T522	Nonsense_Mutation	SNP	ENST00000328051.2	37	CCDS1031.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155425	0.57259	.	.	ENSG00000184148	ENST00000328051	.	.	.	4.86	4.86	0.63082	.	0.000000	0.31134	U	0.008188	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.0046	13.3677	0.60694	0.0:1.0:0.0:0.0	.	.	.	.	X	28	.	ENSP00000332163:Q28X	Q	+	1	0	SPRR4	151211072	0.999000	0.42202	1.000000	0.80357	0.372000	0.29890	3.312000	0.51927	2.532000	0.85374	0.460000	0.39030	CAG	.		0.572	SPRR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034663.1	NM_173080	
SREK1IP1	285672	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	64023956	64023956	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:64023956T>A	ENST00000513458.4	-	4	423	c.256A>T	c.(256-258)Aaa>Taa	p.K86*		NM_173829.3	NP_776190.1	Q8N9Q2	SR1IP_HUMAN	SREK1-interacting protein 1	86	Lys-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)		nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6						tttttcaatttgattttttct	0.269																																					p.K86X		.											.	SREK1IP1	23	0			c.A256T						.						17.0	21.0	19.0					5																	64023956		2129	4184	6313	SO:0001587	stop_gained	285672	exon4			TCAATTTGATTTT	AK094073	CCDS34171.1	5q12.3	2010-09-20	2010-09-20	2010-09-20	ENSG00000153006	ENSG00000153006			26716	protein-coding gene	gene with protein product	"""p18 splicing regulatory protein"""		"""SFRS12-interacting protein 1"""	SFRS12IP1		15456940	Standard	NM_173829		Approved	FLJ36754, P18SRP	uc003jtk.3	Q8N9Q2	OTTHUMG00000162291	ENST00000513458.4:c.256A>T	5.37:g.64023956T>A	ENSP00000427401:p.Lys86*	Somatic	236.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	51.0	NM_173829	Q32NC8	Nonsense_Mutation	SNP	ENST00000513458.4	37	CCDS34171.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.433650	0.83776	.	.	ENSG00000153006	ENST00000513458	.	.	.	4.17	2.98	0.34508	.	0.404164	0.27236	N	0.020290	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.87	6.9743	0.24666	0.203:0.0:0.0:0.797	.	.	.	.	X	86	.	ENSP00000427401:K86X	K	-	1	0	SREK1IP1	64059712	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	3.061000	0.49963	0.731000	0.32448	0.533000	0.62120	AAA	.		0.269	SREK1IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368457.4	NM_173829	
ST3GAL3	6487	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	44395833	44395833	+	Silent	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:44395833A>G	ENST00000361392.4	+	12	1245	c.1068A>G	c.(1066-1068)aaA>aaG	p.K356K	ST3GAL3_ENST00000332628.6_Silent_p.K325K|ST3GAL3_ENST00000330208.2_Missense_Mutation_p.R143G|ST3GAL3_ENST00000528371.1_Missense_Mutation_p.K180R|ST3GAL3_ENST00000372372.2_Silent_p.K394K|ST3GAL3_ENST00000372362.2_Missense_Mutation_p.R143G|ST3GAL3_ENST00000372369.1_Silent_p.K326K|ST3GAL3_ENST00000361812.4_Missense_Mutation_p.R158G|ST3GAL3_ENST00000361746.4_Silent_p.K425K|ST3GAL3_ENST00000351035.3_Silent_p.K394K|ST3GAL3_ENST00000531451.1_Missense_Mutation_p.R127G|ST3GAL3_ENST00000361400.4_Silent_p.K340K|ST3GAL3_ENST00000372374.2_Silent_p.K325K|ST3GAL3_ENST00000372366.1_3'UTR|ST3GAL3_ENST00000262915.3_Silent_p.K425K|ST3GAL3_ENST00000531816.1_Missense_Mutation_p.K95R|ST3GAL3_ENST00000347631.2_Silent_p.K371K|ST3GAL3_ENST00000531993.1_Silent_p.K242K|ST3GAL3_ENST00000372375.2_Silent_p.K410K|ST3GAL3_ENST00000372367.1_Missense_Mutation_p.K195R|ST3GAL3_ENST00000545417.1_Missense_Mutation_p.R158G|ST3GAL3_ENST00000372365.1_3'UTR|ST3GAL3_ENST00000372377.4_3'UTR|ST3GAL3_ENST00000353126.3_Silent_p.K258K|ST3GAL3_ENST00000533933.1_Silent_p.K258K|ST3GAL3_ENST00000335430.6_3'UTR|ST3GAL3_ENST00000372368.2_Silent_p.K410K	NM_001270459.1|NM_006279.3|NM_174964.2	NP_001257388.1|NP_006270.1|NP_777624.1	Q11203	SIAT6_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 3	356					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|N-acetyllactosaminide alpha-2,3-sialyltransferase activity (GO:0008118)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(3)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0518)				AGCGAGAGAAAGAGTTTCTGC	0.552																																					p.K195R		.											.	ST3GAL3	93	0			c.A584G						.						197.0	181.0	187.0					1																	44395833		2203	4300	6503	SO:0001819	synonymous_variant	6487	exon8			AGAGAAAGAGTTT	L23768	CCDS492.1, CCDS493.1, CCDS494.1, CCDS495.1, CCDS496.1, CCDS497.1, CCDS498.1, CCDS499.1, CCDS500.1, CCDS53310.1, CCDS57988.1, CCDS57989.1, CCDS57990.1, CCDS57991.1, CCDS57992.1, CCDS57993.1, CCDS57994.1	1p34.1	2014-01-31	2005-02-07	2005-02-07	ENSG00000126091	ENSG00000126091	2.4.99.6	"""Sialyltransferases"""	10866	protein-coding gene	gene with protein product	"""ST3Gal III"""	606494	"""sialyltransferase 6 (N-acetyllacosaminide alpha 2,3-sialyltransferase)"", ""mental retardation, non-syndromic, autosomal recessive, 12"""	SIAT6, MRT12		8333853, 21907012	Standard	NM_174963		Approved		uc001cjz.4	Q11203	OTTHUMG00000007561	ENST00000361392.4:c.1068A>G	1.37:g.44395833A>G		Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	15.0	NM_001270463	A9Z1W2|D3DPX8|Q5T4W9|Q5T4X0|Q5T4X7|Q5T4X8|Q5T4X9|Q5T4Y0|Q5T4Y2|Q5T4Y3|Q5T4Y4|Q86UR6|Q86UR7|Q86UR8|Q86UR9|Q86US0|Q86US1|Q86US2|Q8IX41|Q8IX42|Q8IX43|Q8IX44|Q8IX45|Q8IX46|Q8IX47|Q8IX48|Q8IX49|Q8IX50|Q8IX51|Q8IX52|Q8IX53|Q8IX54|Q8IX55|Q8IX56|Q8IX57|Q8IX58	Missense_Mutation	SNP	ENST00000361392.4	37	CCDS492.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.84|17.84	3.488833|3.488833	0.64074|0.64074	.|.	.|.	ENSG00000126091|ENSG00000126091	ENST00000372367;ENST00000528371;ENST00000531816|ENST00000545417;ENST00000330208;ENST00000361812;ENST00000372362;ENST00000531451;ENST00000490502	T;T;T|T;T;T;T;T	0.77750|0.77877	-0.16;0.43;-1.12|-1.13;-1.13;-1.13;-1.13;-1.11	4.5|4.5	-2.06|-2.06	0.07298|0.07298	.|.	0.057637|.	0.64402|.	D|.	0.000002|.	T|T	0.67571|0.67571	0.2907|0.2907	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B;B;B|B;B;B	0.02656|0.02656	0.0;0.0;0.0|0.0;0.0;0.0	B;B;B|B;B;B	0.04013|0.01281	0.001;0.001;0.001|0.0;0.0;0.0	T|T	0.58999|0.58999	-0.7536|-0.7536	9|8	0.87932|0.87932	D|D	0|0	.|.	11.1695|11.1695	0.48563|0.48563	0.2712:0.0:0.7288:0.0|0.2712:0.0:0.7288:0.0	.|.	95;180;195|143;158;127	Q11203-22;Q11203-17;Q11203-24|Q11203-12;Q5T4Y1;Q11203-18	.;.;.|.;.;.	R|G	195;180;95|158;143;158;143;127;193	ENSP00000361442:K195R;ENSP00000434876:K180R;ENSP00000434378:K95R|ENSP00000439634:R158G;ENSP00000333494:R143G;ENSP00000355201:R158G;ENSP00000361437:R143G;ENSP00000435603:R127G	ENSP00000361442:K195R|ENSP00000333494:R143G	K|R	+|+	2|1	0|2	ST3GAL3|ST3GAL3	44168420|44168420	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.984000|0.984000	0.73092|0.73092	1.759000|1.759000	0.38420|0.38420	-0.208000|-0.208000	0.10171|0.10171	-0.462000|-0.462000	0.05337|0.05337	AAG|AGA	.		0.552	ST3GAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019964.1	NM_174963	
STAC	6769	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	36484900	36484900	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:36484900A>T	ENST00000273183.3	+	2	456	c.156A>T	c.(154-156)ttA>ttT	p.L52F	STAC_ENST00000457375.2_Missense_Mutation_p.L52F|STAC_ENST00000476388.1_3'UTR	NM_003149.1	NP_003140.1	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	52					cellular response to heat (GO:0034605)|intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytosol (GO:0005829)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(9)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(5)	32						CCAAGAGTTTACGGAGCAAAA	0.478																																					p.L52F		.											.	STAC	94	0			c.A156T						.						77.0	62.0	67.0					3																	36484900		2203	4300	6503	SO:0001583	missense	6769	exon2			GAGTTTACGGAGC	D86640	CCDS2662.1	3p22.3	2007-06-08			ENSG00000144681	ENSG00000144681			11353	protein-coding gene	gene with protein product		602317	"""src homology three (SH3) and cysteine rich domain"""			8954993, 10393425	Standard	XM_006713308		Approved	STAC1	uc003cgh.1	Q99469	OTTHUMG00000130798	ENST00000273183.3:c.156A>T	3.37:g.36484900A>T	ENSP00000273183:p.Leu52Phe	Somatic	173.0	1.0		WXS	Illumina HiSeq	Phase_I	170.0	37.0	NM_003149	B2R8S8	Missense_Mutation	SNP	ENST00000273183.3	37	CCDS2662.1	.	.	.	.	.	.	.	.	.	.	A	16.90	3.250628	0.59212	.	.	ENSG00000144681	ENST00000273183;ENST00000457375;ENST00000434649	T;T;T	0.79940	-1.32;0.28;0.15	5.02	-0.0116	0.13991	.	0.203906	0.35349	N	0.003272	T	0.79534	0.4462	L	0.50333	1.59	0.39273	D	0.964413	D;P	0.65815	0.995;0.949	P;P	0.56434	0.798;0.521	T	0.76380	-0.2980	10	0.54805	T	0.06	.	6.3169	0.21196	0.3909:0.1511:0.4579:0.0	.	52;52	E9PEA7;Q99469	.;STAC_HUMAN	F	52;52;41	ENSP00000273183:L52F;ENSP00000393713:L52F;ENSP00000398403:L41F	ENSP00000273183:L52F	L	+	3	2	STAC	36459904	0.935000	0.31712	0.993000	0.49108	0.983000	0.72400	0.404000	0.20999	0.057000	0.16193	0.528000	0.53228	TTA	.		0.478	STAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253338.2	NM_003149	
STK31	56164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	23766879	23766879	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:23766879C>T	ENST00000355870.3	+	5	388	c.269C>T	c.(268-270)tCt>tTt	p.S90F	STK31_ENST00000405627.3_3'UTR|STK31_ENST00000354639.3_Missense_Mutation_p.S67F|STK31_ENST00000428484.1_Missense_Mutation_p.S67F|STK31_ENST00000433467.2_Missense_Mutation_p.S90F	NM_031414.4	NP_113602.2	Q9BXU1	STK31_HUMAN	serine/threonine kinase 31	90	Tudor. {ECO:0000255|PROSITE- ProRule:PRU00211}.					acrosomal vesicle (GO:0001669)	ATP binding (GO:0005524)|hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(31)|ovary(2)|prostate(1)|skin(7)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GGATTATTTTCTGAAGATCAG	0.318																																					p.S90F		.											.	STK31	338	0			c.C269T						.						117.0	112.0	113.0					7																	23766879		2203	4299	6502	SO:0001583	missense	56164	exon5			TATTTTCTGAAGA	AF285599	CCDS5386.1, CCDS43556.1, CCDS59049.1	7p15.3	2014-04-23			ENSG00000196335	ENSG00000196335		"""Tudor domain containing"""	11407	protein-coding gene	gene with protein product		605790				11279525	Standard	NM_031414		Approved	TDRD8, SgK396	uc003sws.5	Q9BXU1	OTTHUMG00000023053	ENST00000355870.3:c.269C>T	7.37:g.23766879C>T	ENSP00000348132:p.Ser90Phe	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	36.0	NM_031414	B4DZ06|B7WPP5|C9J4F9|Q6PCD3|Q9BXH8	Missense_Mutation	SNP	ENST00000355870.3	37	CCDS5386.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266221	0.80358	.	.	ENSG00000196335	ENST00000355870;ENST00000422637;ENST00000456014;ENST00000433467;ENST00000354639;ENST00000444333;ENST00000428484	T;T;T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79;2.79;2.79	5.37	5.37	0.77165	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.067201	0.64402	D	0.000008	T	0.36468	0.0968	M	0.78049	2.395	0.53005	D	0.99996	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.09400	-1.0676	10	0.87932	D	0	-10.2652	18.2362	0.89950	0.0:1.0:0.0:0.0	.	90;90	B4DZ06;Q9BXU1	.;STK31_HUMAN	F	90;46;67;90;67;67;67	ENSP00000348132:S90F;ENSP00000414087:S46F;ENSP00000389340:S67F;ENSP00000411852:S90F;ENSP00000346660:S67F;ENSP00000398413:S67F;ENSP00000406146:S67F	ENSP00000346660:S67F	S	+	2	0	STK31	23733404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.619000	0.67729	2.677000	0.91161	0.650000	0.86243	TCT	.		0.318	STK31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214036.2	NM_031414	
STK17A	9263	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	43647961	43647961	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:43647961T>G	ENST00000319357.5	+	3	705	c.526T>G	c.(526-528)Ttt>Gtt	p.F176V	STK17A_ENST00000462448.1_3'UTR	NM_004760.2	NP_004751.2	Q9UEE5	ST17A_HUMAN	serine/threonine kinase 17a	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein phosphorylation (GO:0006468)|regulation of reactive oxygen species metabolic process (GO:2000377)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						AGGTGTTCACTTTTTACACAC	0.333																																					p.F176V		.											.	STK17A	335	0			c.T526G						.						123.0	121.0	122.0					7																	43647961		2203	4300	6503	SO:0001583	missense	9263	exon3			GTTCACTTTTTAC	AB011420	CCDS5470.1	7p13	2008-05-15	2007-02-12		ENSG00000164543	ENSG00000164543			11395	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 1"""	604726	"""serine/threonine kinase 17a (apoptosis-inducing)"""			9786912	Standard	NM_004760		Approved	DRAK1	uc003tih.3	Q9UEE5	OTTHUMG00000022825	ENST00000319357.5:c.526T>G	7.37:g.43647961T>G	ENSP00000319192:p.Phe176Val	Somatic	164.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	59.0	NM_004760	A4D1V6|Q8IVC8	Missense_Mutation	SNP	ENST00000319357.5	37	CCDS5470.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.485009	0.84854	.	.	ENSG00000164543	ENST00000319357	T	0.67698	-0.28	4.57	4.57	0.56435	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42964	U	0.000628	T	0.72724	0.3496	L	0.39397	1.21	0.58432	D	0.999999	D	0.58970	0.984	D	0.63113	0.911	T	0.74931	-0.3496	10	0.54805	T	0.06	.	14.2605	0.66083	0.0:0.0:0.0:1.0	.	176	Q9UEE5	ST17A_HUMAN	V	176	ENSP00000319192:F176V	ENSP00000319192:F176V	F	+	1	0	STK17A	43614486	1.000000	0.71417	0.898000	0.35279	0.995000	0.86356	6.900000	0.75687	1.822000	0.53115	0.528000	0.53228	TTT	.		0.333	STK17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250902.1	NM_004760	
STK39	27347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	169020389	169020389	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:169020389A>T	ENST00000355999.4	-	4	1137	c.432T>A	c.(430-432)ggT>ggA	p.G144G		NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	144	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						CCAACATTGAACCTAAGTAGA	0.318																																					p.G144G		.											.	STK39	546	0			c.T432A						.						106.0	96.0	99.0					2																	169020389		1844	4089	5933	SO:0001630	splice_region_variant	27347	exon4			CATTGAACCTAAG	AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.431-1T>A	2.37:g.169020389A>T		Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	16.0	NM_013233	O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Silent	SNP	ENST00000355999.4	37	CCDS42770.1																																																																																			.		0.318	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258112.2	NM_013233	Silent
SUFU	51684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	104389884	104389884	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:104389884A>T	ENST00000369902.3	+	12	1593	c.1427A>T	c.(1426-1428)gAc>gTc	p.D476V		NM_016169.3	NP_057253.2	Q9UMX1	SUFU_HUMAN	suppressor of fused homolog (Drosophila)	476					cytoplasmic sequestering of transcription factor (GO:0042994)|heart looping (GO:0001947)|multicellular organismal development (GO:0007275)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skin development (GO:0043588)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|primary cilium (GO:0072372)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(7)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(2)	24		Colorectal(252;0.207)		Epithelial(162;1.36e-08)|all cancers(201;3.81e-07)|BRCA - Breast invasive adenocarcinoma(275;0.242)		ATCCTGCCTGACGTGGTGTTC	0.577			"""D, F, S"""		medulloblastoma	medulloblastoma			Medulloblastoma, associated with Germline SUFU Mutation																												p.D476V		.	yes	Rec	yes	Medulloblastoma predisposition	10	10q24.32	51684	suppressor of fused homolog (Drosophila)		O	.	SUFU	2246	0			c.A1427T						.						196.0	167.0	177.0					10																	104389884		2203	4300	6503	SO:0001583	missense	51684	exon12	Familial Cancer Database		TGCCTGACGTGGT	AF175770	CCDS7537.1, CCDS53571.1	10q24.32	2014-09-17			ENSG00000107882	ENSG00000107882			16466	protein-coding gene	gene with protein product		607035				15367681	Standard	NM_016169		Approved	SUFUH, SUFUXL, PRO1280	uc001kvy.2	Q9UMX1	OTTHUMG00000018966	ENST00000369902.3:c.1427A>T	10.37:g.104389884A>T	ENSP00000358918:p.Asp476Val	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	51.0	23.0	NM_016169	Q7LCP7|Q9NT90|Q9NZ07|Q9UHK2|Q9UHM8|Q9UMY0	Missense_Mutation	SNP	ENST00000369902.3	37	CCDS7537.1	.	.	.	.	.	.	.	.	.	.	A	17.54	3.415788	0.62511	.	.	ENSG00000107882	ENST00000369902	T	0.72051	-0.62	5.59	5.59	0.84812	.	0.128884	0.64402	D	0.000001	T	0.74921	0.3780	L	0.43923	1.385	0.80722	D	1	D	0.56746	0.977	P	0.55871	0.786	T	0.77928	-0.2404	10	0.87932	D	0	-16.554	14.3445	0.66651	1.0:0.0:0.0:0.0	.	476	Q9UMX1	SUFU_HUMAN	V	476	ENSP00000358918:D476V	ENSP00000358918:D476V	D	+	2	0	SUFU	104379874	1.000000	0.71417	0.027000	0.17364	0.626000	0.37791	8.001000	0.88508	2.136000	0.66102	0.459000	0.35465	GAC	.		0.577	SUFU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050089.1	NM_016169	
SULT1B1	27284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	70620914	70620914	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:70620914G>A	ENST00000310613.3	-	2	319	c.22C>T	c.(22-24)Ctg>Ttg	p.L8L		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	8					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						TCTTTTCGCAGAATATCTTTT	0.353																																					p.L8L		.											.	SULT1B1	90	0			c.C22T						.						91.0	92.0	92.0					4																	70620914		2203	4300	6503	SO:0001819	synonymous_variant	27284	exon2			TTCGCAGAATATC	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.22C>T	4.37:g.70620914G>A		Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	38.0	NM_014465	O15497|Q96FI1|Q9UK34	Silent	SNP	ENST00000310613.3	37	CCDS3530.1																																																																																			.		0.353	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251563.2	NM_014465	
SUPT6H	6830	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27017150	27017150	+	Silent	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:27017150C>T	ENST00000314616.6	+	26	3676	c.3393C>T	c.(3391-3393)agC>agT	p.S1131S	SUPT6H_ENST00000347486.4_Silent_p.S1131S	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1131	Interaction with KDM6A. {ECO:0000250}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CAGAGCTGAGCTGTCGATATA	0.512																																					p.S1131S		.											.	SUPT6H	93	0			c.C3393T						.						125.0	121.0	122.0					17																	27017150		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon26			GCTGAGCTGTCGA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.3393C>T	17.37:g.27017150C>T		Somatic	209.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	98.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	CCDS32596.1																																																																																			.		0.512	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	152652650	152652650	+	Silent	SNP	G	G	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:152652650G>A	ENST00000367255.5	-	78	13771	c.13170C>T	c.(13168-13170)atC>atT	p.I4390I	SYNE1_ENST00000341594.5_Silent_p.I4255I|SYNE1_ENST00000423061.1_Silent_p.I4319I|SYNE1_ENST00000265368.4_Silent_p.I4390I|SYNE1_ENST00000448038.1_Silent_p.I4319I	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4390					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTTCACTGCAGATGGCCAGGT	0.542										HNSCC(10;0.0054)																											p.I4390I		.											.	SYNE1	607	0			c.C13170T						.						80.0	77.0	78.0					6																	152652650		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon78			ACTGCAGATGGCC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.13170C>T	6.37:g.152652650G>A		Somatic	133.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	71.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	37	CCDS5236.2																																																																																			.		0.542	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TAOK1	57551	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	27829620	27829620	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:27829620A>G	ENST00000261716.3	+	13	1736	c.1217A>G	c.(1216-1218)tAc>tGc	p.Y406C	TAOK1_ENST00000536202.1_Missense_Mutation_p.Y406C	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	406					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			GAAGAAAATTACAGAGAAGAG	0.348																																					p.Y406C		.											.	TAOK1	521	0			c.A1217G						.						101.0	89.0	93.0					17																	27829620		2203	4300	6503	SO:0001583	missense	57551	exon13			AAAATTACAGAGA	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1217A>G	17.37:g.27829620A>G	ENSP00000261716:p.Tyr406Cys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	13.0	NM_025142	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	37	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	A	14.58	2.578212	0.45902	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.41758	0.99;0.99	6.03	6.03	0.97812	Protein kinase-like domain (1);	0.260256	0.39834	N	0.001260	T	0.46444	0.1393	M	0.72118	2.19	0.54753	D	0.999988	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.10450	0.0;0.005;0.002	T	0.34700	-0.9818	10	0.41790	T	0.15	.	16.5655	0.84588	1.0:0.0:0.0:0.0	.	406;232;406	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	C	406	ENSP00000261716:Y406C;ENSP00000438819:Y406C	ENSP00000261716:Y406C	Y	+	2	0	TAOK1	24853746	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.014000	0.64029	2.302000	0.77476	0.533000	0.62120	TAC	.		0.348	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447790.1	NM_020791	
TEX14	56155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56663388	56663388	+	Silent	SNP	A	A	T	rs576022136	byFrequency	TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:56663388A>T	ENST00000240361.8	-	18	2947	c.2862T>A	c.(2860-2862)ccT>ccA	p.P954P	TEX14_ENST00000349033.5_Silent_p.P948P|TEX14_ENST00000389934.3_Silent_p.P948P			Q8IWB6	TEX14_HUMAN	testis expressed 14	954					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAGGATGCCAAGGAGGTACTG	0.498													A|||	2	0.000399361	0.0015	0.0	5008	,	,		19006	0.0		0.0	False		,,,				2504	0.0				p.P954P		.											.	TEX14	810	0			c.T2862A						.						143.0	145.0	144.0					17																	56663388		2203	4300	6503	SO:0001819	synonymous_variant	56155	exon18			ATGCCAAGGAGGT	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.2862T>A	17.37:g.56663388A>T		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	32.0	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Silent	SNP	ENST00000240361.8	37	CCDS56042.1																																																																																			.		0.498	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
TG	7038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133935748	133935748	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:133935748G>C	ENST00000220616.4	+	22	4734	c.4694G>C	c.(4693-4695)tGt>tCt	p.C1565S	TG_ENST00000542445.1_5'UTR|TG_ENST00000377869.1_Intron	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1565	Thyroglobulin type-1 11. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GACTCACAGTGTTTGAGTAGG	0.577																																					p.C1565S		.											.	TG	145	0			c.G4694C						.						53.0	51.0	52.0					8																	133935748		2203	4300	6503	SO:0001583	missense	7038	exon22			CACAGTGTTTGAG	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.4694G>C	8.37:g.133935748G>C	ENSP00000220616:p.Cys1565Ser	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	24.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.072203	0.55646	.	.	ENSG00000042832	ENST00000543313;ENST00000220616	T	0.78481	-1.18	4.84	4.84	0.62591	Thyroglobulin type-1 (3);	0.100524	0.45606	D	0.000343	D	0.87309	0.6145	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.88849	0.3318	10	0.87932	D	0	.	13.429	0.61044	0.0:0.0:1.0:0.0	.	1565	P01266	THYG_HUMAN	S	371;1565	ENSP00000220616:C1565S	ENSP00000220616:C1565S	C	+	2	0	TG	134004930	1.000000	0.71417	1.000000	0.80357	0.543000	0.35085	5.563000	0.67352	2.247000	0.74100	0.555000	0.69702	TGT	.		0.577	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TGFBRAP1	9392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	105914979	105914979	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:105914979T>G	ENST00000393359.2	-	3	1298	c.872A>C	c.(871-873)cAg>cCg	p.Q291P	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.Q291P			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	291	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						TTCAAAGTCCTGTAGGATATG	0.423																																					p.Q291P	Esophageal Squamous(183;794 2019 9730 21801 48859)	.											.	TGFBRAP1	91	0			c.A872C						.						113.0	109.0	110.0					2																	105914979		2203	4300	6503	SO:0001583	missense	9392	exon3			AAGTCCTGTAGGA	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.872A>C	2.37:g.105914979T>G	ENSP00000377027:p.Gln291Pro	Somatic	83.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	23.0	NM_004257	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	37	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711566	0.68730	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.44881	0.91;0.91	5.65	5.65	0.86999	Citron-like (1);	0.000000	0.85682	D	0.000000	T	0.53981	0.1830	M	0.63428	1.95	0.80722	D	1	D	0.61080	0.989	P	0.54544	0.755	T	0.50448	-0.8827	10	0.27785	T	0.31	-30.2906	15.8909	0.79296	0.0:0.0:0.0:1.0	.	291	Q8WUH2	TGFA1_HUMAN	P	291	ENSP00000377027:Q291P;ENSP00000258449:Q291P	ENSP00000258449:Q291P	Q	-	2	0	TGFBRAP1	105281411	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.825000	0.86693	2.146000	0.66826	0.533000	0.62120	CAG	.		0.423	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
THAP9	79725	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	83838969	83838969	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:83838969T>A	ENST00000302236.5	+	5	1655	c.1604T>A	c.(1603-1605)cTg>cAg	p.L535Q	LIN54_ENST00000505905.1_Intron	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9	535					DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				AAAGGGCCTCTGTTGCCTGAA	0.318																																					p.L535Q		.											.	THAP9	156	0			c.T1604A						.						89.0	93.0	91.0					4																	83838969		2203	4299	6502	SO:0001583	missense	79725	exon5			GGCCTCTGTTGCC	AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291	ENST00000302236.5:c.1604T>A	4.37:g.83838969T>A	ENSP00000305533:p.Leu535Gln	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	16.0	NM_024672	B3KRE2|Q59AC9	Missense_Mutation	SNP	ENST00000302236.5	37	CCDS3598.1	.	.	.	.	.	.	.	.	.	.	T	9.728	1.161373	0.21538	.	.	ENSG00000168152	ENST00000302236;ENST00000536314	D	0.91894	-2.93	3.87	3.87	0.44632	.	0.000000	0.38326	N	0.001732	D	0.94128	0.8117	L	0.58810	1.83	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.93365	0.6730	10	0.45353	T	0.12	-9.6715	11.3618	0.49648	0.0:0.0:0.0:1.0	.	535	Q9H5L6	THAP9_HUMAN	Q	535	ENSP00000305533:L535Q	ENSP00000305533:L535Q	L	+	2	0	THAP9	84057993	0.208000	0.23494	0.116000	0.21606	0.017000	0.09413	4.766000	0.62279	1.983000	0.57843	0.533000	0.62120	CTG	.		0.318	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252633.1	NM_024672	
TMC1	117531	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	75431065	75431065	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr9:75431065T>G	ENST00000297784.5	+	19	2242	c.1702T>G	c.(1702-1704)Tac>Gac	p.Y568D	TMC1_ENST00000486417.1_3'UTR|TMC1_ENST00000340019.3_Missense_Mutation_p.Y568D|TMC1_ENST00000396237.3_Missense_Mutation_p.Y568D	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	568					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						CTAGCCTTCATACACCGAATT	0.453																																					p.Y568D	Pancreas(75;173 1345 14232 34245 43413)	.											.	TMC1	91	0			c.T1702G						.						205.0	155.0	172.0					9																	75431065		2203	4300	6503	SO:0001583	missense	117531	exon19			CCTTCATACACCG	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.1702T>G	9.37:g.75431065T>G	ENSP00000297784:p.Tyr568Asp	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	13.0	NM_138691	A8MVZ2|B1AM91	Missense_Mutation	SNP	ENST00000297784.5	37	CCDS6643.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461157	0.63513	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.63096	-0.02;-0.02;-0.02	6.16	5.03	0.67393	.	0.066732	0.64402	D	0.000007	T	0.78880	0.4353	M	0.82193	2.58	0.53688	D	0.999971	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.79108	0.986;0.986;0.992	T	0.79196	-0.1903	10	0.41790	T	0.15	-19.4271	12.2288	0.54476	0.0:0.0659:0.0:0.9341	.	535;535;568	A5D8Y1;A4FUA6;Q8TDI8	.;.;TMC1_HUMAN	D	568;568;535;535;535;562;568	ENSP00000297784:Y568D;ENSP00000341433:Y568D;ENSP00000379538:Y568D	ENSP00000297784:Y568D	Y	+	1	0	TMC1	74620885	1.000000	0.71417	0.980000	0.43619	0.364000	0.29643	8.040000	0.89188	1.148000	0.42385	0.528000	0.53228	TAC	.		0.453	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
TMEM131	23505	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	98429012	98429012	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:98429012T>C	ENST00000186436.5	-	17	1963	c.1735A>G	c.(1735-1737)Ata>Gta	p.I579V		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	579						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						CAACTTTTTATAGCCAACTTT	0.313																																					p.I579V		.											.	TMEM131	74	0			c.A1735G						.						86.0	78.0	80.0					2																	98429012		1806	4071	5877	SO:0001583	missense	23505	exon17			TTTTTATAGCCAA	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.1735A>G	2.37:g.98429012T>C	ENSP00000186436:p.Ile579Val	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	246.0	52.0	NM_015348		Missense_Mutation	SNP	ENST00000186436.5	37	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	T	11.83	1.755953	0.31137	.	.	ENSG00000075568	ENST00000186436	T	0.42513	0.97	5.14	2.75	0.32379	.	0.040649	0.85682	N	0.000000	T	0.31638	0.0803	L	0.45228	1.405	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.07177	-1.0786	10	0.29301	T	0.29	-16.3249	8.6277	0.33899	0.0:0.151:0.0:0.849	.	579	Q92545	TM131_HUMAN	V	579	ENSP00000186436:I579V	ENSP00000186436:I579V	I	-	1	0	TMEM131	97795444	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	2.218000	0.42889	0.507000	0.28148	-0.250000	0.11733	ATA	.		0.313	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329285.2	XM_371542	
TMEM168	64418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	112412840	112412840	+	Silent	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:112412840T>A	ENST00000312814.6	-	4	2102	c.1542A>T	c.(1540-1542)ctA>ctT	p.L514L	TMEM168_ENST00000480969.1_5'Flank|TMEM168_ENST00000454074.1_Silent_p.L514L	NM_022484.4	NP_071929.3	Q9H0V1	TM168_HUMAN	transmembrane protein 168	514						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|stomach(1)	32						GTTTACCTGCTAGAGCCCACT	0.413																																					p.L514L		.											.	TMEM168	91	0			c.A1542T						.						93.0	80.0	84.0					7																	112412840		2203	4300	6503	SO:0001819	synonymous_variant	64418	exon4			ACCTGCTAGAGCC		CCDS5757.1	7q31.32	2006-08-08			ENSG00000146802	ENSG00000146802			25826	protein-coding gene	gene with protein product						12477932	Standard	XM_005250527		Approved	DKFZp564C012,FLJ13576	uc003vgn.3	Q9H0V1	OTTHUMG00000155188	ENST00000312814.6:c.1542A>T	7.37:g.112412840T>A		Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	37.0	NM_022484	A4D0T9|B4DDS0|Q8NEK4|Q9H8J2	Silent	SNP	ENST00000312814.6	37	CCDS5757.1																																																																																			.		0.413	TMEM168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338696.4	NM_022484	
TMEM183A	92703	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202987649	202987649	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:202987649A>C	ENST00000367242.3	+	6	829	c.749A>C	c.(748-750)cAg>cCg	p.Q250P		NM_001079809.1|NM_138391.4	NP_001073277.1|NP_612400.3	Q8IXX5	T183A_HUMAN	transmembrane protein 183A	250						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|skin(3)	7			BRCA - Breast invasive adenocarcinoma(75;0.18)			GGGAACAGACAGGAACCAATG	0.313																																					p.Q250P		.											.	.	.	0			c.A749C						.						127.0	128.0	128.0					1																	202987649		2203	4300	6503	SO:0001583	missense	653659	exon6			ACAGACAGGAACC	BC013073	CCDS1432.1	1q31.1	2008-09-09	2006-12-18	2006-12-18	ENSG00000163444	ENSG00000163444			20173	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 37"""	C1orf37			Standard	NM_138391		Approved		uc001gyu.1	Q8IXX5	OTTHUMG00000042051	ENST00000367242.3:c.749A>C	1.37:g.202987649A>C	ENSP00000356211:p.Gln250Pro	Somatic	250.0	0.0		WXS	Illumina HiSeq	Phase_I	302.0	124.0	NM_001079809	A8K5W1|Q6NW15|Q96E06	Missense_Mutation	SNP	ENST00000367242.3	37	CCDS1432.1	.	.	.	.	.	.	.	.	.	.	A	9.169	1.020576	0.19433	.	.	ENSG00000163444	ENST00000367242	T	0.24350	1.86	5.71	5.71	0.89125	.	0.221153	0.47455	D	0.000234	T	0.17365	0.0417	N	0.22421	0.69	0.43076	D	0.994727	B;B	0.12013	0.003;0.005	B;B	0.08055	0.002;0.003	T	0.07102	-1.0790	10	0.30854	T	0.27	-15.8121	11.1552	0.48484	0.846:0.154:0.0:0.0	.	250;250	Q1AE95;Q8IXX5	T183B_HUMAN;T183A_HUMAN	P	250	ENSP00000356211:Q250P	ENSP00000356211:Q250P	Q	+	2	0	TMEM183A	201254272	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.539000	0.45718	2.307000	0.77673	0.528000	0.53228	CAG	.		0.313	TMEM183A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000100129.1	NM_138391	
TMEM206	55248	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	212558622	212558622	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:212558622C>A	ENST00000261455.4	-	4	626	c.489G>T	c.(487-489)caG>caT	p.Q163H	TMEM206_ENST00000471937.1_5'UTR|TMEM206_ENST00000535273.1_Missense_Mutation_p.Q224H	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	163						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TTACCACAGTCTGATTGGAGA	0.552																																					p.Q224H		.											.	TMEM206	153	0			c.G672T						.						121.0	115.0	117.0					1																	212558622		2203	4300	6503	SO:0001583	missense	55248	exon5			CACAGTCTGATTG	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.489G>T	1.37:g.212558622C>A	ENSP00000261455:p.Gln163His	Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	313.0	50.0	NM_001198862	B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	ENST00000261455.4	37	CCDS1504.1	.	.	.	.	.	.	.	.	.	.	C	11.39	1.624233	0.28889	.	.	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	5.43	2.08	0.27032	.	0.345356	0.34223	N	0.004159	T	0.32041	0.0816	L	0.27053	0.805	0.35461	D	0.796485	B;B	0.14438	0.01;0.0	B;B	0.16289	0.015;0.001	T	0.17684	-1.0361	9	0.40728	T	0.16	-16.7474	2.8675	0.05605	0.0:0.3206:0.2611:0.4183	.	224;163	B7Z4D6;Q9H813	.;TM206_HUMAN	H	163;224	.	ENSP00000261455:Q163H	Q	-	3	2	TMEM206	210625245	0.995000	0.38212	0.987000	0.45799	0.538000	0.34931	0.179000	0.16840	0.628000	0.30357	0.655000	0.94253	CAG	.		0.552	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
TNFSF11	8600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	43174893	43174893	+	Silent	SNP	A	A	G	rs375216189		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr13:43174893A>G	ENST00000239849.6	+	3	544	c.393A>G	c.(391-393)ttA>ttG	p.L131L	TNFSF11_ENST00000405262.2_Silent_p.L58L|TNFSF11_ENST00000358545.2_Silent_p.L58L|TNFSF11_ENST00000398795.2_Silent_p.L58L|TNFSF11_ENST00000544862.1_Silent_p.L58L			O14788	TNF11_HUMAN	tumor necrosis factor (ligand) superfamily, member 11	131					activation of JUN kinase activity (GO:0007257)|bone resorption (GO:0045453)|calcium ion homeostasis (GO:0055074)|cytokine-mediated signaling pathway (GO:0019221)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|monocyte chemotaxis (GO:0002548)|organ morphogenesis (GO:0009887)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of bone resorption (GO:0045780)|positive regulation of corticotropin-releasing hormone secretion (GO:0051466)|positive regulation of ERK1 and ERK2 cascade via TNFSF11-mediated signaling (GO:0071848)|positive regulation of fever generation by positive regulation of prostaglandin secretion (GO:0071812)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoclast development (GO:2001206)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|TNFSF11-mediated signaling pathway (GO:0071847)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	cytokine activity (GO:0005125)|tumor necrosis factor receptor binding (GO:0005164)|tumor necrosis factor receptor superfamily binding (GO:0032813)			kidney(1)|large_intestine(4)|lung(3)|prostate(1)|urinary_tract(1)	10		Lung NSC(96;1.11e-05)|Breast(139;0.00868)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000249)|GBM - Glioblastoma multiforme(144;0.00119)|BRCA - Breast invasive adenocarcinoma(63;0.073)	Denosumab(DB06643)|Lenalidomide(DB00480)	TTCAGGAATTACAACATATCG	0.333																																					p.L131L		.											.	TNFSF11	522	0			c.A393G						.	A	,	1,4405	2.1+/-5.4	0,1,2202	69.0	66.0	67.0		393,174	0.2	1.0	13		67	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	TNFSF11	NM_003701.3,NM_033012.3	,	0,2,6501	GG,GA,AA		0.0116,0.0227,0.0154	,	131/318,58/245	43174893	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	8600	exon3			GGAATTACAACAT	AF013171	CCDS9384.1, CCDS9385.1	13q14	2008-02-05			ENSG00000120659	ENSG00000120659		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11926	protein-coding gene	gene with protein product		602642				9312132, 9367155	Standard	NM_003701		Approved	TRANCE, RANKL, OPGL, ODF, CD254	uc001uyu.2	O14788	OTTHUMG00000016807	ENST00000239849.6:c.393A>G	13.37:g.43174893A>G		Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	38.0	13.0	NM_003701	O14723|Q96Q17|Q9P2Q3	Silent	SNP	ENST00000239849.6	37	CCDS9384.1																																																																																			.		0.333	TNFSF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044702.2		
TNNC2	7125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	44453043	44453043	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:44453043T>G	ENST00000372555.3	-	4	294	c.202A>C	c.(202-204)Agc>Cgc	p.S68R	TNNC2_ENST00000372557.1_Missense_Mutation_p.S53R	NM_003279.2	NP_003270.1	P02585	TNNC2_HUMAN	troponin C type 2 (fast)	68	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				muscle filament sliding (GO:0030049)|regulation of muscle contraction (GO:0006937)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|troponin complex (GO:0005861)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.0122)			Felodipine(DB01023)	ATGGTGCCGCTGCCTGCGGGC	0.657																																					p.S68R		.											.	TNNC2	91	0			c.A202C						.						66.0	59.0	62.0					20																	44453043		2203	4300	6503	SO:0001583	missense	7125	exon4			TGCCGCTGCCTGC		CCDS13375.1	20q12-q13.11	2013-01-10	2005-09-12		ENSG00000101470	ENSG00000101470		"""EF-hand domain containing"""	11944	protein-coding gene	gene with protein product		191039	"""troponin C2, fast"""			2373703	Standard	NM_003279		Approved		uc002xpr.3	P02585	OTTHUMG00000032623	ENST00000372555.3:c.202A>C	20.37:g.44453043T>G	ENSP00000361636:p.Ser68Arg	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	20.0	NM_003279	Q6FH92	Missense_Mutation	SNP	ENST00000372555.3	37	CCDS13375.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.163407	0.78226	.	.	ENSG00000101470	ENST00000372557;ENST00000372555	T;T	0.79749	-1.3;-1.3	4.49	4.49	0.54785	EF-hand-like domain (1);	0.083853	0.85682	D	0.000000	D	0.86192	0.5874	L	0.54863	1.705	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.87529	0.2451	10	0.87932	D	0	-30.5273	12.7774	0.57457	0.0:0.0:0.0:1.0	.	68	P02585	TNNC2_HUMAN	R	53;68	ENSP00000361638:S53R;ENSP00000361636:S68R	ENSP00000361636:S68R	S	-	1	0	TNNC2	43886450	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	7.863000	0.87023	1.892000	0.54788	0.455000	0.32223	AGC	.		0.657	TNNC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079524.3	NM_003279	
TP53	7157	broad.mit.edu;bcgsc.ca	37	17	7576866	7576866	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:7576866delT	ENST00000269305.4	-	9	1169	c.980delA	c.(979-981)tatfs	p.Y327fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.Y327fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.Y327fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.Y327fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.Y327fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	327	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		Y -> H (in a sporadic cancer; somatic mutation).|Y -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.Y327fs*1(1)|p.?(1)|p.Y327fs*9(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAGGGTGAAATATTCTCCATC	0.443		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y327fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,NS,carcinoma,+1	TP53	70225	11	Whole gene deletion(8)|Unknown(1)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|breast(1)|ovary(1)	c.980delA						.						123.0	115.0	118.0					17																	7576866		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon9	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GTGAAATATTCTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.980delA	17.37:g.7576866delT	ENSP00000269305:p.Tyr327fs	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	15.0	8.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.443	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TP53	7157	broad.mit.edu;bcgsc.ca	37	17	7576868	7576897	+	In_Frame_Del	DEL	TTCTCCATCCAGTGGTTTCTTCTTTGGCTG	TTCTCCATCCAGTGGTTTCTTCTTTGGCTG	-	rs121912659		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	TTCTCCATCCAGTGGTTTCTTCTTTGGCTG	TTCTCCATCCAGTGGTTTCTTCTTTGGCTG	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:7576868_7576897delTTCTCCATCCAGTGGTTTCTTCTTTGGCTG	ENST00000269305.4	-	9	1138_1167	c.949_978delCAGCCAAAGAAGAAACCACTGGATGGAGAA	c.(949-978)cagccaaagaagaaaccactggatggagaadel	p.QPKKKPLDGE317del	TP53_ENST00000420246.2_In_Frame_Del_p.QPKKKPLDGE317del|TP53_ENST00000445888.2_In_Frame_Del_p.QPKKKPLDGE317del|TP53_ENST00000455263.2_In_Frame_Del_p.QPKKKPLDGE317del|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_In_Frame_Del_p.QPKKKPLDGE317del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	317	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		Q -> H (in a kidney cancer with no family history; germline mutation and in a sporadic cancer; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in a sporadic cancer; somatic mutation).|Q -> P (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q317*(29)|p.0?(8)|p.K319*(8)|p.E326*(4)|p.K321fs*24(4)|p.Q317K(3)|p.P322fs*23(3)|p.K320*(3)|p.K320N(3)|p.K321_P322insK(2)|p.K319N(2)|p.Q317R(2)|p.P318fs*15(2)|p.D324E(2)|p.K319E(2)|p.K320fs*26(2)|p.K319fs*19(2)|p.P322L(2)|p.P318A(2)|p.P322R(2)|p.K321*(2)|p.G325*(1)|p.S315fs*22(1)|p.S314fs*25(1)|p.Q317P(1)|p.L323fs*22(1)|p.K321K(1)|p.P318fs*21(1)|p.K320fs*25(1)|p.Y327fs*10(1)|p.D324fs*29(1)|p.L323V(1)|p.K319R(1)|p.L323R(1)|p.?(1)|p.L323P(1)|p.D324fs*21(1)|p.G325fs*23(1)|p.L308fs*15(1)|p.L323G(1)|p.Q317fs*28(1)|p.Q317fs*45(1)|p.L323M(1)|p.K320K(1)|p.G325A(1)|p.D324D(1)|p.G325E(1)|p.E326K(1)|p.D324S(1)|p.G325V(1)|p.K320fs*18(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGTGAAATATTCTCCATCCAGTGGTTTCTTCTTTGGCTGGGGAGAGGAG	0.465		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.317_326del	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,colon,carcinoma,-2	TP53	70225	119	Substitution - Nonsense(47)|Substitution - Missense(32)|Deletion - Frameshift(16)|Insertion - Frameshift(9)|Whole gene deletion(8)|Substitution - coding silent(3)|Insertion - In frame(2)|Unknown(1)|Complex - frameshift(1)	upper_aerodigestive_tract(15)|large_intestine(14)|urinary_tract(13)|breast(12)|ovary(12)|skin(9)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(5)|liver(5)|bone(5)|oesophagus(4)|lung(4)|soft_tissue(3)|pancreas(3)|stomach(2)|endometrium(2)|NS(2)|thyroid(1)|peritoneum(1)	c.949_978del	GRCh37	CM920680	TP53	M	rs121912659	.																																			SO:0001651	inframe_deletion	7157	exon9	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GAAATATTCTCCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.949_978delCAGCCAAAGAAGAAACCACTGGATGGAGAA	17.37:g.7576868_7576897delTTCTCCATCCAGTGGTTTCTTCTTTGGCTG	ENSP00000269305:p.Gln317_Glu326del	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	11.0	8.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.465	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TRAPPC6A	79090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45668133	45668133	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:45668133T>C	ENST00000585934.1	-	3	266	c.248A>G	c.(247-249)gAc>gGc	p.D83G	TRAPPC6A_ENST00000006275.4_Missense_Mutation_p.D97G|TRAPPC6A_ENST00000588062.1_Silent_p.G60G|TRAPPC6A_ENST00000592647.1_Silent_p.G74G	NM_001270891.1	NP_001257820.1	O75865	TPC6A_HUMAN	trafficking protein particle complex 6A	83					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	8		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00872)|GBM - Glioblastoma multiforme(486;0.233)		GCGCAGGCTGTCCATCTGCTT	0.647																																					p.D97G		.											.	TRAPPC6A	90	0			c.A290G						.						78.0	77.0	77.0					19																	45668133		2203	4300	6503	SO:0001583	missense	79090	exon3			AGGCTGTCCATCT	AF161407	CCDS12655.1, CCDS59395.1, CCDS59396.1, CCDS59397.1	19q13.32	2012-10-02				ENSG00000007255		"""Trafficking protein particle complex"""	23069	protein-coding gene	gene with protein product		610396					Standard	NM_024108		Approved	TRS33, MGC2650, HSPC289	uc002pav.4	O75865		ENST00000585934.1:c.248A>G	19.37:g.45668133T>C	ENSP00000468612:p.Asp83Gly	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	19.0	NM_024108	K7ERB1|K7ERQ4|Q9BQ45|Q9P092	Missense_Mutation	SNP	ENST00000585934.1	37	CCDS59397.1	.	.	.	.	.	.	.	.	.	.	t	17.01	3.278119	0.59758	.	.	ENSG00000007255	ENST00000006275	T	0.57436	0.4	4.78	4.78	0.61160	NO signalling/Golgi transport  ligand-binding domain (1);	0.113453	0.56097	D	0.000028	T	0.76097	0.3940	M	0.92169	3.28	0.80722	D	1	D;D	0.76494	0.999;0.994	D;P	0.71870	0.975;0.903	T	0.81385	-0.0957	10	0.87932	D	0	-25.0331	10.6947	0.45892	0.0:0.0:0.0:1.0	.	83;97	O75865;O75865-2	TPC6A_HUMAN;.	G	97	ENSP00000006275:D97G	ENSP00000006275:D97G	D	-	2	0	TRAPPC6A	50359973	1.000000	0.71417	0.886000	0.34754	0.495000	0.33615	2.253000	0.43205	1.784000	0.52394	0.460000	0.39030	GAC	.		0.647	TRAPPC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457556.1	NM_024108	
TRIM27	5987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	28876789	28876789	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:28876789T>A	ENST00000377199.3	-	5	1203	c.847A>T	c.(847-849)Aaa>Taa	p.K283*	TRIM27_ENST00000498117.1_5'Flank|TRIM27_ENST00000377194.3_Nonsense_Mutation_p.K283*	NM_006510.4	NP_006501.1	P14373	TRI27_HUMAN	tripartite motif containing 27	283					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell proliferation (GO:0008283)|innate immune response (GO:0045087)|interferon-gamma secretion (GO:0072643)|negative regulation of adaptive immune response (GO:0002820)|negative regulation of calcium ion import (GO:0090281)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of interleukin-2 secretion (GO:1900041)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						AATAGACATTTTTGGGCAAAA	0.393			T	RET	papillary thyroid																																p.K283X		.		Dom	yes		6	6p22	5987	tripartite motif-containing 27		E	.	TRIM27	684	0			c.A847T						.						81.0	83.0	82.0					6																	28876789		2203	4300	6503	SO:0001587	stop_gained	5987	exon5			GACATTTTTGGGC	Z58939	CCDS4654.1	6p22	2013-01-09	2011-01-25	2006-09-26	ENSG00000204713	ENSG00000204713		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9975	protein-coding gene	gene with protein product		602165	"""ret finger protein"", ""tripartite motif-containing 27"""	RFP		8114113	Standard	NM_006510		Approved	RNF76	uc003nlr.3	P14373	OTTHUMG00000031215	ENST00000377199.3:c.847A>T	6.37:g.28876789T>A	ENSP00000366404:p.Lys283*	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	201.0	45.0	NM_006510	A2BE15|Q5RJA8|Q5ST26|Q6LA73|Q6NXR9|Q9BZY6|Q9UJL3	Nonsense_Mutation	SNP	ENST00000377199.3	37	CCDS4654.1	.	.	.	.	.	.	.	.	.	.	T	42	9.282718	0.99123	.	.	ENSG00000204713	ENST00000377199;ENST00000377194	.	.	.	4.47	4.47	0.54385	.	0.000000	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4452	0.44490	0.0:0.0:0.0:1.0	.	.	.	.	X	283	.	ENSP00000366399:K283X	K	-	1	0	TRIM27	28984768	0.993000	0.37304	1.000000	0.80357	0.959000	0.62525	1.997000	0.40786	2.241000	0.73720	0.533000	0.62120	AAA	.		0.393	TRIM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076442.2	NM_030950	
TRIM6	117854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5624771	5624771	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:5624771A>G	ENST00000278302.5	+	2	369	c.229A>G	c.(229-231)Ata>Gta	p.I77V	AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000506134.1_Intron|TRIM6_ENST00000515022.1_Intron|TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.I105V|TRIM6_ENST00000380107.1_Missense_Mutation_p.I77V|TRIM6_ENST00000380097.3_Missense_Mutation_p.I105V|TRIM6_ENST00000507320.1_Intron|TRIM6_ENST00000445329.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	77					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		TCTGGCCAACATAGTGAGGCG	0.552																																					p.I105V		.											.	TRIM6-TRIM34	45	0			c.A313G						.						84.0	84.0	84.0					11																	5624771		2201	4297	6498	SO:0001583	missense	445372	exon2			GCCAACATAGTGA	AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.229A>G	11.37:g.5624771A>G	ENSP00000278302:p.Ile77Val	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	15.0	NM_001003819	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	ENST00000278302.5	37	CCDS31390.1	.	.	.	.	.	.	.	.	.	.	A	13.61	2.287440	0.40494	.	.	ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000258659;ENSG00000258588	ENST00000278302;ENST00000380107;ENST00000380097;ENST00000337072;ENST00000354852	D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99	4.04	4.04	0.47022	Zinc finger, RING/FYVE/PHD-type (1);	.	.	.	.	D	0.88669	0.6499	M	0.62016	1.91	0.19945	N	0.999945	D;P;D;D	0.62365	0.977;0.55;0.991;0.985	P;B;D;D	0.72625	0.836;0.241;0.978;0.952	T	0.77707	-0.2487	9	0.21540	T	0.41	.	7.7915	0.29123	0.7876:0.2124:0.0:0.0	.	77;105;105;77	E9PFM0;B2RNG4;Q9C030-2;Q9C030	.;.;.;TRIM6_HUMAN	V	77;77;105;105;105	ENSP00000278302:I77V;ENSP00000369450:I77V;ENSP00000369440:I105V;ENSP00000346916:I105V	ENSP00000278302:I77V	I	+	1	0	TRIM34;TRIM6;TRIM6-TRIM34	5581347	0.022000	0.18835	1.000000	0.80357	0.731000	0.41821	1.625000	0.37029	2.037000	0.60232	0.533000	0.62120	ATA	.		0.552	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143376.2	NM_001003818	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	179642164	179642164	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr2:179642164A>T	ENST00000591111.1	-	26	4852	c.4628T>A	c.(4627-4629)gTg>gAg	p.V1543E	TTN_ENST00000460472.2_Missense_Mutation_p.V1497E|TTN_ENST00000342992.6_Missense_Mutation_p.V1543E|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V1497E|TTN_ENST00000589042.1_Missense_Mutation_p.V1543E|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V1497E|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.V1543E			Q8WZ42	TITIN_HUMAN	titin	12404	Ig-like 6.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTTAAAATCACTGAAATTGA	0.378																																					p.V1543E		.											.	TTN	636	0			c.T4628A						.						46.0	45.0	46.0					2																	179642164		2203	4300	6503	SO:0001583	missense	7273	exon26			AAAATCACTGAAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.4628T>A	2.37:g.179642164A>T	ENSP00000465570:p.Val1543Glu	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	34.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	A	15.47	2.842610	0.51057	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43;-0.43	5.9	5.9	0.94986	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.83261	0.5216	M	0.89478	3.035	0.36166	D	0.848423	P;P;P;P;D	0.61080	0.773;0.773;0.773;0.879;0.989	P;P;P;P;P	0.61201	0.583;0.583;0.583;0.583;0.885	D	0.89596	0.3831	9	0.87932	D	0	.	16.3228	0.82958	1.0:0.0:0.0:0.0	.	1497;1497;1497;1543;1543	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	E	1543;1497;1497;1497;1497;1543	ENSP00000343764:V1543E;ENSP00000434586:V1497E;ENSP00000340554:V1497E;ENSP00000352154:V1497E;ENSP00000354117:V1543E	ENSP00000340554:V1497E	V	-	2	0	TTN	179350409	1.000000	0.71417	0.996000	0.52242	0.890000	0.51754	7.439000	0.80444	2.262000	0.75019	0.528000	0.53228	GTG	.		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBP1	7342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33441756	33441756	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:33441756T>C	ENST00000283629.3	-	11	1634	c.1105A>G	c.(1105-1107)Acg>Gcg	p.T369A	UBP1_ENST00000283628.5_Missense_Mutation_p.T369A|UBP1_ENST00000486388.1_5'UTR|UBP1_ENST00000447368.2_Missense_Mutation_p.T333A	NM_001128161.1|NM_014517.4	NP_001121633.1|NP_055332.3	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a)	369					angiogenesis (GO:0001525)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|urinary_tract(2)	23						TCCTGGATCGTAGCTGAAGGC	0.368																																					p.T369A		.											.	UBP1	537	0			c.A1105G						.						135.0	121.0	126.0					3																	33441756		2203	4300	6503	SO:0001583	missense	7342	exon11			GGATCGTAGCTGA	AF198487	CCDS2659.1, CCDS46788.1	3p22.3	2004-03-02			ENSG00000153560	ENSG00000153560			12507	protein-coding gene	gene with protein product		609784				8114710	Standard	NM_014517		Approved	LBP-1a	uc010hga.3	Q9NZI7	OTTHUMG00000130749	ENST00000283629.3:c.1105A>G	3.37:g.33441756T>C	ENSP00000283629:p.Thr369Ala	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	6.0	NM_014517	Q68CT0|Q86Y57|Q9H8V0|Q9UD76|Q9UD78	Missense_Mutation	SNP	ENST00000283629.3	37	CCDS2659.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.810728	0.50421	.	.	ENSG00000153560	ENST00000283629;ENST00000447368;ENST00000283628	T;T;T	0.20069	2.1;2.16;2.1	6.16	6.16	0.99307	Sterile alpha motif/pointed domain (1);	0.099426	0.64402	D	0.000001	T	0.26810	0.0656	M	0.66297	2.02	0.49299	D	0.999779	P;B	0.37207	0.587;0.228	B;B	0.38156	0.266;0.146	T	0.04078	-1.0979	10	0.72032	D	0.01	-16.0228	11.8297	0.52288	0.1306:0.0:0.0:0.8694	.	333;369	Q9NZI7-4;Q9NZI7	.;UBIP1_HUMAN	A	369;333;369	ENSP00000283629:T369A;ENSP00000395558:T333A;ENSP00000283628:T369A	ENSP00000283628:T369A	T	-	1	0	UBP1	33416760	1.000000	0.71417	0.994000	0.49952	0.800000	0.45204	4.104000	0.57790	2.367000	0.80283	0.528000	0.53228	ACG	.		0.368	UBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253249.2	NM_014517	
ULK2	9706	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	19741841	19741841	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:19741841T>C	ENST00000395544.4	-	10	1259	c.760A>G	c.(760-762)Aga>Gga	p.R254G	ULK2_ENST00000580130.1_5'Flank|ULK2_ENST00000361658.2_Missense_Mutation_p.R254G	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2	254	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					TTTTGGTTTCTCTGAAGCAAA	0.318																																					p.R254G		.											.	ULK2	334	0			c.A760G						.						58.0	61.0	60.0					17																	19741841		2203	4299	6502	SO:0001583	missense	9706	exon10			GGTTTCTCTGAAG	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.760A>G	17.37:g.19741841T>C	ENSP00000378914:p.Arg254Gly	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	84.0	NM_001142610	A8MY69|O75119	Missense_Mutation	SNP	ENST00000395544.4	37	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.219041	0.79464	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	T;T	0.25414	1.8;1.8	5.79	4.65	0.58169	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.25044	0.0608	L	0.55834	1.745	0.54753	D	0.999981	P	0.40578	0.722	B	0.37015	0.239	T	0.07731	-1.0757	10	0.87932	D	0	-19.7372	11.9521	0.52961	0.0:0.0:0.1448:0.8552	.	254	Q8IYT8	ULK2_HUMAN	G	254	ENSP00000354877:R254G;ENSP00000378914:R254G	ENSP00000354877:R254G	R	-	1	2	ULK2	19682433	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.532000	0.60608	2.215000	0.71742	0.528000	0.53228	AGA	.		0.318	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	
USP19	10869	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49149350	49149350	+	Missense_Mutation	SNP	T	T	A	rs534658521		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr3:49149350T>A	ENST00000398888.2	-	19	2906	c.2588A>T	c.(2587-2589)tAt>tTt	p.Y863F	USP19_ENST00000453664.1_Missense_Mutation_p.Y954F|USP19_ENST00000398898.2_Missense_Mutation_p.Y903F|USP19_ENST00000434032.2_Missense_Mutation_p.Y964F|USP19_ENST00000398896.1_Missense_Mutation_p.Y671F|USP19_ENST00000417901.1_Missense_Mutation_p.Y966F|USP19_ENST00000398892.3_Missense_Mutation_p.Y903F	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19	863	USP.				ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TTACCGGGCATAGCCCTCTAG	0.582																																					p.Y966F		.											.	USP19	663	0			c.A2897T						.						62.0	66.0	65.0					3																	49149350		2084	4225	6309	SO:0001583	missense	10869	exon20			CGGGCATAGCCCT	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611	ENST00000398888.2:c.2588A>T	3.37:g.49149350T>A	ENSP00000381863:p.Tyr863Phe	Somatic	76.0	1.0		WXS	Illumina HiSeq	Phase_I	59.0	18.0	NM_001199161	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	T	13.81	2.347396	0.41599	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664;ENST00000398892;ENST00000398888;ENST00000434032	T;T;T;T;T;T;T	0.23147	1.99;1.94;2.04;2.04;1.92;2.08;2.01	5.94	4.72	0.59763	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	2.867610	0.00622	N	0.000450	T	0.26159	0.0638	N	0.21545	0.675	0.53005	D	0.999966	B;B;B;B;B	0.27351	0.176;0.176;0.033;0.011;0.007	B;B;B;B;B	0.32762	0.152;0.152;0.062;0.022;0.022	T	0.03148	-1.1067	10	0.37606	T	0.19	-10.7462	12.0953	0.53750	0.1286:0.0:0.0:0.8714	.	964;954;863;903;671	E9PEG8;E7EN22;O94966;B5MEG5;E7ESU0	.;.;UBP19_HUMAN;.;.	F	671;903;966;954;903;863;964	ENSP00000381870:Y671F;ENSP00000381872:Y903F;ENSP00000395260:Y966F;ENSP00000400090:Y954F;ENSP00000381867:Y903F;ENSP00000381863:Y863F;ENSP00000401197:Y964F	ENSP00000381863:Y863F	Y	-	2	0	USP19	49124354	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	5.600000	0.67599	2.279000	0.76181	0.459000	0.35465	TAT	.		0.582	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
VENTX	27287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	135053333	135053333	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:135053333A>T	ENST00000325980.9	+	2	906	c.395A>T	c.(394-396)gAg>gTg	p.E132V		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	132					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		CAGCTCTCAGAGGTCCAGGtg	0.647																																					p.E132V		.											.	VENTX	90	0			c.A395T						.						18.0	22.0	20.0					10																	135053333		2203	4295	6498	SO:0001583	missense	27287	exon2			TCTCAGAGGTCCA	AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.395A>T	10.37:g.135053333A>T	ENSP00000357556:p.Glu132Val	Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	12.0	NM_014468	Q32MZ3	Missense_Mutation	SNP	ENST00000325980.9	37	CCDS7675.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.434279	0.62955	.	.	ENSG00000151650	ENST00000325980	D	0.97041	-4.22	3.36	3.36	0.38483	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.130587	0.48767	U	0.000162	D	0.98362	0.9456	M	0.91510	3.215	0.47905	D	0.999543	D	0.89917	1.0	D	0.83275	0.996	D	0.98417	1.0575	10	0.87932	D	0	.	8.4583	0.32912	1.0:0.0:0.0:0.0	.	132	O95231	VENTX_HUMAN	V	132	ENSP00000357556:E132V	ENSP00000357556:E132V	E	+	2	0	VENTX	134903323	1.000000	0.71417	0.681000	0.30009	0.682000	0.39822	6.170000	0.71920	1.316000	0.45131	0.363000	0.22086	GAG	.		0.647	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051116.4	NM_014468	
VSTM1	284415	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	54561741	54561741	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:54561741A>T	ENST00000338372.2	-	3	349	c.174T>A	c.(172-174)ttT>ttA	p.F58L	VSTM1_ENST00000425006.2_Missense_Mutation_p.F58L|VSTM1_ENST00000366170.2_Intron|VSTM1_ENST00000376626.1_Missense_Mutation_p.F58L	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	58	Ig-like V-type.				immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		TGCGCAGCACAAATGTCACAT	0.567																																					p.F58L		.											.	VSTM1	90	0			c.T174A						.						138.0	129.0	132.0					19																	54561741		2203	4300	6503	SO:0001583	missense	284415	exon3			CAGCACAAATGTC	AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.174T>A	19.37:g.54561741A>T	ENSP00000343366:p.Phe58Leu	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	17.0	NM_198481	B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Missense_Mutation	SNP	ENST00000338372.2	37	CCDS12872.1	.	.	.	.	.	.	.	.	.	.	A	16.25	3.069137	0.55539	.	.	ENSG00000189068	ENST00000338372;ENST00000376626;ENST00000425006	T;T;T	0.11821	2.74;2.74;2.74	3.49	1.34	0.21922	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.401900	0.15870	N	0.240598	T	0.26340	0.0643	M	0.84948	2.725	0.09310	N	1	P;P	0.46395	0.877;0.877	P;P	0.51615	0.675;0.675	T	0.06338	-1.0832	9	.	.	.	-5.0435	5.1123	0.14815	0.2773:0.0:0.7227:0.0	.	58;58	D2DJS4;Q6UX27	.;VSTM1_HUMAN	L	58	ENSP00000343366:F58L;ENSP00000365813:F58L;ENSP00000413006:F58L	.	F	-	3	2	VSTM1	59253553	0.011000	0.17503	0.007000	0.13788	0.014000	0.08584	0.420000	0.21263	0.825000	0.34637	-0.375000	0.07067	TTT	.		0.567	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139358.3	NM_198481	
VTN	7448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	26695961	26695961	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr17:26695961T>A	ENST00000226218.4	-	5	1376	c.758A>T	c.(757-759)aAc>aTc	p.N253I	SARM1_ENST00000379061.4_Intron|VTN_ENST00000438614.1_5'Flank|VTN_ENST00000536498.1_5'UTR|SARM1_ENST00000457710.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|CTB-96E2.2_ENST00000555059.2_5'Flank|TMEM199_ENST00000509083.1_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	253					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	TGCATCCACGTTGTCCGGGAT	0.597																																					p.N253I		.											.	VTN	227	0			c.A758T						.						95.0	91.0	92.0					17																	26695961		2203	4300	6503	SO:0001583	missense	7448	exon5			TCCACGTTGTCCG	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.758A>T	17.37:g.26695961T>A	ENSP00000226218:p.Asn253Ile	Somatic	131.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	63.0	NM_000638	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	ENST00000226218.4	37	CCDS11229.1	.	.	.	.	.	.	.	.	.	.	T	16.80	3.224358	0.58668	.	.	ENSG00000255604	ENST00000226218	T	0.09073	3.02	5.92	5.92	0.95590	Hemopexin/matrixin (2);	0.368951	0.36167	N	0.002757	T	0.34978	0.0916	M	0.92367	3.3	0.21105	N	0.999787	D	0.59357	0.985	P	0.58266	0.836	T	0.46442	-0.9191	10	0.87932	D	0	-14.1232	16.3648	0.83312	0.0:0.0:0.0:1.0	.	253	P04004	VTNC_HUMAN	I	253	ENSP00000226218:N253I	ENSP00000226218:N253I	N	-	2	0	AC002094.1	23720088	0.902000	0.30710	0.006000	0.13384	0.027000	0.11550	5.895000	0.69814	2.263000	0.75096	0.533000	0.62120	AAC	.		0.597	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
WBP4	11193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	41656941	41656941	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr13:41656941C>T	ENST00000379487.3	+	10	1422	c.1022C>T	c.(1021-1023)aCa>aTa	p.T341I	WBP4_ENST00000542082.1_Missense_Mutation_p.T320I	NM_007187.3	NP_009118.1	O75554	WBP4_HUMAN	WW domain binding protein 4	341					mRNA cis splicing, via spliceosome (GO:0045292)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	nucleic acid binding (GO:0003676)|proline-rich region binding (GO:0070064)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|prostate(1)|skin(1)	12		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		AAAGAAAAAACAGTCACTTCT	0.408																																					p.T341I		.											.	WBP4	289	0			c.C1022T						.						75.0	75.0	75.0					13																	41656941		2203	4300	6503	SO:0001583	missense	11193	exon10			AAAAAACAGTCAC	AF071185	CCDS9375.1	13q13.3	2012-10-17	2012-10-17		ENSG00000120688	ENSG00000120688			12739	protein-coding gene	gene with protein product	"""formin binding protein 21"""	604981				9724750	Standard	NM_007187		Approved	FBP21, MGC117310	uc001uxt.3	O75554	OTTHUMG00000016784	ENST00000379487.3:c.1022C>T	13.37:g.41656941C>T	ENSP00000368801:p.Thr341Ile	Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	17.0	NM_007187	B7Z4M2|Q32P29	Missense_Mutation	SNP	ENST00000379487.3	37	CCDS9375.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162527	0.57368	.	.	ENSG00000120688	ENST00000379487;ENST00000542082	.	.	.	6.06	6.06	0.98353	.	0.157440	0.56097	D	0.000027	T	0.79753	0.4500	M	0.71581	2.175	0.49687	D	0.999815	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.973	T	0.80122	-0.1514	9	0.87932	D	0	-28.5545	18.8049	0.92032	0.0:1.0:0.0:0.0	.	320;341	B7Z4M2;O75554	.;WBP4_HUMAN	I	341;320	.	ENSP00000368801:T341I	T	+	2	0	WBP4	40554941	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.295000	0.51794	2.879000	0.98667	0.650000	0.86243	ACA	.		0.408	WBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044655.2	NM_007187	
WDFY3	23001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	85623579	85623579	+	Silent	SNP	T	T	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:85623579T>G	ENST00000295888.4	-	56	8930	c.8523A>C	c.(8521-8523)gcA>gcC	p.A2841A	WDFY3_ENST00000322366.6_Silent_p.A2824A	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2841	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTTTTACATCTGCCATATTGT	0.458																																					p.A2841A		.											.	WDFY3	93	0			c.A8523C						.						88.0	95.0	92.0					4																	85623579		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon56			TACATCTGCCATA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8523A>C	4.37:g.85623579T>G		Somatic	200.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	43.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	37	CCDS3609.1																																																																																			.		0.458	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
CFAP43	80217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	105900629	105900629	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:105900629T>A	ENST00000357060.3	-	34	4517	c.4402A>T	c.(4402-4404)Ata>Tta	p.I1468L	WDR96_ENST00000428666.1_Missense_Mutation_p.I1440L|WDR96_ENST00000479392.1_5'UTR	NM_025145.5	NP_079421.5														NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						TCTTCAATTATGTTCTTGTTG	0.333																																					p.I1468L		.											.	WDR96	95	0			c.A4402T						.						83.0	79.0	81.0					10																	105900629		2203	4299	6502	SO:0001583	missense	80217	exon34			CAATTATGTTCTT																												ENST00000357060.3:c.4402A>T	10.37:g.105900629T>A	ENSP00000349568:p.Ile1468Leu	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	7.0	NM_025145		Missense_Mutation	SNP	ENST00000357060.3	37	CCDS31281.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.786802	0.31593	.	.	ENSG00000197748	ENST00000357060;ENST00000428666	T;T	0.14022	2.54;2.55	5.51	3.07	0.35406	.	0.112103	0.64402	D	0.000012	T	0.08802	0.0218	L	0.29908	0.895	0.32488	N	0.54064	B;B	0.02656	0.0;0.0	B;B	0.11329	0.003;0.006	T	0.12218	-1.0556	10	0.26408	T	0.33	.	6.3415	0.21324	0.139:0.076:0.0:0.785	.	1440;1468	G5E9L1;Q8NDM7	.;WDR96_HUMAN	L	1468;1440	ENSP00000349568:I1468L;ENSP00000400289:I1440L	ENSP00000349568:I1468L	I	-	1	0	WDR96	105890619	0.935000	0.31712	0.923000	0.36655	0.857000	0.48899	1.281000	0.33214	0.925000	0.37094	-0.274000	0.10170	ATA	.		0.333	WDR96-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
WFS1	7466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	6288867	6288867	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr4:6288867A>T	ENST00000226760.1	+	3	450	c.280A>T	c.(280-282)Agg>Tgg	p.R94W	WFS1_ENST00000503569.1_Missense_Mutation_p.R94W	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	94					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		AGTCCTGGAGAGGGCCAAGGC	0.582																																					p.R94W		.											WFS1,brain,glioma,-2	WFS1	91	0			c.A280T						.						52.0	50.0	51.0					4																	6288867		2176	4249	6425	SO:0001583	missense	7466	exon3			CTGGAGAGGGCCA	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.280A>T	4.37:g.6288867A>T	ENSP00000226760:p.Arg94Trp	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	32.0	16.0	NM_001145853	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	ENST00000226760.1	37	CCDS3386.1	.	.	.	.	.	.	.	.	.	.	A	17.57	3.421883	0.62622	.	.	ENSG00000109501	ENST00000503569;ENST00000226760	D;D	0.94000	-3.33;-3.33	3.84	3.84	0.44239	.	0.284353	0.38778	N	0.001564	D	0.94085	0.8104	L	0.52573	1.65	0.30760	N	0.744201	D	0.56968	0.978	P	0.62089	0.898	D	0.92021	0.5626	10	0.62326	D	0.03	-22.206	10.6348	0.45558	1.0:0.0:0.0:0.0	.	94	O76024	WFS1_HUMAN	W	94	ENSP00000423337:R94W;ENSP00000226760:R94W	ENSP00000226760:R94W	R	+	1	2	WFS1	6339768	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	6.802000	0.75175	1.623000	0.50342	0.459000	0.35465	AGG	.		0.582	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206863.1		
WISP1	8840	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	134225330	134225330	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:134225330G>T	ENST00000250160.6	+	2	399	c.293G>T	c.(292-294)gGc>gTc	p.G98V	WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Missense_Mutation_p.G98V|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000517423.1_Missense_Mutation_p.G98V	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	98	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			CCCCACCGGGGCCTCTACTGT	0.612																																					p.G98V		.											.	WISP1	610	0			c.G293T						.						57.0	60.0	59.0					8																	134225330		2203	4300	6503	SO:0001583	missense	8840	exon2			ACCGGGGCCTCTA	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.293G>T	8.37:g.134225330G>T	ENSP00000250160:p.Gly98Val	Somatic	168.0	1.0		WXS	Illumina HiSeq	Phase_I	224.0	35.0	NM_003882	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	ENST00000250160.6	37	CCDS6371.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824456	0.90955	.	.	ENSG00000104415	ENST00000250160;ENST00000517423;ENST00000220856	T;T;T	0.70399	-0.48;-0.48;-0.48	5.27	5.27	0.74061	Insulin-like growth factor-binding protein, IGFBP (3);	0.000000	0.85682	D	0.000000	D	0.87269	0.6135	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89491	0.3757	10	0.62326	D	0.03	-15.6375	17.8633	0.88789	0.0:0.0:1.0:0.0	.	98;98;98	E7EMM5;O95388-2;O95388	.;.;WISP1_HUMAN	V	98	ENSP00000250160:G98V;ENSP00000427744:G98V;ENSP00000220856:G98V	ENSP00000220856:G98V	G	+	2	0	WISP1	134294512	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.790000	0.99075	2.460000	0.83146	0.542000	0.68232	GGC	.		0.612	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378794.2	NM_003882	
YIPF1	54432	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	54332055	54332055	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:54332055T>C	ENST00000072644.1	-	9	985	c.649A>G	c.(649-651)Ata>Gta	p.I217V	YIPF1_ENST00000469457.1_5'UTR|YIPF1_ENST00000371399.1_Splice_Site_p.I34V|YIPF1_ENST00000539954.1_Splice_Site_p.I242V	NM_018982.4	NP_061855.1	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	217						integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)				endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|skin(1)|urinary_tract(2)	19						ATCCACAGTATCTGAAAGAAG	0.493																																					p.I217V		.											.	YIPF1	154	0			c.A649G						.						34.0	37.0	36.0					1																	54332055		2203	4300	6503	SO:0001630	splice_region_variant	54432	exon9			ACAGTATCTGAAA	BC009674	CCDS584.1	1p33-p32.1	2008-02-05			ENSG00000058799	ENSG00000058799		"""Yip1 domain family"""	25231	protein-coding gene	gene with protein product						12477932	Standard	NM_018982		Approved	DJ167A19.1, FinGER1	uc001cvu.3	Q9Y548	OTTHUMG00000008074	ENST00000072644.1:c.649-1A>G	1.37:g.54332055T>C		Somatic	282.0	0.0		WXS	Illumina HiSeq	Phase_I	313.0	136.0	NM_018982	B2RCM7|D3DQ40|Q9NWJ1	Missense_Mutation	SNP	ENST00000072644.1	37	CCDS584.1	.	.	.	.	.	.	.	.	.	.	T	3.386	-0.125275	0.06795	.	.	ENSG00000058799	ENST00000371399;ENST00000072644;ENST00000539954	T;T	0.40756	1.02;1.02	5.54	3.2	0.36748	Yip1 domain (1);	0.144208	0.64402	N	0.000009	T	0.19167	0.0460	N	0.11724	0.165	0.47183	D	0.999342	B	0.02656	0.0	B	0.08055	0.003	T	0.15838	-1.0423	10	0.02654	T	1	-24.2691	8.753	0.34629	0.0:0.1615:0.0:0.8385	.	217	Q9Y548	YIPF1_HUMAN	V	34;217;242	ENSP00000072644:I217V;ENSP00000439926:I242V	ENSP00000072644:I217V	I	-	1	0	YIPF1	54104643	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	1.846000	0.39289	0.396000	0.25283	0.482000	0.46254	ATA	.		0.493	YIPF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022103.5	NM_018982	Missense_Mutation
YTHDC2	64848	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	112849665	112849665	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr5:112849665T>C	ENST00000161863.4	+	1	286	c.73T>C	c.(73-75)Tgt>Cgt	p.C25R	YTHDC2_ENST00000515883.1_Missense_Mutation_p.C25R	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	25	Gly-rich.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		CCCCTCGCCTTGTGGCCCTGG	0.682																																					p.C25R		.											.	YTHDC2	92	0			c.T73C						.						10.0	11.0	10.0					5																	112849665		2185	4284	6469	SO:0001583	missense	64848	exon1			TCGCCTTGTGGCC	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.73T>C	5.37:g.112849665T>C	ENSP00000161863:p.Cys25Arg	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	21.0	NM_022828	B2RP66	Missense_Mutation	SNP	ENST00000161863.4	37	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	T	3.576	-0.086703	0.07097	.	.	ENSG00000047188	ENST00000161863;ENST00000515883	T;T	0.06068	4.36;3.35	3.28	2.03	0.26663	.	.	.	.	.	T	0.03608	0.0103	N	0.14661	0.345	0.21915	N	0.999476	B	0.02656	0.0	B	0.01281	0.0	T	0.42224	-0.9464	9	0.45353	T	0.12	.	3.3528	0.07158	0.0:0.13:0.2437:0.6263	.	25	Q9H6S0	YTDC2_HUMAN	R	25	ENSP00000161863:C25R;ENSP00000423101:C25R	ENSP00000161863:C25R	C	+	1	0	YTHDC2	112877564	.	.	0.086000	0.20670	0.040000	0.13550	.	.	0.428000	0.26173	0.260000	0.18958	TGT	.		0.682	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
ZBTB8B	728116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	32950917	32950917	+	Silent	SNP	A	A	C			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:32950917A>C	ENST00000609129.1	+	4	1464	c.1386A>C	c.(1384-1386)ccA>ccC	p.P462P	RP1-27O5.3_ENST00000480336.1_Silent_p.P462P	NM_001145720.1	NP_001139192.1	Q8NAP8	ZBT8B_HUMAN	zinc finger and BTB domain containing 8B	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)	1						ATGACTGGCCAATCTATGTGG	0.463																																					p.P462P		.											.	.	.	0			c.A1386C						.						118.0	100.0	105.0					1																	32950917		692	1591	2283	SO:0001819	synonymous_variant	728116	exon4			CTGGCCAATCTAT	AL442095	CCDS44104.1	1p35.1	2013-01-08			ENSG00000215897	ENSG00000273274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	37057	protein-coding gene	gene with protein product							Standard	NM_001145720		Approved	RP1-27O5.1, DKFZp547H154, ZNF916B	uc001bvl.4	Q8NAP8	OTTHUMG00000167087	ENST00000609129.1:c.1386A>C	1.37:g.32950917A>C		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	34.0	NM_001145720	Q15DG5|Q5VXR5|Q69YT7	Silent	SNP	ENST00000609129.1	37	CCDS44104.1																																																																																			.		0.463	ZBTB8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392986.2	NM_001145720	
ZC3H12C	85463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	110033998	110033998	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:110033998G>T	ENST00000278590.3	+	5	1200	c.1149G>T	c.(1147-1149)aaG>aaT	p.K383N	ZC3H12C_ENST00000453089.2_Splice_Site_p.K352N|ZC3H12C_ENST00000528673.1_Splice_Site_p.K384N	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	383							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TCCATGACAGGTTCATGCCCC	0.383																																					p.K383N		.											.	ZC3H12C	68	0			c.G1149T						.						50.0	44.0	46.0					11																	110033998		1818	4078	5896	SO:0001630	splice_region_variant	85463	exon5			TGACAGGTTCATG		CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1149-1G>T	11.37:g.110033998G>T		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	26.0	NM_033390	B4DI65|B4DR47	Missense_Mutation	SNP	ENST00000278590.3	37	CCDS44727.1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.702546	0.68501	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.43688	0.94;0.94;0.94	5.78	2.58	0.30949	Ribonuclease Zc3h12a-like (1);	0.000000	0.85682	D	0.000000	T	0.58566	0.2131	M	0.76574	2.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.56171	-0.8023	9	.	.	.	.	7.5219	0.27633	0.4263:0.0:0.5737:0.0	.	384;383;383	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	N	383;384;352	ENSP00000278590:K383N;ENSP00000431821:K384N;ENSP00000413094:K352N	.	K	+	3	2	ZC3H12C	109539208	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	0.990000	0.29642	0.606000	0.29965	0.561000	0.74099	AAG	.		0.383	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000390491.1	NM_033390	Missense_Mutation
ZFHX3	463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	72993128	72993128	+	Missense_Mutation	SNP	C	C	T	rs142256050		TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr16:72993128C>T	ENST00000268489.5	-	2	1589	c.917G>A	c.(916-918)cGa>cAa	p.R306Q	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	306					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CAGGGTCATTCGATGGTCATG	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		19031	0.0		0.001	False		,,,				2504	0.0				p.R306Q		.											.	ZFHX3	72	0			c.G917A						.	C	,GLN/ARG	0,4396		0,0,2198	86.0	77.0	80.0		,917	4.5	1.0	16	dbSNP_134	80	3,8597	3.0+/-9.4	0,3,4297	yes	intron,missense	ZFHX3	NM_001164766.1,NM_006885.3	,43	0,3,6495	TT,TC,CC		0.0349,0.0,0.0231	,possibly-damaging	,306/3704	72993128	3,12993	2198	4300	6498	SO:0001583	missense	463	exon2			GTCATTCGATGGT	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.917G>A	16.37:g.72993128C>T	ENSP00000268489:p.Arg306Gln	Somatic	181.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	35.0	NM_006885	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	ENST00000268489.5	37	CCDS10908.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307156	0.40795	0.0	3.49E-4	ENSG00000140836	ENST00000268489	T	0.74209	-0.82	4.51	4.51	0.55191	.	0.000000	0.39759	N	0.001261	T	0.81555	0.4847	L	0.42245	1.32	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.81040	-0.1113	10	0.38643	T	0.18	.	17.5869	0.87984	0.0:1.0:0.0:0.0	.	306	Q15911	ZFHX3_HUMAN	Q	306	ENSP00000268489:R306Q	ENSP00000268489:R306Q	R	-	2	0	ZFHX3	71550629	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.673000	0.68109	2.235000	0.73313	0.491000	0.48974	CGA	C|0.999;T|0.001		0.493	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ZFP41	286128	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	144332183	144332183	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr8:144332183A>T	ENST00000330701.4	+	2	539	c.170A>T	c.(169-171)gAa>gTa	p.E57V	ZFP41_ENST00000522452.1_Missense_Mutation_p.E57V|ZFP41_ENST00000520584.1_Missense_Mutation_p.E57V	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	57					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CCTGAAGACGAAGAGCACGTC	0.552																																					p.E57V		.											.	ZFP41	91	0			c.A170T						.						62.0	69.0	66.0					8																	144332183		2203	4300	6503	SO:0001583	missense	286128	exon2			AAGACGAAGAGCA		CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.170A>T	8.37:g.144332183A>T	ENSP00000327427:p.Glu57Val	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	7.0	NM_173832	D3DWJ5	Missense_Mutation	SNP	ENST00000330701.4	37	CCDS6397.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.921081	0.73213	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.07216	3.21;3.21;3.21	2.82	1.66	0.24008	.	.	.	.	.	T	0.08313	0.0207	N	0.24115	0.695	0.09310	N	1	D	0.61080	0.989	P	0.50825	0.651	T	0.27365	-1.0076	9	0.72032	D	0.01	-10.2381	4.5313	0.12006	0.7139:0.0:0.2861:0.0	.	57	Q8N8Y5	ZFP41_HUMAN	V	57	ENSP00000430465:E57V;ENSP00000327427:E57V;ENSP00000428966:E57V	ENSP00000327427:E57V	E	+	2	0	ZFP41	144403558	0.001000	0.12720	0.001000	0.08648	0.710000	0.40934	0.272000	0.18644	0.499000	0.27970	0.383000	0.25322	GAA	.		0.552	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381114.2	NM_173832	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	22157397	22157397	+	Missense_Mutation	SNP	G	G	T	rs530559517	byFrequency	TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:22157397G>T	ENST00000397126.4	-	4	587	c.439C>A	c.(439-441)Cgt>Agt	p.R147S	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TATTTGCCACGTTGAAATACT	0.328																																					p.R147S		.											.	ZNF208	7	0			c.C439A						.						131.0	128.0	129.0					19																	22157397		2052	4230	6282	SO:0001583	missense	7757	exon4			TGCCACGTTGAAA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.439C>A	19.37:g.22157397G>T	ENSP00000380315:p.Arg147Ser	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	16.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	37	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	G	0.889	-0.726286	0.03158	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.06687	3.27	1.44	-2.88	0.05682	.	.	.	.	.	T	0.06554	0.0168	.	.	.	0.09310	N	1	P	0.43314	0.803	B	0.40602	0.334	T	0.25537	-1.0129	8	0.52906	T	0.07	.	6.3092	0.21154	0.4659:0.0:0.5341:0.0	.	147	O43345	ZN208_HUMAN	S	147	ENSP00000380315:R147S	ENSP00000380315:R147S	R	-	1	0	ZNF208	21949237	0.000000	0.05858	0.004000	0.12327	0.027000	0.11550	-0.464000	0.06688	-0.603000	0.05767	-0.763000	0.03452	CGT	.		0.328	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF273	10793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	64388967	64388967	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr7:64388967A>G	ENST00000476120.1	+	4	1332	c.1261A>G	c.(1261-1263)Aag>Gag	p.K421E	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Missense_Mutation_p.K356E	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TACTAAACATAAGAGAATTTA	0.338																																					p.K421E	Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)	.											.	ZNF273	90	0			c.A1261G						.						37.0	40.0	39.0					7																	64388967		2203	4298	6501	SO:0001583	missense	10793	exon4			AAACATAAGAGAA	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1261A>G	7.37:g.64388967A>G	ENSP00000418719:p.Lys421Glu	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	22.0	NM_021148	B3KQZ5|Q6P3V4	Missense_Mutation	SNP	ENST00000476120.1	37	CCDS5528.2	.	.	.	.	.	.	.	.	.	.	.	17.81	3.480294	0.63849	.	.	ENSG00000198039	ENST00000476120;ENST00000319636	T;T	0.18016	2.24;2.24	1.16	-2.32	0.06745	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18425	0.0442	N	0.20807	0.61	0.21220	N	0.999759	D	0.61697	0.99	D	0.73380	0.98	T	0.19614	-1.0300	9	0.59425	D	0.04	.	2.2335	0.04002	0.4355:0.3136:0.2509:0.0	.	421	Q14593	ZN273_HUMAN	E	421;356	ENSP00000418719:K421E;ENSP00000324518:K356E	ENSP00000324518:K356E	K	+	1	0	ZNF273	64026402	0.000000	0.05858	0.800000	0.32199	0.797000	0.45037	-0.346000	0.07760	0.175000	0.19841	0.172000	0.16884	AAG	.		0.338	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313502.1		
ZNF311	282890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	28963167	28963167	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr6:28963167C>A	ENST00000377179.3	-	7	2124	c.1612G>T	c.(1612-1614)Ggg>Tgg	p.G538W	ZNF311_ENST00000483450.1_5'UTR	NM_001010877.2	NP_001010877.2	Q5JNZ3	ZN311_HUMAN	zinc finger protein 311	538					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|skin(3)|upper_aerodigestive_tract(2)	28						TTTGACTTCCCACTGAAAGCT	0.443																																					p.G538W		.											.	ZNF311	22	0			c.G1612T						.						93.0	87.0	89.0					6																	28963167		1511	2709	4220	SO:0001583	missense	282890	exon7			ACTTCCCACTGAA	AL833166	CCDS34357.1	6p21.33	2013-01-08			ENSG00000197935	ENSG00000197935		"""Zinc fingers, C2H2-type"", ""-"""	13847	protein-coding gene	gene with protein product							Standard	XM_006715067		Approved		uc003nlu.2	Q5JNZ3	OTTHUMG00000031292	ENST00000377179.3:c.1612G>T	6.37:g.28963167C>A	ENSP00000366384:p.Gly538Trp	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	8.0	NM_001010877	A2BFK5|B0S7Y4|Q92971	Missense_Mutation	SNP	ENST00000377179.3	37	CCDS34357.1	.	.	.	.	.	.	.	.	.	.	C	9.143	1.014365	0.19277	.	.	ENSG00000197935	ENST00000377179;ENST00000535083	T	0.07688	3.17	3.59	1.44	0.22558	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00875	0.0029	N	0.02985	-0.445	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.47923	-0.9079	9	0.33940	T	0.23	-6.2223	1.7053	0.02881	0.2174:0.4475:0.2117:0.1234	.	538	Q5JNZ3	ZN311_HUMAN	W	538;446	ENSP00000366384:G538W	ENSP00000366384:G538W	G	-	1	0	ZNF311	29071146	0.000000	0.05858	0.424000	0.26647	0.547000	0.35210	-0.965000	0.03829	0.744000	0.32741	0.585000	0.79938	GGG	.		0.443	ZNF311-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076631.3	XM_212581	
ZNF334	55713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	45130957	45130957	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr20:45130957T>A	ENST00000347606.4	-	5	1203	c.1021A>T	c.(1021-1023)Agg>Tgg	p.R341W	ZNF334_ENST00000457685.2_Missense_Mutation_p.R303W|ZNF334_ENST00000593880.1_Missense_Mutation_p.R364W	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				GTGTGTGACCTGAAATGTTCA	0.433																																					p.R341W		.											.	ZNF334	92	0			c.A1021T						.						148.0	151.0	150.0					20																	45130957		2203	4300	6503	SO:0001583	missense	55713	exon5			GTGACCTGAAATG	AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1021A>T	20.37:g.45130957T>A	ENSP00000255129:p.Arg341Trp	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	16.0	NM_018102	Q5T6U2|Q9NVW4	Missense_Mutation	SNP	ENST00000347606.4	37	CCDS33480.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707875	0.68615	.	.	ENSG00000198185	ENST00000457685;ENST00000347606	T;T	0.25579	1.79;1.79	3.3	2.15	0.27550	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.52092	0.1713	M	0.89030	3	0.36092	D	0.843496	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	T	0.61332	-0.7084	9	0.87932	D	0	.	8.0599	0.30627	0.0:0.0:0.205:0.795	.	303;341;364	B3KQ93;Q9HCZ1;Q8N3P8	.;ZN334_HUMAN;.	W	303;341	ENSP00000402582:R303W;ENSP00000255129:R341W	ENSP00000255129:R341W	R	-	1	2	ZNF334	44564364	0.000000	0.05858	0.244000	0.24202	0.986000	0.74619	-0.558000	0.05978	0.419000	0.25927	0.482000	0.46254	AGG	.		0.433	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079575.1		
ZNF347	84671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53645692	53645692	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:53645692G>T	ENST00000334197.7	-	5	457	c.389C>A	c.(388-390)tCc>tAc	p.S130Y	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000452676.2_Missense_Mutation_p.S131Y|ZNF347_ENST00000601469.2_Missense_Mutation_p.S131Y	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TTCCCTGAAGGAACATCCTTC	0.403																																					p.S131Y	Melanoma(64;205 1597 17324 45721)	.											.	ZNF347	90	0			c.C392A						.						129.0	110.0	116.0					19																	53645692		2203	4299	6502	SO:0001583	missense	84671	exon5			CTGAAGGAACATC	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.389C>A	19.37:g.53645692G>T	ENSP00000334146:p.Ser130Tyr	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	10.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	37	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.979416	0.00448	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.07114	3.23;3.22	2.64	-3.02	0.05446	.	.	.	.	.	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	P;B	0.37207	0.587;0.183	B;B	0.36922	0.236;0.054	T	0.32134	-0.9918	9	0.02654	T	1	.	3.7249	0.08470	0.3157:0.0:0.4528:0.2315	.	131;130	G5E9N4;Q96SE7	.;ZN347_HUMAN	Y	130;131	ENSP00000334146:S130Y;ENSP00000405218:S131Y	ENSP00000334146:S130Y	S	-	2	0	ZNF347	58337504	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.894000	0.00707	-0.156000	0.11079	-0.244000	0.11960	TCC	.		0.403	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
ZNF408	79797	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46724704	46724704	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr11:46724704A>T	ENST00000311764.2	+	4	793	c.563A>T	c.(562-564)gAg>gTg	p.E188V	ARHGAP1_ENST00000311956.4_5'Flank	NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	188					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTGGACAAAGAGGCAGCTGTA	0.592																																					p.E188V	Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	.											.	ZNF408	90	0			c.A563T						.						44.0	39.0	41.0					11																	46724704		2201	4299	6500	SO:0001583	missense	79797	exon4			ACAAAGAGGCAGC	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.563A>T	11.37:g.46724704A>T	ENSP00000309606:p.Glu188Val	Somatic	87.0	1.0		WXS	Illumina HiSeq	Phase_I	39.0	12.0	NM_024741		Missense_Mutation	SNP	ENST00000311764.2	37	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.091449	0.55968	.	.	ENSG00000175213	ENST00000311764	T	0.12039	2.72	5.88	-6.86	0.01676	.	1.010710	0.07962	N	0.982474	T	0.06645	0.0170	L	0.29908	0.895	0.09310	N	1	B;B	0.14805	0.006;0.011	B;B	0.06405	0.002;0.002	T	0.40403	-0.9565	10	0.39692	T	0.17	-4.3081	0.8997	0.01271	0.2667:0.2968:0.2431:0.1934	.	180;188	B4DXY4;Q9H9D4	.;ZN408_HUMAN	V	188	ENSP00000309606:E188V	ENSP00000309606:E188V	E	+	2	0	ZNF408	46681280	0.000000	0.05858	0.002000	0.10522	0.193000	0.23685	-0.339000	0.07832	-0.778000	0.04566	0.533000	0.62120	GAG	.		0.592	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741	
ZNF518A	9849	broad.mit.edu;ucsc.edu;mdanderson.org	37	10	97916998	97916998	+	RNA	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr10:97916998A>G	ENST00000534948.1	+	0	1776							Q6AHZ1	Z518A_HUMAN	zinc finger protein 518A						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	24		Colorectal(252;0.0815)		Epithelial(162;4.23e-08)|all cancers(201;1.85e-06)		AATGGCAAAGACTTCTGCAGG	0.333																																					.		.											.	ZNF518A	23	0			.						.						35.0	32.0	33.0					10																	97916998		1828	4074	5902			9849	.			GCAAAGACTTCTG	AB002333	CCDS73170.1	10q23.33	2012-08-08	2007-12-07	2007-12-07	ENSG00000177853	ENSG00000177853		"""Zinc fingers, C2H2-type"""	29009	protein-coding gene	gene with protein product			"""zinc finger protein 518"""	ZNF518		9205841	Standard	NM_014803		Approved	KIAA0335	uc001klp.3	Q6AHZ1	OTTHUMG00000018828		10.37:g.97916998A>G		Somatic	125.0	1.0		WXS	Illumina HiSeq	Phase_I	92.0	51.0	.	A0PJI5|O15044|Q32MP4	RNA	SNP	ENST00000534948.1	37																																																																																				.		0.333	ZNF518A-202	KNOWN	basic	processed_transcript	processed_transcript		NM_014803	
ZNF578	147660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53013987	53013987	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr19:53013987A>G	ENST00000421239.2	+	6	597	c.353A>G	c.(352-354)cAa>cGa	p.Q118R	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TTTCAGTCACAAAAAGATGAA	0.398																																					p.Q118R		.											.	.	.	0			c.A353G						.						99.0	104.0	102.0					19																	53013987		2201	4300	6501	SO:0001583	missense	147660	exon6			AGTCACAAAAAGA	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.353A>G	19.37:g.53013987A>G	ENSP00000459216:p.Gln118Arg	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	58.0	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	1.815	-0.473611	0.04414	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.72	-3.43	0.04810	.	.	.	.	.	T	0.26882	0.0658	N	0.17723	0.515	0.09310	N	1	D	0.57899	0.981	D	0.67900	0.954	T	0.12319	-1.0552	7	.	.	.	.	0.2444	0.00196	0.3715:0.2054:0.217:0.206	.	118	G3V4F6	.	R	118	.	.	Q	+	2	0	ZNF578	57705799	0.000000	0.05858	0.001000	0.08648	0.277000	0.26821	-1.667000	0.01961	-0.679000	0.05217	0.113000	0.15668	CAA	.		0.398	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	152284916	152284917	+	Missense_Mutation	DNP	CT	CT	GA			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:152284916_152284917CT>GA	ENST00000368799.1	-	3	2480_2481	c.2445_2446AG>TC	c.(2443-2448)ggAGta>ggTCta	p.V816L	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	816	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTTGTCTTACTCCAGTGCTGG	0.569									Ichthyosis																												p.V816L		.											.	.	.	0			.						.																																			SO:0001583	missense	2312	.	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GTCTTACTCCAGT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2445_2446delinsGA	1.37:g.152284916_152284917delinsGA	ENSP00000357789:p.Val816Leu	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	37.0	.	Q01720|Q5T583|Q9UC71	Missense_Mutation	DNP	ENST00000368799.1	37	CCDS30860.1																																																																																			.		0.569	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
CR2	1380	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	207649619	207649620	+	Missense_Mutation	DNP	GA	GA	TC			TCGA-CC-A7IK-01A-12D-A33Q-10	TCGA-CC-A7IK-10A-01D-A33Q-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93a9dd15-d593-4dcb-bf89-401618ca141b	437320c7-d091-4bee-9776-417b93833127	g.chr1:207649619_207649620GA>TC	ENST00000367058.3	+	14	2769_2770	c.2580_2581GA>TC	c.(2578-2583)ggGAac>ggTCac	p.N861H	CR2_ENST00000458541.2_Missense_Mutation_p.N834H|CR2_ENST00000367059.3_Intron|CR2_ENST00000367057.3_Missense_Mutation_p.N920H	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	861	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CCCCTAACGGGAACCATACTGG	0.5																																					p.N920H		.											.	.	.	0			.						.																																			SO:0001583	missense	1380	.			TAACGGGAACCAT	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	Exception_encountered	1.37:g.207649619_207649620delinsTC	ENSP00000356025:p.Asn861His	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	61.0	.	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	DNP	ENST00000367058.3	37	CCDS1478.1																																																																																			.		0.500	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
