#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
A2ML1	144568	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	9020503	9020503	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:9020503G>A	ENST00000299698.7	+	30	3963	c.3783G>A	c.(3781-3783)gaG>gaA	p.E1261E	A2ML1_ENST00000539547.1_Silent_p.E770E	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CATCTGAGGAGATCAACCTGG	0.443																																					p.E1261E		.											.	A2ML1	93	0			c.G3783A						.						128.0	117.0	120.0					12																	9020503		1954	4132	6086	SO:0001819	synonymous_variant	144568	exon30			TGAGGAGATCAAC	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.3783G>A	12.37:g.9020503G>A		Somatic	216.0	2.0		WXS	Illumina HiSeq	Phase_I	244.0	89.0	NM_144670		Silent	SNP	ENST00000299698.7	37	CCDS8596.2																																																																																			.		0.443	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
ABCD2	225	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	39973407	39973407	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:39973407T>A	ENST00000308666.3	-	8	1942	c.1807A>T	c.(1807-1809)Atg>Ttg	p.M603L		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	603	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						TTCCAGTCCATAACAGCATCC	0.328																																					p.M603L		.											.	ABCD2	95	0			c.A1807T						.						158.0	150.0	152.0					12																	39973407		2203	4300	6503	SO:0001583	missense	225	exon8			AGTCCATAACAGC	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1807A>T	12.37:g.39973407T>A	ENSP00000310688:p.Met603Leu	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	36.0	NM_005164	B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	T	11.99	1.803390	0.31869	.	.	ENSG00000173208	ENST00000308666	D	0.99840	-7.08	5.23	1.41	0.22369	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.369037	0.28895	N	0.013793	D	0.96904	0.8989	N	0.01015	-1.05	0.27788	N	0.942933	B	0.02656	0.0	B	0.09377	0.004	D	0.98220	1.0477	9	.	.	.	-11.4561	7.9315	0.29905	0.1275:0.0:0.2665:0.606	.	603	Q9UBJ2	ABCD2_HUMAN	L	603	ENSP00000310688:M603L	.	M	-	1	0	ABCD2	38259674	1.000000	0.71417	0.981000	0.43875	0.994000	0.84299	2.561000	0.45905	0.004000	0.14682	0.472000	0.43445	ATG	.		0.328	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164	
ADAMTS20	80070	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	43769288	43769288	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:43769288A>T	ENST00000389420.3	-	36	5339	c.5340T>A	c.(5338-5340)ttT>ttA	p.F1780L		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1780	GON. {ECO:0000255|PROSITE- ProRule:PRU00383}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TACTCCCATTAAAAGGACATT	0.368																																					p.F1780L		.											.	ADAMTS20	795	0			c.T5340A						.						147.0	147.0	147.0					12																	43769288		2203	4300	6503	SO:0001583	missense	80070	exon36			CCCATTAAAAGGA	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.5340T>A	12.37:g.43769288A>T	ENSP00000374071:p.Phe1780Leu	Somatic	269.0	0.0		WXS	Illumina HiSeq	Phase_I	314.0	16.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	37	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744687	0.49151	.	.	ENSG00000173157	ENST00000389420	T	0.16597	2.33	4.8	-0.635	0.11512	Peptidase M12B, GON-ADAMTSs (2);	0.000000	0.51477	D	0.000084	T	0.27594	0.0678	M	0.75264	2.295	0.80722	D	1	D	0.56035	0.974	P	0.54664	0.758	T	0.06752	-1.0809	10	0.25751	T	0.34	.	10.3787	0.44099	0.5499:0.0:0.4501:0.0	.	1780	P59510	ATS20_HUMAN	L	1780	ENSP00000374071:F1780L	ENSP00000374071:F1780L	F	-	3	2	ADAMTS20	42055555	0.998000	0.40836	0.997000	0.53966	0.398000	0.30690	0.460000	0.21924	-0.163000	0.10946	0.377000	0.23210	TTT	.		0.368	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
ADCY2	108	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	7773143	7773143	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:7773143G>A	ENST00000338316.4	+	18	2402	c.2313G>A	c.(2311-2313)gtG>gtA	p.V771V	ADCY2_ENST00000537121.1_Silent_p.V591V	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	771					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TGGCCTTGGTGGGCTACAACA	0.517																																					p.V771V		.											.	ADCY2	97	0			c.G2313A						.						225.0	193.0	204.0					5																	7773143		2203	4300	6503	SO:0001819	synonymous_variant	108	exon18			CTTGGTGGGCTAC	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2313G>A	5.37:g.7773143G>A		Somatic	382.0	0.0		WXS	Illumina HiSeq	Phase_I	412.0	186.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	ENST00000338316.4	37	CCDS3872.2																																																																																			.		0.517	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ADCY5	111	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	123166600	123166600	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:123166600G>T	ENST00000462833.1	-	1	2005	c.793C>A	c.(793-795)Ccg>Acg	p.P265T		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	265					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.P265T(1)		breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		AGCTGGAGCGGGGGCCGCGCC	0.672																																					p.P265T		.											.	ADCY5	94	1	Substitution - Missense(1)	lung(1)	c.C793A						.						22.0	25.0	24.0					3																	123166600		2198	4292	6490	SO:0001583	missense	111	exon1			GGAGCGGGGGCCG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.793C>A	3.37:g.123166600G>T	ENSP00000419361:p.Pro265Thr	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	17.0	NM_183357	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	ENST00000462833.1	37	CCDS3022.1	.	.	.	.	.	.	.	.	.	.	G	6.211	0.407100	0.11754	.	.	ENSG00000173175	ENST00000462833	T	0.76186	-1.0	4.91	4.0	0.46444	.	0.688433	0.13366	N	0.393306	T	0.65770	0.2723	L	0.44542	1.39	0.47737	D	0.999503	B	0.02656	0.0	B	0.06405	0.002	T	0.55736	-0.8094	10	0.17832	T	0.49	.	12.5467	0.56203	0.0:0.0:0.8331:0.1669	.	265	O95622	ADCY5_HUMAN	T	265	ENSP00000419361:P265T	ENSP00000419361:P265T	P	-	1	0	ADCY5	124649290	0.994000	0.37717	0.948000	0.38648	0.967000	0.64934	2.196000	0.42686	1.005000	0.39183	0.505000	0.49811	CCG	.		0.672	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
ADCY8	114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	131793001	131793001	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:131793001G>A	ENST00000286355.5	-	18	5483	c.3391C>T	c.(3391-3393)Caa>Taa	p.Q1131*	ADCY8_ENST00000377928.3_Nonsense_Mutation_p.Q1000*	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	1131					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TCTGGGACTTGGATCCGGCCA	0.522										HNSCC(32;0.087)																											p.Q1131X		.											.	ADCY8	157	0			c.C3391T						.						134.0	134.0	134.0					8																	131793001		2203	4300	6503	SO:0001587	stop_gained	114	exon18			GGACTTGGATCCG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.3391C>T	8.37:g.131793001G>A	ENSP00000286355:p.Gln1131*	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	35.0	NM_001115		Nonsense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	G	55	23.590000	0.99956	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.0195	0.92908	0.0:0.0:1.0:0.0	.	.	.	.	X	1131;1000	.	ENSP00000286355:Q1131X	Q	-	1	0	ADCY8	131862183	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.869000	0.99810	2.746000	0.94184	0.655000	0.94253	CAA	.		0.522	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
AGBL1	123624	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	86810275	86810275	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr15:86810275A>G	ENST00000441037.2	+	12	1763	c.1668A>G	c.(1666-1668)tcA>tcG	p.S556S	AGBL1_ENST00000389298.3_Silent_p.S287S|AGBL1_ENST00000421325.2_Silent_p.S556S	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	556					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						AATTTGAGTCAGGAAATCTTC	0.423																																					p.S556S		.											.	.	.	0			c.A1668G						.						88.0	79.0	82.0					15																	86810275		1907	4120	6027	SO:0001819	synonymous_variant	123624	exon12			TGAGTCAGGAAAT	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1668A>G	15.37:g.86810275A>G		Somatic	290.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	144.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	ENST00000441037.2	37	CCDS58398.1																																																																																			.		0.423	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
AHCTF1	25909	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	247024552	247024553	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:247024552_247024553insT	ENST00000391829.2	-	29	3903_3904	c.3780_3781insA	c.(3778-3783)aaatgtfs	p.C1261fs	AHCTF1_ENST00000366508.1_Frame_Shift_Ins_p.C1296fs|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Frame_Shift_Ins_p.C1270fs			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1261	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GGAACTGCACATTTTTTAGGTG	0.361																																					p.C1270fs	Colon(145;197 1800 4745 15099 26333)	.											.	AHCTF1	97	0			c.3808_3809insA						.																																			SO:0001589	frameshift_variant	25909	exon29			CTGCACATTTTTT		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3781dupA	1.37:g.247024558_247024558dupT	ENSP00000375705:p.Cys1261fs	Somatic	424.0	0.0		WXS	Illumina HiSeq	Phase_I	903.0	217.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Frame_Shift_Ins	INS	ENST00000391829.2	37																																																																																				.		0.361	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
ANKHD1	54882	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139915024	139915024	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:139915024G>A	ENST00000360839.2	+	30	7082	c.6928G>A	c.(6928-6930)Gga>Aga	p.G2310R	ANKHD1_ENST00000544120.1_Intron|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.G2310R|ANKHD1_ENST00000297183.6_Missense_Mutation_p.G2310R	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2310						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCATACCAGGAACAAGGGT	0.502																																					p.G2310R		.											.	ANKHD1	185	0			c.G6928A						.						104.0	101.0	102.0					5																	139915024		2203	4300	6503	SO:0001583	missense	54882	exon30			ATACCAGGAACAA	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.6928G>A	5.37:g.139915024G>A	ENSP00000354085:p.Gly2310Arg	Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	288.0	115.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.8|28.8	4.952477|4.952477	0.92660|0.92660	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000433049;ENST00000532219;ENST00000437495|ENST00000435794	T;T;T;T;T;T|.	0.74106|.	-0.76;-0.81;1.29;1.29;-0.81;0.27|.	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	0.058131|.	0.64402|.	D|.	0.000002|.	T|T	0.70527|0.70527	0.3234|0.3234	L|L	0.52573|0.52573	1.65|1.65	0.42584|0.42584	D|D	0.99322|0.99322	D;D;D|.	0.71674|.	0.994;0.982;0.998|.	P;P;D|.	0.78314|.	0.865;0.785;0.991|.	T|T	0.67047|0.67047	-0.5769|-0.5769	10|5	0.72032|.	D|.	0.01|.	.|.	19.0911|19.0911	0.93227|0.93227	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2310;2310;2310|.	E9PF56;Q8IWZ2;Q8IWZ3|.	.;.;ANKH1_HUMAN|.	R|K	2310;2310;2310;966;832;2310;321|800	ENSP00000354085:G2310R;ENSP00000297183:G2310R;ENSP00000393204:G966R;ENSP00000390034:G832R;ENSP00000432016:G2310R;ENSP00000396882:G321R|.	ENSP00000396882:G321R|.	G|R	+|+	1|2	0|0	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139895208|139895208	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.179000|8.179000	0.89692|0.89692	2.746000|2.746000	0.94184|0.94184	0.563000|0.563000	0.77884|0.77884	GGA|AGG	.		0.502	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
AP2B1	163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	33925274	33925274	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:33925274A>T	ENST00000262325.7	+	3	616	c.63A>T	c.(61-63)gaA>gaT	p.E21D	AP2B1_ENST00000589344.1_Missense_Mutation_p.E21D|AP2B1_ENST00000592545.1_Missense_Mutation_p.E21D|AP2B1_ENST00000538556.1_5'UTR|AP2B1_ENST00000537622.2_Missense_Mutation_p.E21D|AP2B1_ENST00000312678.8_Missense_Mutation_p.E21D	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	21					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TAAAAGCTGAACTCAACAATG	0.403																																					p.E21D		.											.	AP2B1	91	0			c.A63T						.						94.0	88.0	90.0					17																	33925274		2203	4300	6503	SO:0001583	missense	163	exon3			AGCTGAACTCAAC	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.63A>T	17.37:g.33925274A>T	ENSP00000262325:p.Glu21Asp	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	77.0	NM_001282	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	37	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	A	14.98	2.696408	0.48202	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000537622	T;T;T	0.25085	1.82;1.82;1.82	5.01	-3.25	0.05079	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	L	0.46947	1.48	0.80722	D	1	B;B;B	0.19331	0.035;0.015;0.0	B;B;B	0.33690	0.168;0.063;0.009	T	0.09530	-1.0670	10	0.44086	T	0.13	-9.3327	13.0692	0.59050	0.4582:0.0:0.5418:0.0	.	21;21;21	B4DWG4;P63010;P63010-2	.;AP2B1_HUMAN;.	D	21	ENSP00000262325:E21D;ENSP00000314414:E21D;ENSP00000437413:E21D	ENSP00000262325:E21D	E	+	3	2	AP2B1	30949387	0.997000	0.39634	1.000000	0.80357	0.902000	0.53008	0.438000	0.21559	-0.516000	0.06470	-1.409000	0.01127	GAA	.		0.403	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21228862	21228862	+	Silent	SNP	A	A	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:21228862A>C	ENST00000233242.1	-	26	11005	c.10878T>G	c.(10876-10878)acT>acG	p.T3626T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3626					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTGGTTCTTAGTGTTAGCAT	0.488																																					p.T3626T		.											.	APOB	175	0			c.T10878G						.						60.0	57.0	58.0					2																	21228862		2203	4300	6503	SO:0001819	synonymous_variant	338	exon26			GTTCTTAGTGTTA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.10878T>G	2.37:g.21228862A>C		Somatic	273.0	0.0		WXS	Illumina HiSeq	Phase_I	350.0	115.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.488	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
AQR	9716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	35212596	35212596	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr15:35212596C>A	ENST00000156471.5	-	14	1383	c.1158G>T	c.(1156-1158)ttG>ttT	p.L386F		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	386					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GAGTTGGCAACAAGCAGAGGT	0.333																																					p.L386F		.											.	AQR	135	0			c.G1158T						.						79.0	76.0	77.0					15																	35212596		1829	4088	5917	SO:0001583	missense	9716	exon14			TGGCAACAAGCAG	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1158G>T	15.37:g.35212596C>A	ENSP00000156471:p.Leu386Phe	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	33.0	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261543	0.59431	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.94793	-3.52	5.16	3.09	0.35607	.	0.068279	0.56097	D	0.000024	D	0.94262	0.8157	M	0.68317	2.08	0.48341	D	0.999631	D	0.63046	0.992	P	0.57911	0.829	D	0.92124	0.5706	10	0.44086	T	0.13	-10.9319	3.6009	0.08024	0.1526:0.5579:0.1594:0.13	.	386	O60306	AQR_HUMAN	F	386	ENSP00000156471:L386F	ENSP00000156471:L386F	L	-	3	2	AQR	32999888	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.734000	0.26101	1.368000	0.46115	0.563000	0.77884	TTG	.		0.333	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
ARHGAP22	58504	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	49661391	49661391	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr10:49661391T>C	ENST00000249601.4	-	8	1240	c.944A>G	c.(943-945)aAc>aGc	p.N315S	ARHGAP22_ENST00000374170.1_Missense_Mutation_p.N156S|ARHGAP22_ENST00000435790.2_Missense_Mutation_p.N321S|ARHGAP22_ENST00000417912.2_Missense_Mutation_p.N331S|ARHGAP22_ENST00000374172.1_Missense_Mutation_p.N206S|ARHGAP22_ENST00000477708.2_5'Flank|ARHGAP22_ENST00000417247.2_Missense_Mutation_p.N225S	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	315	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCGCAGAATGTTAGGTCCAAA	0.517																																					p.N331S		.											.	ARHGAP22	228	0			c.A992G						.						155.0	131.0	139.0					10																	49661391		2202	4300	6502	SO:0001583	missense	58504	exon8			AGAATGTTAGGTC	AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.944A>G	10.37:g.49661391T>C	ENSP00000249601:p.Asn315Ser	Somatic	244.0	0.0		WXS	Illumina HiSeq	Phase_I	282.0	17.0	NM_001256024	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Missense_Mutation	SNP	ENST00000249601.4	37	CCDS7227.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.878238	0.91664	.	.	ENSG00000128805	ENST00000249601;ENST00000374172;ENST00000374170;ENST00000417247;ENST00000435790;ENST00000417912	T;T;T;T;T;T	0.41400	2.78;1.0;2.78;2.78;2.78;1.0	5.37	5.37	0.77165	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	L	0.52823	1.66	0.80722	D	1	P;D;D;D;P	0.71674	0.944;0.998;0.998;0.998;0.931	D;D;D;D;P	0.76071	0.968;0.98;0.987;0.98;0.881	T	0.58769	-0.7578	10	0.45353	T	0.12	.	14.5586	0.68120	0.0:0.0:0.0:1.0	.	321;315;331;315;225	B4DED8;A6NDI7;Q7Z5H3-2;Q7Z5H3;Q7Z5H3-3	.;.;.;RHG22_HUMAN;.	S	315;206;156;225;321;331	ENSP00000249601:N315S;ENSP00000363287:N206S;ENSP00000363285:N156S;ENSP00000410054:N225S;ENSP00000416701:N321S;ENSP00000412461:N331S	ENSP00000249601:N315S	N	-	2	0	ARHGAP22	49331397	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	7.871000	0.87180	2.036000	0.60181	0.519000	0.50382	AAC	.		0.517	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000358767.1	NM_021226	
ARHGAP33	115703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	36278140	36278140	+	Silent	SNP	G	G	A	rs200811520	byFrequency	TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:36278140G>A	ENST00000007510.4	+	21	2817	c.2673G>A	c.(2671-2673)ccG>ccA	p.P891P	ARHGAP33_ENST00000314737.5_Silent_p.P730P|AC002398.5_ENST00000433059.1_lincRNA|ARHGAP33_ENST00000378944.5_Silent_p.P755P			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	891	Poly-Pro.				protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CCCCACCCCCGCCCCCTAAGA	0.657													G|||	3	0.000599042	0.0	0.0014	5008	,	,		10874	0.001		0.001	False		,,,				2504	0.0				p.P755P		.											.	ARHGAP33	229	0			c.G2265A						.	G	,	0,4308		0,0,2154	16.0	22.0	20.0		2265,2190	-9.3	0.6	19		20	1,8387		0,1,4193	no	coding-synonymous,coding-synonymous	ARHGAP33	NM_001172630.1,NM_052948.3	,	0,1,6347	AA,AG,GG		0.0119,0.0,0.0079	,	755/1124,730/1127	36278140	1,12695	2154	4194	6348	SO:0001819	synonymous_variant	115703	exon20			ACCCCCGCCCCCT	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.2673G>A	19.37:g.36278140G>A		Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	30.0	NM_001172630	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Silent	SNP	ENST00000007510.4	37																																																																																				G|0.999;A|0.000		0.657	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
ARL8A	127829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	202104642	202104642	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:202104642C>G	ENST00000272217.2	-	5	553	c.385G>C	c.(385-387)Ggt>Cgt	p.G129R	ARL8A_ENST00000486225.1_5'UTR	NM_001256129.1|NM_138795.3	NP_001243058.1|NP_620150.1	Q96BM9	ARL8A_HUMAN	ADP-ribosylation factor-like 8A	129					chromosome segregation (GO:0007059)|GTP catabolic process (GO:0006184)|mitotic nuclear division (GO:0007067)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|midbody (GO:0030496)|spindle midzone (GO:0051233)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(2)|ovary(2)|skin(1)	6						CGCTTGTTACCCAGGACTAAG	0.552											OREG0012976	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G129R		.											.	ARL8A	229	0			c.G385C						.						132.0	132.0	132.0					1																	202104642		2203	4300	6503	SO:0001583	missense	127829	exon5			TGTTACCCAGGAC	BC015408	CCDS1421.1, CCDS73004.1	1q32.1	2014-05-09	2005-11-03	2005-11-03	ENSG00000143862	ENSG00000143862		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25192	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10B"""	ARL10B		8889548	Standard	NM_001256129		Approved	FLJ45195, Gie2	uc001gxk.2	Q96BM9	OTTHUMG00000035923	ENST00000272217.2:c.385G>C	1.37:g.202104642C>G	ENSP00000272217:p.Gly129Arg	Somatic	114.0	0.0	2126	WXS	Illumina HiSeq	Phase_I	155.0	40.0	NM_138795	B3KXD0	Missense_Mutation	SNP	ENST00000272217.2	37	CCDS1421.1	.	.	.	.	.	.	.	.	.	.	C	31	5.092006	0.94149	.	.	ENSG00000143862	ENST00000272217	D	0.84070	-1.8	5.06	5.06	0.68205	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95040	0.8394	H	0.98629	4.285	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97249	0.9896	10	0.87932	D	0	-36.1721	18.4214	0.90591	0.0:1.0:0.0:0.0	.	129	Q96BM9	ARL8A_HUMAN	R	129	ENSP00000272217:G129R	ENSP00000272217:G129R	G	-	1	0	ARL8A	200371265	1.000000	0.71417	0.997000	0.53966	0.883000	0.51084	7.606000	0.82863	2.334000	0.79466	0.305000	0.20034	GGT	.		0.552	ARL8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087493.1	NM_138795	
ASB6	140459	ucsc.edu;bcgsc.ca	37	9	132400355	132400355	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:132400355T>C	ENST00000277458.4	-	6	1145	c.980A>G	c.(979-981)gAg>gGg	p.E327G	RP11-483H20.4_ENST00000455074.1_RNA|ASB6_ENST00000277459.4_3'UTR|ASB6_ENST00000450050.2_Missense_Mutation_p.E248G	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	327					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				CAGGACAGTCTCAGCTTTGCG	0.577																																					p.E327G		.											.	ASB6	226	0			c.A980G						.						103.0	97.0	99.0					9																	132400355		2203	4300	6503	SO:0001583	missense	140459	exon6			ACAGTCTCAGCTT		CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.980A>G	9.37:g.132400355T>C	ENSP00000277458:p.Glu327Gly	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_017873	Q5SZB7|Q9BV15	Missense_Mutation	SNP	ENST00000277458.4	37	CCDS6924.1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.549768	0.45383	.	.	ENSG00000148331	ENST00000277458;ENST00000450050	T;T	0.73152	-0.72;0.47	5.06	5.06	0.68205	.	0.049881	0.85682	D	0.000000	T	0.68860	0.3047	L	0.29908	0.895	0.80722	D	1	D;D;D	0.54047	0.964;0.964;0.964	P;P;P	0.52672	0.706;0.637;0.637	T	0.69262	-0.5191	10	0.39692	T	0.17	-28.6013	14.1367	0.65291	0.0:0.0:0.0:1.0	.	248;327;327	B4DRC4;A8K9U2;Q9NWX5	.;.;ASB6_HUMAN	G	327;248	ENSP00000277458:E327G;ENSP00000416172:E248G	ENSP00000277458:E327G	E	-	2	0	ASB6	131440176	1.000000	0.71417	0.997000	0.53966	0.276000	0.26787	7.051000	0.76627	2.128000	0.65567	0.379000	0.24179	GAG	.		0.577	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054594.1	NM_017873	
ATL1	51062	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	51087446	51087446	+	Splice_Site	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr14:51087446T>A	ENST00000358385.6	+	9	1231		c.e9+2		ATL1_ENST00000441560.2_Splice_Site|ATL1_ENST00000354525.4_Splice_Site|ATL1_ENST00000357032.3_Splice_Site	NM_015915.4	NP_056999.2	Q8WXF7	ATLA1_HUMAN	atlastin GTPase 1						axonogenesis (GO:0007409)|cell death (GO:0008219)|endoplasmic reticulum organization (GO:0007029)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi cis cisterna (GO:0000137)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(3)	18						TACTTCAAGGTATCACTCTCA	0.388																																					.		.											.	ATL1	93	0			c.990+2T>A						.						104.0	113.0	110.0					14																	51087446		2203	4300	6503	SO:0001630	splice_region_variant	51062	exon10			TCAAGGTATCACT	AF131801	CCDS9700.1, CCDS32077.1	14q21.3	2014-09-17	2008-09-17	2008-09-17	ENSG00000198513	ENSG00000198513			11231	protein-coding gene	gene with protein product	"""atlastin"""	606439	"""spastic paraplegia 3A (autosomal dominant)"""	SPG3, SPG3A		8252041, 7825576	Standard	NM_015915		Approved	FSP1, AD-FSP	uc001wyd.4	Q8WXF7	OTTHUMG00000140297	ENST00000358385.6:c.990+2T>A	14.37:g.51087446T>A		Somatic	120.0	1.0		WXS	Illumina HiSeq	Phase_I	94.0	45.0	NM_001127713	A6NND5|A8K2C0|G5E9T1|O95890|Q69YH7|Q96FK0	Splice_Site	SNP	ENST00000358385.6	37	CCDS9700.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.426973	0.83667	.	.	ENSG00000198513	ENST00000441560;ENST00000358385;ENST00000357032;ENST00000354525	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2194	0.73299	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATL1	50157196	1.000000	0.71417	0.997000	0.53966	0.877000	0.50540	8.040000	0.89188	2.194000	0.70268	0.533000	0.62120	.	.		0.388	ATL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276884.2		Intron
ATP13A5	344905	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	193028474	193028474	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:193028474C>A	ENST00000342358.4	-	21	2595	c.2478G>T	c.(2476-2478)atG>atT	p.M826I	ATP13A5_ENST00000495496.1_5'UTR|ATP13A5-AS1_ENST00000414634.1_RNA	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	826						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GCCCAGGAGACATTCTTGCAA	0.343																																					p.M826I		.											.	ATP13A5	144	0			c.G2478T						.						107.0	99.0	102.0					3																	193028474		2203	4300	6503	SO:0001583	missense	344905	exon21			AGGAGACATTCTT	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2478G>T	3.37:g.193028474C>A	ENSP00000341942:p.Met826Ile	Somatic	154.0	0.0		WXS	Illumina HiSeq	Phase_I	167.0	10.0	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916650	0.92249	.	.	ENSG00000187527	ENST00000342358	T	0.64991	-0.13	5.56	5.56	0.83823	HAD-like domain (2);	0.056781	0.64402	D	0.000001	T	0.77751	0.4177	M	0.85373	2.75	0.52501	D	0.99995	P	0.52316	0.952	P	0.54664	0.758	T	0.80750	-0.1243	10	0.62326	D	0.03	-30.5217	17.3696	0.87372	0.0:1.0:0.0:0.0	.	826	Q4VNC0	AT135_HUMAN	I	826	ENSP00000341942:M826I	ENSP00000341942:M826I	M	-	3	0	ATP13A5	194511168	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.414000	0.73318	2.778000	0.95560	0.655000	0.94253	ATG	.		0.343	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
ATP4A	495	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36047867	36047867	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:36047867G>A	ENST00000262623.3	-	12	1845	c.1817C>T	c.(1816-1818)cCc>cTc	p.P606L		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	606					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	GGTGGCCCGGGGTGGGTCAAT	0.592																																					p.P606L		.											.	ATP4A	91	0			c.C1817T						.						67.0	63.0	64.0					19																	36047867		2203	4300	6503	SO:0001583	missense	495	exon12			GCCCGGGGTGGGT		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1817C>T	19.37:g.36047867G>A	ENSP00000262623:p.Pro606Leu	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	10.0	NM_000704	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973527	0.92919	.	.	ENSG00000105675	ENST00000262623	D	0.95272	-3.66	4.93	4.93	0.64822	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.64402	D	0.000005	D	0.96990	0.9017	M	0.79011	2.435	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97432	1.0016	10	0.87932	D	0	.	15.671	0.77274	0.0:0.0:1.0:0.0	.	606	P20648	ATP4A_HUMAN	L	606	ENSP00000262623:P606L	ENSP00000262623:P606L	P	-	2	0	ATP4A	40739707	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.623000	0.98386	2.562000	0.86427	0.591000	0.81541	CCC	.		0.592	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109470.2	NM_000704	
ATP5EP2	432369	ucsc.edu;mdanderson.org	37	13	28519559	28519559	+	3'UTR	SNP	C	C	G	rs192325513		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr13:28519559C>G	ENST00000381026.3	+	0	217							Q5VTU8	AT5EL_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit pseudogene 2						ATP synthesis coupled proton transport (GO:0015986)	mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			ovary(1)	1						ATAATCTACCCTGACTAAAGC	0.378																																					.		.											.	ATP5EP2	1	0			.						.																																			SO:0001624	3_prime_UTR_variant	432369	.			TCTACCCTGACTA	EC567419		13q12	2008-10-21			ENSG00000180389	ENSG00000180389			34026	pseudogene	pseudogene							Standard	NR_002162		Approved		uc001uru.3	Q5VTU8	OTTHUMG00000016642	ENST00000381026.3:c.*7C>G	13.37:g.28519559C>G		Somatic	331.0	0.0		WXS	Illumina HiSeq	.	318.0	250.0	.		RNA	SNP	ENST00000381026.3	37																																																																																				C|0.999;T|0.000		0.378	ATP5EP2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000044314.1	NR_002162	
ATP6AP1	537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153657461	153657461	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:153657461T>A	ENST00000369762.2	+	2	290	c.229T>A	c.(229-231)Tac>Aac	p.Y77N		NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	77					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTCTCTACCTACTTAGATCC	0.642																																					p.Y77N		.											.	ATP6AP1	138	0			c.T229A						.						103.0	91.0	95.0					X																	153657461		2203	4300	6503	SO:0001583	missense	537	exon2			TCTACCTACTTAG	D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.229T>A	X.37:g.153657461T>A	ENSP00000358777:p.Tyr77Asn	Somatic	268.0	0.0		WXS	Illumina HiSeq	Phase_I	197.0	33.0	NM_001183	A6ZKI4|Q8NBT4|Q9H0C7	Missense_Mutation	SNP	ENST00000369762.2	37	CCDS35451.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517895	0.85495	.	.	ENSG00000071553	ENST00000369762;ENST00000422890;ENST00000449556	.	.	.	4.74	4.74	0.60224	.	0.187498	0.48286	D	0.000196	T	0.71995	0.3406	M	0.72894	2.215	0.42659	D	0.993473	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.74160	-0.3755	9	0.56958	D	0.05	-16.6308	9.7389	0.40406	0.0:0.0:0.0:1.0	.	37;77	B3KR70;Q15904	.;VAS1_HUMAN	N	77	.	ENSP00000358777:Y77N	Y	+	1	0	ATP6AP1	153310655	1.000000	0.71417	0.965000	0.40720	0.845000	0.48019	3.303000	0.51858	1.560000	0.49568	0.430000	0.28490	TAC	.		0.642	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081639.4	NM_001183	
ATRNL1	26033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	117607492	117607492	+	Silent	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr10:117607492T>A	ENST00000355044.3	+	28	4134	c.4008T>A	c.(4006-4008)ccT>ccA	p.P1336P	ATRNL1_ENST00000303745.7_Silent_p.P129P|ATRNL1_ENST00000423111.2_Silent_p.P387P	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1336					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CCCCTCCCCCTGGGCAGTCAG	0.468																																					p.P1336P		.											.	ATRNL1	96	0			c.T4008A						.						97.0	87.0	90.0					10																	117607492		2203	4300	6503	SO:0001819	synonymous_variant	26033	exon28			TCCCCCTGGGCAG	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.4008T>A	10.37:g.117607492T>A		Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	229.0	70.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	CCDS7592.1																																																																																			.		0.468	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
BTBD6	90135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105716439	105716439	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr14:105716439C>T	ENST00000392554.3	+	4	1185	c.888C>T	c.(886-888)ggC>ggT	p.G296G	BRF1_ENST00000446501.2_5'Flank|BTBD6_ENST00000536364.1_Silent_p.G296G|BRF1_ENST00000440513.3_Intron|BRF1_ENST00000327359.3_Intron|BRF1_ENST00000379937.2_Intron|BRF1_ENST00000392557.4_5'Flank|BRF1_ENST00000546474.1_Intron|BRF1_ENST00000551787.1_5'Flank|BTBD6_ENST00000463376.2_Silent_p.G221G|BTBD6_ENST00000327471.3_Silent_p.G221G|BRF1_ENST00000379932.4_5'Flank			Q96KE9	BTBD6_HUMAN	BTB (POZ) domain containing 6	296						cytoplasm (GO:0005737)				endometrium(1)|lung(3)	4		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.0163)|Epithelial(46;0.0391)	Epithelial(152;0.18)		TTGCCAACGGCGCTGCCCAGT	0.587																																					p.G296G		.											.	BTBD6	90	0			c.C888T						.						66.0	73.0	71.0					14																	105716439		2203	4300	6503	SO:0001819	synonymous_variant	90135	exon5			CAACGGCGCTGCC	AF353674	CCDS10002.1, CCDS10002.2	14q32.33	2013-01-08			ENSG00000184887	ENSG00000184887		"""BTB/POZ domain containing"""	19897	protein-coding gene	gene with protein product							Standard	NM_033271		Approved	BDPL	uc010tyq.2	Q96KE9	OTTHUMG00000029887	ENST00000392554.3:c.888C>T	14.37:g.105716439C>T		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	25.0	NM_033271	Q8IVQ7|Q9BR94	Silent	SNP	ENST00000392554.3	37	CCDS10002.2																																																																																			.		0.587	BTBD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074556.4		
BZW1	9689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	201677965	201677965	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:201677965C>T	ENST00000409600.1	+	2	480	c.25C>T	c.(25-27)Cca>Tca	p.P9S	BZW1_ENST00000409226.1_Missense_Mutation_p.P13S|BZW1_ENST00000452790.2_Missense_Mutation_p.P41S|AC007163.6_ENST00000447972.3_RNA	NM_001207067.1|NM_014670.3	NP_001193996.1|NP_055485.2	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(1)|lung(2)	6						GCAGCAAAAGCCAACGCTATC	0.338																																					p.P41S		.											.	BZW1	90	0			c.C121T						.						83.0	78.0	80.0					2																	201677965		1844	4081	5925	SO:0001583	missense	9689	exon2			CAAAAGCCAACGC	D13630	CCDS56154.1, CCDS56155.1, CCDS56156.1	2q33	2010-04-09			ENSG00000082153	ENSG00000082153			18380	protein-coding gene	gene with protein product						10964520, 11524015	Standard	NM_001207067		Approved	BZAP45, KIAA0005	uc021vus.1	Q7L1Q6	OTTHUMG00000154560	ENST00000409600.1:c.25C>T	2.37:g.201677965C>T	ENSP00000386474:p.Pro9Ser	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	117.0	62.0	NM_001207068	B4DLZ8|B4DWF7|Q14281|Q15394|Q9BUY0	Missense_Mutation	SNP	ENST00000409600.1	37	CCDS56156.1	.	.	.	.	.	.	.	.	.	.	C	32	5.140318	0.94560	.	.	ENSG00000082153	ENST00000450637;ENST00000452206;ENST00000410110;ENST00000409600;ENST00000409226;ENST00000452790;ENST00000447069;ENST00000419090	T;T;T;D;D;D;T;T	0.94330	-1.03;-1.14;-1.42;-3.17;-3.24;-3.4;-1.11;-1.07	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	D	0.97213	0.9089	M	0.88310	2.945	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.98027	1.0374	10	0.72032	D	0.01	-13.5255	18.166	0.89727	0.0:1.0:0.0:0.0	.	13;41;9	B4DWF7;B4DLZ8;Q7L1Q6	.;.;BZW1_HUMAN	S	9;9;9;9;13;41;13;9	ENSP00000412072:P9S;ENSP00000390766:P9S;ENSP00000387086:P9S;ENSP00000386474:P9S;ENSP00000386837:P13S;ENSP00000394316:P41S;ENSP00000393587:P13S;ENSP00000407268:P9S	ENSP00000386837:P13S	P	+	1	0	BZW1	201386210	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.580000	0.82523	2.360000	0.80028	0.555000	0.69702	CCA	.		0.338	BZW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335975.1	NM_014670	
C16orf96	342346	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	4641701	4641701	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr16:4641701A>T	ENST00000444310.4	+	10	2627	c.2627A>T	c.(2626-2628)gAa>gTa	p.E876V		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						TTGAAGAAAGAAATGGAAGAG	0.502																																					p.E876V		.											.	.	.	0			c.A2627T						.						122.0	116.0	118.0					16																	4641701		692	1591	2283	SO:0001583	missense	342346	exon10			AGAAAGAAATGGA		CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2627A>T	16.37:g.4641701A>T	ENSP00000415027:p.Glu876Val	Somatic	264.0	0.0		WXS	Illumina HiSeq	Phase_I	338.0	52.0	NM_001145011		Missense_Mutation	SNP	ENST00000444310.4	37	CCDS53986.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.389201	0.25118	.	.	ENSG00000205832	ENST00000444310	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	T	0.30510	0.0767	N	0.08118	0	0.23243	N	0.998055	D	0.64830	0.994	P	0.57776	0.827	T	0.09618	-1.0666	8	0.14656	T	0.56	.	10.7142	0.46002	1.0:0.0:0.0:0.0	.	876	A6NNT2	CP096_HUMAN	V	876	.	ENSP00000415027:E876V	E	+	2	0	C16orf96	4581702	0.997000	0.39634	0.572000	0.28498	0.214000	0.24535	4.132000	0.57977	1.798000	0.52647	0.459000	0.35465	GAA	.		0.502	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432384.1	NM_001145011	
C5orf28	64417	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	43446540	43446540	+	Silent	SNP	A	A	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:43446540A>C	ENST00000500337.2	-	5	763	c.432T>G	c.(430-432)ctT>ctG	p.L144L	C5orf28_ENST00000511525.1_5'UTR|C5orf28_ENST00000510130.1_Silent_p.L42L|C5orf28_ENST00000512085.1_Silent_p.L144L|C5orf28_ENST00000397080.3_Silent_p.L144L|C5orf28_ENST00000537319.1_Silent_p.L13L			Q0VDI3	CE028_HUMAN	chromosome 5 open reading frame 28	144						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(5)	9	Lung NSC(6;2.07e-05)					ACATCCAGGGAAGAAAGCACC	0.423																																					p.L144L		.											.	C5orf28	90	0			c.T432G						.						110.0	102.0	105.0					5																	43446540		2203	4300	6503	SO:0001819	synonymous_variant	64417	exon3			CCAGGGAAGAAAG	AK025310	CCDS3945.1	5p12	2011-01-25			ENSG00000151881	ENSG00000151881			26139	protein-coding gene	gene with protein product						12477932	Standard	NM_022483		Approved	FLJ21657	uc003jny.3	Q0VDI3	OTTHUMG00000131150	ENST00000500337.2:c.432T>G	5.37:g.43446540A>C		Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	214.0	13.0	NM_022483	B2RDA6|Q9H6Z2	Silent	SNP	ENST00000500337.2	37	CCDS3945.1																																																																																			.		0.423	C5orf28-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368003.1	NM_022483	
C6orf57	135154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	71298368	71298368	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:71298368G>C	ENST00000370474.3	+	3	292	c.268G>C	c.(268-270)Ggc>Cgc	p.G90R		NM_145267.2	NP_660310.2	Q5VUM1	SDHF4_HUMAN	chromosome 6 open reading frame 57	90					innate immune response (GO:0045087)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)				kidney(1)|lung(1)|skin(1)	3						TGGACCCAGGGGCCCAGAACC	0.393																																					p.G90R		.											.	C6orf57	90	0			c.G268C						.						79.0	87.0	84.0					6																	71298368		2203	4300	6503	SO:0001583	missense	135154	exon3			CCCAGGGGCCCAG	BC018085	CCDS4972.1	6q12	2011-12-13			ENSG00000154079	ENSG00000154079			20957	protein-coding gene	gene with protein product							Standard	NM_145267		Approved		uc003pfq.1	Q5VUM1	OTTHUMG00000014992	ENST00000370474.3:c.268G>C	6.37:g.71298368G>C	ENSP00000359505:p.Gly90Arg	Somatic	262.0	0.0		WXS	Illumina HiSeq	Phase_I	281.0	120.0	NM_145267	E1P532	Missense_Mutation	SNP	ENST00000370474.3	37	CCDS4972.1	.	.	.	.	.	.	.	.	.	.	G	33	5.269293	0.95429	.	.	ENSG00000154079	ENST00000370474	T	0.57907	0.37	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.72112	0.3420	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74093	-0.3776	10	0.87932	D	0	-20.4851	19.3381	0.94329	0.0:0.0:1.0:0.0	.	90	Q5VUM1	CF057_HUMAN	R	90	ENSP00000359505:G90R	ENSP00000359505:G90R	G	+	1	0	C6orf57	71355089	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.894000	0.92506	2.854000	0.98071	0.655000	0.94253	GGC	.		0.393	C6orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041140.1	NM_145267	
CDH6	1004	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	31297484	31297484	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:31297484A>G	ENST00000265071.2	+	4	877	c.612A>G	c.(610-612)ggA>ggG	p.G204G	CDH6_ENST00000514738.1_Silent_p.G149G	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	204	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTCTACAGGGACAGCCCTATT	0.378																																					p.G204G		.											.	CDH6	159	0			c.A612G						.						132.0	122.0	125.0					5																	31297484		2203	4300	6503	SO:0001819	synonymous_variant	1004	exon4			ACAGGGACAGCCC	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.612A>G	5.37:g.31297484A>G		Somatic	220.0	1.0		WXS	Illumina HiSeq	Phase_I	294.0	124.0	NM_004932	A8K5H5|Q9BWS0	Silent	SNP	ENST00000265071.2	37	CCDS3894.1																																																																																			.		0.378	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207355.2	NM_004932	
CDK14	5218	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	90355912	90355912	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:90355912G>T	ENST00000380050.3	+	3	286	c.155G>T	c.(154-156)tGc>tTc	p.C52F	CDK14_ENST00000406263.1_Missense_Mutation_p.C6F|CDK14_ENST00000496279.1_3'UTR|CDK14_ENST00000265741.3_Missense_Mutation_p.C34F|CDK14_ENST00000436577.2_5'UTR			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	52					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						ACACGGAACTGCCAGGGAATG	0.388																																					p.C34F	GBM(83;1228 1256 8311 16577 31299)	.											.	CDK14	970	0			c.G101T						.						88.0	80.0	83.0					7																	90355912		2203	4300	6503	SO:0001583	missense	5218	exon2			GGAACTGCCAGGG		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.155G>T	7.37:g.90355912G>T	ENSP00000369390:p.Cys52Phe	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	11.0	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	37		.	.	.	.	.	.	.	.	.	.	G	12.12	1.842206	0.32513	.	.	ENSG00000058091	ENST00000449528;ENST00000446224;ENST00000430760;ENST00000456689;ENST00000380050;ENST00000446790;ENST00000265741;ENST00000406263	T;T;T;T;T;T;T	0.70282	1.97;1.97;1.97;1.97;-0.46;-0.47;-0.45	5.72	4.84	0.62591	.	0.112528	0.64402	D	0.000008	T	0.54481	0.1861	L	0.27053	0.805	0.80722	D	1	B;B	0.25667	0.131;0.08	B;B	0.19148	0.024;0.016	T	0.50432	-0.8829	10	0.09338	T	0.73	-9.1952	14.4616	0.67453	0.0703:0.0:0.9297:0.0	.	34;52	O94921-2;O94921	.;CDK14_HUMAN	F	6;6;6;6;52;6;34;6	ENSP00000393616:C6F;ENSP00000410770:C6F;ENSP00000394570:C6F;ENSP00000406848:C6F;ENSP00000369390:C52F;ENSP00000265741:C34F;ENSP00000385034:C6F	ENSP00000265741:C34F	C	+	2	0	CDK14	90193848	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.075000	0.76798	1.427000	0.47276	0.563000	0.77884	TGC	.		0.388	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
CHAC1	79094	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	15	41247963	41247963	+	Silent	SNP	G	G	A	rs147315683	byFrequency	TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr15:41247963G>A	ENST00000446533.3	+	3	1095	c.786G>A	c.(784-786)gcG>gcA	p.A262A	CHAC1_ENST00000444189.2_Silent_p.A217A|CHAC1_ENST00000487220.1_Silent_p.A35A	NM_001142776.1|NM_024111.3	NP_001136248.1|NP_077016.2	Q9BUX1	CHAC1_HUMAN	ChaC, cation transport regulator homolog 1 (E. coli)	262					intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein processing (GO:0010955)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|trans-Golgi network (GO:0005802)	Notch binding (GO:0005112)			endometrium(1)|large_intestine(1)|skin(1)	3		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)		AGGCTCTGGCGCTGGTGTGAG	0.662													G|||	2	0.000399361	0.0015	0.0	5008	,	,		18633	0.0		0.0	False		,,,				2504	0.0				p.A262A		.											.	CHAC1	90	0			c.G786A						.	G	,	6,4398		0,6,2196	19.0	19.0	19.0		651,786	-10.0	0.7	15	dbSNP_134	19	0,8590		0,0,4295	no	coding-synonymous,coding-synonymous	CHAC1	NM_001142776.1,NM_024111.3	,	0,6,6491	AA,AG,GG		0.0,0.1362,0.0462	,	217/220,262/265	41247963	6,12988	2202	4295	6497	SO:0001819	synonymous_variant	79094	exon3			TCTGGCGCTGGTG	BC019625	CCDS10070.2, CCDS45233.1	15q15.1	2013-09-12	2006-09-12		ENSG00000128965	ENSG00000128965			28680	protein-coding gene	gene with protein product	"""gamma-GCT acting on glutathione homolog 1"""	614587	"""ChaC, cation transport regulator-like 1 (E. coli)"""			23070364	Standard	NM_024111		Approved	MGC4504	uc001znh.2	Q9BUX1	OTTHUMG00000130208	ENST00000446533.3:c.786G>A	15.37:g.41247963G>A		Somatic	18.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	9.0	NM_024111	Q0VIA0	Silent	SNP	ENST00000446533.3	37	CCDS10070.2																																																																																			G|0.999;A|0.001		0.662	CHAC1-001	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252526.3	NM_024111	
CHD6	84181	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	40049753	40049753	+	Missense_Mutation	SNP	T	T	A	rs140430642	byFrequency	TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr20:40049753T>A	ENST00000373233.3	-	31	5699	c.5522A>T	c.(5521-5523)gAt>gTt	p.D1841V		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1841					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TAATTGCTGATCTGATGACAG	0.383																																					p.D1841V		.											.	CHD6	238	0			c.A5522T						.						104.0	116.0	112.0					20																	40049753		2201	4300	6501	SO:0001583	missense	84181	exon31			TGCTGATCTGATG	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.5522A>T	20.37:g.40049753T>A	ENSP00000362330:p.Asp1841Val	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	54.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	T	14.39	2.521344	0.44866	.	.	ENSG00000124177	ENST00000373233	D	0.87103	-2.21	5.82	5.82	0.92795	.	0.317824	0.27060	N	0.021139	T	0.81009	0.4734	L	0.27053	0.805	0.80722	D	1	B	0.27559	0.181	B	0.24974	0.057	T	0.79502	-0.1777	10	0.72032	D	0.01	-6.9308	14.755	0.69557	0.0:0.0:0.0:1.0	.	1841	Q8TD26	CHD6_HUMAN	V	1841	ENSP00000362330:D1841V	ENSP00000362330:D1841V	D	-	2	0	CHD6	39483167	1.000000	0.71417	0.733000	0.30861	0.996000	0.88848	3.292000	0.51772	2.222000	0.72286	0.533000	0.62120	GAT	T|1.000;C|0.000		0.383	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
CHPF	79586	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	220404778	220404778	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:220404778C>T	ENST00000243776.6	-	4	1903	c.1655G>A	c.(1654-1656)cGc>cAc	p.R552H	CHPF_ENST00000535926.1_Missense_Mutation_p.R390H	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	552	Ala-rich.				carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CTGGGCCTGGCGCGGCTCATA	0.677																																					p.R552H		.											.	CHPF	90	0			c.G1655A						.						16.0	18.0	17.0					2																	220404778		2198	4293	6491	SO:0001583	missense	79586	exon4			GCCTGGCGCGGCT	BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1655G>A	2.37:g.220404778C>T	ENSP00000243776:p.Arg552His	Somatic	55.0	1.0		WXS	Illumina HiSeq	Phase_I	33.0	13.0	NM_024536	B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	ENST00000243776.6	37	CCDS2443.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995905	0.35226	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15952	2.38;2.38	4.72	3.83	0.44106	.	0.162049	0.43110	D	0.000604	T	0.12732	0.0309	N	0.14661	0.345	0.32791	N	0.501139	D	0.55800	0.973	P	0.53760	0.734	T	0.05716	-1.0868	10	0.15066	T	0.55	-21.5731	6.0453	0.19755	0.3267:0.5791:0.0:0.0942	.	552	Q8IZ52	CHSS2_HUMAN	H	552;390	ENSP00000243776:R552H;ENSP00000445571:R390H	ENSP00000243776:R552H	R	-	2	0	CHPF	220113022	0.997000	0.39634	0.997000	0.53966	0.685000	0.39939	3.167000	0.50793	2.619000	0.88677	0.561000	0.74099	CGC	.		0.677	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130268.1	NM_024536	
CLEC1B	51266	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	10150973	10150973	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:10150973G>T	ENST00000298527.6	-	2	250	c.71C>A	c.(70-72)tCt>tAt	p.S24Y	CLEC1B_ENST00000348658.4_Intron|CLEC1B_ENST00000428126.2_Intron	NM_016509.3	NP_057593.3	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B	24			S -> P (in dbSNP:rs2273986). {ECO:0000269|PubMed:12975309}.		cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|platelet formation (GO:0030220)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(12)|stomach(1)|urinary_tract(1)	19						GGAGGATGCAGAGCCAACTGT	0.562																																					p.S24Y		.											.	CLEC1B	90	0			c.C71A						.						87.0	94.0	91.0					12																	10150973		2104	4214	6318	SO:0001583	missense	51266	exon2			GATGCAGAGCCAA	AF124841	CCDS41751.1, CCDS41752.1	12p13.31	2006-04-12				ENSG00000165682		"""C-type lectin domain containing"""	24356	protein-coding gene	gene with protein product		606783				10671229, 11745369	Standard	NM_016509		Approved	CLEC2	uc001qwu.3	Q9P126		ENST00000298527.6:c.71C>A	12.37:g.10150973G>T	ENSP00000298527:p.Ser24Tyr	Somatic	238.0	0.0		WXS	Illumina HiSeq	Phase_I	244.0	11.0	NM_016509	Q6UWX7|Q8NHR6	Missense_Mutation	SNP	ENST00000298527.6	37	CCDS41752.1	.	.	.	.	.	.	.	.	.	.	G	8.645	0.896920	0.17686	.	.	ENSG00000165682	ENST00000298527	T	0.01505	4.82	4.37	3.47	0.39725	.	0.126684	0.36101	N	0.002786	T	0.01976	0.0062	L	0.34521	1.04	0.19945	N	0.999948	B	0.20550	0.046	B	0.22601	0.04	T	0.41945	-0.9480	10	0.72032	D	0.01	.	9.6983	0.40171	0.0:0.0:0.7925:0.2075	.	24	Q9P126	CLC1B_HUMAN	Y	24	ENSP00000298527:S24Y	ENSP00000298527:S24Y	S	-	2	0	CLEC1B	10042240	0.005000	0.15991	0.003000	0.11579	0.001000	0.01503	1.506000	0.35747	0.809000	0.34255	-0.856000	0.03024	TCT	.		0.562	CLEC1B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399922.1	NM_016509	
CNKSR2	22866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	21550127	21550127	+	Silent	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:21550127T>C	ENST00000379510.3	+	11	1281	c.1245T>C	c.(1243-1245)taT>taC	p.Y415Y	CNKSR2_ENST00000425654.2_Silent_p.Y415Y|CNKSR2_ENST00000485012.1_3'UTR|CNKSR2_ENST00000543067.1_Silent_p.Y366Y|CNKSR2_ENST00000279451.4_Silent_p.Y415Y	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	415	DUF1170.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						TATATTGCTATGAATATGAAA	0.338																																					p.Y415Y		.											.	CNKSR2	625	0			c.T1245C						.						93.0	89.0	90.0					X																	21550127		2202	4299	6501	SO:0001819	synonymous_variant	22866	exon11			TTGCTATGAATAT	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.1245T>C	X.37:g.21550127T>C		Somatic	354.0	0.0		WXS	Illumina HiSeq	Phase_I	346.0	66.0	NM_001168647	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	ENST00000379510.3	37	CCDS14198.1																																																																																			.		0.338	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
COL28A1	340267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	7571014	7571014	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:7571014C>T	ENST00000399429.3	-	3	786	c.646G>A	c.(646-648)Gat>Aat	p.D216N		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	216	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		AGGGTTGGATCACTCAACAGT	0.363																																					p.D216N		.											.	COL28A1	93	0			c.G646A						.						78.0	71.0	73.0					7																	7571014		1841	4087	5928	SO:0001583	missense	340267	exon3			TTGGATCACTCAA	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.646G>A	7.37:g.7571014C>T	ENSP00000382356:p.Asp216Asn	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	50.0	NM_001037763	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	37	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643034	0.47153	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	T	0.56776	0.44	3.88	3.88	0.44766	von Willebrand factor, type A (2);	0.000000	0.64402	U	0.000002	T	0.65407	0.2688	L	0.54323	1.7	0.47308	D	0.999389	D	0.69078	0.997	D	0.64321	0.924	T	0.68326	-0.5438	10	0.51188	T	0.08	-4.4813	16.016	0.80441	0.0:1.0:0.0:0.0	.	216	Q2UY09	COSA1_HUMAN	N	216	ENSP00000382356:D216N	ENSP00000382347:D216N	D	-	1	0	COL28A1	7537539	1.000000	0.71417	0.341000	0.25589	0.051000	0.14879	3.488000	0.53229	2.183000	0.69458	0.655000	0.94253	GAT	.		0.363	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	
COL4A1	1282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	110804702	110804702	+	Missense_Mutation	SNP	A	A	G	rs201012509		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr13:110804702A>G	ENST00000375820.4	-	51	5028	c.4907T>C	c.(4906-4908)aTa>aCa	p.I1636T		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1636	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			GCTCCTCTCTATGGTGGCGAG	0.507													A|||	1	0.000199681	0.0	0.0	5008	,	,		18713	0.001		0.0	False		,,,				2504	0.0				p.I1636T		.											.	COL4A1	654	0			c.T4907C						.						74.0	61.0	65.0					13																	110804702		2203	4300	6503	SO:0001583	missense	1282	exon51			CTCTCTATGGTGG	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.4907T>C	13.37:g.110804702A>G	ENSP00000364979:p.Ile1636Thr	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	53.0	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	37	CCDS9511.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	A	18.65	3.669022	0.67814	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.97352	-4.35	5.31	5.31	0.75309	C-type lectin fold (1);	0.000000	0.85682	D	0.000000	D	0.96978	0.9013	L	0.28608	0.87	0.80722	D	1	D	0.65815	0.995	D	0.71184	0.972	D	0.98188	1.0461	10	0.87932	D	0	.	15.3028	0.73966	1.0:0.0:0.0:0.0	.	1636	P02462	CO4A1_HUMAN	T	1279;1636;1285	ENSP00000364979:I1636T	ENSP00000364973:I1279T	I	-	2	0	COL4A1	109602703	1.000000	0.71417	0.718000	0.30602	0.986000	0.74619	8.999000	0.93557	2.012000	0.59069	0.533000	0.62120	ATA	A|0.999;G|0.000		0.507	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
COL4A5	1287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	107834827	107834827	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:107834827C>T	ENST00000361603.2	+	21	1620	c.1376C>T	c.(1375-1377)cCa>cTa	p.P459L	COL4A5_ENST00000328300.6_Missense_Mutation_p.P459L	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	459	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CCAGGCCCCCCAGGATCTCCA	0.393									Alport syndrome with Diffuse Leiomyomatosis																												p.P459L		.											.	COL4A5	133	0			c.C1376T	GRCh37	CD961912	COL4A5	D	rs104886113	.						101.0	105.0	104.0					X																	107834827		2203	4300	6503	SO:0001583	missense	1287	exon21	Familial Cancer Database		GCCCCCCAGGATC	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1376C>T	X.37:g.107834827C>T	ENSP00000354505:p.Pro459Leu	Somatic	735.0	0.0		WXS	Illumina HiSeq	Phase_I	566.0	150.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	c	9.965	1.223813	0.22457	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.96685	-4.09;-4.09	5.36	4.47	0.54385	.	0.122857	0.56097	D	0.000032	D	0.96728	0.8932	M	0.87617	2.895	0.80722	D	1	D;P;D	0.54047	0.964;0.954;0.964	P;P;P	0.48454	0.563;0.578;0.563	D	0.95576	0.8642	10	0.51188	T	0.08	.	11.4258	0.50009	0.3268:0.6732:0.0:0.0	.	459;67;459	E7EVY4;Q49AM6;P29400	.;.;CO4A5_HUMAN	L	459	ENSP00000331902:P459L;ENSP00000354505:P459L	ENSP00000331902:P459L	P	+	2	0	COL4A5	107721483	0.998000	0.40836	0.030000	0.17652	0.003000	0.03518	2.341000	0.43983	0.977000	0.38444	0.540000	0.68198	CCA	.		0.393	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
COPS8	10920	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	237998516	237998516	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:237998516A>G	ENST00000354371.2	+	4	863	c.210A>G	c.(208-210)gaA>gaG	p.E70E	COPS8_ENST00000409629.1_Silent_p.E70E|COPS8_ENST00000409334.1_Silent_p.E70E|COPS8_ENST00000392008.2_Silent_p.E21E	NM_006710.4	NP_006701.1	Q99627	CSN8_HUMAN	COP9 signalosome subunit 8	70	PCI.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|cullin deneddylation (GO:0010388)|negative regulation of cell proliferation (GO:0008285)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Breast(86;0.000162)|Renal(207;0.00339)|all_hematologic(139;0.0123)|Ovarian(221;0.0694)|Acute lymphoblastic leukemia(138;0.0775)|all_lung(227;0.169)|all_neural(83;0.211)		Epithelial(121;7.41e-23)|OV - Ovarian serous cystadenocarcinoma(60;5.42e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000175)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0258)		CAAATTCTGAACTTGGGGGAA	0.403																																					p.E70E		.											.	COPS8	228	0			c.A210G						.						63.0	65.0	64.0					2																	237998516		2203	4300	6503	SO:0001819	synonymous_variant	10920	exon4			TTCTGAACTTGGG		CCDS2517.1, CCDS42835.1	2q37.3	2013-03-14	2013-03-14		ENSG00000198612	ENSG00000198612			24335	protein-coding gene	gene with protein product			"""COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)"""			7634324, 12732143	Standard	NM_006710		Approved	COP9, CSN8, MGC1297, SGN8	uc002vwh.3	Q99627	OTTHUMG00000133297	ENST00000354371.2:c.210A>G	2.37:g.237998516A>G		Somatic	157.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	42.0	NM_006710	A8K1H6|Q53QS9	Silent	SNP	ENST00000354371.2	37	CCDS2517.1																																																																																			.		0.403	COPS8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257082.3	NM_006710	
CRLF1	9244	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	18709391	18709391	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:18709391G>A	ENST00000392386.3	-	4	741	c.548C>T	c.(547-549)aCa>aTa	p.T183I		NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	183	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of motor neuron apoptotic process (GO:2000672)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|ureteric bud development (GO:0001657)	CRLF-CLCF1 complex (GO:0097058)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9						CTCCTCACATGTGTTGTCCTG	0.632																																					p.T183I		.											.	CRLF1	514	0			c.C548T						.						122.0	103.0	109.0					19																	18709391		2203	4300	6503	SO:0001583	missense	9244	exon4			TCACATGTGTTGT	AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016		"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237				9686600	Standard	NM_004750		Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.548C>T	19.37:g.18709391G>A	ENSP00000376188:p.Thr183Ile	Somatic	115.0	1.0		WXS	Illumina HiSeq	Phase_I	198.0	44.0	NM_004750	Q9UHH5	Missense_Mutation	SNP	ENST00000392386.3	37	CCDS32962.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465146	0.43839	.	.	ENSG00000006016	ENST00000392386	D	0.83506	-1.73	4.81	4.81	0.61882	Fibronectin, type III (3);Growth hormone/erythropoietin receptor, ligand binding (1);Immunoglobulin-like fold (1);	0.345383	0.31847	N	0.006965	D	0.82554	0.5062	L	0.29908	0.895	0.36713	D	0.880744	D	0.61697	0.99	P	0.56343	0.796	T	0.82283	-0.0534	10	0.21540	T	0.41	-15.7055	16.808	0.85710	0.0:0.0:1.0:0.0	.	183	O75462	CRLF1_HUMAN	I	183	ENSP00000376188:T183I	ENSP00000376188:T183I	T	-	2	0	CRLF1	18570391	1.000000	0.71417	0.959000	0.39883	0.577000	0.36160	6.051000	0.71072	2.385000	0.81259	0.313000	0.20887	ACA	.		0.632	CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1		
CYP2C18	1562	ucsc.edu;bcgsc.ca;mdanderson.org	37	10	96493059	96493059	+	Silent	SNP	G	G	T	rs114879149	byFrequency	TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr10:96493059G>T	ENST00000285979.6	+	8	1354	c.1155G>T	c.(1153-1155)acG>acT	p.T385T	CYP2C18_ENST00000339022.5_Silent_p.T326T|CYP2C19_ENST00000464755.1_3'UTR	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	385			T -> M (in dbSNP:rs2281891). {ECO:0000269|PubMed:2009263, ECO:0000269|PubMed:8333835}.		small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	TTCAGGGCACGACCATAATAA	0.413																																					p.T385T		.											.	CYP2C18	95	0			c.G1155T						.						170.0	154.0	160.0					10																	96493059		2203	4300	6503	SO:0001819	synonymous_variant	1562	exon8			GGGCACGACCATA	M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.1155G>T	10.37:g.96493059G>T		Somatic	266.0	1.0		WXS	Illumina HiSeq	.	291.0	42.0	NM_000772	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Silent	SNP	ENST00000285979.6	37	CCDS7435.1																																																																																			G|0.996;A|0.004		0.413	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049486.1	NM_000772	
DCT	1638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	95131263	95131263	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr13:95131263G>A	ENST00000377028.5	-	1	660	c.247C>T	c.(247-249)Cgt>Tgt	p.R83C	DCT_ENST00000446125.1_Missense_Mutation_p.R83C	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	83					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CACAGCTCACGGTCATCCTGG	0.607																																					p.R83C		.											DCT,mouth,carcinoma,+1	DCT	94	0			c.C247T						.						101.0	87.0	91.0					13																	95131263		2203	4300	6503	SO:0001583	missense	1638	exon1			GCTCACGGTCATC	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.247C>T	13.37:g.95131263G>A	ENSP00000366227:p.Arg83Cys	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	48.0	NM_001129889	Q09GT4	Missense_Mutation	SNP	ENST00000377028.5	37	CCDS9470.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287558	0.80803	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.86956	-2.19;-2.19	5.32	5.32	0.75619	Uncharacterised domain, di-copper centre (1);	0.000000	0.85682	D	0.000000	D	0.95793	0.8631	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.96961	0.9701	10	0.87932	D	0	-15.1729	19.0	0.92829	0.0:0.0:1.0:0.0	.	83;83	Q09GT4;P40126	.;TYRP2_HUMAN	C	83	ENSP00000366227:R83C;ENSP00000392762:R83C	ENSP00000366227:R83C	R	-	1	0	DCT	93929264	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	3.887000	0.56197	2.482000	0.83794	0.650000	0.86243	CGT	.		0.607	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045461.3		
DGAT1	8694	broad.mit.edu;mdanderson.org	37	8	145540247	145540247	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:145540247G>A	ENST00000332324.4	-	17	1710	c.1437C>T	c.(1435-1437)ctC>ctT	p.L479L	GS1-393G12.12_ENST00000525023.1_RNA|DGAT1_ENST00000527438.1_5'UTR	NM_012079.4	NP_036211.2	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	479					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	diacylglycerol O-acyltransferase activity (GO:0004144)|retinol O-fatty-acyltransferase activity (GO:0050252)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	9	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			CCTCATAGTTGAGCACGTAGT	0.607																																					p.L479L		.											.	.	.	0			c.C1437T						.						56.0	45.0	49.0					8																	145540247		2195	4295	6490	SO:0001819	synonymous_variant	8694	exon17			ATAGTTGAGCACG	AF059202	CCDS6420.1	8q24.3	2014-05-06	2010-06-24	2001-11-09	ENSG00000185000	ENSG00000185000	2.3.1.20		2843	protein-coding gene	gene with protein product		604900	"""diacylglycerol O-acyltransferase homolog 1 (mouse)"""			9756920	Standard	NM_012079		Approved	ARGP1, DGAT	uc003zbv.3	O75907	OTTHUMG00000174606	ENST00000332324.4:c.1437C>T	8.37:g.145540247G>A		Somatic	54.0	1.0		WXS	Illumina HiSeq	Phase_I	65.0	30.0	NM_012079	B2RWQ2|D3DWL6|Q96BB8	Silent	SNP	ENST00000332324.4	37	CCDS6420.1	.	.	.	.	.	.	.	.	.	.	G	38	6.800326	0.97849	.	.	ENSG00000185000	ENST00000526479	.	.	.	4.55	3.66	0.41972	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-19.0371	11.048	0.47870	0.0:0.3654:0.6346:0.0	.	.	.	.	X	314	.	ENSP00000435883:Q314X	Q	-	1	0	DGAT1	145511055	0.818000	0.29161	0.977000	0.42913	0.910000	0.53928	-0.241000	0.08940	1.111000	0.41721	0.561000	0.74099	CAA	.		0.607	DGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382059.3	NM_012079	
DNAH10	196385	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	124399402	124399402	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:124399402G>T	ENST00000409039.3	+	61	10249	c.10224G>T	c.(10222-10224)tgG>tgT	p.W3408C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3408	AAA 5. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CTTCCAGATGGGGATCCCAGG	0.562																																					p.W3408C		.											.	DNAH10	95	0			c.G10224T						.						25.0	30.0	28.0					12																	124399402		1909	4123	6032	SO:0001583	missense	196385	exon61			CAGATGGGGATCC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.10224G>T	12.37:g.124399402G>T	ENSP00000386770:p.Trp3408Cys	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	21.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998006	0.74818	.	.	ENSG00000197653	ENST00000409039	T	0.35048	1.33	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.78227	0.4250	H	0.99425	4.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88959	0.3392	10	0.87932	D	0	.	18.093	0.89480	0.0:0.0:1.0:0.0	.	3408	Q8IVF4	DYH10_HUMAN	C	3408	ENSP00000386770:W3408C	ENSP00000386770:W3408C	W	+	3	0	DNAH10	122965355	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	9.739000	0.98837	2.242000	0.73789	0.555000	0.69702	TGG	.		0.562	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DNAH7	56171	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	196674472	196674472	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:196674472C>T	ENST00000312428.6	-	52	9985	c.9885G>A	c.(9883-9885)cgG>cgA	p.R3295R		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3295					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TACTGACCGCCCGCTCATGCA	0.323																																					p.R3295R		.											.	DNAH7	102	0			c.G9885A						.						67.0	61.0	63.0					2																	196674472		1836	4077	5913	SO:0001819	synonymous_variant	56171	exon52			GACCGCCCGCTCA	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.9885G>A	2.37:g.196674472C>T		Somatic	283.0	0.0		WXS	Illumina HiSeq	Phase_I	515.0	160.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	37	CCDS42794.1																																																																																			.		0.323	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
DNHD1	144132	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	6566486	6566486	+	Silent	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:6566486T>A	ENST00000527990.2	+	19	4317	c.4317T>A	c.(4315-4317)ccT>ccA	p.P1439P	DNHD1_ENST00000254579.6_Silent_p.P1439P			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1439					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GTCCCCTTCCTCTGCATCCAG	0.607																																					p.P1439P		.											.	DNHD1	24	0			c.T4317A						.						97.0	102.0	101.0					11																	6566486		692	1591	2283	SO:0001819	synonymous_variant	144132	exon21			CCTTCCTCTGCAT	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.4317T>A	11.37:g.6566486T>A		Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	12.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	ENST00000527990.2	37	CCDS44532.1																																																																																			.		0.607	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
DNM3	26052	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	172100413	172100413	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:172100413G>C	ENST00000355305.5	+	15	1831	c.1674G>C	c.(1672-1674)tgG>tgC	p.W558C	DNM3_ENST00000367731.1_Missense_Mutation_p.W548C|DNM3_ENST00000520906.1_Missense_Mutation_p.W548C|DNM3_ENST00000367733.2_Missense_Mutation_p.W548C|DNM3_ENST00000358155.4_Missense_Mutation_p.W548C			Q9UQ16	DYN3_HUMAN	dynamin 3	558	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						GCTTGTCCTGGTATAAAGATG	0.393																																					p.W548C		.											.	DNM3	90	0			c.G1644C						.						88.0	85.0	86.0					1																	172100413		1952	4177	6129	SO:0001583	missense	26052	exon14			GTCCTGGTATAAA	AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1674G>C	1.37:g.172100413G>C	ENSP00000347457:p.Trp558Cys	Somatic	132.0	0.0		WXS	Illumina HiSeq	Phase_I	231.0	80.0	NM_001136127	A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	ENST00000355305.5	37		.	.	.	.	.	.	.	.	.	.	G	18.28	3.589394	0.66105	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	D;D;D;D;D;D	0.96265	-3.96;-3.96;-3.96;-3.96;-3.96;-3.96	5.85	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.98169	0.9395	M	0.90082	3.085	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.994;0.997;0.977	D	0.99160	1.0861	10	0.72032	D	0.01	.	15.4223	0.75022	0.0:0.0:0.8599:0.1401	.	548;548;548;548	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	C	558;548;548;558;548;548;438	ENSP00000350876:W548C;ENSP00000356707:W548C;ENSP00000347457:W558C;ENSP00000356705:W548C;ENSP00000429701:W548C;ENSP00000429416:W438C	ENSP00000347457:W558C	W	+	3	0	DNM3	170367036	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.813000	0.99286	1.458000	0.47871	-0.321000	0.08615	TGG	.		0.393	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000084531.1	NM_015569	
DOC2A	8448	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	30018188	30018188	+	Silent	SNP	G	G	T	rs370463371		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr16:30018188G>T	ENST00000350119.4	-	8	986	c.796C>A	c.(796-798)Cgg>Agg	p.R266R	DOC2A_ENST00000564944.1_Silent_p.R266R|DOC2A_ENST00000564979.1_Silent_p.R266R	NM_001282062.1|NM_001282063.1|NM_001282068.1|NM_003586.2	NP_001268991.1|NP_001268992.1|NP_001268997.1|NP_003577.2	Q14183	DOC2A_HUMAN	double C2-like domains, alpha	266	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Interaction with UNC13D.				nervous system development (GO:0007399)|regulation of calcium ion-dependent exocytosis (GO:0017158)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|lysosome (GO:0005764)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)	9						AGCAGTCCCCGGCGCCGCGAG	0.662																																					p.R266R		.											.	DOC2A	92	0			c.C796A						.						30.0	34.0	33.0					16																	30018188		2197	4300	6497	SO:0001819	synonymous_variant	8448	exon8			GTCCCCGGCGCCG	D31897	CCDS10666.1	16p11.2	2014-07-02			ENSG00000149927	ENSG00000149927		"""Synaptotagmins"""	2985	protein-coding gene	gene with protein product		604567				7826360, 9736751	Standard	NM_003586		Approved		uc002dvn.3	Q14183	OTTHUMG00000132109	ENST00000350119.4:c.796C>A	16.37:g.30018188G>T		Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	8.0	NM_003586	B4DEJ2|H3BNH6|Q6P4G4|Q7Z5G0|Q8IVX0	Silent	SNP	ENST00000350119.4	37	CCDS10666.1																																																																																			.		0.662	DOC2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255148.2	NM_003586	
DOCK11	139818	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	117752664	117752664	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:117752664T>G	ENST00000276202.7	+	31	3507	c.3444T>G	c.(3442-3444)caT>caG	p.H1148Q	DOCK11_ENST00000276204.6_Missense_Mutation_p.H1148Q	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1148					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGATAAAACATGCATTTGACA	0.358																																					p.H1148Q		.											.	DOCK11	93	0			c.T3444G						.						70.0	61.0	64.0					X																	117752664		2203	4299	6502	SO:0001583	missense	139818	exon31			AAAACATGCATTT	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.3444T>G	X.37:g.117752664T>G	ENSP00000276202:p.His1148Gln	Somatic	377.0	0.0		WXS	Illumina HiSeq	Phase_I	365.0	35.0	NM_144658	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	ENST00000276202.7	37	CCDS35373.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.444422	0.63178	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	D;D	0.96885	-4.16;-4.16	5.68	0.724	0.18236	.	0.000000	0.85682	D	0.000000	D	0.98172	0.9396	H	0.94183	3.505	0.52501	D	0.999958	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.97216	0.9874	10	0.87932	D	0	-31.3629	9.0274	0.36239	0.0:0.2886:0.0:0.7114	.	1148;1148	A6NIW2;Q5JSL3	.;DOC11_HUMAN	Q	1148	ENSP00000276204:H1148Q;ENSP00000276202:H1148Q	ENSP00000276202:H1148Q	H	+	3	2	DOCK11	117636692	0.997000	0.39634	0.999000	0.59377	0.983000	0.72400	0.320000	0.19540	0.049000	0.15920	-0.435000	0.05868	CAT	.		0.358	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000356002.1	NM_144658	
DUSP8	1850	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	1586842	1586842	+	Missense_Mutation	SNP	G	G	A	rs571594390		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:1586842G>A	ENST00000397374.3	-	2	342	c.215C>T	c.(214-216)cCg>cTg	p.P72L	DUSP8_ENST00000331588.4_Missense_Mutation_p.P72L	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	72	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		GCGTGCAGCCGGCTGGATGAG	0.657													G|||	1	0.000199681	0.0	0.0	5008	,	,		14272	0.0		0.001	False		,,,				2504	0.0				p.P72L		.											.	DUSP8	226	0			c.C215T						.						34.0	27.0	30.0					11																	1586842		2197	4295	6492	SO:0001583	missense	1850	exon2			GCAGCCGGCTGGA		CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.215C>T	11.37:g.1586842G>A	ENSP00000380530:p.Pro72Leu	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	23.0	NM_004420	Q86SS8	Missense_Mutation	SNP	ENST00000397374.3	37	CCDS7724.1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657585	0.47467	.	.	ENSG00000184545	ENST00000397374;ENST00000331588	T;T	0.47528	0.84;0.84	3.23	3.23	0.37069	Rhodanese-like (5);	0.183457	0.35262	N	0.003337	T	0.59500	0.2198	L	0.59436	1.845	0.80722	D	1	D	0.65815	0.995	P	0.62649	0.905	T	0.58983	-0.7539	10	0.34782	T	0.22	.	13.8674	0.63596	0.0:0.0:1.0:0.0	.	72	Q13202	DUS8_HUMAN	L	72	ENSP00000380530:P72L;ENSP00000329539:P72L	ENSP00000329539:P72L	P	-	2	0	DUSP8	1543418	1.000000	0.71417	0.913000	0.36048	0.148000	0.21650	4.402000	0.59722	2.113000	0.64589	0.561000	0.74099	CCG	.		0.657	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257178.3	NM_004420	
EFCAB6	64800	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	44112732	44112732	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr22:44112732delA	ENST00000262726.7	-	9	1131	c.878delT	c.(877-879)ctafs	p.L293fs	EFCAB6_ENST00000396231.2_Frame_Shift_Del_p.L141fs|EFCAB6_ENST00000356087.4_Frame_Shift_Del_p.L187fs|EFCAB6_ENST00000358439.4_Frame_Shift_Del_p.L187fs	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TCTTACTTGTAGACAAAAGTT	0.343																																					p.L293fs		.											.	EFCAB6	97	0			c.878delT						.						119.0	112.0	114.0					22																	44112732		2202	4300	6502	SO:0001589	frameshift_variant	64800	exon9			ACTTGTAGACAAA	Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.878delT	22.37:g.44112732delA	ENSP00000262726:p.Leu293fs	Somatic	430.0	0.0		WXS	Illumina HiSeq	Phase_I	299.0	117.0	NM_022785	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Frame_Shift_Del	DEL	ENST00000262726.7	37	CCDS14049.1																																																																																			.		0.343	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353176.1	NM_022785	
EGFLAM	133584	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	38406944	38406944	+	Silent	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:38406944T>A	ENST00000354891.3	+	8	1189	c.843T>A	c.(841-843)ccT>ccA	p.P281P	EGFLAM_ENST00000336740.6_Silent_p.P47P|EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000322350.5_Silent_p.P281P	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	281					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AACCACTTCCTGCTACCAAAG	0.418																																					p.P281P	Colon(62;485 1295 3347 17454)	.											.	EGFLAM	187	0			c.T843A						.						89.0	85.0	86.0					5																	38406944		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon8			ACTTCCTGCTACC	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.843T>A	5.37:g.38406944T>A		Somatic	319.0	0.0		WXS	Illumina HiSeq	Phase_I	338.0	21.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	37	CCDS56363.1																																																																																			.		0.418	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
EMCN	51705	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	101401081	101401081	+	Silent	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:101401081A>T	ENST00000296420.4	-	2	358	c.180T>A	c.(178-180)acT>acA	p.T60T	EMCN_ENST00000502327.1_5'UTR|EMCN_ENST00000305864.3_Silent_p.T60T|EMCN_ENST00000511970.1_Silent_p.T60T	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	60	Thr-rich.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		TACCTTTAGGAGTTGTTCCAG	0.284																																					p.T60T		.											.	EMCN	90	0			c.T180A						.						161.0	150.0	154.0					4																	101401081		2201	4295	6496	SO:0001819	synonymous_variant	51705	exon2			TTTAGGAGTTGTT	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.180T>A	4.37:g.101401081A>T		Somatic	902.0	0.0		WXS	Illumina HiSeq	Phase_I	723.0	49.0	NM_001159694	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Silent	SNP	ENST00000296420.4	37	CCDS3655.1																																																																																			.		0.284	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242	
EPN3	55040	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	48617654	48617654	+	Missense_Mutation	SNP	C	C	T	rs142210765		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:48617654C>T	ENST00000268933.3	+	6	1517	c.938C>T	c.(937-939)cCg>cTg	p.P313L	EPN3_ENST00000541226.1_Intron|RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000537145.1_Missense_Mutation_p.P341L	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	313						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GCCCTGGCCCCGCCCTCCACA	0.662													C|||	1	0.000199681	0.0	0.0	5008	,	,		18685	0.001		0.0	False		,,,				2504	0.0				p.P313L		.											.	EPN3	91	0			c.C938T						.	C	LEU/PRO	2,4404	6.2+/-15.9	0,2,2201	92.0	71.0	78.0		938	2.5	1.0	17	dbSNP_134	78	0,8600		0,0,4300	yes	missense	EPN3	NM_017957.2	98	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	313/633	48617654	2,13004	2203	4300	6503	SO:0001583	missense	55040	exon6			TGGCCCCGCCCTC	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.938C>T	17.37:g.48617654C>T	ENSP00000268933:p.Pro313Leu	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	7.0	NM_017957	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.36	2.511070	0.44660	4.54E-4	0.0	ENSG00000049283	ENST00000268933;ENST00000442715;ENST00000537145	T;T	0.18338	2.32;2.22	4.96	2.48	0.30137	.	0.488222	0.20373	N	0.093615	T	0.07234	0.0183	N	0.05330	-0.07	0.80722	D	1	B;B;B	0.18741	0.017;0.03;0.003	B;B;B	0.13407	0.004;0.009;0.002	T	0.31779	-0.9931	10	0.22109	T	0.4	-3.6494	6.0604	0.19835	0.0:0.6877:0.0:0.3123	.	341;341;313	B4DK18;F6QWW5;Q9H201	.;.;EPN3_HUMAN	L	313;341;341	ENSP00000268933:P313L;ENSP00000439512:P341L	ENSP00000268933:P313L	P	+	2	0	EPN3	45972653	0.032000	0.19561	0.969000	0.41365	0.998000	0.95712	0.209000	0.17435	0.246000	0.21394	0.655000	0.94253	CCG	C|1.000;T|0.000		0.662	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
ETV3L	440695	broad.mit.edu;bcgsc.ca	37	1	157062526	157062526	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:157062526G>A	ENST00000454449.2	-	5	1285	c.1001C>T	c.(1000-1002)aCc>aTc	p.T334I		NM_001004341.2	NP_001004341.1	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	334					cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GAGTCTGCGGGTCTCTGGGCA	0.577																																					p.T334I		.											.	ETV3L	228	0			c.C1001T						.						78.0	78.0	78.0					1																	157062526		2203	4300	6503	SO:0001583	missense	440695	exon5			CTGCGGGTCTCTG	AK131392	CCDS30893.1	1q23.1	2013-09-24	2008-09-12		ENSG00000253831	ENSG00000253831			33834	protein-coding gene	gene with protein product			"""ets variant gene 3-like"""				Standard	NM_001004341		Approved	FLJ16478	uc001fqq.2	Q6ZN32	OTTHUMG00000041325	ENST00000454449.2:c.1001C>T	1.37:g.157062526G>A	ENSP00000430271:p.Thr334Ile	Somatic	197.0	1.0		WXS	Illumina HiSeq	Phase_I	367.0	18.0	NM_001004341		Missense_Mutation	SNP	ENST00000454449.2	37	CCDS30893.1	.	.	.	.	.	.	.	.	.	.	G	0.428	-0.904920	0.02453	.	.	ENSG00000253831	ENST00000454449	T	0.35236	1.32	3.78	-6.32	0.01995	.	7739.210000	0.00166	N	0.000001	T	0.04363	0.0120	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.12192	-1.0557	10	0.21014	T	0.42	.	0.7531	0.00994	0.3917:0.1318:0.2512:0.2252	.	334	Q6ZN32	ETV3L_HUMAN	I	334	ENSP00000430271:T334I	ENSP00000430271:T334I	T	-	2	0	ETV3L	155329150	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.472000	0.06623	-1.300000	0.02341	-1.108000	0.02087	ACC	.		0.577	ETV3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099024.2	NM_001004341	
FAM174B	400451	broad.mit.edu;bcgsc.ca	37	15	93198581	93198581	+	Silent	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr15:93198581G>T	ENST00000327355.5	-	1	607	c.309C>A	c.(307-309)acC>acA	p.T103T	FAM174B_ENST00000555696.1_5'Flank|FAM174B_ENST00000555748.1_5'UTR	NM_207446.2	NP_997329.2	Q3ZCQ3	F174B_HUMAN	family with sequence similarity 174, member B	103						integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3						CGATGAGGAGGGTGGTAAAGG	0.677																																					p.T103T		.											.	FAM174B	90	0			c.C309A						.						24.0	31.0	28.0					15																	93198581		2120	4227	6347	SO:0001819	synonymous_variant	400451	exon1			GAGGAGGGTGGTA		CCDS45355.1	15q26.1	2012-10-03			ENSG00000185442	ENSG00000185442			34339	protein-coding gene	gene with protein product							Standard	NM_207446		Approved	LOC400451, MGC102891	uc010boe.3	Q3ZCQ3	OTTHUMG00000171744	ENST00000327355.5:c.309C>A	15.37:g.93198581G>T		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	8.0	NM_207446	Q3ZCR9|Q8NBH7	Silent	SNP	ENST00000327355.5	37	CCDS45355.1																																																																																			.		0.677	FAM174B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414931.1	NM_207446	
FAM208A	23272	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	56681065	56681065	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:56681065C>T	ENST00000493960.2	-	14	1710	c.1700G>A	c.(1699-1701)gGt>gAt	p.G567D	FAM208A_ENST00000355628.5_Missense_Mutation_p.G567D|FAM208A_ENST00000431842.2_Missense_Mutation_p.G171D	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	567							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						TTTACCTGAACCAAAACCTCG	0.303																																					p.G567D		.											.	.	.	0			c.G1700A						.						41.0	45.0	43.0					3																	56681065		2196	4294	6490	SO:0001583	missense	23272	exon14			CCTGAACCAAAAC	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.1700G>A	3.37:g.56681065C>T	ENSP00000417509:p.Gly567Asp	Somatic	194.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	93.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	37	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.858711	0.32791	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.11821	2.74;2.92;2.93	5.38	5.38	0.77491	.	0.093149	0.47093	D	0.000251	T	0.20941	0.0504	L	0.29908	0.895	0.35335	D	0.785953	D;D;D	0.89917	0.98;0.986;1.0	P;P;D	0.73708	0.844;0.504;0.981	T	0.09465	-1.0673	10	0.23302	T	0.38	-14.328	9.453	0.38739	0.1427:0.7842:0.0:0.0731	.	567;567;171	Q9UK61-3;Q9UK61-4;Q9UK61-2	.;.;.	D	171;567;567	ENSP00000399410:G171D;ENSP00000417509:G567D;ENSP00000347845:G567D	ENSP00000347845:G567D	G	-	2	0	C3orf63	56656105	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.164000	0.64954	2.793000	0.96121	0.655000	0.94253	GGT	.		0.303	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
FAM47B	170062	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	34962850	34962850	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:34962850C>T	ENST00000329357.5	+	1	1938	c.1902C>T	c.(1900-1902)taC>taT	p.Y634Y		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	634										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TTTACAAGTACAAAGAAGACG	0.383																																					p.Y634Y		.											.	FAM47B	196	0			c.C1902T						.						122.0	109.0	113.0					X																	34962850		2202	4300	6502	SO:0001819	synonymous_variant	170062	exon1			CAAGTACAAAGAA	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1902C>T	X.37:g.34962850C>T		Somatic	244.0	0.0		WXS	Illumina HiSeq	Phase_I	212.0	15.0	NM_152631	Q5JQN5|Q6PIG3	Silent	SNP	ENST00000329357.5	37	CCDS14236.1																																																																																			.		0.383	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056211.1	NM_152631	
FAM53C	51307	ucsc.edu;bcgsc.ca	37	5	137681160	137681160	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:137681160A>G	ENST00000239906.5	+	4	1211	c.783A>G	c.(781-783)cgA>cgG	p.R261R	RP11-256P1.1_ENST00000504539.1_RNA|FAM53C_ENST00000513056.1_Missense_Mutation_p.D71G|FAM53C_ENST00000434981.2_Silent_p.R261R	NM_016605.2	NP_057689.1	Q9NYF3	FA53C_HUMAN	family with sequence similarity 53, member C	261								p.W260fs*44(1)		breast(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TGCCCTGGCGACCTCGAGGTC	0.682																																					p.R261R		.											.	FAM53C	91	1	Deletion - Frameshift(1)	breast(1)	c.A783G						.						47.0	56.0	53.0					5																	137681160		2203	4300	6503	SO:0001819	synonymous_variant	51307	exon4			CTGGCGACCTCGA	AF251040	CCDS4204.1	5q31	2008-02-05	2004-11-24	2004-11-26	ENSG00000120709	ENSG00000120709			1336	protein-coding gene	gene with protein product		609372	"""chromosome 5 open reading frame 6"""	C5orf6		11087669, 11161817	Standard	NM_001135647		Approved		uc003lcv.3	Q9NYF3	OTTHUMG00000129201	ENST00000239906.5:c.783A>G	5.37:g.137681160A>G		Somatic	40.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_001135647	B2RDJ5|D3DQB9	Silent	SNP	ENST00000239906.5	37	CCDS4204.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.505910	0.26949	.	.	ENSG00000120709	ENST00000513056	T	0.54279	0.58	5.55	5.55	0.83447	.	.	.	.	.	T	0.45074	0.1324	.	.	.	0.27717	N	0.945248	P	0.42518	0.782	B	0.41764	0.366	T	0.44772	-0.9306	8	0.46703	T	0.11	-4.343	8.1212	0.30971	0.9132:0.0:0.0868:0.0	.	71	D6RE00	.	G	71	ENSP00000425154:D71G	ENSP00000425154:D71G	D	+	2	0	FAM53C	137709059	0.005000	0.15991	1.000000	0.80357	0.998000	0.95712	0.023000	0.13533	2.333000	0.79357	0.533000	0.62120	GAC	.		0.682	FAM53C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251278.2	NM_016605	
FASN	2194	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	80047248	80047248	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:80047248C>A	ENST00000306749.2	-	13	2196	c.1978G>T	c.(1978-1980)Gag>Tag	p.E660*		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	660	Acyl and malonyl transferases. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TCCACGAACTCAAACACCGGG	0.642																																					p.E660X	Colon(59;314 1043 11189 28578 32273)	.											.	FASN	90	0			c.G1978T						.						54.0	54.0	54.0					17																	80047248		2202	4299	6501	SO:0001587	stop_gained	2194	exon13			CGAACTCAAACAC	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.1978G>T	17.37:g.80047248C>A	ENSP00000304592:p.Glu660*	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	19.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Nonsense_Mutation	SNP	ENST00000306749.2	37	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	C	38	6.758981	0.97817	.	.	ENSG00000169710	ENST00000306749	.	.	.	4.4	-2.35	0.06684	.	0.628162	0.14977	N	0.287497	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-8.453	6.412	0.21696	0.0:0.3849:0.1295:0.4856	.	.	.	.	X	660	.	ENSP00000304592:E660X	E	-	1	0	FASN	77640537	0.001000	0.12720	0.003000	0.11579	0.003000	0.03518	-0.179000	0.09768	-0.244000	0.09639	0.462000	0.41574	GAG	.		0.642	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
FAT3	120114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	92565042	92565042	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:92565042C>T	ENST00000298047.6	+	13	9753	c.9736C>T	c.(9736-9738)Cct>Tct	p.P3246S	FAT3_ENST00000409404.2_Missense_Mutation_p.P3246S|FAT3_ENST00000525166.1_Missense_Mutation_p.P3096S			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3246	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				GGTGACGGTGCCTGAGGACAC	0.527										TCGA Ovarian(4;0.039)																											p.P3246S		.											.	FAT3	73	0			c.C9736T						.						71.0	73.0	72.0					11																	92565042		1978	4168	6146	SO:0001583	missense	120114	exon13			ACGGTGCCTGAGG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.9736C>T	11.37:g.92565042C>T	ENSP00000298047:p.Pro3246Ser	Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	21.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	37		.	.	.	.	.	.	.	.	.	.	C	11.30	1.597153	0.28445	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.01629	4.72;4.72;4.72	5.04	5.04	0.67666	.	.	.	.	.	T	0.02929	0.0087	N	0.25485	0.75	0.80722	D	1	D	0.52996	0.957	P	0.54590	0.756	T	0.62955	-0.6744	9	0.07325	T	0.83	.	14.3827	0.66921	0.0:0.8523:0.1477:0.0	.	3246	Q8TDW7-3	.	S	3246;3246;3096	ENSP00000298047:P3246S;ENSP00000387040:P3246S;ENSP00000432586:P3096S	ENSP00000298047:P3246S	P	+	1	0	FAT3	92204690	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	2.531000	0.45650	2.488000	0.83962	0.655000	0.94253	CCT	.		0.527	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FBF1	85302	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	73915917	73915917	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:73915917C>A	ENST00000586717.1	-	19	2201	c.1928G>T	c.(1927-1929)cGg>cTg	p.R643L	FBF1_ENST00000389570.4_Missense_Mutation_p.R643L|FBF1_ENST00000319129.5_Missense_Mutation_p.R642L			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	643					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						CCGCTCCTCCCGTTGCTGGTA	0.617																																					p.R642L		.											.	FBF1	205	0			c.G1925T						.						92.0	92.0	92.0					17																	73915917		2029	4188	6217	SO:0001583	missense	85302	exon19			TCCTCCCGTTGCT	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.1928G>T	17.37:g.73915917C>A	ENSP00000465132:p.Arg643Leu	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	51.0	NM_001080542	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000586717.1	37		.	.	.	.	.	.	.	.	.	.	C	19.17	3.775097	0.70107	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.21191	2.02;2.02	5.15	4.18	0.49190	.	.	.	.	.	T	0.44746	0.1308	M	0.75264	2.295	0.43965	D	0.996644	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.98;1.0;0.999	T	0.35201	-0.9798	9	0.36615	T	0.2	-27.4853	13.2587	0.60093	0.0:0.9225:0.0:0.0775	.	657;643;642	Q8TES7-6;Q8TES7;A6NLR5	.;FBF1_HUMAN;.	L	643;643;642;656	ENSP00000374221:R643L;ENSP00000324292:R642L	ENSP00000324292:R642L	R	-	2	0	FBF1	71427512	0.996000	0.38824	0.995000	0.50966	0.321000	0.28281	5.135000	0.64777	1.184000	0.42957	-0.136000	0.14681	CGG	.		0.617	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	
FBXL19	54620	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	30958514	30958514	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr16:30958514G>A	ENST00000380310.2	+	11	2206	c.2048G>A	c.(2047-2049)cGc>cAc	p.R683H	ORAI3_ENST00000318663.4_5'Flank|FBXL19_ENST00000471231.2_Missense_Mutation_p.R371H|ORAI3_ENST00000566237.1_5'Flank|FBXL19_ENST00000565690.1_Missense_Mutation_p.R547H|FBXL19_ENST00000562319.1_Missense_Mutation_p.R663H|AC135048.13_ENST00000566056.1_RNA|FBXL19_ENST00000338343.4_Missense_Mutation_p.R663H|ORAI3_ENST00000562699.1_5'Flank	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19	683					proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						GGCCCCTTCCGCTGCCCTGAG	0.697																																					p.R683H		.											.	FBXL19	661	0			c.G2048A						.						10.0	13.0	12.0					16																	30958514		1861	4071	5932	SO:0001583	missense	54620	exon11			CCTTCCGCTGCCC	AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403	ENST00000380310.2:c.2048G>A	16.37:g.30958514G>A	ENSP00000369666:p.Arg683His	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	9.0	NM_001099784	A8MT10|Q8N789|Q9NT14	Missense_Mutation	SNP	ENST00000380310.2	37	CCDS45465.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534276	0.45073	.	.	ENSG00000099364	ENST00000338343;ENST00000380310	T;T	0.24723	1.84;2.17	5.16	5.16	0.70880	.	0.259655	0.26499	N	0.024036	T	0.23330	0.0564	N	0.08118	0	0.38690	D	0.952749	D;D	0.71674	0.998;0.985	P;P	0.61070	0.883;0.619	T	0.10451	-1.0629	10	0.18276	T	0.48	-14.6679	11.0036	0.47620	0.0877:0.0:0.9123:0.0	.	683;640	Q6PCT2;Q6PCT2-2	FXL19_HUMAN;.	H	663;683	ENSP00000339712:R663H;ENSP00000369666:R683H	ENSP00000339712:R663H	R	+	2	0	FBXL19	30866015	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.387000	0.44389	2.398000	0.81561	0.555000	0.69702	CGC	.		0.697	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_019085	
FMNL2	114793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	153496548	153496548	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:153496548T>A	ENST00000475377.2	+	11	1348	c.1148T>A	c.(1147-1149)cTg>cAg	p.L383Q	FMNL2_ENST00000288670.9_Missense_Mutation_p.L1008Q			Q96PY5	FMNL2_HUMAN	formin-like 2	1008	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CAAGAAGCTCTGATGGAGCAG	0.488																																					p.L1008Q		.											.	FMNL2	516	0			c.T3023A						.						37.0	35.0	35.0					2																	153496548		1925	4088	6013	SO:0001583	missense	114793	exon24			AAGCTCTGATGGA	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000475377.2:c.1148T>A	2.37:g.153496548T>A	ENSP00000418959:p.Leu383Gln	Somatic	342.0	0.0		WXS	Illumina HiSeq	Phase_I	491.0	246.0	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000475377.2	37		.	.	.	.	.	.	.	.	.	.	T	10.94	1.491974	0.26774	.	.	ENSG00000157827	ENST00000288670;ENST00000421344;ENST00000475377	T;T	0.77229	-1.08;2.19	5.08	5.08	0.68730	Actin-binding FH2/DRF autoregulatory (1);	.	.	.	.	T	0.58581	0.2132	N	0.08118	0	0.37242	D	0.906156	B;B;B	0.28512	0.214;0.006;0.009	B;B;B	0.26517	0.07;0.01;0.054	T	0.60469	-0.7257	9	0.13853	T	0.58	.	15.1392	0.72599	0.0:0.0:0.0:1.0	.	1008;489;1008	Q96PY5;Q6ZN96;Q96PY5-3	FMNL2_HUMAN;.;.	Q	1008;489;383	ENSP00000288670:L1008Q;ENSP00000418959:L383Q	ENSP00000288670:L1008Q	L	+	2	0	FMNL2	153204794	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	4.350000	0.59392	2.044000	0.60594	0.455000	0.32223	CTG	.		0.488	FMNL2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000333583.3	NM_052905	
FOXG1	2290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	29237217	29237217	+	Silent	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr14:29237217C>A	ENST00000313071.4	+	1	931	c.732C>A	c.(730-732)cgC>cgA	p.R244R	FOXG1_ENST00000382535.3_Silent_p.R244R|RP11-966I7.1_ENST00000546560.1_RNA|RP11-966I7.1_ENST00000551395.1_RNA|RP11-966I7.1_ENST00000549487.1_RNA	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	244			R -> C (in RTTCV; the mutant protein extensively, although not fully, localizes in nuclear speckles, while the wild-type is more widely dispersed throughout the nucleus). {ECO:0000269|PubMed:21280142}.		aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		AGGTGCCGCGCCACTACGACG	0.617																																					p.R244R		.											.	FOXG1	660	0			c.C732A						.						47.0	48.0	47.0					14																	29237217		2203	4300	6503	SO:0001819	synonymous_variant	2290	exon1			GCCGCGCCACTAC		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.732C>A	14.37:g.29237217C>A		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	23.0	NM_005249	A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	ENST00000313071.4	37	CCDS9636.1																																																																																			.		0.617	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
FOXS1	2307	broad.mit.edu;bcgsc.ca	37	20	30432421	30432421	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr20:30432421C>T	ENST00000375978.3	-	1	999	c.925G>A	c.(925-927)Ggc>Agc	p.G309S		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	309					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						TAGCCGGAGCCTCCCTGGACA	0.647																																					p.G309S		.											.	FOXS1	69	0			c.G925A						.						37.0	38.0	38.0					20																	30432421		2203	4300	6503	SO:0001583	missense	2307	exon1			CGGAGCCTCCCTG	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.925G>A	20.37:g.30432421C>T	ENSP00000365145:p.Gly309Ser	Somatic	138.0	1.0		WXS	Illumina HiSeq	Phase_I	235.0	12.0	NM_004118	Q96D28	Missense_Mutation	SNP	ENST00000375978.3	37	CCDS13192.1	.	.	.	.	.	.	.	.	.	.	C	8.173	0.792063	0.16258	.	.	ENSG00000179772	ENST00000375978	D	0.96992	-4.2	4.54	2.55	0.30701	.	0.273747	0.25692	N	0.028923	D	0.90249	0.6951	N	0.19112	0.55	0.09310	N	0.999999	B	0.10296	0.003	B	0.08055	0.003	T	0.81920	-0.0712	10	0.46703	T	0.11	.	6.9371	0.24472	0.0:0.6996:0.0:0.3004	.	309	O43638	FOXS1_HUMAN	S	309	ENSP00000365145:G309S	ENSP00000365145:G309S	G	-	1	0	FOXS1	29896082	0.000000	0.05858	0.750000	0.31169	0.337000	0.28794	-0.023000	0.12456	0.497000	0.27926	0.462000	0.41574	GGC	.		0.647	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078560.2	NM_004118	
FRS3	10817	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	41738507	41738507	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:41738507C>A	ENST00000373018.3	-	7	1580	c.1329G>T	c.(1327-1329)atG>atT	p.M443I	FRS3_ENST00000259748.2_Missense_Mutation_p.M443I	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	443					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGGTGGTGGGCATGGGGGCTT	0.637																																					p.M443I		.											.	FRS3	92	0			c.G1329T						.						49.0	57.0	55.0					6																	41738507		2203	4300	6503	SO:0001583	missense	10817	exon7			GGTGGGCATGGGG	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.1329G>T	6.37:g.41738507C>A	ENSP00000362109:p.Met443Ile	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	22.0	NM_006653	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	37	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	C	7.680	0.688906	0.14973	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.20738	2.05;2.05	5.33	4.45	0.53987	.	2.877110	0.00714	N	0.000856	T	0.03564	0.0102	N	0.02539	-0.55	0.19945	N	0.999943	B	0.02656	0.0	B	0.01281	0.0	T	0.37033	-0.9723	10	0.23302	T	0.38	-0.3259	12.6261	0.56630	0.4229:0.5771:0.0:0.0	.	443	O43559	FRS3_HUMAN	I	443	ENSP00000362109:M443I;ENSP00000259748:M443I	ENSP00000259748:M443I	M	-	3	0	FRS3	41846485	0.357000	0.24938	0.536000	0.28039	0.933000	0.57130	1.030000	0.30153	1.230000	0.43646	0.655000	0.94253	ATG	.		0.637	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653	
FSIP1	161835	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	39909936	39909936	+	Splice_Site	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr15:39909936C>T	ENST00000350221.3	-	11	1908	c.1699G>A	c.(1699-1701)Gat>Aat	p.D567N		NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	567										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		CAAGCCTCACCTGCTATTGTA	0.388																																					p.D567N		.											.	FSIP1	517	0			c.G1699A						.						83.0	79.0	80.0					15																	39909936		2200	4297	6497	SO:0001630	splice_region_variant	161835	exon11			CCTCACCTGCTAT	BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.1699+1G>A	15.37:g.39909936C>T		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	54.0	NM_152597	Q6X2C8|Q86Y89	Missense_Mutation	SNP	ENST00000350221.3	37	CCDS10050.1	.	.	.	.	.	.	.	.	.	.	C	11.71	1.718952	0.30503	.	.	ENSG00000150667	ENST00000350221	T	0.15256	2.44	4.84	4.84	0.62591	.	0.202066	0.31909	N	0.006878	T	0.21841	0.0526	N	0.19112	0.55	0.39441	D	0.967248	D	0.67145	0.996	P	0.56916	0.809	T	0.02852	-1.1102	9	.	.	.	-5.2151	16.6331	0.85039	0.0:1.0:0.0:0.0	.	567	Q8NA03	FSIP1_HUMAN	N	567	ENSP00000280236:D567N	.	D	-	1	0	FSIP1	37697228	1.000000	0.71417	0.991000	0.47740	0.074000	0.17049	4.302000	0.59092	2.669000	0.90835	0.591000	0.81541	GAT	.		0.388	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597	Missense_Mutation
G3BP2	9908	broad.mit.edu;bcgsc.ca	37	4	76572314	76572314	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:76572314G>A	ENST00000359707.4	-	10	1741	c.956C>T	c.(955-957)tCt>tTt	p.S319F	G3BP2_ENST00000395719.3_Missense_Mutation_p.S319F|G3BP2_ENST00000357854.3_Missense_Mutation_p.S286F	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	319					cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ACGGTTGTCAGAGTCATTCTG	0.338																																					p.S319F		.											.	G3BP2	153	0			c.C956T						.						106.0	106.0	106.0					4																	76572314		2203	4299	6502	SO:0001583	missense	9908	exon10			TTGTCAGAGTCAT	AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.956C>T	4.37:g.76572314G>A	ENSP00000352738:p.Ser319Phe	Somatic	172.0	1.0		WXS	Illumina HiSeq	Phase_I	269.0	11.0	NM_012297	A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	ENST00000359707.4	37	CCDS3571.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.186363	0.57909	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854	T;T;T	0.78816	-1.21;-1.21;-1.17	6.04	6.04	0.98038	.	0.245631	0.47852	D	0.000212	T	0.74168	0.3681	L	0.39898	1.24	0.49798	D	0.999825	B;B	0.34103	0.231;0.437	B;B	0.34038	0.056;0.174	T	0.73216	-0.4053	10	0.56958	D	0.05	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	286;319	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	F	319;319;286	ENSP00000379069:S319F;ENSP00000352738:S319F;ENSP00000350518:S286F	ENSP00000350518:S286F	S	-	2	0	G3BP2	76791338	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.206000	0.72154	2.873000	0.98535	0.561000	0.74099	TCT	.		0.338	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252399.2	NM_012297	
GABRA3	2556	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	151393310	151393310	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:151393310T>C	ENST00000370314.4	-	6	797	c.559A>G	c.(559-561)Att>Gtt	p.I187V	GABRA3_ENST00000535043.1_Missense_Mutation_p.I187V	NM_000808.3	NP_000799.1	P34903	GBRA3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 3	187					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(6)	37	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCAGCATGAATTGTTAACCTA	0.388																																					p.I187V	NSCLC(142;2578 2613 10251 16743)	.											.	GABRA3	131	0			c.A559G						.						112.0	105.0	108.0					X																	151393310		2203	4300	6503	SO:0001583	missense	2556	exon6			CATGAATTGTTAA		CCDS14706.1	Xq28	2012-06-22			ENSG00000011677	ENSG00000011677		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4077	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 3"""	305660					Standard	NM_000808		Approved		uc010ntk.1	P34903	OTTHUMG00000024183	ENST00000370314.4:c.559A>G	X.37:g.151393310T>C	ENSP00000359337:p.Ile187Val	Somatic	854.0	0.0		WXS	Illumina HiSeq	Phase_I	702.0	199.0	NM_000808	Q8TAF9	Missense_Mutation	SNP	ENST00000370314.4	37	CCDS14706.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.601978	0.46423	.	.	ENSG00000011677	ENST00000370314;ENST00000370311;ENST00000535043	T;T;T	0.77750	-1.12;-1.12;-1.12	5.46	5.46	0.80206	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.78610	0.4310	N	0.20685	0.6	0.58432	D	0.999994	P	0.47604	0.898	D	0.68192	0.956	T	0.77284	-0.2645	10	0.31617	T	0.26	.	12.3594	0.55194	0.0:0.0:0.0:1.0	.	187	P34903	GBRA3_HUMAN	V	187	ENSP00000359337:I187V;ENSP00000359334:I187V;ENSP00000443527:I187V	ENSP00000359334:I187V	I	-	1	0	GABRA3	151143966	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.826000	0.48104	1.824000	0.53156	0.441000	0.28932	ATT	.		0.388	GABRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060921.1	NM_000808	
GALNT4	8693	broad.mit.edu;bcgsc.ca	37	12	89917584	89917584	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:89917584T>C	ENST00000529983.2	-	1	999	c.743A>G	c.(742-744)gAa>gGa	p.E248G	POC1B_ENST00000393179.4_Intron|POC1B_ENST00000541909.1_Intron|POC1B-GALNT4_ENST00000547474.1_Intron|RP11-734K2.4_ENST00000605233.1_RNA|POC1B-GALNT4_ENST00000548729.1_Missense_Mutation_p.E245G|POC1B_ENST00000549035.1_Intron|POC1B_ENST00000313546.3_Intron|GALNT4_ENST00000413530.1_Intron|POC1B_ENST00000549504.1_Intron	NM_003774.4	NP_003765.2	Q8N4A0	GALT4_HUMAN	polypeptide N-acetylgalactosaminyltransferase 4	248					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(4)|kidney(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)	14						AACTGCTGTTTCATCTCTCCC	0.473																																					p.E248G		.											.	.	.	0			c.A743G						.						74.0	74.0	74.0					12																	89917584		1918	4125	6043	SO:0001583	missense	8693	exon1			GCTGTTTCATCTC	Y08564	CCDS53817.1	12q21.33	2014-03-13	2014-03-13		ENSG00000257594	ENSG00000257594	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4126	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 4"""	603565	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)"""			9804815	Standard	NM_003774		Approved	GalNAc-T4	uc001tbd.3	Q8N4A0	OTTHUMG00000166292	ENST00000529983.2:c.743A>G	12.37:g.89917584T>C	ENSP00000436604:p.Glu248Gly	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	166.0	7.0	NM_003774	B2R775|B4DMX6|O00208	Missense_Mutation	SNP	ENST00000529983.2	37	CCDS53817.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.287650	0.40494	.	.	ENSG00000259075;ENSG00000257594	ENST00000548729;ENST00000529983	T;T	0.57107	0.42;0.42	5.45	5.45	0.79879	Glycosyl transferase, family 2 (1);	.	.	.	.	T	0.55752	0.1940	L	0.48877	1.53	0.40013	D	0.975317	P;P	0.38473	0.58;0.633	B;P	0.46208	0.373;0.507	T	0.57670	-0.7771	9	0.44086	T	0.13	.	14.6838	0.69035	0.0:0.0:0.0:1.0	.	245;248	F8VUJ3;Q8N4A0	.;GALT4_HUMAN	G	245;248	ENSP00000447852:E245G;ENSP00000436604:E248G	ENSP00000436604:E248G	E	-	2	0	GALNT4;RP11-1109F11.4	88441715	1.000000	0.71417	0.872000	0.34217	0.329000	0.28539	6.646000	0.74348	2.067000	0.61834	0.533000	0.62120	GAA	.		0.473	GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388973.2	NM_003774	
GDAP2	54834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	118454654	118454654	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:118454654C>T	ENST00000369443.5	-	5	770	c.521G>A	c.(520-522)cGt>cAt	p.R174H	GDAP2_ENST00000369442.3_Missense_Mutation_p.R174H	NM_017686.3	NP_060156.1	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated protein 2	174	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				response to retinoic acid (GO:0032526)	lysosomal membrane (GO:0005765)				kidney(2)|large_intestine(3)|lung(9)|ovary(2)	16		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		AGGATAACCACGTTTTGCAGA	0.353																																					p.R174H		.											.	GDAP2	92	0			c.G521A						.						112.0	104.0	107.0					1																	118454654		2203	4300	6503	SO:0001583	missense	54834	exon5			TAACCACGTTTTG	AK000149	CCDS897.1, CCDS44201.1	1q11	2011-10-20			ENSG00000196505	ENSG00000196505			18010	protein-coding gene	gene with protein product						1021725	Standard	NM_017686		Approved	FLJ20142, dJ776P7.1, MACROD3	uc001ehf.3	Q9NXN4	OTTHUMG00000012199	ENST00000369443.5:c.521G>A	1.37:g.118454654C>T	ENSP00000358451:p.Arg174His	Somatic	433.0	0.0		WXS	Illumina HiSeq	Phase_I	354.0	273.0	NM_017686	Q96DZ0	Missense_Mutation	SNP	ENST00000369443.5	37	CCDS897.1	.	.	.	.	.	.	.	.	.	.	C	35	5.545744	0.96488	.	.	ENSG00000196505	ENST00000369443;ENST00000369442	T;T	0.22336	1.96;1.96	5.23	5.23	0.72850	Appr-1-p processing (2);	0.000000	0.85682	D	0.000000	T	0.38108	0.1028	L	0.61387	1.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.04440	-1.0951	10	0.48119	T	0.1	-9.6423	19.0551	0.93059	0.0:1.0:0.0:0.0	.	174;174	Q9NXN4-2;Q9NXN4	.;GDAP2_HUMAN	H	174	ENSP00000358451:R174H;ENSP00000358450:R174H	ENSP00000358450:R174H	R	-	2	0	GDAP2	118256177	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.174000	0.77620	2.729000	0.93468	0.650000	0.86243	CGT	.		0.353	GDAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033732.2	NM_017686	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	89933635	89933635	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:89933635C>A	ENST00000405460.2	+	11	2206	c.2110C>A	c.(2110-2112)Ccg>Acg	p.P704T		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	704	Calx-beta 5. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AGCAGTGACCCCGGATGATAT	0.423																																					p.P704T		.											.	GPR98	103	0			c.C2110A						.						69.0	64.0	66.0					5																	89933635		1824	4080	5904	SO:0001583	missense	84059	exon11			GTGACCCCGGATG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.2110C>A	5.37:g.89933635C>A	ENSP00000384582:p.Pro704Thr	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	144.0	12.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.061|2.061	-0.415274|-0.415274	0.04766|0.04766	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000504142|ENST00000405460;ENST00000296619;ENST00000399043	.|T	.|0.26957	.|1.7	5.46|5.46	-3.43|-3.43	0.04810|0.04810	.|.	1.763740|1.763740	0.02465|0.02465	N|N	0.086918|0.086918	T|T	0.13415|0.13415	0.0325|0.0325	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.09377	.|0.004	T|T	0.10567|0.10567	-1.0624|-1.0624	6|10	.|0.14252	.|T	.|0.57	.|.	1.6629|1.6629	0.02796|0.02796	0.2717:0.1765:0.3587:0.1931|0.2717:0.1765:0.3587:0.1931	.|.	.|704	.|Q8WXG9	.|GPR98_HUMAN	H|T	292|704	.|ENSP00000384582:P704T	.|ENSP00000296619:P704T	P|P	+|+	2|1	0|0	GPR98|GPR98	89969391|89969391	0.000000|0.000000	0.05858|0.05858	0.539000|0.539000	0.28077|0.28077	0.744000|0.744000	0.42396|0.42396	-0.617000|-0.617000	0.05584|0.05584	-0.761000|-0.761000	0.04670|0.04670	-0.156000|-0.156000	0.13503|0.13503	CCC|CCG	.		0.423	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
HIST1H2BB	3018	broad.mit.edu;bcgsc.ca	37	6	26043596	26043596	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:26043596G>A	ENST00000357905.2	-	1	289	c.290C>T	c.(289-291)aCg>aTg	p.T97M	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	97					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						GCGCACAGCCGTCTGAATCTC	0.557																																					p.T97M		.											.	HIST1H2BB	90	0			c.C290T						.						60.0	61.0	60.0					6																	26043596		2203	4300	6503	SO:0001583	missense	3018	exon1			ACAGCCGTCTGAA	AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.290C>T	6.37:g.26043596G>A	ENSP00000350580:p.Thr97Met	Somatic	160.0	1.0		WXS	Illumina HiSeq	Phase_I	175.0	12.0	NM_021062	Q4KN36	Missense_Mutation	SNP	ENST00000357905.2	37	CCDS4575.1	.	.	.	.	.	.	.	.	.	.	g	19.17	3.776577	0.70107	.	.	ENSG00000196226	ENST00000357905	T	0.45276	0.9	5.08	5.08	0.68730	Histone-fold (2);Histone core (1);	0.000000	0.64402	U	0.000015	T	0.70116	0.3187	M	0.93763	3.455	0.50171	D	0.999851	D	0.89917	1.0	D	0.85130	0.997	T	0.79210	-0.1897	10	0.87932	D	0	.	17.8155	0.88632	0.0:0.0:1.0:0.0	.	97	P33778	H2B1B_HUMAN	M	97	ENSP00000350580:T97M	ENSP00000350580:T97M	T	-	2	0	HIST1H2BB	26151575	1.000000	0.71417	0.998000	0.56505	0.909000	0.53808	9.789000	0.99068	2.498000	0.84270	0.467000	0.42956	ACG	.		0.557	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040083.1	NM_021062	
HTR2C	3358	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	113965762	113965762	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:113965762C>G	ENST00000276198.1	+	4	823	c.95C>G	c.(94-96)gCt>gGt	p.A32G	HTR2C_ENST00000371951.1_Missense_Mutation_p.A32G|HTR2C_ENST00000371950.3_Missense_Mutation_p.A32G	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	32					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CCAGTAGCAGCTATAGTAACT	0.388																																					p.A32G		.											.	HTR2C	133	0			c.C95G						.						115.0	109.0	111.0					X																	113965762		2203	4300	6503	SO:0001583	missense	3358	exon4			TAGCAGCTATAGT		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.95C>G	X.37:g.113965762C>G	ENSP00000276198:p.Ala32Gly	Somatic	745.0	2.0		WXS	Illumina HiSeq	Phase_I	615.0	40.0	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	37	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.679619	0.47886	.	.	ENSG00000147246	ENST00000276198;ENST00000371951;ENST00000371950	T;T;T	0.58358	0.34;0.34;0.61	4.47	3.6	0.41247	.	0.268255	0.30093	N	0.010430	T	0.29256	0.0728	N	0.14661	0.345	0.25856	N	0.983885	B;B	0.15719	0.014;0.003	B;B	0.12837	0.008;0.002	T	0.09997	-1.0649	10	0.22706	T	0.39	.	5.2619	0.15578	0.0:0.6819:0.2062:0.1118	.	32;32	B1AMW4;P28335	.;5HT2C_HUMAN	G	32	ENSP00000276198:A32G;ENSP00000361019:A32G;ENSP00000361018:A32G	ENSP00000276198:A32G	A	+	2	0	HTR2C	113872018	1.000000	0.71417	0.780000	0.31762	0.803000	0.45373	3.935000	0.56560	1.203000	0.43233	0.594000	0.82650	GCT	.		0.388	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
HTR3D	200909	broad.mit.edu;bcgsc.ca	37	3	183753882	183753882	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:183753882A>G	ENST00000382489.3	+	3	374	c.374A>G	c.(373-375)gAg>gGg	p.E125G	HTR3D_ENST00000334128.2_Intron|HTR3D_ENST00000453435.1_Intron|HTR3D_ENST00000428798.2_Missense_Mutation_p.E64G	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	125					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	GTCTTCATCGAGGAGTCGTGA	0.473																																					p.E125G		.											.	HTR3D	90	0			c.A374G						.						74.0	68.0	70.0					3																	183753882		692	1591	2283	SO:0001583	missense	200909	exon3			TCATCGAGGAGTC	AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.374A>G	3.37:g.183753882A>G	ENSP00000371929:p.Glu125Gly	Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	9.0	NM_001163646	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Missense_Mutation	SNP	ENST00000382489.3	37	CCDS54685.1	.	.	.	.	.	.	.	.	.	.	a	5.210	0.224186	0.09863	.	.	ENSG00000186090	ENST00000428798;ENST00000382489	T;T	0.77877	-1.0;-1.13	4.19	2.93	0.34026	Neurotransmitter-gated ion-channel ligand-binding (3);	0.848082	0.09901	U	0.741105	T	0.74884	0.3775	L	0.50333	1.59	0.34422	D	0.697552	P	0.39216	0.664	P	0.45538	0.484	T	0.75961	-0.3133	10	0.36615	T	0.2	-0.9893	6.4257	0.21768	0.7823:0.0:0.0:0.2177	.	125	Q70Z44	5HT3D_HUMAN	G	64;125	ENSP00000405409:E64G;ENSP00000371929:E125G	ENSP00000371929:E125G	E	+	2	0	HTR3D	185236576	0.703000	0.27826	0.461000	0.27105	0.002000	0.02628	2.521000	0.45563	1.888000	0.54679	0.478000	0.44815	GAG	.		0.473	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346289.1	NM_182537	
HTT	3064	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3230361	3230361	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:3230361G>T	ENST00000355072.5	+	58	8013	c.7868G>T	c.(7867-7869)tGg>tTg	p.W2623L		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2623					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CACTCCGTGTGGCTGGGGAAC	0.647																																					p.W2623L		.											.	HTT	281	0			c.G7868T						.						48.0	55.0	53.0					4																	3230361		2077	4185	6262	SO:0001583	missense	3064	exon58			CCGTGTGGCTGGG	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.7868G>T	4.37:g.3230361G>T	ENSP00000347184:p.Trp2623Leu	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	38.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	37	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890780	0.72524	.	.	ENSG00000197386	ENST00000355072	T	0.62232	0.04	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	L	0.56769	1.78	0.80722	D	1	P	0.36990	0.577	B	0.33568	0.166	T	0.67337	-0.5696	10	0.72032	D	0.01	.	18.7031	0.91627	0.0:0.0:1.0:0.0	.	2623	P42858	HD_HUMAN	L	2623	ENSP00000347184:W2623L	ENSP00000347184:W2623L	W	+	2	0	HTT	3200159	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.118000	0.94355	2.511000	0.84671	0.563000	0.77884	TGG	.		0.647	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
IL9	3578	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	135231424	135231424	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:135231424G>A	ENST00000274520.1	-	1	92	c.82C>T	c.(82-84)Ctg>Ttg	p.L28L	GS1-39E22.2_ENST00000522973.1_RNA	NM_000590.1	NP_000581.1	P15248	IL9_HUMAN	interleukin 9	28					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interleukin-5 biosynthetic process (GO:0045407)	extracellular space (GO:0005615)				large_intestine(3)|lung(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTGATGTCCAGGATCCCCGCC	0.552																																					p.L28L		.											.	IL9	90	0			c.C82T						.						70.0	73.0	72.0					5																	135231424		2203	4300	6503	SO:0001819	synonymous_variant	3578	exon1			TGTCCAGGATCCC	S63356	CCDS4189.1	5q31-q35	2008-07-18			ENSG00000145839	ENSG00000145839		"""Interleukins and interleukin receptors"""	6029	protein-coding gene	gene with protein product	"""p40 T-cell and mast cell growth factor"", ""T-cell growth factor p40"", ""p40 cytokine"", ""homolog of mouse T cell and mast cell growth factor 40"""	146931				8379467	Standard	NM_000590		Approved	IL-9, HP40, P40	uc003lbb.1	P15248	OTTHUMG00000129147	ENST00000274520.1:c.82C>T	5.37:g.135231424G>A		Somatic	216.0	1.0		WXS	Illumina HiSeq	Phase_I	250.0	22.0	NM_000590		Silent	SNP	ENST00000274520.1	37	CCDS4189.1																																																																																			.		0.552	IL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251210.1	NM_000590	
INADL	10207	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	62237159	62237159	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:62237159A>T	ENST00000371158.2	+	6	695	c.581A>T	c.(580-582)gAt>gTt	p.D194V	INADL_ENST00000316485.6_Missense_Mutation_p.D194V	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	194	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						ACGCCATTGGATCAGAACATT	0.363																																					p.D194V		.											.	INADL	94	0			c.A581T						.						135.0	123.0	127.0					1																	62237159		2203	4300	6503	SO:0001583	missense	10207	exon6			CATTGGATCAGAA	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.581A>T	1.37:g.62237159A>T	ENSP00000360200:p.Asp194Val	Somatic	829.0	1.0		WXS	Illumina HiSeq	Phase_I	753.0	83.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	37	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	15.81	2.941933	0.53079	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.25579	1.79;1.79	4.67	4.67	0.58626	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000005	T	0.41465	0.1160	L	0.41356	1.27	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.22138	-1.0225	10	0.48119	T	0.1	.	14.1115	0.65123	1.0:0.0:0.0:0.0	.	194;194;194	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	V	194	ENSP00000360200:D194V;ENSP00000326199:D194V	ENSP00000255202:D194V	D	+	2	0	INADL	62009747	1.000000	0.71417	0.989000	0.46669	0.281000	0.26958	8.578000	0.90777	1.746000	0.51805	0.377000	0.23210	GAT	.		0.363	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	
INF2	64423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105174811	105174811	+	Missense_Mutation	SNP	G	G	A	rs530285485		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr14:105174811G>A	ENST00000392634.4	+	9	1886	c.1774G>A	c.(1774-1776)Gcc>Acc	p.A592T	INF2_ENST00000330634.7_Missense_Mutation_p.A592T	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	592	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CAGCCCCGACGCCGAGGCTGT	0.682											OREG0022959	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0014	5008	,	,		15905	0.0		0.0	False		,,,				2504	0.0				p.A592T		.											.	INF2	492	0			c.G1774A						.						35.0	41.0	39.0					14																	105174811		1936	4130	6066	SO:0001583	missense	64423	exon9			CCCGACGCCGAGG	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.1774G>A	14.37:g.105174811G>A	ENSP00000376410:p.Ala592Thr	Somatic	84.0	0.0	1387	WXS	Illumina HiSeq	Phase_I	85.0	15.0	NM_022489	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	ENST00000392634.4	37	CCDS9989.2	.	.	.	.	.	.	.	.	.	.	G	2.400	-0.337744	0.05278	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	T;T	0.17054	2.3;2.3	4.04	-7.77	0.01227	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.650666	0.15095	N	0.280854	T	0.05456	0.0144	N	0.20685	0.6	0.09310	N	1	B;B	0.12013	0.004;0.005	B;B	0.08055	0.001;0.003	T	0.34403	-0.9830	10	0.12766	T	0.61	.	1.837	0.03142	0.2573:0.2406:0.3818:0.1203	.	592;592	Q27J81-2;Q27J81	.;INF2_HUMAN	T	592	ENSP00000376406:A592T;ENSP00000376410:A592T	ENSP00000252527:A60T	A	+	1	0	INF2	104245856	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.152000	0.10159	-1.360000	0.02172	0.561000	0.74099	GCC	.		0.682	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000074371.4	NM_022489	
INSRR	3645	broad.mit.edu;bcgsc.ca	37	1	156828412	156828412	+	Start_Codon_SNP	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:156828412A>T	ENST00000368195.3	-	1	398	c.2T>A	c.(1-3)aTg>aAg	p.M1K	NTRK1_ENST00000392302.2_Intron|NTRK1_ENST00000358660.3_5'Flank|NTRK1_ENST00000524377.1_5'Flank|NTRK1_ENST00000368196.3_5'Flank	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	1					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AGGCACTGCCATTGTCCCAGC	0.597																																					p.M1K		.											.	INSRR	1403	0			c.T2A						.						101.0	92.0	95.0					1																	156828412		2203	4300	6503	SO:0001582	initiator_codon_variant	3645	exon1			ACTGCCATTGTCC	J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.2T>A	1.37:g.156828412A>T	ENSP00000357178:p.Met1Lys	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	8.0	NM_014215	O60724|Q5VZS3	Missense_Mutation	SNP	ENST00000368195.3	37	CCDS1160.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.983944	0.53827	.	.	ENSG00000027644	ENST00000368195	T	0.73789	-0.78	4.97	4.97	0.65823	.	0.000000	0.51477	D	0.000092	T	0.74489	0.3723	.	.	.	0.80722	D	1	P	0.40431	0.717	P	0.52189	0.692	T	0.79167	-0.1915	9	0.87932	D	0	.	10.963	0.47395	1.0:0.0:0.0:0.0	.	1	P14616	INSRR_HUMAN	K	1	ENSP00000357178:M1K	ENSP00000357178:M1K	M	-	2	0	INSRR	155095036	1.000000	0.71417	0.978000	0.43139	0.026000	0.11368	4.269000	0.58890	2.084000	0.62774	0.533000	0.62120	ATG	.		0.597	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098929.1	NM_014215	Missense_Mutation
INTS8	55656	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	95839952	95839952	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:95839952C>A	ENST00000523731.1	+	4	582	c.449C>A	c.(448-450)gCa>gAa	p.A150E	INTS8_ENST00000447247.1_Missense_Mutation_p.A150E	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	150					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					TTCTTCAGGGCAATTAGGACA	0.353																																					p.A150E		.											.	INTS8	90	0			c.C449A						.						109.0	113.0	112.0					8																	95839952		2203	4300	6503	SO:0001583	missense	55656	exon4			TCAGGGCAATTAG	AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.449C>A	8.37:g.95839952C>A	ENSP00000430338:p.Ala150Glu	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	271.0	11.0	NM_017864	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Missense_Mutation	SNP	ENST00000523731.1	37	CCDS34925.1	.	.	.	.	.	.	.	.	.	.	C	32	5.168172	0.94768	.	.	ENSG00000164941	ENST00000522171;ENST00000519457;ENST00000519053;ENST00000523731;ENST00000447247	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.78329	0.4266	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.76501	-0.2936	9	0.54805	T	0.06	-0.7547	20.5948	0.99439	0.0:1.0:0.0:0.0	.	150;150	Q75QN2;Q75QN2-2	INT8_HUMAN;.	E	109;103;41;150;150	.	ENSP00000343274:A150E	A	+	2	0	INTS8	95909128	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.346000	0.79347	2.873000	0.98535	0.563000	0.77884	GCA	.		0.353	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379794.1	NM_017864	
ITGAD	3681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31426269	31426269	+	Missense_Mutation	SNP	G	G	A	rs200483957		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr16:31426269G>A	ENST00000389202.2	+	18	2289	c.2240G>A	c.(2239-2241)cGt>cAt	p.R747H		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	747					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CAGAACCTGCGTCCTGTGCTG	0.547																																					p.R747H		.											.	ITGAD	226	0			c.G2240A						.	G	HIS/ARG	0,4394		0,0,2197	115.0	103.0	107.0		2240	3.0	0.5	16		107	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ITGAD	NM_005353.2	29	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	747/1162	31426269	1,12993	2197	4300	6497	SO:0001583	missense	3681	exon18			ACCTGCGTCCTGT	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.2240G>A	16.37:g.31426269G>A	ENSP00000373854:p.Arg747His	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	50.0	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	37	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	8.869	0.948792	0.18356	0.0	1.16E-4	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.46819	0.86	5.03	3.04	0.35103	Integrin alpha-2 (1);	.	.	.	.	T	0.46151	0.1378	M	0.80422	2.495	0.20764	N	0.999857	B;B	0.34226	0.443;0.443	B;B	0.27715	0.082;0.082	T	0.41197	-0.9522	9	0.56958	D	0.05	.	8.1469	0.31117	0.1879:0.0:0.8121:0.0	.	763;747	Q59H14;Q13349	.;ITAD_HUMAN	H	763;747	ENSP00000373854:R747H	ENSP00000373854:R747H	R	+	2	0	ITGAD	31333770	0.000000	0.05858	0.542000	0.28115	0.127000	0.20565	-0.442000	0.06871	0.524000	0.28502	0.195000	0.17529	CGT	.		0.547	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	4726834	4726834	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:4726834C>T	ENST00000443694.2	+	27	3601	c.3601C>T	c.(3601-3603)Cgg>Tgg	p.R1201W	ITPR1_ENST00000302640.8_Missense_Mutation_p.R1201W|ITPR1_ENST00000423119.2_Missense_Mutation_p.R1207W|ITPR1_ENST00000357086.4_Missense_Mutation_p.R1207W|ITPR1_ENST00000456211.2_Missense_Mutation_p.R1192W|ITPR1_ENST00000354582.6_Missense_Mutation_p.R1216W|ITPR1_ENST00000544951.1_Intron			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1216					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GCGTCTGCTCCGGAACATGGG	0.542																																					p.R1207W		.											.	ITPR1	710	0			c.C3619T						.						41.0	40.0	40.0					3																	4726834		2079	4222	6301	SO:0001583	missense	3708	exon30			CTGCTCCGGAACA	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.3601C>T	3.37:g.4726834C>T	ENSP00000401671:p.Arg1201Trp	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	30.0	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003942	0.54254	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.97553	-4.43;-4.43;-4.43;-4.43;-4.43;-4.43	5.25	1.08	0.20341	Intracellular calcium-release channel (1);	0.049033	0.85682	N	0.000000	D	0.97785	0.9273	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.975	D	0.96915	0.9670	10	0.87932	D	0	.	10.0029	0.41940	0.5879:0.3431:0.0:0.069	.	1216;1207	Q14643;G5E9P1	ITPR1_HUMAN;.	W	1216;1201;1216;1207;1207;1192;1201	ENSP00000306253:R1201W;ENSP00000346595:R1216W;ENSP00000405934:R1207W;ENSP00000349597:R1207W;ENSP00000397885:R1192W;ENSP00000401671:R1201W	ENSP00000306253:R1201W	R	+	1	2	ITPR1	4701834	0.832000	0.29368	0.996000	0.52242	0.486000	0.33341	1.274000	0.33132	0.164000	0.19529	-0.293000	0.09583	CGG	.		0.542	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
KANSL3	55683	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	97285440	97285440	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:97285440G>C	ENST00000431828.1	-	4	522	c.446C>G	c.(445-447)tCt>tGt	p.S149C	KANSL3_ENST00000599854.1_Missense_Mutation_p.S62C|KANSL3_ENST00000487070.1_Intron|KANSL3_ENST00000435669.1_Missense_Mutation_p.S62C|KANSL3_ENST00000440133.1_Intron|KANSL3_ENST00000441706.2_Missense_Mutation_p.S62C			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	149					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AAGCCGGTCAGACTGCAGGGC	0.542																																					p.S149C		.											.	.	.	0			c.C446G						.						33.0	35.0	34.0					2																	97285440		1938	4138	6076	SO:0001583	missense	55683	exon4			CGGTCAGACTGCA	BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.446C>G	2.37:g.97285440G>C	ENSP00000396749:p.Ser149Cys	Somatic	229.0	0.0		WXS	Illumina HiSeq	Phase_I	302.0	158.0	NM_001115016	A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	ENST00000431828.1	37	CCDS46361.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127703	0.77549	.	.	ENSG00000114982	ENST00000354204;ENST00000447759;ENST00000431828;ENST00000441706;ENST00000452268;ENST00000435669	T	0.49139	0.79	5.49	3.64	0.41730	.	0.055620	0.64402	D	0.000001	T	0.57403	0.2051	L	0.42245	1.32	0.38769	D	0.954504	B;D;B	0.76494	0.0;0.999;0.0	B;D;B	0.63192	0.0;0.912;0.0	T	0.61964	-0.6954	10	0.62326	D	0.03	.	13.8808	0.63682	0.0:0.292:0.708:0.0	.	149;62;37	Q9P2N6-3;Q9P2N6-5;Q9P2N6-6	.;.;.	C	62;37;149;62;62;62	ENSP00000396749:S149C	ENSP00000346144:S62C	S	-	2	0	KIAA1310	96649167	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.320000	0.65841	0.635000	0.30488	0.655000	0.94253	TCT	.		0.542	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339040.2	NM_017991	
KCNV2	169522	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	2718691	2718691	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:2718691C>T	ENST00000382082.3	+	1	1190	c.952C>T	c.(952-954)Ctg>Ttg	p.L318L		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	318					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		GCTCGAGTACCTGCTGCGCCT	0.682																																					p.L318L		.											.	KCNV2	515	0			c.C952T						.						44.0	49.0	47.0					9																	2718691		2203	4299	6502	SO:0001819	synonymous_variant	169522	exon1			GAGTACCTGCTGC	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.952C>T	9.37:g.2718691C>T		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	9.0	NM_133497	Q5T6X0	Silent	SNP	ENST00000382082.3	37	CCDS6447.1	.	.	.	.	.	.	.	.	.	.	C	4.290	0.052959	0.08291	.	.	ENSG00000168263	ENST00000423608	.	.	.	5.22	3.4	0.38934	.	.	.	.	.	T	0.55033	0.1895	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47861	-0.9084	4	.	.	.	.	6.4921	0.22121	0.1286:0.6578:0.0:0.2137	.	.	.	.	L	268	.	.	P	+	2	0	KCNV2	2708691	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	1.001000	0.29783	0.610000	0.30035	-0.253000	0.11424	CCT	.		0.682	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
KEL	3792	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	142639989	142639989	+	Silent	SNP	G	G	A	rs367661434		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:142639989G>A	ENST00000355265.2	-	17	2388	c.1914C>T	c.(1912-1914)gaC>gaT	p.D638D		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	638					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GCCCCCCAACGTCTGCAGCAT	0.502																																					p.D638D		.											.	KEL	93	0			c.C1914T						.	G		0,4406		0,0,2203	103.0	95.0	98.0		1914	-1.9	0.0	7		98	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KEL	NM_000420.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		638/733	142639989	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3792	exon17			CCCAACGTCTGCA	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1914C>T	7.37:g.142639989G>A		Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	8.0	NM_000420	B2RBV4|Q96RS8|Q99885	Silent	SNP	ENST00000355265.2	37	CCDS34766.1																																																																																			.		0.502	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347671.2	NM_000420	
KIRREL	55243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158059385	158059385	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:158059385G>A	ENST00000359209.6	+	9	1205	c.1138G>A	c.(1138-1140)Gtg>Atg	p.V380M	KIRREL_ENST00000368172.1_Missense_Mutation_p.V194M|KIRREL_ENST00000416935.2_Missense_Mutation_p.V280M|KIRREL_ENST00000368173.3_Missense_Mutation_p.V396M|KIRREL_ENST00000360089.4_Missense_Mutation_p.V216M|KIRREL_ENST00000392272.2_Missense_Mutation_p.V277M			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	380	Ig-like C2-type 4.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					TCGAATCGGAGTGGCTGAGCG	0.622																																					p.V380M		.											.	KIRREL	91	0			c.G1138A						.						56.0	59.0	58.0					1																	158059385		2203	4300	6503	SO:0001583	missense	55243	exon9			ATCGGAGTGGCTG	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1138G>A	1.37:g.158059385G>A	ENSP00000352138:p.Val380Met	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	47.0	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	37	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792257	0.90453	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.12569	2.67;2.67;2.67;2.67;2.67;2.67	4.71	4.71	0.59529	Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.441677	0.16510	N	0.211273	T	0.16171	0.0389	L	0.28344	0.845	0.80722	D	1	P;D;D;D	0.71674	0.742;0.998;0.997;0.997	P;D;D;D	0.70227	0.644;0.968;0.964;0.964	T	0.03139	-1.1068	10	0.51188	T	0.08	-11.7061	15.1859	0.73002	0.0:0.0:1.0:0.0	.	280;216;194;380	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	M	216;396;277;380;280;194	ENSP00000353202:V216M;ENSP00000357155:V396M;ENSP00000376098:V277M;ENSP00000352138:V380M;ENSP00000389674:V280M;ENSP00000357154:V194M	ENSP00000352138:V380M	V	+	1	0	KIRREL	156326009	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.135000	0.94478	2.434000	0.82447	0.460000	0.39030	GTG	.		0.622	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
LAMC1	3915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	183085929	183085929	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:183085929A>G	ENST00000258341.4	+	8	1712	c.1455A>G	c.(1453-1455)gaA>gaG	p.E485E		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	485	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TTAATCTGGAATCATCTAATC	0.383																																					p.E485E		.											.	LAMC1	252	0			c.A1455G						.						114.0	111.0	112.0					1																	183085929		2203	4300	6503	SO:0001819	synonymous_variant	3915	exon8			TCTGGAATCATCT	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.1455A>G	1.37:g.183085929A>G		Somatic	293.0	0.0		WXS	Illumina HiSeq	Phase_I	572.0	150.0	NM_002293	Q5VYE7	Silent	SNP	ENST00000258341.4	37	CCDS1351.1																																																																																			.		0.383	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
LEPREL1	55214	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	189700835	189700835	+	Splice_Site	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:189700835C>T	ENST00000319332.5	-	8	1521	c.1324G>A	c.(1324-1326)Ggt>Agt	p.G442S	LEPREL1_ENST00000427335.2_Splice_Site_p.G261S	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	442					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	AGCTACTTACCTTCTCTTAGG	0.473																																					p.G442S		.											.	LEPREL1	155	0			c.G1324A						.						174.0	166.0	169.0					3																	189700835		2203	4300	6503	SO:0001630	splice_region_variant	55214	exon8			ACTTACCTTCTCT		CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.1324+1G>A	3.37:g.189700835C>T		Somatic	396.0	0.0		WXS	Illumina HiSeq	Phase_I	365.0	21.0	NM_018192	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	ENST00000319332.5	37	CCDS3294.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.782428	0.70222	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	T;T	0.36520	1.25;1.6	5.25	5.25	0.73442	.	0.311844	0.34110	N	0.004249	T	0.48295	0.1492	L	0.44542	1.39	0.80722	D	1	D	0.56035	0.974	P	0.58013	0.831	T	0.26985	-1.0087	9	.	.	.	-13.1508	17.7955	0.88568	0.0:1.0:0.0:0.0	.	442	Q8IVL5	P3H2_HUMAN	S	442;261	ENSP00000316881:G442S;ENSP00000408947:G261S	.	G	-	1	0	LEPREL1	191183529	1.000000	0.71417	0.998000	0.56505	0.427000	0.31564	4.636000	0.61339	2.622000	0.88805	0.637000	0.83480	GGT	.		0.473	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	Missense_Mutation
LHCGR	3973	broad.mit.edu;bcgsc.ca	37	2	48914906	48914906	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:48914906G>C	ENST00000294954.7	-	11	2051	c.2030C>G	c.(2029-2031)aCc>aGc	p.T677S	LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000405626.1_Missense_Mutation_p.T650S|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000401907.1_3'UTR|LHCGR_ENST00000344775.3_Missense_Mutation_p.T615S	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	677					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CAACTTCAAGGTGGATTGAGA	0.408																																					p.T677S		.											.	LHCGR	589	0			c.C2030G						.						123.0	119.0	120.0					2																	48914906		2203	4300	6503	SO:0001583	missense	3973	exon11			TTCAAGGTGGATT		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.2030C>G	2.37:g.48914906G>C	ENSP00000294954:p.Thr677Ser	Somatic	215.0	0.0		WXS	Illumina HiSeq	Phase_I	227.0	11.0	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	37	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.303113	0.01353	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.76060	-0.99;-0.83;-0.89	5.4	2.61	0.31194	.	0.836654	0.10921	N	0.619405	T	0.58821	0.2149	L	0.37630	1.12	0.09310	N	1	B	0.21905	0.062	B	0.21708	0.036	T	0.45220	-0.9276	9	.	.	.	.	1.5246	0.02523	0.2362:0.1448:0.4693:0.1497	.	677	P22888	LSHR_HUMAN	S	615;677;650	ENSP00000344301:T615S;ENSP00000294954:T677S;ENSP00000386033:T650S	.	T	-	2	0	LHCGR	48768410	0.003000	0.15002	0.000000	0.03702	0.071000	0.16799	1.455000	0.35190	0.395000	0.25257	0.585000	0.79938	ACC	.		0.408	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
LRRK2	120892	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	40745384	40745384	+	Missense_Mutation	SNP	G	G	A	rs371284884		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:40745384G>A	ENST00000298910.7	+	44	6483	c.6425G>A	c.(6424-6426)aGa>aAa	p.R2142K		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2142					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGTCTGACGAGACGCATTTTA	0.398																																					p.R2142K		.											.	LRRK2	533	0			c.G6425A						.	G	LYS/ARG	1,4405		0,1,2202	66.0	64.0	65.0		6425	4.2	0.9	12		65	0,8600		0,0,4300	no	missense	LRRK2	NM_198578.3	26	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	2142/2528	40745384	1,13005	2203	4300	6503	SO:0001583	missense	120892	exon44			TGACGAGACGCAT	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.6425G>A	12.37:g.40745384G>A	ENSP00000298910:p.Arg2142Lys	Somatic	195.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	10.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617000	0.66672	2.27E-4	0.0	ENSG00000188906	ENST00000298910	T	0.71934	-0.61	6.06	4.24	0.50183	.	0.123348	0.64402	N	0.000001	T	0.62816	0.2459	L	0.58101	1.795	0.39344	D	0.965639	P;P	0.40681	0.528;0.727	B;B	0.33568	0.166;0.166	T	0.63332	-0.6661	10	0.37606	T	0.19	.	12.5172	0.56038	0.1337:0.0:0.8663:0.0	.	2142;2142	Q17RV3;Q5S007	.;LRRK2_HUMAN	K	2142	ENSP00000298910:R2142K	ENSP00000298910:R2142K	R	+	2	0	LRRK2	39031651	1.000000	0.71417	0.939000	0.37840	0.428000	0.31595	5.232000	0.65332	0.896000	0.36366	0.655000	0.94253	AGA	.		0.398	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57599015	57599015	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:57599015A>G	ENST00000243077.3	+	73	11784	c.11318A>G	c.(11317-11319)gAg>gGg	p.E3773G		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3773	LDL-receptor class A 31. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGCTCTGACGAGGAGGACTGC	0.657																																					p.E3773G		.											.	LRP1	596	0			c.A11318G						.						66.0	64.0	65.0					12																	57599015		2203	4300	6503	SO:0001583	missense	4035	exon73			CTGACGAGGAGGA	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.11318A>G	12.37:g.57599015A>G	ENSP00000243077:p.Glu3773Gly	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	19.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.494334	0.64186	.	.	ENSG00000123384	ENST00000243077	D	0.97959	-4.63	4.55	3.41	0.39046	Low-density lipoprotein (LDL) receptor class A, conserved site (1);Growth factor, receptor (1);	0.148881	0.42053	D	0.000777	D	0.98207	0.9407	H	0.96805	3.885	0.80722	D	1	P	0.47484	0.896	P	0.46510	0.519	D	0.97606	1.0126	10	0.72032	D	0.01	.	9.4051	0.38457	0.9134:0.0:0.0866:0.0	.	3773	Q07954	LRP1_HUMAN	G	3773	ENSP00000243077:E3773G	ENSP00000243077:E3773G	E	+	2	0	LRP1	55885282	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.276000	0.78559	0.900000	0.36469	0.533000	0.62120	GAG	.		0.657	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LTN1	26046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	30354673	30354673	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr21:30354673A>G	ENST00000361371.5	-	5	673	c.594T>C	c.(592-594)ctT>ctC	p.L198L	LTN1_ENST00000389194.2_Silent_p.L244L|LTN1_ENST00000389195.2_Silent_p.L244L			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	198					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TTTCTTTTATAAGATGATCCT	0.378																																					p.L244L		.											.	LTN1	530	0			c.T732C						.						81.0	80.0	81.0					21																	30354673		2203	4300	6503	SO:0001819	synonymous_variant	26046	exon5			TTTTATAAGATGA	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.594T>C	21.37:g.30354673A>G		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	87.0	NM_015565	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Silent	SNP	ENST00000361371.5	37																																																																																				.		0.378	LTN1-008	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000472108.1	NM_015565	
LYZL1	84569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	29599920	29599920	+	Splice_Site	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr10:29599920C>A	ENST00000375500.3	+	5	574	c.517C>A	c.(517-519)Caa>Aaa	p.Q173K		NM_032517.4	NP_115906.3	Q6UWQ5	LYZL1_HUMAN	lysozyme-like 1	127					cell wall macromolecule catabolic process (GO:0016998)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			central_nervous_system(1)|cervix(2)|large_intestine(2)|lung(5)|skin(1)	11		Breast(68;0.203)				CATCCTCAGGCAAGGCTGGAA	0.493																																					p.Q173K		.											.	LYZL1	90	0			c.C517A						.						151.0	144.0	147.0					10																	29599920		2203	4300	6503	SO:0001630	splice_region_variant	84569	exon5			CTCAGGCAAGGCT		CCDS31174.1	10p12.1	2004-08-02			ENSG00000120563	ENSG00000120563	3.2.1.1		30502	protein-coding gene	gene with protein product						12477932	Standard	XM_005252627		Approved	MGC33408, LYC2	uc001iul.3	Q6UWQ5	OTTHUMG00000017880	ENST00000375500.3:c.516-1C>A	10.37:g.29599920C>A		Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	104.0	NM_032517	Q5T921|Q8WW16	Missense_Mutation	SNP	ENST00000375500.3	37	CCDS31174.1	.	.	.	.	.	.	.	.	.	.	C	11.00	1.509264	0.27036	.	.	ENSG00000120563	ENST00000375500	T	0.68025	-0.3	4.95	3.97	0.46021	.	0.427338	0.23387	N	0.048730	T	0.40423	0.1116	N	0.05306	-0.075	0.35034	D	0.759021	B	0.16802	0.019	B	0.24541	0.054	T	0.44498	-0.9324	10	0.16420	T	0.52	-31.3683	7.7752	0.29033	0.1811:0.6437:0.1752:0.0	.	173	Q6UWQ5-2	.	K	173	ENSP00000364650:Q173K	ENSP00000364650:Q173K	Q	+	1	0	LYZL1	29639926	1.000000	0.71417	1.000000	0.80357	0.623000	0.37688	1.059000	0.30517	2.673000	0.90976	0.650000	0.86243	CAA	.		0.493	LYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047381.1	NM_032517	Missense_Mutation
MAPKBP1	23005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	42115228	42115228	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr15:42115228G>A	ENST00000456763.2	+	29	3620	c.3424G>A	c.(3424-3426)Gcc>Acc	p.A1142T	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.A1136T|RP11-23P13.4_ENST00000512295.1_RNA|RP11-23P13.4_ENST00000510176.1_RNA|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.A1019T|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.A975T|MAPKBP1_ENST00000514566.1_Intron	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1142										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AGGCAATGGTGCCAATCCCCC	0.647																																					p.A1142T		.											.	MAPKBP1	589	0			c.G3424A						.						58.0	50.0	53.0					15																	42115228		2203	4300	6503	SO:0001583	missense	23005	exon29			AATGGTGCCAATC	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.3424G>A	15.37:g.42115228G>A	ENSP00000393099:p.Ala1142Thr	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	31.0	NM_001128608	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	.	16.59	3.165632	0.57476	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763	T;T;T;T	0.40476	1.2;1.37;1.03;1.25	5.22	4.31	0.51392	.	0.828534	0.11372	N	0.570812	T	0.29850	0.0746	N	0.24115	0.695	0.19300	N	0.99998	B;B;B;B;P	0.43352	0.035;0.129;0.197;0.323;0.804	B;B;B;B;B	0.42282	0.013;0.046;0.036;0.114;0.382	T	0.03945	-1.0990	10	0.15066	T	0.55	-12.0694	9.6994	0.40178	0.0933:0.0:0.9067:0.0	.	975;1019;975;1142;1136	F8WC21;O60336-3;B4DYK7;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	T	1136;1019;975;1142	ENSP00000397570:A1136T;ENSP00000221214:A1019T;ENSP00000260357:A975T;ENSP00000393099:A1142T	ENSP00000221214:A1019T	A	+	1	0	MAPKBP1	39902520	0.081000	0.21417	0.661000	0.29709	0.865000	0.49528	1.427000	0.34881	1.435000	0.47434	0.561000	0.74099	GCC	.		0.647	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
MB21D1	115004	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	74161889	74161889	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:74161889C>T	ENST00000370315.3	-	1	110	c.16G>A	c.(16-18)Gga>Aga	p.G6R	MB21D1_ENST00000370318.1_Missense_Mutation_p.G6R	NM_138441.2	NP_612450.2	Q8N884	CGAS_HUMAN	Mab-21 domain containing 1	6					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|cyclic nucleotide biosynthetic process (GO:0009190)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of type I interferon production (GO:0032481)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cyclic-GMP-AMP synthase activity (GO:0061501)|DNA binding (GO:0003677)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|lung(1)	6						ATGGCCTTTCCGTGCCAAGGC	0.627																																					p.G6R		.											.	MB21D1	90	0			c.G16A						.						10.0	11.0	11.0					6																	74161889		2161	4236	6397	SO:0001583	missense	115004	exon1			CCTTTCCGTGCCA	BC012928	CCDS4978.1	6q13	2011-02-23	2011-02-23	2011-02-23	ENSG00000164430	ENSG00000164430			21367	protein-coding gene	gene with protein product		613973	"""chromosome 6 open reading frame 150"""	C6orf150			Standard	NM_138441		Approved		uc003pgx.1	Q8N884	OTTHUMG00000015034	ENST00000370315.3:c.16G>A	6.37:g.74161889C>T	ENSP00000359339:p.Gly6Arg	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	25.0	NM_138441	L0L2J9|Q14CV6|Q32NC9|Q5SWL0|Q5SWL1|Q96E45	Missense_Mutation	SNP	ENST00000370315.3	37	CCDS4978.1	.	.	.	.	.	.	.	.	.	.	C	6.306	0.424561	0.11928	.	.	ENSG00000164430	ENST00000370318;ENST00000370315;ENST00000296913	T;T	0.56941	0.43;0.6	3.59	-3.7	0.04437	.	1.610930	0.04166	N	0.324014	T	0.07548	0.0190	N	0.19112	0.55	0.09310	N	1	P	0.34826	0.471	B	0.20184	0.028	T	0.04090	-1.0978	10	0.10111	T	0.7	-0.2984	0.895	0.01262	0.148:0.2687:0.2908:0.2925	.	6	Q8N884	M21D1_HUMAN	R	6	ENSP00000359342:G6R;ENSP00000359339:G6R	ENSP00000296913:G6R	G	-	1	0	MB21D1	74218610	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	-0.790000	0.04604	-1.092000	0.03062	0.313000	0.20887	GGA	.		0.627	MB21D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041221.5	NM_138441	
MCF2L2	23101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183056602	183056602	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:183056602T>G	ENST00000328913.3	-	5	769	c.472A>C	c.(472-474)Aaa>Caa	p.K158Q	MCF2L2_ENST00000414362.2_Missense_Mutation_p.K158Q|MCF2L2_ENST00000447025.2_Missense_Mutation_p.K158Q|MCF2L2_ENST00000473233.1_Missense_Mutation_p.K158Q	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	158	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			ACTTTCGTTTTAAACTCATTT	0.418																																					p.K158Q		.											.	MCF2L2	293	0			c.A472C						.						117.0	105.0	109.0					3																	183056602		2203	4300	6503	SO:0001583	missense	23101	exon5			TCGTTTTAAACTC	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.472A>C	3.37:g.183056602T>G	ENSP00000328118:p.Lys158Gln	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	147.0	51.0	NM_015078	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.667007	0.47677	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	4.81	4.81	0.61882	Cellular retinaldehyde-binding/triple function, C-terminal (3);	0.112777	0.64402	D	0.000016	T	0.75027	0.3794	M	0.76574	2.34	0.36373	D	0.861417	P;P;P	0.52577	0.938;0.552;0.954	P;P;P	0.58331	0.837;0.661;0.759	T	0.82870	-0.0243	10	0.66056	D	0.02	.	14.0518	0.64742	0.0:0.0:0.0:1.0	.	158;158;158	Q86YR7-3;Q86YR7-2;Q86YR7	.;.;MF2L2_HUMAN	Q	158	ENSP00000328118:K158Q;ENSP00000420070:K158Q;ENSP00000388190:K158Q;ENSP00000414131:K158Q	ENSP00000328118:K158Q	K	-	1	0	MCF2L2	184539296	1.000000	0.71417	0.986000	0.45419	0.028000	0.11728	4.406000	0.59748	1.814000	0.52955	0.533000	0.62120	AAA	.		0.418	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
MDFIC	29969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	114655974	114655974	+	Silent	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:114655974T>C	ENST00000393486.1	+	5	1316	c.726T>C	c.(724-726)atT>atC	p.I242I	MDFIC_ENST00000257724.3_Silent_p.I351I	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						GCTGTGGAATTTGTTTTCCTT	0.373																																					p.I351I		.											.	MDFIC	91	0			c.T1053C						.						231.0	209.0	216.0					7																	114655974		2203	4300	6503	SO:0001819	synonymous_variant	29969	exon5			TGGAATTTGTTTT	AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.726T>C	7.37:g.114655974T>C		Somatic	225.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	106.0	NM_199072		Silent	SNP	ENST00000393486.1	37	CCDS55155.1																																																																																			.		0.373	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059968.4	NM_199072	
MERTK	10461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	112786337	112786337	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:112786337G>C	ENST00000295408.4	+	19	3153	c.2896G>C	c.(2896-2898)Ggg>Cgg	p.G966R	MERTK_ENST00000421804.2_Missense_Mutation_p.G966R|MERTK_ENST00000409780.1_Missense_Mutation_p.G790R			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	966					apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TGTTAGGAATGGGGTCTCCTG	0.532																																					p.G966R		.											.	MERTK	1463	0			c.G2896C						.						47.0	43.0	44.0					2																	112786337		2203	4300	6503	SO:0001583	missense	10461	exon19			AGGAATGGGGTCT	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.2896G>C	2.37:g.112786337G>C	ENSP00000295408:p.Gly966Arg	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	28.0	NM_006343	Q9HBB4	Missense_Mutation	SNP	ENST00000295408.4	37	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	G	4.785	0.146018	0.09134	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000409780	T;T;T	0.76186	-1.0;-1.0;-0.93	5.58	2.78	0.32641	.	0.000000	0.34067	U	0.004283	T	0.63651	0.2529	L	0.55103	1.725	0.09310	N	0.999996	B	0.22541	0.071	B	0.19666	0.026	T	0.55655	-0.8107	10	0.48119	T	0.1	-11.8275	3.6891	0.08339	0.1107:0.2531:0.5065:0.1297	.	966	Q12866	MERTK_HUMAN	R	966;966;790	ENSP00000295408:G966R;ENSP00000389152:G966R;ENSP00000387277:G790R	ENSP00000295408:G966R	G	+	1	0	MERTK	112502808	0.490000	0.26012	0.040000	0.18447	0.188000	0.23474	1.066000	0.30604	0.290000	0.22444	0.655000	0.94253	GGG	.		0.532	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254046.2		
MKRN1	23608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	140156621	140156621	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:140156621C>A	ENST00000255977.2	-	5	1041	c.817G>T	c.(817-819)Gtg>Ttg	p.V273L	MKRN1_ENST00000480552.1_Silent_p.P56P|MKRN1_ENST00000443720.2_Missense_Mutation_p.V273L|MKRN1_ENST00000474576.1_Missense_Mutation_p.V209L|MKRN1_ENST00000437223.2_Missense_Mutation_p.V7L	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	273					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					CTGCGCTGCACGGCAAATGAG	0.532																																					p.V273L		.											.	MKRN1	91	0			c.G817T						.						73.0	58.0	63.0					7																	140156621		2203	4300	6503	SO:0001583	missense	23608	exon5			GCTGCACGGCAAA	AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.817G>T	7.37:g.140156621C>A	ENSP00000255977:p.Val273Leu	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	44.0	NM_013446	A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	ENST00000255977.2	37	CCDS5860.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.593459	0.46214	.	.	ENSG00000133606	ENST00000255977;ENST00000539898;ENST00000437223;ENST00000474576;ENST00000443720	T;T;T;T	0.65916	0.98;1.46;0.98;-0.18	5.11	4.23	0.50019	Zinc finger, RING/FYVE/PHD-type (1);	0.163809	0.53938	D	0.000041	T	0.58352	0.2116	L	0.47016	1.485	0.48632	D	0.999682	P	0.43094	0.799	B	0.44163	0.443	T	0.56294	-0.8003	10	0.29301	T	0.29	.	13.6921	0.62553	0.0:0.9261:0.0:0.0739	.	273	Q9UHC7	MKRN1_HUMAN	L	273;209;7;209;273	ENSP00000255977:V273L;ENSP00000439823:V7L;ENSP00000417863:V209L;ENSP00000416369:V273L	ENSP00000255977:V273L	V	-	1	0	MKRN1	139803090	1.000000	0.71417	0.716000	0.30569	0.997000	0.91878	4.435000	0.59941	1.392000	0.46585	0.655000	0.94253	GTG	.		0.532	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348752.1	NM_013446	
MLH3	27030	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	75513372	75513372	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr14:75513372delC	ENST00000556740.1	-	1	3022	c.2987delG	c.(2986-2988)ggafs	p.G996fs	MLH3_ENST00000555671.1_5'UTR|MLH3_ENST00000355774.2_Frame_Shift_Del_p.G996fs|MLH3_ENST00000556257.1_Frame_Shift_Del_p.G996fs|MLH3_ENST00000238662.7_Frame_Shift_Del_p.G996fs|MLH3_ENST00000380968.2_5'UTR|MLH3_ENST00000544985.1_5'Flank			Q9UHC1	MLH3_HUMAN	mutL homolog 3	996					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		GTCAAGACTTCCTATCTGTTG	0.388								Mismatch excision repair (MMR)																													p.G996fs		.											.	MLH3	228	0			c.2987delG						.						111.0	117.0	115.0					14																	75513372		2203	4300	6503	SO:0001589	frameshift_variant	27030	exon2			AGACTTCCTATCT	AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.2987delG	14.37:g.75513372delC	ENSP00000452316:p.Gly996fs	Somatic	340.0	0.0		WXS	Illumina HiSeq	Phase_I	269.0	62.0	NM_014381	P49751|Q56DK9|Q9P292|Q9UHC0	Frame_Shift_Del	DEL	ENST00000556740.1	37	CCDS32123.1																																																																																			.		0.388	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415006.1	NM_014381	
MS4A6A	64231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	59947427	59947427	+	Silent	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:59947427G>T	ENST00000530839.1	-	4	651	c.159C>A	c.(157-159)atC>atA	p.I53I	MS4A6A_ENST00000529054.1_Silent_p.I81I|MS4A6A_ENST00000412309.2_Silent_p.I81I|MS4A6A_ENST00000323961.3_Silent_p.I53I|MS4A6A_ENST00000532169.1_Silent_p.I53I|MS4A6A_ENST00000533023.1_Intron|MS4A6A_ENST00000420732.2_Silent_p.I53I|MS4A6A_ENST00000528851.1_Silent_p.I53I|MS4A6A_ENST00000426738.2_Intron|MS4A6A_ENST00000529906.1_5'UTR	NM_152852.2	NP_690591.1	Q9H2W1	M4A6A_HUMAN	membrane-spanning 4-domains, subfamily A, member 6A	53						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGCCACACAAGATCTGGATAG	0.438																																					p.I81I		.											.	MS4A6A	90	0			c.C243A						.						92.0	85.0	88.0					11																	59947427		2201	4295	6496	SO:0001819	synonymous_variant	64231	exon4			ACACAAGATCTGG	AB013104	CCDS7981.1, CCDS44615.1, CCDS44616.1, CCDS58134.1	11q12.1	2008-03-25			ENSG00000110077	ENSG00000110077			13375	protein-coding gene	gene with protein product		606548		MS4A6		11245982, 11401424	Standard	NM_152852		Approved	CD20L3	uc010rla.2	Q9H2W1	OTTHUMG00000167241	ENST00000530839.1:c.159C>A	11.37:g.59947427G>T		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	86.0	NM_001247999	A8K755|F8W9K1|Q7Z4E8|Q8TBV7|Q8TEZ4|Q8TEZ5|Q96PG6|Q9H2L1|Q9H2N3|Q9H3V1|Q9HC76	Silent	SNP	ENST00000530839.1	37	CCDS7981.1																																																																																			.		0.438	MS4A6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393848.1		
MSH3	4437	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	80021280	80021280	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:80021280A>G	ENST00000265081.6	+	9	1429	c.1349A>G	c.(1348-1350)gAt>gGt	p.D450G	MSH3_ENST00000512258.1_3'UTR	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	450					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		AGTGTGCAGGATGACAGAATT	0.348								Mismatch excision repair (MMR)																													p.D450G	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3	661	0			c.A1349G						.						110.0	104.0	106.0					5																	80021280		2203	4300	6503	SO:0001583	missense	4437	exon9			TGCAGGATGACAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.1349A>G	5.37:g.80021280A>G	ENSP00000265081:p.Asp450Gly	Somatic	317.0	0.0		WXS	Illumina HiSeq	Phase_I	388.0	16.0	NM_002439	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	.	.	.	.	.	.	.	.	.	.	A	7.372	0.627023	0.14257	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.88201	-2.35	5.25	5.25	0.73442	DNA mismatch repair protein MutS, connector (2);	1.874300	0.03171	N	0.170725	D	0.91499	0.7316	N	0.20845	0.615	0.44330	D	0.997217	D	0.89917	1.0	D	0.81914	0.995	T	0.80627	-0.1298	9	.	.	.	-21.3145	14.4164	0.67153	1.0:0.0:0.0:0.0	.	450	P20585	MSH3_HUMAN	G	450;441	ENSP00000265081:D450G	.	D	+	2	0	MSH3	80057036	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	5.514000	0.67043	2.111000	0.64477	0.472000	0.43445	GAT	.		0.348	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
MTMR14	64419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	9703950	9703950	+	Splice_Site	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:9703950G>A	ENST00000296003.4	+	3	430		c.e3-1		MTMR14_ENST00000353332.5_Splice_Site|MTMR14_ENST00000351233.5_Splice_Site|MTMR14_ENST00000420925.1_Intron	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14						phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					CTGTGTGTTAGGTTTGAGAGT	0.493																																					.		.											.	MTMR14	91	0			c.309-1G>A						.						102.0	103.0	103.0					3																	9703950		2029	4192	6221	SO:0001630	splice_region_variant	64419	exon3			GTGTTAGGTTTGA	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.309-1G>A	3.37:g.9703950G>A		Somatic	204.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	39.0	NM_001077525	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Splice_Site	SNP	ENST00000296003.4	37	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.013365	0.75161	.	.	ENSG00000163719	ENST00000353332;ENST00000296003;ENST00000351233;ENST00000419048	.	.	.	6.01	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0845	0.86608	0.0:0.1269:0.8731:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTMR14	9678950	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	9.160000	0.94734	1.547000	0.49401	0.650000	0.86243	.	.		0.493	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	Intron
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	9074278	9074278	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:9074278G>A	ENST00000397910.4	-	3	13371	c.13168C>T	c.(13168-13170)Caa>Taa	p.Q4390*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4392	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGACCTGTTTGGGTGGTGATG	0.458																																					p.Q4390X		.											.	MUC16	566	0			c.C13168T						.						135.0	131.0	132.0					19																	9074278		2040	4183	6223	SO:0001587	stop_gained	94025	exon3			CTGTTTGGGTGGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13168C>T	19.37:g.9074278G>A	ENSP00000381008:p.Gln4390*	Somatic	529.0	0.0		WXS	Illumina HiSeq	Phase_I	395.0	36.0	NM_024690	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	54	22.026602	0.99945	.	.	ENSG00000181143	ENST00000397910	.	.	.	1.58	0.443	0.16587	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.605	0.17374	0.0:0.3505:0.6495:0.0	.	.	.	.	X	4390	.	ENSP00000381008:Q4390X	Q	-	1	0	MUC16	8935278	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.087000	0.14958	0.199000	0.20427	0.305000	0.20034	CAA	.		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC7	4589	hgsc.bcm.edu;broad.mit.edu	37	4	71346650	71346650	+	Nonsense_Mutation	SNP	T	T	A	rs147746777		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:71346650T>A	ENST00000304887.5	+	3	379	c.189T>A	c.(187-189)taT>taA	p.Y63*	MUC7_ENST00000514512.1_3'UTR|MUC7_ENST00000456088.1_Nonsense_Mutation_p.Y63*|MUC7_ENST00000413702.1_Nonsense_Mutation_p.Y63*	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	63					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			GAAAGTCCTATAAATGTCTGC	0.448																																					p.Y63X		.											.	MUC7	93	0			c.T189A						.						170.0	165.0	167.0					4																	71346650		2203	4300	6503	SO:0001587	stop_gained	4589	exon4			GTCCTATAAATGT	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.189T>A	4.37:g.71346650T>A	ENSP00000302021:p.Tyr63*	Somatic	214.0	0.0		WXS	Illumina HiSeq	Phase_I	273.0	12.0	NM_001145007	Q9UCD7|Q9UCD8	Nonsense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	T	14.79	2.640851	0.47153	.	.	ENSG00000171195	ENST00000413702;ENST00000505411;ENST00000456088;ENST00000304887	.	.	.	2.8	-3.52	0.04682	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.2724	1.2396	0.01960	0.1666:0.3649:0.2001:0.2684	.	.	.	.	X	63	.	ENSP00000302021:Y63X	Y	+	3	2	MUC7	71381239	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.849000	0.04322	-0.686000	0.05170	-0.256000	0.11100	TAT	T|1.000;C|0.000		0.448	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
MYEF2	50804	broad.mit.edu;mdanderson.org	37	15	48470360	48470360	+	Silent	SNP	C	C	T	rs567102663	byFrequency	TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr15:48470360C>T	ENST00000324324.7	-	1	354	c.75G>A	c.(73-75)ccG>ccA	p.P25P	MYEF2_ENST00000267836.6_Silent_p.P25P	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	25					myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		GCTCGCCCGGCGGCTCTGCGG	0.716																																					p.P25P		.											.	MYEF2	523	0			c.G75A						.						4.0	4.0	4.0					15																	48470360		2063	4013	6076	SO:0001819	synonymous_variant	50804	exon1			GCCCGGCGGCTCT	AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.75G>A	15.37:g.48470360C>T		Somatic	12.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	5.0	NM_016132	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Silent	SNP	ENST00000324324.7	37	CCDS32230.1																																																																																			.		0.716	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132	
MYH11	4629	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	15931795	15931795	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr16:15931795C>T	ENST00000300036.5	-	2	424	c.315G>A	c.(313-315)ctG>ctA	p.L105L	MYH11_ENST00000576790.2_Silent_p.L105L|MYH11_ENST00000452625.2_Silent_p.L105L|MYH11_ENST00000396324.3_Silent_p.L105L	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	105	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						ACCGCTCCCTCAGGTTGTGTA	0.517			T	CBFB	AML																																p.L105L		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11	666	0			c.G315A						.						164.0	140.0	148.0					16																	15931795		2197	4300	6497	SO:0001819	synonymous_variant	4629	exon2			CTCCCTCAGGTTG	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.315G>A	16.37:g.15931795C>T		Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	224.0	102.0	NM_001040114	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	ENST00000300036.5	37	CCDS10565.1																																																																																			.		0.517	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
MYO5B	4645	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	47500944	47500944	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr18:47500944C>T	ENST00000285039.7	-	10	1397	c.1098G>A	c.(1096-1098)ggG>ggA	p.G366G		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	366	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		TGTGCTCCACCCCTAGCAGTC	0.587																																					p.G366G		.											.	MYO5B	72	0			c.G1098A						.						142.0	140.0	141.0					18																	47500944		2129	4252	6381	SO:0001819	synonymous_variant	4645	exon10			CTCCACCCCTAGC	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1098G>A	18.37:g.47500944C>T		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	52.0	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	ENST00000285039.7	37	CCDS42436.1																																																																																			.		0.587	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
MYO6	4646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	76599823	76599823	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:76599823T>G	ENST00000369977.3	+	26	2847	c.2708T>G	c.(2707-2709)gTt>gGt	p.V903G	MYO6_ENST00000369975.1_Missense_Mutation_p.V903G|MYO6_ENST00000369981.3_Missense_Mutation_p.V903G|MYO6_ENST00000369985.4_Missense_Mutation_p.V903G	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	903					actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GATGCACTGGTTAAAAGCTCA	0.368																																					p.V903G		.											.	MYO6	92	0			c.T2708G						.						85.0	91.0	89.0					6																	76599823		2203	4300	6503	SO:0001583	missense	4646	exon26			CACTGGTTAAAAG	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2708T>G	6.37:g.76599823T>G	ENSP00000358994:p.Val903Gly	Somatic	273.0	0.0		WXS	Illumina HiSeq	Phase_I	325.0	123.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	37	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	T	19.31	3.803091	0.70682	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	T;D;T;T	0.89617	2.24;-2.54;1.64;2.24	5.84	5.84	0.93424	.	0.061435	0.64402	D	0.000004	D	0.91352	0.7272	L	0.55990	1.75	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.76575	0.988;0.731	D	0.90986	0.4831	10	0.41790	T	0.15	.	16.216	0.82217	0.0:0.0:0.0:1.0	.	903;903	Q9UM54-2;Q9UM54-1	.;.	G	903	ENSP00000358998:V903G;ENSP00000359002:V903G;ENSP00000358994:V903G;ENSP00000358992:V903G	ENSP00000358992:V903G	V	+	2	0	MYO6	76656543	1.000000	0.71417	0.984000	0.44739	0.528000	0.34623	6.970000	0.76099	2.228000	0.72767	0.482000	0.46254	GTT	.		0.368	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
MYOM2	9172	ucsc.edu;bcgsc.ca	37	8	2033424	2033424	+	Missense_Mutation	SNP	G	G	A	rs557348295		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:2033424G>A	ENST00000262113.4	+	14	1687	c.1546G>A	c.(1546-1548)Ggt>Agt	p.G516S	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	516	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)	p.G516S(1)		autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GCCTCCCACCGGTGTGCACGC	0.602													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16438	0.0		0.0	False		,,,				2504	0.0				p.G516S		.											.	MYOM2	95	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G1546A						.						77.0	67.0	70.0					8																	2033424		2203	4300	6503	SO:0001583	missense	9172	exon14			CCCACCGGTGTGC		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1546G>A	8.37:g.2033424G>A	ENSP00000262113:p.Gly516Ser	Somatic	60.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	37	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	10.62	1.400159	0.25291	.	.	ENSG00000036448	ENST00000262113	T	0.58210	0.35	5.75	3.36	0.38483	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.339342	0.31347	N	0.007816	T	0.30324	0.0761	N	0.04132	-0.27	0.80722	D	1	B	0.24092	0.097	B	0.27608	0.081	T	0.09037	-1.0693	10	0.54805	T	0.06	.	9.9768	0.41789	0.8631:0.0:0.1369:0.0	.	516	P54296	MYOM2_HUMAN	S	516	ENSP00000262113:G516S	ENSP00000262113:G516S	G	+	1	0	MYOM2	2020831	0.998000	0.40836	0.147000	0.22382	0.001000	0.01503	2.263000	0.43293	0.455000	0.26910	-0.245000	0.11935	GGT	.		0.602	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
MYT1L	23040	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	1946902	1946902	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:1946902A>T	ENST00000399161.2	-	9	1104	c.357T>A	c.(355-357)gaT>gaA	p.D119E	MYT1L_ENST00000428368.2_Missense_Mutation_p.D119E	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	119	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		cctcgtcctcatccCCTGGCT	0.582																																					p.D119E		.											.	MYT1L	95	0			c.T357A						.						98.0	97.0	97.0					2																	1946902		2096	4109	6205	SO:0001583	missense	23040	exon9			GTCCTCATCCCCT	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.357T>A	2.37:g.1946902A>T	ENSP00000382114:p.Asp119Glu	Somatic	546.0	1.0		WXS	Illumina HiSeq	Phase_I	634.0	28.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	37		.	.	.	.	.	.	.	.	.	.	A	8.695	0.908339	0.17833	.	.	ENSG00000186487	ENST00000399161;ENST00000428368	T;T	0.40225	1.04;1.04	5.37	-10.7	0.00240	.	0.544994	0.15638	N	0.252028	T	0.11153	0.0272	N	0.04880	-0.145	0.26923	N	0.966623	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.24083	-1.0170	10	0.08599	T	0.76	-2.3729	5.2159	0.15342	0.4331:0.0983:0.3837:0.0849	.	119;119	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	E	119	ENSP00000382114:D119E;ENSP00000396103:D119E	ENSP00000382114:D119E	D	-	3	2	MYT1L	1925909	0.000000	0.05858	0.280000	0.24747	0.047000	0.14425	-3.848000	0.00351	-1.533000	0.01745	-1.098000	0.02139	GAT	.		0.582	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NCAM2	4685	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	22664428	22664428	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr21:22664428G>A	ENST00000400546.1	+	5	735	c.486G>A	c.(484-486)cgG>cgA	p.R162R	NCAM2_ENST00000535285.1_Silent_p.R187R|NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000284894.7_Silent_p.R20R	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	162	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TTCCAGATCGGTTCGCTATGT	0.398																																					p.R162R		.											.	NCAM2	94	0			c.G486A						.						124.0	114.0	117.0					21																	22664428		1848	4101	5949	SO:0001819	synonymous_variant	4685	exon5			AGATCGGTTCGCT		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.486G>A	21.37:g.22664428G>A		Somatic	352.0	0.0		WXS	Illumina HiSeq	Phase_I	489.0	37.0	NM_004540	A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	ENST00000400546.1	37	CCDS42910.1																																																																																			.		0.398	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000170915.1	NM_004540	
NFIB	4781	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	14307000	14307000	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:14307000C>T	ENST00000380959.3	-	2	1023	c.550G>A	c.(550-552)Gtg>Atg	p.V184M	NFIB_ENST00000380953.1_Missense_Mutation_p.V184M|NFIB_ENST00000397581.2_Missense_Mutation_p.V184M|NFIB_ENST00000397575.3_Missense_Mutation_p.V184M|NFIB_ENST00000380921.3_Missense_Mutation_p.V184M|NFIB_ENST00000397579.2_Missense_Mutation_p.V184M|NFIB_ENST00000380934.4_Missense_Mutation_p.V210M	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B	184					anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		TGCTCCTGCACGTAGTATGCC	0.458			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																p.V210M	Esophageal Squamous(132;921 1730 14828 40753 46471)	.		Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	.	NFIB	226	0			c.G628A						.						131.0	119.0	123.0					9																	14307000		2203	4300	6503	SO:0001583	missense	4781	exon2			CCTGCACGTAGTA	U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.550G>A	9.37:g.14307000C>T	ENSP00000370346:p.Val184Met	Somatic	160.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	83.0	NM_001190738	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Missense_Mutation	SNP	ENST00000380959.3	37	CCDS6474.1	.	.	.	.	.	.	.	.	.	.	C	18.62	3.662716	0.67700	.	.	ENSG00000147862	ENST00000380934;ENST00000380959;ENST00000380953;ENST00000397575;ENST00000397581;ENST00000397579;ENST00000380921	T;T;T;T;T;T	0.55588	0.57;0.59;0.55;0.51;0.52;0.59	5.53	5.53	0.82687	CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.67813	0.2933	L	0.49126	1.545	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;P;D	0.70935	0.971;0.902;0.971	T	0.63337	-0.6660	10	0.33940	T	0.23	-3.4196	19.4694	0.94956	0.0:1.0:0.0:0.0	.	184;184;184	Q5VW27;Q5VW29;O00712	.;.;NFIB_HUMAN	M	210;184;184;184;184;184;184	ENSP00000370321:V210M;ENSP00000370346:V184M;ENSP00000370340:V184M;ENSP00000380705:V184M;ENSP00000380711:V184M;ENSP00000380709:V184M	ENSP00000370308:V184M	V	-	1	0	NFIB	14297000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.790000	0.85794	2.587000	0.87381	0.591000	0.81541	GTG	.		0.458	NFIB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055468.1	NM_005596	
NFKBIB	4793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39395721	39395721	+	Silent	SNP	C	C	A	rs142337920		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:39395721C>A	ENST00000313582.5	+	2	280	c.246C>A	c.(244-246)gcC>gcA	p.A82A	NFKBIB_ENST00000392079.3_Silent_p.A50A|NFKBIB_ENST00000572515.1_Silent_p.A82A	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	82					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GCTTCTCGGCCGGCACTGAGT	0.577																																					p.A82A	Pancreas(165;1492 2005 6979 7739 34483)	.											.	NFKBIB	658	0			c.C246A						.						168.0	163.0	165.0					19																	39395721		2203	4300	6503	SO:0001819	synonymous_variant	4793	exon2			CTCGGCCGGCACT	L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.246C>A	19.37:g.39395721C>A		Somatic	214.0	0.0		WXS	Illumina HiSeq	Phase_I	326.0	130.0	NM_002503	A8K3F4|Q96BJ7	Silent	SNP	ENST00000313582.5	37	CCDS12524.1																																																																																			C|1.000;T|0.000		0.577	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438155.1	NM_002503	
NFX1	4799	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33351695	33351695	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:33351695G>A	ENST00000379540.3	+	16	2624	c.2562G>A	c.(2560-2562)caG>caA	p.Q854Q	NFX1_ENST00000379521.4_Silent_p.Q854Q|Y_RNA_ENST00000363674.1_RNA	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	854					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		CCTGCAAGCAGCCCTGCACCA	0.572																																					p.Q854Q		.											.	NFX1	91	0			c.G2562A						.						106.0	101.0	103.0					9																	33351695		2203	4300	6503	SO:0001819	synonymous_variant	4799	exon16			CAAGCAGCCCTGC	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.2562G>A	9.37:g.33351695G>A		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	91.0	16.0	NM_147133	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Silent	SNP	ENST00000379540.3	37	CCDS6538.1																																																																																			.		0.572	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
NOS1	4842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	117696859	117696859	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr12:117696859C>A	ENST00000338101.4	-	14	2448	c.2444G>T	c.(2443-2445)gGc>gTc	p.G815V	NOS1_ENST00000317775.6_Missense_Mutation_p.G815V|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ATCTCCATTGCCAAAGGTGCT	0.502																																					p.G815V	Esophageal Squamous(162;1748 2599 51982 52956)	.											.	NOS1	154	0			c.G2444T						.						110.0	108.0	109.0					12																	117696859		2030	4203	6233	SO:0001583	missense	4842	exon15			CCATTGCCAAAGG		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.2444G>T	12.37:g.117696859C>A	ENSP00000337459:p.Gly815Val	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	39.0	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.757750	0.89843	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.73789	-0.78;-0.78	4.95	4.95	0.65309	Flavodoxin/nitric oxide synthase (2);	0.000000	0.85682	D	0.000000	D	0.91646	0.7360	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94580	0.7778	10	0.72032	D	0.01	-28.7058	17.9604	0.89083	0.0:1.0:0.0:0.0	.	815	P29475	NOS1_HUMAN	V	710;815;815;815	ENSP00000320758:G815V;ENSP00000337459:G815V	ENSP00000320758:G815V	G	-	2	0	NOS1	116181242	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.555000	0.82223	2.560000	0.86352	0.655000	0.94253	GGC	.		0.502	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
NOX1	27035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100105359	100105359	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:100105359G>A	ENST00000372966.3	-	9	1119	c.914C>T	c.(913-915)tCc>tTc	p.S305F	NOX1_ENST00000217885.5_Missense_Mutation_p.S305F|NOX1_ENST00000372960.4_Missense_Mutation_p.S268F|NOX1_ENST00000372964.1_Intron	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	305	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						CAAAACTTTGGATGGGTGCAT	0.448																																					p.S305F		.											.	NOX1	131	0			c.C914T						.						32.0	28.0	30.0					X																	100105359		2202	4297	6499	SO:0001583	missense	27035	exon9			ACTTTGGATGGGT	AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.914C>T	X.37:g.100105359G>A	ENSP00000362057:p.Ser305Phe	Somatic	248.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	103.0	NM_013955	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	ENST00000372966.3	37	CCDS14474.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853958	0.32791	.	.	ENSG00000007952	ENST00000372966;ENST00000217885;ENST00000372960	T;T;T	0.15256	2.44;2.44;2.44	3.87	3.87	0.44632	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.141960	0.47852	D	0.000210	T	0.30008	0.0751	M	0.90705	3.14	0.58432	D	0.999994	P;B;B	0.42871	0.792;0.188;0.18	B;B;B	0.41619	0.361;0.162;0.25	T	0.36744	-0.9735	10	0.36615	T	0.2	-6.1232	13.7359	0.62817	0.0:0.0:1.0:0.0	.	268;305;305	A6NGA6;Q9Y5S8-3;Q9Y5S8	.;.;NOX1_HUMAN	F	305;305;268	ENSP00000362057:S305F;ENSP00000217885:S305F;ENSP00000362051:S268F	ENSP00000217885:S305F	S	-	2	0	NOX1	99992015	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.678000	0.61641	1.767000	0.52121	0.422000	0.28245	TCC	.		0.448	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057495.1	NM_007052	
OR10T2	128360	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	158369189	158369189	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:158369189T>C	ENST00000334438.1	-	1	67	c.68A>G	c.(67-69)gAg>gGg	p.E23G		NM_001004475.1	NP_001004475.1	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T, member 2	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_hematologic(112;0.0378)					CAGCTGGAGCTCCCCCAGGCT	0.473																																					p.E23G		.											.	OR10T2	70	0			c.A68G						.						34.0	39.0	37.0					1																	158369189		2203	4300	6503	SO:0001583	missense	128360	exon1			TGGAGCTCCCCCA	AB065643	CCDS30895.1	1q23.1	2012-08-09			ENSG00000186306	ENSG00000186306		"""GPCR / Class A : Olfactory receptors"""	14816	protein-coding gene	gene with protein product							Standard	NM_001004475		Approved		uc010pih.2	Q8NGX3	OTTHUMG00000017521	ENST00000334438.1:c.68A>G	1.37:g.158369189T>C	ENSP00000334115:p.Glu23Gly	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	17.0	NM_001004475	Q6IF98	Missense_Mutation	SNP	ENST00000334438.1	37	CCDS30895.1	.	.	.	.	.	.	.	.	.	.	T	11.84	1.759778	0.31137	.	.	ENSG00000186306	ENST00000334438	T	0.00444	7.4	4.65	3.5	0.40072	.	0.000000	0.38381	U	0.001720	T	0.00178	0.0005	L	0.58302	1.8	0.09310	N	1	P	0.47409	0.895	B	0.43155	0.41	T	0.42732	-0.9434	10	0.52906	T	0.07	.	10.6373	0.45573	0.0:0.0:0.1615:0.8385	.	23	Q8NGX3	O10T2_HUMAN	G	23	ENSP00000334115:E23G	ENSP00000334115:E23G	E	-	2	0	OR10T2	156635813	0.030000	0.19436	0.268000	0.24571	0.992000	0.81027	2.344000	0.44010	0.779000	0.33543	0.482000	0.46254	GAG	.		0.473	OR10T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046371.1	NM_001004475	
OR5D18	219438	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	55587248	55587248	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:55587248T>C	ENST00000333976.4	+	1	163	c.143T>C	c.(142-144)gTg>gCg	p.V48A		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				GGGTTGATTGTGATCATCAAA	0.458																																					p.V48A		.											.	OR5D18	71	0			c.T143C						.						219.0	200.0	206.0					11																	55587248		2200	4296	6496	SO:0001583	missense	219438	exon1			TGATTGTGATCAT	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.143T>C	11.37:g.55587248T>C	ENSP00000335025:p.Val48Ala	Somatic	467.0	1.0		WXS	Illumina HiSeq	Phase_I	475.0	30.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	37	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	3.437	-0.114934	0.06881	.	.	ENSG00000186119	ENST00000333976	T	0.01119	5.31	4.84	0.947	0.19555	GPCR, rhodopsin-like superfamily (1);	0.730031	0.11269	N	0.581735	T	0.00815	0.0027	N	0.16166	0.38	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.47636	-0.9102	10	0.20046	T	0.44	-3.375	6.379	0.21523	0.0:0.1328:0.1375:0.7297	.	48	Q8NGL1	OR5DI_HUMAN	A	48	ENSP00000335025:V48A	ENSP00000335025:V48A	V	+	2	0	OR5D18	55343824	0.000000	0.05858	0.004000	0.12327	0.285000	0.27093	-0.425000	0.07017	0.339000	0.23719	0.514000	0.50259	GTG	.		0.458	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
OR7E24	26648	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	9362317	9362317	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:9362317T>C	ENST00000456448.1	+	1	712	c.598T>C	c.(598-600)Tct>Cct	p.S200P		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						CTGTGACCCTTCTCAACTCCT	0.413																																					p.S200P		.											.	OR7E24	47	0			c.T598C						.						69.0	72.0	71.0					19																	9362317		1945	4144	6089	SO:0001583	missense	26648	exon1			GACCCTTCTCAAC	Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.598T>C	19.37:g.9362317T>C	ENSP00000387523:p.Ser200Pro	Somatic	309.0	0.0		WXS	Illumina HiSeq	Phase_I	271.0	18.0	NM_001079935	B9EJD9|Q9UPJ1	Missense_Mutation	SNP	ENST00000456448.1	37	CCDS45955.1	.	.	.	.	.	.	.	.	.	.	t	7.759	0.705086	0.15172	.	.	ENSG00000237521	ENST00000456448	T	0.00026	8.94	2.21	-4.42	0.03579	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.13043	0.29	0.09310	N	1	D	0.71674	0.998	D	0.74674	0.984	T	0.44742	-0.9308	9	0.30854	T	0.27	.	0.6522	0.00828	0.2432:0.2341:0.3333:0.1894	.	200	Q6IFN5	O7E24_HUMAN	P	200	ENSP00000387523:S200P	ENSP00000387523:S200P	S	+	1	0	OR7E24	9223317	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	-3.223000	0.00551	-1.444000	0.01950	0.358000	0.22013	TCT	.		0.413	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449006.1		
OR8K1	390157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	56113637	56113637	+	Silent	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:56113637T>C	ENST00000279783.2	+	1	217	c.123T>C	c.(121-123)taT>taC	p.Y41Y		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					TCATCATATATCTGGTCACAG	0.463										HNSCC(65;0.19)																											p.Y41Y		.											.	OR8K1	70	0			c.T123C						.						145.0	129.0	134.0					11																	56113637		2201	4296	6497	SO:0001819	synonymous_variant	390157	exon1			CATATATCTGGTC	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.123T>C	11.37:g.56113637T>C		Somatic	374.0	0.0		WXS	Illumina HiSeq	Phase_I	343.0	21.0	NM_001002907	B9EJB1|Q6IFC3|Q96RC1	Silent	SNP	ENST00000279783.2	37	CCDS31528.1																																																																																			.		0.463	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391605.1	NM_001002907	
PAK3	5063	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	110439120	110439120	+	Silent	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:110439120T>C	ENST00000372010.1	+	16	1648	c.1206T>C	c.(1204-1206)gaT>gaC	p.D402D	PAK3_ENST00000425146.1_Silent_p.D387D|PAK3_ENST00000446737.1_Silent_p.D387D|PAK3_ENST00000417227.1_Silent_p.D408D|PAK3_ENST00000519681.1_Silent_p.D408D|PAK3_ENST00000372007.5_Silent_p.D387D|PAK3_ENST00000262836.4_Silent_p.D402D|PAK3_ENST00000360648.4_Silent_p.D423D|PAK3_ENST00000518291.1_Silent_p.D423D			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	402	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						TCCATAGAGATATAAAGAGTG	0.338										TSP Lung(19;0.15)																											p.D423D		.											.	PAK3	1043	0			c.T1269C						.						128.0	125.0	126.0					X																	110439120		2203	4300	6503	SO:0001819	synonymous_variant	5063	exon13			TAGAGATATAAAG	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1206T>C	X.37:g.110439120T>C		Somatic	528.0	0.0		WXS	Illumina HiSeq	Phase_I	460.0	239.0	NM_001128168	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Silent	SNP	ENST00000372010.1	37	CCDS48153.1																																																																																			.		0.338	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
PAK7	57144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9525047	9525047	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr20:9525047T>A	ENST00000378429.3	-	9	2384	c.1838A>T	c.(1837-1839)gAg>gTg	p.E613V	PAK7_ENST00000353224.5_Missense_Mutation_p.E613V|PAK7_ENST00000378423.1_Missense_Mutation_p.E613V	NM_020341.3	NP_065074.1	Q9P286	PAK7_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 7	613	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|learning (GO:0007612)|locomotory behavior (GO:0007626)|memory (GO:0007613)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|signal transduction (GO:0007165)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(44)|ovary(2)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)	81			COAD - Colon adenocarcinoma(9;0.194)			AGAAATCACCTCAGGGGCCAT	0.502																																					p.E613V		.											.	PAK7	1434	0			c.A1838T						.						123.0	112.0	116.0					20																	9525047		2203	4300	6503	SO:0001583	missense	57144	exon8			ATCACCTCAGGGG	AB033090	CCDS13107.1	20p12	2008-06-17	2008-06-17		ENSG00000101349	ENSG00000101349			15916	protein-coding gene	gene with protein product		608038	"""p21(CDKN1A)-activated kinase 7"""			11756552, 10574462	Standard	NM_020341		Approved	KIAA1264, PAK5	uc002wnk.2	Q9P286	OTTHUMG00000031857	ENST00000378429.3:c.1838A>T	20.37:g.9525047T>A	ENSP00000367686:p.Glu613Val	Somatic	134.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	42.0	NM_177990	A8K5T6|D3DW14|Q5W115|Q9BX09|Q9ULF6	Missense_Mutation	SNP	ENST00000378429.3	37	CCDS13107.1	.	.	.	.	.	.	.	.	.	.	T	33	5.210553	0.95069	.	.	ENSG00000101349	ENST00000378429;ENST00000353224;ENST00000378423	D;D;D	0.82167	-1.58;-1.58;-1.58	5.97	5.97	0.96955	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95310	0.8478	H	0.99249	4.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97385	0.9985	9	.	.	.	.	16.4608	0.84044	0.0:0.0:0.0:1.0	.	613	Q9P286	PAK7_HUMAN	V	613	ENSP00000367686:E613V;ENSP00000322957:E613V;ENSP00000367679:E613V	.	E	-	2	0	PAK7	9473047	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.988000	0.88194	2.288000	0.76882	0.533000	0.62120	GAG	.		0.502	PAK7-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077962.1		
PANX1	24145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	93911635	93911635	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:93911635T>C	ENST00000227638.3	+	3	807	c.422T>C	c.(421-423)tTt>tCt	p.F141S	PANX1_ENST00000436171.2_Missense_Mutation_p.F141S	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	141					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	GACTTGAAGTTTATCATGGAA	0.498																																					p.F141S		.											.	PANX1	68	0			c.T422C						.						115.0	99.0	105.0					11																	93911635		2201	4298	6499	SO:0001583	missense	24145	exon3			TGAAGTTTATCAT	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.422T>C	11.37:g.93911635T>C	ENSP00000227638:p.Phe141Ser	Somatic	272.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	13.0	NM_015368	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	ENST00000227638.3	37	CCDS8296.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.886232	0.91814	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.26518	1.73;1.73	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.56558	0.1993	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.64145	-0.6476	10	0.56958	D	0.05	-28.1811	15.0086	0.71533	0.0:0.0:0.0:1.0	.	141;141	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	S	141	ENSP00000227638:F141S;ENSP00000411461:F141S	ENSP00000227638:F141S	F	+	2	0	PANX1	93551283	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.538000	0.82048	1.945000	0.56424	0.460000	0.39030	TTT	.		0.498	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396121.1	NM_015368	
PDS5A	23244	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	39878616	39878616	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:39878616C>T	ENST00000303538.8	-	19	2689	c.2150G>A	c.(2149-2151)cGa>cAa	p.R717Q		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TACTCACGATCGTATCTGGGG	0.378																																					p.R717Q		.											.	.	.	0			c.G2150A						.						138.0	122.0	127.0					4																	39878616		1836	4086	5922	SO:0001583	missense	23244	exon19			CACGATCGTATCT	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.2150G>A	4.37:g.39878616C>T	ENSP00000303427:p.Arg717Gln	Somatic	302.0	0.0		WXS	Illumina HiSeq	Phase_I	437.0	30.0	NM_001100399		Missense_Mutation	SNP	ENST00000303538.8	37	CCDS47045.1	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603618	0.66445	.	.	ENSG00000121892	ENST00000303538	T	0.64438	-0.1	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67942	0.2947	L	0.47716	1.5	0.80722	D	1	D	0.61697	0.99	P	0.53450	0.726	T	0.66571	-0.5890	9	.	.	.	.	18.7568	0.91836	0.0:1.0:0.0:0.0	.	717	Q29RF7	PDS5A_HUMAN	Q	717	ENSP00000303427:R717Q	.	R	-	2	0	PDS5A	39555011	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	4.912000	0.63335	2.501000	0.84356	0.591000	0.81541	CGA	.		0.378	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361287.1	NM_015200	
PDX1	3651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	28498525	28498525	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr13:28498525C>T	ENST00000381033.4	+	2	658	c.539C>T	c.(538-540)gCt>gTt	p.A180V	PDX1-AS1_ENST00000499662.2_RNA	NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	0					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		GTGGAGCTGGCTGTCATGTTG	0.582																																					p.A180V		.											.	PDX1	514	0			c.C539T						.						56.0	60.0	59.0					13																	28498525		2203	4300	6503	SO:0001583	missense	3651	exon2			AGCTGGCTGTCAT	AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.539C>T	13.37:g.28498525C>T	ENSP00000370421:p.Ala180Val	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	66.0	NM_000209	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	ENST00000381033.4	37	CCDS9327.1	.	.	.	.	.	.	.	.	.	.	C	33	5.230002	0.95173	.	.	ENSG00000139515	ENST00000381033	D	0.98362	-4.89	4.86	4.86	0.63082	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99306	0.9757	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98776	1.0730	10	0.87932	D	0	.	18.338	0.90295	0.0:1.0:0.0:0.0	.	180	P52945	PDX1_HUMAN	V	180	ENSP00000370421:A180V	ENSP00000370421:A180V	A	+	2	0	PDX1	27396525	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.743000	0.85020	2.382000	0.81193	0.555000	0.69702	GCT	.		0.582	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044310.2	NM_000209	
PGBD2	267002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	249211815	249211815	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:249211815G>A	ENST00000329291.5	+	3	1179	c.1032G>A	c.(1030-1032)ctG>ctA	p.L344L	PGBD2_ENST00000539153.1_Silent_p.L341L|PGBD2_ENST00000355360.4_Silent_p.L93L	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	344										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GTGGTTTTCTGCCATATCACA	0.443																																					p.L344L		.											.	PGBD2	91	0			c.G1032A						.						121.0	125.0	124.0					1																	249211815		2203	4300	6503	SO:0001819	synonymous_variant	267002	exon3			TTTTCTGCCATAT	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1032G>A	1.37:g.249211815G>A		Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	386.0	89.0	NM_170725	B3KVR8|Q6MZF8	Silent	SNP	ENST00000329291.5	37	CCDS31128.1																																																																																			.		0.443	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
PGK2	5232	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49754008	49754008	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:49754008A>T	ENST00000304801.3	-	1	1045	c.893T>A	c.(892-894)gTt>gAt	p.V298D		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	298					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					GGCTTTTCCAACCTGAGCGTT	0.448																																					p.V298D		.											.	PGK2	91	0			c.T893A						.						149.0	147.0	148.0					6																	49754008		2203	4300	6503	SO:0001583	missense	5232	exon1			TTTCCAACCTGAG	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.893T>A	6.37:g.49754008A>T	ENSP00000305995:p.Val298Asp	Somatic	162.0	1.0		WXS	Illumina HiSeq	Phase_I	149.0	70.0	NM_138733	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	A	7.200	0.593276	0.13875	.	.	ENSG00000170950	ENST00000304801	D	0.92249	-3.0	4.19	3.03	0.35002	Phosphoglycerate kinase, C-terminal (1);	0.224067	0.42821	D	0.000659	D	0.87313	0.6146	M	0.84219	2.685	0.46078	D	0.998854	B	0.22604	0.072	B	0.30105	0.111	D	0.86078	0.1542	10	0.72032	D	0.01	-24.8929	5.71	0.17929	0.7895:0.0:0.2105:0.0	.	298	P07205	PGK2_HUMAN	D	298	ENSP00000305995:V298D	ENSP00000305995:V298D	V	-	2	0	PGK2	49861967	0.995000	0.38212	0.540000	0.28089	0.209000	0.24338	2.012000	0.40932	0.951000	0.37770	0.477000	0.44152	GTT	.		0.448	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
PLA2G4A	5321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186948491	186948491	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:186948491G>T	ENST00000367466.3	+	17	2157	c.2005G>T	c.(2005-2007)Gat>Tat	p.D669Y	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.D609Y	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	669	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	CGCTGACTTTGATATTTTTGA	0.338																																					p.D669Y		.											.	PLA2G4A	721	0			c.G2005T						.						108.0	105.0	106.0					1																	186948491		2203	4300	6503	SO:0001583	missense	5321	exon17			GACTTTGATATTT	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.2005G>T	1.37:g.186948491G>T	ENSP00000356436:p.Asp669Tyr	Somatic	401.0	1.0		WXS	Illumina HiSeq	Phase_I	603.0	205.0	NM_024420	B1AKG4|Q29R80	Missense_Mutation	SNP	ENST00000367466.3	37	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619506	0.87460	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.13196	2.61;2.61	5.6	5.6	0.85130	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.089358	0.85682	D	0.000000	T	0.41488	0.1161	M	0.77313	2.365	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.992;0.992	T	0.26326	-1.0106	10	0.72032	D	0.01	-13.8788	18.5987	0.91239	0.0:0.0:1.0:0.0	.	609;669	E7EU42;P47712	.;PA24A_HUMAN	Y	669;609	ENSP00000356436:D669Y;ENSP00000406892:D609Y	ENSP00000356436:D669Y	D	+	1	0	PLA2G4A	185215114	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.338000	0.96553	2.625000	0.88918	0.563000	0.77884	GAT	.		0.338	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	
POM121L12	285877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	53104219	53104219	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:53104219C>T	ENST00000408890.4	+	1	871	c.855C>T	c.(853-855)ctC>ctT	p.L285L		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	285										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCTTCGCCCTCGAGGTCACCC	0.622																																					p.L285L		.											.	.	.	0			c.C855T						.						42.0	47.0	45.0					7																	53104219		1995	4171	6166	SO:0001819	synonymous_variant	285877	exon1			CGCCCTCGAGGTC		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.855C>T	7.37:g.53104219C>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	80.0	NM_182595	Q8NDI9	Silent	SNP	ENST00000408890.4	37	CCDS43584.1																																																																																			.		0.622	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595	
PPP1R3A	5506	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	113518905	113518905	+	Missense_Mutation	SNP	C	C	G	rs4304271		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:113518905C>G	ENST00000284601.3	-	4	2310	c.2242G>C	c.(2242-2244)Gaa>Caa	p.E748Q		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	748			E -> K (in dbSNP:rs4304271).		glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATTGCTTTTTCTCTAGCAGAC	0.423																																					p.E748Q		.											.	PPP1R3A	832	0			c.G2242C						.						126.0	116.0	119.0					7																	113518905		2203	4300	6503	SO:0001583	missense	5506	exon4			CTTTTTCTCTAGC	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2242G>C	7.37:g.113518905C>G	ENSP00000284601:p.Glu748Gln	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	143.0	48.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	37	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708574	0.68615	.	.	ENSG00000154415	ENST00000284601	T	0.23147	1.92	5.9	5.9	0.94986	.	0.266734	0.32328	N	0.006248	T	0.50188	0.1601	M	0.67953	2.075	0.34365	D	0.691406	D	0.76494	0.999	P	0.62491	0.903	T	0.59096	-0.7518	10	0.72032	D	0.01	-2.4646	20.2626	0.98452	0.0:1.0:0.0:0.0	.	748	Q16821	PPR3A_HUMAN	Q	748	ENSP00000284601:E748Q	ENSP00000284601:E748Q	E	-	1	0	PPP1R3A	113306141	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	5.114000	0.64648	2.802000	0.96397	0.650000	0.86243	GAA	C|1.000;|0.000		0.423	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
PPP6R2	9701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	50876004	50876004	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr22:50876004G>C	ENST00000216061.5	+	17	2123	c.1753G>C	c.(1753-1755)Gag>Cag	p.E585Q	PPP6R2_ENST00000395744.3_Missense_Mutation_p.E558Q|PPP6R2_ENST00000395741.3_Missense_Mutation_p.E559Q|PPP6R2_ENST00000359139.3_Missense_Mutation_p.E558Q			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	585						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						CAATGATGAGGAGTTTGCCGA	0.597																																					p.E585Q		.											.	PPP6R2	92	0			c.G1753C						.						128.0	105.0	113.0					22																	50876004		2203	4300	6503	SO:0001583	missense	9701	exon16			GATGAGGAGTTTG	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1753G>C	22.37:g.50876004G>C	ENSP00000216061:p.Glu585Gln	Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	33.0	NM_001242898	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	ENST00000216061.5	37		.	.	.	.	.	.	.	.	.	.	G	27.7	4.850992	0.91277	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.42131	0.98;0.98;0.98;1.1	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.64713	0.2623	M	0.73319	2.225	0.58432	D	0.999999	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.91635	0.992;0.999;0.998;0.991;0.999;0.991	T	0.68977	-0.5267	10	0.72032	D	0.01	-30.6513	16.869	0.86036	0.0:0.0:1.0:0.0	.	117;585;585;559;558;558	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	Q	558;559;558;585	ENSP00000352051:E558Q;ENSP00000379090:E559Q;ENSP00000379093:E558Q;ENSP00000216061:E585Q	ENSP00000216061:E585Q	E	+	1	0	PPP6R2	49222870	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.770000	0.85390	2.280000	0.76307	0.462000	0.41574	GAG	.		0.597	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000316809.1	NM_014678	
PTCHD2	57540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11562021	11562021	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:11562021T>G	ENST00000294484.6	+	2	1110	c.972T>G	c.(970-972)gaT>gaG	p.D324E	PTCHD2_ENST00000389575.3_Missense_Mutation_p.D324E	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	324					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGCTCAAGGATCTGCCGCTGG	0.607																																					p.D324E		.											.	PTCHD2	209	0			c.T972G						.						37.0	40.0	39.0					1																	11562021		1958	4145	6103	SO:0001583	missense	57540	exon2			CAAGGATCTGCCG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.972T>G	1.37:g.11562021T>G	ENSP00000294484:p.Asp324Glu	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	11.0	NM_020780	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765394	0.69878	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	T;T	0.49139	0.79;0.79	5.42	1.99	0.26369	.	0.053624	0.64402	D	0.000001	T	0.49029	0.1533	L	0.27053	0.805	0.37011	D	0.895714	D	0.89917	1.0	D	0.80764	0.994	T	0.49670	-0.8915	10	0.40728	T	0.16	-43.3451	7.6093	0.28120	0.1202:0.6579:0.0:0.2219	.	324	Q9P2K9	PTHD2_HUMAN	E	324	ENSP00000294484:D324E;ENSP00000374226:D324E	ENSP00000294484:D324E	D	+	3	2	PTCHD2	11484608	0.997000	0.39634	1.000000	0.80357	0.980000	0.70556	0.497000	0.22514	0.259000	0.21709	-0.119000	0.15052	GAT	.		0.607	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
PTGS2	5743	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	186648333	186648333	+	Splice_Site	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:186648333G>A	ENST00000367468.5	-	3	306	c.170C>T	c.(169-171)cCg>cTg	p.P57L	PTGS2_ENST00000490885.2_5'UTR|RP5-973M2.2_ENST00000608917.1_lincRNA	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	57					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	CAAAAATTCCGCTGCAAGAAG	0.388																																					p.P57L		.											.	PTGS2	227	0			c.C170T						.						82.0	82.0	82.0					1																	186648333		2203	4300	6503	SO:0001630	splice_region_variant	5743	exon3			AATTCCGCTGCAA	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.170-1C>T	1.37:g.186648333G>A		Somatic	291.0	0.0		WXS	Illumina HiSeq	Phase_I	581.0	35.0	NM_000963	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	37	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327597	0.81690	.	.	ENSG00000073756	ENST00000367468	T	0.73469	-0.75	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.85309	0.5667	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.64144	0.922	D	0.86531	0.1822	10	0.87932	D	0	.	19.5047	0.95110	0.0:0.0:1.0:0.0	.	57	P35354	PGH2_HUMAN	L	57	ENSP00000356438:P57L	ENSP00000356438:P57L	P	-	2	0	PTGS2	184914956	1.000000	0.71417	1.000000	0.80357	0.305000	0.27757	9.617000	0.98361	2.585000	0.87301	0.655000	0.94253	CCG	.		0.388	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	Missense_Mutation
RAB32	10981	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	146865246	146865246	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:146865246G>A	ENST00000367495.3	+	1	418	c.239G>A	c.(238-240)tGg>tAg	p.W80*		NM_006834.3	NP_006825.1	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	80					antigen processing and presentation (GO:0019882)|endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome maturation (GO:0090382)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	8		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		CTGCAGCTGTGGGACATCGCG	0.632																																					p.W80X		.											.	RAB32	651	0			c.G239A						.						29.0	27.0	28.0					6																	146865246		2203	4300	6503	SO:0001587	stop_gained	10981	exon1			AGCTGTGGGACAT	U71127	CCDS5210.1	6q24.2	2010-08-20			ENSG00000118508	ENSG00000118508		"""RAB, member RAS oncogene"", ""A-kinase anchor proteins"""	9772	protein-coding gene	gene with protein product		612906					Standard	NM_006834		Approved		uc003qln.1	Q13637	OTTHUMG00000015755	ENST00000367495.3:c.239G>A	6.37:g.146865246G>A	ENSP00000356465:p.Trp80*	Somatic	136.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	17.0	NM_006834		Nonsense_Mutation	SNP	ENST00000367495.3	37	CCDS5210.1	.	.	.	.	.	.	.	.	.	.	G	40	8.156051	0.98680	.	.	ENSG00000118508	ENST00000367495	.	.	.	4.54	4.54	0.55810	.	0.435444	0.28431	N	0.015362	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.071	17.2973	0.87173	0.0:0.0:1.0:0.0	.	.	.	.	X	80	.	ENSP00000356465:W80X	W	+	2	0	RAB32	146906939	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.441000	0.97557	2.057000	0.61298	0.557000	0.71058	TGG	.		0.632	RAB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042579.1	NM_006834	
RAG1	5896	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	36597714	36597714	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:36597714G>T	ENST00000299440.5	+	2	2972	c.2860G>T	c.(2860-2862)Ggc>Tgc	p.G954C		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	954					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				TGAGAGGGATGGCTCCATTGG	0.443									Familial Hemophagocytic Lymphohistiocytosis																												p.G954C	Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)	.											.	RAG1	230	0			c.G2860T						.						82.0	88.0	86.0					11																	36597714		2202	4298	6500	SO:0001583	missense	5896	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AGGGATGGCTCCA	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.2860G>T	11.37:g.36597714G>T	ENSP00000299440:p.Gly954Cys	Somatic	117.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	45.0	NM_000448	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	ENST00000299440.5	37	CCDS7902.1	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819164	0.71028	.	.	ENSG00000166349	ENST00000299440	D	0.86366	-2.11	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.92492	0.7616	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90999	0.4841	9	.	.	.	.	20.1028	0.97881	0.0:0.0:1.0:0.0	.	954	P15918	RAG1_HUMAN	C	954	ENSP00000299440:G954C	.	G	+	1	0	RAG1	36554290	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.420000	0.97426	2.827000	0.97445	0.644000	0.83932	GGC	.		0.443	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389535.1	NM_000448	
RB1	5925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	48881512	48881512	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr13:48881512G>A	ENST00000267163.4	+	2	372	c.234G>A	c.(232-234)tgG>tgA	p.W78*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	78					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.W78*(3)|p.?(3)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGTTAACTTGGGAGAAAGTTT	0.323		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.W78X		.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	RB1,NS,Ewings_sarcoma-peripheral_primitive_neuroectodermal_tumour,0	RB1	3784	21	Whole gene deletion(15)|Substitution - Nonsense(3)|Unknown(3)	bone(11)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|eye(1)|soft_tissue(1)|endometrium(1)|lung(1)|skin(1)|stomach(1)	c.G234A						.						136.0	138.0	137.0					13																	48881512		2203	4299	6502	SO:0001587	stop_gained	5925	exon2	Familial Cancer Database		AACTTGGGAGAAA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.234G>A	13.37:g.48881512G>A	ENSP00000267163:p.Trp78*	Somatic	247.0	0.0		WXS	Illumina HiSeq	Phase_I	235.0	173.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	ENST00000267163.4	37	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	G	37	5.989199	0.97179	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	4.86	4.86	0.63082	.	0.135639	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.2922	13.8493	0.63487	0.0:0.0:1.0:0.0	.	.	.	.	X	57;78	.	ENSP00000267163:W78X	W	+	3	0	RB1	47779513	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.967000	0.49216	2.401000	0.81631	0.650000	0.86243	TGG	.		0.323	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
RB1CC1	9821	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	53569525	53569525	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:53569525C>T	ENST00000025008.5	-	15	3387	c.2864G>A	c.(2863-2865)cGa>cAa	p.R955Q	RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000435644.2_Missense_Mutation_p.R955Q|RB1CC1_ENST00000539297.1_Missense_Mutation_p.R955Q	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	955					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				CACTATTTCTCGTGACTGCTT	0.363																																					p.R955Q	GBM(180;1701 2102 13475 42023 52570)	.											.	RB1CC1	170	0			c.G2864A						.						80.0	81.0	81.0					8																	53569525		2203	4300	6503	SO:0001583	missense	9821	exon15			ATTTCTCGTGACT	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.2864G>A	8.37:g.53569525C>T	ENSP00000025008:p.Arg955Gln	Somatic	359.0	0.0		WXS	Illumina HiSeq	Phase_I	356.0	16.0	NM_001083617	Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	ENST00000025008.5	37	CCDS34892.1	.	.	.	.	.	.	.	.	.	.	C	8.990	0.977503	0.18812	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.03982	3.74;3.74;3.74	5.39	2.6	0.31112	.	0.123631	0.53938	D	0.000059	T	0.07279	0.0184	L	0.34521	1.04	0.28551	N	0.911606	D;D	0.69078	0.997;0.996	P;P	0.53549	0.729;0.54	T	0.12837	-1.0532	10	0.41790	T	0.15	-6.0497	8.9166	0.35585	0.0:0.7411:0.1233:0.1356	.	955;955	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	Q	955	ENSP00000025008:R955Q;ENSP00000396067:R955Q;ENSP00000445960:R955Q	ENSP00000025008:R955Q	R	-	2	0	RB1CC1	53732078	0.955000	0.32602	0.001000	0.08648	0.053000	0.15095	2.037000	0.41174	0.335000	0.23614	-0.182000	0.12963	CGA	.		0.363	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
RBM47	54502	broad.mit.edu;bcgsc.ca	37	4	40440062	40440062	+	Silent	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:40440062G>A	ENST00000381793.2	-	3	1245	c.849C>T	c.(847-849)taC>taT	p.Y283Y	RBM47_ENST00000295971.7_Silent_p.Y283Y|RBM47_ENST00000381795.6_Silent_p.Y283Y|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000319592.4_Silent_p.Y283Y|RBM47_ENST00000514014.1_Silent_p.Y245Y			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	283	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACGAAGGCGTAGTCGCGGA	0.617																																					p.Y283Y		.											.	RBM47	25	0			c.C849T						.						56.0	51.0	52.0					4																	40440062		2203	4300	6503	SO:0001819	synonymous_variant	54502	exon4			GAAGGCGTAGTCG	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.849C>T	4.37:g.40440062G>A		Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	9.0	NM_001098634	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			.		0.617	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
RDH10	157506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	74209535	74209535	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:74209535C>T	ENST00000240285.5	+	2	1074	c.396C>T	c.(394-396)gtC>gtT	p.V132V	RP11-434I12.2_ENST00000520894.1_RNA|RDH10_ENST00000519380.1_5'UTR|RPL7_ENST00000396465.1_5'Flank|RPL7_ENST00000396466.1_5'Flank	NM_172037.4	NP_742034.1	Q8IZV5	RDH10_HUMAN	retinol dehydrogenase 10 (all-trans)	132					bud elongation involved in lung branching (GO:0060449)|ear development (GO:0043583)|embryonic camera-type eye development (GO:0031076)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|gonad development (GO:0008406)|in utero embryonic development (GO:0001701)|metanephros development (GO:0001656)|neural crest cell development (GO:0014032)|nose development (GO:0043584)|phototransduction, visible light (GO:0007603)|primary lung bud formation (GO:0060431)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	11	Breast(64;0.0954)		Epithelial(68;0.0105)|all cancers(69;0.0465)|BRCA - Breast invasive adenocarcinoma(89;0.0608)			CTGAAAGAGTCCGCAAGGAGG	0.512																																					p.V132V		.											.	RDH10	514	0			c.C396T						.						213.0	169.0	184.0					8																	74209535		2203	4300	6503	SO:0001819	synonymous_variant	157506	exon2			AAGAGTCCGCAAG	AF456765	CCDS6213.1	8q21.11	2011-09-20			ENSG00000121039	ENSG00000121039	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	19975	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 4"""	607599				12407145, 19027726	Standard	NM_172037		Approved	SDR16C4	uc003xzi.3	Q8IZV5	OTTHUMG00000164492	ENST00000240285.5:c.396C>T	8.37:g.74209535C>T		Somatic	252.0	0.0		WXS	Illumina HiSeq	Phase_I	445.0	19.0	NM_172037		Silent	SNP	ENST00000240285.5	37	CCDS6213.1																																																																																			.		0.512	RDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378982.1		
RGAG1	57529	broad.mit.edu;bcgsc.ca	37	X	109695251	109695251	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:109695251T>C	ENST00000465301.2	+	3	1652	c.1406T>C	c.(1405-1407)aTg>aCg	p.M469T	RGAG1_ENST00000540313.1_Missense_Mutation_p.M469T	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	469										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						CAGTTAACAATGGCCAAAACT	0.517																																					p.M469T		.											.	RGAG1	132	0			c.T1406C						.						150.0	131.0	138.0					X																	109695251		2203	4300	6503	SO:0001583	missense	57529	exon3			TAACAATGGCCAA	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1406T>C	X.37:g.109695251T>C	ENSP00000419786:p.Met469Thr	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	9.0	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	37	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	T	0.324	-0.960216	0.02267	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.43688	0.94;0.94	3.97	-2.75	0.05914	.	0.644518	0.12950	N	0.425887	T	0.20861	0.0502	N	0.21142	0.635	0.09310	N	1	B	0.20052	0.041	B	0.14578	0.011	T	0.16660	-1.0395	9	.	.	.	0.9973	4.5746	0.12226	0.1849:0.4792:0.0:0.3359	.	469	Q8NET4	RGAG1_HUMAN	T	469	ENSP00000419786:M469T;ENSP00000441452:M469T	.	M	+	2	0	RGAG1	109581907	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.104000	0.10923	-0.729000	0.04875	-0.377000	0.06932	ATG	.		0.517	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
RHBDL1	9028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	726998	726998	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr16:726998C>T	ENST00000219551.2	+	3	676	c.649C>T	c.(649-651)Cgc>Tgc	p.R217C	LA16c-313D11.9_ENST00000567091.1_RNA|RHBDL1_ENST00000352681.3_Missense_Mutation_p.R152C|LA16c-313D11.9_ENST00000571933.1_RNA			O75783	RHBL1_HUMAN	rhomboid, veinlet-like 1 (Drosophila)	217					signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(1)|lung(4)|urinary_tract(3)	9		Hepatocellular(780;0.0218)				TTACGGGGCCCGCCTCAACAA	0.682																																					p.R217C		.											.	RHBDL1	90	0			c.C649T						.						63.0	67.0	66.0					16																	726998		2201	4298	6499	SO:0001583	missense	9028	exon3			GGGGCCCGCCTCA	Y17108	CCDS61779.1	16p13.3	2008-02-05	2001-11-28	2003-04-11	ENSG00000103269	ENSG00000103269			10007	protein-coding gene	gene with protein product		603264	"""rhomboid (veinlet, Drosophila)-like"""	RHBDL		9662444	Standard	NM_001278720		Approved	RRP	uc002cis.1	O75783	OTTHUMG00000121141	ENST00000219551.2:c.649C>T	16.37:g.726998C>T	ENSP00000219551:p.Arg217Cys	Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	12.0	NM_003961	A2IDC0|A2IDC1|Q0VAX4|Q9NQ85	Missense_Mutation	SNP	ENST00000219551.2	37	CCDS10418.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.859017	0.32884	.	.	ENSG00000103269	ENST00000352681;ENST00000450775;ENST00000219551	T;T	0.33216	1.46;1.42	3.99	3.99	0.46301	.	0.143249	0.42964	D	0.000631	T	0.22399	0.0540	N	0.08118	0	0.46981	D	0.999279	D;D;D	0.61080	0.989;0.977;0.958	P;B;P	0.50617	0.54;0.439;0.646	T	0.05099	-1.0906	10	0.56958	D	0.05	-18.8892	10.2818	0.43543	0.1975:0.8025:0.0:0.0	.	152;217;152	B4DFK3;O75783;O75783-2	.;RHBL1_HUMAN;.	C	152;152;217	ENSP00000344206:R152C;ENSP00000219551:R217C	ENSP00000219551:R217C	R	+	1	0	RHBDL1	666999	0.811000	0.29063	0.683000	0.30040	0.029000	0.11900	1.737000	0.38197	2.062000	0.61559	0.557000	0.71058	CGC	.		0.682	RHBDL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000241619.1	NM_003961	
RNF13	11342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	149589886	149589886	+	Missense_Mutation	SNP	C	C	T	rs138683130		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:149589886C>T	ENST00000344229.3	+	5	968	c.266C>T	c.(265-267)tCa>tTa	p.S89L	RNF13_ENST00000392894.3_Missense_Mutation_p.S89L|RNF13_ENST00000361785.6_5'UTR	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	89	PA.				protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AAAGACAATTCATCTGGCACT	0.313																																					p.S89L		.											.	RNF13	227	0			c.C266T						.	C	LEU/SER,LEU/SER	0,4406		0,0,2203	85.0	83.0	84.0		266,266	5.3	1.0	3	dbSNP_134	84	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	RNF13	NM_007282.4,NM_183381.2	145,145	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	89/382,89/382	149589886	1,13005	2203	4300	6503	SO:0001583	missense	11342	exon5			ACAATTCATCTGG	AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.266C>T	3.37:g.149589886C>T	ENSP00000341361:p.Ser89Leu	Somatic	263.0	0.0		WXS	Illumina HiSeq	Phase_I	221.0	36.0	NM_007282	A6NC87|B3KR12|Q05D66|Q6IBJ9	Missense_Mutation	SNP	ENST00000344229.3	37	CCDS3146.1	.	.	.	.	.	.	.	.	.	.	C	15.02	2.707979	0.48412	0.0	1.16E-4	ENSG00000082996	ENST00000392894;ENST00000344229;ENST00000543506;ENST00000468648;ENST00000459632;ENST00000466795;ENST00000482539;ENST00000490631	T;T;T;T;T;T;T	0.51325	3.3;3.3;2.44;3.3;3.3;0.71;3.3	5.28	5.28	0.74379	Protease-associated domain, PA (1);	5.674880	0.00166	N	0.000002	T	0.48077	0.1480	L	0.41492	1.28	0.80722	D	1	B	0.12013	0.005	B	0.15052	0.012	T	0.04635	-1.0937	10	0.24483	T	0.36	-15.648	15.9549	0.79880	0.0:1.0:0.0:0.0	.	89	O43567	RNF13_HUMAN	L	89	ENSP00000376628:S89L;ENSP00000341361:S89L;ENSP00000420067:S89L;ENSP00000419069:S89L;ENSP00000417655:S89L;ENSP00000420691:S89L;ENSP00000417294:S89L	ENSP00000341361:S89L	S	+	2	0	RNF13	151072576	0.966000	0.33281	0.996000	0.52242	0.928000	0.56348	2.120000	0.41968	2.756000	0.94617	0.655000	0.94253	TCA	C|1.000;T|0.000		0.313	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356876.1	NM_183384	
RNF217	154214	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	125402633	125402633	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:125402633G>T	ENST00000521654.2	+	5	1535	c.1535G>T	c.(1534-1536)gGg>gTg	p.G512V	RNF217_ENST00000368414.2_Missense_Mutation_p.G74V|RNF217_ENST00000275184.6_Missense_Mutation_p.G156V|RNF217_ENST00000359704.2_Missense_Mutation_p.G220V|RNF217_ENST00000560949.1_Missense_Mutation_p.G277V			Q8TC41	RN217_HUMAN	ring finger protein 217	512					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		TTGGCACTAGGGGCCATAGCG	0.363																																					p.G220V		.											.	RNF217	68	0			c.G659T						.						100.0	100.0	100.0					6																	125402633		2203	4300	6503	SO:0001583	missense	154214	exon7			CACTAGGGGCCAT	BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.1535G>T	6.37:g.125402633G>T	ENSP00000428698:p.Gly512Val	Somatic	303.0	0.0		WXS	Illumina HiSeq	Phase_I	325.0	30.0	NM_152553	H7C5V4|Q5TCA4|Q9BX48	Missense_Mutation	SNP	ENST00000521654.2	37		.	.	.	.	.	.	.	.	.	.	G	24.9	4.577046	0.86645	.	.	ENSG00000146373	ENST00000521654;ENST00000368414;ENST00000359704;ENST00000275184	T;T	0.46063	0.88;0.88	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.91635	0.999;0.792	T	0.50048	-0.8873	10	0.37606	T	0.19	.	19.3694	0.94479	0.0:0.0:1.0:0.0	.	220;277	Q8TC41;F2Z2M4	RN217_HUMAN;.	V	277;74;220;156	ENSP00000352734:G220V;ENSP00000275184:G156V	ENSP00000275184:G156V	G	+	2	0	RNF217	125444332	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.577000	0.74027	2.821000	0.97095	0.650000	0.86243	GGG	.		0.363	RNF217-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000042063.3	NM_152553	
RNF6	6049	broad.mit.edu;bcgsc.ca	37	13	26788012	26788012	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr13:26788012A>G	ENST00000381588.4	-	5	2759	c.2007T>C	c.(2005-2007)tgT>tgC	p.C669C	RNF6_ENST00000399762.2_Silent_p.C313C|RNF6_ENST00000346166.3_Silent_p.C669C|RNF6_ENST00000381570.3_Silent_p.C669C|RNF6_ENST00000468480.1_Intron	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	669	Required for polyubiquitination. {ECO:0000250}.				negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		GACAGATCGGACAAGTGCAAT	0.403																																					p.C669C		.											.	RNF6	228	0			c.T2007C						.						126.0	114.0	118.0					13																	26788012		2203	4300	6503	SO:0001819	synonymous_variant	6049	exon5			GATCGGACAAGTG	AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.2007T>C	13.37:g.26788012A>G		Somatic	242.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	8.0	NM_183043	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Silent	SNP	ENST00000381588.4	37	CCDS9316.1																																																																																			.		0.403	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044246.2	NM_005977	
RYR2	6262	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	237905615	237905615	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:237905615A>T	ENST00000366574.2	+	80	11428	c.11111A>T	c.(11110-11112)gAt>gTt	p.D3704V	RYR2_ENST00000542537.1_Missense_Mutation_p.D3688V|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Missense_Mutation_p.D3702V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3704					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GATGAGGAAGATGACGATGGT	0.318																																					p.D3704V		.											.	RYR2	158	0			c.A11111T						.						201.0	204.0	203.0					1																	237905615		1868	4091	5959	SO:0001583	missense	6262	exon80			AGGAAGATGACGA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11111A>T	1.37:g.237905615A>T	ENSP00000355533:p.Asp3704Val	Somatic	219.0	0.0		WXS	Illumina HiSeq	Phase_I	364.0	70.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	37	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	A	12.88	2.071034	0.36566	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96913	-4.17;-4.12;-4.16	5.89	4.76	0.60689	.	0.077328	0.49916	D	0.000133	D	0.93871	0.8039	L	0.32530	0.975	0.80722	D	1	D;B	0.53462	0.96;0.346	P;B	0.47744	0.556;0.047	D	0.93001	0.6423	10	0.72032	D	0.01	-14.9408	9.9481	0.41623	0.9235:0.0:0.0765:0.0	.	659;3704	B4DGV4;Q92736	.;RYR2_HUMAN	V	3704;3702;3688;659	ENSP00000355533:D3704V;ENSP00000353174:D3702V;ENSP00000443798:D3688V	ENSP00000353174:D3702V	D	+	2	0	RYR2	235972238	1.000000	0.71417	0.997000	0.53966	0.287000	0.27160	6.112000	0.71547	1.052000	0.40392	0.477000	0.44152	GAT	.		0.318	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
SCN3A	6328	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	165948928	165948928	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:165948928T>C	ENST00000360093.3	-	27	5134	c.4643A>G	c.(4642-4644)gAt>gGt	p.D1548G	AC013463.2_ENST00000431341.1_RNA|SCN3A_ENST00000409101.3_Missense_Mutation_p.D1499G|SCN3A_ENST00000283254.7_Missense_Mutation_p.D1548G|SCN3A_ENST00000540861.1_Missense_Mutation_p.D31G|SCN3A_ENST00000465043.1_5'UTR	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1548					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCCCTGGTCATCCGTTTCCAC	0.448																																					p.D1548G		.											.	SCN3A	141	0			c.A4643G						.						178.0	135.0	149.0					2																	165948928		2203	4300	6503	SO:0001583	missense	6328	exon27			TGGTCATCCGTTT	AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4643A>G	2.37:g.165948928T>C	ENSP00000353206:p.Asp1548Gly	Somatic	368.0	0.0		WXS	Illumina HiSeq	Phase_I	413.0	204.0	NM_006922	Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	ENST00000360093.3	37		.	.	.	.	.	.	.	.	.	.	T	27.1	4.797628	0.90538	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.97378	-4.36;-4.36;-4.36;-4.36	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.98836	0.9607	M	0.93550	3.43	0.80722	D	1	D;D;D	0.71674	0.998;0.983;0.988	D;P;P	0.81914	0.995;0.822;0.688	D	0.99690	1.1001	10	0.72032	D	0.01	.	16.4053	0.83662	0.0:0.0:0.0:1.0	.	1499;1499;1548	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	G	1548;1548;1499;31	ENSP00000353206:D1548G;ENSP00000283254:D1548G;ENSP00000386726:D1499G;ENSP00000439920:D31G	ENSP00000283254:D1548G	D	-	2	0	SCN3A	165657174	1.000000	0.71417	0.986000	0.45419	0.903000	0.53119	7.997000	0.88414	2.333000	0.79357	0.482000	0.46254	GAT	.		0.448	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_006922	
SEMA4D	10507	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	91991876	91991876	+	3'UTR	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:91991876G>T	ENST00000450295.1	-	0	5108				SEMA4D_ENST00000339861.4_Missense_Mutation_p.T585N|SEMA4D_ENST00000420987.1_Missense_Mutation_p.T585N|SEMA4D_ENST00000343780.4_Missense_Mutation_p.T585N|SEMA4D_ENST00000455551.2_Missense_Mutation_p.T585N			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						TGGCCAGGGGGTCCAGGGAGA	0.682																																					p.T585N		.											.	SEMA4D	92	0			c.C1754A						.						15.0	18.0	17.0					9																	91991876		692	1591	2283	SO:0001624	3_prime_UTR_variant	10507	exon18			CAGGGGGTCCAGG	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.*1743C>A	9.37:g.91991876G>T		Somatic	85.0	2.0		WXS	Illumina HiSeq	Phase_I	68.0	20.0	NM_001142287	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	ENST00000450295.1	37	CCDS6685.1	.	.	.	.	.	.	.	.	.	.	G	6.685	0.494979	0.12702	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000455551;ENST00000343780	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	4.47	2.58	0.30949	.	.	.	.	.	T	0.17023	0.0409	.	.	.	0.80722	D	1	B	0.23249	0.082	B	0.21708	0.036	T	0.04347	-1.0958	8	0.27785	T	0.31	.	14.6838	0.69035	0.0:0.7124:0.2876:0.0	.	585	Q92854-2	.	N	585	ENSP00000344923:T585N;ENSP00000391733:T585N;ENSP00000411981:T585N;ENSP00000343418:T585N	ENSP00000344923:T585N	T	-	2	0	SEMA4D	91181696	0.992000	0.36948	1.000000	0.80357	0.030000	0.12068	0.401000	0.20948	0.608000	0.30000	-0.321000	0.08615	ACC	.		0.682	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378	
SH3GL1	6455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	4361758	4361758	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:4361758C>G	ENST00000269886.3	-	10	1124	c.946G>C	c.(946-948)Gac>Cac	p.D316H	SH3GL1_ENST00000417295.2_Missense_Mutation_p.D268H|SH3GL1_ENST00000598564.1_Missense_Mutation_p.D252H|AC007292.6_ENST00000594444.1_RNA	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	316	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.			D -> G (in Ref. 5; BAG61213). {ECO:0000305}.	central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		GGCTCGAAGTCGTACAGCGCC	0.677			T	MLL	AL																																p.D316H	NSCLC(94;1152 2133 30346 33362)	.		Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	.	SH3GL1	659	0			c.G946C						.						72.0	57.0	62.0					19																	4361758		2203	4300	6503	SO:0001583	missense	6455	exon10			CGAAGTCGTACAG		CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.946G>C	19.37:g.4361758C>G	ENSP00000269886:p.Asp316His	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	42.0	NM_003025	B4DRA1|E7EVZ4|M0QZV5|Q99668	Missense_Mutation	SNP	ENST00000269886.3	37	CCDS32874.1	.	.	.	.	.	.	.	.	.	.	.	23.1	4.373428	0.82573	.	.	ENSG00000141985	ENST00000269886;ENST00000417295	T;T	0.67698	-0.28;-0.28	3.9	3.9	0.45041	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	D	0.86468	0.5940	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.988;0.988	D	0.90934	0.4792	10	0.87932	D	0	-1.3315	15.0282	0.71684	0.0:1.0:0.0:0.0	.	268;316;316	E7EVZ4;Q6FGM0;Q99961	.;.;SH3G1_HUMAN	H	316;268	ENSP00000269886:D316H;ENSP00000404568:D268H	ENSP00000269886:D316H	D	-	1	0	SH3GL1	4312758	1.000000	0.71417	0.959000	0.39883	0.736000	0.42039	7.486000	0.81215	1.998000	0.58463	0.511000	0.50034	GAC	.		0.677	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458302.1	NM_003025	
SH3GL2	6456	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	17787406	17787406	+	Silent	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:17787406C>A	ENST00000380607.4	+	5	480	c.360C>A	c.(358-360)gcC>gcA	p.A120A	SH3GL2_ENST00000537391.1_Silent_p.A73A	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	120	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Binds and tubulates liposomes. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		TCGGGGAGGCCATGCGGGAAC	0.463																																					p.A120A		.											.	SH3GL2	91	0			c.C360A						.						121.0	117.0	118.0					9																	17787406		2203	4300	6503	SO:0001819	synonymous_variant	6456	exon5			GGAGGCCATGCGG	X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.360C>A	9.37:g.17787406C>A		Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	9.0	NM_003026	B2R618|Q9NQK5	Silent	SNP	ENST00000380607.4	37	CCDS6483.1																																																																																			.		0.463	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026	
SHANK2	22941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	70333710	70333710	+	Silent	SNP	C	C	T	rs141694314		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:70333710C>T	ENST00000423696.2	-	15	1587	c.1551G>A	c.(1549-1551)ccG>ccA	p.P517P	SHANK2_ENST00000409161.1_Silent_p.P300P|SHANK2_ENST00000449833.2_Silent_p.P301P|SHANK2_ENST00000338508.4_Silent_p.P897P			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	517	Pro-rich.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GTGGTGGGGACGGGGGCACAG	0.587																																					p.P308P		.											.	SHANK2	94	0			c.G924A						.						42.0	40.0	41.0					11																	70333710		2200	4294	6494	SO:0001819	synonymous_variant	22941	exon10			TGGGGACGGGGGC	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1551G>A	11.37:g.70333710C>T		Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	31.0	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	37																																																																																				C|0.999;T|0.000		0.587	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
SIGLEC1	6614	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3673312	3673312	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr20:3673312G>A	ENST00000344754.4	-	15	3885	c.3886C>T	c.(3886-3888)Cac>Tac	p.H1296Y	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.H1296Y	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1296	Ig-like C2-type 13.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CGACCGTTGTGGTACCAAGTA	0.647																																					p.H1296Y		.											.	SIGLEC1	167	0			c.C3886T						.						50.0	51.0	51.0					20																	3673312		2203	4300	6503	SO:0001583	missense	6614	exon15			CGTTGTGGTACCA	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3886C>T	20.37:g.3673312G>A	ENSP00000341141:p.His1296Tyr	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	7.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	CCDS13060.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.83|11.83	1.754801|1.754801	0.31046|0.31046	.|.	.|.	ENSG00000088827|ENSG00000088827	ENST00000344754;ENST00000202578|ENST00000419548	T;T|.	0.12465|.	2.68;2.68|.	5.71|5.71	4.73|4.73	0.59995|0.59995	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.36703|.	N|.	0.002456|.	T|T	0.60301|0.60301	0.2258|0.2258	M|M	0.84511|0.84511	2.7|2.7	0.30631|0.30631	N|N	0.75748|0.75748	B;B|.	0.18310|.	0.019;0.027|.	B;B|.	0.23419|.	0.046;0.027|.	T|T	0.65565|0.65565	-0.6137|-0.6137	10|5	0.06625|.	T|.	0.88|.	.|.	6.3934|6.3934	0.21599|0.21599	0.0982:0.0:0.7234:0.1785|0.0982:0.0:0.7234:0.1785	.|.	1296;1296|.	Q9BZZ2;Q9BZZ2-3|.	SN_HUMAN;.|.	Y|L	1296|109	ENSP00000341141:H1296Y;ENSP00000202578:H1296Y|.	ENSP00000202578:H1296Y|.	H|P	-|-	1|2	0|0	SIGLEC1|SIGLEC1	3621312|3621312	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.487000|0.487000	0.33371|0.33371	2.172000|2.172000	0.42463|0.42463	1.336000|1.336000	0.45506|0.45506	0.655000|0.655000	0.94253|0.94253	CAC|CCA	.		0.647	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
SIGLEC1	6614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3673732	3673732	+	Silent	SNP	G	G	A	rs144602570	byFrequency	TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr20:3673732G>A	ENST00000344754.4	-	14	3554	c.3555C>T	c.(3553-3555)ggC>ggT	p.G1185G	SIGLEC1_ENST00000202578.4_Silent_p.G1185G	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1185	Ig-like C2-type 12.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CCAGCTGCCCGCCATGGCTCT	0.701													A|||	3	0.000599042	0.0023	0.0	5008	,	,		14319	0.0		0.0	False		,,,				2504	0.0				p.G1185G		.											.	SIGLEC1	167	0			c.C3555T						.	A		2,4316		0,2,2157	14.0	19.0	18.0		3555	-9.6	0.0	20	dbSNP_134	18	0,8544		0,0,4272	no	coding-synonymous	SIGLEC1	NM_023068.3		0,2,6429	AA,AG,GG		0.0,0.0463,0.0155		1185/1710	3673732	2,12860	2159	4272	6431	SO:0001819	synonymous_variant	6614	exon14			CTGCCCGCCATGG	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3555C>T	20.37:g.3673732G>A		Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	28.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Silent	SNP	ENST00000344754.4	37	CCDS13060.1																																																																																			G|0.999;A|0.001		0.701	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
SLC16A6	9120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	66270184	66270184	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:66270184C>T	ENST00000327268.4	-	4	424	c.260G>A	c.(259-261)cGt>cAt	p.R87H	SLC16A6_ENST00000580666.1_Missense_Mutation_p.R87H|ARSG_ENST00000448504.2_Intron	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	87					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	GTGTCCGAAACGATTGCTCAG	0.542																																					p.R87H		.											.	SLC16A6	90	0			c.G260A						.						81.0	70.0	74.0					17																	66270184		2203	4300	6503	SO:0001583	missense	9120	exon4			CCGAAACGATTGC	U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.260G>A	17.37:g.66270184C>T	ENSP00000319991:p.Arg87His	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	20.0	NM_001174166	Q6P1X3	Missense_Mutation	SNP	ENST00000327268.4	37	CCDS11675.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174901	0.78564	.	.	ENSG00000108932	ENST00000327268	T	0.65549	-0.16	5.8	4.84	0.62591	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.114238	0.64402	D	0.000007	T	0.62356	0.2421	M	0.73319	2.225	0.58432	D	0.999999	P	0.50617	0.937	B	0.43754	0.43	T	0.62469	-0.6848	10	0.25106	T	0.35	.	13.6225	0.62144	0.0:0.9266:0.0:0.0734	.	87	O15403	MOT7_HUMAN	H	87	ENSP00000319991:R87H	ENSP00000319991:R87H	R	-	2	0	SLC16A6	63781779	1.000000	0.71417	0.004000	0.12327	0.609000	0.37215	4.440000	0.59975	1.453000	0.47775	0.655000	0.94253	CGT	.		0.542	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448323.1	NM_004694	
SLC25A17	10478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	41173261	41173261	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr22:41173261T>C	ENST00000435456.2	-	6	701	c.568A>G	c.(568-570)Aaa>Gaa	p.K190E	SLC25A17_ENST00000491545.1_5'UTR|SLC25A17_ENST00000544408.1_Missense_Mutation_p.K153E|SLC25A17_ENST00000542412.1_Missense_Mutation_p.K117E|SLC25A17_ENST00000402844.3_Missense_Mutation_p.K108E	NM_006358.2	NP_006349.1	O43808	PM34_HUMAN	solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17	190					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|cellular lipid metabolic process (GO:0044255)|coenzyme A transmembrane transport (GO:0035349)|FAD transmembrane transport (GO:0035350)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|fatty acid transport (GO:0015908)|NAD transport (GO:0043132)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|chaperone binding (GO:0051087)|coenzyme A transmembrane transporter activity (GO:0015228)|FAD transmembrane transporter activity (GO:0015230)|FMN transmembrane transporter activity (GO:0044610)|NAD transporter activity (GO:0051724)			central_nervous_system(1)|large_intestine(4)|lung(2)|skin(1)	8						AGCTGCCGTTTTAAACCTTCA	0.388																																					p.K190E		.											.	SLC25A17	90	0			c.A568G						.						65.0	60.0	61.0					22																	41173261		2203	4300	6503	SO:0001583	missense	10478	exon6			GCCGTTTTAAACC	Y12860	CCDS14005.1, CCDS74868.1	22q13.2	2013-05-22	2002-08-29		ENSG00000100372	ENSG00000100372		"""Solute carriers"""	10987	protein-coding gene	gene with protein product	"""peroxisomal membrane protein (34kD)"""	606795	"""solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kD), member 17"""			9874197	Standard	NM_006358		Approved	PMP34	uc003azc.3	O43808	OTTHUMG00000151139	ENST00000435456.2:c.568A>G	22.37:g.41173261T>C	ENSP00000390722:p.Lys190Glu	Somatic	262.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	73.0	NM_006358	A8KA59|Q5TFL0|Q9UGW8|Q9UGY7	Missense_Mutation	SNP	ENST00000435456.2	37	CCDS14005.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.858739	0.91433	.	.	ENSG00000100372	ENST00000435456;ENST00000402844;ENST00000544408;ENST00000542412	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	5.86	4.81	0.61882	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.91898	0.7435	M	0.90542	3.125	0.80722	D	1	D;D;D	0.71674	0.994;0.998;0.998	D;D;D	0.73380	0.919;0.967;0.98	D	0.92770	0.6231	10	0.87932	D	0	-25.5221	12.5436	0.56186	0.1249:0.0:0.0:0.8751	.	117;153;190	F5GYD1;B4DU97;O43808	.;.;PM34_HUMAN	E	190;108;153;117	ENSP00000390722:K190E;ENSP00000385303:K108E;ENSP00000438355:K153E;ENSP00000446471:K117E	ENSP00000385303:K108E	K	-	1	0	SLC25A17	39503207	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.742000	0.85008	1.110000	0.41699	0.528000	0.53228	AAA	.		0.388	SLC25A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321487.1	NM_006358	
SLC2A5	6518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	9097670	9097670	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:9097670A>G	ENST00000377424.4	-	12	1660	c.1481T>C	c.(1480-1482)cTt>cCt	p.L494P	SLC2A5_ENST00000536305.1_Missense_Mutation_p.L435P|SLC2A5_ENST00000535586.1_Missense_Mutation_p.L379P	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	494					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GACAGGTGGAAGCTCTTTCAG	0.498																																					p.L494P		.											.	SLC2A5	517	0			c.T1481C						.						119.0	125.0	123.0					1																	9097670		2203	4300	6503	SO:0001583	missense	6518	exon12			GGTGGAAGCTCTT	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.1481T>C	1.37:g.9097670A>G	ENSP00000366641:p.Leu494Pro	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	14.0	NM_003039	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	37	CCDS99.1	.	.	.	.	.	.	.	.	.	.	A	15.38	2.816434	0.50527	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000536305;ENST00000535586	T;D;T	0.81739	-1.27;-1.53;-1.17	5.71	3.34	0.38264	.	1.362620	0.04509	N	0.382496	T	0.64962	0.2646	N	0.08118	0	0.25367	N	0.988734	B;B;B	0.15473	0.004;0.013;0.004	B;B;B	0.12156	0.007;0.007;0.007	T	0.53634	-0.8411	10	0.31617	T	0.26	.	6.8386	0.23951	0.7704:0.1503:0.0793:0.0	.	450;435;494	B4DG19;B4DU31;P22732	.;.;GTR5_HUMAN	P	494;477;435;379	ENSP00000366641:L494P;ENSP00000440688:L435P;ENSP00000442744:L379P	ENSP00000366641:L494P	L	-	2	0	SLC2A5	9020257	0.004000	0.15560	0.001000	0.08648	0.009000	0.06853	1.870000	0.39529	0.965000	0.38133	-0.313000	0.08912	CTT	.		0.498	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
SLC37A1	54020	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	43962522	43962522	+	Silent	SNP	C	C	T	rs141486944	byFrequency	TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr21:43962522C>T	ENST00000352133.2	+	7	1477	c.495C>T	c.(493-495)aaC>aaT	p.N165N	SLC37A1_ENST00000398341.3_Silent_p.N165N			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	165					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						AGGTCATCAACGGGCTGGTGC	0.597													C|||	21	0.00419329	0.0159	0.0	5008	,	,		12769	0.0		0.0	False		,,,				2504	0.0				p.N165N		.											.	SLC37A1	90	0			c.C495T						.	C		59,4347	55.5+/-91.7	1,57,2145	36.0	33.0	34.0		495	-0.8	0.9	21	dbSNP_134	34	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC37A1	NM_018964.3		1,58,6444	TT,TC,CC		0.0116,1.3391,0.4613		165/534	43962522	60,12946	2203	4300	6503	SO:0001819	synonymous_variant	54020	exon8			CATCAACGGGCTG	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.495C>T	21.37:g.43962522C>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	34.0	NM_018964	D3DSJ7|Q9HAQ1	Silent	SNP	ENST00000352133.2	37	CCDS13689.1																																																																																			C|0.996;T|0.004		0.597	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195377.1		
SLC6A4	6532	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	28530206	28530206	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:28530206G>A	ENST00000401766.2	-	13	2314	c.1802C>T	c.(1801-1803)cCa>cTa	p.P601L	RP11-354P11.4_ENST00000581633.1_RNA|SLC6A4_ENST00000261707.3_Missense_Mutation_p.P601L			P31645	SC6A4_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 4	601					brain morphogenesis (GO:0048854)|cellular response to cGMP (GO:0071321)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|memory (GO:0007613)|monoamine transport (GO:0015844)|negative regulation of cerebellar granule cell precursor proliferation (GO:0021941)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of organ growth (GO:0046621)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|serotonin transport (GO:0006837)|serotonin uptake (GO:0051610)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|thalamus development (GO:0021794)|vasoconstriction (GO:0042310)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|cocaine binding (GO:0019811)|monoamine transmembrane transporter activity (GO:0008504)|Rab GTPase binding (GO:0017137)|serotonin transmembrane transporter activity (GO:0015222)|serotonin:sodium symporter activity (GO:0005335)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(4)	25					Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexfenfluramine(DB01191)|Dexmethylphenidate(DB06701)|Dextromethorphan(DB00514)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Levomilnacipran(DB08918)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Pethidine(DB00454)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vilazodone(DB06684)	AAATGTCCCTGGAGTGATGAT	0.373																																					p.P601L		.											.	SLC6A4	94	0			c.C1802T						.						145.0	137.0	139.0					17																	28530206		2203	4300	6503	SO:0001583	missense	6532	exon14			GTCCCTGGAGTGA	L05568	CCDS11256.1	17q11.2	2014-01-30	2013-07-19		ENSG00000108576	ENSG00000108576		"""Solute carriers"""	11050	protein-coding gene	gene with protein product	"""serotonin transporter 1"""	182138	"""solute carrier family 6 (neurotransmitter transporter, serotonin), member 4"", ""5-hydroxytryptamine (serotonin) transporter"", ""obsessive-compulsive disorder 1"""	HTT, OCD1		7681602, 19806148	Standard	NM_001045		Approved	5-HTT, SERT1	uc002hey.5	P31645	OTTHUMG00000132751	ENST00000401766.2:c.1802C>T	17.37:g.28530206G>A	ENSP00000385822:p.Pro601Leu	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	13.0	NM_001045	Q5EE02	Missense_Mutation	SNP	ENST00000401766.2	37	CCDS11256.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355819	0.82243	.	.	ENSG00000108576	ENST00000394821;ENST00000401766;ENST00000261707	T;T	0.74421	-0.84;-0.84	6.17	6.17	0.99709	.	0.098249	0.64402	D	0.000001	T	0.69369	0.3103	N	0.08118	0	0.58432	D	0.999999	P	0.45011	0.848	P	0.50352	0.638	T	0.74487	-0.3649	10	0.66056	D	0.02	.	19.8676	0.96824	0.0:0.0:1.0:0.0	.	601	P31645	SC6A4_HUMAN	L	643;601;601	ENSP00000385822:P601L;ENSP00000261707:P601L	ENSP00000261707:P601L	P	-	2	0	SLC6A4	25554332	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.151000	0.64875	2.941000	0.99782	0.655000	0.94253	CCA	.		0.373	SLC6A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256115.3	NM_001045	
SLFN11	91607	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	33680372	33680372	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:33680372A>G	ENST00000394566.1	-	6	2177	c.1905T>C	c.(1903-1905)ccT>ccC	p.P635P	SLFN11_ENST00000308377.4_Silent_p.P635P	NM_001104587.1|NM_001104588.1|NM_001104589.1|NM_001104590.1	NP_001098057.1|NP_001098058.1|NP_001098059.1|NP_001098060.1	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	635					defense response to virus (GO:0051607)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tRNA binding (GO:0000049)			autonomic_ganglia(1)|breast(1)|kidney(3)|large_intestine(14)|lung(17)|ovary(1)|prostate(4)|skin(2)|stomach(5)|upper_aerodigestive_tract(2)	50		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AGTTCCTCAGAGGCTGGTTTT	0.408																																					p.P635P		.											.	SLFN11	159	0			c.T1905C						.						73.0	71.0	72.0					17																	33680372		2203	4299	6502	SO:0001819	synonymous_variant	91607	exon4			CCTCAGAGGCTGG	AK074184	CCDS11294.1	17q12	2006-04-05			ENSG00000172716	ENSG00000172716			26633	protein-coding gene	gene with protein product		614953				12477932	Standard	NM_001104587		Approved	FLJ34922	uc010ctr.3	Q7Z7L1	OTTHUMG00000132948	ENST00000394566.1:c.1905T>C	17.37:g.33680372A>G		Somatic	720.0	1.0		WXS	Illumina HiSeq	Phase_I	697.0	34.0	NM_152270	E1P643|Q8N3S8|Q8N762|Q8TEE0	Silent	SNP	ENST00000394566.1	37	CCDS11294.1																																																																																			.		0.408	SLFN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256480.1	NM_152270	
SMTNL1	219537	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57317551	57317551	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:57317551T>G	ENST00000399154.2	+	8	1340	c.1340T>G	c.(1339-1341)gTg>gGg	p.V447G	SMTNL1_ENST00000457912.1_Missense_Mutation_p.V502G|SMTNL1_ENST00000527972.1_Missense_Mutation_p.V484G			A8MU46	SMTL1_HUMAN	smoothelin-like 1	447	Calmodulin-binding. {ECO:0000250}.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						CGCAGCCTTGTGCAGAAAGGA	0.602																																					p.V484G		.											.	SMTNL1	23	0			c.T1451G						.						54.0	54.0	54.0					11																	57317551		2098	4223	6321	SO:0001583	missense	219537	exon7			GCCTTGTGCAGAA	BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.1340T>G	11.37:g.57317551T>G	ENSP00000382108:p.Val447Gly	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	53.0	NM_001105565		Missense_Mutation	SNP	ENST00000399154.2	37		.	.	.	.	.	.	.	.	.	.	T	21.9	4.213952	0.79352	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	D;D;D	0.94138	-3.34;-3.32;-3.36	4.89	4.89	0.63831	.	.	.	.	.	D	0.95404	0.8508	L	0.60455	1.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.95000	0.8142	9	0.45353	T	0.12	-20.1687	13.6324	0.62202	0.0:0.0:0.0:1.0	.	502	C9J621	.	G	502;484;447	ENSP00000406485:V502G;ENSP00000432651:V484G;ENSP00000382108:V447G	ENSP00000382108:V447G	V	+	2	0	SMTNL1	57074127	1.000000	0.71417	0.994000	0.49952	0.885000	0.51271	3.229000	0.51278	2.062000	0.61559	0.459000	0.35465	GTG	.		0.602	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_166203	
SNX13	23161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	17833732	17833732	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:17833732C>T	ENST00000428135.3	-	26	3009	c.2811G>A	c.(2809-2811)aaG>aaA	p.K937K	SNX13_ENST00000409389.1_3'UTR|SNX13_ENST00000496855.1_5'UTR	NM_015132.4	NP_055947.1	Q9Y5W8	SNX13_HUMAN	sorting nexin 13	948					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TCTGCATCTGCTTTGACCGTG	0.383																																					p.K937K		.											.	SNX13	650	0			c.G2811A						.						109.0	102.0	104.0					7																	17833732		1848	4089	5937	SO:0001819	synonymous_variant	23161	exon26			CATCTGCTTTGAC	AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000428135.3:c.2811G>A	7.37:g.17833732C>T		Somatic	463.0	0.0		WXS	Illumina HiSeq	Phase_I	707.0	37.0	NM_015132	B2RCI9|O94821|Q8WVZ2|Q8WXH8	Silent	SNP	ENST00000428135.3	37	CCDS47551.1																																																																																			.		0.383	SNX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327607.2	NM_015132	
SOWAHB	345079	broad.mit.edu;bcgsc.ca	37	4	77817401	77817401	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:77817401C>T	ENST00000334306.2	-	1	1601	c.1602G>A	c.(1600-1602)aaG>aaA	p.K534K		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	534																	CCGTTCCTGCCTTGGAGGGCT	0.572																																					p.K534K		.											.	.	.	0			c.G1602A						.						45.0	47.0	46.0					4																	77817401		2203	4300	6503	SO:0001819	synonymous_variant	345079	exon1			TCCTGCCTTGGAG		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1602G>A	4.37:g.77817401C>T		Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	7.0	NM_001029870	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			.		0.572	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
SPOP	8405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47677798	47677798	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:47677798A>T	ENST00000393328.2	-	11	1432	c.1067T>A	c.(1066-1068)cTg>cAg	p.L356Q	SPOP_ENST00000504102.1_Missense_Mutation_p.L356Q|SPOP_ENST00000347630.2_Missense_Mutation_p.L356Q|SPOP_ENST00000503676.1_Missense_Mutation_p.L356Q|SPOP_ENST00000393331.3_Missense_Mutation_p.L356Q	NM_003563.3	NP_003554.1	O43791	SPOP_HUMAN	speckle-type POZ protein	356					glucose homeostasis (GO:0042593)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			endometrium(18)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(3)|prostate(33)	63						TGCTGAAGCCAGAGAGCGGTA	0.522										Prostate(2;0.17)																											p.L356Q		.											.	SPOP	660	0			c.T1067A						.						150.0	150.0	150.0					17																	47677798		2203	4300	6503	SO:0001583	missense	8405	exon10			GAAGCCAGAGAGC	AJ000644	CCDS11551.1	17q21.33	2013-01-09			ENSG00000121067	ENSG00000121067		"""BTB/POZ domain containing"""	11254	protein-coding gene	gene with protein product		602650				9414087	Standard	NM_001007227		Approved	TEF2, BTBD32	uc002ipg.3	O43791	OTTHUMG00000161496	ENST00000393328.2:c.1067T>A	17.37:g.47677798A>T	ENSP00000377001:p.Leu356Gln	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	69.0	NM_001007228	B2R6S3|D3DTW7|Q53HJ1	Missense_Mutation	SNP	ENST00000393328.2	37	CCDS11551.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.199968	0.79015	.	.	ENSG00000121067	ENST00000393328;ENST00000393331;ENST00000347630;ENST00000504102;ENST00000503536;ENST00000503676;ENST00000513872	T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.87767	0.6260	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	D	0.90838	0.4721	10	0.87932	D	0	-6.5284	15.6986	0.77521	1.0:0.0:0.0:0.0	.	356	O43791	SPOP_HUMAN	Q	356;356;356;356;240;356;309	ENSP00000377001:L356Q;ENSP00000377004:L356Q;ENSP00000240327:L356Q;ENSP00000425905:L356Q;ENSP00000420908:L356Q	ENSP00000240327:L356Q	L	-	2	0	SPOP	45032797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.959000	0.93110	2.371000	0.80710	0.533000	0.62120	CTG	.		0.522	SPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365154.2	NM_003563	
SYCP2	10388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	58467323	58467323	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr20:58467323G>A	ENST00000357552.3	-	24	2311	c.2086C>T	c.(2086-2088)Caa>Taa	p.Q696*	SYCP2_ENST00000371001.2_Nonsense_Mutation_p.Q696*			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	696					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TGATTTTGTTGCTGATTGTGT	0.343																																					p.Q696X		.											.	SYCP2	525	0			c.C2086T						.						173.0	178.0	177.0					20																	58467323		2203	4300	6503	SO:0001587	stop_gained	10388	exon23			TTTGTTGCTGATT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.2086C>T	20.37:g.58467323G>A	ENSP00000350162:p.Gln696*	Somatic	502.0	1.0		WXS	Illumina HiSeq	Phase_I	687.0	327.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Nonsense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.039507	0.93630	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	.	.	.	4.89	2.44	0.29823	.	0.919223	0.09243	N	0.828993	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-6.7525	4.1694	0.10322	0.1611:0.2497:0.5892:0.0	.	.	.	.	X	696	.	ENSP00000350162:Q696X	Q	-	1	0	SYCP2	57900718	0.021000	0.18746	0.006000	0.13384	0.163000	0.22366	1.341000	0.33907	1.149000	0.42402	0.591000	0.81541	CAA	.		0.343	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
SYNE1	23345	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	152631939	152631939	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:152631939T>G	ENST00000367255.5	-	88	17381	c.16780A>C	c.(16780-16782)Act>Cct	p.T5594P	SYNE1_ENST00000356820.4_Missense_Mutation_p.T118P|SYNE1_ENST00000265368.4_Missense_Mutation_p.T5594P|SYNE1_ENST00000448038.1_Missense_Mutation_p.T5523P|SYNE1_ENST00000423061.1_Missense_Mutation_p.T5523P|SYNE1_ENST00000341594.5_Missense_Mutation_p.T5206P	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5594					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TACACGCTAGTGAGGTACTGT	0.428										HNSCC(10;0.0054)																											p.T5594P		.											.	SYNE1	607	0			c.A16780C						.						114.0	97.0	102.0					6																	152631939		2203	4300	6503	SO:0001583	missense	23345	exon88			CGCTAGTGAGGTA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16780A>C	6.37:g.152631939T>G	ENSP00000356224:p.Thr5594Pro	Somatic	363.0	2.0		WXS	Illumina HiSeq	Phase_I	342.0	33.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	9.116	1.007764	0.19199	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.49432	1.32;1.32;1.32;1.32;0.78;1.32	5.9	-2.24	0.06909	.	1.027200	0.07729	N	0.944945	T	0.10809	0.0264	N	0.08118	0	0.09310	N	1	B;B;B	0.20988	0.029;0.029;0.05	B;B;B	0.25884	0.017;0.017;0.064	T	0.36163	-0.9759	10	0.35671	T	0.21	.	9.9992	0.41918	0.1252:0.6725:0.0:0.2023	.	5594;5594;5523	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	P	5594;5523;5594;5523;5206;118	ENSP00000356224:T5594P;ENSP00000396024:T5523P;ENSP00000265368:T5594P;ENSP00000390975:T5523P;ENSP00000341887:T5206P;ENSP00000349276:T118P	ENSP00000265368:T5594P	T	-	1	0	SYNE1	152673632	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	-0.627000	0.05521	-0.365000	0.08076	0.482000	0.46254	ACT	.		0.428	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
SYNE3	161176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	95918595	95918595	+	Silent	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr14:95918595C>T	ENST00000334258.5	-	6	1277	c.1263G>A	c.(1261-1263)caG>caA	p.Q421Q	SYNE3_ENST00000554873.1_Silent_p.Q178Q|SYNE3_ENST00000557275.1_Silent_p.Q421Q|SYNE3_ENST00000553340.1_Silent_p.Q421Q	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	421					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						TCTGATACTCCTGGATGGTAG	0.582											OREG0022900	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q421Q		.											.	.	.	0			c.G1263A						.						119.0	100.0	106.0					14																	95918595		2203	4300	6503	SO:0001819	synonymous_variant	161176	exon6			ATACTCCTGGATG	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.1263G>A	14.37:g.95918595C>T		Somatic	118.0	0.0	1316	WXS	Illumina HiSeq	Phase_I	112.0	29.0	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Silent	SNP	ENST00000334258.5	37	CCDS9935.1																																																																																			.		0.582	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	
SYNJ1	8867	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	34067440	34067440	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr21:34067440C>T	ENST00000322229.7	-	4	631	c.632G>A	c.(631-633)cGa>cAa	p.R211Q	SYNJ1_ENST00000382491.3_Missense_Mutation_p.R211Q|SYNJ1_ENST00000382499.2_Missense_Mutation_p.R250Q|SYNJ1_ENST00000357345.3_Missense_Mutation_p.R211Q|SYNJ1_ENST00000433931.2_Missense_Mutation_p.R250Q			O43426	SYNJ1_HUMAN	synaptojanin 1	211	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GGTCCCAGCTCGTTCACAGCT	0.383																																					p.R250Q		.											.	SYNJ1	232	0			c.G749A						.						148.0	131.0	137.0					21																	34067440		2203	4300	6503	SO:0001583	missense	8867	exon5			CCAGCTCGTTCAC	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.632G>A	21.37:g.34067440C>T	ENSP00000322234:p.Arg211Gln	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	312.0	105.0	NM_203446	O43425|O94984|Q4KMR1	Missense_Mutation	SNP	ENST00000322229.7	37	CCDS54484.1	.	.	.	.	.	.	.	.	.	.	C	36	5.691462	0.96793	.	.	ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229;ENST00000429236	T;T;T;T;T;T	0.62232	0.04;0.04;0.04;0.04;0.04;0.04	4.96	4.96	0.65561	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.84884	0.5571	M	0.93150	3.385	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;0.996	D	0.89107	0.3493	10	0.87932	D	0	.	18.6311	0.91360	0.0:1.0:0.0:0.0	.	211;250;211;211;211	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4	.;.;.;SYNJ1_HUMAN;.	Q	211;211;250;250;211;211	ENSP00000371931:R211Q;ENSP00000349903:R211Q;ENSP00000371939:R250Q;ENSP00000409667:R250Q;ENSP00000322234:R211Q;ENSP00000413649:R211Q	ENSP00000322234:R211Q	R	-	2	0	SYNJ1	32989311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.214000	0.77958	2.486000	0.83907	0.558000	0.71614	CGA	.		0.383	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			
TCTN3	26123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	97447351	97447351	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr10:97447351T>A	ENST00000371217.5	-	4	648	c.625A>T	c.(625-627)Agg>Tgg	p.R209W	TCTN3_ENST00000265993.9_Missense_Mutation_p.R227W|TCTN3_ENST00000371209.5_Missense_Mutation_p.R209W|TCTN3_ENST00000430368.2_Intron			Q6NUS6	TECT3_HUMAN	tectonic family member 3	209					apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		AGGCTCACCCTGTAAAAAGAT	0.478																																					p.R209W		.											.	TCTN3	22	0			c.A625T						.						90.0	86.0	88.0					10																	97447351		2203	4300	6503	SO:0001583	missense	26123	exon4			TCACCCTGTAAAA	AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.625A>T	10.37:g.97447351T>A	ENSP00000360261:p.Arg209Trp	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	208.0	117.0	NM_015631	A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Missense_Mutation	SNP	ENST00000371217.5	37	CCDS31258.2	.	.	.	.	.	.	.	.	.	.	T	17.61	3.431269	0.62844	.	.	ENSG00000119977	ENST00000265993;ENST00000371217;ENST00000343162;ENST00000371209	D;D	0.83673	-1.75;-1.75	5.72	5.72	0.89469	Domain of unknown function DUF1619 (1);	0.327980	0.33438	N	0.004920	D	0.89280	0.6670	M	0.70275	2.135	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.994	D;D;P	0.66979	0.948;0.936;0.898	D	0.90179	0.4241	10	0.72032	D	0.01	-3.1243	12.3905	0.55356	0.0:0.0:0.0:1.0	.	209;209;58	Q6NUS6-2;Q6NUS6;Q6NUS6-3	.;TECT3_HUMAN;.	W	209;227;58;209	ENSP00000265993:R209W;ENSP00000360253:R209W	ENSP00000265993:R209W	R	-	1	2	TCTN3	97437341	0.998000	0.40836	0.915000	0.36163	0.226000	0.24999	2.432000	0.44784	2.169000	0.68431	0.482000	0.46254	AGG	.		0.478	TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000471858.1	NM_015631	
TEK	7010	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	27228230	27228230	+	Missense_Mutation	SNP	G	G	T	rs536255448		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:27228230G>T	ENST00000380036.4	+	22	3669	c.3227G>T	c.(3226-3228)cGg>cTg	p.R1076L	TEK_ENST00000519097.1_Missense_Mutation_p.R928L|TEK_ENST00000406359.4_Missense_Mutation_p.R1033L	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	1076	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	CAATGCTGGCGGGAGAAGCCT	0.433																																					p.R1076L		.											.	TEK	1584	0			c.G3227T						.						130.0	129.0	129.0					9																	27228230		2203	4300	6503	SO:0001583	missense	7010	exon22			GCTGGCGGGAGAA	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.3227G>T	9.37:g.27228230G>T	ENSP00000369375:p.Arg1076Leu	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	27.0	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	37	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	G	30	5.054881	0.93793	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	D;D;D	0.82803	-1.65;-1.65;-1.65	5.81	5.81	0.92471	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45867	D	0.000337	D	0.86083	0.5848	N	0.20304	0.555	0.58432	D	0.999999	D;P;D	0.69078	0.997;0.942;0.997	D;P;D	0.78314	0.991;0.635;0.991	D	0.87827	0.2642	10	0.87932	D	0	.	19.6728	0.95916	0.0:0.0:1.0:0.0	.	928;1109;1076	E7EWI2;Q59HG2;Q02763	.;.;TIE2_HUMAN	L	928;1076;1033	ENSP00000430686:R928L;ENSP00000369375:R1076L;ENSP00000383977:R1033L	ENSP00000369375:R1076L	R	+	2	0	TEK	27218230	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.797000	0.69087	2.760000	0.94817	0.643000	0.83706	CGG	.		0.433	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167643791	167643791	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr5:167643791A>G	ENST00000518659.1	+	22	4136	c.4097A>G	c.(4096-4098)aAt>aGt	p.N1366S	TENM2_ENST00000520394.1_Missense_Mutation_p.N1127S|TENM2_ENST00000519204.1_Missense_Mutation_p.N1245S|TENM2_ENST00000545108.1_Missense_Mutation_p.N1365S|TENM2_ENST00000403607.2_Missense_Mutation_p.N1190S	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1366					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GTAGACAAGAATGGGCTCATG	0.527																																					p.N1357S		.											.	.	.	0			c.A4070G						.						91.0	91.0	91.0					5																	167643791		2035	4193	6228	SO:0001583	missense	57451	exon22			ACAAGAATGGGCT	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4097A>G	5.37:g.167643791A>G	ENSP00000429430:p.Asn1366Ser	Somatic	219.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	98.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	A	16.06	3.014983	0.54468	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65;-2.65	5.42	5.42	0.78866	Six-bladed beta-propeller, TolB-like (1);	0.088409	0.85682	D	0.000000	D	0.86744	0.6006	L	0.35288	1.05	0.38826	D	0.955746	B;B;B	0.20164	0.014;0.008;0.042	B;B;B	0.28465	0.031;0.014;0.09	D	0.83624	0.0141	10	0.33141	T	0.24	.	15.4962	0.75653	1.0:0.0:0.0:0.0	.	1365;1366;1127	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	S	1366;1365;1245;1127;1190	ENSP00000429430:N1366S;ENSP00000438635:N1365S;ENSP00000428964:N1245S;ENSP00000427874:N1127S;ENSP00000384905:N1190S	ENSP00000384905:N1190S	N	+	2	0	ODZ2	167576369	1.000000	0.71417	0.969000	0.41365	0.992000	0.81027	9.339000	0.96797	2.058000	0.61347	0.533000	0.62120	AAT	.		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TGFBR3	7049	broad.mit.edu;bcgsc.ca	37	1	92187585	92187585	+	Silent	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:92187585A>G	ENST00000525962.1	-	7	1063	c.1002T>C	c.(1000-1002)aaT>aaC	p.N334N	TGFBR3_ENST00000370399.2_Silent_p.N334N|TGFBR3_ENST00000212355.4_Silent_p.N334N			Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	334					blastocyst development (GO:0001824)|blood vessel development (GO:0001568)|BMP signaling pathway (GO:0030509)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac muscle cell proliferation (GO:0060038)|cell growth (GO:0016049)|cell migration (GO:0016477)|definitive erythrocyte differentiation (GO:0060318)|definitive hemopoiesis (GO:0060216)|epithelial to mesenchymal transition (GO:0001837)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|negative regulation of cellular component movement (GO:0051271)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of protein binding (GO:0043393)|response to follicle-stimulating hormone (GO:0032354)|response to hypoxia (GO:0001666)|response to luteinizing hormone (GO:0034699)|response to prostaglandin E (GO:0034695)|transforming growth factor beta receptor complex assembly (GO:0007181)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	coreceptor activity (GO:0015026)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|PDZ domain binding (GO:0030165)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type III (GO:0070123)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(24)|ovary(3)|prostate(4)|skin(1)|stomach(1)|urinary_tract(3)	55		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		GACTATAGCCATTGTCCAAAG	0.373																																					p.N334N		.											.	TGFBR3	93	0			c.T1002C						.						132.0	116.0	121.0					1																	92187585		2203	4300	6503	SO:0001819	synonymous_variant	7049	exon9			ATAGCCATTGTCC	L07594	CCDS30770.1, CCDS55614.1	1p33-p32	2008-02-05	2007-02-15		ENSG00000069702	ENSG00000069702		"""Proteoglycans / Cell surface : Other"""	11774	protein-coding gene	gene with protein product	"""betaglycan proteoglycan"""	600742	"""transforming growth factor, beta receptor III (betaglycan, 300kDa)"""			1333192, 1319842	Standard	NM_001195684		Approved	betaglycan, BGCAN	uc001doh.3	Q03167	OTTHUMG00000010097	ENST00000525962.1:c.1002T>C	1.37:g.92187585A>G		Somatic	241.0	0.0		WXS	Illumina HiSeq	Phase_I	213.0	14.0	NM_001195684	A0AUW8|A8K5N0|B9EG88|Q5T2T4|Q5U731|Q9UGI2	Silent	SNP	ENST00000525962.1	37	CCDS30770.1																																																																																			.		0.373	TGFBR3-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382308.1	NM_003243	
TMC6	11322	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	76120679	76120679	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:76120679G>T	ENST00000590602.1	-	8	976	c.817C>A	c.(817-819)Cct>Act	p.P273T	TMC6_ENST00000589553.1_Missense_Mutation_p.P46T|TMC6_ENST00000592076.1_5'Flank|TMC6_ENST00000322914.3_Missense_Mutation_p.P273T|TMC6_ENST00000322933.4_5'UTR|TMC6_ENST00000306591.7_Missense_Mutation_p.P273T|TMC6_ENST00000392467.3_Missense_Mutation_p.P273T|TMC6_ENST00000591436.1_5'Flank			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	273					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GCGACCTGAGGGCCCATGATG	0.662																																					p.P273T		.											.	TMC6	90	0			c.C817A						.						17.0	19.0	18.0					17																	76120679		2182	4237	6419	SO:0001583	missense	11322	exon8			CCTGAGGGCCCAT	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.817C>A	17.37:g.76120679G>T	ENSP00000465261:p.Pro273Thr	Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	22.0	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	37	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	G	9.668	1.146041	0.21288	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000306591	T;T;T	0.62232	0.04;0.04;0.04	3.64	1.5	0.22942	.	0.614231	0.15341	N	0.267532	T	0.74313	0.3700	M	0.84156	2.68	0.53005	D	0.999961	B;D;D;B;D	0.71674	0.358;0.985;0.985;0.081;0.998	B;P;P;B;D	0.65010	0.08;0.795;0.733;0.015;0.931	T	0.71738	-0.4502	10	0.52906	T	0.07	-9.6633	6.3986	0.21626	0.0:0.3705:0.4436:0.1859	.	110;273;46;273;273	B4E003;Q7Z403-2;Q7Z403-4;B3KTU5;Q7Z403	.;.;.;.;TMC6_HUMAN	T	273	ENSP00000313408:P273T;ENSP00000376260:P273T;ENSP00000306405:P273T	ENSP00000306405:P273T	P	-	1	0	TMC6	73632274	0.927000	0.31430	0.515000	0.27774	0.007000	0.05969	1.360000	0.34125	0.493000	0.27837	-0.502000	0.04539	CCT	.		0.662	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
TMED10	10972	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	75614379	75614379	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr14:75614379T>G	ENST00000303575.4	-	3	450	c.399A>C	c.(397-399)aaA>aaC	p.K133N	TMED10_ENST00000557670.1_5'UTR	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	133	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.|Required for interaction with STX17.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		CTTCGTAATTTTTCGCCTCCA	0.488																																					p.K133N		.											.	TMED10	90	0			c.A399C						.						258.0	230.0	240.0					14																	75614379		2203	4300	6503	SO:0001583	missense	10972	exon3			GTAATTTTTCGCC	AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.399A>C	14.37:g.75614379T>G	ENSP00000303145:p.Lys133Asn	Somatic	168.0	1.0		WXS	Illumina HiSeq	Phase_I	130.0	58.0	NM_006827	B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	ENST00000303575.4	37	CCDS9840.1	.	.	.	.	.	.	.	.	.	.	T	16.89	3.247510	0.59103	.	.	ENSG00000170348	ENST00000303575	T	0.18502	2.21	6.06	4.93	0.64822	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.23926	0.0579	L	0.56340	1.77	0.80722	D	1	D	0.56521	0.976	P	0.53760	0.734	T	0.01118	-1.1446	10	0.32370	T	0.25	-13.5666	7.3585	0.26733	0.0:0.1552:0.0:0.8448	.	133	P49755	TMEDA_HUMAN	N	133	ENSP00000303145:K133N	ENSP00000303145:K133N	K	-	3	2	TMED10	74684132	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.766000	0.38491	2.323000	0.78572	0.528000	0.53228	AAA	.		0.488	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415034.1	NM_006827	
TMEM185A	84548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	148690383	148690383	+	Silent	SNP	C	C	T	rs150113040		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chrX:148690383C>T	ENST00000316916.8	-	3	658	c.354G>A	c.(352-354)ccG>ccA	p.P118P	TMEM185A_ENST00000536359.1_Silent_p.P59P|TMEM185A_ENST00000507237.1_Silent_p.P118P	NM_032508.2	NP_115897.1	Q8NFB2	T185A_HUMAN	transmembrane protein 185A	118						dendrite (GO:0030425)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(3)|lung(10)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CAAAGAACAGCGGCATGAAGA	0.468													c|||	1	0.000264901	0.0	0.0014	3775	,	,		13854	0.0		0.0	False		,,,				2504	0.0				p.P118P		.											.	TMEM185A	131	0			c.G354A						.	C	,	1,3833		0,1,1631,570	173.0	167.0	169.0		177,354	-9.7	0.7	X	dbSNP_134	169	0,6727		0,0,2428,1871	no	coding-synonymous,coding-synonymous	TMEM185A	NM_001174092.1,NM_032508.2	,	0,1,4059,2441	TT,TC,CC,C		0.0,0.0261,0.0095	,	59/292,118/351	148690383	1,10560	2202	4299	6501	SO:0001819	synonymous_variant	84548	exon3			GAACAGCGGCATG	AF353675	CCDS14689.1, CCDS55523.1, CCDS76041.1	Xq28	2014-01-28	2007-02-05	2007-02-05	ENSG00000155984	ENSG00000269556			17125	protein-coding gene	gene with protein product		300031	"""chromosome X open reading frame 13"", ""family with sequence similarity 11, member A"""	CXorf13, FAM11A		12404111	Standard	NM_032508		Approved		uc022cgl.1	Q8NFB2	OTTHUMG00000022625	ENST00000316916.8:c.354G>A	X.37:g.148690383C>T		Somatic	397.0	0.0		WXS	Illumina HiSeq	Phase_I	350.0	81.0	NM_032508	B3KTZ3|Q3SYH1|Q96CW3|Q96KE8	Silent	SNP	ENST00000316916.8	37	CCDS14689.1	1	6.027727546714888E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	8.764	0.924218	0.18056	2.61E-4	0.0	ENSG00000155984	ENST00000502858	.	.	.	5.46	-9.7	0.00521	.	.	.	.	.	T	0.43033	0.1229	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50242	-0.8851	4	.	.	.	-13.1114	5.9091	0.19018	0.1668:0.5092:0.083:0.241	.	.	.	.	H	19	.	.	R	-	2	0	TMEM185A	148498179	0.000000	0.05858	0.721000	0.30653	0.947000	0.59692	-2.305000	0.01133	-1.553000	0.01702	-0.505000	0.04504	CGC	C|1.000;T|0.000		0.468	TMEM185A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058710.4	NM_032508	
TMEM53	79639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	45120780	45120780	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:45120780C>A	ENST00000372237.3	-	3	448	c.285G>T	c.(283-285)gaG>gaT	p.E95D	TMEM53_ENST00000372242.3_Missense_Mutation_p.E95D|TMEM53_ENST00000372235.3_Missense_Mutation_p.E65D|TMEM53_ENST00000372244.3_Intron|TMEM53_ENST00000372243.3_Intron|TMEM53_ENST00000476724.1_5'UTR	NM_024587.2	NP_078863.2	Q6P2H8	TMM53_HUMAN	transmembrane protein 53	95						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(3)|ovary(2)|urinary_tract(1)	10	Acute lymphoblastic leukemia(166;0.155)					CAAAGAGCAGCTCGAGCAGCT	0.547											OREG0013446	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E95D		.											.	TMEM53	92	0			c.G285T						.						56.0	61.0	59.0					1																	45120780		2203	4300	6503	SO:0001583	missense	79639	exon3			GAGCAGCTCGAGC		CCDS511.1, CCDS72773.1	1p34.1	2008-02-26			ENSG00000126106	ENSG00000126106			26186	protein-coding gene	gene with protein product						12958361	Standard	XR_425151		Approved	FLJ22353, NET4	uc001cmc.3	Q6P2H8	OTTHUMG00000007833	ENST00000372237.3:c.285G>T	1.37:g.45120780C>A	ENSP00000361311:p.Glu95Asp	Somatic	108.0	0.0	929	WXS	Illumina HiSeq	Phase_I	67.0	56.0	NM_024587	B4DKG0|Q5JPH2|Q6IA07|Q9H6E2	Missense_Mutation	SNP	ENST00000372237.3	37	CCDS511.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203085	0.79127	.	.	ENSG00000126106	ENST00000372242;ENST00000372237;ENST00000372235;ENST00000420706	.	.	.	5.67	3.79	0.43588	.	0.000000	0.85682	D	0.000000	T	0.68751	0.3035	L	0.57536	1.79	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.65224	-0.6220	9	0.21540	T	0.41	.	12.6523	0.56768	0.0:0.8639:0.0:0.1361	.	95	Q6P2H8	TMM53_HUMAN	D	95;95;65;64	.	ENSP00000361309:E65D	E	-	3	2	TMEM53	44893367	1.000000	0.71417	0.995000	0.50966	0.969000	0.65631	3.999000	0.57031	1.413000	0.46997	0.563000	0.77884	GAG	.		0.547	TMEM53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021599.1	NM_024587	
TMEM79	84283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	156255314	156255314	+	Silent	SNP	A	A	T	rs553983602		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:156255314A>T	ENST00000405535.2	+	2	468	c.297A>T	c.(295-297)ccA>ccT	p.P99P	TMEM79_ENST00000495881.1_3'UTR|SMG5_ENST00000368267.5_5'Flank|TMEM79_ENST00000357501.2_Intron|SMG5_ENST00000361813.5_5'Flank|TMEM79_ENST00000295694.5_Silent_p.P99P	NM_032323.2	NP_115699.1	Q9BSE2	TMM79_HUMAN	transmembrane protein 79	99					cornification (GO:0070268)|cuticle development (GO:0042335)|epithelial cell maturation (GO:0002070)|establishment of skin barrier (GO:0061436)|hair follicle morphogenesis (GO:0031069)|positive regulation of epidermis development (GO:0045684)|regulated secretory pathway (GO:0045055)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|urinary_tract(1)	21	Hepatocellular(266;0.158)					ACATTGAACCAGAGCCCCCTG	0.622																																					p.P99P		.											.	TMEM79	90	0			c.A297T						.						49.0	55.0	53.0					1																	156255314		2203	4300	6503	SO:0001819	synonymous_variant	84283	exon2			TGAACCAGAGCCC	BC005094	CCDS1138.1	1q22	2014-04-22			ENSG00000163472	ENSG00000163472			28196	protein-coding gene	gene with protein product	"""mattrin"""	615531					Standard	NM_032323		Approved	MGC13102, FLJ16057, FLJ32254, MATT	uc009wrw.3	Q9BSE2	OTTHUMG00000019788	ENST00000405535.2:c.297A>T	1.37:g.156255314A>T		Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	192.0	53.0	NM_032323	B2RE22|D3DVB8	Silent	SNP	ENST00000405535.2	37	CCDS1138.1																																																																																			.		0.622	TMEM79-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052101.1	NM_032323	
TMEM8C	389827	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	136379801	136379801	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:136379801G>T	ENST00000339996.3	-	5	724	c.623C>A	c.(622-624)cCg>cAg	p.P208Q	TMEM8C_ENST00000413714.1_5'Flank	NM_001080483.2	NP_001073952.1	A6NI61	TMM8C_HUMAN	transmembrane protein 8C	208					muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|plasma membrane fusion (GO:0045026)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|large_intestine(2)|lung(4)	8						CAGCTTGGCCGGGGTCCCCGG	0.617																																					p.P208Q		.											.	TMEM8C	68	0			c.C623A						.						97.0	89.0	92.0					9																	136379801		2203	4300	6503	SO:0001583	missense	389827	exon5			TTGGCCGGGGTCC	BX324209	CCDS35170.1	9q34.2	2009-06-19		2009-06-19	ENSG00000187616	ENSG00000187616			33778	protein-coding gene	gene with protein product	"""transmembrane protein 226"""	615345					Standard	NM_001080483		Approved	TMEM226	uc011mdk.2	A6NI61	OTTHUMG00000131685	ENST00000339996.3:c.623C>A	9.37:g.136379801G>T	ENSP00000419712:p.Pro208Gln	Somatic	116.0	1.0		WXS	Illumina HiSeq	Phase_I	89.0	39.0	NM_001080483		Missense_Mutation	SNP	ENST00000339996.3	37	CCDS35170.1	.	.	.	.	.	.	.	.	.	.	N	16.15	3.041808	0.55003	.	.	ENSG00000187616	ENST00000339996	T	0.44083	0.93	3.9	3.9	0.45041	.	0.233336	0.35096	N	0.003449	T	0.51210	0.1661	L	0.40543	1.245	0.44181	D	0.996992	D	0.63880	0.993	P	0.60286	0.872	T	0.56667	-0.7941	10	0.72032	D	0.01	-34.5693	14.8127	0.70008	0.0:0.0:1.0:0.0	.	208	A6NI61	TMM8C_HUMAN	Q	208	ENSP00000419712:P208Q	ENSP00000419712:P208Q	P	-	2	0	TMEM8C	135369622	1.000000	0.71417	0.840000	0.33206	0.201000	0.24016	9.110000	0.94302	1.888000	0.54679	0.397000	0.26171	CCG	.		0.617	TMEM8C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356200.2	NM_001080483	
TNIP3	79931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122078361	122078361	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr4:122078361C>A	ENST00000509841.1	-	7	560	c.482G>T	c.(481-483)aGa>aTa	p.R161I	TNIP3_ENST00000507879.1_Missense_Mutation_p.R154I|TNIP3_ENST00000454328.1_Missense_Mutation_p.R84I|TNIP3_ENST00000057513.3_Missense_Mutation_p.R84I	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						GCTGAGGAATCTTTCCGCGGC	0.587																																					p.R161I		.											.	TNIP3	91	0			c.G482T						.						212.0	232.0	225.0					4																	122078361		2203	4300	6503	SO:0001583	missense	79931	exon7			AGGAATCTTTCCG	AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.482G>T	4.37:g.122078361C>A	ENSP00000426613:p.Arg161Ile	Somatic	335.0	1.0		WXS	Illumina HiSeq	Phase_I	364.0	131.0	NM_001244764		Missense_Mutation	SNP	ENST00000509841.1	37	CCDS58926.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.124248	0.37533	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	T;T;T;T	0.62639	0.01;0.01;0.01;0.01	4.16	2.35	0.29111	.	0.464644	0.23038	N	0.052657	T	0.70605	0.3243	M	0.68952	2.095	0.09310	N	1	D;D;B	0.71674	0.998;0.994;0.114	D;P;B	0.72075	0.976;0.808;0.032	T	0.57774	-0.7753	10	0.48119	T	0.1	-0.2459	5.0205	0.14358	0.0:0.6637:0.2172:0.1191	.	154;84;84	B4DVF5;A5HU65;Q96KP6	.;.;TNIP3_HUMAN	I	84;84;154;161	ENSP00000057513:R84I;ENSP00000411817:R84I;ENSP00000427106:R154I;ENSP00000426613:R161I	ENSP00000057513:R84I	R	-	2	0	TNIP3	122297811	0.000000	0.05858	0.001000	0.08648	0.128000	0.20619	0.228000	0.17814	0.658000	0.30925	0.484000	0.47621	AGA	.		0.587	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364000.4	NM_024873	
TNXB	7148	hgsc.bcm.edu;bcgsc.ca	37	6	32010105	32010105	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:32010105A>C	ENST00000375244.3	-	41	12446	c.12245T>G	c.(12244-12246)tTc>tGc	p.F4082C	TNXB_ENST00000451343.1_Missense_Mutation_p.F511C|TNXB_ENST00000375247.2_Missense_Mutation_p.F4080C			P22105	TENX_HUMAN	tenascin XB	4127	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GTCCCTCCAGAAGTCTGTCTG	0.612																																					p.F4080C		.											.	TNXB	90	0			c.T12239G						.																																			SO:0001583	missense	7148	exon41			CTCCAGAAGTCTG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.12245T>G	6.37:g.32010105A>C	ENSP00000364393:p.Phe4082Cys	Somatic	1140.0	2.0		WXS	Illumina HiSeq	Phase_I	1240.0	314.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		.	.	.	.	.	.	.	.	.	.	a	19.73	3.881496	0.72294	.	.	ENSG00000168477	ENST00000375244;ENST00000451343;ENST00000375247	D;D;D	0.99418	-5.87;-5.87;-5.87	4.8	4.8	0.61643	.	0.000000	0.51477	D	0.000087	D	0.99746	0.9899	H	0.98426	4.23	0.52501	D	0.99995	D	0.89917	1.0	D	0.85130	0.997	D	0.97106	0.9801	10	0.87932	D	0	.	13.5365	0.61650	1.0:0.0:0.0:0.0	.	4080	P22105-3	.	C	4082;511;4080	ENSP00000364393:F4082C;ENSP00000407685:F511C;ENSP00000364396:F4080C	ENSP00000364393:F4082C	F	-	2	0	TNXB	32118084	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.560000	0.73950	2.046000	0.60703	0.525000	0.51046	TTC	.		0.612	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
TPP1	1200	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	6638385	6638385	+	Splice_Site	SNP	C	C	T	rs56144125		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:6638385C>T	ENST00000299427.6	-	6	569		c.e6-1		TPP1_ENST00000534644.1_Splice_Site|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000533371.1_Splice_Site	NM_000391.3	NP_000382.3	P49638	TTPA_HUMAN	tripeptidyl peptidase I						embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)	Vitamin E(DB00163)	AGTCCCCCCACTGTAGGGAGA	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		18894	0.0		0.001	False		,,,				2504	0.0				.		.											.	TPP1	90	0			c.509-1G>A	GRCh37	CS971663|CS991344	TPP1	S	rs56144125	.						61.0	64.0	63.0					11																	6638385		2201	4296	6497	SO:0001630	splice_region_variant	1200	exon7			CCCCCACTGTAGG	AF017456	CCDS7770.1	11p15.4	2014-09-17	2004-12-09	2004-12-10	ENSG00000166340	ENSG00000166340			2073	protein-coding gene	gene with protein product	"""TPP I"""	607998	"""ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease)"", ""spinocerebellar ataxia, autosomal recessive 7"""	CLN2, SCAR7		9653647, 23418007	Standard	NM_000391		Approved		uc001mel.1	O14773	OTTHUMG00000133404	ENST00000299427.6:c.509-1G>A	11.37:g.6638385C>T		Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	51.0	NM_000391	Q71V64	Splice_Site	SNP	ENST00000299427.6	37	CCDS7770.1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	16.40	3.113441	0.56398	.	.	ENSG00000166340	ENST00000299427	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7903	0.78350	0.0:1.0:0.0:0.0	rs56144125	.	.	.	.	-1	.	.	.	-	.	.	TPP1	6594961	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.179000	0.71974	2.290000	0.77057	0.460000	0.39030	.	C|0.999;G|0.001;T|0.000		0.572	TPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257261.2		Intron
TRIM31	11074	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	30071337	30071337	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:30071337C>A	ENST00000376734.3	-	9	1379	c.1254G>T	c.(1252-1254)tgG>tgT	p.W418C	TRIM31-AS1_ENST00000440874.1_RNA|TRIM31_ENST00000485864.1_5'Flank|TRIM31_ENST00000540829.1_Missense_Mutation_p.W418C	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	418					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						CCTCACAAAACCAAGCCCGGA	0.577																																					p.W418C		.											.	TRIM31	658	0			c.G1254T						.						145.0	160.0	154.0					6																	30071337		1510	2709	4219	SO:0001583	missense	11074	exon9			ACAAAACCAAGCC	AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.1254G>T	6.37:g.30071337C>A	ENSP00000365924:p.Trp418Cys	Somatic	71.0	1.0		WXS	Illumina HiSeq	Phase_I	65.0	34.0	NM_007028	A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Missense_Mutation	SNP	ENST00000376734.3	37	CCDS34374.1	.	.	.	.	.	.	.	.	.	.	C	5.975	0.363918	0.11296	.	.	ENSG00000204616	ENST00000376734;ENST00000376728;ENST00000540829	T;T	0.70986	-0.53;-0.53	1.47	-1.81	0.07882	.	.	.	.	.	T	0.21921	0.0528	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15867	-1.0422	9	0.59425	D	0.04	.	2.3547	0.04293	0.4365:0.2868:0.0:0.2768	.	418	Q9BZY9	TRI31_HUMAN	C	418	ENSP00000365924:W418C;ENSP00000444311:W418C	ENSP00000365918:W418C	W	-	3	0	TRIM31	30179316	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	0.124000	0.15728	-0.418000	0.07450	-0.973000	0.02599	TGG	.		0.577	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076081.2		
TRIM34	53840	broad.mit.edu;bcgsc.ca	37	11	5663672	5663672	+	Silent	SNP	T	T	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr11:5663672T>C	ENST00000514226.1	+	6	1147	c.810T>C	c.(808-810)gtT>gtC	p.V270V	TRIM34_ENST00000429814.2_Silent_p.V270V|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_Silent_p.V624V|TRIM34_ENST00000495668.1_3'UTR|TRIM6-TRIM34_ENST00000457787.2_Silent_p.V270V	NM_001003827.1	NP_001003827.1	Q9BYJ4	TRI34_HUMAN	tripartite motif containing 34	270					positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	17		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;5.72e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAAAAATGGTTTCCAAGAAAC	0.448																																					p.V624V		.											.	TRIM6-TRIM34	45	0			c.T1872C						.						97.0	92.0	94.0					11																	5663672		2201	4297	6498	SO:0001819	synonymous_variant	445372	exon12			AATGGTTTCCAAG	AB039902	CCDS31391.1	11p15	2013-01-09	2011-01-25	2001-11-23		ENSG00000258659		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10063	protein-coding gene	gene with protein product		605684	"""tripartite motif-containing 34"""	RNF21			Standard	NM_130390		Approved			Q9BYJ4	OTTHUMG00000066892	ENST00000514226.1:c.810T>C	11.37:g.5663672T>C		Somatic	113.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	4.0	NM_001003819	D3DQS7|Q9C016|Q9HCR0|Q9HCR1|Q9HCR2	Silent	SNP	ENST00000514226.1	37	CCDS31391.1																																																																																			.		0.448	TRIM34-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143357.2	NM_001003827	
TSPYL5	85453	broad.mit.edu;bcgsc.ca	37	8	98289467	98289467	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:98289467C>T	ENST00000322128.3	-	1	709	c.606G>A	c.(604-606)atG>atA	p.M202I		NM_033512.2	NP_277047.2	Q86VY4	TSYL5_HUMAN	TSPY-like 5	202					cellular response to gamma radiation (GO:0071480)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	nucleus (GO:0005634)				cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	20	Breast(36;2.56e-06)					CCAGCGTATCCATGCTGCCTT	0.617																																					p.M202I		.											.	TSPYL5	136	0			c.G606A						.						88.0	89.0	89.0					8																	98289467		2203	4300	6503	SO:0001583	missense	85453	exon1			CGTATCCATGCTG	AB051537	CCDS34927.1	8q22.1	2011-05-24			ENSG00000180543	ENSG00000180543			29367	protein-coding gene	gene with protein product		614721				11214970	Standard	NM_033512		Approved	KIAA1750	uc003yhy.3	Q86VY4	OTTHUMG00000164857	ENST00000322128.3:c.606G>A	8.37:g.98289467C>T	ENSP00000322802:p.Met202Ile	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	7.0	NM_033512	B3KRF0|Q9C0B3	Missense_Mutation	SNP	ENST00000322128.3	37	CCDS34927.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.256477	0.59321	.	.	ENSG00000180543	ENST00000322128	T	0.22539	1.95	4.13	4.13	0.48395	.	0.000000	0.41194	D	0.000932	T	0.11793	0.0287	N	0.11201	0.11	0.35640	D	0.810917	B	0.18013	0.025	B	0.24701	0.055	T	0.17715	-1.0360	10	0.23891	T	0.37	-20.6918	12.2087	0.54367	0.0:1.0:0.0:0.0	.	202	Q86VY4	TSYL5_HUMAN	I	202	ENSP00000322802:M202I	ENSP00000322802:M202I	M	-	3	0	TSPYL5	98358643	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	2.801000	0.47908	2.590000	0.87494	0.563000	0.77884	ATG	.		0.617	TSPYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380611.1	NM_033512	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	179510675	179510675	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:179510675A>T	ENST00000591111.1	-	167	35681	c.35457T>A	c.(35455-35457)gaT>gaA	p.D11819E	TTN_ENST00000342992.6_Missense_Mutation_p.D10892E|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000418062.1_RNA|RP11-171I2.3_ENST00000605021.1_lincRNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D13460E|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11819	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTCCTTCACATCTTCCTTAG	0.408																																					p.D13460E		.											.	TTN	636	0			c.T40380A						.						105.0	98.0	100.0					2																	179510675		1830	4079	5909	SO:0001583	missense	7273	exon217			CTTCACATCTTCC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35457T>A	2.37:g.179510675A>T	ENSP00000465570:p.Asp11819Glu	Somatic	437.0	0.0		WXS	Illumina HiSeq	Phase_I	604.0	30.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.758|3.758	-0.050228|-0.050228	0.07407|0.07407	.|.	.|.	ENSG00000155657|ENSG00000155657	ENST00000426232|ENST00000342992;ENST00000429997;ENST00000446966;ENST00000434777	.|T	.|0.68025	.|-0.3	5.39|5.39	-5.56|-5.56	0.02529|0.02529	.|Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.|.	.|.	.|.	.|.	T|T	0.39036|0.39036	0.1063|0.1063	N|N	0.14661|0.14661	0.345|0.345	0.38293|0.38293	D|D	0.942765|0.942765	.|B;B	.|0.17667	.|0.0;0.023	.|B;B	.|0.14578	.|0.001;0.011	T|T	0.10706|0.10706	-1.0618|-1.0618	5|9	.|0.87932	.|D	.|0	.|.	2.3534|2.3534	0.04290|0.04290	0.414:0.0947:0.3252:0.1661|0.414:0.0947:0.3252:0.1661	.|.	.|11819;299	.|Q8WZ42;A2TKE4	.|TITIN_HUMAN;.	S|E	167|10892;299;299;119	.|ENSP00000343764:D10892E	.|ENSP00000343764:D10892E	C|D	-|-	1|3	0|2	TTN|TTN	179218920|179218920	0.001000|0.001000	0.12720|0.12720	0.939000|0.939000	0.37840|0.37840	0.707000|0.707000	0.40811|0.40811	-0.805000|-0.805000	0.04530|0.04530	-0.478000|-0.478000	0.06823|0.06823	-0.376000|-0.376000	0.06991|0.06991	TGT|GAT	.		0.408	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TUBG1	7283	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	40766524	40766524	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr17:40766524G>A	ENST00000251413.3	+	10	1069	c.1007G>A	c.(1006-1008)aGc>aAc	p.S336N		NM_001070.4	NP_001061.2	P23258	TBG1_HUMAN	tubulin, gamma 1	336					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic spindle organization (GO:0000212)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	apical part of cell (GO:0045177)|cell leading edge (GO:0031252)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)|polar microtubule (GO:0005827)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Vinblastine(DB00570)	GTCCACAAGAGCTTGCAGAGG	0.652																																					p.S336N	Colon(20;114 698 11420 22864)	.											.	TUBG1	91	0			c.G1007A						.						43.0	46.0	45.0					17																	40766524		2203	4300	6503	SO:0001583	missense	7283	exon10			ACAAGAGCTTGCA	BC000619	CCDS11433.1	17q21.31	2010-03-15	2000-01-20		ENSG00000131462	ENSG00000131462		"""Tubulins"""	12417	protein-coding gene	gene with protein product		191135	"""tubulin, gamma polypeptide"""	TUBG		1904010	Standard	NM_001070		Approved	TUBGCP1	uc002ian.3	P23258		ENST00000251413.3:c.1007G>A	17.37:g.40766524G>A	ENSP00000251413:p.Ser336Asn	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	182.0	17.0	NM_001070	Q53X79|Q9BW59	Missense_Mutation	SNP	ENST00000251413.3	37	CCDS11433.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217680	0.79352	.	.	ENSG00000131462	ENST00000251413	D	0.84660	-1.88	4.06	4.06	0.47325	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94765	0.8310	H	0.96398	3.815	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	D	0.96683	0.9505	10	0.87932	D	0	-24.4152	16.4351	0.83872	0.0:0.0:1.0:0.0	.	336	P23258	TBG1_HUMAN	N	336	ENSP00000251413:S336N	ENSP00000251413:S336N	S	+	2	0	TUBG1	38020050	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.630000	0.83225	2.104000	0.64026	0.563000	0.77884	AGC	.		0.652	TUBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450548.1	NM_001070	
TUSC1	286319	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	25677928	25677928	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:25677928C>T	ENST00000358022.3	-	1	928	c.392G>A	c.(391-393)cGg>cAg	p.R131Q		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	131										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		TTCAGGGACCCGGCGTGCCTC	0.716																																					p.R131Q	Pancreas(19;648 672 25630 30820 31331)	.											.	TUSC1	90	0			c.G392A						.						3.0	5.0	4.0					9																	25677928		1965	3964	5929	SO:0001583	missense	286319	exon1			GGGACCCGGCGTG	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.392G>A	9.37:g.25677928C>T	ENSP00000350716:p.Arg131Gln	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	8.0	NM_001004125	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Missense_Mutation	SNP	ENST00000358022.3	37	CCDS34999.1	.	.	.	.	.	.	.	.	.	.	C	1.420	-0.573018	0.03882	.	.	ENSG00000198680	ENST00000358022	T	0.44881	0.91	3.24	-2.39	0.06602	.	0.581515	0.12874	U	0.431987	T	0.20659	0.0497	L	0.36672	1.1	0.09310	N	1	B	0.27416	0.178	B	0.20384	0.029	T	0.19712	-1.0297	10	0.13470	T	0.59	1.1294	0.9093	0.01291	0.2763:0.3247:0.2425:0.1564	.	131	Q2TAM9	TUSC1_HUMAN	Q	131	ENSP00000350716:R131Q	ENSP00000350716:R131Q	R	-	2	0	TUSC1	25667928	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.340000	0.07821	-0.261000	0.09405	-0.539000	0.04255	CGG	.		0.716	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
UBE2J1	51465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	90053437	90053437	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:90053437C>A	ENST00000435041.2	-	2	348	c.70G>T	c.(70-72)Gat>Tat	p.D24Y		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	24					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		TCTGTTGGATCTTTCAATTCT	0.279																																					p.D24Y		.											.	UBE2J1	226	0			c.G70T						.						58.0	58.0	58.0					6																	90053437		2203	4299	6502	SO:0001583	missense	51465	exon2			TTGGATCTTTCAA	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.70G>T	6.37:g.90053437C>A	ENSP00000451261:p.Asp24Tyr	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	64.0	NM_016021	A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Missense_Mutation	SNP	ENST00000435041.2	37	CCDS5021.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406487	0.83230	.	.	ENSG00000198833	ENST00000435041;ENST00000536477	T	0.50277	0.75	5.4	5.4	0.78164	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.041477	0.85682	D	0.000000	T	0.71533	0.3351	M	0.90019	3.08	0.80722	D	1	D	0.64830	0.994	D	0.68943	0.961	T	0.77466	-0.2577	10	0.87932	D	0	.	19.5511	0.95322	0.0:1.0:0.0:0.0	.	24	Q9Y385	UB2J1_HUMAN	Y	24;9	ENSP00000451261:D24Y	ENSP00000354684:D24Y	D	-	1	0	UBE2J1	90110156	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.423000	0.73361	2.704000	0.92352	0.650000	0.86243	GAT	.		0.279	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043742.2	NM_016021	
UCKL1	54963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	20	62577849	62577849	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr20:62577849C>T	ENST00000354216.6	-	2	303	c.261G>A	c.(259-261)tgG>tgA	p.W87*	UCKL1_ENST00000358711.3_Nonsense_Mutation_p.W87*|UCKL1_ENST00000369908.5_Nonsense_Mutation_p.W72*|UCKL1_ENST00000492660.1_5'UTR|UCKL1_ENST00000369892.3_Nonsense_Mutation_p.W87*	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	87					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GTTCATTGTACCAGGGCGGCC	0.682																																					p.W87X		.											.	UCKL1	115	0			c.G261A						.						55.0	50.0	52.0					20																	62577849		2201	4294	6495	SO:0001587	stop_gained	54963	exon2			ATTGTACCAGGGC	AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.261G>A	20.37:g.62577849C>T	ENSP00000346155:p.Trp87*	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	20.0	NM_017859	B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Nonsense_Mutation	SNP	ENST00000354216.6	37	CCDS13547.1	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372231	0.61624	.	.	ENSG00000198276	ENST00000354216;ENST00000369892;ENST00000358711;ENST00000369908;ENST00000418992	.	.	.	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.984	15.4917	0.75611	0.0:1.0:0.0:0.0	.	.	.	.	X	87;87;87;72;72	.	ENSP00000346155:W87X	W	-	3	0	UCKL1	62048293	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	7.328000	0.79160	2.063000	0.61619	0.313000	0.20887	TGG	.		0.682	UCKL1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080236.1	NM_017859	
URM1	81605	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131140322	131140322	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:131140322G>A	ENST00000372853.4	+	2	105	c.43G>A	c.(43-45)Gcg>Acg	p.A15T	URM1_ENST00000452446.1_Missense_Mutation_p.A15T|URM1_ENST00000372850.1_Missense_Mutation_p.A15T|URM1_ENST00000372847.1_Silent_p.V28V	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1									p.G13_L18>V(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						CAGAGGTGGTGCGGAGCTCCT	0.512																																					p.A15T		.											.	URM1	90	1	Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(1)	c.G43A						.						118.0	107.0	111.0					9																	131140322		2203	4300	6503	SO:0001583	missense	81605	exon2			GGTGGTGCGGAGC	AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.43G>A	9.37:g.131140322G>A	ENSP00000361944:p.Ala15Thr	Somatic	452.0	1.0		WXS	Illumina HiSeq	Phase_I	373.0	39.0	NM_001265582		Missense_Mutation	SNP	ENST00000372853.4	37	CCDS6900.1	.	.	.	.	.	.	.	.	.	.	G	18.29	3.591004	0.66219	.	.	ENSG00000167118	ENST00000372853;ENST00000452446;ENST00000372850	.	.	.	5.42	5.42	0.78866	Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp (1);Beta-grasp fold, ferredoxin-type (1);	0.058905	0.64402	D	0.000002	T	0.68540	0.3012	M	0.78801	2.425	0.80722	D	1	P;B	0.40619	0.724;0.134	B;B	0.41988	0.372;0.299	T	0.71951	-0.4437	9	0.48119	T	0.1	-8.7389	18.2079	0.89860	0.0:0.0:1.0:0.0	.	15;15	Q9BTM9-2;Q9BTM9	.;URM1_HUMAN	T	15	.	ENSP00000361941:A15T	A	+	1	0	URM1	130180143	1.000000	0.71417	0.744000	0.31058	0.926000	0.56050	7.159000	0.77483	2.538000	0.85594	0.462000	0.41574	GCG	.		0.512	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054422.1	NM_030914	
USP19	10869	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49145886	49145886	+	IGR	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr3:49145886G>A	ENST00000398888.2	-	0	4559				USP19_ENST00000417901.1_Missense_Mutation_p.R1372W|USP19_ENST00000453664.1_Missense_Mutation_p.R1360W|USP19_ENST00000398896.1_Missense_Mutation_p.R1077W|USP19_ENST00000398898.2_Missense_Mutation_p.R1309W	NM_006677.2	NP_006668.1	O94966	UBP19_HUMAN	ubiquitin specific peptidase 19						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of skeletal muscle tissue development (GO:0048642)|positive regulation of cell cycle process (GO:0090068)|protein deubiquitination (GO:0016579)|regulation of cellular response to hypoxia (GO:1900037)|regulation of protein stability (GO:0031647)|response to endoplasmic reticulum stress (GO:0034976)|skeletal muscle atrophy (GO:0014732)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(10)|lung(5)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GGGGCTGGCCGATCCACAGGG	0.677																																					p.R1372W		.											.	USP19	663	0			c.C4114T						.																																			SO:0001628	intergenic_variant	10869	exon27			CTGGCCGATCCAC	AB020698	CCDS43090.1, CCDS56254.1, CCDS56255.1, CCDS56256.1	3p21.31	2005-10-13	2005-08-08		ENSG00000172046	ENSG00000172046		"""Zinc fingers, MYND-type"", ""Ubiquitin-specific peptidases"""	12617	protein-coding gene	gene with protein product		614471	"""ubiquitin specific protease 19"""			12838346	Standard	NM_001199160		Approved	KIAA0891, ZMYND9	uc011bch.2	O94966	OTTHUMG00000133611		3.37:g.49145886G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	49.0	14.0	NM_001199161	A5PKX8|A6H8U2|B4DGT3|B4DTZ0|E7EN22|E7ETS0|E9PEG8|Q3KQW4|Q641Q9|Q6NZY8|Q86XV9	Missense_Mutation	SNP	ENST00000398888.2	37	CCDS43090.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653217	0.47362	.	.	ENSG00000172046	ENST00000398896;ENST00000398898;ENST00000417901;ENST00000453664	T;T;T;T	0.20463	2.07;2.07;2.17;2.17	5.4	4.43	0.53597	.	.	.	.	.	T	0.08935	0.0221	N	0.03608	-0.345	0.80722	D	1	B;B	0.13145	0.007;0.001	B;B	0.08055	0.003;0.0	T	0.10042	-1.0647	9	0.87932	D	0	.	5.417	0.16380	0.18:0.0:0.6629:0.1572	.	1360;1077	E7EN22;E7ESU0	.;.	W	1077;1309;1372;1360	ENSP00000381870:R1077W;ENSP00000381872:R1309W;ENSP00000395260:R1372W;ENSP00000400090:R1360W	ENSP00000381870:R1077W	R	-	1	2	USP19	49120890	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.261000	0.43276	1.248000	0.43934	0.655000	0.94253	CGG	.		0.677	USP19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257721.1	NM_006677	
USP42	84132	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	6189266	6189266	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr7:6189266delC	ENST00000306177.5	+	13	1597	c.1439delC	c.(1438-1440)tccfs	p.S480fs		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	480					cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCAAGCAGTTCCATGTCGAGT	0.488																																					p.S480fs		.											USP42,NS,malignant_melanoma,-1	USP42	659	0			c.1439delC						.						127.0	122.0	123.0					7																	6189266		1970	4147	6117	SO:0001589	frameshift_variant	84132	exon13			GCAGTTCCATGTC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.1439delC	7.37:g.6189266delC	ENSP00000301962:p.Ser480fs	Somatic	207.0	0.0		WXS	Illumina HiSeq	Phase_I	280.0	57.0	NM_032172	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Frame_Shift_Del	DEL	ENST00000306177.5	37	CCDS47535.1																																																																																			.		0.488	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
UTRN	7402	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	144765510	144765510	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr6:144765510G>T	ENST00000367545.3	+	13	1606	c.1606G>T	c.(1606-1608)Gaa>Taa	p.E536*		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	536	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GGAATTATTGGAAGAACAGGT	0.373																																					p.E536X		.											.	UTRN	95	0			c.G1606T						.						65.0	64.0	64.0					6																	144765510		2203	4300	6503	SO:0001587	stop_gained	7402	exon13			TTATTGGAAGAAC	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.1606G>T	6.37:g.144765510G>T	ENSP00000356515:p.Glu536*	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	29.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Nonsense_Mutation	SNP	ENST00000367545.3	37	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	G	39	7.624871	0.98396	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	.	.	.	5.44	5.44	0.79542	.	0.000000	0.53938	D	0.000058	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	.	19.6212	0.95656	0.0:0.0:1.0:0.0	.	.	.	.	X	536	.	ENSP00000356499:E536X	E	+	1	0	UTRN	144807203	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.338000	0.59316	2.723000	0.93209	0.655000	0.94253	GAA	.		0.373	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
VAV3	10451	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	108315394	108315394	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr1:108315394T>G	ENST00000370056.4	-	5	792	c.518A>C	c.(517-519)tAt>tCt	p.Y173S	VAV3_ENST00000371846.4_Missense_Mutation_p.Y108S|VAV3_ENST00000527011.1_Missense_Mutation_p.Y173S|VAV3_ENST00000343258.4_5'UTR	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	173					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TAAGTCCTCATAGACTTCTCC	0.368																																					p.Y173S		.											.	VAV3	1339	0			c.A518C						.						180.0	167.0	172.0					1																	108315394		2203	4300	6503	SO:0001583	missense	10451	exon5			TCCTCATAGACTT	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.518A>C	1.37:g.108315394T>G	ENSP00000359073:p.Tyr173Ser	Somatic	185.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	16.0	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.4|25.4	4.630967|4.630967	0.87660|0.87660	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000490388|ENST00000370056;ENST00000527011;ENST00000371846	.|T;T;T	.|0.36878	.|1.23;1.23;1.23	5.92|5.92	5.92|5.92	0.95590|0.95590	.|Dbl homology (DH) domain (1);Calponin homology domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.56906|0.56906	0.2017|0.2017	M|M	0.85041|0.85041	2.73|2.73	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.999;1.0;0.997	.|D;D;D	.|0.97110	.|0.995;1.0;0.957	T|T	0.61633|0.61633	-0.7023|-0.7023	5|10	.|0.45353	.|T	.|0.12	.|.	15.3456|15.3456	0.74334|0.74334	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|173;173;173	.|B7ZLR1;E9PQ97;Q9UKW4	.|.;.;VAV3_HUMAN	L|S	168|173;173;108	.|ENSP00000359073:Y173S;ENSP00000432540:Y173S;ENSP00000360912:Y108S	.|ENSP00000359073:Y173S	M|Y	-|-	1|2	0|0	VAV3|VAV3	108116917|108116917	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.977000|0.977000	0.68977|0.68977	6.722000|6.722000	0.74735|0.74735	2.266000|2.266000	0.75297|0.75297	0.533000|0.533000	0.62120|0.62120	ATG|TAT	.		0.368	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
WDR31	114987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	116082738	116082738	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:116082738G>C	ENST00000374193.4	-	9	925	c.679C>G	c.(679-681)Cct>Gct	p.P227A	WDR31_ENST00000341761.4_Missense_Mutation_p.P226A|WDR31_ENST00000374195.3_Missense_Mutation_p.P102A|WDR31_ENST00000461942.1_5'UTR	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31	227										NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						TGCTTTGCAGGAAACATATGA	0.478																																					p.P227A		.											.	WDR31	90	0			c.C679G						.						104.0	91.0	95.0					9																	116082738		2203	4300	6503	SO:0001583	missense	114987	exon9			TTGCAGGAAACAT	BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.679C>G	9.37:g.116082738G>C	ENSP00000363308:p.Pro227Ala	Somatic	142.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	61.0	NM_001012361	Q5W0T9|Q96EG8	Missense_Mutation	SNP	ENST00000374193.4	37	CCDS35110.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373672	0.61624	.	.	ENSG00000148225	ENST00000374193;ENST00000374195;ENST00000341761	T;T;T	0.06608	3.28;3.28;3.28	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.059559	0.64402	D	0.000002	T	0.08626	0.0214	L	0.55990	1.75	0.80722	D	1	P;P	0.41450	0.635;0.75	B;B	0.39152	0.153;0.292	T	0.34650	-0.9820	10	0.13108	T	0.6	-14.2162	16.2869	0.82725	0.0:0.1321:0.8679:0.0	.	227;226	Q8NA23;Q8NA23-2	WDR31_HUMAN;.	A	227;102;226	ENSP00000363308:P227A;ENSP00000363310:P102A;ENSP00000345027:P226A	ENSP00000345027:P226A	P	-	1	0	WDR31	115122559	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	6.877000	0.75562	2.771000	0.95319	0.563000	0.77884	CCT	.		0.478	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053734.2	NM_145241	
XKR9	389668	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	71646369	71646369	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr8:71646369A>G	ENST00000408926.3	+	5	1366	c.832A>G	c.(832-834)Att>Gtt	p.I278V	XKR9_ENST00000520030.1_Missense_Mutation_p.I278V|XKR9_ENST00000520273.1_Intron	NM_001011720.1	NP_001011720.1	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related family, member 9	278						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			ATTTTTTAATATTAAGGGACA	0.348																																					p.I278V		.											.	XKR9	92	0			c.A832G						.						76.0	75.0	75.0					8																	71646369		2203	4298	6501	SO:0001583	missense	389668	exon5			TTTAATATTAAGG	AY534247	CCDS34905.1	8q13.3	2006-01-12	2006-01-12			ENSG00000221947			20937	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 9"""				Standard	NM_001287258		Approved		uc003xyq.3	Q5GH70		ENST00000408926.3:c.832A>G	8.37:g.71646369A>G	ENSP00000386141:p.Ile278Val	Somatic	544.0	0.0		WXS	Illumina HiSeq	Phase_I	895.0	44.0	NM_001011720	B2RNS9|B9EH74	Missense_Mutation	SNP	ENST00000408926.3	37	CCDS34905.1	.	.	.	.	.	.	.	.	.	.	A	5.564	0.288872	0.10513	.	.	ENSG00000221947	ENST00000408926;ENST00000520030	T;T	0.56275	0.47;0.47	4.99	-0.673	0.11373	.	0.380726	0.29565	N	0.011793	T	0.20210	0.0486	N	0.02985	-0.445	0.38921	D	0.957737	B	0.09022	0.002	B	0.12156	0.007	T	0.38178	-0.9673	10	0.02654	T	1	-10.3735	10.2591	0.43416	0.592:0.0:0.408:0.0	.	278	Q5GH70	XKR9_HUMAN	V	278	ENSP00000386141:I278V;ENSP00000431088:I278V	ENSP00000386141:I278V	I	+	1	0	XKR9	71808923	0.993000	0.37304	0.999000	0.59377	0.982000	0.71751	0.215000	0.17562	0.006000	0.14734	0.460000	0.39030	ATT	.		0.348	XKR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378752.1	NM_001011720	
ZCCHC6	79670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	88934568	88934568	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr9:88934568T>A	ENST00000375963.3	-	15	3218	c.3046A>T	c.(3046-3048)Att>Ttt	p.I1016F	ZCCHC6_ENST00000277141.6_Missense_Mutation_p.I305F|ZCCHC6_ENST00000375960.2_Intron|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.I1016F|ZCCHC6_ENST00000375957.1_5'Flank	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	1016					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TCTTCTATAATTGTTGGAGAA	0.279																																					p.I1016F		.											.	ZCCHC6	92	0			c.A3046T						.						44.0	45.0	45.0					9																	88934568		2202	4298	6500	SO:0001583	missense	79670	exon15			CTATAATTGTTGG	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.3046A>T	9.37:g.88934568T>A	ENSP00000365130:p.Ile1016Phe	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	19.0	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	ENST00000375963.3	37	CCDS35057.1	.	.	.	.	.	.	.	.	.	.	T	11.11	1.542120	0.27563	.	.	ENSG00000083223	ENST00000277141;ENST00000375961;ENST00000375963	T;T;T	0.42513	0.97;0.97;0.97	4.95	-2.8	0.05823	.	0.686043	0.15557	N	0.256148	T	0.25644	0.0624	N	0.16656	0.425	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.15464	-1.0436	10	0.52906	T	0.07	-0.6012	13.7231	0.62740	0.0:0.574:0.0:0.426	.	1016	Q5VYS8	TUT7_HUMAN	F	305;1016;1016	ENSP00000277141:I305F;ENSP00000365128:I1016F;ENSP00000365130:I1016F	ENSP00000277141:I305F	I	-	1	0	ZCCHC6	88124388	0.001000	0.12720	0.076000	0.20297	0.965000	0.64279	0.122000	0.15687	-0.607000	0.05738	0.528000	0.53228	ATT	.		0.279	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
ZEB2	9839	broad.mit.edu;bcgsc.ca	37	2	145147427	145147427	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr2:145147427G>T	ENST00000558170.2	-	10	4420	c.3236C>A	c.(3235-3237)tCc>tAc	p.S1079Y	ZEB2_ENST00000303660.4_Missense_Mutation_p.S1079Y|ZEB2_ENST00000409487.3_Missense_Mutation_p.S1079Y|ZEB2_ENST00000539609.3_Missense_Mutation_p.S1055Y	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1079					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CTTGCAGTAGGAATACCTGTG	0.602																																					p.S1079Y	Melanoma(33;1235 1264 5755 16332)	.											.	ZEB2	297	0			c.C3236A						.						54.0	53.0	54.0					2																	145147427		2203	4300	6503	SO:0001583	missense	9839	exon10			CAGTAGGAATACC	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3236C>A	2.37:g.145147427G>T	ENSP00000454157:p.Ser1079Tyr	Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	6.0	NM_014795	A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	ENST00000558170.2	37	CCDS2186.1	.	.	.	.	.	.	.	.	.	.	G	31	5.059692	0.93846	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.10382	2.88;2.88;2.88	5.51	5.51	0.81932	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.35799	0.0944	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.995	D;D;D	0.91635	0.999;0.986;0.986	T	0.03221	-1.1059	10	0.87932	D	0	-7.5586	19.7945	0.96474	0.0:0.0:1.0:0.0	.	1055;1078;1079	F5H814;A0JP08;O60315	.;.;ZEB2_HUMAN	Y	1055;1079;1079	ENSP00000443792:S1055Y;ENSP00000302501:S1079Y;ENSP00000386854:S1079Y	ENSP00000302501:S1079Y	S	-	2	0	ZEB2	144863897	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.746000	0.94184	0.591000	0.81541	TCC	.		0.602	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
ZNF253	56242	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	20003387	20003387	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:20003387G>A	ENST00000589717.1	+	4	1423	c.1331G>A	c.(1330-1332)aGa>aAa	p.R444K	AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.R368K|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	444					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACACATAAGAGAATTCATACT	0.358																																					p.R444K		.											.	ZNF253	90	0			c.G1331A						.						43.0	47.0	46.0					19																	20003387		2132	4271	6403	SO:0001583	missense	56242	exon4			ATAAGAGAATTCA	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1331G>A	19.37:g.20003387G>A	ENSP00000468720:p.Arg444Lys	Somatic	122.0	0.0		WXS	Illumina HiSeq	Phase_I	233.0	15.0	NM_021047	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	g	2.517	-0.311623	0.05422	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	-1.75	0.08031	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17195	0.0413	N	0.13003	0.285	0.25324	N	0.98909	B	0.06786	0.001	B	0.11329	0.006	T	0.27226	-1.0080	7	.	.	.	.	5.676	0.17749	0.0:0.0:0.686:0.314	.	444	O75346	ZN253_HUMAN	K	444	.	.	R	+	2	0	ZNF253	19864387	0.000000	0.05858	0.018000	0.16275	0.018000	0.09664	0.158000	0.16422	-0.892000	0.03935	-0.901000	0.02856	AGA	.		0.358	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
ZNF253	56242	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	20003414	20003414	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:20003414A>G	ENST00000589717.1	+	4	1450	c.1358A>G	c.(1357-1359)aAa>aGa	p.K453R	AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.K377R|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	453					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAACCTTACAAATGTGAAGAA	0.363																																					p.K453R		.											.	ZNF253	90	0			c.A1358G						.						47.0	53.0	51.0					19																	20003414		2115	4267	6382	SO:0001583	missense	56242	exon4			CTTACAAATGTGA	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1358A>G	19.37:g.20003414A>G	ENSP00000468720:p.Lys453Arg	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	316.0	28.0	NM_021047	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	37	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	a	6.633	0.485302	0.12641	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31670	0.0804	M	0.65498	2.005	0.18873	N	0.999982	P	0.42078	0.77	B	0.40199	0.322	T	0.20174	-1.0283	7	.	.	.	.	2.9089	0.05730	0.5963:0.0:0.0:0.4036	.	453	O75346	ZN253_HUMAN	R	453	.	.	K	+	2	0	ZNF253	19864414	0.000000	0.05858	0.056000	0.19401	0.056000	0.15407	-1.607000	0.02070	0.251000	0.21505	0.248000	0.18094	AAA	.		0.363	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
ZNF570	148268	broad.mit.edu;bcgsc.ca	37	19	37975151	37975151	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:37975151G>C	ENST00000330173.1	+	5	1156	c.627G>C	c.(625-627)aaG>aaC	p.K209N	ZNF570_ENST00000586475.1_Missense_Mutation_p.K265N|ZNF570_ENST00000388801.3_Missense_Mutation_p.K6N	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTAAGCCCAAGAGTGTCTGTG	0.353																																					p.K209N		.											.	ZNF570	91	0			c.G627C						.						114.0	134.0	127.0					19																	37975151		2193	4298	6491	SO:0001583	missense	148268	exon5			GCCCAAGAGTGTC	AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.627G>C	19.37:g.37975151G>C	ENSP00000331540:p.Lys209Asn	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	136.0	6.0	NM_144694	A1L472|B4DMP1	Missense_Mutation	SNP	ENST00000330173.1	37	CCDS12504.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.320044	0.41096	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	T;T	0.06142	3.53;3.34	4.74	-1.58	0.08479	.	0.000000	0.34555	N	0.003872	T	0.09069	0.0224	L	0.43152	1.355	0.23210	N	0.998117	D;D	0.56287	0.975;0.973	P;P	0.55455	0.776;0.599	T	0.12656	-1.0539	10	0.87932	D	0	.	5.023	0.14370	0.4399:0.0:0.4215:0.1386	.	6;209	B4DMP1;Q96NI8	.;ZN570_HUMAN	N	209;6	ENSP00000331540:K209N;ENSP00000373453:K6N	ENSP00000331540:K209N	K	+	3	2	ZNF570	42666991	0.000000	0.05858	0.418000	0.26571	0.754000	0.42855	0.031000	0.13710	0.020000	0.15106	0.563000	0.77884	AAG	.		0.353	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109600.1	NM_144694	
ZNF69	7620	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	12014498	12014498	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:12014498G>C	ENST00000429654.2	+	2	314	c.174G>C	c.(172-174)agG>agC	p.R58S	ZNF69_ENST00000340180.5_Missense_Mutation_p.R44S			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		AAACTTTCAGGAACCTGACCT	0.443																																					p.R44S		.											.	ZNF69	91	0			c.G132C						.						145.0	141.0	142.0					19																	12014498		2203	4300	6503	SO:0001583	missense	7620	exon2			TTTCAGGAACCTG	X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.174G>C	19.37:g.12014498G>C	ENSP00000402985:p.Arg58Ser	Somatic	385.0	0.0		WXS	Illumina HiSeq	Phase_I	679.0	386.0	NM_021915	Q86VA7	Missense_Mutation	SNP	ENST00000429654.2	37		.	.	.	.	.	.	.	.	.	.	g	8.952	0.968472	0.18659	.	.	ENSG00000198429	ENST00000429654;ENST00000445911;ENST00000340180	T;T;T	0.01629	4.72;4.72;4.72	1.04	-1.38	0.09027	.	.	.	.	.	T	0.03477	0.0100	L	0.53671	1.685	0.19300	N	0.99997	B	0.31026	0.304	B	0.43658	0.426	T	0.45071	-0.9286	9	0.72032	D	0.01	.	5.24	0.15467	0.3966:0.0:0.6034:0.0	.	44	C9JR48	.	S	58;44;44	ENSP00000402985:R58S;ENSP00000388784:R44S;ENSP00000345333:R44S	ENSP00000345333:R44S	R	+	3	2	ZNF69	11875498	0.001000	0.12720	0.034000	0.17996	0.362000	0.29581	0.353000	0.20130	-0.409000	0.07553	0.398000	0.26397	AGG	.		0.443	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000344082.1	NM_021915	
ZNF578	147660	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53008031	53008031	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:53008031G>A	ENST00000421239.2	+	5	431	c.187G>A	c.(187-189)Gtg>Atg	p.V63M		NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	63	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		CCTGGAGGCTGTGGGTGAGGA	0.488																																					p.V63M		.											.	.	.	0			c.G187A						.						80.0	89.0	86.0					19																	53008031		2203	4297	6500	SO:0001583	missense	147660	exon5			GAGGCTGTGGGTG	AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.187G>A	19.37:g.53008031G>A	ENSP00000459216:p.Val63Met	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	47.0	NM_001099694	B4DR51|I3L1Y6	Missense_Mutation	SNP	ENST00000421239.2	37	CCDS54310.1	.	.	.	.	.	.	.	.	.	.	-	8.400	0.841750	0.16963	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.29	-2.57	0.06248	.	.	.	.	.	T	0.39963	0.1098	L	0.49350	1.555	0.09310	N	1	D	0.58620	0.983	P	0.57776	0.827	T	0.26189	-1.0110	7	.	.	.	.	4.2396	0.10642	0.0:0.3577:0.3802:0.2621	.	63	G3V4F6	.	M	63	.	.	V	+	1	0	ZNF578	57699843	0.000000	0.05858	0.084000	0.20598	0.426000	0.31534	-1.278000	0.02809	-1.233000	0.02551	0.194000	0.17425	GTG	.		0.488	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344298.3	NM_152472	
ZNF813	126017	broad.mit.edu;bcgsc.ca	37	19	53995075	53995075	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr19:53995075A>G	ENST00000396403.4	+	4	1717	c.1589A>G	c.(1588-1590)aAg>aGg	p.K530R	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		GAATGTGGCAAGGTTTTTAAT	0.358																																					p.K530R		.											.	ZNF813	67	0			c.A1589G						.						49.0	53.0	52.0					19																	53995075		2199	4294	6493	SO:0001583	missense	126017	exon4			GTGGCAAGGTTTT	AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1589A>G	19.37:g.53995075A>G	ENSP00000379684:p.Lys530Arg	Somatic	238.0	1.0		WXS	Illumina HiSeq	Phase_I	310.0	18.0	NM_001004301		Missense_Mutation	SNP	ENST00000396403.4	37	CCDS46172.1	.	.	.	.	.	.	.	.	.	.	a	11.48	1.650567	0.29336	.	.	ENSG00000198346	ENST00000396403	T	0.26223	1.75	1.32	0.179	0.15063	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32645	0.0836	L	0.39514	1.22	0.37686	D	0.923686	D	0.59357	0.985	D	0.66351	0.943	T	0.19257	-1.0311	9	0.56958	D	0.05	.	5.1816	0.15163	0.8192:0.0:0.1808:0.0	.	530	Q6ZN06	ZN813_HUMAN	R	530	ENSP00000379684:K530R	ENSP00000379684:K530R	K	+	2	0	ZNF813	58686887	0.444000	0.25649	0.001000	0.08648	0.005000	0.04900	2.316000	0.43761	-0.828000	0.04273	-1.365000	0.01206	AAG	.		0.358	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350638.1	NM_001004301	
ZSCAN30	100101467	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	32843982	32843982	+	Missense_Mutation	SNP	C	C	T	rs368624179		TCGA-DD-A113-01A-11D-A12Z-10	TCGA-DD-A113-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	c6c53601-c4c7-429b-9fac-cf9d3db20ab1	59993464-9550-4996-b7c9-ca8629febad1	g.chr18:32843982C>T	ENST00000420878.3	-	3	790	c.335G>A	c.(334-336)cGg>cAg	p.R112Q	ZSCAN30_ENST00000383091.2_Missense_Mutation_p.R112Q|ZSCAN30_ENST00000592278.1_Missense_Mutation_p.R112Q|ZSCAN30_ENST00000589178.1_Missense_Mutation_p.R112Q|ZSCAN30_ENST00000333206.5_Missense_Mutation_p.R112Q|ZNF397_ENST00000589420.1_Intron|ZSCAN30_ENST00000601405.1_Intron	NM_001166012.1	NP_001159484.1	Q86W11	ZSC30_HUMAN	zinc finger and SCAN domain containing 30	112	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(3)|urinary_tract(1)	9						ATTCTCTGGCCGATGCTCTCG	0.527																																					p.R112Q		.											.	ZSCAN30	68	0			c.G335A						.	C	GLN/ARG,GLN/ARG	0,3136		0,0,1568	58.0	56.0	57.0		335,335	-2.5	0.0	18		57	1,7163		0,1,3581	no	missense,missense	ZSCAN30	NM_001112734.2,NM_001166012.1	43,43	0,1,5149	TT,TC,CC		0.014,0.0,0.0097	benign,benign	112/495,112/495	32843982	1,10299	1568	3582	5150	SO:0001583	missense	100101467	exon3			TCTGGCCGATGCT	AY234408	CCDS42427.1, CCDS74207.1	18q12.2	2013-01-08	2010-07-23	2010-07-23	ENSG00000186814	ENSG00000186814		"""-"", ""Zinc fingers, C2H2-type"""	33517	protein-coding gene	gene with protein product			"""zinc finger protein 397 opposite strand"", ""ZNF397 opposite strand"""	ZNF397OS		12801647	Standard	NM_001166012		Approved	ZNF917	uc002kym.3	Q86W11		ENST00000420878.3:c.335G>A	18.37:g.32843982C>T	ENSP00000392371:p.Arg112Gln	Somatic	223.0	0.0		WXS	Illumina HiSeq	Phase_I	352.0	17.0	NM_001166012	B4E0N0|Q6ZNB3|Q96PN3	Missense_Mutation	SNP	ENST00000420878.3	37	CCDS42427.1	.	.	.	.	.	.	.	.	.	.	C	7.519	0.656308	0.14580	0.0	1.4E-4	ENSG00000186814	ENST00000420878;ENST00000333206;ENST00000360932;ENST00000383091	T;T;T	0.05855	3.38;3.38;3.38	4.6	-2.48	0.06423	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.04679	0.0127	L	0.31120	0.905	0.09310	N	1	B;B	0.18166	0.026;0.001	B;B	0.13407	0.009;0.005	T	0.42632	-0.9440	9	0.24483	T	0.36	.	9.7917	0.40710	0.0:0.3334:0.0:0.6666	.	112;112	C9JCM2;Q86W11	.;ZSC30_HUMAN	Q	112;112;69;112	ENSP00000392371:R112Q;ENSP00000329738:R112Q;ENSP00000372569:R112Q	ENSP00000329738:R112Q	R	-	2	0	ZSCAN30	31097980	0.000000	0.05858	0.000000	0.03702	0.915000	0.54546	-1.800000	0.01744	-0.685000	0.05177	-0.143000	0.13931	CGG	.		0.527	ZSCAN30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442510.1	NM_001112734	
