#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48311639	48311639	+	Silent	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr7:48311639A>G	ENST00000435803.1	+	17	2400	c.2376A>G	c.(2374-2376)aaA>aaG	p.K792K		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	792					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATGCTCAGAAACTCTTGGAAT	0.383																																					p.K792K		.											.	ABCA13	521	0			c.A2376G						.						41.0	41.0	41.0					7																	48311639		1835	4093	5928	SO:0001819	synonymous_variant	154664	exon17			TCAGAAACTCTTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2376A>G	7.37:g.48311639A>G		Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	11.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	ENST00000435803.1	37	CCDS47584.1																																																																																			.		0.383	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ABCC6	368	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	16244451	16244451	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:16244451C>A	ENST00000205557.7	-	30	4416	c.4387G>T	c.(4387-4389)Gtg>Ttg	p.V1463L		NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	1463	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CAGTCCATCACGGAGCGCAGG	0.682																																					p.V1463L		.											.	ABCC6	93	0			c.G4387T						.						36.0	30.0	32.0					16																	16244451		2197	4298	6495	SO:0001583	missense	368	exon30			CCATCACGGAGCG	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.4387G>T	16.37:g.16244451C>A	ENSP00000205557:p.Val1463Leu	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	24.0	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	37	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673134	0.29693	.	.	ENSG00000091262	ENST00000205557;ENST00000205558	T	0.70164	-0.46	4.38	4.38	0.52667	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.187888	0.25086	U	0.033253	T	0.42832	0.1220	N	0.16903	0.455	0.80722	D	1	P;P	0.42961	0.795;0.795	B;B	0.35073	0.195;0.195	T	0.47407	-0.9120	10	0.62326	D	0.03	.	5.1143	0.14825	0.0:0.6404:0.1828:0.1768	.	1463;1463	O95255;A8Y988	MRP6_HUMAN;.	L	1463;401	ENSP00000205557:V1463L	ENSP00000205557:V1463L	V	-	1	0	ABCC6	16151952	0.905000	0.30787	0.868000	0.34077	0.300000	0.27592	1.567000	0.36407	2.164000	0.68074	0.561000	0.74099	GTG	.		0.682	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
AHNAK2	113146	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105416248	105416248	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr14:105416248T>C	ENST00000333244.5	-	7	5659	c.5540A>G	c.(5539-5541)gAt>gGt	p.D1847G	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1847						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGCAGACACATCCACCGAGGC	0.597																																					p.D1847G		.											.	AHNAK2	47	0			c.A5540G						.						171.0	210.0	197.0					14																	105416248		1940	4105	6045	SO:0001583	missense	113146	exon7			GACACATCCACCG	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.5540A>G	14.37:g.105416248T>C	ENSP00000353114:p.Asp1847Gly	Somatic	335.0	0.0		WXS	Illumina HiSeq	Phase_I	194.0	44.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	t	18.96	3.732789	0.69189	.	.	ENSG00000185567	ENST00000333244	T	0.02177	4.41	4.65	4.65	0.58169	.	.	.	.	.	T	0.12178	0.0296	M	0.88640	2.97	0.32732	N	0.508881	D	0.67145	0.996	P	0.62298	0.9	T	0.14420	-1.0473	9	0.31617	T	0.26	-16.2422	12.0778	0.53653	0.0:0.0:0.0:1.0	.	1847	Q8IVF2	AHNK2_HUMAN	G	1847	ENSP00000353114:D1847G	ENSP00000353114:D1847G	D	-	2	0	AHNAK2	104487293	0.057000	0.20700	0.271000	0.24616	0.017000	0.09413	1.235000	0.32671	1.751000	0.51876	0.454000	0.30748	GAT	.		0.597	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
AKAP13	11214	ucsc.edu;bcgsc.ca	37	15	86236558	86236558	+	Silent	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:86236558A>G	ENST00000394518.2	+	17	5435	c.5340A>G	c.(5338-5340)aaA>aaG	p.K1780K	AKAP13_ENST00000394510.2_Silent_p.K25K|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Silent_p.K1784K	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1780					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						aagattctaaagacaaggaga	0.413																																					p.K1784K	Melanoma(94;603 1453 3280 32295 32951)	.											.	AKAP13	258	0			c.A5352G						.						129.0	133.0	132.0					15																	86236558		2202	4299	6501	SO:0001819	synonymous_variant	11214	exon17			TTCTAAAGACAAG	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.5340A>G	15.37:g.86236558A>G		Somatic	108.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	ENST00000394518.2	37	CCDS32319.1																																																																																			.		0.413	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
ALS2	57679	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	202633600	202633600	+	Silent	SNP	T	T	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:202633600T>G	ENST00000264276.6	-	2	381	c.9A>C	c.(7-9)tcA>tcC	p.S3S	ALS2_ENST00000467448.1_Silent_p.S3S|ALS2_ENST00000496244.1_5'UTR	NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	3					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						TTCTCTTCTTTGAGTCCATCG	0.368																																					p.S3S		.											.	ALS2	275	0			c.A9C						.						137.0	129.0	131.0					2																	202633600		1862	4102	5964	SO:0001819	synonymous_variant	57679	exon2			CTTCTTTGAGTCC	AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.9A>C	2.37:g.202633600T>G		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	22.0	NM_001135745	Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Silent	SNP	ENST00000264276.6	37	CCDS42800.1																																																																																			.		0.368	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335562.3	NM_020919	
ANKRD26	22852	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	27352965	27352965	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:27352965C>A	ENST00000376087.4	-	12	1480	c.1315G>T	c.(1315-1317)Ggg>Tgg	p.G439W	ANKRD26_ENST00000436985.2_Missense_Mutation_p.G488W	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	439					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TCTGCAGCCCCAGCTAAAGGA	0.308																																					p.G439W		.											.	ANKRD26	138	0			c.G1315T						.						92.0	82.0	85.0					10																	27352965		1791	4063	5854	SO:0001583	missense	22852	exon12			CAGCCCCAGCTAA	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1315G>T	10.37:g.27352965C>A	ENSP00000365255:p.Gly439Trp	Somatic	211.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	45.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	37	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.028967	0.35797	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.35973	1.37;1.28	4.16	3.23	0.37069	.	.	.	.	.	T	0.56156	0.1966	M	0.71036	2.16	0.27959	N	0.936847	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.74674	0.984;0.964;0.976	T	0.48210	-0.9055	9	0.66056	D	0.02	.	10.4564	0.44553	0.0:0.8008:0.1992:0.0	.	439;439;488	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	W	439;488	ENSP00000365255:G439W;ENSP00000405112:G488W	ENSP00000365255:G439W	G	-	1	0	ANKRD26	27392971	0.526000	0.26298	0.034000	0.17996	0.001000	0.01503	1.865000	0.39479	1.022000	0.39626	-0.305000	0.09177	GGG	.		0.308	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
ANXA3	306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79503384	79503384	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr4:79503384G>A	ENST00000264908.6	+	5	631	c.252G>A	c.(250-252)atG>atA	p.M84I	ANXA3_ENST00000503570.2_Missense_Mutation_p.M45I|ANXA3_ENST00000512884.1_Missense_Mutation_p.M45I	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	84					defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						AGCATCTCATGGTGGCCCTAG	0.453																																					p.M84I	GBM(2;126 157 27790 28920 42492)	.											.	ANXA3	90	0			c.G252A						.						87.0	84.0	85.0					4																	79503384		2203	4300	6503	SO:0001583	missense	306	exon5			TCTCATGGTGGCC	M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.252G>A	4.37:g.79503384G>A	ENSP00000264908:p.Met84Ile	Somatic	304.0	0.0		WXS	Illumina HiSeq	Phase_I	157.0	62.0	NM_005139	B2R9W6|Q6LET2	Missense_Mutation	SNP	ENST00000264908.6	37	CCDS3584.1	.	.	.	.	.	.	.	.	.	.	G	8.570	0.879933	0.17467	.	.	ENSG00000138772	ENST00000264908;ENST00000512884;ENST00000503570;ENST00000512373;ENST00000514171;ENST00000508214	T;T;T;T;T;T	0.03181	4.02;4.02;4.02;4.02;4.02;4.02	5.16	5.16	0.70880	Annexin repeat, conserved site (1);	0.146214	0.64402	D	0.000009	T	0.03220	0.0094	N	0.16066	0.365	0.51233	D	0.999914	B	0.27117	0.168	B	0.34346	0.18	T	0.32268	-0.9913	10	0.02654	T	1	.	17.5603	0.87905	0.0:0.0:1.0:0.0	.	84	P12429	ANXA3_HUMAN	I	84;45;45;84;84;84	ENSP00000264908:M84I;ENSP00000423068:M45I;ENSP00000421015:M45I;ENSP00000424584:M84I;ENSP00000421512:M84I;ENSP00000422281:M84I	ENSP00000264908:M84I	M	+	3	0	ANXA3	79722408	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	1.792000	0.38754	2.674000	0.91012	0.591000	0.81541	ATG	.		0.453	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252516.3	NM_005139	
ARHGAP30	257106	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	161017651	161017651	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:161017651A>T	ENST00000368013.3	-	12	3480	c.3160T>A	c.(3160-3162)Tct>Act	p.S1054T	USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Missense_Mutation_p.S843T|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.S877T|USF1_ENST00000368020.1_5'Flank|USF1_ENST00000368021.3_5'Flank	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	1054					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			GCACCTTCAGATGGGAGCTCC	0.592																																					p.S1054T		.											.	ARHGAP30	25	0			c.T3160A						.						76.0	76.0	76.0					1																	161017651		2203	4300	6503	SO:0001583	missense	257106	exon12			CTTCAGATGGGAG	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.3160T>A	1.37:g.161017651A>T	ENSP00000356992:p.Ser1054Thr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	35.0	NM_001025598	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	A	1.347	-0.592555	0.03799	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368015	T;T;T	0.30182	3.07;3.07;1.54	3.89	-3.82	0.04281	.	1.419890	0.04833	N	0.439041	T	0.07999	0.0200	L	0.36672	1.1	0.09310	N	1	B;B	0.18610	0.01;0.029	B;B	0.12156	0.007;0.006	T	0.33523	-0.9865	10	0.49607	T	0.09	.	6.4205	0.21740	0.5708:0.1497:0.2795:0.0	.	1054;843	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	T	843;1054;877	ENSP00000356995:S843T;ENSP00000356992:S1054T;ENSP00000356994:S877T	ENSP00000356992:S1054T	S	-	1	0	ARHGAP30	159284275	0.012000	0.17670	0.018000	0.16275	0.020000	0.10135	-0.680000	0.05197	-1.463000	0.01904	-1.815000	0.00603	TCT	.		0.592	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077090.2	NM_181720	
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	73168941	73168941	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:73168941C>T	ENST00000426542.2	+	21	2704	c.2684C>T	c.(2683-2685)cCc>cTc	p.P895L	ARHGEF28_ENST00000513042.2_Missense_Mutation_p.P895L|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.P895L|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.P895L|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.P895L|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.P895L|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.P582L			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	895	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										AAAATTTTCCCCTGTTTAGAT	0.468																																					p.P895L		.											.	.	.	0			c.C2684T						.						58.0	58.0	58.0					5																	73168941		1937	4140	6077	SO:0001583	missense	64283	exon22			TTTTCCCCTGTTT		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2684C>T	5.37:g.73168941C>T	ENSP00000412175:p.Pro895Leu	Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	50.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970568	0.92919	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.24	5.24	0.73138	Dbl homology (DH) domain (5);	.	.	.	.	D	0.84401	0.5464	M	0.85041	2.73	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;0.999	D;D;D;D	0.97110	1.0;0.99;0.99;0.986	D	0.86711	0.1936	9	0.87932	D	0	.	19.1848	0.93639	0.0:1.0:0.0:0.0	.	582;895;895;895	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	L	895;895;895;895;895;895;582	ENSP00000296794:P895L;ENSP00000441913:P895L;ENSP00000441436:P895L;ENSP00000287898:P895L;ENSP00000411459:P895L;ENSP00000412175:P895L;ENSP00000296799:P582L	ENSP00000287898:P895L	P	+	2	0	RP11-428C6.1	73204697	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.729000	0.84864	2.610000	0.88304	0.650000	0.86243	CCC	.		0.468	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
ATM	472	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	108172499	108172499	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:108172499A>G	ENST00000452508.2	+	36	5491	c.5302A>G	c.(5302-5304)Aga>Gga	p.R1768G	ATM_ENST00000278616.4_Missense_Mutation_p.R1768G			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1768					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACAGCCTTTTAGAACATCAAG	0.353			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.R1768G		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	3419	0			c.A5302G						.						85.0	88.0	87.0					11																	108172499		2201	4298	6499	SO:0001583	missense	472	exon35	Familial Cancer Database	AT, Louis-Bar syndrome	CCTTTTAGAACAT	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.5302A>G	11.37:g.108172499A>G	ENSP00000388058:p.Arg1768Gly	Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	113.0	15.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	37	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196148	0.58126	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.83506	-1.73;-1.73	4.8	2.41	0.29592	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.88043	0.6331	M	0.73598	2.24	0.40800	D	0.983336	D	0.69078	0.997	P	0.61003	0.882	D	0.87215	0.2250	10	0.52906	T	0.07	.	12.038	0.53435	0.6669:0.3331:0.0:0.0	.	1768	Q13315	ATM_HUMAN	G	1768	ENSP00000278616:R1768G;ENSP00000388058:R1768G	ENSP00000278616:R1768G	R	+	1	2	ATM	107677709	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.034000	0.49751	0.274000	0.22072	0.377000	0.23210	AGA	.		0.353	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
ATP9A	10079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50346419	50346419	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:50346419T>A	ENST00000338821.5	-	2	431	c.167A>T	c.(166-168)aAt>aTt	p.N56I	ATP9A_ENST00000311637.5_Missense_Mutation_p.N41I|ATP9A_ENST00000402822.1_Missense_Mutation_p.N56I|ATP9A_ENST00000477492.1_5'UTR	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	56					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						GTTGATGACATTCCGAGGATA	0.547																																					p.N56I		.											.	ATP9A	94	0			c.A167T						.						155.0	133.0	140.0					20																	50346419		2203	4300	6503	SO:0001583	missense	10079	exon2			ATGACATTCCGAG	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.167A>T	20.37:g.50346419T>A	ENSP00000342481:p.Asn56Ile	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	23.0	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.980823	0.92982	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.98762	-5.12;-5.12;-5.12	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	M	0.85041	2.73	0.33794	D	0.625851	B;P	0.49862	0.054;0.929	B;P	0.54815	0.055;0.761	D	0.99978	1.2344	10	0.87932	D	0	-20.706	15.4675	0.75412	0.0:0.0:0.0:1.0	.	56;56	O75110-2;O75110	.;ATP9A_HUMAN	I	41;56;56	ENSP00000309086:N41I;ENSP00000342481:N56I;ENSP00000385875:N56I	ENSP00000309086:N41I	N	-	2	0	ATP9A	49779826	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.461000	0.80834	2.107000	0.64212	0.460000	0.39030	AAT	.		0.547	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
BAHCC1	57597	ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79409035	79409035	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:79409035G>A	ENST00000307745.7	+	9	660	c.660G>A	c.(658-660)gtG>gtA	p.V220V																								GCTTCCTCGTGGGCAAAGAGC	0.701																																					.		.											.	BAHCC1	23	0			.						.						20.0	26.0	24.0					17																	79409035		2081	4183	6264	SO:0001819	synonymous_variant	57597	.			CCTCGTGGGCAAA																												ENST00000307745.7:c.660G>A	17.37:g.79409035G>A		Somatic	57.0	0.0		WXS	Illumina HiSeq	.	46.0	7.0	.		Silent	SNP	ENST00000307745.7	37																																																																																				.		0.701	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
C20orf196	149840	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	5844104	5844104	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:5844104C>G	ENST00000303142.6	+	3	700	c.613C>G	c.(613-615)Ctg>Gtg	p.L205V		NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	205										endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						AATGAAAGACCTGTAACTGGT	0.512																																					p.L205V		.											.	C20orf196	90	0			c.C613G						.						71.0	70.0	70.0					20																	5844104		2201	4298	6499	SO:0001583	missense	149840	exon3			AAAGACCTGTAAC	AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.613C>G	20.37:g.5844104C>G	ENSP00000305875:p.Leu205Val	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	7.0	NM_152504	A8K9J3|Q5TGA9|Q96LU1	Missense_Mutation	SNP	ENST00000303142.6	37	CCDS13091.1	.	.	.	.	.	.	.	.	.	.	C	11.92	1.782024	0.31502	.	.	ENSG00000171984	ENST00000303142;ENST00000378971	T	0.48522	0.81	5.54	1.21	0.21127	.	1.162880	0.06175	N	0.678450	T	0.30448	0.0765	N	0.19112	0.55	0.09310	N	1	B	0.23990	0.095	B	0.18871	0.023	T	0.33137	-0.9880	10	0.87932	D	0	-11.1558	3.344	0.07128	0.1662:0.4178:0.3232:0.0928	.	205	Q8IYI0	CT196_HUMAN	V	205;151	ENSP00000305875:L205V	ENSP00000305875:L205V	L	+	1	2	C20orf196	5792104	0.000000	0.05858	0.447000	0.26932	0.171000	0.22731	-0.269000	0.08596	0.828000	0.34709	0.655000	0.94253	CTG	.		0.512	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077882.2	NM_152504	
CACNB4	785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152732958	152732958	+	Missense_Mutation	SNP	C	C	G	rs376364352		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:152732958C>G	ENST00000539935.1	-	5	570	c.503G>C	c.(502-504)aGa>aCa	p.R168T	CACNB4_ENST00000397327.2_Missense_Mutation_p.R121T|CACNB4_ENST00000360283.6_Missense_Mutation_p.R134T|CACNB4_ENST00000201943.5_Missense_Mutation_p.R168T|CACNB4_ENST00000427385.1_Missense_Mutation_p.R150T|CACNB4_ENST00000534999.1_Missense_Mutation_p.R134T	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	168					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	AAAACGTCCTCTTTTTTGTTC	0.418																																					p.R168T		.											.	CACNB4	24	0			c.G503C						.	C	THR/ARG,THR/ARG,THR/ARG,THR/ARG	1,3793		0,1,1896	139.0	131.0	134.0		503,449,401,503	5.6	1.0	2		134	0,8242		0,0,4121	no	missense,missense,missense,missense	CACNB4	NM_000726.3,NM_001005746.2,NM_001005747.2,NM_001145798.1	71,71,71,71	0,1,6017	GG,GC,CC		0.0,0.0264,0.0083	benign,benign,benign,benign	168/521,150/503,134/487,168/459	152732958	1,12035	1897	4121	6018	SO:0001583	missense	785	exon5			CGTCCTCTTTTTT	AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.503G>C	2.37:g.152732958C>G	ENSP00000438949:p.Arg168Thr	Somatic	279.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	28.0	NM_001145798	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Missense_Mutation	SNP	ENST00000539935.1	37	CCDS46426.1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.731069	0.48939	2.64E-4	0.0	ENSG00000182389	ENST00000539935;ENST00000360283;ENST00000543269;ENST00000439467;ENST00000534999;ENST00000397327;ENST00000427385;ENST00000201943;ENST00000339254	D;D;D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57;-1.57	5.63	5.63	0.86233	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	T	0.76343	0.3974	L	0.28115	0.83	0.58432	D	0.999999	P;B;P;B;P	0.38922	0.651;0.129;0.561;0.418;0.554	B;B;B;B;B	0.39419	0.212;0.071;0.157;0.157;0.299	T	0.72228	-0.4354	10	0.15952	T	0.53	-17.4098	20.0499	0.97621	0.0:1.0:0.0:0.0	.	168;134;168;150;134	A7BJ74;E7DBM8;O00305;B4DG40;O00305-2	.;.;CACB4_HUMAN;.;.	T	168;134;125;163;134;121;150;168;168	ENSP00000438949:R168T;ENSP00000353425:R134T;ENSP00000390161:R163T;ENSP00000443893:R134T;ENSP00000380490:R121T;ENSP00000410978:R150T;ENSP00000201943:R168T	ENSP00000201943:R168T	R	-	2	0	CACNB4	152441204	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.847000	0.69451	2.798000	0.96311	0.655000	0.94253	AGA	.		0.418	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	
CCDC168	643677	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	103381888	103381888	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr13:103381888C>T	ENST00000322527.2	-	1	7271	c.7272G>A	c.(7270-7272)aaG>aaA	p.K2424K		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2424																	AACTTGAAATCTTTGCCACTA	0.448																																					p.K7053K		.											.	.	.	0			c.G21159A						.						55.0	57.0	57.0					13																	103381888		692	1591	2283	SO:0001819	synonymous_variant	643677	exon4			TGAAATCTTTGCC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.7272G>A	13.37:g.103381888C>T		Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	119.0	9.0	NM_001146197	Q8N800	Silent	SNP	ENST00000322527.2	37																																																																																				.		0.448	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
CEP97	79598	hgsc.bcm.edu;bcgsc.ca	37	3	101481359	101481360	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:101481359_101481360insA	ENST00000341893.3	+	10	2600_2601	c.1848_1849insA	c.(1849-1851)aaafs	p.K617fs	CEP97_ENST00000327230.4_Frame_Shift_Ins_p.K617fs|CEP97_ENST00000494050.1_Frame_Shift_Ins_p.K558fs			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	617	CCP110-binding.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						AAGAACGTATTAAAAAATTTGT	0.337																																					p.I616fs		.											.	CEP97	70	0			c.1848_1849insA						.																																			SO:0001589	frameshift_variant	79598	exon10			ACGTATTAAAAAA	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1854dupA	3.37:g.101481365_101481365dupA	ENSP00000342510:p.Lys617fs	Somatic	511.0	0.0		WXS	Illumina HiSeq	Phase_I	281.0	51.0	NM_024548	B5MDY8|Q8NA71|Q9H5T9	Frame_Shift_Ins	INS	ENST00000341893.3	37	CCDS2944.1																																																																																			.		0.337	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548	
CLEC4F	165530	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	71043634	71043634	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:71043634C>G	ENST00000272367.2	-	4	955	c.879G>C	c.(877-879)caG>caC	p.Q293H	CLEC4F_ENST00000426626.1_Missense_Mutation_p.Q293H	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	293					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CATTTGTGTTCTGCAAATTTT	0.408																																					p.Q293H	Colon(107;10 2157 6841 26035)	.											.	CLEC4F	95	0			c.G879C						.						91.0	96.0	94.0					2																	71043634		2203	4299	6502	SO:0001583	missense	165530	exon4			TGTGTTCTGCAAA	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.879G>C	2.37:g.71043634C>G	ENSP00000272367:p.Gln293His	Somatic	428.0	0.0		WXS	Illumina HiSeq	Phase_I	297.0	19.0	NM_173535	A4QPA5	Missense_Mutation	SNP	ENST00000272367.2	37	CCDS1910.1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082720	0.55861	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.79554	-1.28;-1.28	4.19	-0.85	0.10720	.	0.178344	0.27223	N	0.020352	D	0.83751	0.5322	M	0.61703	1.905	0.09310	N	1	D;D	0.71674	0.998;0.998	D;D	0.68192	0.956;0.956	T	0.74847	-0.3525	10	0.87932	D	0	.	7.336	0.26609	0.0:0.4908:0.0:0.5092	.	293;293	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	H	293	ENSP00000272367:Q293H;ENSP00000390581:Q293H	ENSP00000272367:Q293H	Q	-	3	2	CLEC4F	70897142	0.000000	0.05858	0.001000	0.08648	0.652000	0.38707	-0.120000	0.10660	-0.237000	0.09739	0.313000	0.20887	CAG	.		0.408	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251922.1	NM_173535	
CNPY2	10330	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56708752	56708752	+	Splice_Site	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:56708752T>C	ENST00000273308.4	-	3	629		c.e3-2		CNPY2_ENST00000551720.1_Splice_Site|RP11-977G19.11_ENST00000549565.1_RNA|RP11-977G19.10_ENST00000549318.1_Splice_Site|PAN2_ENST00000549090.1_5'Flank|RP11-977G19.11_ENST00000549860.1_RNA	NM_014255.5	NP_055070.1	Q9Y2B0	CNPY2_HUMAN	canopy FGF signaling regulator 2						negative regulation of gene expression (GO:0010629)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of low-density lipoprotein particle clearance (GO:0010988)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(2)	4						CCCTGCATGCTGGTGGAAGAG	0.537																																					.		.											.	CNPY2	68	0			c.89-2A>G						.						71.0	66.0	68.0					12																	56708752		2203	4300	6503	SO:0001630	splice_region_variant	10330	exon4			GCATGCTGGTGGA	AB015631	CCDS8914.1	12q15	2013-07-23	2013-07-23	2007-10-22		ENSG00000257727			13529	protein-coding gene	gene with protein product		605861	"""transmembrane protein 4"", ""canopy 2 homolog (zebrafish)"""	TMEM4		10072769, 15905959	Standard	NM_001190991		Approved	HP10390, ZSIG9, Cnpy2	uc001sku.2	Q9Y2B0	OTTHUMG00000170330	ENST00000273308.4:c.89-2A>G	12.37:g.56708752T>C		Somatic	129.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	32.0	NM_014255	B2R7B9|Q9UHE9	Splice_Site	SNP	ENST00000273308.4	37	CCDS8914.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.937588	0.52972	.	.	ENSG00000144785;ENSG00000144785;ENSG00000144785;ENSG00000257727;ENSG00000257727	ENST00000549318;ENST00000547423;ENST00000548360;ENST00000273308;ENST00000551475	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9233	0.70856	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RP11-977G19.10;CNPY2	54995019	1.000000	0.71417	0.999000	0.59377	0.575000	0.36095	7.848000	0.86902	2.231000	0.72958	0.533000	0.62120	.	.		0.537	CNPY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408546.1	NM_014255	Intron
CPAMD8	27151	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17038989	17038989	+	Missense_Mutation	SNP	G	G	A	rs200032712		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:17038989G>A	ENST00000443236.1	-	25	3372	c.3341C>T	c.(3340-3342)cCg>cTg	p.P1114L		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1067						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						TGGTGGCCTCGGGAGGGTCCA	0.582																																					p.P1114L		.											.	CPAMD8	141	0			c.C3341T						.						44.0	49.0	47.0					19																	17038989		1933	4133	6066	SO:0001583	missense	27151	exon25			GGCCTCGGGAGGG	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3341C>T	19.37:g.17038989G>A	ENSP00000402505:p.Pro1114Leu	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	23.0	NM_015692	Q8NC09|Q9ULD7	Missense_Mutation	SNP	ENST00000443236.1	37	CCDS42519.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.094|8.094	0.775190|0.775190	0.16051|0.16051	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	3.02|3.02	-0.754|-0.754	0.11065|0.11065	Farnesoic acid O-methyl transferase (1);|.	0.630912|.	0.14270|.	N|.	0.330240|.	T|.	0.46483|.	0.1395|.	M|M	0.81682|0.81682	2.555|2.555	0.09310|0.09310	N|N	0.999994|0.999994	D|.	0.53151|.	0.958|.	B|.	0.43680|.	0.427|.	T|.	0.45498|.	-0.9257|.	9|.	0.33141|.	T|.	0.24|.	.|.	2.7214|2.7214	0.05202|0.05202	0.0941:0.1586:0.4216:0.3257|0.0941:0.1586:0.4216:0.3257	.|.	1067|.	Q8IZJ3|.	CPMD8_HUMAN|.	L|X	1114|1125	.|.	ENSP00000291440:P1114L|.	P|R	-|-	2|1	0|2	CPAMD8|CPAMD8	16899989|16899989	1.000000|1.000000	0.71417|0.71417	0.026000|0.026000	0.17262|0.17262	0.000000|0.000000	0.00434|0.00434	1.685000|1.685000	0.37659|0.37659	-0.498000|-0.498000	0.06632|0.06632	-1.802000|-1.802000	0.00618|0.00618	CCG|CGA	G|0.999;A|0.001		0.582	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257531.2	NM_015692	
CREB5	9586	ucsc.edu;bcgsc.ca	37	7	28547332	28547332	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr7:28547332C>A	ENST00000357727.2	+	4	658	c.268C>A	c.(268-270)Cag>Aag	p.Q90K	CREB5_ENST00000396299.2_Missense_Mutation_p.Q57K|CREB5_ENST00000396300.2_Missense_Mutation_p.Q83K|CREB5_ENST00000409603.1_Missense_Mutation_p.Q57K	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	90					adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						CAGGAAGGCTCAGGAAGAGGA	0.572																																					p.Q90K		.											.	CREB5	92	0			c.C268A						.						98.0	103.0	101.0					7																	28547332		2203	4300	6503	SO:0001583	missense	9586	exon4			AAGGCTCAGGAAG	L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081	ENST00000357727.2:c.268C>A	7.37:g.28547332C>A	ENSP00000350359:p.Gln90Lys	Somatic	112.0	1.0		WXS	Illumina HiSeq	.	72.0	10.0	NM_182898	A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	Missense_Mutation	SNP	ENST00000357727.2	37	CCDS5417.1	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539989	0.45176	.	.	ENSG00000146592	ENST00000396299;ENST00000424599;ENST00000357727;ENST00000396300;ENST00000409603	T;T;T;T;T	0.31510	1.49;1.5;1.49;1.49;1.49	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.49150	0.1540	M	0.70275	2.135	0.80722	D	1	P	0.49447	0.924	P	0.59424	0.857	T	0.39333	-0.9619	10	0.07813	T	0.8	-16.3957	18.1451	0.89652	0.0:1.0:0.0:0.0	.	90	Q02930	CREB5_HUMAN	K	57;83;90;83;57	ENSP00000379593:Q57K;ENSP00000394088:Q83K;ENSP00000350359:Q90K;ENSP00000379594:Q83K;ENSP00000387197:Q57K	ENSP00000350359:Q90K	Q	+	1	0	CREB5	28513857	1.000000	0.71417	0.993000	0.49108	0.868000	0.49771	7.450000	0.80656	2.592000	0.87571	0.655000	0.94253	CAG	.		0.572	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214204.4	NM_004904	
CTNNA2	1496	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	80101327	80101327	+	Silent	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:80101327A>G	ENST00000402739.4	+	5	716	c.711A>G	c.(709-711)agA>agG	p.R237R	CTNNA2_ENST00000361291.4_Silent_p.R271R|CTNNA2_ENST00000466387.1_Silent_p.R237R|CTNNA2_ENST00000540488.1_Silent_p.R237R|CTNNA2_ENST00000541047.1_Silent_p.R237R|CTNNA2_ENST00000496558.1_Silent_p.R237R	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	237					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CCGCTACGAGAGCCAACCGAG	0.577																																					p.R237R		.											.	CTNNA2	368	0			c.A711G						.						51.0	55.0	54.0					2																	80101327		2074	4220	6294	SO:0001819	synonymous_variant	1496	exon6			TACGAGAGCCAAC		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.711A>G	2.37:g.80101327A>G		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	55.0	7.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Silent	SNP	ENST00000402739.4	37																																																																																				.		0.577	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
DAPK1	1612	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	90272970	90272970	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr9:90272970G>A	ENST00000408954.3	+	18	2186	c.1851G>A	c.(1849-1851)gcG>gcA	p.A617A	DAPK1_ENST00000358077.5_Silent_p.A617A|DAPK1_ENST00000491893.1_Silent_p.A617A|DAPK1_ENST00000469640.2_Silent_p.A617A|DAPK1_ENST00000472284.1_Silent_p.A617A|DAPK1_ENST00000466188.1_3'UTR	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	617					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TGCACCTTGCGGCCAACAACG	0.567									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.A617A		.											.	DAPK1	359	0			c.G1851A						.						50.0	56.0	54.0					9																	90272970		2124	4246	6370	SO:0001819	synonymous_variant	1612	exon18	Familial Cancer Database	Familial CLL	CCTTGCGGCCAAC	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.1851G>A	9.37:g.90272970G>A		Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	5.0	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Silent	SNP	ENST00000408954.3	37	CCDS43842.1																																																																																			.		0.567	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
DHRS4L1	728635	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	14	24517998	24517998	+	RNA	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr14:24517998T>C	ENST00000558293.1	+	0	646					NR_102693.1																						CCTGGACTTATCAAGACTAGC	0.522																																					p.I218T		.											.	.	.	0			c.T653C						.						141.0	137.0	139.0					14																	24517998		2203	4298	6501			728635	exon8			GACTTATCAAGAC																													14.37:g.24517998T>C		Somatic	818.0	2.0		WXS	Illumina HiSeq	Phase_I	502.0	180.0	NM_001082488		Missense_Mutation	SNP	ENST00000558293.1	37		.	.	.	.	.	.	.	.	.	.	T	10.56	1.384474	0.25031	.	.	ENSG00000225766	ENST00000397065	.	.	.	4.67	4.67	0.58626	NAD(P)-binding domain (1);	.	.	.	.	T	0.70360	0.3215	L	0.60455	1.87	0.50813	D	0.999890	D	0.89917	1.0	D	0.97110	1.0	T	0.76694	-0.2865	7	0.46703	T	0.11	.	12.0988	0.53772	0.0:0.0:0.0:1.0	.	218	P0CG22	DR4L1_HUMAN	T	218	.	ENSP00000380255:I218T	I	+	2	0	AL136295.1	23587838	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	6.335000	0.72949	1.958000	0.56883	0.329000	0.21502	ATC	.		0.522	RP11-468E2.9-005	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000417272.1		
DLK2	65989	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	43418506	43418506	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:43418506A>G	ENST00000357338.3	-	6	1623	c.923T>C	c.(922-924)gTg>gCg	p.V308A	DLK2_ENST00000414245.1_Missense_Mutation_p.V302A|DLK2_ENST00000372488.3_Missense_Mutation_p.V308A|DLK2_ENST00000372485.1_Missense_Mutation_p.V302A	NM_206539.1	NP_996262.1	Q6UY11	DLK2_HUMAN	delta-like 2 homolog (Drosophila)	308					negative regulation of Notch signaling pathway (GO:0045746)|regulation of fat cell differentiation (GO:0045598)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CACCAGGGCCACCAAGCTAGG	0.687																																					p.V308A		.											.	DLK2	68	0			c.T923C						.						78.0	78.0	78.0					6																	43418506		2203	4300	6503	SO:0001583	missense	65989	exon6			AGGGCCACCAAGC	AK055380	CCDS4897.1, CCDS75461.1	6p21.1	2008-02-05	2007-07-05	2007-07-05	ENSG00000171462	ENSG00000171462			21113	protein-coding gene	gene with protein product			"""EGF-like-domain, multiple 9"""	EGFL9			Standard	NM_001286656		Approved	MGC2487	uc003ovb.3	Q6UY11	OTTHUMG00000014735	ENST00000357338.3:c.923T>C	6.37:g.43418506A>G	ENSP00000349893:p.Val308Ala	Somatic	135.0	1.0		WXS	Illumina HiSeq	Phase_I	114.0	31.0	NM_023932	B3KNZ7|Q5T3T8|Q9BQ54	Missense_Mutation	SNP	ENST00000357338.3	37	CCDS4897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.82|16.82	3.228369|3.228369	0.58777|0.58777	.|.	.|.	ENSG00000171462|ENSG00000171462	ENST00000372485;ENST00000372488;ENST00000357338;ENST00000414245|ENST00000430324	D;D;D;D|.	0.91464|.	-2.85;-2.81;-2.81;-2.85|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.245613|.	0.33327|.	N|.	0.005036|.	T|T	0.34193|0.34193	0.0889|0.0889	L|L	0.27053|0.27053	0.805|0.805	0.35904|0.35904	D|D	0.830622|0.830622	P|.	0.43094|.	0.799|.	B|.	0.31547|.	0.132|.	T|T	0.27806|0.27806	-1.0063|-1.0063	10|5	0.45353|.	T|.	0.12|.	.|.	14.8498|14.8498	0.70286|0.70286	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	308|.	Q6UY11|.	DLK2_HUMAN|.	A|R	302;308;308;302|214	ENSP00000361563:V302A;ENSP00000361566:V308A;ENSP00000349893:V308A;ENSP00000398906:V302A|.	ENSP00000349893:V308A|.	V|W	-|-	2|1	0|0	DLK2|DLK2	43526484|43526484	1.000000|1.000000	0.71417|0.71417	0.978000|0.978000	0.43139|0.43139	0.371000|0.371000	0.29859|0.29859	5.824000|5.824000	0.69279|0.69279	1.925000|1.925000	0.55765|0.55765	0.379000|0.379000	0.24179|0.24179	GTG|TGG	.		0.687	DLK2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040618.1	NM_023932	
DMD	1756	broad.mit.edu;bcgsc.ca	37	X	31525446	31525446	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chrX:31525446T>C	ENST00000357033.4	-	56	8548	c.8342A>G	c.(8341-8343)aAc>aGc	p.N2781S	DMD_ENST00000378677.2_Missense_Mutation_p.N2777S|DMD_ENST00000378707.3_Missense_Mutation_p.N321S|DMD_ENST00000541735.1_Missense_Mutation_p.N321S|DMD_ENST00000343523.2_Missense_Mutation_p.N321S|DMD_ENST00000445312.1_5'UTR|DMD_ENST00000359836.1_Missense_Mutation_p.N321S|DMD_ENST00000474231.1_Missense_Mutation_p.N321S	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2781					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GAAGTTCATGTTATCCAAACG	0.403																																					p.N2781S		.											.	DMD	265	0			c.A8342G						.						190.0	154.0	166.0					X																	31525446		2202	4300	6502	SO:0001583	missense	1756	exon56			TTCATGTTATCCA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8342A>G	X.37:g.31525446T>C	ENSP00000354923:p.Asn2781Ser	Somatic	287.0	1.0		WXS	Illumina HiSeq	Phase_I	168.0	7.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.742861	0.49151	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	T;T;T;T;T;T;T;T	0.49139	1.42;0.79;0.79;0.79;0.79;0.79;0.79;0.79	5.75	1.95	0.26073	.	0.170697	0.26338	N	0.024956	T	0.49932	0.1586	L	0.54323	1.7	0.30257	N	0.793536	B;P;B;D;D;B;P;P;B;B;P	0.61080	0.084;0.91;0.011;0.989;0.989;0.022;0.542;0.542;0.201;0.167;0.508	B;P;B;P;P;B;B;B;B;B;B	0.59357	0.184;0.554;0.013;0.856;0.856;0.037;0.403;0.309;0.197;0.124;0.285	T	0.50197	-0.8856	10	0.09590	T	0.72	.	7.703	0.28634	0.0:0.071:0.283:0.646	.	2773;2781;2777;1440;1437;321;321;321;321;321;2658	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	S	2773;1440;1437;477;2777;2781;321;321;2781;2658;321;321;321	ENSP00000350765:N477S;ENSP00000367948:N2777S;ENSP00000354923:N2781S;ENSP00000352894:N321S;ENSP00000340057:N321S;ENSP00000367979:N321S;ENSP00000444119:N321S;ENSP00000417123:N321S	ENSP00000340057:N321S	N	-	2	0	DMD	31435367	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	1.395000	0.34520	-0.007000	0.14345	0.481000	0.45027	AAC	.		0.403	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
DNAJC1	64215	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	22048461	22048461	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:22048461T>A	ENST00000376980.3	-	11	1524	c.1234A>T	c.(1234-1236)Acc>Tcc	p.T412S	DNAJC1_ENST00000483085.1_5'UTR	NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	412					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				TCTCGCTGGGTGATCATGTCA	0.612																																					p.T412S		.											.	DNAJC1	226	0			c.A1234T						.						51.0	45.0	47.0					10																	22048461		2203	4300	6503	SO:0001583	missense	64215	exon11			GCTGGGTGATCAT	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.1234A>T	10.37:g.22048461T>A	ENSP00000366179:p.Thr412Ser	Somatic	312.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	53.0	NM_022365	B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	ENST00000376980.3	37	CCDS7136.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.060799	0.76074	.	.	ENSG00000136770	ENST00000376980	T	0.23552	1.9	5.58	5.58	0.84498	.	0.294795	0.36234	N	0.002710	T	0.47078	0.1426	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.35351	-0.9792	10	0.15499	T	0.54	-4.9574	15.7332	0.77822	0.0:0.0:0.0:1.0	.	133;412	Q96NY3;Q96KC8	.;DNJC1_HUMAN	S	412	ENSP00000366179:T412S	ENSP00000366179:T412S	T	-	1	0	DNAJC1	22088467	1.000000	0.71417	1.000000	0.80357	0.149000	0.21700	5.478000	0.66806	2.132000	0.65825	0.402000	0.26972	ACC	.		0.612	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047149.1	NM_022365	
DPP3	10072	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	11	66249912	66249912	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:66249912G>T	ENST00000360510.2	+	2	306	c.241G>T	c.(241-243)Gct>Tct	p.A81S	CTD-3074O7.5_ENST00000533502.1_RNA|DPP3_ENST00000453114.1_Missense_Mutation_p.A81S|CTD-3074O7.5_ENST00000527274.2_RNA|DPP3_ENST00000532677.1_Missense_Mutation_p.A100S|CTD-3074O7.5_ENST00000525142.1_RNA|DPP3_ENST00000541961.1_Missense_Mutation_p.A81S|DPP3_ENST00000531863.1_Missense_Mutation_p.A101S|CTD-3074O7.5_ENST00000527092.1_RNA|DPP3_ENST00000530165.1_Missense_Mutation_p.A81S			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	81					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						ACATGCCCTGGCTGAAGGCCT	0.592																																					p.A81S		.											.	DPP3	46	0			c.G241T						.						41.0	43.0	42.0					11																	66249912		2200	4295	6495	SO:0001583	missense	10072	exon2			GCCCTGGCTGAAG	AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.241G>T	11.37:g.66249912G>T	ENSP00000353701:p.Ala81Ser	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	9.0	NM_001256670	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	ENST00000360510.2	37	CCDS8141.1	.	.	.	.	.	.	.	.	.	.	G	10.95	1.494377	0.26774	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000526515;ENST00000530165;ENST00000347422;ENST00000531314;ENST00000531354	T;T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.71	3.59	0.41128	.	0.553031	0.19477	N	0.113320	T	0.22399	0.0540	N	0.17278	0.47	0.29919	N	0.82289	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.03384	-1.1042	10	0.38643	T	0.18	.	4.3711	0.11247	0.1748:0.2096:0.6156:0.0	.	100;81	G3V1D3;Q9NY33	.;DPP3_HUMAN	S	101;100;81;81;81;81;81;81;81;81	ENSP00000432782:A101S;ENSP00000435284:A100S;ENSP00000353701:A81S;ENSP00000389943:A81S;ENSP00000440502:A81S;ENSP00000431606:A81S;ENSP00000436941:A81S;ENSP00000436820:A81S;ENSP00000432618:A81S	ENSP00000309957:A81S	A	+	1	0	DPP3	66006488	0.999000	0.42202	1.000000	0.80357	0.978000	0.69477	1.588000	0.36633	2.691000	0.91804	0.563000	0.77884	GCT	.		0.592	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393424.2		
DYNC1H1	1778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	102466376	102466376	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr14:102466376G>A	ENST00000360184.4	+	17	4019	c.3855G>A	c.(3853-3855)ggG>ggA	p.G1285G		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1285	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TATATGAGGGGAAGTTTGGTA	0.532																																					p.G1285G		.											.	DYNC1H1	98	0			c.G3855A						.						103.0	94.0	97.0					14																	102466376		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon17			TGAGGGGAAGTTT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.3855G>A	14.37:g.102466376G>A		Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	25.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	37	CCDS9966.1																																																																																			.		0.532	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
EIF2AK4	440275	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	40268641	40268641	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:40268641C>T	ENST00000263791.5	+	12	1888	c.1845C>T	c.(1843-1845)tgC>tgT	p.C615C	EIF2AK4_ENST00000382727.2_Silent_p.C615C	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	615	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		ACGGCTGCTGCTACGCAGTGA	0.622																																					p.C615C		.											.	EIF2AK4	757	0			c.C1845T						.						32.0	34.0	34.0					15																	40268641		2090	4211	6301	SO:0001819	synonymous_variant	440275	exon12			CTGCTGCTACGCA	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1845C>T	15.37:g.40268641C>T		Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	34.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Silent	SNP	ENST00000263791.5	37	CCDS42016.1																																																																																			.		0.622	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
EMP2	2013	ucsc.edu;bcgsc.ca	37	16	10626944	10626944	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:10626944A>G	ENST00000359543.3	-	5	531	c.322T>C	c.(322-324)Tgt>Cgt	p.C108R	EMP2_ENST00000566033.1_5'Flank|EMP2_ENST00000536829.1_Missense_Mutation_p.C108R|RP11-27M24.1_ENST00000535363.1_RNA	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2	108					cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						ATCATGACACACAGACCTGTC	0.488																																					p.C108R	GBM(158;2021 2691 14714 39478)	.											.	EMP2	90	0			c.T322C						.						96.0	82.0	87.0					16																	10626944		2197	4300	6497	SO:0001583	missense	2013	exon5			TGACACACAGACC	U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.322T>C	16.37:g.10626944A>G	ENSP00000352540:p.Cys108Arg	Somatic	34.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001424	B2R7V6|D3DUF8	Missense_Mutation	SNP	ENST00000359543.3	37	CCDS10541.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.620643	0.66787	.	.	ENSG00000213853	ENST00000359543;ENST00000536829	D;D	0.90504	-2.68;-2.68	5.53	5.53	0.82687	.	0.000000	0.85682	U	0.000000	D	0.95598	0.8569	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96191	0.9138	10	0.87932	D	0	-13.7957	15.1474	0.72667	1.0:0.0:0.0:0.0	.	108	P54851	EMP2_HUMAN	R	108	ENSP00000352540:C108R;ENSP00000445712:C108R	ENSP00000352540:C108R	C	-	1	0	EMP2	10534445	1.000000	0.71417	0.998000	0.56505	0.314000	0.28054	6.939000	0.75911	2.236000	0.73375	0.533000	0.62120	TGT	.		0.488	EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251965.1	NM_001424	
EWSR1	2130	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	22	29694814	29694814	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr22:29694814G>A	ENST00000397938.2	+	14	1828	c.1509G>A	c.(1507-1509)cgG>cgA	p.R503R	EWSR1_ENST00000414183.2_Silent_p.R508R|EWSR1_ENST00000331029.7_Silent_p.R465R|EWSR1_ENST00000332050.6_Silent_p.R430R|EWSR1_ENST00000332035.6_Silent_p.R447R|EWSR1_ENST00000406548.1_Silent_p.R502R	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	503	Arg/Gly/Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAGGACCCCGGGGTTCCCGAG	0.607			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																p.R508R		.		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	.	EWSR1	3375	0			c.G1524A						.						56.0	65.0	62.0					22																	29694814		2203	4300	6503	SO:0001819	synonymous_variant	2130	exon15			ACCCCGGGGTTCC		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1509G>A	22.37:g.29694814G>A		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	61.0	23.0	NM_013986	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Silent	SNP	ENST00000397938.2	37	CCDS13851.1	.	.	.	.	.	.	.	.	.	.	G	4.311	0.056969	0.08339	.	.	ENSG00000182944	ENST00000360091	.	.	.	5.52	-1.92	0.07618	.	.	.	.	.	T	0.38558	0.1045	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28138	-1.0053	4	.	.	.	.	0.704	0.00913	0.3743:0.1243:0.2641:0.2373	.	.	.	.	R	159	.	.	G	+	1	0	EWSR1	28024814	0.897000	0.30589	0.828000	0.32881	0.332000	0.28634	-0.043000	0.12043	-0.501000	0.06605	-0.379000	0.06801	GGG	.		0.607	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243	
FAM162B	221303	broad.mit.edu;bcgsc.ca	37	6	117083206	117083206	+	Silent	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:117083206T>C	ENST00000368557.4	-	3	470	c.324A>G	c.(322-324)aaA>aaG	p.K108K		NM_001085480.2	NP_001078949.1	Q5T6X4	F162B_HUMAN	family with sequence similarity 162, member B	108						integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)	6						TGTAACAAGCTTTCACTCGAG	0.378																																					p.K108K		.											.	FAM162B	22	0			c.A324G						.						206.0	196.0	199.0					6																	117083206		1890	4118	6008	SO:0001819	synonymous_variant	221303	exon3			ACAAGCTTTCACT	BC038997	CCDS43497.1	6q22.31	2014-01-28	2008-06-05	2008-06-05	ENSG00000183807	ENSG00000183807			21549	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 189"""	C6orf189			Standard	NM_001085480		Approved	bA86F4.2	uc003pxi.2	Q5T6X4	OTTHUMG00000015446	ENST00000368557.4:c.324A>G	6.37:g.117083206T>C		Somatic	355.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	6.0	NM_001085480	Q8IXW8	Silent	SNP	ENST00000368557.4	37	CCDS43497.1																																																																																			.		0.378	FAM162B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041965.1	XM_927381	
FANCA	2175	ucsc.edu;bcgsc.ca	37	16	89813300	89813300	+	Splice_Site	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:89813300T>C	ENST00000389301.3	-	34	3379		c.e34-2		FANCA_ENST00000568369.1_Splice_Site	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A						DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GAAGTTTCTCTGCAAAAGAGT	0.537			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												.		.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	1130	0			c.3349-2A>G						.						45.0	36.0	39.0					16																	89813300		2188	4268	6456	SO:0001630	splice_region_variant	2175	exon35	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TTTCTCTGCAAAA	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3349-2A>G	16.37:g.89813300T>C		Somatic	38.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Splice_Site	SNP	ENST00000389301.3	37	CCDS32515.1	.	.	.	.	.	.	.	.	.	.	T	10.52	1.372543	0.24857	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3323	0.66566	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	FANCA	88340801	1.000000	0.71417	0.968000	0.41197	0.037000	0.13140	5.491000	0.66887	2.045000	0.60652	0.459000	0.35465	.	.		0.537	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		Intron
FARP2	9855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242343251	242343251	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:242343251C>T	ENST00000264042.3	+	3	362	c.192C>T	c.(190-192)tgC>tgT	p.C64C	FARP2_ENST00000373287.4_Silent_p.C64C|FARP2_ENST00000545004.1_Silent_p.C64C	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	64	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.C64C(2)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		AGCCTAAATGCGATGGCCAGG	0.413																																					p.C64C		.											.	FARP2	93	2	Substitution - coding silent(2)	large_intestine(1)|lung(1)	c.C192T						.						109.0	102.0	104.0					2																	242343251		2203	4300	6503	SO:0001819	synonymous_variant	9855	exon3			TAAATGCGATGGC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.192C>T	2.37:g.242343251C>T		Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	20.0	NM_014808	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	37	CCDS33424.1																																																																																			.		0.413	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
FAT3	120114	broad.mit.edu;bcgsc.ca	37	11	92534438	92534438	+	Silent	SNP	G	G	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:92534438G>C	ENST00000298047.6	+	9	8276	c.8259G>C	c.(8257-8259)ggG>ggC	p.G2753G	FAT3_ENST00000409404.2_Silent_p.G2753G|FAT3_ENST00000525166.1_Silent_p.G2603G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2753	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATAACAAAGGGGGCATATTCG	0.473										TCGA Ovarian(4;0.039)																											p.G2753G		.											.	FAT3	73	0			c.G8259C						.						53.0	51.0	52.0					11																	92534438		1914	4128	6042	SO:0001819	synonymous_variant	120114	exon9			CAAAGGGGGCATA	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.8259G>C	11.37:g.92534438G>C		Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	6.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	37																																																																																				.		0.473	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
FCAR	2204	broad.mit.edu;bcgsc.ca	37	19	55386823	55386823	+	Splice_Site	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:55386823T>C	ENST00000355524.3	+	2	80		c.e2+2		FCAR_ENST00000391726.3_Intron|FCAR_ENST00000353758.4_Intron|FCAR_ENST00000469767.1_Splice_Site|FCAR_ENST00000391723.3_Intron|FCAR_ENST00000391725.3_Splice_Site|FCAR_ENST00000482092.2_Splice_Site|FCAR_ENST00000345937.4_Splice_Site|FCAR_ENST00000359272.4_Intron|FCAR_ENST00000391724.3_Intron	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for						immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		CACAGGAAGGTAAGTGTCCTG	0.438																																					.		.											.	FCAR	92	0			c.70+2T>C						.						152.0	153.0	153.0					19																	55386823		2203	4300	6503	SO:0001630	splice_region_variant	2204	exon2			GGAAGGTAAGTGT	X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.70+2T>C	19.37:g.55386823T>C		Somatic	170.0	1.0		WXS	Illumina HiSeq	Phase_I	112.0	54.0	NM_002000	Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Splice_Site	SNP	ENST00000355524.3	37	CCDS12907.1	.	.	.	.	.	.	.	.	.	.	.	12.33	1.904571	0.33628	.	.	ENSG00000186431	ENST00000433231;ENST00000355524;ENST00000391725;ENST00000345937	.	.	.	2.96	1.92	0.25849	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.8005	0.13294	0.0:0.1536:0.0:0.8464	.	.	.	.	.	-1	.	.	.	+	.	.	FCAR	60078635	0.970000	0.33590	0.389000	0.26208	0.915000	0.54546	0.989000	0.29629	0.358000	0.24211	0.374000	0.22700	.	.		0.438	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141243.1	NM_002000	Intron
FRS3	10817	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	41738386	41738386	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:41738386G>C	ENST00000373018.3	-	7	1701	c.1450C>G	c.(1450-1452)Cgg>Ggg	p.R484G	FRS3_ENST00000259748.2_Missense_Mutation_p.R484G	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	484					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTGTTGTGCCGGGTTTTCCTG	0.602																																					p.R484G		.											.	FRS3	92	0			c.C1450G						.						109.0	100.0	103.0					6																	41738386		2203	4300	6503	SO:0001583	missense	10817	exon7			TGTGCCGGGTTTT	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.1450C>G	6.37:g.41738386G>C	ENSP00000362109:p.Arg484Gly	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	82.0	29.0	NM_006653	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	37	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494080	0.64186	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.62639	0.01;0.01	5.8	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.71643	0.3364	M	0.73598	2.24	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.76767	-0.2838	10	0.87932	D	0	-31.9543	13.9088	0.63853	0.0:0.0:0.6035:0.3965	.	484	O43559	FRS3_HUMAN	G	484	ENSP00000362109:R484G;ENSP00000259748:R484G	ENSP00000259748:R484G	R	-	1	2	FRS3	41846364	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	2.681000	0.46926	0.776000	0.33473	0.655000	0.94253	CGG	.		0.602	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040532.2	NM_006653	
FUT3	2525	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5844841	5844841	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:5844841G>A	ENST00000303225.6	-	3	644	c.10C>T	c.(10-12)Ctg>Ttg	p.L4L	FUT3_ENST00000589918.1_Silent_p.L4L|FUT3_ENST00000458379.2_Silent_p.L4L|FUT3_ENST00000589620.1_Silent_p.L4L|AC024592.9_ENST00000589276.1_RNA|FUT3_ENST00000593144.1_5'Flank	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	4					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						GCTGCACCCAGGGGATCCATG	0.572																																					p.L4L	Esophageal Squamous(82;745 1728 24593 44831)	.											.	FUT3	90	0			c.C10T						.						23.0	22.0	22.0					19																	5844841		2203	4300	6503	SO:0001819	synonymous_variant	2525	exon3			CACCCAGGGGATC		CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.10C>T	19.37:g.5844841G>A		Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	13.0	NM_001097640	B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Silent	SNP	ENST00000303225.6	37	CCDS12153.1																																																																																			.		0.572	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452204.1	NM_000149	
GAA	2548	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	78091993	78091993	+	Splice_Site	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:78091993G>T	ENST00000302262.3	+	18	2702	c.2483G>T	c.(2482-2484)gGc>gTc	p.G828V	GAA_ENST00000390015.3_Splice_Site_p.G828V	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	828					cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	CCTTTCCAGGGCCCTGGCCTC	0.667																																					p.G828V		.											.	GAA	91	0			c.G2483T						.						44.0	46.0	45.0					17																	78091993		2203	4300	6503	SO:0001630	splice_region_variant	2548	exon19			TCCAGGGCCCTGG		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.2482-1G>T	17.37:g.78091993G>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	27.0	NM_001079803	Q09GN4|Q14351|Q16302|Q8IWE7	Missense_Mutation	SNP	ENST00000302262.3	37	CCDS32760.1	.	.	.	.	.	.	.	.	.	.	G	9.396	1.076732	0.20227	.	.	ENSG00000171298	ENST00000302262;ENST00000390015	D;D	0.89810	-2.57;-2.57	5.51	1.96	0.26148	.	0.464777	0.24020	N	0.042294	T	0.78635	0.4314	L	0.37850	1.14	0.58432	D	0.999996	B	0.09022	0.002	B	0.09377	0.004	T	0.69888	-0.5023	10	0.34782	T	0.22	-33.8352	2.0092	0.03484	0.1276:0.3792:0.2986:0.1945	.	828	P10253	LYAG_HUMAN	V	828	ENSP00000305692:G828V;ENSP00000374665:G828V	ENSP00000305692:G828V	G	+	2	0	GAA	75706588	0.950000	0.32346	0.985000	0.45067	0.615000	0.37417	1.871000	0.39539	1.267000	0.44247	0.655000	0.94253	GGC	.		0.667	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1		Missense_Mutation
GCN1L1	10985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	120602144	120602144	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:120602144T>C	ENST00000300648.6	-	18	1856	c.1844A>G	c.(1843-1845)cAc>cGc	p.H615R		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	615					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCTCACCTTGTGAGAACTGAG	0.582																																					p.H615R		.											.	GCN1L1	94	0			c.A1844G						.						101.0	105.0	104.0					12																	120602144		1968	4141	6109	SO:0001583	missense	10985	exon18			ACCTTGTGAGAAC	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.1844A>G	12.37:g.120602144T>C	ENSP00000300648:p.His615Arg	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	32.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	37	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	T	12.70	2.017799	0.35606	.	.	ENSG00000089154	ENST00000300648	T	0.04551	3.6	5.83	5.83	0.93111	Armadillo-like helical (1);Domain of unknown function DUF3554 (1);Armadillo-type fold (1);	0.048650	0.85682	D	0.000000	T	0.08582	0.0213	M	0.69823	2.125	0.80722	D	1	B	0.30973	0.302	B	0.30855	0.121	T	0.21827	-1.0234	10	0.14656	T	0.56	.	16.2009	0.82078	0.0:0.0:0.0:1.0	.	615	Q92616	GCN1L_HUMAN	R	615	ENSP00000300648:H615R	ENSP00000300648:H615R	H	-	2	0	GCN1L1	119086527	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.403000	0.79983	2.235000	0.73313	0.533000	0.62120	CAC	.		0.582	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
GHR	2690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	42713546	42713546	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:42713546G>A	ENST00000230882.4	+	8	990	c.800G>A	c.(799-801)tGg>tAg	p.W267*	GHR_ENST00000537449.1_Nonsense_Mutation_p.W80*|GHR_ENST00000357703.3_Nonsense_Mutation_p.W245*	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	267					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TACTTTCCATGGCTCTTAATT	0.328																																					p.W274X		.											.	GHR	659	0			c.G821A						.						181.0	186.0	184.0					5																	42713546		2202	4295	6497	SO:0001587	stop_gained	2690	exon8			TTCCATGGCTCTT		CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.800G>A	5.37:g.42713546G>A	ENSP00000230882:p.Trp267*	Somatic	425.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	49.0	NM_001242399	Q9HCX2	Nonsense_Mutation	SNP	ENST00000230882.4	37	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	G	39	7.446990	0.98289	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000356276;ENST00000537449	.	.	.	5.43	5.43	0.79202	.	0.224065	0.39341	N	0.001389	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-5.871	17.4237	0.87521	0.0:0.0:1.0:0.0	.	.	.	.	X	267;245;267;80	.	ENSP00000230882:W267X	W	+	2	0	GHR	42749303	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.594000	0.61041	2.550000	0.86006	0.591000	0.81541	TGG	.		0.328	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163	
GPR84	53831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54757477	54757477	+	Silent	SNP	G	G	A	rs143236488		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:54757477G>A	ENST00000551809.1	-	1	794	c.159C>T	c.(157-159)acC>acT	p.T53T	RP11-753H16.3_ENST00000550474.1_RNA|GPR84_ENST00000267015.3_Silent_p.T53T|RP11-753H16.5_ENST00000552785.1_RNA			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						GGTTGAATCGGGTACGGAGCT	0.592													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20806	0.0		0.0	False		,,,				2504	0.0				p.T53T		.											.	GPR84	523	0			c.C159T						.						183.0	158.0	166.0					12																	54757477		2203	4300	6503	SO:0001819	synonymous_variant	53831	exon2			GAATCGGGTACGG	AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.159C>T	12.37:g.54757477G>A		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	53.0	NM_020370	B6V9G7	Silent	SNP	ENST00000551809.1	37	CCDS8878.1																																																																																			G|0.999;A|0.000		0.592	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406156.1		
GTF2E1	2960	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	120469757	120469757	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:120469757G>A	ENST00000283875.5	+	2	451	c.358G>A	c.(358-360)Gat>Aat	p.D120N		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	120					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		CGATGAGAGAGATTCGACCAA	0.403																																					p.D120N		.											.	GTF2E1	91	0			c.G358A						.						81.0	82.0	82.0					3																	120469757		2203	4300	6503	SO:0001583	missense	2960	exon2			GAGAGAGATTCGA	S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.358G>A	3.37:g.120469757G>A	ENSP00000283875:p.Asp120Asn	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	61.0	NM_005513	Q16103	Missense_Mutation	SNP	ENST00000283875.5	37	CCDS3002.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973662	0.53720	.	.	ENSG00000153767	ENST00000283875;ENST00000492959	T	0.47528	0.84	6.06	5.18	0.71444	Zinc finger, RING/FYVE/PHD-type (1);TFIIEalpha/SarR/Rpc3 HTH domain (1);	0.042733	0.85682	N	0.000000	T	0.49115	0.1538	M	0.68593	2.085	0.80722	D	1	B;B	0.16166	0.002;0.016	B;B	0.29077	0.047;0.098	T	0.43130	-0.9410	9	.	.	.	-8.7497	13.5627	0.61799	0.075:0.0:0.925:0.0	.	120;120	P29083;Q53F88	T2EA_HUMAN;.	N	120	ENSP00000283875:D120N	.	D	+	1	0	GTF2E1	121952447	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.905000	0.87416	1.547000	0.49401	0.655000	0.94253	GAT	.		0.403	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513	
GTF3C1	2975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27517278	27517278	+	Missense_Mutation	SNP	G	G	T	rs140459536		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:27517278G>T	ENST00000356183.4	-	10	1727	c.1712C>A	c.(1711-1713)gCg>gAg	p.A571E	GTF3C1_ENST00000561623.1_Missense_Mutation_p.A571E	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	571					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GTTGCTGTCCGCACAGTGGGA	0.567																																					p.A571E		.											.	GTF3C1	94	0			c.C1712A						.						139.0	115.0	123.0					16																	27517278		2197	4300	6497	SO:0001583	missense	2975	exon10			CTGTCCGCACAGT	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.1712C>A	16.37:g.27517278G>T	ENSP00000348510:p.Ala571Glu	Somatic	148.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	41.0	NM_001520	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	ENST00000356183.4	37	CCDS32414.1	.	.	.	.	.	.	.	.	.	.	G	0.498	-0.872140	0.02570	.	.	ENSG00000077235	ENST00000356183;ENST00000388971	T	0.22539	1.95	5.39	2.83	0.33086	.	1.419090	0.03886	N	0.277842	T	0.12050	0.0293	N	0.19112	0.55	0.09310	N	1	B;B	0.18610	0.001;0.029	B;B	0.12156	0.0;0.007	T	0.28427	-1.0044	10	0.02654	T	1	-4.6393	5.1223	0.14867	0.7147:0.0:0.2853:0.0	.	571;571	Q12789;Q12789-3	TF3C1_HUMAN;.	E	571;569	ENSP00000348510:A571E	ENSP00000348510:A571E	A	-	2	0	GTF3C1	27424779	0.000000	0.05858	0.003000	0.11579	0.001000	0.01503	0.574000	0.23714	0.984000	0.38629	-0.302000	0.09304	GCG	G|1.000;A|0.000		0.567	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433856.1	NM_001520	
HELZ2	85441	ucsc.edu;bcgsc.ca	37	20	62191577	62191577	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:62191577A>G	ENST00000467148.1	-	17	7673	c.7604T>C	c.(7603-7605)cTt>cCt	p.L2535P	HELZ2_ENST00000427522.2_Missense_Mutation_p.L1966P	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2535	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCTCGCCGAAGGGCCTTGCT	0.697																																					p.L2535P		.											.	.	.	0			c.T7604C						.						34.0	25.0	28.0					20																	62191577		2183	4279	6462	SO:0001583	missense	85441	exon18			CGCCGAAGGGCCT	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7604T>C	20.37:g.62191577A>G	ENSP00000417401:p.Leu2535Pro	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_001037335	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	.	.	.	.	.	.	.	.	.	.	A	13.81	2.347900	0.41599	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	D;D	0.88509	-2.39;-2.39	3.94	3.94	0.45596	.	0.000000	0.64402	D	0.000012	D	0.95802	0.8634	H	0.96208	3.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96247	0.9180	10	0.87932	D	0	-19.4852	11.4003	0.49866	1.0:0.0:0.0:0.0	.	2535;1966	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	P	1966;2535	ENSP00000393257:L1966P;ENSP00000417401:L2535P	ENSP00000393257:L1966P	L	-	2	0	RP4-697K14.7	61662021	1.000000	0.71417	0.008000	0.14137	0.034000	0.12701	6.245000	0.72398	1.448000	0.47680	0.402000	0.26972	CTT	.		0.697	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
HERC1	8925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	63991120	63991120	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:63991120T>C	ENST00000443617.2	-	26	4799	c.4712A>G	c.(4711-4713)aAc>aGc	p.N1571S	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1571					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ATAGGAGGAGTTGCATAACCA	0.413																																					p.N1571S		.											.	HERC1	666	0			c.A4712G						.						145.0	139.0	141.0					15																	63991120		1857	4106	5963	SO:0001583	missense	8925	exon26			GAGGAGTTGCATA	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4712A>G	15.37:g.63991120T>C	ENSP00000390158:p.Asn1571Ser	Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	17.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	37	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	T	4.091	0.014801	0.07959	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	T	0.21543	2.0	5.54	1.4	0.22301	.	0.368782	0.24154	N	0.041047	T	0.05456	0.0144	N	0.02539	-0.55	0.27402	N	0.954825	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39057	-0.9632	10	0.06625	T	0.88	.	4.6136	0.12415	0.0:0.314:0.3802:0.3058	.	555;1571	B4DKS2;Q15751	.;HERC1_HUMAN	S	1571;555	ENSP00000390158:N1571S	ENSP00000389613:N555S	N	-	2	0	HERC1	61778173	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	1.607000	0.36836	0.933000	0.37291	0.482000	0.46254	AAC	.		0.413	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
HIST1H4K	8362	broad.mit.edu;mdanderson.org	37	6	27799305	27799305	+	Splice_Site	SNP	T	T	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:27799305T>G	ENST00000357549.2	-	1	0	c.1A>C	c.(1-3)Atg>Ctg	p.M1L		NM_003541.2	NP_003532.1	P62805	H4_HUMAN	histone cluster 1, H4k	1					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|lung(3)|ovary(1)|prostate(1)	7						CGGCCAGACATGACGAGCAAG	0.587																																					p.M1L		.											.	HIST1H4K	90	0			c.A1C						.						37.0	35.0	36.0					6																	27799305		2202	4297	6499	SO:0001630	splice_region_variant	8362	exon1			CAGACATGACGAG	X60483	CCDS4631.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197914	ENSG00000273542		"""Histones / Replication-dependent"""	4784	protein-coding gene	gene with protein product		602825	"""H4 histone family, member D"", ""histone 1, H4k"""	H4FD		9439656, 12408966	Standard	NM_003541		Approved	H4/d, H4F2iii, dJ160A22.1	uc003njr.3	P62805	OTTHUMG00000014488	ENST00000357549.2:c.1-1A>C	6.37:g.27799305T>G		Somatic	223.0	1.0		WXS	Illumina HiSeq	Phase_I	138.0	37.0	NM_003541	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000357549.2	37	CCDS4631.1	.	.	.	.	.	.	.	.	.	.	.	16.01	3.001231	0.54254	.	.	ENSG00000197914	ENST00000357549	.	.	.	4.05	4.05	0.47172	.	0.000000	0.64402	U	0.000004	T	0.55768	0.1941	.	.	.	.	.	.	.	.	.	.	.	.	T	0.64202	-0.6463	5	0.72032	D	0.01	.	11.3291	0.49467	0.0:0.0:0.0:1.0	.	.	.	.	L	1	.	ENSP00000350159:M1L	M	-	1	0	HIST1H4K	27907284	1.000000	0.71417	0.918000	0.36340	0.560000	0.35617	7.171000	0.77595	1.613000	0.50231	0.524000	0.50904	ATG	.		0.587	HIST1H4K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040156.1	NM_003541	Missense_Mutation
HYDIN	54768	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	70891690	70891690	+	Silent	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:70891690G>T	ENST00000393567.2	-	72	12363	c.12213C>A	c.(12211-12213)gtC>gtA	p.V4071V		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4071					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GCAGGAAAGGGACTGTGATGT	0.483																																					p.V4071V		.											.	HYDIN	92	0			c.C12213A						.						61.0	78.0	72.0					16																	70891690		1939	4143	6082	SO:0001819	synonymous_variant	54768	exon72			GAAAGGGACTGTG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12213C>A	16.37:g.70891690G>T		Somatic	289.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	40.0	NM_001270974	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	ENST00000393567.2	37	CCDS59269.1																																																																																			.		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
IGLL5	100423062	broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	23237760	23237760	+	Missense_Mutation	SNP	C	C	A	rs367960872		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr22:23237760C>A	ENST00000526893.1	+	3	805	c.531C>A	c.(529-531)agC>agA	p.S177R	IGLL5_ENST00000531372.1_3'UTR|IGLJ1_ENST00000390320.2_RNA|IGLC1_ENST00000390321.2_RNA|IGLL5_ENST00000532223.2_Missense_Mutation_p.S178R	NM_001178126.1	NP_001171597.1	B9A064	IGLL5_HUMAN	immunoglobulin lambda-like polypeptide 5	177	C region (By similarity to lambda light- chain).|Ig-like C1-type.					extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|urinary_tract(1)	7						ACGCGGCCAGCAGCTACCTGA	0.612																																					p.S177R		.											.	.	.	0			c.C531A						.	C	ARG/SER	0,4404		0,0,2202	77.0	78.0	78.0		531	4.0	1.0	22		78	1,8591	1.2+/-3.3	0,1,4295	no	missense	IGLL5	NM_001178126.1	110	0,1,6497	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging	177/215	23237760	1,12995	2202	4296	6498	SO:0001583	missense	100423062	exon3			GGCCAGCAGCTAC	M34518, M34515	CCDS54506.1	22q11.22	2013-01-11			ENSG00000254709	ENSG00000254709		"""Immunoglobulin superfamily / C1-set domain containing"""	38476	protein-coding gene	gene with protein product							Standard	NM_001178126		Approved		uc010gtu.3	B9A064	OTTHUMG00000165670	ENST00000526893.1:c.531C>A	22.37:g.23237760C>A	ENSP00000431254:p.Ser177Arg	Somatic	313.0	2.0		WXS	Illumina HiSeq	Phase_I	208.0	77.0	NM_001178126		Missense_Mutation	SNP	ENST00000526893.1	37	CCDS54506.1	.	.	.	.	.	.	.	.	.	.	C	19.44	3.828595	0.71258	0.0	1.16E-4	ENSG00000254709	ENST00000532223;ENST00000526893	T;T	0.03212	4.01;4.01	3.98	3.98	0.46160	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.20373	0.0490	M	0.88775	2.98	0.80722	D	1	D	0.71674	0.998	D	0.68353	0.957	T	0.02721	-1.1119	9	0.87932	D	0	.	13.8824	0.63689	0.0:1.0:0.0:0.0	.	177	B9A064	IGLL5_HUMAN	R	178;177	ENSP00000436353:S178R;ENSP00000431254:S177R	ENSP00000431254:S177R	S	+	3	2	IGLL5	21567760	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	4.880000	0.63107	2.164000	0.68074	0.650000	0.86243	AGC	.		0.612	IGLL5-002	KNOWN	basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000385699.1	NM_001178126	
KCNJ6	3763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	39086700	39086700	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr21:39086700G>A	ENST00000609713.1	-	3	1349	c.760C>T	c.(760-762)Ccg>Tcg	p.P254S	KCNJ6_ENST00000288309.6_Missense_Mutation_p.P254S|KCNJ6-IT1_ENST00000435001.1_RNA	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	254					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	TGGTTCAACGGGATGAACTCC	0.502																																					p.P254S	Pancreas(48;379 1118 2936 19024 28214)	.											.	KCNJ6	91	0			c.C760T						.						108.0	109.0	109.0					21																	39086700		1909	4143	6052	SO:0001583	missense	3763	exon3			TCAACGGGATGAA	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.760C>T	21.37:g.39086700G>A	ENSP00000477437:p.Pro254Ser	Somatic	321.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	33.0	NM_002240	Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	37	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585385	0.86748	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.91996	-2.95;-2.95	6.17	6.17	0.99709	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.96839	0.8968	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95956	0.8958	10	0.52906	T	0.07	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	254	P48051	IRK6_HUMAN	S	254	ENSP00000383330:P254S;ENSP00000288309:P254S	ENSP00000288309:P254S	P	-	1	0	KCNJ6	38008570	1.000000	0.71417	0.993000	0.49108	0.883000	0.51084	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	CCG	.		0.502	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
LINGO2	158038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	27949442	27949442	+	Missense_Mutation	SNP	G	G	T	rs199551773		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr9:27949442G>T	ENST00000379992.2	-	6	1677	c.1228C>A	c.(1228-1230)Ccc>Acc	p.P410T	LINGO2_ENST00000308675.3_Missense_Mutation_p.P410T	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	410	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.P410T(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CGGATTTTGGGTTTTTTGCAG	0.488																																					p.P410T		.											.	LINGO2	516	2	Substitution - Missense(2)	prostate(2)	c.C1228A						.						97.0	93.0	94.0					9																	27949442		2203	4300	6503	SO:0001583	missense	158038	exon7			TTTTGGGTTTTTT	AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1228C>A	9.37:g.27949442G>T	ENSP00000369328:p.Pro410Thr	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	16.0	NM_001258282	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	ENST00000379992.2	37	CCDS6524.1	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400240	0.62177	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	D;D	0.99789	-6.75;-6.75	6.16	6.16	0.99307	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.93550	3.43	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	D	0.97341	0.9957	9	.	.	.	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	410	Q7L985	LIGO2_HUMAN	T	410	ENSP00000369328:P410T;ENSP00000310126:P410T	.	P	-	1	0	LINGO2	27939442	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.837000	0.99465	2.937000	0.99478	0.650000	0.86243	CCC	G|0.999;A|0.001		0.488	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051978.2	NM_152570	
ALOX12	239	ucsc.edu;bcgsc.ca	37	17	6905848	6905848	+	Intron	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:6905848T>C	ENST00000251535.6	+	8	1214				AC027763.2_ENST00000399540.2_Silent_p.T63T|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000574377.1_Silent_p.T75T|AC027763.2_ENST00000575727.1_Silent_p.T63T|AC027763.2_ENST00000573939.1_3'UTR	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase						aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						ggttcacgcctgtaatcccag	0.498																																					.		.											.	.	.	0			.						.																																			SO:0001627	intron_variant	0	.			CACGCCTGTAATC	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1161+718T>C	17.37:g.6905848T>C		Somatic	84.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	.	O95569|Q6ISF8|Q9UQM4	RNA	SNP	ENST00000251535.6	37	CCDS11084.1																																																																																			.		0.498	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2		
MAP2K6	5608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	67521065	67521065	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:67521065C>T	ENST00000590474.1	+	9	974	c.687C>T	c.(685-687)ctC>ctT	p.L229L	MAP2K6_ENST00000589647.1_Silent_p.L173L	NM_002758.3	NP_002749.2	P52564	MP2K6_HUMAN	mitogen-activated protein kinase kinase 6	229	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cell cycle arrest (GO:0007050)|cellular response to sorbitol (GO:0072709)|DNA damage induced protein phosphorylation (GO:0006975)|innate immune response (GO:0045087)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to ischemia (GO:0002931)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	20	Breast(10;6.05e-10)					ACCCAGAGCTCAACCAGAAGG	0.438																																					p.L229L		.											.	MAP2K6	1404	0			c.C687T						.						105.0	94.0	98.0					17																	67521065		2203	4300	6503	SO:0001819	synonymous_variant	5608	exon9			AGAGCTCAACCAG	U39064	CCDS11686.1	17q	2011-06-09						"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6846	protein-coding gene	gene with protein product	"""protein kinase, mitogen-activated, kinase 6 (MAP kinase kinase 6)"""	601254		PRKMK6		8621675	Standard	XM_005257515		Approved	MEK6, MKK6, SAPKK3, MAPKK6	uc002jij.3	P52564		ENST00000590474.1:c.687C>T	17.37:g.67521065C>T		Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	86.0	NM_002758		Silent	SNP	ENST00000590474.1	37	CCDS11686.1																																																																																			.		0.438	MAP2K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450689.1	NM_002758	
MKI67	4288	ucsc.edu;bcgsc.ca	37	10	129913987	129913987	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:129913987T>C	ENST00000368654.3	-	7	1060	c.685A>G	c.(685-687)Aat>Gat	p.N229D	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	229					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTTTTGCTATTGTCAAGACAT	0.358																																					p.N229D		.											.	MKI67	519	0			c.A685G						.						84.0	82.0	82.0					10																	129913987		2203	4300	6503	SO:0001583	missense	4288	exon7			TGCTATTGTCAAG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.685A>G	10.37:g.129913987T>C	ENSP00000357643:p.Asn229Asp	Somatic	77.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	6.049	0.377353	0.11466	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.20463	2.07	3.69	-1.35	0.09114	.	1.335270	0.04923	N	0.455332	T	0.12518	0.0304	N	0.17082	0.46	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33163	-0.9879	9	.	.	.	.	7.9632	0.30083	0.0:0.3812:0.0:0.6188	.	229	P46013	KI67_HUMAN	D	229	ENSP00000357643:N229D	.	N	-	1	0	MKI67	129803977	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.078000	0.14761	-0.256000	0.09473	-1.151000	0.01829	AAT	.		0.358	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
MKNK1	8569	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47028365	47028365	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:47028365C>T	ENST00000371946.4	-	11	1082	c.919G>A	c.(919-921)Gcc>Acc	p.A307T	MKNK1_ENST00000341183.5_Missense_Mutation_p.A266T|MKNK1_ENST00000371944.4_Missense_Mutation_p.A171T|MKNK1-AS1_ENST00000602433.1_RNA|MKNK1_ENST00000428112.2_Missense_Mutation_p.A266T|MKNK1_ENST00000371945.4_Missense_Mutation_p.A266T	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	307	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					CCACAGTCGGCCCCGCAGTGA	0.657																																					p.A307T		.											.	MKNK1	978	0			c.G919A						.						28.0	25.0	26.0					1																	47028365		2200	4286	6486	SO:0001583	missense	8569	exon11			AGTCGGCCCCGCA	AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.919G>A	1.37:g.47028365C>T	ENSP00000361014:p.Ala307Thr	Somatic	77.0	0.0		WXS	Illumina HiSeq	Phase_I	59.0	11.0	NM_003684	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	37	CCDS538.1	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807832	0.31961	.	.	ENSG00000079277	ENST00000371946;ENST00000371945;ENST00000371944;ENST00000341183;ENST00000428112	T;T;T;T;T	0.20069	2.1;2.1;2.1;2.1;2.1	5.42	1.26	0.21427	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.356802	0.34986	N	0.003538	T	0.09949	0.0244	N	0.12611	0.24	0.80722	D	1	B;B;B;B;B;B	0.10296	0.003;0.003;0.0;0.0;0.0;0.002	B;B;B;B;B;B	0.14023	0.01;0.01;0.004;0.002;0.003;0.006	T	0.17961	-1.0352	10	0.25751	T	0.34	.	8.0312	0.30465	0.0:0.5842:0.0:0.4158	.	171;171;266;266;266;307	B4DQK5;Q7Z319;A8K341;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.;.;.;.;MKNK1_HUMAN	T	307;266;171;266;266	ENSP00000361014:A307T;ENSP00000361013:A266T;ENSP00000361012:A171T;ENSP00000339573:A266T;ENSP00000411135:A266T	ENSP00000339573:A266T	A	-	1	0	MKNK1	46800952	1.000000	0.71417	0.929000	0.37066	0.564000	0.35744	1.333000	0.33816	0.424000	0.26061	0.563000	0.77884	GCC	.		0.657	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684	
MLXIP	22877	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	122623457	122623457	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:122623457G>A	ENST00000319080.7	+	15	2612	c.2480G>A	c.(2479-2481)cGg>cAg	p.R827Q	MLXIP_ENST00000538698.1_Missense_Mutation_p.R434Q					MLX interacting protein											NS(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		GTGAAAACCCGGACCTTGCAG	0.532																																					p.R827Q	Esophageal Squamous(105;787 1493 16200 18566 52466)	.											.	MLXIP	92	0			c.G2480A						.						78.0	80.0	80.0					12																	122623457		1885	4099	5984	SO:0001583	missense	22877	exon15			AAACCCGGACCTT	AB020674	CCDS73540.1	12q21.31	2013-05-21				ENSG00000175727		"""Basic helix-loop-helix proteins"""	17055	protein-coding gene	gene with protein product		608090				10048485, 11073985	Standard	XM_006719290		Approved	MONDOA, KIAA0867, MIR, bHLHe36	uc001ubq.3	Q9HAP2		ENST00000319080.7:c.2480G>A	12.37:g.122623457G>A	ENSP00000312834:p.Arg827Gln	Somatic	389.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	12.0	NM_014938		Missense_Mutation	SNP	ENST00000319080.7	37		.	.	.	.	.	.	.	.	.	.	G	25.7	4.664907	0.88251	.	.	ENSG00000175727	ENST00000319080;ENST00000538698;ENST00000366272	T;T;T	0.53206	2.27;1.52;0.63	5.45	5.45	0.79879	.	0.241216	0.42420	D	0.000710	T	0.35770	0.0943	.	.	.	0.80722	D	1	D	0.53312	0.959	B	0.35607	0.206	T	0.26643	-1.0097	9	0.39692	T	0.17	-28.5222	14.5441	0.68015	0.0721:0.0:0.9279:0.0	.	827	Q9HAP2	MLXIP_HUMAN	Q	827;434;298	ENSP00000312834:R827Q;ENSP00000440769:R434Q;ENSP00000445891:R298Q	ENSP00000312834:R827Q	R	+	2	0	MLXIP	121189410	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.772000	0.62324	2.549000	0.85964	0.655000	0.94253	CGG	.		0.532	MLXIP-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401718.2	NM_014938	
MPO	4353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56355395	56355395	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:56355395G>A	ENST00000225275.3	-	7	1173	c.997C>T	c.(997-999)Ctc>Ttc	p.L333F	MPO_ENST00000578493.1_5'UTR|MPO_ENST00000340482.3_Missense_Mutation_p.L365F	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	333					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	AAGGAAGTGAGCGCGTTGATC	0.637																																					p.L333F		.											.	MPO	156	0			c.C997T						.						114.0	98.0	103.0					17																	56355395		2203	4300	6503	SO:0001583	missense	4353	exon7			AAGTGAGCGCGTT		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.997C>T	17.37:g.56355395G>A	ENSP00000225275:p.Leu333Phe	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	23.0	NM_000250	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	ENST00000225275.3	37	CCDS11604.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187934	0.78789	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.70164	-0.46;-0.46	5.32	4.35	0.52113	.	0.060693	0.64402	D	0.000003	D	0.84338	0.5450	M	0.92555	3.32	0.58432	D	0.999994	D	0.89917	1.0	D	0.80764	0.994	D	0.87509	0.2438	10	0.87932	D	0	-37.0231	12.4835	0.55859	0.0802:0.0:0.9198:0.0	.	333	P05164	PERM_HUMAN	F	365;333	ENSP00000344419:L365F;ENSP00000225275:L333F	ENSP00000225275:L333F	L	-	1	0	MPO	53710394	1.000000	0.71417	0.996000	0.52242	0.909000	0.53808	3.253000	0.51469	2.518000	0.84900	0.561000	0.74099	CTC	.		0.637	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443971.1		
MRC2	9902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	60743465	60743465	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:60743465C>T	ENST00000303375.5	+	3	933	c.531C>T	c.(529-531)acC>acT	p.T177T		NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	177					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						AGGTCTACACCATCCAGGGAA	0.617																																					p.T177T		.											.	MRC2	117	0			c.C531T						.						58.0	43.0	49.0					17																	60743465		2199	4294	6493	SO:0001819	synonymous_variant	9902	exon3			CTACACCATCCAG	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.531C>T	17.37:g.60743465C>T		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	33.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Silent	SNP	ENST00000303375.5	37	CCDS11634.1																																																																																			.		0.617	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
MRPS12	6183	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	39421984	39421984	+	Splice_Site	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:39421984G>A	ENST00000407800.2	+	1	390		c.e1+1		MRPS12_ENST00000308018.4_Splice_Site|MRPS12_ENST00000402029.3_Splice_Site|SARS2_ENST00000448145.2_Intron|SARS2_ENST00000221431.6_5'Flank|SARS2_ENST00000600042.1_5'Flank|SARS2_ENST00000430193.3_5'Flank|CTC-360G5.8_ENST00000599996.1_Intron|SARS2_ENST00000594171.1_5'Flank	NM_021107.1	NP_066930.1	O15235	RT12_HUMAN	mitochondrial ribosomal protein S12						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)	2	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			CTAACTTGTGGTAAGTGGGGG	0.607																																					.		.											.	MRPS12	90	0			c.49+1G>A						.						113.0	106.0	108.0					19																	39421984		2203	4300	6503	SO:0001630	splice_region_variant	6183	exon2			CTTGTGGTAAGTG	Y11681	CCDS12525.1	19q13.1-q13.2	2012-09-13			ENSG00000128626	ENSG00000128626		"""Mitochondrial ribosomal proteins / small subunits"""	10380	protein-coding gene	gene with protein product		603021		RPMS12		9545647, 9790755	Standard	NM_021107		Approved	RPS12, RPSM12	uc002oke.3	O15235		ENST00000407800.2:c.49+1G>A	19.37:g.39421984G>A		Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	6.0	NM_033362	Q53X98	Splice_Site	SNP	ENST00000407800.2	37	CCDS12525.1	.	.	.	.	.	.	.	.	.	.	G	17.61	3.433035	0.62844	.	.	ENSG00000128626	ENST00000308018;ENST00000407800;ENST00000402029	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1927	0.59719	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRPS12	44113824	1.000000	0.71417	0.988000	0.46212	0.314000	0.28054	3.817000	0.55668	2.828000	0.97474	0.655000	0.94253	.	.		0.607	MRPS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463154.1		Intron
MTF2	22823	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	93599749	93599749	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:93599749delA	ENST00000370298.4	+	14	1710	c.1421delA	c.(1420-1422)tatfs	p.Y474fs	MTF2_ENST00000545708.1_Frame_Shift_Del_p.Y372fs|MTF2_ENST00000471953.1_3'UTR|MTF2_ENST00000370303.4_Frame_Shift_Del_p.Y417fs|MTF2_ENST00000540243.1_Frame_Shift_Del_p.Y372fs	NM_001164392.1|NM_007358.3	NP_001157864.1|NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription factor 2	474					chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|segment specification (GO:0007379)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		TCCAGGCATTATGGGTAGATA	0.338																																					p.Y474fs		.											.	MTF2	92	0			c.1421delA						.						64.0	68.0	66.0					1																	93599749		2201	4299	6500	SO:0001589	frameshift_variant	22823	exon14			GGCATTATGGGTA	AJ010014	CCDS742.1, CCDS53340.1, CCDS53341.1	1p22.1	2013-01-28			ENSG00000143033	ENSG00000143033		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	29535	protein-coding gene	gene with protein product	"""polycomb-like 2"", ""tudor domain containing 19A"""	609882				15563832	Standard	NM_007358		Approved	M96, PCL2, TDRD19A	uc009wdj.3	Q9Y483	OTTHUMG00000010161	ENST00000370298.4:c.1421delA	1.37:g.93599749delA	ENSP00000359321:p.Tyr474fs	Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	121.0	50.0	NM_007358	A6NGQ9|A8K2Q3|B1AKT5|B1AKT6|Q9UES9|Q9UP40	Frame_Shift_Del	DEL	ENST00000370298.4	37	CCDS742.1																																																																																			.		0.338	MTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028075.3	NM_007358	
MYO7A	4647	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	76858899	76858899	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:76858899C>G	ENST00000409709.3	+	4	460	c.188C>G	c.(187-189)tCg>tGg	p.S63W	MYO7A_ENST00000409619.2_Missense_Mutation_p.S52W|MYO7A_ENST00000409893.1_Missense_Mutation_p.S63W|MYO7A_ENST00000458637.2_Missense_Mutation_p.S63W	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	63					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CACCCCACGTCGGTCCACGGC	0.637																																					p.S63W		.											.	MYO7A	138	0			c.C188G						.						32.0	37.0	35.0					11																	76858899		2102	4217	6319	SO:0001583	missense	4647	exon4			CCACGTCGGTCCA	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.188C>G	11.37:g.76858899C>G	ENSP00000386331:p.Ser63Trp	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	24.0	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	C	33	5.195496	0.94960	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.72615	-0.67;-0.67;-0.67;-0.67	4.86	4.86	0.63082	Myosin head, motor domain (1);	0.000000	0.64402	D	0.000001	D	0.86855	0.6033	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.89341	0.3654	10	0.72032	D	0.01	.	18.1904	0.89805	0.0:1.0:0.0:0.0	.	63;63;63	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	W	63;63;63;52;62;62;62;62	ENSP00000386331:S63W;ENSP00000386689:S63W;ENSP00000392185:S63W;ENSP00000386635:S52W	ENSP00000345075:S62W	S	+	2	0	MYO7A	76536547	1.000000	0.71417	0.969000	0.41365	0.986000	0.74619	4.730000	0.62015	2.523000	0.85059	0.455000	0.32223	TCG	.		0.637	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
MYT1L	23040	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	1946920	1946920	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:1946920G>A	ENST00000399161.2	-	9	1086	c.339C>T	c.(337-339)gaC>gaT	p.D113D	MYT1L_ENST00000428368.2_Silent_p.D113D	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	113	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCTCATCATTGTCCTCGGAGT	0.587																																					p.D113D		.											.	MYT1L	95	0			c.C339T						.						112.0	111.0	111.0					2																	1946920		2091	4109	6200	SO:0001819	synonymous_variant	23040	exon9			ATCATTGTCCTCG	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.339C>T	2.37:g.1946920G>A		Somatic	555.0	0.0		WXS	Illumina HiSeq	Phase_I	509.0	26.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	37																																																																																				.		0.587	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
NAAA	27163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	76861223	76861223	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr4:76861223C>A	ENST00000286733.4	-	2	403	c.302G>T	c.(301-303)gGc>gTc	p.G101V	NAAA_ENST00000505594.1_5'UTR|NAAA_ENST00000507956.1_Missense_Mutation_p.G101V|NAAA_ENST00000507187.2_Missense_Mutation_p.G101V|NAAA_ENST00000399497.3_Missense_Mutation_p.G101V	NM_014435.3	NP_055250.2	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase	101					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	11						GTCACACATGCCGCGGATCTC	0.622																																					p.G101V		.											.	NAAA	91	0			c.G302T						.						52.0	60.0	57.0					4																	76861223		2029	4183	6212	SO:0001583	missense	27163	exon2			CACATGCCGCGGA	M92449	CCDS43239.1	4q21.1	2011-09-23	2008-04-24	2008-04-24	ENSG00000138744	ENSG00000138744	3.5.1.-		736	protein-coding gene	gene with protein product		607469	"""N-acylsphingosine amidohydrolase (acid ceramidase)-like"""	ASAHL		10610717, 1446826	Standard	NM_001042402		Approved		uc003hjb.3	Q02083	OTTHUMG00000160855	ENST00000286733.4:c.302G>T	4.37:g.76861223C>A	ENSP00000286733:p.Gly101Val	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	57.0	22.0	NM_014435	Q5KTF2|Q96EY2|Q9BRA8	Missense_Mutation	SNP	ENST00000286733.4	37	CCDS43239.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.262281	0.80358	.	.	ENSG00000138744	ENST00000399497;ENST00000286733;ENST00000507956;ENST00000399490;ENST00000507187	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.1	5.1	0.69264	.	0.055581	0.64402	D	0.000001	T	0.77130	0.4085	M	0.73217	2.22	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.79784	0.993;0.985	T	0.79249	-0.1881	10	0.87932	D	0	-19.6079	13.8776	0.63662	0.0:1.0:0.0:0.0	.	101;101	D6R9S9;Q02083	.;NAAA_HUMAN	V	101	ENSP00000382420:G101V;ENSP00000286733:G101V;ENSP00000427641:G101V;ENSP00000423142:G101V	ENSP00000286733:G101V	G	-	2	0	NAAA	77080247	0.937000	0.31787	0.992000	0.48379	0.693000	0.40251	5.302000	0.65733	2.655000	0.90218	0.585000	0.79938	GGC	.		0.622	NAAA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362843.4		
NEO1	4756	ucsc.edu;bcgsc.ca	37	15	73541532	73541532	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:73541532G>T	ENST00000339362.5	+	11	2185	c.1738G>T	c.(1738-1740)Ggg>Tgg	p.G580W	NEO1_ENST00000558964.1_Missense_Mutation_p.G580W|NEO1_ENST00000560262.1_Missense_Mutation_p.G580W|NEO1_ENST00000261908.6_Missense_Mutation_p.G580W|NEO1_ENST00000560352.1_3'UTR			Q92859	NEO1_HUMAN	neogenin 1	580	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						CATGGAAAAGGGGACTGATAA	0.388																																					p.G580W		.											.	NEO1	116	0			c.G1738T						.						71.0	74.0	73.0					15																	73541532		2198	4297	6495	SO:0001583	missense	4756	exon10			GAAAAGGGGACTG	U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.1738G>T	15.37:g.73541532G>T	ENSP00000341198:p.Gly580Trp	Somatic	88.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001172623	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	ENST00000339362.5	37	CCDS10247.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934490	0.73442	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.60171	0.21;0.21	5.52	5.52	0.82312	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.161274	0.56097	D	0.000027	D	0.83399	0.5246	H	0.95004	3.61	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.984;0.992;0.992	D;D;D;D	0.80764	0.994;0.943;0.943;0.962	D	0.87894	0.2686	10	0.87932	D	0	-11.7186	19.0691	0.93125	0.0:0.0:1.0:0.0	.	580;580;318;580	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	W	580;318;580	ENSP00000341198:G580W;ENSP00000261908:G580W	ENSP00000261908:G580W	G	+	1	0	NEO1	71328585	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.496000	0.81526	2.601000	0.87937	0.650000	0.86243	GGG	.		0.388	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257472.2	NM_002499	
NINL	22981	ucsc.edu;bcgsc.ca	37	20	25485596	25485596	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:25485596G>A	ENST00000278886.6	-	6	709	c.636C>T	c.(634-636)agC>agT	p.S212S	NINL_ENST00000422516.1_Silent_p.S212S	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	212	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GGTGTCCGCTGCTGCCCACCC	0.657																																					p.S212S		.											.	NINL	94	0			c.C636T						.						41.0	45.0	43.0					20																	25485596		2203	4300	6503	SO:0001819	synonymous_variant	22981	exon6			TCCGCTGCTGCCC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.636C>T	20.37:g.25485596G>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	ENST00000278886.6	37	CCDS33452.1																																																																																			.		0.657	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
NPAS2	4862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	101580593	101580593	+	Silent	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:101580593T>C	ENST00000335681.5	+	8	957	c.672T>C	c.(670-672)gtT>gtC	p.V224V	NPAS2_ENST00000486017.1_3'UTR|NPAS2_ENST00000542504.1_Silent_p.V289V	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	224					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAAAGGAGGTTTGCTTCATTG	0.502																																					p.V224V		.											.	NPAS2	94	0			c.T672C						.						129.0	120.0	123.0					2																	101580593		2203	4300	6503	SO:0001819	synonymous_variant	4862	exon8			GGAGGTTTGCTTC	U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.672T>C	2.37:g.101580593T>C		Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	31.0	NM_002518	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Silent	SNP	ENST00000335681.5	37	CCDS2048.1																																																																																			.		0.502	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253168.3		
NRK	203447	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	105152837	105152837	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chrX:105152837C>A	ENST00000243300.9	+	13	1507	c.1204C>A	c.(1204-1206)Cag>Aag	p.Q402K	NRK_ENST00000428173.2_Missense_Mutation_p.Q403K	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	402	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						AGAAGAGCCACAGGTCCAGGC	0.582										HNSCC(51;0.14)																											p.Q402K		.											.	NRK	630	0			c.C1204A						.						51.0	53.0	52.0					X																	105152837		2068	4192	6260	SO:0001583	missense	203447	exon13			GAGCCACAGGTCC	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1204C>A	X.37:g.105152837C>A	ENSP00000434830:p.Gln402Lys	Somatic	127.0	2.0		WXS	Illumina HiSeq	Phase_I	72.0	8.0	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	ENST00000243300.9	37		.	.	.	.	.	.	.	.	.	.	C	11.70	1.716858	0.30413	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.77358	-1.09;-1.07	5.05	3.25	0.37280	.	0.448981	0.19101	N	0.122710	T	0.66015	0.2747	L	0.53249	1.67	0.80722	D	1	B;B	0.33612	0.419;0.043	B;B	0.26770	0.073;0.01	T	0.59445	-0.7453	10	0.20046	T	0.44	.	7.7243	0.28750	0.0:0.7383:0.1655:0.0962	.	70;402	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	K	402;403	ENSP00000434830:Q402K;ENSP00000438378:Q403K	ENSP00000434830:Q402K	Q	+	1	0	NRK	105039493	0.995000	0.38212	1.000000	0.80357	0.576000	0.36127	0.657000	0.24963	1.223000	0.43536	0.600000	0.82982	CAG	.		0.582	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
OR2H2	7932	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	29556102	29556102	+	Silent	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:29556102C>A	ENST00000383640.2	+	1	420	c.381C>A	c.(379-381)ccC>ccA	p.P127P	GABBR1_ENST00000355973.3_Intron	NM_007160.3	NP_009091.3	O95918	OR2H2_HUMAN	olfactory receptor, family 2, subfamily H, member 2	127					defense response (GO:0006952)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|mating (GO:0007618)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	14						TCTGCCAGCCCCTCCACTATG	0.577																																					p.P127P		.											.	OR2H2	22	0			c.C381A						.						124.0	128.0	126.0					6																	29556102		1509	2709	4218	SO:0001819	synonymous_variant	7932	exon1			CCAGCCCCTCCAC		CCDS34365.1	6p22.2-p21.31	2012-08-09				ENSG00000204657		"""GPCR / Class A : Olfactory receptors"""	8253	protein-coding gene	gene with protein product		600578					Standard	XM_005249407		Approved	hs6M1-12	uc003nmr.1	O95918		ENST00000383640.2:c.381C>A	6.37:g.29556102C>A		Somatic	180.0	0.0		WXS	Illumina HiSeq	Phase_I	122.0	40.0	NM_007160	Q15062|Q2M1Y3|Q5STL8|Q5SUK1|Q6IFN7|Q6NTB7|Q96R14	Silent	SNP	ENST00000383640.2	37	CCDS34365.1																																																																																			.		0.577	OR2H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076057.2		
OR51A4	401666	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	4968139	4968139	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:4968139delA	ENST00000380373.2	-	1	217	c.192delT	c.(190-192)tttfs	p.F64fs	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACATGGAAAGAAAATAGTACA	0.418																																					p.F64fs		.											.	OR51A4	71	0			c.192delT						.						163.0	147.0	153.0					11																	4968139		2198	4298	6496	SO:0001589	frameshift_variant	401666	exon1			GGAAAGAAAATAG	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.192delT	11.37:g.4968139delA	ENSP00000369731:p.Phe64fs	Somatic	1236.0	0.0		WXS	Illumina HiSeq	Phase_I	599.0	135.0	NM_001005329		Frame_Shift_Del	DEL	ENST00000380373.2	37	CCDS31367.1																																																																																			.		0.418	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
OR51E2	81285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	4703712	4703712	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:4703712A>T	ENST00000396950.3	-	2	469	c.230T>A	c.(229-231)aTg>aAg	p.M77K		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	77					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GATCTTAGGCATGGTGGATGT	0.502																																					p.M77K		.											.	OR51E2	502	0			c.T230A						.						101.0	85.0	90.0					11																	4703712		2201	4298	6499	SO:0001583	missense	81285	exon2			TTAGGCATGGTGG	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.230T>A	11.37:g.4703712A>T	ENSP00000380153:p.Met77Lys	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	15.0	NM_030774	B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	37	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.945756	0.73672	.	.	ENSG00000167332	ENST00000396950;ENST00000532598	T;T	0.03035	4.07;4.07	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	D	0.000027	T	0.15869	0.0382	M	0.82193	2.58	0.42787	D	0.993881	D	0.55172	0.97	P	0.57324	0.818	T	0.00411	-1.1756	10	0.87932	D	0	.	13.681	0.62484	1.0:0.0:0.0:0.0	.	77	Q9H255	O51E2_HUMAN	K	77	ENSP00000380153:M77K;ENSP00000432644:M77K	ENSP00000380153:M77K	M	-	2	0	OR51E2	4660288	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.718000	0.68455	2.112000	0.64535	0.533000	0.62120	ATG	.		0.502	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774	
PACS1	55690	broad.mit.edu;bcgsc.ca	37	11	65988182	65988182	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr11:65988182G>A	ENST00000320580.4	+	9	1152	c.1119G>A	c.(1117-1119)ctG>ctA	p.L373L		NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	373					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						ATGACAGTCTGGAGATGTACA	0.562																																					p.L373L		.											.	PACS1	74	0			c.G1119A						.						123.0	112.0	115.0					11																	65988182		2201	4295	6496	SO:0001819	synonymous_variant	55690	exon9			CAGTCTGGAGATG	AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.1119G>A	11.37:g.65988182G>A		Somatic	171.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	6.0	NM_018026	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Silent	SNP	ENST00000320580.4	37	CCDS8129.1																																																																																			.		0.562	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026	
PCBP1	5093	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	70315174	70315174	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:70315174T>A	ENST00000303577.5	+	1	590	c.299T>A	c.(298-300)cTg>cAg	p.L100Q	PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	100	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.L100P(1)|p.L100Q(1)		endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						CCGGTCACCCTGAGGCTGGTG	0.602																																					p.L100Q	Colon(85;1146 1307 3484 18706 25380)	.											.	PCBP1	226	2	Substitution - Missense(2)	large_intestine(2)	c.T299A						.						59.0	73.0	68.0					2																	70315174		2201	4300	6501	SO:0001583	missense	5093	exon1			TCACCCTGAGGCT		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.299T>A	2.37:g.70315174T>A	ENSP00000305556:p.Leu100Gln	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	30.0	10.0	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	37	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	T	18.11	3.551119	0.65311	.	.	ENSG00000169564	ENST00000303577	T	0.30714	1.52	4.16	4.16	0.48862	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.168590	0.40469	U	0.001094	T	0.60573	0.2279	M	0.91459	3.21	0.54753	D	0.999986	D	0.71674	0.998	D	0.70487	0.969	T	0.69781	-0.5052	10	0.87932	D	0	.	11.8577	0.52449	0.0:0.0:0.0:1.0	.	100	Q15365	PCBP1_HUMAN	Q	100	ENSP00000305556:L100Q	ENSP00000305556:L100Q	L	+	2	0	PCBP1	70168678	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	5.884000	0.69729	2.120000	0.65058	0.477000	0.44152	CTG	.		0.602	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
PCDHA11	56138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140249239	140249239	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:140249239C>T	ENST00000398640.2	+	1	551	c.551C>T	c.(550-552)aCa>aTa	p.T184I	PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	184	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.T184I(2)		breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATTCACCAACAAATGGTAAG	0.383																																					p.T184I		.											.	PCDHA11	67	2	Substitution - Missense(2)	lung(2)	c.C551T						.						68.0	75.0	73.0					5																	140249239		2000	4181	6181	SO:0001583	missense	56138	exon1			CACCAACAAATGG	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.551C>T	5.37:g.140249239C>T	ENSP00000381636:p.Thr184Ile	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	9.0	NM_018902	B2RN58|O75279	Missense_Mutation	SNP	ENST00000398640.2	37	CCDS47284.1	.	.	.	.	.	.	.	.	.	.	C	0.427	-0.905228	0.02453	.	.	ENSG00000249158	ENST00000398640	T	0.58060	0.36	5.71	0.824	0.18818	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.44265	0.1285	M	0.66297	2.02	0.09310	N	1	B;B	0.17852	0.024;0.017	B;B	0.21151	0.019;0.033	T	0.44298	-0.9337	9	0.44086	T	0.13	.	1.251	0.01982	0.202:0.3351:0.2615:0.2014	.	184;184	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	I	184	ENSP00000381636:T184I	ENSP00000381636:T184I	T	+	2	0	PCDHA11	140229423	0.000000	0.05858	0.029000	0.17559	0.175000	0.22909	-3.644000	0.00405	-0.129000	0.11620	-0.122000	0.15005	ACA	.		0.383	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372885.2	NM_018902	
PLA2G7	7941	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46672428	46672428	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:46672428G>C	ENST00000274793.7	-	12	1391	c.1195C>G	c.(1195-1197)Cat>Gat	p.H399D	PLA2G7_ENST00000537365.1_Missense_Mutation_p.H399D	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	399					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			AAATCTTTATGAAGTCCTATA	0.338																																					p.H399D		.											.	PLA2G7	90	0			c.C1195G						.						72.0	67.0	69.0					6																	46672428		2202	4298	6500	SO:0001583	missense	7941	exon12			CTTTATGAAGTCC	U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.1195C>G	6.37:g.46672428G>C	ENSP00000274793:p.His399Asp	Somatic	385.0	0.0		WXS	Illumina HiSeq	Phase_I	275.0	143.0	NM_005084	A5HTT5|Q15692|Q5VTT1|Q8IVA2	Missense_Mutation	SNP	ENST00000274793.7	37	CCDS4917.1	.	.	.	.	.	.	.	.	.	.	G	9.263	1.043790	0.19748	.	.	ENSG00000146070	ENST00000274793;ENST00000537365	T;T	0.39406	1.08;1.08	5.5	2.48	0.30137	.	0.960419	0.08735	N	0.901426	T	0.09598	0.0236	N	0.12182	0.205	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31447	-0.9943	10	0.13853	T	0.58	.	9.9133	0.41419	0.0:0.1357:0.5908:0.2735	.	399	Q13093	PAFA_HUMAN	D	399	ENSP00000274793:H399D;ENSP00000445666:H399D	ENSP00000274793:H399D	H	-	1	0	PLA2G7	46780387	0.995000	0.38212	0.982000	0.44146	0.966000	0.64601	0.383000	0.20651	0.254000	0.21573	0.561000	0.74099	CAT	.		0.338	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040802.1		
PGK2	5232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49753721	49753721	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:49753721T>A	ENST00000304801.3	-	1	1332	c.1180A>T	c.(1180-1182)Act>Tct	p.T394S		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	394					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					CCGCCTCCAGTGCTGACATGG	0.483																																					p.T394S		.											.	PGK2	91	0			c.A1180T						.						114.0	110.0	112.0					6																	49753721		2203	4300	6503	SO:0001583	missense	5232	exon1			CTCCAGTGCTGAC	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.1180A>T	6.37:g.49753721T>A	ENSP00000305995:p.Thr394Ser	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	54.0	NM_138733	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.388149	0.82902	.	.	ENSG00000170950	ENST00000304801	D	0.94330	-3.4	4.19	4.19	0.49359	Phosphoglycerate kinase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96337	0.8805	M	0.92691	3.335	0.58432	D	0.999997	P	0.51537	0.946	P	0.61275	0.886	D	0.96806	0.9593	10	0.72032	D	0.01	-20.2441	11.8373	0.52333	0.0:0.0:0.0:1.0	.	394	P07205	PGK2_HUMAN	S	394	ENSP00000305995:T394S	ENSP00000305995:T394S	T	-	1	0	PGK2	49861680	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.565000	0.67365	2.115000	0.64714	0.477000	0.44152	ACT	.		0.483	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
PLCB4	5332	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9401994	9401994	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:9401994G>T	ENST00000378493.1	+	23	2184	c.2169G>T	c.(2167-2169)gaG>gaT	p.E723D	PLCB4_ENST00000414679.2_Missense_Mutation_p.E735D|PLCB4_ENST00000278655.4_Missense_Mutation_p.E723D|PLCB4_ENST00000378501.2_Missense_Mutation_p.E723D|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000334005.3_Missense_Mutation_p.E723D|PLCB4_ENST00000378473.3_Missense_Mutation_p.E735D			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	723	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						CCTACGTAGAGGTGGATATGT	0.418																																					p.E735D		.											.	PLCB4	274	0			c.G2205T						.						116.0	106.0	109.0					20																	9401994		2203	4300	6503	SO:0001583	missense	5332	exon26			CGTAGAGGTGGAT		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.2169G>T	20.37:g.9401994G>T	ENSP00000367754:p.Glu723Asp	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	116.0	48.0	NM_001172646	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Missense_Mutation	SNP	ENST00000378493.1	37	CCDS13105.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605140	0.66445	.	.	ENSG00000101333	ENST00000334005;ENST00000378473;ENST00000278655;ENST00000378493;ENST00000378501;ENST00000414679	T;T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48;-0.48	5.68	2.21	0.28008	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.86301	0.5900	H	0.94658	3.565	0.80722	D	1	D;P;D;D	0.89917	1.0;0.913;0.962;0.983	D;P;D;P	0.91635	0.999;0.549;0.957;0.826	D	0.85773	0.1356	10	0.87932	D	0	.	9.7585	0.40517	0.7336:0.0:0.2664:0.0	.	735;570;723;723	E2QRH8;Q15147-2;Q15147;Q15147-4	.;.;PLCB4_HUMAN;.	D	723;735;723;723;723;571	ENSP00000334105:E723D;ENSP00000367734:E735D;ENSP00000278655:E723D;ENSP00000367754:E723D;ENSP00000367762:E723D;ENSP00000390616:E571D	ENSP00000278655:E723D	E	+	3	2	PLCB4	9349994	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	1.150000	0.31639	0.119000	0.18210	-0.483000	0.04790	GAG	.		0.418	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PLXND1	23129	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	129275500	129275500	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:129275500A>G	ENST00000324093.4	-	35	5799	c.5621T>C	c.(5620-5622)aTg>aCg	p.M1874T	PLXND1_ENST00000393239.1_3'UTR|PLXND1_ENST00000504689.1_Missense_Mutation_p.M30T	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1874					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						AATCTCTGCCATGGCCACATT	0.552																																					p.M1874T	Ovarian(97;366 1484 3738 22084 39045)	.											.	PLXND1	90	0			c.T5621C						.						158.0	142.0	147.0					3																	129275500		2203	4300	6503	SO:0001583	missense	23129	exon35			TCTGCCATGGCCA	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5621T>C	3.37:g.129275500A>G	ENSP00000317128:p.Met1874Thr	Somatic	179.0	0.0		WXS	Illumina HiSeq	Phase_I	148.0	55.0	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.636703	0.47049	.	.	ENSG00000004399	ENST00000324093;ENST00000504689	T;T	0.11930	2.73;2.73	5.11	3.96	0.45880	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.103102	0.64402	D	0.000004	T	0.09905	0.0243	N	0.14661	0.345	0.80722	D	1	B;P	0.38677	0.017;0.642	B;B	0.39971	0.018;0.315	T	0.14559	-1.0468	10	0.87932	D	0	.	10.902	0.47058	0.9258:0.0:0.0742:0.0	.	470;1874	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	T	1874;30	ENSP00000317128:M1874T;ENSP00000426162:M30T	ENSP00000317128:M1874T	M	-	2	0	PLXND1	130758190	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	5.168000	0.64978	0.786000	0.33708	-0.609000	0.04063	ATG	.		0.552	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
PPP1R21	129285	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	48718183	48718183	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:48718183G>A	ENST00000294952.8	+	15	1630	c.1473G>A	c.(1471-1473)ttG>ttA	p.L491L	PPP1R21_ENST00000281394.4_Silent_p.L491L|PPP1R21_ENST00000449090.2_Silent_p.L491L	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	491						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						GCAACAATTTGGACTACTTCA	0.343																																					p.L491L		.											.	.	.	0			c.G1473A						.						135.0	128.0	130.0					2																	48718183		2203	4300	6503	SO:0001819	synonymous_variant	129285	exon15			CAATTTGGACTAC	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1473G>A	2.37:g.48718183G>A		Somatic	218.0	0.0		WXS	Illumina HiSeq	Phase_I	134.0	9.0	NM_152994	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Silent	SNP	ENST00000294952.8	37	CCDS46278.1																																																																																			.		0.343	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251238.4	NM_152994	
PSD2	84249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	139193051	139193051	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:139193051G>T	ENST00000274710.3	+	3	734	c.529G>T	c.(529-531)Gag>Tag	p.E177*		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	177					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCAGCTTCGAGGCCCCCCT	0.662																																					p.E177X		.											.	PSD2	91	0			c.G529T						.						37.0	41.0	39.0					5																	139193051		2203	4300	6503	SO:0001587	stop_gained	84249	exon3			AGCTTCGAGGCCC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.529G>T	5.37:g.139193051G>T	ENSP00000274710:p.Glu177*	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	50.0	NM_032289	D3DQD3|Q8N3J8	Nonsense_Mutation	SNP	ENST00000274710.3	37	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	G	38	7.037932	0.98021	.	.	ENSG00000146005	ENST00000274710	.	.	.	3.99	3.99	0.46301	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.7866	0.69808	0.0:0.0:1.0:0.0	.	.	.	.	X	177	.	ENSP00000274710:E177X	E	+	1	0	PSD2	139173235	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.484000	0.90445	2.214000	0.71695	0.462000	0.41574	GAG	.		0.662	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PTPRB	5787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	70960239	70960239	+	Missense_Mutation	SNP	C	C	G	rs374292920		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:70960239C>G	ENST00000261266.5	-	13	3255	c.3226G>C	c.(3226-3228)Gaa>Caa	p.E1076Q	PTPRB_ENST00000550358.1_Missense_Mutation_p.E1206Q|PTPRB_ENST00000451516.2_Missense_Mutation_p.E986Q|PTPRB_ENST00000538708.1_Intron|PTPRB_ENST00000551525.1_Missense_Mutation_p.E1293Q|PTPRB_ENST00000334414.6_Missense_Mutation_p.E1294Q|PTPRB_ENST00000550857.1_Missense_Mutation_p.E986Q	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1076	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GTCTGGGCTTCCTTGCTAAAG	0.453																																					p.E1294Q		.											.	PTPRB	226	0			c.G3880C						.						162.0	152.0	155.0					12																	70960239		2012	4159	6171	SO:0001583	missense	5787	exon15			GGGCTTCCTTGCT	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.3226G>C	12.37:g.70960239C>G	ENSP00000261266:p.Glu1076Gln	Somatic	543.0	0.0		WXS	Illumina HiSeq	Phase_I	349.0	142.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	37	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	C	8.361	0.833091	0.16820	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T	0.04406	3.63;3.63;3.63;3.63;3.63;3.63;3.63	5.37	3.05	0.35203	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.649807	0.15086	N	0.281376	T	0.03011	0.0089	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B	0.19445	0.016;0.036;0.027;0.021;0.011;0.033	B;B;B;B;B;B	0.25405	0.02;0.06;0.015;0.034;0.021;0.059	T	0.45906	-0.9229	10	0.17369	T	0.5	.	7.7889	0.29108	0.0:0.5497:0.3184:0.1319	.	986;1173;1293;1294;1076;1206	P23467-2;Q6ZR19;F8VSD5;P23467-3;P23467;F8VU56	.;.;.;.;PTPRB_HUMAN;.	Q	1294;986;1206;986;1076;1293;1173	ENSP00000334928:E1294Q;ENSP00000393028:E986Q;ENSP00000448058:E1206Q;ENSP00000447302:E986Q;ENSP00000261266:E1076Q;ENSP00000448349:E1293Q;ENSP00000446982:E1173Q	ENSP00000261266:E1076Q	E	-	1	0	PTPRB	69246506	0.219000	0.23619	0.990000	0.47175	0.708000	0.40852	1.169000	0.31871	2.515000	0.84797	0.655000	0.94253	GAA	.		0.453	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
RAB40B	10966	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	80615904	80615904	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:80615904delG	ENST00000571995.1	-	6	803	c.672delC	c.(670-672)tccfs	p.S224fs	RAB40B_ENST00000571880.1_5'Flank|RAB40B_ENST00000269347.6_Frame_Shift_Del_p.S45fs|RAB40B_ENST00000538809.2_3'UTR	NM_006822.2	NP_006813.1	Q12829	RB40B_HUMAN	RAB40B, member RAS oncogene family	224	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(2)	10	Breast(20;0.00132)|all_neural(118;0.0952)	all_cancers(8;0.072)|all_epithelial(8;0.139)	BRCA - Breast invasive adenocarcinoma(99;0.0262)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CCATCGAGAAGGACTTGAGGT	0.617																																					p.S224fs		.											.	RAB40B	227	0			c.672delC						.						159.0	143.0	149.0					17																	80615904		2203	4300	6503	SO:0001589	frameshift_variant	10966	exon6			CGAGAAGGACTTG	U05227	CCDS11816.1	17q25.3	2014-08-12			ENSG00000141542	ENSG00000141542		"""RAB, member RAS oncogene"""	18284	protein-coding gene	gene with protein product						11697911	Standard	NM_006822		Approved	SEC4L, RAR	uc002kft.3	Q12829	OTTHUMG00000177806	ENST00000571995.1:c.672delC	17.37:g.80615904delG	ENSP00000461785:p.Ser224fs	Somatic	191.0	0.0		WXS	Illumina HiSeq	Phase_I	164.0	23.0	NM_006822	Q8WVG3	Frame_Shift_Del	DEL	ENST00000571995.1	37	CCDS11816.1																																																																																			.		0.617	RAB40B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439007.1		
RNF10	9921	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	121013648	121013648	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:121013648A>T	ENST00000325954.4	+	16	2715	c.2254A>T	c.(2254-2256)Aat>Tat	p.N752Y	RNF10_ENST00000413266.2_Missense_Mutation_p.N757Y|RNF10_ENST00000542701.1_3'UTR	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	752					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGAGAGTGATAATTCAGACCG	0.443																																					p.N752Y		.											.	RNF10	227	0			c.A2254T						.						178.0	183.0	181.0					12																	121013648		2203	4300	6503	SO:0001583	missense	9921	exon16			AGTGATAATTCAG	AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.2254A>T	12.37:g.121013648A>T	ENSP00000322242:p.Asn752Tyr	Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	13.0	NM_014868	Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	ENST00000325954.4	37	CCDS9201.1	.	.	.	.	.	.	.	.	.	.	A	12.74	2.027270	0.35797	.	.	ENSG00000022840	ENST00000325954;ENST00000458409;ENST00000413266;ENST00000538254	D;D	0.89681	-2.55;-2.54	5.39	5.39	0.77823	.	0.338826	0.36200	N	0.002732	D	0.89663	0.6780	L	0.40543	1.245	0.40164	D	0.977097	D;D	0.61080	0.989;0.976	P;P	0.59546	0.859;0.556	D	0.90106	0.4188	10	0.54805	T	0.06	.	10.6496	0.45640	0.8572:0.0:0.0:0.1428	.	757;752	Q8N5U6-2;Q8N5U6	.;RNF10_HUMAN	Y	752;752;757;87	ENSP00000322242:N752Y;ENSP00000415682:N757Y	ENSP00000322242:N752Y	N	+	1	0	RNF10	119498031	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.487000	0.60293	2.054000	0.61138	0.533000	0.62120	AAT	.		0.443	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401898.4		
RPS6KB1	6198	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	58013587	58013587	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:58013587A>T	ENST00000225577.4	+	11	1011	c.990A>T	c.(988-990)agA>agT	p.R330S	RPS6KB1_ENST00000443572.2_Missense_Mutation_p.R307S|RPS6KB1_ENST00000406116.3_Missense_Mutation_p.R330S|RPS6KB1_ENST00000393021.3_Missense_Mutation_p.R277S	NM_001272042.1|NM_001272044.1|NM_001272060.1|NM_003161.2	NP_001258971.1|NP_001258973.1|NP_001258989.1|NP_003152.1	P23443	KS6B1_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 1	330	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				aging (GO:0007568)|apoptotic process (GO:0006915)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|G1/S transition of mitotic cell cycle (GO:0000082)|germ cell development (GO:0007281)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue growth (GO:0048633)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of glucose import (GO:0046324)|response to drug (GO:0042493)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to ethanol (GO:0045471)|response to glucagon (GO:0033762)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to leucine (GO:0043201)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|response to testosterone (GO:0033574)|response to toxic substance (GO:0009636)|response to tumor necrosis factor (GO:0034612)|response to wounding (GO:0009611)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	all_cancers(5;1.63e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.57e-12)|all cancers(12;6.41e-11)			TGCTGAAAAGAAATGCTGCTT	0.408																																					p.R330S		.											.	RPS6KB1	1041	0			c.A990T						.						110.0	110.0	110.0					17																	58013587		2203	4300	6503	SO:0001583	missense	6198	exon11			GAAAAGAAATGCT	M60724	CCDS11621.1, CCDS62271.1, CCDS62272.1, CCDS62273.1	17q23.1	2011-04-05	2002-08-29		ENSG00000108443	ENSG00000108443			10436	protein-coding gene	gene with protein product		608938	"""ribosomal protein S6 kinase, 70kD, polypeptide 1"""	STK14A		1922062	Standard	NM_003161		Approved	S6K1, p70(S6K)-alpha, PS6K	uc002ixy.4	P23443	OTTHUMG00000150642	ENST00000225577.4:c.990A>T	17.37:g.58013587A>T	ENSP00000225577:p.Arg330Ser	Somatic	302.0	1.0		WXS	Illumina HiSeq	Phase_I	257.0	155.0	NM_001272043	B2R779|B4DLT4|B4DTG1|E7ESB8|F6UYM1|Q7Z721	Missense_Mutation	SNP	ENST00000225577.4	37	CCDS11621.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.716500	0.89205	.	.	ENSG00000108443	ENST00000443572;ENST00000406116;ENST00000225577;ENST00000393021	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.55	3.35	0.38373	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62648	0.2445	L	0.33710	1.025	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.999	D;D;D	0.78314	0.991;0.978;0.987	T	0.63849	-0.6544	10	0.87932	D	0	.	9.3291	0.38010	0.8551:0.0:0.1449:0.0	.	307;330;330	F6UYM1;Q7Z721;P23443	.;.;KS6B1_HUMAN	S	307;330;330;277	ENSP00000441993:R307S;ENSP00000384335:R330S;ENSP00000225577:R330S;ENSP00000376744:R277S	ENSP00000225577:R330S	R	+	3	2	RPS6KB1	55368369	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.090000	0.57693	0.941000	0.37499	0.524000	0.50904	AGA	.		0.408	RPS6KB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319324.1	NM_003161	
SARDH	1757	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	136582451	136582451	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr9:136582451G>T	ENST00000371872.4	-	8	1404	c.1147C>A	c.(1147-1149)Cct>Act	p.P383T	SARDH_ENST00000439388.1_Missense_Mutation_p.P383T|SARDH_ENST00000422262.2_Missense_Mutation_p.P215T	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	383					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		CACTCACCAGGGCCGCAGACC	0.592																																					p.P383T		.											.	SARDH	90	0			c.C1147A						.						104.0	99.0	101.0					9																	136582451		2203	4300	6503	SO:0001583	missense	1757	exon8			CACCAGGGCCGCA		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1147C>A	9.37:g.136582451G>T	ENSP00000360938:p.Pro383Thr	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	12.0	NM_007101	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	ENST00000371872.4	37	CCDS6978.1	.	.	.	.	.	.	.	.	.	.	G	16.21	3.059542	0.55325	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227;ENST00000535281	T;T;T	0.81163	-1.46;-1.46;-1.46	3.95	3.95	0.45737	FAD dependent oxidoreductase (1);	0.064367	0.64402	D	0.000008	D	0.92361	0.7576	H	0.95780	3.72	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.94982	0.8126	10	0.87932	D	0	.	16.0188	0.80464	0.0:0.0:1.0:0.0	.	383	Q9UL12	SARDH_HUMAN	T	383;383;215;383;383;383	ENSP00000360938:P383T;ENSP00000403084:P383T;ENSP00000415537:P215T	ENSP00000360938:P383T	P	-	1	0	SARDH	135572272	1.000000	0.71417	0.894000	0.35097	0.149000	0.21700	9.718000	0.98758	1.760000	0.52011	0.462000	0.41574	CCT	.		0.592	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054931.1		
SCAPER	49855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	77134131	77134131	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr15:77134131C>T	ENST00000563290.1	-	5	432	c.337G>A	c.(337-339)Gca>Aca	p.A113T	SCAPER_ENST00000324767.7_Missense_Mutation_p.A113T|SCAPER_ENST00000538941.2_5'UTR			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	113						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TCATCTACTGCTCGGCGAAGA	0.393																																					p.A113T		.											.	SCAPER	137	0			c.G337A						.						132.0	118.0	123.0					15																	77134131		1837	4078	5915	SO:0001583	missense	49855	exon4			CTACTGCTCGGCG	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.337G>A	15.37:g.77134131C>T	ENSP00000454973:p.Ala113Thr	Somatic	271.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	87.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	37	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	36	5.657937	0.96734	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.54866	0.55	5.14	5.14	0.70334	.	0.115428	0.64402	D	0.000016	T	0.68952	0.3057	L	0.49640	1.575	0.58432	D	0.999999	D;P	0.89917	1.0;0.935	D;P	0.91635	0.999;0.847	T	0.71337	-0.4623	10	0.66056	D	0.02	.	18.6068	0.91270	0.0:1.0:0.0:0.0	.	113;128	Q6NSF1;Q9BY12-2	.;.	T	113;129	ENSP00000326924:A113T	ENSP00000303560:A129T	A	-	1	0	SCAPER	74921186	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.412000	0.81896	0.655000	0.94253	GCA	.		0.393	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
SF3A3	10946	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	38453345	38453345	+	Missense_Mutation	SNP	C	C	T	rs372195588		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:38453345C>T	ENST00000373019.4	-	4	1158	c.203G>A	c.(202-204)cGa>cAa	p.R68Q	SF3A3_ENST00000448721.2_Intron|SF3A3_ENST00000489537.1_5'UTR	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa	68					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTCCTCCTTTCGTAATCTGCA	0.423																																					p.R68Q		.											.	SF3A3	90	0			c.G203A						.	C	GLN/ARG	0,4406		0,0,2203	104.0	105.0	105.0		203	5.6	1.0	1		105	1,8599	1.2+/-3.3	0,1,4299	no	missense	SF3A3	NM_006802.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	68/502	38453345	1,13005	2203	4300	6503	SO:0001583	missense	10946	exon4			TCCTTTCGTAATC	U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.203G>A	1.37:g.38453345C>T	ENSP00000362110:p.Arg68Gln	Somatic	220.0	0.0		WXS	Illumina HiSeq	Phase_I	131.0	54.0	NM_006802	D3DPT5|Q15460|Q5VT87	Missense_Mutation	SNP	ENST00000373019.4	37	CCDS428.1	.	.	.	.	.	.	.	.	.	.	C	36	5.708777	0.96821	0.0	1.16E-4	ENSG00000183431	ENST00000373019	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.86351	0.5912	M	0.92604	3.325	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	D	0.88495	0.3078	9	0.56958	D	0.05	-7.9523	19.6316	0.95708	0.0:1.0:0.0:0.0	.	68	Q12874	SF3A3_HUMAN	Q	68	.	ENSP00000362110:R68Q	R	-	2	0	SF3A3	38225932	1.000000	0.71417	0.995000	0.50966	0.936000	0.57629	7.684000	0.84104	2.642000	0.89623	0.557000	0.71058	CGA	.		0.423	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012976.1	NM_006802	
SIGLEC12	89858	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52001391	52001391	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:52001391C>A	ENST00000291707.3	-	5	1341	c.1286G>T	c.(1285-1287)gGg>gTg	p.G429V	SIGLEC12_ENST00000598614.1_Missense_Mutation_p.G311V	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	429	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CTCCAGCACCCCAAGGTTCGA	0.617																																					p.G429V		.											.	SIGLEC12	96	0			c.G1286T						.						50.0	49.0	49.0					19																	52001391		2203	4300	6503	SO:0001583	missense	89858	exon5			AGCACCCCAAGGT	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.1286G>T	19.37:g.52001391C>A	ENSP00000291707:p.Gly429Val	Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	17.0	NM_053003	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	9.204	1.029301	0.19512	.	.	ENSG00000254521	ENST00000291707	T	0.15718	2.4	1.39	-2.77	0.05877	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.198493	0.24779	U	0.035667	T	0.41673	0.1169	H	0.95402	3.665	0.09310	N	0.999998	D;D	0.69078	0.997;0.99	D;D	0.76071	0.987;0.929	T	0.33394	-0.9870	10	0.72032	D	0.01	.	2.2019	0.03926	0.2445:0.4208:0.0:0.3347	.	429;311	Q96PQ1;Q96PQ1-2	SIG12_HUMAN;.	V	429	ENSP00000291707:G429V	ENSP00000291707:G429V	G	-	2	0	SIGLEC12	56693203	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.240000	0.18042	-0.859000	0.04105	-0.784000	0.03344	GGG	.		0.617	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
SIRPD	128646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1532400	1532400	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr20:1532400A>G	ENST00000381623.3	-	2	1547	c.358T>C	c.(358-360)Ttc>Ctc	p.F120L	SIRPD_ENST00000381621.1_Missense_Mutation_p.F120L			Q9H106	SIRPD_HUMAN	signal-regulatory protein delta	120	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)	15						CCTTTTATGAACTTCACGCAG	0.488																																					p.F120L		.											.	SIRPD	227	0			c.T358C						.						149.0	143.0	145.0					20																	1532400		2203	4300	6503	SO:0001583	missense	128646	exon2			TTATGAACTTCAC	AL049634	CCDS13018.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000125900	ENSG00000125900		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16248	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type substrate 1-like 2"""	PTPNS1L2		16339511	Standard	NM_178460		Approved	dJ576H24.4	uc002wfi.3	Q9H106	OTTHUMG00000031674	ENST00000381623.3:c.358T>C	20.37:g.1532400A>G	ENSP00000371036:p.Phe120Leu	Somatic	137.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	24.0	NM_178460	B3KS88|Q5TFQ6	Missense_Mutation	SNP	ENST00000381623.3	37	CCDS13018.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.272461	0.40194	.	.	ENSG00000125900	ENST00000381623;ENST00000381621	T;T	0.64991	-0.13;-0.13	4.02	1.74	0.24563	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.680568	0.12147	N	0.495245	T	0.44973	0.1319	L	0.33753	1.03	0.24203	N	0.995501	P	0.34587	0.458	B	0.29077	0.098	T	0.32188	-0.9916	10	0.59425	D	0.04	.	5.698	0.17867	0.7725:0.0:0.2275:0.0	.	120	Q9H106	SIRPD_HUMAN	L	120	ENSP00000371036:F120L;ENSP00000371034:F120L	ENSP00000371034:F120L	F	-	1	0	SIRPD	1480400	1.000000	0.71417	0.776000	0.31678	0.180000	0.23129	2.564000	0.45931	0.235000	0.21160	-0.394000	0.06481	TTC	.		0.488	SIRPD-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077552.1	NM_178460	
SLC10A5	347051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	82606130	82606130	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr8:82606130G>A	ENST00000518568.1	-	1	2279	c.1078C>T	c.(1078-1080)Ctg>Ttg	p.L360L		NM_001010893.2	NP_001010893.1	Q5PT55	NTCP5_HUMAN	solute carrier family 10, member 5	360						integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)	p.L360L(1)		autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)	15						GGAAGAGGCAGCGTACAAACT	0.408																																					p.L360L		.											.	SLC10A5	90	1	Substitution - coding silent(1)	endometrium(1)	c.C1078T						.						76.0	73.0	74.0					8																	82606130		2203	4300	6503	SO:0001819	synonymous_variant	347051	exon1			GAGGCAGCGTACA		CCDS34915.1	8q21.13	2013-07-18	2013-07-18		ENSG00000253598	ENSG00000253598		"""Solute carriers"""	22981	protein-coding gene	gene with protein product							Standard	NM_001010893		Approved		uc011lfs.2	Q5PT55	OTTHUMG00000164683	ENST00000518568.1:c.1078C>T	8.37:g.82606130G>A		Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	13.0	NM_001010893	B2RN26	Silent	SNP	ENST00000518568.1	37	CCDS34915.1																																																																																			.		0.408	SLC10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379736.1	XM_294493	
SLC25A12	8604	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	172691267	172691267	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:172691267C>A	ENST00000422440.2	-	7	758	c.721G>T	c.(721-723)Ggc>Tgc	p.G241C	SLC25A12_ENST00000392592.4_Missense_Mutation_p.G134C	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	241					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TTCCTTGTGCCAGCTAGAGTG	0.363																																					p.G241C		.											.	SLC25A12	90	0			c.G721T						.						132.0	124.0	127.0					2																	172691267		2203	4300	6503	SO:0001583	missense	8604	exon7			TTGTGCCAGCTAG	Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.721G>T	2.37:g.172691267C>A	ENSP00000388658:p.Gly241Cys	Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	8.0	NM_003705	B3KR64|Q96AM8	Missense_Mutation	SNP	ENST00000422440.2	37	CCDS33327.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817550	0.90790	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	T;T	0.80214	-1.35;-1.19	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.89577	0.6755	M	0.81682	2.555	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.61800	0.894;0.894	D	0.90304	0.4332	10	0.72032	D	0.01	-10.0474	19.7609	0.96316	0.0:1.0:0.0:0.0	.	134;241	B3KR64;O75746	.;CMC1_HUMAN	C	241;134	ENSP00000388658:G241C;ENSP00000376371:G134C	ENSP00000376371:G134C	G	-	1	0	SLC25A12	172399513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.729000	0.84864	2.741000	0.93983	0.563000	0.77884	GGC	.		0.363	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259010.2	NM_003705	
SLC2A3	6515	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	8086448	8086448	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:8086448G>T	ENST00000075120.7	-	2	306	c.66C>A	c.(64-66)ttC>ttA	p.F22L		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	22					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		AGCCAAATTGGAAAGAGCCGA	0.443											OREG0021656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F22L	Colon(96;424 1461 14416 20933 23688)	.											.	SLC2A3	94	0			c.C66A						.						97.0	94.0	95.0					12																	8086448		2203	4300	6503	SO:0001583	missense	6515	exon2			AAATTGGAAAGAG	M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.66C>A	12.37:g.8086448G>T	ENSP00000075120:p.Phe22Leu	Somatic	211.0	0.0	646	WXS	Illumina HiSeq	Phase_I	143.0	47.0	NM_006931	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	ENST00000075120.7	37	CCDS8586.1	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870476	0.72065	.	.	ENSG00000059804	ENST00000075120	D	0.82167	-1.58	4.23	3.33	0.38152	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.062472	0.64402	D	0.000003	T	0.60689	0.2288	N	0.05534	-0.03	0.45216	D	0.998223	B	0.10296	0.003	B	0.20184	0.028	T	0.53989	-0.8360	10	0.12430	T	0.62	.	5.4377	0.16490	0.1094:0.2076:0.6829:0.0	.	22	P11169	GTR3_HUMAN	L	22	ENSP00000075120:F22L	ENSP00000075120:F22L	F	-	3	2	SLC2A3	7977715	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	1.215000	0.32431	2.370000	0.80446	0.543000	0.68304	TTC	.		0.443	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931	
SMAP2	64744	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	40839819	40839819	+	IGR	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:40839819G>A								COL9A2 (56853 upstream) : SMAP2 (22687 downstream)																							TGAAGGACGTGGATCGGTACC	0.652																																					p.V9V		.											.	SMAP2	68	0			c.G27A						.						66.0	57.0	60.0					1																	40839819		2203	4300	6503	SO:0001628	intergenic_variant	64744	exon1			GGACGTGGATCGG																													1.37:g.40839819G>A		Somatic	198.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	47.0	NM_022733		Silent	SNP		37																																																																																				.	0	0.652								
FAM47E-STBD1	100631383	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77230589	77230589	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr4:77230589G>T	ENST00000237642.6	+	2	1257	c.513G>T	c.(511-513)gaG>gaT	p.E171D	FAM47E-STBD1_ENST00000539752.1_Missense_Mutation_p.E22D|FAM47E_ENST00000515604.1_3'UTR	NM_003943.4	NP_003934.1			FAM47E-STBD1 readthrough																		GTTTTGCAGAGAAGTTGCCTT	0.443																																					p.E171D		.											.	STBD1	69	0			c.G513T						.						52.0	54.0	54.0					4																	77230589		2203	4300	6503	SO:0001583	missense	8987	exon2			TGCAGAGAAGTTG		CCDS58908.1	4q21.1	2013-04-23			ENSG00000118804	ENSG00000118804			44667	other	readthrough							Standard	NM_001242939		Approved				OTTHUMG00000160966	ENST00000237642.6:c.513G>T	4.37:g.77230589G>T	ENSP00000237642:p.Glu171Asp	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	42.0	NM_003943		Missense_Mutation	SNP	ENST00000237642.6	37	CCDS3578.1	.	.	.	.	.	.	.	.	.	.	G	2.139	-0.397246	0.04899	.	.	ENSG00000118804	ENST00000539752;ENST00000237642	.	.	.	4.73	-1.64	0.08318	.	0.933364	0.08922	N	0.874297	T	0.23926	0.0579	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.21930	-1.0231	9	0.30078	T	0.28	-0.6048	1.7559	0.02982	0.3423:0.1295:0.3961:0.132	.	171	O95210	STBD1_HUMAN	D	22;171	.	ENSP00000237642:E171D	E	+	3	2	STBD1	77449613	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.073000	0.11468	-0.250000	0.09555	-0.165000	0.13383	GAG	.		0.443	FAM47E-STBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252415.2		
STOX1	219736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70652470	70652470	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:70652470T>C	ENST00000298596.6	+	4	3031	c.2948T>C	c.(2947-2949)cTa>cCa	p.L983P	STOX1_ENST00000399162.2_3'UTR|STOX1_ENST00000399169.4_Missense_Mutation_p.L983P|STOX1_ENST00000399165.4_3'UTR|STOX1_ENST00000421961.2_Missense_Mutation_p.L873P	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	983						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						TTACTACCGCTAACTCCAGTC	0.333																																					p.L983P		.											.	STOX1	92	0			c.T2948C						.						111.0	115.0	113.0					10																	70652470		1984	4191	6175	SO:0001583	missense	219736	exon4			TACCGCTAACTCC	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.2948T>C	10.37:g.70652470T>C	ENSP00000298596:p.Leu983Pro	Somatic	303.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	77.0	NM_152709	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	ENST00000298596.6	37	CCDS41535.1	.	.	.	.	.	.	.	.	.	.	T	15.03	2.712971	0.48517	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000421961	D;D;T	0.84146	-1.81;-1.81;-1.48	5.83	5.83	0.93111	.	0.171834	0.38837	N	0.001547	D	0.91683	0.7371	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.92517	0.6021	10	0.87932	D	0	.	15.8862	0.79251	0.0:0.0:0.0:1.0	.	983	Q6ZVD7	STOX1_HUMAN	P	983;983;873	ENSP00000382121:L983P;ENSP00000298596:L983P;ENSP00000394509:L873P	ENSP00000298596:L983P	L	+	2	0	STOX1	70322476	1.000000	0.71417	0.998000	0.56505	0.013000	0.08279	5.045000	0.64220	2.236000	0.73375	0.533000	0.62120	CTA	.		0.333	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
SYCP2L	221711	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	10894136	10894136	+	Nonsense_Mutation	SNP	G	G	T	rs529185874		TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr6:10894136G>T	ENST00000283141.6	+	3	411	c.115G>T	c.(115-117)Gga>Tga	p.G39*	RP11-637O19.3_ENST00000480294.1_3'UTR|SYCP2L_ENST00000543878.1_5'UTR	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	39						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			CCATGATAAAGGATTTCAGAA	0.294																																					p.G39X		.											.	SYCP2L	24	0			c.G115T						.						34.0	33.0	33.0					6																	10894136		1798	4060	5858	SO:0001587	stop_gained	221711	exon3			GATAAAGGATTTC	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.115G>T	6.37:g.10894136G>T	ENSP00000283141:p.Gly39*	Somatic	285.0	0.0		WXS	Illumina HiSeq	Phase_I	173.0	70.0	NM_001040274	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Nonsense_Mutation	SNP	ENST00000283141.6	37	CCDS43423.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585750	0.86748	.	.	ENSG00000153157	ENST00000283141	.	.	.	5.66	1.91	0.25777	.	0.456218	0.21304	N	0.076756	.	.	.	.	.	.	0.24096	N	0.995895	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.7238	6.7655	0.23564	0.2148:0.1279:0.6572:0.0	.	.	.	.	X	39	.	ENSP00000283141:G39X	G	+	1	0	SYCP2L	11002122	1.000000	0.71417	0.053000	0.19242	0.184000	0.23303	2.359000	0.44142	0.063000	0.16370	-0.878000	0.02970	GGA	.		0.294	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
TAF1	6872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70680629	70680629	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chrX:70680629A>G	ENST00000373790.4	+	37	5423	c.5372A>G	c.(5371-5373)cAt>cGt	p.H1791R	TAF1_ENST00000423759.1_Missense_Mutation_p.H1814R|TAF1_ENST00000461764.1_3'UTR|TAF1_ENST00000449580.1_Missense_Mutation_p.H1825R|TAF1_ENST00000276072.3_Missense_Mutation_p.H1812R	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1791	Asp/Glu-rich (acidic tail).|Protein kinase 2.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GAGGCTTCCCATGGTTTGGAG	0.507																																					p.H1812R		.											.	TAF1	900	0			c.A5435G						.						117.0	81.0	93.0					X																	70680629		2201	4299	6500	SO:0001583	missense	6872	exon37			CTTCCCATGGTTT		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.5372A>G	X.37:g.70680629A>G	ENSP00000362895:p.His1791Arg	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	67.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.11|10.11	1.259763|1.259763	0.23051|0.23051	.|.	.|.	ENSG00000147133|ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000276072|ENST00000437147	T;T;T;T|.	0.08370|.	3.1;3.14;3.16;3.1|.	4.76|4.76	-0.271|-0.271	0.12922|0.12922	.|.	0.662303|.	0.16392|.	N|.	0.216437|.	T|T	0.22704|0.22704	0.0548|0.0548	N|N	0.19112|0.19112	0.55|0.55	0.20873|0.20873	N|N	0.999833|0.999833	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.04013|.	0.001;0.001;0.0;0.001|.	T|T	0.29701|0.29701	-1.0003|-1.0003	10|5	0.11485|.	T|.	0.65|.	.|.	8.3625|8.3625	0.32367|0.32367	0.6661:0.0:0.3339:0.0|0.6661:0.0:0.3339:0.0	.|.	481;1825;1791;1812|.	A5CVC9;P21675-4;P21675;P21675-2|.	.;.;TAF1_HUMAN;.|.	R|V	1791;1825;1814;533;1812|480	ENSP00000362895:H1791R;ENSP00000389000:H1825R;ENSP00000406549:H1814R;ENSP00000276072:H1812R|.	ENSP00000276072:H1812R|.	H|M	+|+	2|1	0|0	TAF1|TAF1	70597354|70597354	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.997000|0.997000	0.91878|0.91878	1.978000|1.978000	0.40598|0.40598	-0.324000|-0.324000	0.08589|0.08589	0.430000|0.430000	0.28490|0.28490	CAT|ATG	.		0.507	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
TAS2R39	259285	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	142881187	142881187	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr7:142881187C>A	ENST00000446620.1	+	1	676	c.676C>A	c.(676-678)Ctg>Atg	p.L226M		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	226					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					CATGTTCATCCTGACAGCCAC	0.507																																					p.L226M		.											.	TAS2R39	1	0			c.C676A						.						135.0	124.0	128.0					7																	142881187		1989	4154	6143	SO:0001583	missense	259285	exon1			TTCATCCTGACAG	AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.676C>A	7.37:g.142881187C>A	ENSP00000405095:p.Leu226Met	Somatic	260.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	12.0	NM_176881	A4FUI7|Q3ZCN6|Q645W4	Missense_Mutation	SNP	ENST00000446620.1	37	CCDS47729.1	.	.	.	.	.	.	.	.	.	.	C	8.827	0.938867	0.18281	.	.	ENSG00000236398	ENST00000446620	T	0.39592	1.07	4.45	-0.668	0.11392	.	.	.	.	.	T	0.24470	0.0593	L	0.28504	0.86	0.09310	N	1	B	0.31256	0.316	B	0.30646	0.118	T	0.18999	-1.0319	9	0.24483	T	0.36	.	4.097	0.09995	0.1009:0.1888:0.4806:0.2297	.	226	P59534	T2R39_HUMAN	M	226	ENSP00000405095:L226M	ENSP00000405095:L226M	L	+	1	2	TAS2R39	142591309	0.000000	0.05858	0.025000	0.17156	0.934000	0.57294	-1.823000	0.01710	-0.248000	0.09583	-0.143000	0.13931	CTG	.		0.507	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327090.2	NM_176881	
TBC1D26	353149	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	15642100	15642100	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr17:15642100C>T	ENST00000437605.2	+	8	703	c.453C>T	c.(451-453)caC>caT	p.H151H	AC005324.6_ENST00000580194.1_RNA|ZNF286A_ENST00000413242.2_3'UTR|TBC1D26_ENST00000579428.1_Silent_p.H151H|AC005324.6_ENST00000434017.1_RNA|AC005324.6_ENST00000433873.1_RNA	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	151	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		ATGTCAGCCACACCCTGCAGA	0.537																																					p.H151H		.											.	TBC1D26	90	0			c.C453T						.						108.0	99.0	102.0					17																	15642100		2154	4235	6389	SO:0001819	synonymous_variant	353149	exon8			CAGCCACACCCTG		CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.453C>T	17.37:g.15642100C>T		Somatic	585.0	1.0		WXS	Illumina HiSeq	Phase_I	222.0	94.0	NM_178571	A8K929|Q4G172	Silent	SNP	ENST00000437605.2	37	CCDS42265.1																																																																																			.		0.537	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178571	
TENM2	57451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	166711893	166711893	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr5:166711893C>T	ENST00000518659.1	+	1	90	c.51C>T	c.(49-51)ggC>ggT	p.G17G	CTB-180C19.1_ENST00000521697.1_RNA|TENM2_ENST00000545108.1_Silent_p.G17G	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	17	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GACGCTGTGGCAAAGAGTGTC	0.527																																					p.G17G		.											.	.	.	0			c.C51T						.						66.0	63.0	64.0					5																	166711893		692	1591	2283	SO:0001819	synonymous_variant	57451	exon1			CTGTGGCAAAGAG	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.51C>T	5.37:g.166711893C>T		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	22.0	NM_001122679	Q9ULU2	Silent	SNP	ENST00000518659.1	37																																																																																				.		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TEX261	113419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	71215838	71215838	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr2:71215838G>A	ENST00000272438.4	-	6	670	c.483C>T	c.(481-483)gtC>gtT	p.V161V	TEX261_ENST00000466731.1_5'UTR|AC007040.11_ENST00000606025.1_Intron	NM_144582.2	NP_653183.2	Q6UWH6	TX261_HUMAN	testis expressed 261	161						integral component of membrane (GO:0016021)				NS(1)|breast(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						AATTGGAGACGACATCATCTG	0.512																																					p.V161V		.											.	TEX261	90	0			c.C483T						.						99.0	92.0	94.0					2																	71215838		2203	4300	6503	SO:0001819	synonymous_variant	113419	exon6			GGAGACGACATCA	AL832385	CCDS1914.1	2p13.3	2013-09-24	2007-03-13		ENSG00000144043	ENSG00000144043			30712	protein-coding gene	gene with protein product			"""testis expressed sequence 261"""			9464256	Standard	NM_144582		Approved	MGC32043, TEG-261	uc002shn.3	Q6UWH6	OTTHUMG00000129708	ENST00000272438.4:c.483C>T	2.37:g.71215838G>A		Somatic	101.0	0.0		WXS	Illumina HiSeq	Phase_I	68.0	27.0	NM_144582	A1A587|D6W5G9|Q8WUJ5	Silent	SNP	ENST00000272438.4	37	CCDS1914.1																																																																																			.		0.512	TEX261-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251916.1	NM_144582	
TIMP4	7079	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	12195189	12195189	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:12195189delG	ENST00000287814.4	-	5	1011	c.501delC	c.(499-501)cccfs	p.P167fs	SYN2_ENST00000432424.2_RNA	NM_003256.3	NP_003247.1	Q99727	TIMP4_HUMAN	TIMP metallopeptidase inhibitor 4	167					central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|ovulation cycle (GO:0042698)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)|sarcomere (GO:0030017)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11						AGATGGTACAGGGTACTGTGT	0.488																																					p.P167fs	Melanoma(199;1446 2144 30617 38794 51714)	.											.	TIMP4	226	0			c.501delC						.						134.0	124.0	127.0					3																	12195189		2203	4300	6503	SO:0001589	frameshift_variant	7079	exon5			GGTACAGGGTACT	U76456	CCDS2608.1	3p25	2005-10-31	2005-08-08		ENSG00000157150	ENSG00000157150			11823	protein-coding gene	gene with protein product		601915	"""tissue inhibitor of metalloproteinase 4"""			8939999, 9693046	Standard	NM_003256		Approved		uc003bwo.3	Q99727	OTTHUMG00000129763	ENST00000287814.4:c.501delC	3.37:g.12195189delG	ENSP00000287814:p.Pro167fs	Somatic	202.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	23.0	NM_003256	B2R7K6	Frame_Shift_Del	DEL	ENST00000287814.4	37	CCDS2608.1																																																																																			.		0.488	TIMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251978.1	NM_003256	
TNFRSF25	8718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	6522204	6522204	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:6522204G>A	ENST00000356876.3	-	9	862	c.775C>T	c.(775-777)Cac>Tac	p.H259Y	TNFRSF25_ENST00000351748.3_Missense_Mutation_p.H76Y|TNFRSF25_ENST00000461703.2_5'Flank|TNFRSF25_ENST00000377782.3_Missense_Mutation_p.H268Y|TNFRSF25_ENST00000348333.3_Missense_Mutation_p.H214Y|TNFRSF25_ENST00000351959.5_Missense_Mutation_p.H222Y	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	259					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		AGAAGGGTGTGGGCGCTGTCC	0.637																																					p.H268Y		.											.	TNFRSF25	714	0			c.C802T						.						128.0	132.0	130.0					1																	6522204		2203	4300	6503	SO:0001583	missense	8718	exon9			GGGTGTGGGCGCT	U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.775C>T	1.37:g.6522204G>A	ENSP00000349341:p.His259Tyr	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	35.0	NM_148965	B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	ENST00000356876.3	37	CCDS71.1	.	.	.	.	.	.	.	.	.	.	G	3.260	-0.151332	0.06585	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959;ENST00000351748;ENST00000348333	D;D;D;T;D	0.92965	-2.96;-3.14;-3.05;2.5;-2.01	4.89	1.93	0.25924	.	688.334000	0.00447	U	0.000093	D	0.93609	0.7959	M	0.64997	1.995	0.09310	N	1	D;D;D;P;D;D	0.67145	0.996;0.969;0.986;0.947;0.975;0.962	P;P;P;P;P;P	0.53450	0.726;0.656;0.656;0.454;0.726;0.67	T	0.79960	-0.1583	10	0.56958	D	0.05	0.8416	7.6734	0.28471	0.2917:0.0:0.7083:0.0	.	268;214;222;259;260;76	Q93038-11;Q93038-9;Q93038-10;Q93038;Q93038-2;Q93038-8	.;.;.;TNR25_HUMAN;.;.	Y	259;268;222;76;214	ENSP00000349341:H259Y;ENSP00000367013:H268Y;ENSP00000337713:H222Y;ENSP00000326762:H76Y;ENSP00000314451:H214Y	ENSP00000314451:H214Y	H	-	1	0	TNFRSF25	6444791	0.116000	0.22171	0.003000	0.11579	0.075000	0.17131	0.987000	0.29603	0.563000	0.29222	0.655000	0.94253	CAC	.		0.637	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002259.1	NM_148965	
TRIM71	131405	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	32915309	32915309	+	Splice_Site	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:32915309G>A	ENST00000383763.5	+	2	915		c.e2-1			NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase						fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTTGTCCCCAGGTGCTGCACC	0.592																																					.		.											.	TRIM71	92	0			c.853-1G>A						.						301.0	312.0	308.0					3																	32915309		2116	4231	6347	SO:0001630	splice_region_variant	131405	exon2			TCCCCAGGTGCTG		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.853-1G>A	3.37:g.32915309G>A		Somatic	299.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	32.0	NM_001039111		Splice_Site	SNP	ENST00000383763.5	37	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606327	0.87157	.	.	ENSG00000206557	ENST00000383763	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3848	0.90463	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRIM71	32890313	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.751000	0.98889	2.769000	0.95229	0.655000	0.94253	.	.		0.592	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	Intron
TRMT10C	54931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	101283884	101283884	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr3:101283884G>A	ENST00000309922.6	+	2	413	c.259G>A	c.(259-261)Gat>Aat	p.D87N		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	87					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										AAGCAGTAAGGATGAAGATCC	0.438																																					p.D87N		.											.	.	.	0			c.G259A						.						117.0	108.0	111.0					3																	101283884		1907	4127	6034	SO:0001583	missense	54931	exon2			AGTAAGGATGAAG	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.259G>A	3.37:g.101283884G>A	ENSP00000312356:p.Asp87Asn	Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	44.0	NM_017819	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	ENST00000309922.6	37	CCDS43122.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.673703	0.29693	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.54866	0.55;0.55	5.45	5.45	0.79879	.	0.854822	0.10779	N	0.635072	T	0.54598	0.1868	L	0.57536	1.79	0.32643	N	0.520404	B	0.27559	0.181	B	0.20767	0.031	T	0.57768	-0.7754	10	0.39692	T	0.17	-2.6616	20.1745	0.98175	0.0:0.0:1.0:0.0	.	87	Q7L0Y3	MRRP1_HUMAN	N	87	ENSP00000312356:D87N;ENSP00000419389:D87N	ENSP00000312356:D87N	D	+	1	0	RG9MTD1	102766574	1.000000	0.71417	0.943000	0.38184	0.644000	0.38419	3.148000	0.50647	2.941000	0.99782	0.655000	0.94253	GAT	.		0.438	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819	
TRPV4	59341	ucsc.edu;bcgsc.ca	37	12	110234363	110234363	+	Silent	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr12:110234363C>T	ENST00000418703.2	-	6	1393	c.1299G>A	c.(1297-1299)gtG>gtA	p.V433V	TRPV4_ENST00000261740.2_Silent_p.V433V|TRPV4_ENST00000536838.1_Silent_p.V399V|TRPV4_ENST00000346520.2_Intron|TRPV4_ENST00000544971.1_Intron|TRPV4_ENST00000537083.1_Intron|TRPV4_ENST00000392719.2_Silent_p.V386V|TRPV4_ENST00000541794.1_Silent_p.V386V	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	433					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						GGATCTCCAGCACGGAGGCCT	0.622																																					p.V433V		.											.	TRPV4	94	0			c.G1299A						.						110.0	91.0	97.0					12																	110234363		2203	4300	6503	SO:0001819	synonymous_variant	59341	exon7			CTCCAGCACGGAG	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.1299G>A	12.37:g.110234363C>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_021625	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Silent	SNP	ENST00000418703.2	37	CCDS9134.1																																																																																			.		0.622	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625	
TRPV5	56302	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	142612521	142612521	+	Silent	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr7:142612521G>A	ENST00000265310.1	-	10	1590	c.1242C>T	c.(1240-1242)cgC>cgT	p.R414R		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	414					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					TTCCAAAATAGCGAGAGGCAC	0.507																																					p.R414R		.											.	TRPV5	177	0			c.C1242T						.						145.0	140.0	142.0					7																	142612521		2203	4300	6503	SO:0001819	synonymous_variant	56302	exon10			AAAATAGCGAGAG	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1242C>T	7.37:g.142612521G>A		Somatic	189.0	2.0		WXS	Illumina HiSeq	Phase_I	111.0	39.0	NM_019841	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	ENST00000265310.1	37	CCDS5875.1																																																																																			.		0.507	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	
TSHZ3	57616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	31768122	31768122	+	Silent	SNP	C	C	T	rs147790864	byFrequency	TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:31768122C>T	ENST00000240587.4	-	2	2904	c.2577G>A	c.(2575-2577)acG>acA	p.T859T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	859					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					AGGATTTTGACGTGTGGCTCT	0.537													C|||	13	0.00259585	0.0	0.0	5008	,	,		19730	0.001		0.008	False		,,,				2504	0.0041				p.T859T		.											.	TSHZ3	232	0			c.G2577A						.	C		3,4403	6.2+/-15.9	0,3,2200	128.0	122.0	124.0		2577	4.1	1.0	19	dbSNP_134	124	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous	TSHZ3	NM_020856.2		0,15,6488	TT,TC,CC		0.1395,0.0681,0.1153		859/1082	31768122	15,12991	2203	4300	6503	SO:0001819	synonymous_variant	57616	exon2			TTTTGACGTGTGG	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2577G>A	19.37:g.31768122C>T		Somatic	165.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	34.0	NM_020856	Q9H0G6|Q9P254	Silent	SNP	ENST00000240587.4	37	CCDS12421.2																																																																																			C|0.998;T|0.002		0.537	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	49939462	49939462	+	Silent	SNP	G	G	T	rs372273417	byFrequency	TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:49939462G>T	ENST00000325239.5	+	8	1464	c.1437G>T	c.(1435-1437)ggG>ggT	p.G479G	WDFY4_ENST00000360890.2_Silent_p.G479G|WDFY4_ENST00000413659.2_Silent_p.G479G	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	479						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGAGCCCTGGGCCATCCTGCA	0.602																																					p.G479G		.											.	WDFY4	22	0			c.G1437T						.						57.0	56.0	56.0					10																	49939462		692	1591	2283	SO:0001819	synonymous_variant	57705	exon9			CCCTGGGCCATCC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.1437G>T	10.37:g.49939462G>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	12.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1																																																																																			.		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
CFAP46	54777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134751175	134751175	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr10:134751175G>T	ENST00000368586.5	-	6	641	c.541C>A	c.(541-543)Ctt>Att	p.L181I	TTC40_ENST00000368585.3_Missense_Mutation_p.L181I|TTC40_ENST00000368582.2_Missense_Mutation_p.L181I	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CACTCCAGAAGTTCCCTGGAT	0.448																																					p.L181I		.											.	.	.	0			c.C541A						.						95.0	102.0	100.0					10																	134751175		2203	4300	6503	SO:0001583	missense	54777	exon6			CCAGAAGTTCCCT																												ENST00000368586.5:c.541C>A	10.37:g.134751175G>T	ENSP00000357575:p.Leu181Ile	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	30.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510690	0.64522	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	D;D;D	0.82619	-1.63;-1.63;-1.63	4.74	4.74	0.60224	.	0.204737	0.30556	N	0.009374	D	0.90215	0.6941	M	0.80183	2.485	0.29567	N	0.850207	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	D	0.86489	0.1796	10	0.87932	D	0	.	11.2452	0.48993	0.091:0.0:0.909:0.0	.	181;181	Q5SR76-2;Q5SR76-1	.;.	I	181	ENSP00000357575:L181I;ENSP00000357571:L181I;ENSP00000357574:L181I	ENSP00000357571:L181I	L	-	1	0	C10orf93	134601165	1.000000	0.71417	0.991000	0.47740	0.753000	0.42808	2.650000	0.46665	2.336000	0.79503	0.650000	0.86243	CTT	.		0.448	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
YWHAZ	7534	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	101960838	101960838	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr8:101960838A>T	ENST00000395957.2	-	3	621	c.280T>A	c.(280-282)Tgc>Agc	p.C94S	YWHAZ_ENST00000395953.2_Missense_Mutation_p.C94S|YWHAZ_ENST00000457309.1_Missense_Mutation_p.C94S|YWHAZ_ENST00000522542.1_5'Flank|YWHAZ_ENST00000521309.1_Intron|YWHAZ_ENST00000395958.2_Missense_Mutation_p.C94S|YWHAZ_ENST00000419477.2_Missense_Mutation_p.C94S|YWHAZ_ENST00000395956.3_Missense_Mutation_p.C94S|YWHAZ_ENST00000395951.3_Missense_Mutation_p.C94S|YWHAZ_ENST00000395948.2_Missense_Mutation_p.C17S|YWHAZ_ENST00000353245.3_Missense_Mutation_p.C94S			P63104	1433Z_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta	94					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|gene expression (GO:0010467)|histamine secretion by mast cell (GO:0002553)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|platelet activation (GO:0030168)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting to mitochondrion (GO:0006626)|response to drug (GO:0042493)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mast cell granule (GO:0042629)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			large_intestine(1)|lung(2)	3	all_cancers(14;7.43e-06)|all_epithelial(15;2.77e-08)|Lung NSC(17;6.08e-05)|all_lung(17;0.000197)		Epithelial(11;2.79e-11)|all cancers(13;5.45e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.75e-05)			ACATCATTGCAGATATCTCTT	0.393																																					p.C94S		.											.	YWHAZ	658	0			c.T280A						.						297.0	311.0	306.0					8																	101960838		2203	4300	6503	SO:0001583	missense	7534	exon2			CATTGCAGATATC	U28964	CCDS6290.1	8q22.3	2013-12-03	2013-12-03		ENSG00000164924	ENSG00000164924			12855	protein-coding gene	gene with protein product	"""14-3-3 zeta"", ""14-3-3 delta"""	601288	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, delta polypeptide"", ""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide"""	YWHAD		8617504, 7890696	Standard	NM_003406		Approved	KCIP-1, 14-3-3-zeta	uc010mbr.2	P63104	OTTHUMG00000134291	ENST00000395957.2:c.280T>A	8.37:g.101960838A>T	ENSP00000379287:p.Cys94Ser	Somatic	286.0	0.0		WXS	Illumina HiSeq	Phase_I	158.0	12.0	NM_145690	A8K1N0|B7Z465|P29213|P29312|Q32P43|Q5XJ08|Q6GPI2|Q6IN74|Q6NUR9|Q6P3U9|Q86V33	Missense_Mutation	SNP	ENST00000395957.2	37	CCDS6290.1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.881205	0.91740	.	.	ENSG00000164924	ENST00000395957;ENST00000457309;ENST00000395958;ENST00000395956;ENST00000353245;ENST00000517797;ENST00000395953;ENST00000395948;ENST00000395951;ENST00000419477;ENST00000521607;ENST00000521328;ENST00000418997	T;T;T;T;T;T;T;T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07;-0.07	5.68	5.68	0.88126	14-3-3 domain (4);	0.144262	0.49305	D	0.000147	D	0.83422	0.5251	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.87247	0.2270	10	0.72032	D	0.01	.	15.9332	0.79683	1.0:0.0:0.0:0.0	.	94;94	D0PNI1;P63104	.;1433Z_HUMAN	S	94;94;94;94;94;17;94;17;94;94;94;94;94	ENSP00000379287:C94S;ENSP00000398599:C94S;ENSP00000379288:C94S;ENSP00000379286:C94S;ENSP00000309503:C94S;ENSP00000379283:C94S;ENSP00000379278:C17S;ENSP00000379281:C94S;ENSP00000395114:C94S;ENSP00000430058:C94S;ENSP00000429041:C94S;ENSP00000416551:C94S	ENSP00000309503:C94S	C	-	1	0	YWHAZ	102030014	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.172000	0.68678	0.533000	0.62120	TGC	.		0.393	YWHAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259017.2	NM_145690	
ZBTB7B	51043	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	154988092	154988092	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:154988092G>A	ENST00000368426.3	+	3	1093	c.956G>A	c.(955-957)aGc>aAc	p.S319N	ZBTB7B_ENST00000417934.2_Missense_Mutation_p.S353N|ZBTB7B_ENST00000292176.2_Missense_Mutation_p.S319N|ZBTB7B_ENST00000535420.1_Missense_Mutation_p.S319N	NM_001256455.1	NP_001243384.1	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	319					cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)	29	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCCTACCTAAGCTCCCTGCAC	0.657																																					p.S353N		.											.	ZBTB7B	90	0			c.G1058A						.						44.0	43.0	43.0					1																	154988092		2203	4300	6503	SO:0001583	missense	51043	exon4			ACCTAAGCTCCCT	AF007833	CCDS1081.1, CCDS58030.1	1q21.2	2013-01-08		2005-04-07	ENSG00000160685	ENSG00000160685		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18668	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 15"""	607646	"""zinc finger protein 67 homolog (mouse)"""	ZFP67		9370309, 7937772	Standard	NR_045515		Approved	ZBTB15, c-Krox, hcKrox, ZNF857B	uc010peq.3	O15156	OTTHUMG00000037414	ENST00000368426.3:c.956G>A	1.37:g.154988092G>A	ENSP00000357411:p.Ser319Asn	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	16.0	NM_001252406	B4E3K5|D3DV83|J3KQQ3|Q68DR2|Q96EP2	Missense_Mutation	SNP	ENST00000368426.3	37	CCDS1081.1	.	.	.	.	.	.	.	.	.	.	g	14.18	2.459273	0.43634	.	.	ENSG00000160685	ENST00000535420;ENST00000368426;ENST00000417934;ENST00000292176	T;T;T;T	0.10477	2.89;2.89;2.87;2.89	4.08	4.08	0.47627	.	0.187911	0.30969	N	0.008506	T	0.02119	0.0066	N	0.14661	0.345	0.28989	N	0.888149	B;B;B	0.21225	0.053;0.053;0.053	B;B;B	0.17722	0.019;0.01;0.019	T	0.38286	-0.9668	10	0.44086	T	0.13	.	7.6015	0.28079	0.115:0.0:0.885:0.0	.	319;319;353	A8K6F4;O15156;B4E3K5	.;ZBT7B_HUMAN;.	N	319;319;353;319	ENSP00000438647:S319N;ENSP00000357411:S319N;ENSP00000406286:S353N;ENSP00000292176:S319N	ENSP00000292176:S319N	S	+	2	0	ZBTB7B	153254716	0.953000	0.32496	0.988000	0.46212	0.972000	0.66771	2.260000	0.43267	2.109000	0.64355	0.462000	0.41574	AGC	.		0.657	ZBTB7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091083.1	NM_015872	
ZNF236	7776	ucsc.edu;bcgsc.ca	37	18	74637445	74637445	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr18:74637445A>G	ENST00000253159.8	+	22	4154	c.3956A>G	c.(3955-3957)cAg>cGg	p.Q1319R	ZNF236_ENST00000320610.9_Missense_Mutation_p.Q1321R	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	1319					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CTAACAGGACAGTTTGATCAG	0.512																																					p.Q1319R		.											.	ZNF236	94	0			c.A3956G						.						67.0	67.0	67.0					18																	74637445		2008	4170	6178	SO:0001583	missense	7776	exon22			CAGGACAGTTTGA	AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.3956A>G	18.37:g.74637445A>G	ENSP00000253159:p.Gln1319Arg	Somatic	85.0	0.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_007345	B2RTX9|Q9UL37	Missense_Mutation	SNP	ENST00000253159.8	37	CCDS42447.1	.	.	.	.	.	.	.	.	.	.	A	19.73	3.881173	0.72294	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.11930	2.73;2.97	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	T	0.24812	0.0602	L	0.32530	0.975	0.53688	D	0.999975	D	0.63880	0.993	D	0.70227	0.968	T	0.01670	-1.1299	10	0.31617	T	0.26	.	14.4249	0.67207	1.0:0.0:0.0:0.0	.	1319	Q9UL36	ZN236_HUMAN	R	1319	ENSP00000253159:Q1319R;ENSP00000444524:Q1319R	ENSP00000253159:Q1319R	Q	+	2	0	ZNF236	72766433	1.000000	0.71417	0.381000	0.26106	0.624000	0.37722	6.892000	0.75644	1.863000	0.54032	0.455000	0.32223	CAG	.		0.512	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000445776.1		
ZNF560	147741	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	9580387	9580387	+	Splice_Site	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:9580387C>T	ENST00000301480.4	-	8	662		c.e8-1			NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						AGCTGGTAACCTGTACACAGG	0.448																																					.		.											.	ZNF560	158	0			c.449-1G>A						.						101.0	89.0	93.0					19																	9580387		2203	4300	6503	SO:0001630	splice_region_variant	147741	exon9			GGTAACCTGTACA	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.449-1G>A	19.37:g.9580387C>T		Somatic	167.0	1.0		WXS	Illumina HiSeq	Phase_I	78.0	9.0	NM_152476	Q495S9|Q495T1	Splice_Site	SNP	ENST00000301480.4	37	CCDS12214.1	.	.	.	.	.	.	.	.	.	.	C	7.555	0.663430	0.14710	.	.	ENSG00000198028	ENST00000301480	.	.	.	2.43	0.779	0.18550	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.99998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9883	0.14202	0.0:0.7516:0.0:0.2484	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF560	9441387	0.000000	0.05858	0.000000	0.03702	0.204000	0.24138	-0.149000	0.10204	0.076000	0.16826	0.462000	0.41574	.	.		0.448	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	Intron
ZNF432	9668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52538685	52538685	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr19:52538685C>T	ENST00000594154.1	-	5	459	c.247G>A	c.(247-249)Gaa>Aaa	p.E83K	ZNF432_ENST00000221315.5_Missense_Mutation_p.E83K			O94892	ZN432_HUMAN	zinc finger protein 432	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		TCATCAACTTCGTTGTTTTCT	0.343																																					p.E83K		.											.	ZNF432	154	0			c.G247A						.						58.0	56.0	57.0					19																	52538685		2202	4300	6502	SO:0001583	missense	9668	exon5			CAACTTCGTTGTT	AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.247G>A	19.37:g.52538685C>T	ENSP00000470488:p.Glu83Lys	Somatic	246.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	61.0	NM_014650		Missense_Mutation	SNP	ENST00000594154.1	37	CCDS12848.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.015319	0.00042	.	.	ENSG00000256087	ENST00000221315	T	0.05258	3.47	3.32	1.14	0.20703	.	.	.	.	.	T	0.02156	0.0067	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46638	-0.9177	9	0.02654	T	1	.	4.1709	0.10329	0.0:0.2106:0.1774:0.612	.	83	O94892	ZN432_HUMAN	K	83	ENSP00000221315:E83K	ENSP00000221315:E83K	E	-	1	0	ZNF432	57230497	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.266000	0.18534	-0.095000	0.12351	-0.332000	0.08345	GAA	.		0.343	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462410.1	NM_014650	
AP1G1	164	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	71823203	71823204	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr16:71823203_71823204GC>AA	ENST00000299980.4	-	2	620_621	c.179_180GC>TT	c.(178-180)gGC>gTT	p.G60V	AP1G1_ENST00000433195.2_Missense_Mutation_p.G83V|AP1G1_ENST00000423132.2_Missense_Mutation_p.G60V|AP1G1_ENST00000569748.1_Missense_Mutation_p.G60V|AP1G1_ENST00000570297.1_5'Flank|AP1G1_ENST00000393512.3_Missense_Mutation_p.G60V	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	60					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				GAGCAGGGTAGCCCAGCATGTG	0.45																																					p.G83V		.											.	.	.	0			.						.																																			SO:0001583	missense	164	.			AGGGTAGCCCAGC	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.179_180delinsAA	16.37:g.71823203_71823204delinsAA	ENSP00000299980:p.Gly60Val	Somatic	169.0	0.0		WXS	Illumina HiSeq	Phase_I	111.0	52.0	.	O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	DNP	ENST00000299980.4	37	CCDS32480.1																																																																																			.		0.450	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434147.1		
OR2B11	127623	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247615107	247615108	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-A115-01A-11D-A12Z-10	TCGA-DD-A115-10A-01D-A12Z-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	29d6950d-f63e-48ca-afb5-cdd95aa16f0e	97ef9891-4c64-4f64-b1be-59895971138d	g.chr1:247615107_247615108GG>TT	ENST00000318749.6	-	1	200_201	c.177_178CC>AA	c.(175-180)ctCCac>ctAAac	p.H60N		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			ATGGGGCTGTGGAGTTGAGGAT	0.579																																					p.H60N		.											.	.	.	0			.						.																																			SO:0001583	missense	127623	.			GGCTGTGGAGTTG		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.177_178delinsTT	1.37:g.247615107_247615108delinsTT	ENSP00000325682:p.His60Asn	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	34.0	.	B2RP03	Missense_Mutation	DNP	ENST00000318749.6	37	CCDS31090.1																																																																																			.		0.579	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
