#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCA13	154664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48467402	48467402	+	Missense_Mutation	SNP	C	C	T	rs547117792		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:48467402C>T	ENST00000435803.1	+	42	12523	c.12499C>T	c.(12499-12501)Cac>Tac	p.H4167Y		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4167					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CAAGAAATCTCACATTGCCCT	0.423																																					p.H4167Y		.											.	ABCA13	521	0			c.C12499T						.						59.0	56.0	57.0					7																	48467402		1866	4123	5989	SO:0001583	missense	154664	exon42			AAATCTCACATTG	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12499C>T	7.37:g.48467402C>T	ENSP00000411096:p.His4167Tyr	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	52.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	0.291	-0.979834	0.02197	.	.	ENSG00000179869	ENST00000435803	D	0.86297	-2.1	4.74	0.727	0.18254	.	0.603419	0.14587	N	0.310535	T	0.62441	0.2428	N	0.02011	-0.69	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.53180	-0.8475	10	0.05436	T	0.98	.	8.5673	0.33547	0.0:0.2977:0.5957:0.1066	.	1869;4167	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	Y	4167	ENSP00000411096:H4167Y	ENSP00000411096:H4167Y	H	+	1	0	ABCA13	48437948	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.394000	0.07296	0.017000	0.15025	-0.150000	0.13652	CAC	.		0.423	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ACLY	47	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	40024989	40024989	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:40024989C>T	ENST00000352035.2	-	28	3314	c.3184G>A	c.(3184-3186)Gtg>Atg	p.V1062M	ACLY_ENST00000537919.1_Missense_Mutation_p.V791M|ACLY_ENST00000588779.1_5'UTR|ACLY_ENST00000353196.1_Missense_Mutation_p.V1052M|ACLY_ENST00000590151.1_Missense_Mutation_p.V1062M|ACLY_ENST00000393896.2_Missense_Mutation_p.V1052M	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	1062					ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				CTTCCCAGCACAAAGATGCCA	0.448																																					p.V1062M	Colon(64;807 1396 15971 30971)	.											.	ACLY	228	0			c.G3184A						.						171.0	148.0	156.0					17																	40024989		2203	4300	6503	SO:0001583	missense	47	exon28			CCAGCACAAAGAT	X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.3184G>A	17.37:g.40024989C>T	ENSP00000253792:p.Val1062Met	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	19.0	NM_001096	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	ENST00000352035.2	37	CCDS11412.1	.	.	.	.	.	.	.	.	.	.	c	32	5.173660	0.94807	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	D;D;D;D	0.90620	-1.74;-1.74;-2.7;-1.74	5.53	5.53	0.82687	Citrate synthase-like, core (1);	0.059404	0.64402	D	0.000002	D	0.95701	0.8602	M	0.83384	2.64	0.80722	D	1	P;D;D;D;D	0.69078	0.942;0.991;0.991;0.997;0.968	P;P;P;D;P	0.71184	0.776;0.906;0.906;0.972;0.837	D	0.95660	0.8714	10	0.87932	D	0	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	791;1106;1116;1052;1062	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	M	1062;1116;1052;791;1052	ENSP00000253792:V1062M;ENSP00000345398:V1052M;ENSP00000445349:V791M;ENSP00000377474:V1052M	ENSP00000253792:V1062M	V	-	1	0	ACLY	37278515	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.182000	0.77689	2.882000	0.98803	0.655000	0.94253	GTG	.		0.448	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257465.1	NM_001096	
ACTC1	70	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	35085586	35085586	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr15:35085586G>A	ENST00000290378.4	-	3	969	c.314C>T	c.(313-315)aCc>aTc	p.T105I	RP11-814P5.1_ENST00000503496.1_RNA|ACTC1_ENST00000557860.1_5'Flank	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	105					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TGTGAGCAGGGTGGGGTGCTC	0.572																																					p.T105I		.											.	ACTC1	92	0			c.C314T						.						86.0	85.0	86.0					15																	35085586		2201	4298	6499	SO:0001583	missense	70	exon3			AGCAGGGTGGGGT	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.314C>T	15.37:g.35085586G>A	ENSP00000290378:p.Thr105Ile	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	88.0	62.0	NM_005159	P04270	Missense_Mutation	SNP	ENST00000290378.4	37	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118132	0.56505	.	.	ENSG00000159251	ENST00000290378	D	0.93247	-3.19	5.63	5.63	0.86233	.	0.000000	0.53938	U	0.000052	D	0.87537	0.6202	N	0.00092	-2.175	0.80722	D	1	D	0.54772	0.968	D	0.87578	0.998	D	0.94287	0.7525	10	0.87932	D	0	.	20.0442	0.97604	0.0:0.0:1.0:0.0	.	105	P68032	ACTC_HUMAN	I	105	ENSP00000290378:T105I	ENSP00000290378:T105I	T	-	2	0	ACTC1	32872878	1.000000	0.71417	0.988000	0.46212	0.984000	0.73092	8.062000	0.89475	2.814000	0.96858	0.655000	0.94253	ACC	.		0.572	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
ACTN2	88	ucsc.edu;bcgsc.ca	37	1	236906333	236906333	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:236906333T>C	ENST00000366578.4	+	11	1411	c.1245T>C	c.(1243-1245)acT>acC	p.T415T	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Silent_p.T415T|ACTN2_ENST00000546208.1_5'UTR	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	415					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CGCACGAGACTTGGGCTTATG	0.498																																					p.T415T		.											.	ACTN2	95	0			c.T1245C						.						88.0	81.0	83.0					1																	236906333		2203	4300	6503	SO:0001819	synonymous_variant	88	exon11			CGAGACTTGGGCT	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1245T>C	1.37:g.236906333T>C		Somatic	59.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	ENST00000366578.4	37	CCDS1613.1																																																																																			.		0.498	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
ALKBH3	221120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	43923153	43923153	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:43923153A>T	ENST00000302708.4	+	8	958	c.547A>T	c.(547-549)Aat>Tat	p.N183Y	ALKBH3_ENST00000532410.1_Intron	NM_139178.3	NP_631917.1	Q96Q83	ALKB3_HUMAN	alkB, alkylation repair homolog 3 (E. coli)	183	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)|oxidative single-stranded DNA demethylation (GO:0035552)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)			endometrium(2)|kidney(1)|lung(4)|prostate(1)	8					Vitamin C(DB00126)	TCTTTATCGCAATGAGAAGGA	0.502								Direct reversal of damage																													p.N183Y		.											.	ALKBH3	90	0			c.A547T						.						170.0	140.0	150.0					11																	43923153		2203	4300	6503	SO:0001583	missense	221120	exon8			TATCGCAATGAGA	AB042029	CCDS7906.1	11p11.2	2013-10-11			ENSG00000166199	ENSG00000166199		"""Alkylation repair homologs"""	30141	protein-coding gene	gene with protein product		610603				22055184	Standard	NM_139178		Approved	DEPC-1	uc001mxs.2	Q96Q83	OTTHUMG00000166417	ENST00000302708.4:c.547A>T	11.37:g.43923153A>T	ENSP00000302232:p.Asn183Tyr	Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	26.0	NM_139178	A6NDJ1|Q3SYI0|Q6NX57|Q96BU8	Missense_Mutation	SNP	ENST00000302708.4	37	CCDS7906.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.85|16.85	3.237268|3.237268	0.58886|0.58886	.|.	.|.	ENSG00000166199|ENSG00000166199	ENST00000302708;ENST00000529366|ENST00000532129	T;T|.	0.14516|.	2.5;2.5|.	5.67|5.67	1.56|1.56	0.23342|0.23342	Oxoglutarate/iron-dependent oxygenase (2);|.	0.190738|.	0.56097|.	D|.	0.000039|.	T|T	0.53786|0.53786	0.1818|0.1818	M|M	0.80847|0.80847	2.515|2.515	0.24941|0.24941	N|N	0.991851|0.991851	P|.	0.46064|.	0.872|.	P|.	0.56514|.	0.8|.	T|T	0.48681|0.48681	-0.9014|-0.9014	10|5	0.72032|.	D|.	0.01|.	-5.7296|-5.7296	5.0171|5.0171	0.14343|0.14343	0.5765:0.145:0.2785:0.0|0.5765:0.145:0.2785:0.0	.|.	183|.	Q96Q83|.	ALKB3_HUMAN|.	Y|L	183;182|52	ENSP00000302232:N183Y;ENSP00000435848:N182Y|.	ENSP00000302232:N183Y|.	N|Q	+|+	1|2	0|0	ALKBH3|ALKBH3	43879729|43879729	0.906000|0.906000	0.30813|0.30813	0.003000|0.003000	0.11579|0.11579	0.900000|0.900000	0.52787|0.52787	1.880000|1.880000	0.39628|0.39628	0.012000|0.012000	0.14892|0.14892	0.533000|0.533000	0.62120|0.62120	AAT|CAA	.		0.502	ALKBH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389693.1	NM_139178	
ALKBH4	54784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102100057	102100057	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:102100057C>A	ENST00000292566.3	-	2	354	c.315G>T	c.(313-315)agG>agT	p.R105S		NM_017621.3	NP_060091.1	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4 (E. coli)	105					actomyosin structure organization (GO:0031032)|cleavage furrow ingression (GO:0036090)|protein demethylation (GO:0006482)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	contractile ring (GO:0070938)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	actin binding (GO:0003779)|demethylase activity (GO:0032451)|metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			kidney(1)|lung(5)|skin(2)	8						CTACCTGCTTCCTCCGTCCAG	0.642																																					p.R105S		.											.	ALKBH4	90	0			c.G315T						.						94.0	88.0	90.0					7																	102100057		2203	4300	6503	SO:0001583	missense	54784	exon2			CTGCTTCCTCCGT	BC017096	CCDS5723.1	7q22.1	2006-02-09			ENSG00000160993	ENSG00000160993		"""Alkylation repair homologs"""	21900	protein-coding gene	gene with protein product		613302					Standard	NM_017621		Approved	FLJ20013	uc003uzl.3	Q9NXW9	OTTHUMG00000157720	ENST00000292566.3:c.315G>T	7.37:g.102100057C>A	ENSP00000292566:p.Arg105Ser	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	12.0	NM_017621	Q53H92|Q9H6A4	Missense_Mutation	SNP	ENST00000292566.3	37	CCDS5723.1	.	.	.	.	.	.	.	.	.	.	C	15.42	2.827971	0.50845	.	.	ENSG00000160993	ENST00000292566	T	0.40756	1.02	4.51	2.7	0.31948	.	0.098436	0.64402	D	0.000002	T	0.46889	0.1416	M	0.86740	2.835	0.53688	D	0.999979	P	0.51653	0.947	B	0.41723	0.365	T	0.54057	-0.8350	10	0.72032	D	0.01	-18.5777	9.7796	0.40640	0.0:0.8308:0.0:0.1692	.	105	Q9NXW9	ALKB4_HUMAN	S	105	ENSP00000292566:R105S	ENSP00000292566:R105S	R	-	3	2	ALKBH4	101887062	1.000000	0.71417	0.997000	0.53966	0.721000	0.41392	2.531000	0.45650	0.355000	0.24131	-0.258000	0.10820	AGG	.		0.642	ALKBH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349503.1	NM_017621	
AMPD1	270	ucsc.edu;bcgsc.ca	37	1	115218550	115218550	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:115218550T>C	ENST00000520113.2	-	11	1577	c.1562A>G	c.(1561-1563)gAg>gGg	p.E521G	AMPD1_ENST00000353928.6_Missense_Mutation_p.E488G|AMPD1_ENST00000369538.3_Missense_Mutation_p.E517G			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	521					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	GATGGTGGCCTCAAACACTGG	0.458																																					p.E521G		.											.	AMPD1	293	0			c.A1562G						.						150.0	149.0	149.0					1																	115218550		2203	4300	6503	SO:0001583	missense	270	exon11			GTGGCCTCAAACA	M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1562A>G	1.37:g.115218550T>C	ENSP00000430075:p.Glu521Gly	Somatic	42.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_000036	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	ENST00000520113.2	37	CCDS876.2	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689763	0.88735	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.85339	-1.97;-1.97;-1.97	5.58	5.58	0.84498	Adenosine/AMP deaminase (1);	0.139892	0.64402	D	0.000004	D	0.90239	0.6948	M	0.93808	3.46	0.80722	D	1	P;P	0.51147	0.942;0.911	B;P	0.50192	0.4;0.634	D	0.92754	0.6218	10	0.87932	D	0	-24.0057	15.7564	0.78030	0.0:0.0:0.0:1.0	.	517;488	Q5TF02;P23109	.;AMPD1_HUMAN	G	521;517;488	ENSP00000430075:E521G;ENSP00000358551:E517G;ENSP00000316520:E488G	ENSP00000316520:E488G	E	-	2	0	AMPD1	115020073	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.040000	0.89188	2.122000	0.65172	0.459000	0.35465	GAG	.		0.458	AMPD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032860.4		
ANKRD12	23253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	9255525	9255525	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr18:9255525A>T	ENST00000262126.4	+	9	2500	c.2260A>T	c.(2260-2262)Att>Ttt	p.I754F	ANKRD12_ENST00000400020.3_Missense_Mutation_p.I731F|ANKRD12_ENST00000383440.2_Missense_Mutation_p.I731F	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	754						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						ACGAGACAAGATTAAAAAGGA	0.308																																					p.I754F		.											.	ANKRD12	92	0			c.A2260T						.						49.0	51.0	50.0					18																	9255525		2200	4291	6491	SO:0001583	missense	23253	exon9			GACAAGATTAAAA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2260A>T	18.37:g.9255525A>T	ENSP00000262126:p.Ile754Phe	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	11.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	37	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	0.090	-1.169146	0.01660	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000400020	T;T	0.44083	0.93;0.93	5.1	-1.93	0.07594	.	0.624489	0.15199	N	0.275134	T	0.18841	0.0452	N	0.08118	0	0.20821	N	0.999844	B;B;B	0.24882	0.113;0.091;0.028	B;B;B	0.28232	0.034;0.087;0.015	T	0.14783	-1.0460	10	0.56958	D	0.05	-30.356	4.1483	0.10225	0.5513:0.0:0.2181:0.2306	.	381;731;754	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	F	731;754;49	ENSP00000372932:I731F;ENSP00000262126:I754F	ENSP00000262126:I754F	I	+	1	0	ANKRD12	9245525	0.020000	0.18652	0.829000	0.32907	0.680000	0.39746	0.404000	0.20999	-0.230000	0.09840	-0.756000	0.03474	ATT	.		0.308	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
ANKRD34A	284615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	145474731	145474731	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:145474731T>A	ENST00000323397.4	+	4	2696	c.1403T>A	c.(1402-1404)tTg>tAg	p.L468*	RP11-315I20.1_ENST00000600340.1_RNA|LIX1L_ENST00000369308.3_5'Flank	NM_001039888.2	NP_001034977.1	Q69YU3	AN34A_HUMAN	ankyrin repeat domain 34A	468						cytoplasm (GO:0005737)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	20	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AAGCGCAAATTGGTGAGACGC	0.662																																					p.L468X		.											.	ANKRD34A	68	0			c.T1403A						.						21.0	24.0	23.0					1																	145474731		2203	4300	6503	SO:0001587	stop_gained	284615	exon4			GCAAATTGGTGAG	AK128050	CCDS72874.1	1q21.1	2013-01-10	2007-11-20	2007-11-20	ENSG00000181039	ENSG00000272031		"""Ankyrin repeat domain containing"""	27639	protein-coding gene	gene with protein product			"""ankyrin repeat domain 34"""	ANKRD34			Standard	NM_001039888		Approved		uc001enq.1	Q69YU3	OTTHUMG00000013740	ENST00000323397.4:c.1403T>A	1.37:g.145474731T>A	ENSP00000314103:p.Leu468*	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	16.0	NM_001039888	B3KSU3	Nonsense_Mutation	SNP	ENST00000323397.4	37	CCDS30829.1	.	.	.	.	.	.	.	.	.	.	T	48	14.271858	0.99787	.	.	ENSG00000181039	ENST00000323397	.	.	.	5.22	5.22	0.72569	.	0.099140	0.31031	N	0.008393	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1908	13.1433	0.59446	0.0:0.0:0.0:1.0	.	.	.	.	X	468	.	ENSP00000314103:L468X	L	+	2	0	ANKRD34A	144186088	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.633000	0.61318	2.190000	0.69967	0.529000	0.55759	TTG	.		0.662	ANKRD34A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038512.1		
ANKRD52	283373	ucsc.edu;bcgsc.ca	37	12	56648360	56648360	+	Splice_Site	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:56648360A>G	ENST00000267116.7	-	7	815		c.e7+1			NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52											endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						CAAAGCCCTGACCTCCGCTCC	0.537																																					.		.											.	ANKRD52	70	0			c.693+2T>C						.						41.0	42.0	41.0					12																	56648360		1974	4159	6133	SO:0001630	splice_region_variant	283373	exon8			GCCCTGACCTCCG	AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.693+1T>C	12.37:g.56648360A>G		Somatic	61.0	0.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_173595	A6NE79|B1Q2K2	Splice_Site	SNP	ENST00000267116.7	37	CCDS44920.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.766128	0.49574	.	.	ENSG00000139645	ENST00000267116;ENST00000417002	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9306	0.35668	0.9126:0.0:0.0874:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD52	54934627	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	7.021000	0.76425	2.172000	0.68678	0.533000	0.62120	.	.		0.537	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595	Intron
ARHGAP31	57514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	119087231	119087231	+	Silent	SNP	C	C	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:119087231C>G	ENST00000264245.4	+	3	748	c.216C>G	c.(214-216)ggC>ggG	p.G72G		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	72	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AAGAGTTTGGCTCAGATCAAT	0.522																																					p.G72G	Pancreas(7;176 297 5394 51128 51241)	.											.	ARHGAP31	92	0			c.C216G						.						129.0	122.0	124.0					3																	119087231		1967	4160	6127	SO:0001819	synonymous_variant	57514	exon3			GTTTGGCTCAGAT		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.216C>G	3.37:g.119087231C>G		Somatic	86.0	0.0		WXS	Illumina HiSeq	Phase_I	86.0	57.0	NM_020754	Q9ULL6	Silent	SNP	ENST00000264245.4	37	CCDS43135.1																																																																																			.		0.522	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
ARMC3	219681	ucsc.edu;bcgsc.ca	37	10	23326201	23326201	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:23326201T>C	ENST00000298032.5	+	19	2496	c.2412T>C	c.(2410-2412)gcT>gcC	p.A804A	ARMC3_ENST00000409983.3_Silent_p.A797A|ARMC3_ENST00000376528.4_Silent_p.A541A	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	804						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TCCTGCAGGCTCTGGCTGATA	0.498																																					p.A804A		.											.	ARMC3	90	0			c.T2412C						.						92.0	95.0	94.0					10																	23326201		2203	4300	6503	SO:0001819	synonymous_variant	219681	exon19			GCAGGCTCTGGCT	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.2412T>C	10.37:g.23326201T>C		Somatic	108.0	0.0		WXS	Illumina HiSeq	.	51.0	5.0	NM_173081	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Silent	SNP	ENST00000298032.5	37	CCDS7142.1																																																																																			.		0.498	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047197.2	NM_173081	
ASNS	440	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	97481701	97481701	+	Missense_Mutation	SNP	C	C	T	rs568570377		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:97481701C>T	ENST00000394309.3	-	13	2027	c.1556G>A	c.(1555-1557)cGt>cAt	p.R519H	ASNS_ENST00000437628.1_Missense_Mutation_p.R436H|ASNS_ENST00000394308.3_Missense_Mutation_p.R519H|ASNS_ENST00000175506.4_Missense_Mutation_p.R519H|ASNS_ENST00000455086.1_Missense_Mutation_p.R436H|ASNS_ENST00000444334.1_Missense_Mutation_p.R498H|ASNS_ENST00000422745.1_Missense_Mutation_p.R498H	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	519	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	AAAGACTTGACGGTAGTAATA	0.478																																					p.R519H	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	.											.	ASNS	91	0			c.G1556A						.						154.0	148.0	150.0					7																	97481701		2203	4300	6503	SO:0001583	missense	440	exon13			ACTTGACGGTAGT	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1556G>A	7.37:g.97481701C>T	ENSP00000377846:p.Arg519His	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	50.0	NM_133436	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Missense_Mutation	SNP	ENST00000394309.3	37	CCDS5652.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.039046	0.93630	.	.	ENSG00000070669	ENST00000175506;ENST00000394309;ENST00000437628;ENST00000394308;ENST00000422745;ENST00000455086;ENST00000444334	T;T;T;T;T;T;T	0.53640	0.62;0.62;0.61;0.62;0.63;0.61;0.63	5.23	5.23	0.72850	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.75803	0.3899	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.82186	-0.0582	10	0.87932	D	0	-6.9268	16.6738	0.85273	0.0:1.0:0.0:0.0	.	519	P08243	ASNS_HUMAN	H	519;519;436;519;498;436;498	ENSP00000175506:R519H;ENSP00000377846:R519H;ENSP00000414379:R436H;ENSP00000377845:R519H;ENSP00000414901:R498H;ENSP00000408472:R436H;ENSP00000406994:R498H	ENSP00000175506:R519H	R	-	2	0	ASNS	97319637	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	5.580000	0.67464	2.609000	0.88269	0.561000	0.74099	CGT	.		0.478	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
ASPHD1	253982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	29912566	29912566	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:29912566C>T	ENST00000308748.5	+	1	526	c.274C>T	c.(274-276)Ctc>Ttc	p.L92F	SEZ6L2_ENST00000537485.1_5'Flank|SEZ6L2_ENST00000346932.5_5'Flank|SEZ6L2_ENST00000350527.3_5'Flank|ASPHD1_ENST00000483405.1_Intron|SEZ6L2_ENST00000308713.5_5'Flank	NM_181718.3	NP_859069.2	Q5U4P2	ASPH1_HUMAN	aspartate beta-hydroxylase domain containing 1	92					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)	dioxygenase activity (GO:0051213)			endometrium(4)|large_intestine(2)|lung(1)|prostate(1)	8						TTCCCTGTTCCTCTGGTACTG	0.677																																					p.L92F		.											.	ASPHD1	68	0			c.C274T						.						54.0	59.0	57.0					16																	29912566		2196	4299	6495	SO:0001583	missense	253982	exon1			CTGTTCCTCTGGT	AF070642	CCDS10660.1	16p11.2	2008-02-05			ENSG00000174939	ENSG00000174939			27380	protein-coding gene	gene with protein product							Standard	NM_181718		Approved		uc002dut.3	Q5U4P2	OTTHUMG00000132121	ENST00000308748.5:c.274C>T	16.37:g.29912566C>T	ENSP00000311447:p.Leu92Phe	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	22.0	NM_181718	A0AVE3|B7ZLZ3|Q8IW63|Q8N316|Q96H00	Missense_Mutation	SNP	ENST00000308748.5	37	CCDS10660.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102295	0.76983	.	.	ENSG00000174939	ENST00000414952;ENST00000308748	T;T	0.56611	0.45;0.45	4.28	3.33	0.38152	.	0.000000	0.56097	D	0.000026	T	0.43255	0.1239	L	0.44542	1.39	0.44908	D	0.997928	B	0.17038	0.02	B	0.17433	0.018	T	0.42999	-0.9418	10	0.72032	D	0.01	-15.8544	9.5322	0.39200	0.0:0.8982:0.0:0.1018	.	92	Q5U4P2	ASPH1_HUMAN	F	92	ENSP00000388036:L92F;ENSP00000311447:L92F	ENSP00000311447:L92F	L	+	1	0	ASPHD1	29820067	0.998000	0.40836	1.000000	0.80357	0.929000	0.56500	1.601000	0.36773	1.151000	0.42436	0.462000	0.41574	CTC	.		0.677	ASPHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255163.2	NM_181718	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96795907	96795907	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:96795907T>G	ENST00000359933.4	-	12	2688	c.1795A>C	c.(1795-1797)Agt>Cgt	p.S599R		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	599					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ATATCAGTACTAAAATATCGG	0.323																																					p.S599R		.											.	ATG2B	93	0			c.A1795C						.						115.0	114.0	114.0					14																	96795907		1813	4074	5887	SO:0001583	missense	55102	exon12			CAGTACTAAAATA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.1795A>C	14.37:g.96795907T>G	ENSP00000353010:p.Ser599Arg	Somatic	166.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	50.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973215	0.74246	.	.	ENSG00000066739	ENST00000359933	T	0.11385	2.78	5.68	4.41	0.53225	.	0.061259	0.64402	U	0.000007	T	0.13586	0.0329	L	0.60455	1.87	0.44117	D	0.996893	P	0.38250	0.624	B	0.37943	0.261	T	0.01528	-1.1332	10	0.62326	D	0.03	.	11.5336	0.50624	0.0:0.0756:0.0:0.9244	.	599	Q96BY7	ATG2B_HUMAN	R	599	ENSP00000353010:S599R	ENSP00000353010:S599R	S	-	1	0	ATG2B	95865660	1.000000	0.71417	0.851000	0.33527	0.868000	0.49771	4.022000	0.57203	0.962000	0.38057	0.482000	0.46254	AGT	.		0.323	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ATP6V0A2	23545	ucsc.edu;bcgsc.ca	37	12	124220107	124220107	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:124220107A>G	ENST00000330342.3	+	8	1009	c.761A>G	c.(760-762)aAc>aGc	p.N254S		NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	254					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		CCCTATCCAAACACAGCCGAG	0.532																																					p.N254S		.											.	ATP6V0A2	92	0			c.A761G						.						99.0	85.0	90.0					12																	124220107		2203	4300	6503	SO:0001583	missense	23545	exon8			ATCCAAACACAGC	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.761A>G	12.37:g.124220107A>G	ENSP00000332247:p.Asn254Ser	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	57.0	5.0	NM_012463	A8K026|Q6NUM0	Missense_Mutation	SNP	ENST00000330342.3	37	CCDS9254.1	.	.	.	.	.	.	.	.	.	.	A	10.71	1.427623	0.25726	.	.	ENSG00000185344	ENST00000330342;ENST00000541854;ENST00000504192	D;D	0.85484	-1.99;-1.99	5.97	-1.46	0.08800	.	0.435282	0.31404	N	0.007705	T	0.64483	0.2602	N	0.05510	-0.035	0.09310	N	0.999999	B;B	0.06786	0.0;0.001	B;B	0.12837	0.001;0.008	T	0.53173	-0.8476	10	0.25751	T	0.34	-13.6945	7.7392	0.28831	0.4245:0.1197:0.4558:0.0	.	254;254	Q9Y487;Q8TBM3	VPP2_HUMAN;.	S	254;254;124	ENSP00000332247:N254S;ENSP00000443441:N124S	ENSP00000332247:N254S	N	+	2	0	ATP6V0A2	122786060	0.000000	0.05858	0.001000	0.08648	0.619000	0.37552	0.294000	0.19047	0.129000	0.18514	0.482000	0.46254	AAC	.		0.532	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
BIRC6	57448	ucsc.edu;bcgsc.ca	37	2	32773060	32773060	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:32773060A>G	ENST00000421745.2	+	64	13088	c.12954A>G	c.(12952-12954)gaA>gaG	p.E4318E		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4318					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TGGAAGAGGAACATGTTACCT	0.368																																					p.E4318E	Pancreas(94;175 1509 16028 18060 45422)	.											.	BIRC6	233	0			c.A12954G						.						72.0	67.0	69.0					2																	32773060		2203	4300	6503	SO:0001819	synonymous_variant	57448	exon64			AGAGGAACATGTT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12954A>G	2.37:g.32773060A>G		Somatic	77.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_016252	Q9ULD1	Silent	SNP	ENST00000421745.2	37	CCDS33175.2																																																																																			.		0.368	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
C12orf40	283461	ucsc.edu;bcgsc.ca	37	12	40040182	40040182	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:40040182C>T	ENST00000324616.5	+	4	408	c.254C>T	c.(253-255)cCc>cTc	p.P85L	C12orf40_ENST00000398716.1_Missense_Mutation_p.P8L|C12orf40_ENST00000405531.3_Missense_Mutation_p.P85L	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	85										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						ATAAAAATGCCCCTAAGAAAG	0.294																																					p.P85L		.											.	C12orf40	96	0			c.C254T						.						117.0	111.0	113.0					12																	40040182		1813	4080	5893	SO:0001583	missense	283461	exon4			AAATGCCCCTAAG	AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.254C>T	12.37:g.40040182C>T	ENSP00000317671:p.Pro85Leu	Somatic	93.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001031748	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	ENST00000324616.5	37	CCDS41770.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.848663	0.51164	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.58506	0.33;0.35	5.35	5.35	0.76521	.	0.149680	0.31709	N	0.007187	T	0.64472	0.2601	L	0.29908	0.895	0.46356	D	0.999009	D	0.89917	1.0	D	0.75020	0.985	T	0.62343	-0.6874	10	0.38643	T	0.18	.	14.9176	0.70810	0.0:1.0:0.0:0.0	.	85	Q86WS4	CL040_HUMAN	L	85;8;85	ENSP00000383897:P85L;ENSP00000317671:P85L	ENSP00000317671:P85L	P	+	2	0	C12orf40	38326449	0.888000	0.30383	0.963000	0.40424	0.156000	0.22039	1.790000	0.38734	2.667000	0.90743	0.650000	0.86243	CCC	.		0.294	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257664.2	NM_173599	
C16orf54	283897	ucsc.edu;bcgsc.ca	37	16	29755768	29755768	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:29755768A>G	ENST00000329410.3	-	2	600	c.505T>C	c.(505-507)Tgg>Cgg	p.W169R	AC009133.17_ENST00000565600.1_RNA	NM_175900.3	NP_787096.2	Q6UWD8	CP054_HUMAN	chromosome 16 open reading frame 54	169						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|lung(2)|prostate(1)|urinary_tract(1)	6						GGTTCAGCCCAGCTCACCAGG	0.726																																					p.W169R		.											.	.	.	0			c.T505C						.						3.0	4.0	4.0					16																	29755768		1957	3974	5931	SO:0001583	missense	283897	exon2			CAGCCCAGCTCAC	AK093000	CCDS10652.1	16p11.2	2012-10-10		2005-08-09	ENSG00000185905	ENSG00000185905			26649	protein-coding gene	gene with protein product						12975309	Standard	NM_175900		Approved	FLJ35681	uc002dtp.2	Q6UWD8	OTTHUMG00000132116	ENST00000329410.3:c.505T>C	16.37:g.29755768A>G	ENSP00000327506:p.Trp169Arg	Somatic	35.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_175900	A6NJR6|Q8NAB0	Missense_Mutation	SNP	ENST00000329410.3	37	CCDS10652.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.154285	0.57259	.	.	ENSG00000185905	ENST00000329410	.	.	.	5.22	5.22	0.72569	.	0.000000	0.39544	U	0.001330	T	0.64907	0.2641	L	0.32530	0.975	0.40767	D	0.983053	D	0.89917	1.0	D	0.91635	0.999	T	0.68164	-0.5481	9	0.59425	D	0.04	-9.7313	11.4916	0.50383	1.0:0.0:0.0:0.0	.	169	Q6UWD8	CP054_HUMAN	R	169	.	ENSP00000327506:W169R	W	-	1	0	C16orf54	29663269	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	4.277000	0.58939	1.971000	0.57363	0.260000	0.18958	TGG	.		0.726	C16orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255158.1	NM_175900	
C1QBP	708	ucsc.edu;bcgsc.ca	37	17	5336663	5336663	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:5336663A>G	ENST00000225698.4	-	5	730	c.649T>C	c.(649-651)Tct>Cct	p.S217P	C1QBP_ENST00000574444.1_Missense_Mutation_p.S113P|CTC-524C5.2_ENST00000575890.1_RNA	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein	217					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	TTCCATTCAGACTCGCCAGTG	0.463																																					p.S217P		.											.	C1QBP	91	0			c.T649C						.						112.0	110.0	110.0					17																	5336663		2203	4300	6503	SO:0001583	missense	708	exon5			ATTCAGACTCGCC	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021		ENST00000225698.4:c.649T>C	17.37:g.5336663A>G	ENSP00000225698:p.Ser217Pro	Somatic	83.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001212	Q2HXR8|Q9NNY8	Missense_Mutation	SNP	ENST00000225698.4	37	CCDS11071.1	.	.	.	.	.	.	.	.	.	.	A	11.03	1.519969	0.27211	.	.	ENSG00000108561	ENST00000225698	.	.	.	5.11	2.91	0.33838	.	0.391362	0.29558	N	0.011802	T	0.48537	0.1505	L	0.56769	1.78	0.09310	N	0.999997	D	0.58620	0.983	P	0.58928	0.848	T	0.35226	-0.9797	9	0.49607	T	0.09	-7.3531	4.2101	0.10507	0.6944:0.0:0.1571:0.1485	.	217	Q07021	C1QBP_HUMAN	P	217	.	ENSP00000225698:S217P	S	-	1	0	C1QBP	5277387	0.017000	0.18338	0.193000	0.23327	0.230000	0.25150	0.551000	0.23361	0.432000	0.26286	0.533000	0.62120	TCT	.		0.463	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439388.1	NM_001212	
C9orf24	84688	ucsc.edu;bcgsc.ca	37	9	34385758	34385758	+	Silent	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:34385758G>T	ENST00000297623.2	-	2	355	c.157C>A	c.(157-159)Cga>Aga	p.R53R		NM_032596.3	NP_115985.2	Q8NCR6	SMRP1_HUMAN	chromosome 9 open reading frame 24	53					cell differentiation (GO:0030154)|cellular protein complex assembly (GO:0043623)|spermatogenesis (GO:0007283)	manchette (GO:0002177)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0107)	GBM - Glioblastoma multiforme(74;0.123)		TCCACATGTCGCTCCATGGTA	0.567																																					p.R53R		.											.	C9orf24	91	0			c.C157A						.						101.0	97.0	98.0					9																	34385758		2203	4300	6503	SO:0001819	synonymous_variant	84688	exon2			CATGTCGCTCCAT	BC029484	CCDS6553.1, CCDS6554.1, CCDS6555.1, CCDS59121.1	9p11.2	2013-01-11			ENSG00000164972	ENSG00000164972			19919	protein-coding gene	gene with protein product	"""ciliated bronchial epithelium 1"", ""spermatid-specific manchette-related protein 1"""					12029067	Standard	NM_147168		Approved	bA573M23.4, NYD-SP22, MGC32921, MGC33614, CBE1, SMRP1	uc003zuh.1	Q8NCR6	OTTHUMG00000000437	ENST00000297623.2:c.157C>A	9.37:g.34385758G>T		Somatic	113.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_032596	Q5T598|Q5T599|Q5T5A0|Q8N9G4|Q96KD1|Q96LN1	Silent	SNP	ENST00000297623.2	37	CCDS6554.1	.	.	.	.	.	.	.	.	.	.	G	0.098	-1.156565	0.01686	.	.	ENSG00000164972	ENST00000444429	.	.	.	5.89	3.93	0.45458	.	.	.	.	.	T	0.40040	0.1101	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.23440	-1.0188	4	.	.	.	-8.2018	10.9801	0.47488	0.0:0.0:0.6602:0.3398	.	.	.	.	E	18	.	.	A	-	2	0	C9orf24	34375758	0.003000	0.15002	0.008000	0.14137	0.069000	0.16628	0.870000	0.28010	1.475000	0.48197	0.655000	0.94253	GCG	.		0.567	C9orf24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001098.3	NM_147169	
C5	727	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	123792742	123792742	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:123792742T>C	ENST00000223642.1	-	7	720	c.691A>G	c.(691-693)Atc>Gtc	p.I231V		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	231					activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TCTGGCTCGATTGAGACAGAA	0.284																																					p.I231V		.											.	C5	92	0			c.A691G						.						18.0	19.0	18.0					9																	123792742		2136	4159	6295	SO:0001583	missense	727	exon7			GCTCGATTGAGAC	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.691A>G	9.37:g.123792742T>C	ENSP00000223642:p.Ile231Val	Somatic	389.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	88.0	NM_001735	Q14CJ0|Q27I61	Missense_Mutation	SNP	ENST00000223642.1	37	CCDS6826.1	.	.	.	.	.	.	.	.	.	.	T	4.450	0.083274	0.08533	.	.	ENSG00000106804	ENST00000223642;ENST00000430906	T	0.30714	1.52	5.75	1.96	0.26148	.	0.162190	0.56097	N	0.000036	T	0.20170	0.0485	L	0.49699	1.58	0.24121	N	0.995801	P;B	0.40144	0.704;0.001	B;B	0.28638	0.092;0.004	T	0.11251	-1.0595	10	0.45353	T	0.12	.	7.5761	0.27937	0.1082:0.1314:0.0:0.7604	.	302;231	Q59GS8;P01031	.;CO5_HUMAN	V	231;302	ENSP00000223642:I231V	ENSP00000223642:I231V	I	-	1	0	C5	122832563	1.000000	0.71417	0.300000	0.25030	0.314000	0.28054	1.333000	0.33816	0.115000	0.18071	-1.139000	0.01908	ATC	.		0.284	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
CALCA	796	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	14990439	14990439	+	Intron	SNP	A	A	T	rs377551213		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:14990439A>T	ENST00000486207.1	-	3	236				CALCA_ENST00000396372.2_Missense_Mutation_p.I111N|CALCB_ENST00000523376.1_Intron|CALCA_ENST00000359642.3_Missense_Mutation_p.I111N|CALCA_ENST00000331587.4_Missense_Mutation_p.I111N|CALCA_ENST00000361010.3_Intron			P06881	CALCA_HUMAN	calcitonin-related polypeptide alpha						activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|cytosolic calcium ion homeostasis (GO:0051480)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor internalization (GO:0002031)|leukocyte cell-cell adhesion (GO:0007159)|negative regulation of blood pressure (GO:0045776)|negative regulation of bone resorption (GO:0045779)|negative regulation of calcium ion transport into cytosol (GO:0010523)|negative regulation of osteoclast differentiation (GO:0045671)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of vasodilation (GO:0045909)|protein phosphorylation (GO:0006468)|receptor internalization (GO:0031623)|regulation of blood pressure (GO:0008217)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	protein complex binding (GO:0032403)|receptor binding (GO:0005102)			central_nervous_system(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	8						TCCAACCCCAATTGCAGTTTG	0.517																																					p.I111N		.											.	CALCA	514	0			c.T332A						.						221.0	181.0	195.0					11																	14990439		2200	4294	6494	SO:0001627	intron_variant	796	exon4			ACCCCAATTGCAG	X00356, M64486	CCDS7819.1, CCDS31432.1	11p15.2	2014-09-17	2008-02-20		ENSG00000110680	ENSG00000110680		"""Endogenous ligands"""	1437	protein-coding gene	gene with protein product	"""calcitonin"""	114130	"""calcitonin 1"""	CALC1		6546550	Standard	NM_001033953		Approved		uc001mlw.1	P01258	OTTHUMG00000159731	ENST00000486207.1:c.228-1039T>A	11.37:g.14990439A>T		Somatic	190.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	64.0	NM_001741	Q93048|Q9UCP0	Missense_Mutation	SNP	ENST00000486207.1	37	CCDS31432.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216046	0.39201	.	.	ENSG00000110680	ENST00000359642;ENST00000331587;ENST00000396372	T;T;T	0.31247	1.5;1.5;1.5	4.61	2.26	0.28386	Calcitonin peptide-like (1);	0.227204	0.44902	D	0.000413	T	0.29882	0.0747	L	0.44542	1.39	0.34839	D	0.740528	P	0.50369	0.934	P	0.47402	0.546	T	0.42120	-0.9470	10	0.87932	D	0	-16.9073	8.635	0.33941	0.8373:0.0:0.1627:0.0	.	111	P01258	CALC_HUMAN	N	111	ENSP00000352663:I111N;ENSP00000331746:I111N;ENSP00000379657:I111N	ENSP00000331746:I111N	I	-	2	0	CALCA	14947015	1.000000	0.71417	0.780000	0.31762	0.466000	0.32739	5.577000	0.67444	0.370000	0.24538	-0.290000	0.09829	ATT	.		0.517	CALCA-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357068.1	NM_001741	
CASP7	840	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	115457351	115457351	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:115457351G>A	ENST00000345633.4	+	3	483	c.99G>A	c.(97-99)ccG>ccA	p.P33P	CASP7_ENST00000369315.1_Silent_p.P33P|CASP7_ENST00000369318.3_Silent_p.P33P|CASP7_ENST00000369321.2_Silent_p.P66P|CASP7_ENST00000369331.4_Silent_p.P33P	NM_033339.4	NP_203125.1	P55210	CASP7_HUMAN	caspase 7, apoptosis-related cysteine peptidase	33					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway (GO:0097193)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		CGTTTGTACCGTCCCTCTTCA	0.547																																					p.R108H		.											.	CASP7	660	0			c.G323A						.						178.0	141.0	154.0					10																	115457351		2203	4300	6503	SO:0001819	synonymous_variant	840	exon2			TGTACCGTCCCTC	U37448	CCDS7580.1, CCDS7581.1, CCDS7582.1, CCDS58096.1, CCDS73200.1	10q25	2006-02-17	2005-08-17		ENSG00000165806	ENSG00000165806		"""Caspases"""	1508	protein-coding gene	gene with protein product		601761	"""caspase 7, apoptosis-related cysteine protease"""			8521391, 8576161	Standard	NM_033338		Approved	MCH3, CMH-1, ICE-LAP3	uc010qsa.3	P55210	OTTHUMG00000019076	ENST00000345633.4:c.99G>A	10.37:g.115457351G>A		Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	17.0	NM_001267057	B4DQU7|B5BU45|D3DRB8|Q13364|Q53YD5|Q5SVL0|Q5SVL3|Q96BA0	Missense_Mutation	SNP	ENST00000345633.4	37	CCDS7581.1																																																																																			.		0.547	CASP7-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050439.1	NM_033338	
CD27	939	ucsc.edu;bcgsc.ca	37	12	6559457	6559457	+	Silent	SNP	C	C	T	rs199876113		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:6559457C>T	ENST00000266557.3	+	3	616	c.387C>T	c.(385-387)acC>acT	p.T129T	TAPBPL_ENST00000266556.7_5'Flank|CD27_ENST00000541233.1_3'UTR|TAPBPL_ENST00000544021.1_5'Flank|CD27-AS1_ENST00000399492.2_RNA|CD27-AS1_ENST00000545339.1_RNA	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	129					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CTTCGCTGACCGCTCGGTCGT	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		21173	0.0		0.001	False		,,,				2504	0.0				p.T129T		.											.	CD27	659	0			c.C387T						.						149.0	120.0	130.0					12																	6559457		2203	4300	6503	SO:0001819	synonymous_variant	939	exon3			GCTGACCGCTCGG	M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.387C>T	12.37:g.6559457C>T		Somatic	47.0	0.0		WXS	Illumina HiSeq	.	37.0	4.0	NM_001242	B2RDZ0	Silent	SNP	ENST00000266557.3	37	CCDS8545.1																																																																																			C|0.999;T|0.000		0.587	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399258.1		
CDKL5	6792	ucsc.edu;bcgsc.ca	37	X	18664147	18664147	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chrX:18664147A>G	ENST00000379989.3	+	20	3019	c.2734A>G	c.(2734-2736)Aga>Gga	p.R912G	RS1_ENST00000476595.1_Intron|RS1_ENST00000379984.3_Intron|CDKL5_ENST00000379996.3_Missense_Mutation_p.R912G	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	912					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					tgatggcagaagacagagaca	0.488																																					p.R912G		.											.	CDKL5	838	0			c.A2734G						.						164.0	127.0	140.0					X																	18664147		2203	4300	6503	SO:0001583	missense	6792	exon19			GGCAGAAGACAGA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2734A>G	X.37:g.18664147A>G	ENSP00000369325:p.Arg912Gly	Somatic	63.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	37	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	A	8.063	0.768640	0.15983	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.71461	-0.57;-0.57	1.89	1.89	0.25635	.	0.797254	0.10404	N	0.678753	T	0.47600	0.1454	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.01281	0.0	T	0.41466	-0.9507	10	0.87932	D	0	0.9857	5.2684	0.15611	1.0:0.0:0.0:0.0	.	912	O76039	CDKL5_HUMAN	G	912	ENSP00000369332:R912G;ENSP00000369325:R912G	ENSP00000369325:R912G	R	+	1	2	CDKL5	18574068	0.067000	0.21026	0.002000	0.10522	0.004000	0.04260	2.115000	0.41921	1.012000	0.39366	0.340000	0.21749	AGA	.		0.488	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
CISH	1154	hgsc.bcm.edu;bcgsc.ca	37	3	50645109	50645109	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:50645109delC	ENST00000348721.3	-	3	886	c.706delG	c.(706-708)gccfs	p.A236fs	CISH_ENST00000443053.2_Frame_Shift_Del_p.A253fs	NM_145071.2	NP_659508.1	Q9NSE2	CISH_HUMAN	cytokine inducible SH2-containing protein	236	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of signal transduction (GO:0009968)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				breast(2)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		TCCACGTCGGCCACCAGACGG	0.627																																					p.A253fs		.											.	CISH	710	0			c.757delG						.						72.0	73.0	73.0					3																	50645109		2203	4300	6503	SO:0001589	frameshift_variant	1154	exon4			CGTCGGCCACCAG	Z77852	CCDS2831.1, CCDS46834.1	3p21.3	2013-02-14			ENSG00000114737	ENSG00000114737		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	1984	protein-coding gene	gene with protein product		602441				9465889, 7796808	Standard	NM_013324		Approved	CIS, G18, CIS-1, SOCS	uc003dax.3	Q9NSE2	OTTHUMG00000156853	ENST00000348721.3:c.706delG	3.37:g.50645109delC	ENSP00000294173:p.Ala236fs	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	46.0	NM_013324	B2R9N1|G5E9R1|Q9NS38|Q9Y5R1	Frame_Shift_Del	DEL	ENST00000348721.3	37	CCDS2831.1																																																																																			.		0.627	CISH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346245.1	NM_145071	
CLN5	1203	ucsc.edu;bcgsc.ca	37	13	77569324	77569324	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr13:77569324A>G	ENST00000377453.3	+	2	1739	c.447A>G	c.(445-447)ccA>ccG	p.P149P	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	100			L -> P (in CLN5). {ECO:0000269|PubMed:21990111}.		brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		TACAAGCCCCAGTATGGGAAT	0.383																																					p.P149P		.											.	CLN5	91	0			c.A447G						.						156.0	157.0	157.0					13																	77569324		2203	4300	6503	SO:0001819	synonymous_variant	1203	exon2			AGCCCCAGTATGG		CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.447A>G	13.37:g.77569324A>G		Somatic	107.0	1.0		WXS	Illumina HiSeq	.	56.0	6.0	NM_006493	B3KQK7	Silent	SNP	ENST00000377453.3	37	CCDS9456.1																																																																																			.		0.383	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493	
CMBL	134147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	10288612	10288612	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:10288612T>A	ENST00000296658.3	-	3	665	c.245A>T	c.(244-246)cAa>cTa	p.Q82L	CMBL_ENST00000510532.1_5'UTR	NM_138809.3	NP_620164.1	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase homolog (Pseudomonas)	82						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(9)|skin(1)|stomach(1)	13						CCAAGGCTCTTGCCCTACAAA	0.448																																					p.Q82L		.											.	CMBL	69	0			c.A245T						.						95.0	90.0	91.0					5																	10288612		2203	4300	6503	SO:0001583	missense	134147	exon3			GGCTCTTGCCCTA		CCDS3878.1	5p15.2	2010-06-25	2006-09-12		ENSG00000164237	ENSG00000164237	3.1.-.-		25090	protein-coding gene	gene with protein product		613379	"""carboxymethylenebutenolidase-like (Pseudomonas)"""			3804974, 20177059	Standard	NM_138809		Approved	FLJ23617	uc003jes.3	Q96DG6	OTTHUMG00000131043	ENST00000296658.3:c.245A>T	5.37:g.10288612T>A	ENSP00000296658:p.Gln82Leu	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	16.0	NM_138809	D3DTC7|Q8TED6	Missense_Mutation	SNP	ENST00000296658.3	37	CCDS3878.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.924552	0.52653	.	.	ENSG00000164237	ENST00000296658	T	0.48201	0.82	5.48	4.31	0.51392	Dienelactone hydrolase (1);	0.246359	0.40469	N	0.001094	T	0.42449	0.1203	L	0.54323	1.7	0.43032	D	0.994604	B	0.30563	0.285	B	0.28916	0.096	T	0.37572	-0.9700	10	0.59425	D	0.04	-15.8316	10.4159	0.44322	0.0:0.0778:0.0:0.9222	.	82	Q96DG6	CMBL_HUMAN	L	82	ENSP00000296658:Q82L	ENSP00000296658:Q82L	Q	-	2	0	CMBL	10341612	0.999000	0.42202	0.171000	0.22900	0.899000	0.52679	4.149000	0.58091	0.898000	0.36418	0.459000	0.35465	CAA	.		0.448	CMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253689.1	NM_138809	
CNGA1	1259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	47939598	47939598	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:47939598T>C	ENST00000514170.1	-	11	1232	c.913A>G	c.(913-915)Atg>Gtg	p.M305V	CNGA1_ENST00000420489.2_Missense_Mutation_p.M305V|CNGA1_ENST00000402813.3_Missense_Mutation_p.M374V|CNGA1_ENST00000544810.1_Missense_Mutation_p.M305V|CNGA1_ENST00000358519.4_Missense_Mutation_p.M305V			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	305					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						ACGATATACATAACAAGGTTG	0.363																																					p.M374V		.											.	CNGA1	92	0			c.A1120G						.						164.0	158.0	160.0					4																	47939598		1872	4104	5976	SO:0001583	missense	1259	exon10			TATACATAACAAG	M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.913A>G	4.37:g.47939598T>C	ENSP00000426862:p.Met305Val	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	43.0	NM_001142564	A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	ENST00000514170.1	37	CCDS43226.1	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738312	0.49045	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57;-4.57	5.09	5.09	0.68999	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.95037	0.8393	L	0.39566	1.225	0.49582	D	0.999806	B;B	0.18968	0.032;0.032	B;B	0.20577	0.03;0.03	D	0.93042	0.6458	10	0.18276	T	0.48	.	14.9022	0.70687	0.0:0.0:0.0:1.0	.	305;305	Q4W5E3;P29973	.;CNGA1_HUMAN	V	374;305;305;305;305	ENSP00000384264:M374V;ENSP00000426862:M305V;ENSP00000443401:M305V;ENSP00000351320:M305V;ENSP00000389881:M305V	ENSP00000351320:M305V	M	-	1	0	CNGA1	47634355	1.000000	0.71417	0.948000	0.38648	0.862000	0.49288	4.770000	0.62309	1.923000	0.55706	0.533000	0.62120	ATG	.		0.363	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372070.2	NM_000087	
COL11A1	1301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	103461593	103461593	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:103461593G>A	ENST00000370096.3	-	27	2559	c.2247C>T	c.(2245-2247)ccC>ccT	p.P749P	COL11A1_ENST00000353414.4_Silent_p.P710P|COL11A1_ENST00000358392.2_Silent_p.P761P|COL11A1_ENST00000512756.1_Silent_p.P633P	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	749	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GTGGACCAGGGGGACCCTGAA	0.363																																					p.P761P		.											.	COL11A1	586	0			c.C2283T						.						40.0	44.0	43.0					1																	103461593		2201	4300	6501	SO:0001819	synonymous_variant	1301	exon27			ACCAGGGGGACCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.2247C>T	1.37:g.103461593G>A		Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	16.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	37	CCDS778.1																																																																																			.		0.363	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
CRIP3	401262	ucsc.edu;bcgsc.ca	37	6	43274203	43274203	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:43274203A>G	ENST00000274990.4	-	5	385	c.381T>C	c.(379-381)tgT>tgC	p.C127C	CRIP3_ENST00000372569.3_Silent_p.C127C|ZNF318_ENST00000607252.1_5'Flank			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	127	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			CGGGCTCCCCACAGCCAGGGC	0.582																																					p.C127C		.											.	CRIP3	91	0			c.T381C						.						63.0	63.0	63.0					6																	43274203		2203	4300	6503	SO:0001819	synonymous_variant	401262	exon5			CTCCCCACAGCCA	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.381T>C	6.37:g.43274203A>G		Somatic	65.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Silent	SNP	ENST00000274990.4	37																																																																																				.		0.582	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
CROCC	9696	ucsc.edu;bcgsc.ca	37	1	17274950	17274950	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:17274950G>A	ENST00000375541.5	+	18	2708	c.2639G>A	c.(2638-2640)gGc>gAc	p.G880D	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GAGCACGCTGGCCTGGCTGTG	0.711																																					p.G880D		.											.	CROCC	137	0			c.G2639A						.						11.0	11.0	11.0					1																	17274950		2145	4220	6365	SO:0001583	missense	9696	exon18			ACGCTGGCCTGGC	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2639G>A	1.37:g.17274950G>A	ENSP00000364691:p.Gly880Asp	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_014675		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	G	8.093	0.775031	0.16051	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.21734	1.99	4.21	4.21	0.49690	.	.	.	.	.	T	0.19565	0.0470	L	0.47716	1.5	0.30150	N	0.803168	P;P	0.41131	0.739;0.739	B;B	0.36289	0.221;0.221	T	0.06320	-1.0833	9	0.29301	T	0.29	.	14.9241	0.70862	0.0:0.0:1.0:0.0	.	183;880	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	D	880;761	ENSP00000364691:G880D	ENSP00000364691:G880D	G	+	2	0	CROCC	17147537	0.987000	0.35691	0.887000	0.34795	0.370000	0.29829	6.622000	0.74233	2.300000	0.77407	0.449000	0.29647	GGC	.		0.711	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
CSGALNACT2	55454	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	43650967	43650967	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:43650967C>T	ENST00000374466.3	+	2	705	c.370C>T	c.(370-372)Ctt>Ttt	p.L124F	CSGALNACT2_ENST00000374464.1_Missense_Mutation_p.L124F	NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	124					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TTTAGAGTTTCTTCATTCCCA	0.418																																					p.L124F		.											.	CSGALNACT2	69	0			c.C370T						.						90.0	78.0	82.0					10																	43650967		2203	4300	6503	SO:0001583	missense	55454	exon2			GAGTTTCTTCATT	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.370C>T	10.37:g.43650967C>T	ENSP00000363590:p.Leu124Phe	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	33.0	NM_018590	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917611	0.73098	.	.	ENSG00000169826	ENST00000374466;ENST00000374464	T;T	0.36520	1.36;1.25	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.61553	0.2356	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.63391	-0.6648	10	0.59425	D	0.04	-18.9168	13.4372	0.61090	0.0:0.9283:0.0:0.0717	.	124;124	Q8N6G5;Q8N6G5-2	CGAT2_HUMAN;.	F	124	ENSP00000363590:L124F;ENSP00000363588:L124F	ENSP00000363588:L124F	L	+	1	0	CSGALNACT2	42970973	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.728000	0.54991	2.861000	0.98227	0.650000	0.86243	CTT	.		0.418	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047693.1	NM_018590	
CSMD2	114784	ucsc.edu;bcgsc.ca	37	1	34037319	34037319	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:34037319A>G	ENST00000373381.4	-	51	7946	c.7770T>C	c.(7768-7770)acT>acC	p.T2590T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2592	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CATCAGGACAAGTCACAGCTG	0.473																																					p.T2592T		.											.	CSMD2	103	0			c.T7776C						.						73.0	67.0	69.0					1																	34037319		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon52			AGGACAAGTCACA	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.7770T>C	1.37:g.34037319A>G		Somatic	60.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	37																																																																																				.		0.473	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
CTNND1	1500	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	57569523	57569523	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:57569523C>T	ENST00000399050.4	+	7	1811	c.1275C>T	c.(1273-1275)caC>caT	p.H425H	CTNND1_ENST00000428599.2_Silent_p.H425H|CTNND1_ENST00000526357.1_Silent_p.H371H|CTNND1_ENST00000529986.1_Silent_p.H324H|CTNND1_ENST00000358694.6_Silent_p.H425H|CTNND1_ENST00000360682.6_Silent_p.H425H|CTNND1_ENST00000532649.1_Silent_p.H371H|CTNND1_ENST00000415361.2_Silent_p.H324H|CTNND1_ENST00000361332.4_Silent_p.H425H|CTNND1_ENST00000528232.1_Silent_p.H324H|CTNND1_ENST00000361796.4_Silent_p.H425H|CTNND1_ENST00000530748.1_Silent_p.H371H|CTNND1_ENST00000361391.6_Silent_p.H425H|CTNND1_ENST00000534579.1_Silent_p.H371H|CTNND1_ENST00000527467.1_Silent_p.H102H|CTNND1_ENST00000526938.1_Silent_p.H425H|CTNND1_ENST00000529919.1_Silent_p.H425H|CTNND1_ENST00000399039.4_Silent_p.H425H|CTNND1_ENST00000525902.1_Silent_p.H102H|CTNND1_ENST00000524630.1_Silent_p.H425H|CTNND1_ENST00000532844.1_Silent_p.H371H|CTNND1_ENST00000426142.2_Silent_p.H324H|CTNND1_ENST00000533667.1_Silent_p.H102H|CTNND1_ENST00000531014.1_Silent_p.H102H|CTNND1_ENST00000532787.1_Silent_p.H324H|CTNND1_ENST00000530094.1_Silent_p.H324H|CTNND1_ENST00000529873.1_Silent_p.H371H|CTNND1_ENST00000532245.1_Silent_p.H324H|CTNND1_ENST00000526772.1_Silent_p.H102H|CTNND1_ENST00000528621.1_Silent_p.H371H|CTNND1_ENST00000532463.1_Silent_p.H324H|CTNND1_ENST00000529526.1_Silent_p.H371H	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	425					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				AGGAAGTGCACCTTGGAGCCT	0.488																																					p.H425H		.											.	CTNND1	272	0			c.C1275T						.						167.0	168.0	167.0					11																	57569523		1976	4164	6140	SO:0001819	synonymous_variant	1500	exon7			AGTGCACCTTGGA	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.1275C>T	11.37:g.57569523C>T		Somatic	128.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	36.0	NM_001085461	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Silent	SNP	ENST00000399050.4	37	CCDS44604.1																																																																																			.		0.488	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331	
CUEDC1	404093	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	55945598	55945598	+	Missense_Mutation	SNP	C	C	G	rs34800498	byFrequency	TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:55945598C>G	ENST00000577830.1	-	8	1360	c.947G>C	c.(946-948)cGg>cCg	p.R316P	CUEDC1_ENST00000360238.2_Missense_Mutation_p.R316P|CUEDC1_ENST00000407144.2_Missense_Mutation_p.R316P|CUEDC1_ENST00000577840.1_Missense_Mutation_p.R179P|CUEDC1_ENST00000578357.1_5'UTR	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1	316			R -> Q (in dbSNP:rs34800498).							endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						CAGTTTCCTCCGGGTGGCTGG	0.547																																					p.R316P		.											.	CUEDC1	228	0			c.G947C						.						103.0	86.0	91.0					17																	55945598		2203	4300	6503	SO:0001583	missense	404093	exon8			TTCCTCCGGGTGG	AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.947G>C	17.37:g.55945598C>G	ENSP00000462717:p.Arg316Pro	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	43.0	NM_001271875	D3DTZ2|Q9NWD0	Missense_Mutation	SNP	ENST00000577830.1	37	CCDS11599.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963464	0.74016	.	.	ENSG00000180891	ENST00000407144;ENST00000360238	T;T	0.37411	1.2;1.2	4.5	3.52	0.40303	.	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.61703	1.905	0.58432	D	0.999999	D	0.58970	0.984	P	0.59546	0.859	T	0.54050	-0.8351	10	0.87932	D	0	-6.8965	12.0482	0.53491	0.0:0.9155:0.0:0.0845	.	316	Q9NWM3	CUED1_HUMAN	P	316	ENSP00000384712:R316P;ENSP00000353373:R316P	ENSP00000353373:R316P	R	-	2	0	CUEDC1	53300597	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.413000	0.59795	0.875000	0.35847	0.462000	0.41574	CGG	C|0.958;T|0.042		0.547	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443305.1	NM_017949	
DCUN1D4	23142	broad.mit.edu;ucsc.edu	37	4	52779748	52779748	+	Nonstop_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:52779748T>C	ENST00000334635.5	+	11	1057	c.877T>C	c.(877-879)Tag>Cag	p.*293Q	DCUN1D4_ENST00000381437.4_Nonstop_Mutation_p.*233Q|DCUN1D4_ENST00000381441.3_Nonstop_Mutation_p.*258Q|DCUN1D4_ENST00000451288.2_Nonstop_Mutation_p.*337Q	NM_001040402.1	NP_001035492.1	Q92564	DCNL4_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 4	0						nucleus (GO:0005634)				endometrium(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)	9			GBM - Glioblastoma multiforme(4;1.93e-11)|LUSC - Lung squamous cell carcinoma(32;0.00654)			ACAGATGTCCTAGGACTTTAT	0.393																																					p.X293Q		.											.	DCUN1D4	92	0			c.T877C						.						106.0	104.0	104.0					4																	52779748		2203	4300	6503	SO:0001578	stop_lost	23142	exon11			ATGTCCTAGGACT	D87466	CCDS3487.2, CCDS33982.1, CCDS75123.1	4q11	2013-06-10	2013-06-10		ENSG00000109184	ENSG00000109184			28998	protein-coding gene	gene with protein product		612977	"""DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae)"""			15988528	Standard	XM_005265731		Approved	KIAA0276	uc003gze.3	Q92564	OTTHUMG00000128700	ENST00000334635.5:c.877T>C	4.37:g.52779748T>C	ENSP00000334625:p.*293Glnext*82	Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	5.0	NM_001040402	B4DH25|Q7Z3F3|Q7Z6B8	Missense_Mutation	SNP	ENST00000334635.5	37	CCDS33982.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.082050	0.76528	.	.	ENSG00000109184	ENST00000334635;ENST00000381441;ENST00000381437;ENST00000451288;ENST00000510808	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7305	0.77800	0.0:0.0:0.0:1.0	.	.	.	.	Q	293;258;233;337;103	.	.	X	+	1	0	DCUN1D4	52474505	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.774000	0.85478	2.299000	0.77371	0.528000	0.53228	TAG	.		0.393	DCUN1D4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250599.2	NM_015115	
DDX17	10521	ucsc.edu;bcgsc.ca	37	22	38897272	38897272	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr22:38897272C>T	ENST00000396821.3	-	2	400	c.301G>A	c.(301-303)Ggt>Agt	p.G101S	DDX17_ENST00000432525.1_5'UTR|DDX17_ENST00000381633.3_Missense_Mutation_p.G22S	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	101	Poly-Gly.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					CCACCACCACCTCTTGCTCCA	0.393																																					p.G101S	Ovarian(55;1085 1454 6392 21425)	.											.	DDX17	229	0			c.G301A						.						69.0	70.0	70.0					22																	38897272		2203	4300	6503	SO:0001583	missense	10521	exon2			CACCACCTCTTGC	U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.301G>A	22.37:g.38897272C>T	ENSP00000380033:p.Gly101Ser	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	29.0	4.0	NM_006386	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	ENST00000396821.3	37	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855710	0.32791	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.27557	1.66;1.66;1.66	5.36	4.28	0.50868	.	0.092423	0.85682	D	0.000000	T	0.11367	0.0277	N	0.08118	0	0.80722	D	1	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.22312	-1.0220	10	0.08179	T	0.78	-17.2358	4.163	0.10293	0.1389:0.5299:0.2456:0.0856	.	22;103;101	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	S	101;22;101;103	ENSP00000380033:G101S;ENSP00000371046:G22S;ENSP00000385536:G101S	ENSP00000371046:G22S	G	-	1	0	DDX17	37227218	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	1.184000	0.32053	2.508000	0.84585	0.591000	0.81541	GGT	.		0.393	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321476.2	NM_030881	
DNAH6	1768	broad.mit.edu;bcgsc.ca	37	2	84881832	84881832	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:84881832A>G	ENST00000237449.6	+	34	5691	c.5683A>G	c.(5683-5685)Atg>Gtg	p.M1895V	DNAH6_ENST00000398278.2_Missense_Mutation_p.M1895V|DNAH6_ENST00000389394.3_Missense_Mutation_p.M1895V			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1895	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TCGATGTGGAATGGTGTTTGT	0.398																																					p.M1895V		.											.	DNAH6	69	0			c.A5683G						.						281.0	234.0	248.0					2																	84881832		692	1591	2283	SO:0001583	missense	1768	exon35			TGTGGAATGGTGT	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5683A>G	2.37:g.84881832A>G	ENSP00000237449:p.Met1895Val	Somatic	216.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	6.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	37	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	19.84	3.901942	0.72754	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	D;D;D	0.90676	-2.71;-2.71;-2.71	5.59	5.59	0.84812	.	.	.	.	.	D	0.95105	0.8414	M	0.92833	3.35	0.43885	D	0.996508	D	0.60575	0.988	P	0.54401	0.751	D	0.95774	0.8811	9	0.59425	D	0.04	.	14.7324	0.69391	1.0:0.0:0.0:0.0	.	1895	Q9C0G6	DYH6_HUMAN	V	1895	ENSP00000374045:M1895V;ENSP00000381326:M1895V;ENSP00000237449:M1895V	ENSP00000237449:M1895V	M	+	1	0	DNAH6	84735343	1.000000	0.71417	0.992000	0.48379	0.957000	0.61999	8.286000	0.89916	2.129000	0.65627	0.445000	0.29226	ATG	.		0.398	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
DNAJA1	3301	ucsc.edu;bcgsc.ca	37	9	33037026	33037026	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:33037026G>A	ENST00000330899.4	+	8	1071	c.888G>A	c.(886-888)aaG>aaA	p.K296K	DNAJA1_ENST00000544625.1_Silent_p.K139K|DNAJA1_ENST00000495015.1_3'UTR	NM_001539.2	NP_001530.1	P31689	DNJA1_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 1	296					androgen receptor signaling pathway (GO:0030521)|DNA damage response, detection of DNA damage (GO:0042769)|negative regulation of apoptotic process (GO:0043066)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of apoptotic process (GO:0043065)|protein folding (GO:0006457)|protein localization to mitochondrion (GO:0070585)|regulation of protein transport (GO:0051223)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasmic side of endoplasmic reticulum membrane (GO:0098554)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|G-protein coupled receptor binding (GO:0001664)|Hsp70 protein binding (GO:0030544)|low-density lipoprotein particle receptor binding (GO:0050750)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			large_intestine(2)|ovary(1)|skin(3)	6			LUSC - Lung squamous cell carcinoma(29;0.0227)	GBM - Glioblastoma multiforme(74;0.102)		AGATTGTCAAGCATGGAGATA	0.383																																					p.K296K		.											.	DNAJA1	226	0			c.G888A						.						137.0	122.0	127.0					9																	33037026		2203	4300	6503	SO:0001819	synonymous_variant	3301	exon8			TGTCAAGCATGGA	L08069	CCDS6533.1	9p13.3	2011-09-02			ENSG00000086061	ENSG00000086061		"""Heat shock proteins / DNAJ (HSP40)"""	5229	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 7"""	602837		HSJ2		8334160, 11147971	Standard	NM_001539		Approved	HSPF4, hdj-2, dj-2, NEDD7	uc003zsd.1	P31689	OTTHUMG00000019760	ENST00000330899.4:c.888G>A	9.37:g.33037026G>A		Somatic	72.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001539	Q5T7Q0|Q86TL9	Silent	SNP	ENST00000330899.4	37	CCDS6533.1																																																																																			.		0.383	DNAJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052031.1		
DOK7	285489	ucsc.edu;bcgsc.ca	37	4	3494936	3494936	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:3494936C>A	ENST00000340083.5	+	7	1288	c.1223C>A	c.(1222-1224)cCa>cAa	p.P408Q	DOK7_ENST00000389653.2_Missense_Mutation_p.P408Q|DOK7_ENST00000507039.1_3'UTR|DOK7_ENST00000512714.1_3'UTR	NM_173660.4	NP_775931.3	Q18PE1	DOK7_HUMAN	docking protein 7	408					neuromuscular junction development (GO:0007528)|positive regulation of protein tyrosine kinase activity (GO:0061098)|receptor clustering (GO:0043113)	cell junction (GO:0030054)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)			kidney(1)|large_intestine(1)|skin(2)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TATGACACACCACGCAGCCTT	0.721																																					p.P408Q		.											.	DOK7	91	0			c.C1223A						.						16.0	16.0	16.0					4																	3494936		2193	4294	6487	SO:0001583	missense	285489	exon7			ACACACCACGCAG	AK091037	CCDS3370.2, CCDS54717.1	4p16.2	2014-09-17	2006-08-24	2006-08-24	ENSG00000175920	ENSG00000175920			26594	protein-coding gene	gene with protein product		610285	"""chromosome 4 open reading frame 25"""	C4orf25		16794080	Standard	NM_173660		Approved	FLJ33718, FLJ39137, Dok-7	uc003ghd.3	Q18PE1	OTTHUMG00000122087	ENST00000340083.5:c.1223C>A	4.37:g.3494936C>A	ENSP00000344432:p.Pro408Gln	Somatic	63.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_173660	A2A499|A2RRD4|E9PB56|Q6P6A6|Q86XG5|Q8N2J3|Q8NBC1	Missense_Mutation	SNP	ENST00000340083.5	37	CCDS3370.2	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122335	0.37436	.	.	ENSG00000175920	ENST00000389653;ENST00000340083	D;D	0.83837	-1.77;-1.59	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	D	0.90109	0.6910	M	0.74881	2.28	0.41266	D	0.986811	D;D;D	0.89917	0.999;1.0;0.997	D;D;D	0.91635	0.976;0.999;0.916	D	0.91731	0.5396	10	0.72032	D	0.01	-12.2659	14.8406	0.70220	0.0:1.0:0.0:0.0	.	408;270;408	Q18PE1-3;Q18PE1-2;Q18PE1	.;.;DOK7_HUMAN	Q	408	ENSP00000374304:P408Q;ENSP00000344432:P408Q	ENSP00000344432:P408Q	P	+	2	0	DOK7	3464734	0.975000	0.34042	0.986000	0.45419	0.057000	0.15508	4.926000	0.63433	1.965000	0.57142	0.555000	0.69702	CCA	.		0.721	DOK7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313538.1	NM_173660	
DPF3	8110	ucsc.edu;bcgsc.ca	37	14	73181159	73181159	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:73181159T>C	ENST00000556509.1	-	6	575	c.576A>G	c.(574-576)gaA>gaG	p.E192E	DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000546183.1_Silent_p.E202E|DPF3_ENST00000541685.1_Silent_p.E192E	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	192					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		TGTCGTGGTCTTCCTGAGAGG	0.617																																					p.E192E		.											.	DPF3	1	0			c.A576G						.						89.0	102.0	98.0					14																	73181159		2093	4207	6300	SO:0001819	synonymous_variant	8110	exon6			GTGGTCTTCCTGA	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.576A>G	14.37:g.73181159T>C		Somatic	54.0	0.0		WXS	Illumina HiSeq	.	34.0	4.0	NM_012074	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Silent	SNP	ENST00000556509.1	37																																																																																				.		0.617	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2		
DTNB	1838	ucsc.edu;bcgsc.ca	37	2	25799831	25799831	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:25799831A>G	ENST00000406818.3	-	8	1001	c.752T>C	c.(751-753)aTg>aCg	p.M251T	DTNB_ENST00000472690.1_5'UTR|DTNB_ENST00000407661.3_Missense_Mutation_p.M251T|DTNB_ENST00000288642.8_Missense_Mutation_p.M251T|DTNB_ENST00000407186.1_Missense_Mutation_p.M251T|DTNB_ENST00000545439.1_Missense_Mutation_p.M47T|DTNB_ENST00000404103.3_Missense_Mutation_p.M251T|DTNB_ENST00000405222.1_Missense_Mutation_p.M251T|DTNB_ENST00000407038.3_Missense_Mutation_p.M251T|DTNB_ENST00000496972.2_Missense_Mutation_p.M194T	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	251						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAACCCATCATACTCTCACA	0.547																																					p.M251T		.											.	DTNB	137	0			c.T752C						.						39.0	41.0	41.0					2																	25799831		2145	4268	6413	SO:0001583	missense	1838	exon8			CCCATCATACTCT	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.752T>C	2.37:g.25799831A>G	ENSP00000384084:p.Met251Thr	Somatic	89.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_021907	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Missense_Mutation	SNP	ENST00000406818.3	37	CCDS46237.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.829720	0.91036	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000407038;ENST00000405222;ENST00000407186;ENST00000288642;ENST00000545439;ENST00000535791	D;D;D;D;D;D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19;-2.19;-2.19;-2.19;-2.19;-2.19	5.83	5.83	0.93111	Zinc finger, ZZ-type (4);	0.000000	0.85682	D	0.000000	D	0.91747	0.7390	L	0.55481	1.735	0.58432	D	0.999997	P;D;D;P;P;D;P;D;D;D;P;P	0.89917	0.947;1.0;0.968;0.864;0.947;0.993;0.941;0.991;0.995;0.991;0.935;0.947	P;D;P;P;P;D;P;D;D;P;P;P	0.91635	0.777;0.999;0.856;0.736;0.881;0.944;0.856;0.932;0.958;0.908;0.71;0.777	D	0.92495	0.6003	10	0.87932	D	0	-24.4404	15.0265	0.71674	1.0:0.0:0.0:0.0	.	251;47;194;251;251;194;251;251;251;251;251;251	E7EVB6;B7Z202;F5GZG4;O60941-3;B7Z6A9;B7Z733;E9PEY4;Q96AW0;O60941-2;O60941-4;G5E9F6;O60941	.;.;.;.;.;.;.;.;.;.;.;DTNB_HUMAN	T	194;251;251;251;251;251;251;251;47;104	ENSP00000444463:M194T;ENSP00000384084:M251T;ENSP00000385482:M251T;ENSP00000385193:M251T;ENSP00000384767:M251T;ENSP00000384787:M251T;ENSP00000385784:M251T;ENSP00000288642:M251T;ENSP00000444961:M47T	ENSP00000288642:M251T	M	-	2	0	DTNB	25653335	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.210000	0.95106	2.231000	0.72958	0.459000	0.35465	ATG	.		0.547	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147	
DUS1L	64118	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	80017940	80017940	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:80017940C>A	ENST00000354321.7	-	10	1537	c.1052G>T	c.(1051-1053)gGt>gTt	p.G351V	DUS1L_ENST00000306796.5_Missense_Mutation_p.G351V			Q6P1R4	DUS1L_HUMAN	dihydrouridine synthase 1-like (S. cerevisiae)	351							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	6	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GCTGCGCGCACCTGCCTTCTC	0.657																																					p.G351V		.											.	DUS1L	91	0			c.G1052T						.						76.0	68.0	71.0					17																	80017940		2202	4299	6501	SO:0001583	missense	64118	exon11			CGCGCACCTGCCT		CCDS32775.1	17q25.3	2005-08-09				ENSG00000169718			30086	protein-coding gene	gene with protein product						12477932	Standard	NM_022156		Approved	PP3111, DUS1	uc002kdr.4	Q6P1R4		ENST00000354321.7:c.1052G>T	17.37:g.80017940C>A	ENSP00000346280:p.Gly351Val	Somatic	122.0	1.0		WXS	Illumina HiSeq	Phase_I	138.0	25.0	NM_022156	A6NHV4|Q96AI3	Missense_Mutation	SNP	ENST00000354321.7	37	CCDS32775.1	.	.	.	.	.	.	.	.	.	.	C	8.713	0.912578	0.17907	.	.	ENSG00000169718	ENST00000354321;ENST00000306796;ENST00000542088;ENST00000538833	T;T	0.29917	1.55;1.55	4.64	1.38	0.22167	.	0.292622	0.37483	N	0.002079	T	0.29556	0.0737	L	0.53249	1.67	0.26955	N	0.965947	B;B	0.29936	0.138;0.262	B;B	0.30401	0.053;0.115	T	0.17349	-1.0372	10	0.37606	T	0.19	-7.191	14.7057	0.69189	0.0:0.5838:0.4162:0.0	.	351;220	Q6P1R4;Q9BTJ3	DUS1L_HUMAN;.	V	351;351;214;218	ENSP00000346280:G351V;ENSP00000303515:G351V	ENSP00000303515:G351V	G	-	2	0	DUS1L	77611229	0.003000	0.15002	0.000000	0.03702	0.002000	0.02628	0.558000	0.23469	0.156000	0.19299	0.563000	0.77884	GGT	.		0.657	DUS1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442347.1	NM_022156	
EFEMP1	2202	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	56094351	56094351	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:56094351C>A	ENST00000394555.2	-	11	1774	c.1339G>T	c.(1339-1341)Gca>Tca	p.A447S	EFEMP1_ENST00000424836.2_Missense_Mutation_p.A309S|EFEMP1_ENST00000355426.3_Missense_Mutation_p.A447S|EFEMP1_ENST00000394554.1_Missense_Mutation_p.A447S	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	447	Mediates interaction with TIMP3.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACAAGCATTGCACTTACAGGA	0.403																																					p.A447S	GBM(92;934 1319 7714 28760 40110)	.											.	EFEMP1	520	0			c.G1339T						.						77.0	65.0	69.0					2																	56094351		2203	4300	6503	SO:0001583	missense	2202	exon11			GCATTGCACTTAC	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.1339G>T	2.37:g.56094351C>A	ENSP00000378058:p.Ala447Ser	Somatic	83.0	1.0		WXS	Illumina HiSeq	Phase_I	36.0	18.0	NM_001039349	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	ENST00000394555.2	37	CCDS1857.1	.	.	.	.	.	.	.	.	.	.	C	18.98	3.738198	0.69304	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000424836;ENST00000355426	D;D;T;D	0.84730	-1.89;-1.89;-1.37;-1.89	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000013	D	0.88127	0.6353	M	0.73598	2.24	0.80722	D	1	P;D	0.53745	0.82;0.962	B;P	0.46758	0.254;0.526	D	0.89965	0.4089	10	0.72032	D	0.01	.	18.963	0.92684	0.0:1.0:0.0:0.0	.	309;447	B4DW75;Q12805	.;FBLN3_HUMAN	S	447;447;303;309;447	ENSP00000378058:A447S;ENSP00000378057:A447S;ENSP00000399145:A309S;ENSP00000347596:A447S	ENSP00000347596:A447S	A	-	1	0	EFEMP1	55947855	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.559000	0.86315	0.491000	0.48974	GCA	.		0.403	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
EMR1	2015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	6919616	6919616	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:6919616G>A	ENST00000312053.4	+	13	1515	c.1478G>A	c.(1477-1479)cGc>cAc	p.R493H	EMR1_ENST00000381407.5_Missense_Mutation_p.R352H|EMR1_ENST00000250572.8_Missense_Mutation_p.R493H|EMR1_ENST00000450315.3_Missense_Mutation_p.R316H|EMR1_ENST00000381404.4_Missense_Mutation_p.R441H	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	493	Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					TTAAATGAGCGCTTCTTCAAA	0.473																																					p.R493H		.											.	EMR1	526	0			c.G1478A						.						140.0	128.0	132.0					19																	6919616		2203	4300	6503	SO:0001583	missense	2015	exon13			ATGAGCGCTTCTT	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.1478G>A	19.37:g.6919616G>A	ENSP00000311545:p.Arg493His	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	60.0	NM_001256253	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	ENST00000312053.4	37	CCDS12175.1	.	.	.	.	.	.	.	.	.	.	G	7.865	0.726947	0.15439	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.78707	-1.14;-1.17;-1.2;0.01;0.33	3.99	0.387	0.16259	.	.	.	.	.	T	0.68943	0.3056	L	0.59436	1.845	0.09310	N	1	B;B;B;B;B	0.16603	0.018;0.006;0.007;0.004;0.002	B;B;B;B;B	0.10450	0.004;0.003;0.005;0.001;0.002	T	0.60414	-0.7268	9	0.56958	D	0.05	.	3.8521	0.08959	0.2285:0.202:0.5695:0.0	.	316;352;493;441;493	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	H	493;493;441;493;352;316	ENSP00000311545:R493H;ENSP00000370811:R441H;ENSP00000250572:R493H;ENSP00000370814:R352H;ENSP00000405974:R316H	ENSP00000250572:R493H	R	+	2	0	EMR1	6870616	0.075000	0.21258	0.060000	0.19600	0.001000	0.01503	0.811000	0.27198	0.471000	0.27319	-1.141000	0.01876	CGC	.		0.473	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458485.1		
ERO1L	30001	ucsc.edu;bcgsc.ca	37	14	53149118	53149118	+	Silent	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:53149118C>A	ENST00000395686.3	-	3	466	c.243G>T	c.(241-243)ctG>ctT	p.L81L		NM_014584.1	NP_055399.1	Q96HE7	ERO1A_HUMAN	ERO1-like (S. cerevisiae)	81					4-hydroxyproline metabolic process (GO:0019471)|brown fat cell differentiation (GO:0050873)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum unfolded protein response (GO:0030968)|extracellular matrix organization (GO:0030198)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)|release of sequestered calcium ion into cytosol (GO:0051209)|response to endoplasmic reticulum stress (GO:0034976)|response to temperature stimulus (GO:0009266)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)		ERO1L/FERMT2(2)	breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12	Breast(41;0.226)					ACGGCCTCTTCAGGTTTACCT	0.338																																					p.L81L		.											.	ERO1L	90	0			c.G243T						.						71.0	68.0	69.0					14																	53149118		2203	4300	6503	SO:0001819	synonymous_variant	30001	exon3			CCTCTTCAGGTTT	AF081886	CCDS9709.1	14q22.1	2010-10-06	2001-11-28		ENSG00000197930	ENSG00000197930			13280	protein-coding gene	gene with protein product		615435	"""ERO1 (S. cerevisiae)-like"""			10671517	Standard	NM_014584		Approved	ERO1A, ERO1-alpha	uc001wzv.3	Q96HE7	OTTHUMG00000140301	ENST00000395686.3:c.243G>T	14.37:g.53149118C>A		Somatic	119.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_014584	A8K9X4|A8MYW1|Q7LD45|Q9P1Q9|Q9UKV6	Silent	SNP	ENST00000395686.3	37	CCDS9709.1																																																																																			.		0.338	ERO1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276892.1	NM_014584	
EXOC3L2	90332	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45730995	45730995	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:45730995G>T	ENST00000252482.3	-	4	356	c.329C>A	c.(328-330)cCa>cAa	p.P110Q	EXOC3L2_ENST00000413988.1_Missense_Mutation_p.P110Q			Q2M3D2	EX3L2_HUMAN	exocyst complex component 3-like 2	110					exocytosis (GO:0006887)	exocyst (GO:0000145)				endometrium(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00883)		CCGGACTGCTGGGTTCTCATG	0.617																																					p.P110Q		.											.	EXOC3L2	91	0			c.C329A						.						98.0	94.0	95.0					19																	45730995		2203	4300	6503	SO:0001583	missense	90332	exon5			ACTGCTGGGTTCT	AK093466	CCDS12657.1	19q13.32	2011-07-07			ENSG00000130201	ENSG00000130201			30162	protein-coding gene	gene with protein product						21566143	Standard	NM_138568		Approved	FLJ36147, XTP7	uc002pay.1	Q2M3D2	OTTHUMG00000155018	ENST00000252482.3:c.329C>A	19.37:g.45730995G>T	ENSP00000252482:p.Pro110Gln	Somatic	85.0	2.0		WXS	Illumina HiSeq	Phase_I	82.0	24.0	NM_138568	Q8N9W2|Q96GV2	Missense_Mutation	SNP	ENST00000252482.3	37	CCDS12657.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608526	0.28623	.	.	ENSG00000130201	ENST00000252482;ENST00000413988	T;T	0.06142	3.34;3.34	4.92	4.92	0.64577	.	0.332602	0.28572	N	0.014870	T	0.07908	0.0198	L	0.46157	1.445	0.33267	D	0.560483	B	0.18610	0.029	B	0.21917	0.037	T	0.07233	-1.0783	10	0.26408	T	0.33	.	13.5966	0.61994	0.0:0.0:1.0:0.0	.	110	Q2M3D2	EX3L2_HUMAN	Q	110	ENSP00000252482:P110Q;ENSP00000400713:P110Q	ENSP00000252482:P110Q	P	-	2	0	EXOC3L2	50422835	1.000000	0.71417	0.997000	0.53966	0.592000	0.36648	4.473000	0.60196	2.298000	0.77334	0.491000	0.48974	CCA	.		0.617	EXOC3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338073.1	NM_138568	
FAM102A	399665	ucsc.edu;bcgsc.ca	37	9	130705487	130705487	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:130705487A>G	ENST00000373095.1	-	11	1514	c.1139T>C	c.(1138-1140)gTg>gCg	p.V380A	RP11-203J24.8_ENST00000587978.1_RNA|RP11-203J24.8_ENST00000591408.1_RNA|FAM102A_ENST00000373084.4_Missense_Mutation_p.V238A|FAM102A_ENST00000300434.3_5'UTR|RP11-203J24.8_ENST00000587355.1_RNA|RP11-203J24.8_ENST00000592240.1_RNA|RP11-203J24.8_ENST00000415141.2_RNA|RP11-203J24.8_ENST00000608805.1_RNA|RP11-203J24.8_ENST00000588890.1_RNA|RP11-203J24.8_ENST00000586374.1_RNA|RP11-203J24.8_ENST00000590283.1_RNA	NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	380										breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						GCTTTCAATCACAACTGGCTC	0.562											OREG0019513	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V380A		.											.	FAM102A	91	0			c.T1139C						.						129.0	107.0	115.0					9																	130705487		2203	4300	6503	SO:0001583	missense	399665	exon11			TCAATCACAACTG		CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.1139T>C	9.37:g.130705487A>G	ENSP00000362187:p.Val380Ala	Somatic	66.0	0.0	1582	WXS	Illumina HiSeq	.	44.0	4.0	NM_001035254	A2A329|Q8TEL4	Missense_Mutation	SNP	ENST00000373095.1	37	CCDS35150.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.739916	0.69304	.	.	ENSG00000167106	ENST00000373095;ENST00000373084	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.37812	0.1017	L	0.34521	1.04	0.80722	D	1	P	0.46784	0.884	B	0.31946	0.138	T	0.46992	-0.9151	9	0.87932	D	0	-18.0862	14.1229	0.65201	1.0:0.0:0.0:0.0	.	380	Q5T9C2	F102A_HUMAN	A	380;238	.	ENSP00000362176:V238A	V	-	2	0	FAM102A	129745308	1.000000	0.71417	0.991000	0.47740	0.965000	0.64279	8.449000	0.90337	2.076000	0.62316	0.379000	0.24179	GTG	.		0.562	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054298.2		
FAM184B	27146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	17710586	17710586	+	Missense_Mutation	SNP	C	C	A	rs61746992	byFrequency	TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:17710586C>A	ENST00000265018.3	-	2	1035	c.823G>T	c.(823-825)Gac>Tac	p.D275Y		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	275										NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						TGCTCCAGGTCTCCTTCCAGC	0.577																																					p.D275Y		.											.	FAM184B	23	0			c.G823T						.						63.0	55.0	58.0					4																	17710586		692	1591	2283	SO:0001583	missense	27146	exon2			CCAGGTCTCCTTC		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.823G>T	4.37:g.17710586C>A	ENSP00000265018:p.Asp275Tyr	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	45.0	NM_015688		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705797	0.68615	.	.	ENSG00000047662	ENST00000265018	T	0.78126	-1.15	5.14	5.14	0.70334	.	0.185429	0.46442	D	0.000283	D	0.86527	0.5954	L	0.60455	1.87	0.51767	D	0.999939	D	0.69078	0.997	D	0.79784	0.993	D	0.87480	0.2420	10	0.87932	D	0	-31.9922	18.7908	0.91973	0.0:1.0:0.0:0.0	.	275	Q9ULE4	F184B_HUMAN	Y	275	ENSP00000265018:D275Y	ENSP00000265018:D275Y	D	-	1	0	FAM184B	17319684	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.542000	0.53625	2.665000	0.90641	0.655000	0.94253	GAC	C|0.972;G|0.028		0.577	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
FAM20B	9917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179013021	179013021	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:179013021C>T	ENST00000263733.4	+	2	375	c.39C>T	c.(37-39)ctC>ctT	p.L13L		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	13						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						TAGCAATTCTCCTTGTCATTT	0.468																																					p.L13L		.											.	FAM20B	93	0			c.C39T						.						99.0	85.0	90.0					1																	179013021		2203	4300	6503	SO:0001819	synonymous_variant	9917	exon2			AATTCTCCTTGTC	AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.39C>T	1.37:g.179013021C>T		Somatic	127.0	0.0		WXS	Illumina HiSeq	Phase_I	209.0	75.0	NM_014864	Q5W0C3|Q5W0C4	Silent	SNP	ENST00000263733.4	37	CCDS1328.1																																																																																			.		0.468	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084922.1	NM_014864	
FGFBP1	9982	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	15938165	15938165	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:15938165G>T	ENST00000382333.1	-	3	385	c.91C>A	c.(91-93)Ctt>Att	p.L31I	FGFBP1_ENST00000259988.2_Missense_Mutation_p.L31I	NM_005130.4	NP_005121.1	Q14512	FGFP1_HUMAN	fibroblast growth factor binding protein 1	31					cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|signal transduction (GO:0007165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|prostate(2)|skin(1)	10						TTGCTGTGAAGTCCATTCTTC	0.507																																					p.L31I		.											.	FGFBP1	90	0			c.C91A						.						90.0	93.0	92.0					4																	15938165		2203	4299	6502	SO:0001583	missense	9982	exon3			TGTGAAGTCCATT	M60047	CCDS3418.1	4p15.32	2008-02-05			ENSG00000137440	ENSG00000137440			19695	protein-coding gene	gene with protein product		607737				11148217, 1885605	Standard	NM_005130		Approved	HBP17, FGFBP	uc003gom.3	Q14512	OTTHUMG00000097745	ENST00000382333.1:c.91C>A	4.37:g.15938165G>T	ENSP00000371770:p.Leu31Ile	Somatic	318.0	2.0		WXS	Illumina HiSeq	Phase_I	300.0	107.0	NM_005130	A8K5J2	Missense_Mutation	SNP	ENST00000382333.1	37	CCDS3418.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.401436	0.42613	.	.	ENSG00000137440	ENST00000382333;ENST00000259988	T;T	0.14022	2.54;2.54	4.97	0.325	0.15903	.	3.692360	0.00751	N	0.001064	T	0.12263	0.0298	N	0.22421	0.69	0.09310	N	1	B	0.25955	0.138	B	0.29663	0.105	T	0.35126	-0.9801	10	0.46703	T	0.11	2.6573	8.4857	0.33069	0.0:0.4745:0.2801:0.2454	.	31	Q14512	FGFP1_HUMAN	I	31	ENSP00000371770:L31I;ENSP00000259988:L31I	ENSP00000259988:L31I	L	-	1	0	FGFBP1	15547263	0.000000	0.05858	0.001000	0.08648	0.616000	0.37450	0.511000	0.22739	0.100000	0.17581	0.579000	0.79373	CTT	.		0.507	FGFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214974.1	NM_005130	
FLG	2312	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	152280175	152280175	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:152280175T>C	ENST00000368799.1	-	3	7222	c.7187A>G	c.(7186-7188)cAc>cGc	p.H2396R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2396	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGACTCTTGGTGGCTCTGCTG	0.582									Ichthyosis																												p.H2396R		.											.	FLG	106	0			c.A7187G						.						67.0	71.0	70.0					1																	152280175		2202	4279	6481	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCTTGGTGGCTCT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7187A>G	1.37:g.152280175T>C	ENSP00000357789:p.His2396Arg	Somatic	393.0	1.0		WXS	Illumina HiSeq	Phase_I	404.0	106.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.254229	0.22965	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01629	4.72	3.84	-1.46	0.08800	.	.	.	.	.	T	0.00815	0.0027	M	0.78223	2.4	0.09310	N	1	B	0.18741	0.03	B	0.15052	0.012	T	0.41124	-0.9526	9	0.30078	T	0.28	.	3.9105	0.09201	0.0:0.3241:0.1923:0.4836	.	2396	P20930	FILA_HUMAN	R	2396;306	ENSP00000357789:H2396R	ENSP00000271820:H306R	H	-	2	0	FLG	150546799	0.000000	0.05858	0.007000	0.13788	0.038000	0.13279	-0.412000	0.07132	-0.127000	0.11661	0.397000	0.26171	CAC	.		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLAD1	80308	ucsc.edu;bcgsc.ca	37	1	154956204	154956204	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:154956204A>G	ENST00000292180.3	+	1	356	c.34A>G	c.(34-36)Agg>Ggg	p.R12G	FLAD1_ENST00000315144.10_Intron|FLAD1_ENST00000368432.1_Intron|FLAD1_ENST00000368431.3_Intron|FLAD1_ENST00000487371.1_Intron|FLAD1_ENST00000368433.1_Missense_Mutation_p.R12G	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	12					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TTTATTCCAGAGGCAGGAACA	0.463																																					p.R12G		.											.	FLAD1	93	0			c.A34G						.						111.0	110.0	110.0					1																	154956204		2203	4300	6503	SO:0001583	missense	80308	exon1			TTCCAGAGGCAGG		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.34A>G	1.37:g.154956204A>G	ENSP00000292180:p.Arg12Gly	Somatic	54.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_025207	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	.	.	.	.	.	.	.	.	.	.	A	12.14	1.849331	0.32699	.	.	ENSG00000160688	ENST00000368433;ENST00000292180	.	.	.	3.71	-3.72	0.04411	.	.	.	.	.	T	0.04724	0.0128	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.35025	-0.9805	8	0.87932	D	0	0.9434	1.1521	0.01788	0.365:0.1589:0.3213:0.1549	.	12	Q8NFF5	FAD1_HUMAN	G	12	.	ENSP00000292180:R12G	R	+	1	2	FLAD1	153222828	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.504000	0.06375	-0.748000	0.04753	-0.379000	0.06801	AGG	.		0.463	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091089.1	NM_025207	
FOCAD	54914	ucsc.edu;bcgsc.ca	37	9	20717832	20717832	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:20717832G>T	ENST00000380249.1	+	5	461	c.97G>T	c.(97-99)Ggt>Tgt	p.G33C	MIR491_ENST00000384877.1_RNA|FOCAD_ENST00000338382.6_Missense_Mutation_p.G33C	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	33						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											aaaggaaaatggtttttcAGA	0.333																																					p.G33C		.											.	.	.	0			c.G97T						.						137.0	129.0	132.0					9																	20717832		2203	4300	6503	SO:0001583	missense	54914	exon5			GAAAATGGTTTTT	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.97G>T	9.37:g.20717832G>T	ENSP00000369599:p.Gly33Cys	Somatic	78.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_017794	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	G	15.47	2.844450	0.51164	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.07327	3.2;3.2	5.83	2.59	0.31030	Domain of unknown function DUF3730 (1);	0.298462	0.35805	N	0.002972	T	0.07638	0.0192	N	0.19112	0.55	0.32934	D	0.51756	P	0.45126	0.851	P	0.47626	0.552	T	0.17410	-1.0370	10	0.49607	T	0.09	-0.0315	8.2529	0.31737	0.2827:0.0:0.7173:0.0	.	33	Q5VW36	K1797_HUMAN	C	33	ENSP00000369599:G33C;ENSP00000344307:G33C	ENSP00000344307:G33C	G	+	1	0	KIAA1797	20707832	0.932000	0.31603	0.794000	0.32065	0.989000	0.77384	1.041000	0.30291	0.825000	0.34637	0.561000	0.74099	GGT	.		0.333	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143442.1	NM_017794	
GAB1	2549	ucsc.edu;bcgsc.ca	37	4	144381615	144381615	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:144381615A>G	ENST00000262994.4	+	8	2080	c.1778A>G	c.(1777-1779)aAc>aGc	p.N593S	GAB1_ENST00000262995.4_Missense_Mutation_p.N623S|GAB1_ENST00000505913.1_Missense_Mutation_p.N490S	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	593					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					GTTCCCATGAACCCAAACCTG	0.448																																					p.N623S		.											.	GAB1	1146	0			c.A1868G						.						157.0	154.0	155.0					4																	144381615		2203	4300	6503	SO:0001583	missense	2549	exon9			CCATGAACCCAAA	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1778A>G	4.37:g.144381615A>G	ENSP00000262994:p.Asn593Ser	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	45.0	5.0	NM_207123	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	ENST00000262994.4	37	CCDS3759.1	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908072	0.52333	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000505913	T;T;T	0.14022	2.54;2.54;2.54	5.57	5.57	0.84162	.	0.267397	0.42964	D	0.000628	T	0.19406	0.0466	L	0.54323	1.7	0.34034	D	0.654184	P;P	0.49253	0.651;0.921	B;P	0.45998	0.152;0.5	T	0.23440	-1.0188	10	0.27082	T	0.32	-0.8716	15.7316	0.77810	1.0:0.0:0.0:0.0	.	593;623	Q13480;Q13480-2	GAB1_HUMAN;.	S	623;593;490	ENSP00000262995:N623S;ENSP00000262994:N593S;ENSP00000424554:N490S	ENSP00000262994:N593S	N	+	2	0	GAB1	144601065	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.703000	0.54808	2.109000	0.64355	0.482000	0.46254	AAC	.		0.448	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000364998.1	NM_002039	
GAL3ST3	89792	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	65810617	65810617	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:65810617G>A	ENST00000312006.4	-	3	938	c.657C>T	c.(655-657)gaC>gaT	p.D219D	GAL3ST3_ENST00000527878.1_Silent_p.D219D	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	219					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						AGGCGGCGTCGTCGCGCGGGC	0.667																																					p.D219D		.											.	GAL3ST3	91	0			c.C657T						.						33.0	38.0	36.0					11																	65810617		2199	4292	6491	SO:0001819	synonymous_variant	89792	exon3			GGCGTCGTCGCGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.657C>T	11.37:g.65810617G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	20.0	NM_033036	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			.		0.667	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
GBP2	2634	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	89573964	89573964	+	Missense_Mutation	SNP	C	C	T	rs200077424		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:89573964C>T	ENST00000370466.3	-	11	1938	c.1670G>A	c.(1669-1671)cGc>cAc	p.R557H	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	557					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.R557H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		CTTGAGAAGGCGTTCCTGTTC	0.408																																					p.R557H		.											.	GBP2	91	1	Substitution - Missense(1)	endometrium(1)	c.G1670A						.						122.0	113.0	116.0					1																	89573964		2203	4300	6503	SO:0001583	missense	2634	exon11			AGAAGGCGTTCCT	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.1670G>A	1.37:g.89573964C>T	ENSP00000359497:p.Arg557His	Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	20.0	NM_004120	Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	37	CCDS719.1	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680795	0.47886	.	.	ENSG00000162645	ENST00000370466	T	0.55760	0.5	4.29	-6.79	0.01715	Guanylate-binding protein, C-terminal (3);	2.631740	0.03031	U	0.152049	T	0.42988	0.1227	M	0.81802	2.56	0.09310	N	1	D	0.55605	0.972	P	0.51355	0.667	T	0.55211	-0.8176	10	0.59425	D	0.04	-10.6503	7.0098	0.24855	0.2258:0.1683:0.0:0.6059	.	557	P32456	GBP2_HUMAN	H	557	ENSP00000359497:R557H	ENSP00000359497:R557H	R	-	2	0	GBP2	89346552	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-6.050000	0.00083	-1.516000	0.01782	-0.152000	0.13540	CGC	C|0.999;T|0.001		0.408	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120	
GFRA2	2675	ucsc.edu;bcgsc.ca	37	8	21560353	21560353	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:21560353C>T	ENST00000524240.1	-	7	1832	c.1182G>A	c.(1180-1182)ttG>ttA	p.L394L	GFRA2_ENST00000518077.1_Silent_p.L261L|GFRA2_ENST00000517328.1_Silent_p.L394L|GFRA2_ENST00000400782.4_Silent_p.L289L	NM_001495.4	NP_001486.4	O00451	GFRA2_HUMAN	GDNF family receptor alpha 2	394					negative regulation of protein autophosphorylation (GO:0031953)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	anchored component of membrane (GO:0031225)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|prostate(1)|skin(1)	7				Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		CACTGGTCCCCAAGCTGGTAC	0.617																																					p.L394L		.											.	.	.	0			c.G1182A						.						87.0	94.0	92.0					8																	21560353		2099	4210	6309	SO:0001819	synonymous_variant	2675	exon7			GGTCCCCAAGCTG	AF002700	CCDS47816.1, CCDS55207.1	8p21.3	2008-05-02			ENSG00000168546	ENSG00000168546			4244	protein-coding gene	gene with protein product		601956				9177201	Standard	NM_001165038		Approved	RETL2, GDNFRB, NTNRA, TRNR2	uc003wzu.1	O00451	OTTHUMG00000163897	ENST00000524240.1:c.1182G>A	8.37:g.21560353C>T		Somatic	146.0	1.0		WXS	Illumina HiSeq	.	63.0	7.0	NM_001495	E9PD47|O15316|O15328|Q58J92|Q6GTR9|Q7Z5C2	Silent	SNP	ENST00000524240.1	37	CCDS47816.1																																																																																			.		0.617	GFRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376254.3	NM_001495	
GNGT2	2793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47284179	47284179	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:47284179G>A	ENST00000511277.1	-	4	329	c.150C>T	c.(148-150)ctC>ctT	p.L50L	GNGT2_ENST00000511673.1_Silent_p.L50L|GNGT2_ENST00000515635.1_Silent_p.L50L|GNGT2_ENST00000300406.2_Silent_p.L50L|GNGT2_ENST00000503070.1_Silent_p.L50L|GNGT2_ENST00000507680.1_Silent_p.L50L	NM_001198756.1	NP_001185685.1	O14610	GBGT2_HUMAN	guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2	50					G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|phototransduction (GO:0007602)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)	p.L50L(1)		endometrium(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			GGATGCCTTTGAGAAAAGGAT	0.493																																					p.L50L		.											.	GNGT2	227	1	Substitution - coding silent(1)	urinary_tract(1)	c.C150T						.						172.0	149.0	157.0					17																	47284179		2203	4300	6503	SO:0001819	synonymous_variant	2793	exon4			GCCTTTGAGAAAA		CCDS11545.1	17q21	2003-12-17				ENSG00000167083			4412	protein-coding gene	gene with protein product		139391				9286705	Standard	NM_031498		Approved	GNG9	uc021tzq.1	O14610		ENST00000511277.1:c.150C>T	17.37:g.47284179G>A		Somatic	247.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	64.0	NM_031498	B2R746|D3DTW5	Silent	SNP	ENST00000511277.1	37	CCDS11545.1																																																																																			.		0.493	GNGT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364482.1	NM_031498	
GPR114	221188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57596061	57596061	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:57596061C>T	ENST00000340339.4	+	2	579	c.56C>T	c.(55-57)gCa>gTa	p.A19V	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Missense_Mutation_p.A19V	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	19					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						TTGCAGAATGCAACAACAGGT	0.562																																					p.A19V		.											.	GPR114	90	0			c.C56T						.						68.0	64.0	65.0					16																	57596061		2198	4300	6498	SO:0001583	missense	221188	exon2			AGAATGCAACAAC	AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.56C>T	16.37:g.57596061C>T	ENSP00000342981:p.Ala19Val	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	47.0	23.0	NM_153837	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	ENST00000340339.4	37	CCDS10785.1	.	.	.	.	.	.	.	.	.	.	C	8.768	0.925292	0.18056	.	.	ENSG00000159618	ENST00000394361;ENST00000340339;ENST00000349457	T;T	0.28069	1.63;1.63	4.15	-3.43	0.04810	.	2.191750	0.02573	N	0.098001	T	0.13670	0.0331	N	0.12182	0.205	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.08269	-1.0730	10	0.21014	T	0.42	.	0.4945	0.00569	0.205:0.2823:0.2186:0.2941	.	19;19	B4E148;Q8IZF4	.;GP114_HUMAN	V	19	ENSP00000342981:A19V;ENSP00000290823:A19V	ENSP00000342981:A19V	A	+	2	0	GPR114	56153562	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.017000	0.12590	-0.615000	0.05679	-0.367000	0.07326	GCA	.		0.562	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257336.3	NM_153837	
GREB1L	80000	ucsc.edu;bcgsc.ca	37	18	19020239	19020239	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr18:19020239T>C	ENST00000580732.2	+	9	1340	c.959T>C	c.(958-960)tTc>tCc	p.F320S	GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000424526.1_Missense_Mutation_p.F320S|GREB1L_ENST00000431264.1_Missense_Mutation_p.F320S|GREB1L_ENST00000269218.6_Missense_Mutation_p.F320S|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000400483.4_Missense_Mutation_p.F320S			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	320						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						GCTACCATGTTCATTTCTGGG	0.448																																					p.F320S		.											.	.	.	0			c.T959C						.						74.0	68.0	70.0					18																	19020239		692	1591	2283	SO:0001583	missense	80000	exon9			CCATGTTCATTTC	AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.959T>C	18.37:g.19020239T>C	ENSP00000464162:p.Phe320Ser	Somatic	51.0	0.0		WXS	Illumina HiSeq	.	33.0	4.0	NM_001142966	A4QN17|Q9H8F1	Missense_Mutation	SNP	ENST00000580732.2	37	CCDS45836.1	.	.	.	.	.	.	.	.	.	.	T	8.066	0.769171	0.15983	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.12672	3.41;3.41;2.67;2.66	5.48	4.34	0.51931	.	.	.	.	.	T	0.04497	0.0123	N	0.03608	-0.345	0.29479	N	0.856471	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38779	-0.9645	9	0.08837	T	0.75	-2.7186	3.2118	0.06685	0.0:0.3578:0.0:0.6422	.	320;320	Q9C091;Q9C091-2	GRB1L_HUMAN;.	S	320	ENSP00000412060:F320S;ENSP00000269218:F320S;ENSP00000383331:F320S;ENSP00000393125:F320S	ENSP00000269218:F320S	F	+	2	0	GREB1L	17274237	1.000000	0.71417	0.991000	0.47740	0.943000	0.58893	3.588000	0.53964	2.085000	0.62840	0.528000	0.53228	TTC	.		0.448	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443782.2	NM_024935	
GRM5	2915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	88583097	88583097	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:88583097C>T	ENST00000305447.4	-	2	1037	c.888G>A	c.(886-888)gcG>gcA	p.A296A	GRM5_ENST00000455756.2_Silent_p.A296A|GRM5_ENST00000305432.5_Silent_p.A296A|GRM5_ENST00000393297.1_Silent_p.A296A|GRM5_ENST00000418177.2_Silent_p.A296A	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	296					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	GAAATTCTCCCGCTAGACCCA	0.517																																					p.A296A		.											.	GRM5	949	0			c.G888A						.						61.0	68.0	66.0					11																	88583097		2201	4299	6500	SO:0001819	synonymous_variant	2915	exon3			TTCTCCCGCTAGA	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.888G>A	11.37:g.88583097C>T		Somatic	193.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	78.0	NM_000842	Q6J164	Silent	SNP	ENST00000305447.4	37	CCDS44694.1																																																																																			.		0.517	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259226.1	NM_000842	
GUF1	60558	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	44697656	44697656	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:44697656A>T	ENST00000281543.5	+	15	1934	c.1740A>T	c.(1738-1740)aaA>aaT	p.K580N	RP11-700J17.1_ENST00000610260.1_RNA|GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						CAATTGGCAAAGCCATATGTG	0.358																																					p.K580N		.											.	GUF1	91	0			c.A1740T						.						65.0	67.0	66.0					4																	44697656		2203	4300	6503	SO:0001583	missense	60558	exon15			TGGCAAAGCCATA		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1740A>T	4.37:g.44697656A>T	ENSP00000281543:p.Lys580Asn	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	35.0	NM_021927		Missense_Mutation	SNP	ENST00000281543.5	37	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.028402	0.54790	.	.	ENSG00000151806	ENST00000281543	T	0.71103	-0.54	5.74	4.58	0.56647	GTP-binding protein LepA, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.77498	0.4139	M	0.74389	2.26	0.58432	D	0.999999	D	0.56287	0.975	P	0.56514	0.8	T	0.79801	-0.1650	10	0.87932	D	0	-23.4571	7.8275	0.29324	0.8466:0.0:0.1534:0.0	.	580	Q8N442	GUF1_HUMAN	N	580	ENSP00000281543:K580N	ENSP00000281543:K580N	K	+	3	2	GUF1	44392413	0.998000	0.40836	0.992000	0.48379	0.057000	0.15508	3.069000	0.50026	2.183000	0.69458	0.533000	0.62120	AAA	.		0.358	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	
GSTCD	79807	ucsc.edu;bcgsc.ca	37	4	106647833	106647833	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:106647833C>T	ENST00000515279.1	+	4	1212	c.992C>T	c.(991-993)gCa>gTa	p.A331V	GSTCD_ENST00000394730.3_Missense_Mutation_p.A244V|GSTCD_ENST00000394728.3_Missense_Mutation_p.A331V|GSTCD_ENST00000507281.1_Missense_Mutation_p.A244V|GSTCD_ENST00000515255.1_3'UTR|GSTCD_ENST00000360505.5_Missense_Mutation_p.A331V			Q8NEC7	GSTCD_HUMAN	glutathione S-transferase, C-terminal domain containing	331	GST C-terminal.			Missing (in Ref. 4; AAH32942). {ECO:0000305}.		extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	14		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.15e-07)|READ - Rectum adenocarcinoma(30;0.139)		GTAAAAACAGCAGCTTCTAAG	0.423																																					p.A331V		.											.	GSTCD	92	0			c.C992T						.						85.0	75.0	78.0					4																	106647833		2203	4300	6503	SO:0001583	missense	79807	exon4			AAACAGCAGCTTC	BC032942	CCDS3672.2, CCDS43257.1	4q24	2008-02-05	2006-05-09		ENSG00000138780	ENSG00000138780			25806	protein-coding gene	gene with protein product		615912	"""Glutathione S-transferase, C-terminal domain containing"""			12477932	Standard	NM_001031720		Approved	FLJ13273	uc003hxz.4	Q8NEC7	OTTHUMG00000131211	ENST00000515279.1:c.992C>T	4.37:g.106647833C>T	ENSP00000422354:p.Ala331Val	Somatic	115.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_001031720	A8K8J0|A8MVD3|H9KV97|Q9H8S3	Missense_Mutation	SNP	ENST00000515279.1	37	CCDS43257.1	.	.	.	.	.	.	.	.	.	.	C	31	5.099820	0.94197	.	.	ENSG00000138780	ENST00000394730;ENST00000507281;ENST00000515279;ENST00000360505;ENST00000394728	D;D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18;-3.18	5.39	5.39	0.77823	Glutathione S-transferase, C-terminal-like (1);Glutathione S-transferase/chloride channel, C-terminal (1);	0.052479	0.85682	D	0.000000	D	0.95890	0.8662	M	0.76002	2.32	0.58432	D	0.999997	D;D	0.63880	0.982;0.993	P;P	0.57371	0.819;0.736	D	0.96221	0.9160	10	0.87932	D	0	-5.5407	19.1522	0.93493	0.0:1.0:0.0:0.0	.	244;331	D6R9W2;Q8NEC7	.;GSTCD_HUMAN	V	244;244;331;331;331	ENSP00000378218:A244V;ENSP00000422858:A244V;ENSP00000422354:A331V;ENSP00000353695:A331V;ENSP00000378216:A331V	ENSP00000353695:A331V	A	+	2	0	GSTCD	106867282	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.950000	0.70265	2.529000	0.85273	0.591000	0.81541	GCA	.		0.423	GSTCD-006	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363981.1	NM_024751	
HAUS5	23354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36106172	36106172	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:36106172G>A	ENST00000203166.5	+	6	394	c.369G>A	c.(367-369)caG>caA	p.Q123Q	AC002115.9_ENST00000589603.1_lincRNA|HAUS5_ENST00000379045.2_Silent_p.Q123Q	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	123					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						AAGACACCCAGCGTCGAGCTC	0.642																																					p.Q123Q		.											.	HAUS5	68	0			c.G369A						.						29.0	34.0	32.0					19																	36106172		2140	4258	6398	SO:0001819	synonymous_variant	23354	exon6			CACCCAGCGTCGA	AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.369G>A	19.37:g.36106172G>A		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	22.0	NM_015302	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Silent	SNP	ENST00000203166.5	37	CCDS42550.1																																																																																			.		0.642	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459055.2		
HKDC1	80201	ucsc.edu;bcgsc.ca	37	10	71002998	71002998	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:71002998A>G	ENST00000354624.5	+	7	885	c.752A>G	c.(751-753)gAc>gGc	p.D251G	HKDC1_ENST00000395086.2_Missense_Mutation_p.D251G	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	251	Hexokinase type-2 1.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GTGGAGGGCGACGAGGGCAGG	0.592																																					p.D251G		.											.	HKDC1	95	0			c.A752G						.						130.0	118.0	122.0					10																	71002998		2203	4300	6503	SO:0001583	missense	80201	exon7			AGGGCGACGAGGG		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.752A>G	10.37:g.71002998A>G	ENSP00000346643:p.Asp251Gly	Somatic	80.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	37	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.951628	0.92660	.	.	ENSG00000156510	ENST00000354624;ENST00000395087;ENST00000395086	T;T	0.11495	2.77;2.77	5.44	5.44	0.79542	Hexokinase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.19287	0.0463	M	0.78456	2.415	0.80722	D	1	B	0.24721	0.11	B	0.27796	0.083	T	0.01648	-1.1304	10	0.72032	D	0.01	-30.8313	15.6477	0.77068	1.0:0.0:0.0:0.0	.	251	Q2TB90	HKDC1_HUMAN	G	251	ENSP00000346643:D251G;ENSP00000378521:D251G	ENSP00000346643:D251G	D	+	2	0	HKDC1	70673004	1.000000	0.71417	0.985000	0.45067	0.974000	0.67602	9.107000	0.94261	2.283000	0.76528	0.533000	0.62120	GAC	.		0.592	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
HNF1A	6927	ucsc.edu;bcgsc.ca	37	12	121434085	121434085	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:121434085G>T	ENST00000257555.6	+	5	1202	c.976G>T	c.(976-978)Gcg>Tcg	p.A326S	HNF1A_ENST00000541395.1_Missense_Mutation_p.A326S|HNF1A_ENST00000543427.1_Missense_Mutation_p.A209S|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Missense_Mutation_p.A326S|HNF1A_ENST00000402929.1_Missense_Mutation_p.A326S|HNF1A_ENST00000400024.2_Missense_Mutation_p.A326S			P20823	HNF1A_HUMAN	HNF1 homeobox A	326					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGGACAGCCTGCGACCAGTGA	0.632									Hepatic Adenoma, Familial Clustering of																												p.A326S		.											.	HNF1A	1745	0			c.G976T						.						137.0	96.0	110.0					12																	121434085		2203	4300	6503	SO:0001583	missense	6927	exon5	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	CAGCCTGCGACCA	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.976G>T	12.37:g.121434085G>T	ENSP00000257555:p.Ala326Ser	Somatic	55.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_000545	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	ENST00000257555.6	37	CCDS9209.1	.	.	.	.	.	.	.	.	.	.	G	0.942	-0.709130	0.03230	.	.	ENSG00000135100	ENST00000257555;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.97138	-4.26;-4.26;-4.26;-4.26	5.21	1.17	0.20885	Hepatocyte nuclear factor 1, beta isoform, C-terminal (1);	0.444670	0.22705	N	0.056647	D	0.90363	0.6984	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.28128	0.016;0.011;0.201;0.024	B;B;B;B	0.28305	0.037;0.062;0.088;0.06	T	0.80141	-0.1506	10	0.06757	T	0.87	-4.5432	6.7058	0.23250	0.2711:0.1903:0.5385:0.0	.	326;326;326;326	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	S	326;326;326;326;209;326;326;326;326;326	ENSP00000257555:A326S;ENSP00000439721:A209S;ENSP00000443112:A326S;ENSP00000438804:A326S	ENSP00000257555:A326S	A	+	1	0	HNF1A	119918468	0.648000	0.27313	0.020000	0.16555	0.005000	0.04900	0.974000	0.29436	0.229000	0.21039	-0.158000	0.13435	GCG	.		0.632	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320957.5	NM_000545	
ICAM5	7087	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10404831	10404831	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:10404831G>A	ENST00000221980.4	+	8	1890	c.1827G>A	c.(1825-1827)gtG>gtA	p.V609V		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	609	Ig-like C2-type 7.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			TGAAGTGCGTGGGCTCCGGGG	0.647																																					p.V609V		.											.	ICAM5	153	0			c.G1827A						.						61.0	78.0	72.0					19																	10404831		2201	4291	6492	SO:0001819	synonymous_variant	7087	exon8			GTGCGTGGGCTCC	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1827G>A	19.37:g.10404831G>A		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	44.0	22.0	NM_003259	Q9Y6F3	Silent	SNP	ENST00000221980.4	37	CCDS12233.1																																																																																			.		0.647	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
IFT80	57560	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	159976324	159976324	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:159976324A>G	ENST00000326448.7	-	20	2755	c.2323T>C	c.(2323-2325)Tta>Cta	p.L775L	RP11-432B6.3_ENST00000483754.1_Silent_p.L946L|IFT80_ENST00000496589.1_Silent_p.L638L|IFT80_ENST00000483465.1_Silent_p.L638L	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	775					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TAGGGCTTTAAACCTATACTC	0.353																																					p.L775L		.											.	IFT80	522	0			c.T2323C						.						233.0	216.0	221.0					3																	159976324		2203	4300	6503	SO:0001819	synonymous_variant	57560	exon20			GCTTTAAACCTAT	AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.2323T>C	3.37:g.159976324A>G		Somatic	292.0	2.0		WXS	Illumina HiSeq	Phase_I	189.0	121.0	NM_020800	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Silent	SNP	ENST00000326448.7	37	CCDS3188.1																																																																																			.		0.353	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352651.2	NM_020800	
IL12RB1	3594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	18188364	18188364	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:18188364G>A	ENST00000600835.2	-	6	809	c.511C>T	c.(511-513)Cag>Tag	p.Q171*	IL12RB1_ENST00000322153.7_Nonsense_Mutation_p.Q171*|IL12RB1_ENST00000593993.2_Nonsense_Mutation_p.Q171*			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	171	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						TGCCGGAACTGCACCTCAGCA	0.592																																					p.Q171X		.											.	IL12RB1	91	0			c.C511T						.						72.0	56.0	61.0					19																	18188364		2203	4300	6503	SO:0001587	stop_gained	3594	exon5			GGAACTGCACCTC	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.511C>T	19.37:g.18188364G>A	ENSP00000470788:p.Gln171*	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	22.0	NM_153701	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Nonsense_Mutation	SNP	ENST00000600835.2	37	CCDS54232.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364002	0.61513	.	.	ENSG00000096996	ENST00000430026;ENST00000322153	.	.	.	3.76	2.55	0.30701	.	0.147877	0.30329	N	0.009879	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-23.4185	8.2813	0.31902	0.0:0.3301:0.6699:0.0	.	.	.	.	X	171	.	ENSP00000314425:Q171X	Q	-	1	0	IL12RB1	18049364	0.946000	0.32159	0.454000	0.27019	0.006000	0.05464	2.529000	0.45632	1.844000	0.53588	0.484000	0.47621	CAG	.		0.592	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466525.3		
IL36RN	26525	ucsc.edu;bcgsc.ca	37	2	113820248	113820248	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:113820248T>C	ENST00000393200.2	+	5	623	c.462T>C	c.(460-462)tgT>tgC	p.C154C	IL36RN_ENST00000346807.3_Silent_p.C154C	NM_012275.2	NP_036407.1	Q9UBH0	I36RA_HUMAN	interleukin 36 receptor antagonist	154					antifungal humoral response (GO:0019732)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of interferon-gamma secretion (GO:1902714)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)	extracellular space (GO:0005615)	interleukin-1 receptor antagonist activity (GO:0005152)			large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						TCCAGCAGTGTGACTAGGGCA	0.607																																					p.C154C		.											.	IL36RN	91	0			c.T462C						.						31.0	29.0	30.0					2																	113820248		2203	4300	6503	SO:0001819	synonymous_variant	26525	exon5			GCAGTGTGACTAG	AF201830	CCDS2111.1	2q14	2014-09-17	2011-06-06	2011-06-06	ENSG00000136695	ENSG00000136695		"""Interleukins and interleukin receptors"""	15561	protein-coding gene	gene with protein product	"""family of interleukin 1-delta"", ""interleukin-1 receptor antagonist homolog 1"", ""interleukin-1 HY1"", ""IL-1 related protein 3"""	605507	"""interleukin 1 family, member 5 (delta)"""	IL1F5		10625660, 10512743, 11574262	Standard	NM_012275		Approved	FIL1, FIL1(DELTA), FIL1D, IL1HY1, IL1RP3, IL1L1, IL-1F5, IL36RA, MGC29840	uc002tit.3	Q9UBH0	OTTHUMG00000131337	ENST00000393200.2:c.462T>C	2.37:g.113820248T>C		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_012275	A8K2I4|Q56AT9|Q7RTZ6	Silent	SNP	ENST00000393200.2	37	CCDS2111.1																																																																																			.		0.607	IL36RN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330729.1	NM_173170	
INSR	3643	ucsc.edu;bcgsc.ca	37	19	7126664	7126664	+	Splice_Site	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:7126664T>C	ENST00000302850.5	-	16	3088		c.e16-2		INSR_ENST00000341500.5_Splice_Site	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor						activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCTGGCTGCCTGGAGGAGGAA	0.547																																					.		.											.	INSR	1381	0			c.2910-2A>G						.						45.0	36.0	39.0					19																	7126664		2199	4281	6480	SO:0001630	splice_region_variant	3643	exon16			GCTGCCTGGAGGA	M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.2946-2A>G	19.37:g.7126664T>C		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_001079817	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Splice_Site	SNP	ENST00000302850.5	37	CCDS12176.1	.	.	.	.	.	.	.	.	.	.	T	14.46	2.541754	0.45280	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8224	0.57700	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	INSR	7077664	1.000000	0.71417	0.980000	0.43619	0.280000	0.26924	7.163000	0.77524	1.919000	0.55581	0.379000	0.24179	.	.		0.547	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458544.1		Intron
INTS10	55174	ucsc.edu;bcgsc.ca	37	8	19682425	19682425	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:19682425G>A	ENST00000397977.3	+	8	1346	c.948G>A	c.(946-948)ctG>ctA	p.L316L		NM_018142.2	NP_060612.2	Q9NVR2	INT10_HUMAN	integrator complex subunit 10	316					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	20				Colorectal(111;0.057)|COAD - Colon adenocarcinoma(73;0.215)		CCACCATGCTGGTCTTCTTTA	0.368																																					p.L316L		.											.	INTS10	91	0			c.G948A						.						103.0	94.0	97.0					8																	19682425		1884	4102	5986	SO:0001819	synonymous_variant	55174	exon8			CATGCTGGTCTTC	AK001431	CCDS6011.2	8p21.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000104613	ENSG00000104613			25548	protein-coding gene	gene with protein product		611353	"""chromosome 8 open reading frame 35"""	C8orf35		16239144	Standard	XM_005273558		Approved	FLJ10569, INT10	uc003wzj.3	Q9NVR2	OTTHUMG00000131065	ENST00000397977.3:c.948G>A	8.37:g.19682425G>A		Somatic	105.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_018142	Q6IA93|Q7L538|Q7L8C8|Q9H3W8	Silent	SNP	ENST00000397977.3	37	CCDS6011.2	.	.	.	.	.	.	.	.	.	.	G	9.494	1.101554	0.20632	.	.	ENSG00000104613	ENST00000523846	.	.	.	5.82	3.05	0.35203	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.0163	5.6224	0.17465	0.2214:0.0:0.6427:0.1359	.	.	.	.	X	92	.	.	W	+	2	0	INTS10	19726705	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	1.500000	0.35682	0.811000	0.34303	0.467000	0.42956	TGG	.		0.368	INTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253724.2	NM_018142	
ITPR2	3709	ucsc.edu;bcgsc.ca	37	12	26647251	26647251	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:26647251T>C	ENST00000381340.3	-	39	5621	c.5205A>G	c.(5203-5205)tcA>tcG	p.S1735S		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1735					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CCATCTTATCTGAATCTTGTC	0.318																																					p.S1735S		.											.	ITPR2	542	0			c.A5205G						.						86.0	70.0	75.0					12																	26647251		1822	4085	5907	SO:0001819	synonymous_variant	3709	exon39			CTTATCTGAATCT	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5205A>G	12.37:g.26647251T>C		Somatic	56.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_002223	O94773	Silent	SNP	ENST00000381340.3	37	CCDS41764.1																																																																																			.		0.318	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
KAT2A	2648	ucsc.edu;bcgsc.ca	37	17	40270418	40270418	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:40270418G>A	ENST00000225916.5	-	7	1130	c.1077C>T	c.(1075-1077)ttC>ttT	p.F359F		NM_021078.2	NP_066564.2	Q92830	KAT2A_HUMAN	K(lysine) acetyltransferase 2A	359					cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|histone H3-K14 acetylation (GO:0044154)|in utero embryonic development (GO:0001701)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|positive regulation of gluconeogenesis (GO:0045722)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somitogenesis (GO:0001756)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|extracellular space (GO:0005615)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	chromatin binding (GO:0003682)|H3 histone acetyltransferase activity (GO:0010484)|histone acetyltransferase activity (GO:0004402)|histone acetyltransferase activity (H4-K12 specific) (GO:0043997)|histone deacetylase binding (GO:0042826)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GCATGGACAGGAATCTGTAGG	0.602																																					p.F359F		.											.	KAT2A	523	0			c.C1077T						.						77.0	69.0	72.0					17																	40270418		2203	4300	6503	SO:0001819	synonymous_variant	2648	exon7			GGACAGGAATCTG	AF029777	CCDS11417.1	17q12-q21	2011-07-01	2008-07-04	2008-07-04	ENSG00000108773	ENSG00000108773		"""Chromatin-modifying enzymes / K-acetyltransferases"""	4201	protein-coding gene	gene with protein product		602301	"""GCN5 general control of amino-acid synthesis 5-like 2 (yeast)"""	GCN5L2		8552087	Standard	NM_021078		Approved	GCN5, PCAF-b	uc002hyx.2	Q92830	OTTHUMG00000133504	ENST00000225916.5:c.1077C>T	17.37:g.40270418G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	.	49.0	4.0	NM_021078	Q8N1A2|Q9UCW1	Silent	SNP	ENST00000225916.5	37	CCDS11417.1																																																																																			.		0.602	KAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257458.1	NM_021078	
AREL1	9870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	75140804	75140804	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:75140804A>T	ENST00000356357.4	-	9	1606	c.1091T>A	c.(1090-1092)gTg>gAg	p.V364E	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	364					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GAACTCCTTCACTGAGAATTG	0.408																																					p.V364E		.											.	KIAA0317	525	0			c.T1091A						.						73.0	71.0	72.0					14																	75140804		1881	4122	6003	SO:0001583	missense	9870	exon9			TCCTTCACTGAGA	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1091T>A	14.37:g.75140804A>T	ENSP00000348714:p.Val364Glu	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	14.0	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	37	CCDS41971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.7|26.7	4.758454|4.758454	0.89843|0.89843	.|.	.|.	ENSG00000119682|ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202|ENST00000490805	T;T|.	0.52526|.	0.66;0.66|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.168253|.	0.52532|.	D|.	0.000075|.	T|.	0.59555|.	0.2202|.	L|L	0.43152|0.43152	1.355|1.355	0.80722|0.80722	D|D	1|1	P;P|.	0.48503|.	0.557;0.911|.	B;P|.	0.51385|.	0.279;0.668|.	T|.	0.56938|.	-0.7896|.	10|.	0.72032|.	D|.	0.01|.	.|.	13.7014|13.7014	0.62611|0.62611	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	364;364|.	O15033-2;O15033|.	.;K0317_HUMAN|.	E|R	364;203;203|98	ENSP00000348714:V364E;ENSP00000452101:V203E|.	ENSP00000348714:V364E|.	V|X	-|-	2|1	0|0	KIAA0317|KIAA0317	74210557|74210557	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	8.782000|8.782000	0.91809|0.91809	2.159000|2.159000	0.67721|0.67721	0.477000|0.477000	0.44152|0.44152	GTG|TGA	.		0.408	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
KIAA1244	57221	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	138612924	138612924	+	Silent	SNP	G	G	A	rs140287471		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:138612924G>A	ENST00000251691.4	+	19	3268	c.3102G>A	c.(3100-3102)tcG>tcA	p.S1034S		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		ATGGTGCCTCGCAGCCCCCTC	0.652																																					p.S1034S		.											.	KIAA1244	228	0			c.G3102A						.	G		0,4402		0,0,2201	23.0	25.0	24.0		3102	-5.2	0.0	6	dbSNP_134	24	2,8594		0,2,4296	no	coding-synonymous	KIAA1244	NM_020340.4		0,2,6497	AA,AG,GG		0.0233,0.0,0.0154		1034/2178	138612924	2,12996	2201	4298	6499	SO:0001819	synonymous_variant	57221	exon19			TGCCTCGCAGCCC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.3102G>A	6.37:g.138612924G>A		Somatic	135.0	1.0		WXS	Illumina HiSeq	Phase_I	85.0	32.0	NM_020340		Silent	SNP	ENST00000251691.4	37	CCDS5189.2																																																																																			G|1.000;A|0.000		0.652	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
KIAA2026	158358	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5920263	5920263	+	Silent	SNP	G	G	T	rs535663249		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:5920263G>T	ENST00000399933.3	-	8	5732	c.5733C>A	c.(5731-5733)ctC>ctA	p.L1911L	KIAA2026_ENST00000381461.2_Silent_p.L1881L	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1911								p.L1086L(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TAGATATAAGGAGAACATGGC	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		19171	0.0		0.0	False		,,,				2504	0.001				p.L1911L		.											.	KIAA2026	92	1	Substitution - coding silent(1)	breast(1)	c.C5733A						.						135.0	135.0	135.0					9																	5920263		1888	4109	5997	SO:0001819	synonymous_variant	158358	exon8			TATAAGGAGAACA	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.5733C>A	9.37:g.5920263G>T		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	31.0	NM_001017969	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Silent	SNP	ENST00000399933.3	37																																																																																				.		0.443	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051652.2	NM_001017969	
KIF13B	23303	ucsc.edu;bcgsc.ca	37	8	28980997	28980997	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:28980997T>C	ENST00000524189.1	-	28	3403	c.3365A>G	c.(3364-3366)gAt>gGt	p.D1122G	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1122					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GTCAGCATCATCCTCTGTTTT	0.468																																					p.D1122G		.											.	KIF13B	22	0			c.A3365G						.						140.0	138.0	139.0					8																	28980997		1945	4151	6096	SO:0001583	missense	23303	exon28			GCATCATCCTCTG	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3365A>G	8.37:g.28980997T>C	ENSP00000427900:p.Asp1122Gly	Somatic	81.0	0.0		WXS	Illumina HiSeq	.	16.0	4.0	NM_015254	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	T	19.98	3.926605	0.73327	.	.	ENSG00000197892	ENST00000524189	T	0.76578	-1.03	4.59	4.59	0.56863	.	0.095170	0.64402	D	0.000001	T	0.78953	0.4365	L	0.55481	1.735	0.80722	D	1	P	0.37352	0.591	P	0.45037	0.467	T	0.81167	-0.1056	10	0.62326	D	0.03	.	14.1955	0.65667	0.0:0.0:0.0:1.0	.	1122	F8VPJ2	.	G	1122	ENSP00000427900:D1122G	ENSP00000427900:D1122G	D	-	2	0	KIF13B	29036916	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	7.418000	0.80167	1.926000	0.55796	0.529000	0.55759	GAT	.		0.468	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376878.1		
KIF21B	23046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200960199	200960199	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:200960199C>A	ENST00000422435.2	-	18	2849	c.2533G>T	c.(2533-2535)Gac>Tac	p.D845Y	KIF21B_ENST00000360529.5_Missense_Mutation_p.D845Y|KIF21B_ENST00000332129.2_Missense_Mutation_p.D845Y|KIF21B_ENST00000461742.2_Missense_Mutation_p.D845Y	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	845					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GCCCCAGAGTCCAGCATGGGT	0.617																																					p.D845Y		.											.	KIF21B	96	0			c.G2533T						.						69.0	72.0	71.0					1																	200960199		2203	4300	6503	SO:0001583	missense	23046	exon18			CAGAGTCCAGCAT	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2533G>T	1.37:g.200960199C>A	ENSP00000411831:p.Asp845Tyr	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	171.0	47.0	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	37	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364284	0.82463	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.72167	-0.28;-0.59;-0.63;-0.32	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.81049	0.4742	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.998;0.999	P;P;P;D	0.65874	0.87;0.87;0.87;0.939	T	0.81152	-0.1063	9	.	.	.	.	16.9766	0.86315	0.0:1.0:0.0:0.0	.	845;845;845;845	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	Y	845	ENSP00000328494:D845Y;ENSP00000353724:D845Y;ENSP00000433808:D845Y;ENSP00000411831:D845Y	.	D	-	1	0	KIF21B	199226822	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	7.381000	0.79718	2.305000	0.77605	0.591000	0.81541	GAC	.		0.617	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
KIF22	3835	broad.mit.edu;ucsc.edu;mdanderson.org	37	16	29816332	29816332	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:29816332C>A	ENST00000160827.4	+	12	1915	c.1875C>A	c.(1873-1875)caC>caA	p.H625Q	MAZ_ENST00000219782.6_5'Flank|MAZ_ENST00000322945.6_5'Flank|AC009133.15_ENST00000566537.1_RNA|KIF22_ENST00000561482.1_Missense_Mutation_p.H557Q|KIF22_ENST00000569382.2_Missense_Mutation_p.H571Q|MAZ_ENST00000563402.1_5'Flank|MAZ_ENST00000545521.1_5'Flank|MAZ_ENST00000562337.1_5'Flank|MAZ_ENST00000566906.2_5'Flank|KIF22_ENST00000400751.5_Missense_Mutation_p.H557Q	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	625					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						GGGAGCTCCACGGCCCCTTCA	0.672																																					p.H625Q		.											.	KIF22	68	0			c.C1875A						.																																			SO:0001583	missense	3835	exon12			GCTCCACGGCCCC	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1875C>A	16.37:g.29816332C>A	ENSP00000160827:p.His625Gln	Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	6.0	NM_007317	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	ENST00000160827.4	37	CCDS10653.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.612336	0.66672	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.73789	-0.71;-0.78	5.32	-2.77	0.05877	.	.	.	.	.	T	0.78136	0.4236	L	0.51853	1.615	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.67900	0.954;0.95	T	0.76421	-0.2965	9	0.62326	D	0.03	.	10.9462	0.47301	0.0:0.3659:0.0:0.6341	.	557;625	B7Z265;Q14807	.;KIF22_HUMAN	Q	625;557	ENSP00000160827:H625Q;ENSP00000383562:H557Q	ENSP00000160827:H625Q	H	+	3	2	KIF22	29723833	0.038000	0.19896	0.953000	0.39169	0.767000	0.43475	-1.027000	0.03592	-0.534000	0.06315	0.561000	0.74099	CAC	.		0.672	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2		
KRTAP5-1	387264	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1606219	1606219	+	Silent	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:1606219C>A	ENST00000382171.2	-	1	294	c.261G>T	c.(259-261)ggG>ggT	p.G87G	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	87	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGCCACAGCCCCCCTTGCAGC	0.667																																					p.G87G		.											.	KRTAP5-1	44	0			c.G261T						.						39.0	55.0	49.0					11																	1606219		2201	4296	6497	SO:0001819	synonymous_variant	387264	exon1			ACAGCCCCCCTTG	AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.261G>T	11.37:g.1606219C>A		Somatic	168.0	1.0		WXS	Illumina HiSeq	Phase_I	159.0	54.0	NM_001005922		Silent	SNP	ENST00000382171.2	37	CCDS31330.1																																																																																			.		0.667	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127922.1	NM_001005922	
LIN28B	389421	ucsc.edu;bcgsc.ca	37	6	105526351	105526351	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:105526351A>G	ENST00000345080.4	+	4	649	c.446A>G	c.(445-447)aAg>aGg	p.K149R		NM_001004317.3	NP_001004317.1	Q6ZN17	LN28B_HUMAN	lin-28 homolog B (C. elegans)	149					miRNA catabolic process (GO:0010587)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA 3'-end processing (GO:0031123)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(10)|ovary(1)	12		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				CCTCAGCCAAAGAAGTGCCAT	0.463																																					p.K149R		.											.	LIN28B	90	0			c.A446G						.						135.0	119.0	125.0					6																	105526351		2203	4300	6503	SO:0001583	missense	389421	exon4			AGCCAAAGAAGTG	AK131411	CCDS34504.1	6q21	2010-04-06			ENSG00000187772	ENSG00000187772			32207	protein-coding gene	gene with protein product		611044					Standard	NM_001004317		Approved	FLJ16517, CSDD2	uc003pqv.2	Q6ZN17	OTTHUMG00000015290	ENST00000345080.4:c.446A>G	6.37:g.105526351A>G	ENSP00000344401:p.Lys149Arg	Somatic	61.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_001004317	A1L165|B2RPN6|Q5TCM4	Missense_Mutation	SNP	ENST00000345080.4	37	CCDS34504.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.541093	0.85917	.	.	ENSG00000187772	ENST00000345080	.	.	.	6.02	6.02	0.97574	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (1);	0.000000	0.85682	D	0.000000	T	0.70894	0.3276	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.72181	-0.4368	9	0.49607	T	0.09	-16.6471	16.5446	0.84426	1.0:0.0:0.0:0.0	.	149	Q6ZN17	LN28B_HUMAN	R	149	.	ENSP00000344401:K149R	K	+	2	0	LIN28B	105633044	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.310000	0.96267	2.311000	0.77944	0.533000	0.62120	AAG	.		0.463	LIN28B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041646.2	NM_001004317	
LINC00521	256369	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94467500	94467500	+	RNA	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:94467500G>T	ENST00000444118.1	+	0	578					NR_024182.1		Q8NCU1	CN048_HUMAN	long intergenic non-protein coding RNA 521																		GGCTGCACGGGATGGGAGGAG	0.662																																					.		.											.	.	.	0			.						.						40.0	33.0	35.0					14																	94467500		2203	4299	6502			256369	.			GCACGGGATGGGA	BI463117		14q32.12	2012-10-12	2011-11-29	2011-11-29	ENSG00000175699	ENSG00000175699		"""Long non-coding RNAs"""	19860	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 48"""	C14orf48			Standard	NR_024182		Approved		uc001ycg.1	Q8NCU1	OTTHUMG00000156974		14.37:g.94467500G>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	41.0	32.0	.	Q8N7S1	RNA	SNP	ENST00000444118.1	37																																																																																				.		0.662	LINC00521-003	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000346916.1		
LRP1	4035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	57556190	57556190	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:57556190G>T	ENST00000243077.3	+	14	2759	c.2293G>T	c.(2293-2295)Gtc>Ttc	p.V765F		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	765					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGTGGCAGTGTCTACCGCTT	0.572																																					p.V765F		.											.	LRP1	596	0			c.G2293T						.						199.0	159.0	173.0					12																	57556190		2203	4300	6503	SO:0001583	missense	4035	exon14			GGCAGTGTCTACC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.2293G>T	12.37:g.57556190G>T	ENSP00000243077:p.Val765Phe	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	30.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201835	0.58234	.	.	ENSG00000123384	ENST00000243077	D	0.94457	-3.43	4.87	4.87	0.63330	Six-bladed beta-propeller, TolB-like (1);	0.082006	0.48286	D	0.000181	D	0.91219	0.7233	M	0.70787	2.145	0.80722	D	1	P	0.41313	0.745	B	0.33295	0.161	D	0.90526	0.4492	10	0.66056	D	0.02	.	7.5064	0.27547	0.1761:0.0:0.8239:0.0	.	765	Q07954	LRP1_HUMAN	F	765	ENSP00000243077:V765F	ENSP00000243077:V765F	V	+	1	0	LRP1	55842457	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	6.058000	0.71126	2.709000	0.92574	0.563000	0.77884	GTC	.		0.572	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
LRRC4C	57689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	40137651	40137651	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:40137651C>T	ENST00000278198.2	-	2	2155	c.192G>A	c.(190-192)cgG>cgA	p.R64R	LRRC4C_ENST00000527150.1_Silent_p.R64R|LRRC4C_ENST00000530763.1_Silent_p.R64R|LRRC4C_ENST00000528697.1_Silent_p.R64R			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	64	LRRNT.				regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				GCAGGTTTTTCCGAACACAAA	0.532																																					p.R64R		.											.	LRRC4C	521	0			c.G192A						.						88.0	75.0	79.0					11																	40137651		2203	4300	6503	SO:0001819	synonymous_variant	57689	exon7			GTTTTTCCGAACA	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.192G>A	11.37:g.40137651C>T		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	39.0	NM_001258419	A8K0T1|Q7L0N3	Silent	SNP	ENST00000278198.2	37	CCDS31464.1																																																																																			.		0.532	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
LRRK2	120892	ucsc.edu;bcgsc.ca	37	12	40619068	40619068	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:40619068C>A	ENST00000298910.7	+	1	193	c.135C>A	c.(133-135)ttC>ttA	p.F45L	LRRK2_ENST00000343742.2_Missense_Mutation_p.F45L|AC079630.4_ENST00000412812.1_RNA	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	45					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGCTGGTGTTCACGTACTCCG	0.443																																					p.F45L		.											.	LRRK2	533	0			c.C135A						.						67.0	66.0	66.0					12																	40619068		2203	4300	6503	SO:0001583	missense	120892	exon1			GGTGTTCACGTAC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.135C>A	12.37:g.40619068C>A	ENSP00000298910:p.Phe45Leu	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	25.0	4.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	37	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	3.883	-0.025462	0.07589	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.42513	1.36;0.97	5.2	-2.46	0.06461	.	0.492615	0.21471	N	0.073998	T	0.09992	0.0245	N	0.02142	-0.665	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.28106	-1.0054	10	0.02654	T	1	.	3.014	0.06053	0.3417:0.4115:0.1024:0.1444	.	45	Q5S007	LRRK2_HUMAN	L	45	ENSP00000341930:F45L;ENSP00000298910:F45L	ENSP00000298910:F45L	F	+	3	2	LRRK2	38905335	0.998000	0.40836	0.525000	0.27900	0.988000	0.76386	0.283000	0.18846	-0.298000	0.08921	0.655000	0.94253	TTC	.		0.443	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
LRRN3	54674	ucsc.edu;bcgsc.ca	37	7	110763773	110763773	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:110763773A>G	ENST00000422987.3	+	2	1776	c.945A>G	c.(943-945)gaA>gaG	p.E315E	IMMP2L_ENST00000447215.1_Intron|LRRN3_ENST00000308478.5_Silent_p.E315E|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000489381.1_Intron|LRRN3_ENST00000451085.1_Silent_p.E315E|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000405709.2_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	315					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GAAAAATAGAAGCTACTAACA	0.413																																					p.E315E		.											.	LRRN3	154	0			c.A945G						.						81.0	85.0	84.0					7																	110763773		2203	4300	6503	SO:0001819	synonymous_variant	54674	exon2			AATAGAAGCTACT	AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.945A>G	7.37:g.110763773A>G		Somatic	56.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_018334	O43377|Q6I9V8|Q8IYQ6	Silent	SNP	ENST00000422987.3	37	CCDS5754.1																																																																																			.		0.413	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338171.2	NM_018334	
LTA	4049	ucsc.edu;bcgsc.ca	37	6	31540523	31540523	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:31540523A>G	ENST00000454783.1	+	2	262	c.4A>G	c.(4-6)Aca>Gca	p.T2A	LTA_ENST00000418386.2_Missense_Mutation_p.T2A|TNF_ENST00000449264.2_5'Flank	NM_001159740.2	NP_001153212.1	P01374	TNFB_HUMAN	lymphotoxin alpha	2					apoptotic process (GO:0006915)|cell-cell signaling (GO:0007267)|defense response to Gram-positive bacterium (GO:0050830)|humoral immune response (GO:0006959)|lymph node development (GO:0048535)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response to antigenic stimulus (GO:0002876)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of interferon-gamma production (GO:0032729)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|membrane (GO:0016020)	receptor binding (GO:0005102)			endometrium(2)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9					Etanercept(DB00005)	TCTCCCCATGACACCACCTGA	0.642																																					p.T2A		.											.	LTA	522	0			c.A4G						.						79.0	82.0	81.0					6																	31540523		1511	2709	4220	SO:0001583	missense	4049	exon2			CCCATGACACCAC	X01393	CCDS4701.1	6p21.3	2013-05-22	2013-05-22		ENSG00000226979	ENSG00000226979		"""Tumor necrosis factor (ligand) superfamily"""	6709	protein-coding gene	gene with protein product	"""TNF superfamily member 1"""	153440	"""lymphotoxin alpha (TNF superfamily, member 1)"""	TNFB		2995927, 3001529	Standard	NM_001159740		Approved	TNFSF1, LT	uc011dnu.2	P01374	OTTHUMG00000031135	ENST00000454783.1:c.4A>G	6.37:g.31540523A>G	ENSP00000403495:p.Thr2Ala	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_001159740	Q8N4C3|Q9UKS8	Missense_Mutation	SNP	ENST00000454783.1	37	CCDS4701.1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.960810	0.34565	.	.	ENSG00000226979	ENST00000454783;ENST00000418386;ENST00000436827	T;T	0.15834	2.39;2.39	4.73	2.23	0.28157	.	0.404179	0.26635	N	0.023284	T	0.05960	0.0155	M	0.67953	2.075	0.26449	N	0.975647	P	0.38148	0.62	B	0.31946	0.138	T	0.21177	-1.0253	10	0.87932	D	0	-0.754	5.1508	0.15009	0.6284:0.1898:0.0:0.1818	.	2	P01374	TNFB_HUMAN	A	2	ENSP00000403495:T2A;ENSP00000413450:T2A	ENSP00000413450:T2A	T	+	1	0	LTA	31648502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.286000	0.33273	0.280000	0.22209	0.533000	0.62120	ACA	.		0.642	LTA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259097.1		
MAB21L1	4081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	36049572	36049572	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr13:36049572G>A	ENST00000379919.4	-	1	1260	c.704C>T	c.(703-705)gCg>gTg	p.A235V	NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	235					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CTCTGCCTCCGCGAACTGCAG	0.602																																					p.A235V		.											.	MAB21L1	92	0			c.C704T						.						57.0	63.0	61.0					13																	36049572		2203	4300	6503	SO:0001583	missense	4081	exon1			GCCTCCGCGAACT	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.704C>T	13.37:g.36049572G>A	ENSP00000369251:p.Ala235Val	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	18.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	37	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979676	0.34942	.	.	ENSG00000180660	ENST00000379919	T	0.07908	3.15	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.08758	0.0217	L	0.29908	0.895	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33879	-0.9851	10	0.19147	T	0.46	-27.0942	19.9576	0.97228	0.0:0.0:1.0:0.0	.	235	Q13394	MB211_HUMAN	V	235	ENSP00000369251:A235V	ENSP00000369251:A235V	A	-	2	0	MAB21L1	34947572	1.000000	0.71417	0.998000	0.56505	0.934000	0.57294	9.869000	0.99810	2.736000	0.93811	0.655000	0.94253	GCG	.		0.602	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
MAP7	9053	ucsc.edu;bcgsc.ca	37	6	136682317	136682317	+	Splice_Site	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:136682317T>C	ENST00000354570.3	-	12	1937	c.1527A>G	c.(1525-1527)agA>agG	p.R509R	MAP7_ENST00000544465.1_Splice_Site_p.R494R|MAP7_ENST00000432797.2_Splice_Site_p.R363R|MAP7_ENST00000454590.1_Splice_Site_p.R531R|MAP7_ENST00000438100.2_Splice_Site_p.R494R	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	509					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		CTCTCTTTTGTCTGGAAAAAG	0.552																																					p.R539R		.											.	MAP7	90	0			c.A1617G						.						26.0	29.0	28.0					6																	136682317		2186	4282	6468	SO:0001630	splice_region_variant	9053	exon12			CTTTTGTCTGGAA	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1527-1A>G	6.37:g.136682317T>C		Somatic	20.0	0.0		WXS	Illumina HiSeq	.	13.0	4.0	NM_001198609	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Silent	SNP	ENST00000354570.3	37	CCDS5178.1																																																																																			.		0.552	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	Silent
MCTP1	79772	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	94275895	94275895	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:94275895T>C	ENST00000515393.1	-	5	1065	c.1066A>G	c.(1066-1068)Aca>Gca	p.T356A	MCTP1_ENST00000505208.1_Missense_Mutation_p.T135A|MCTP1_ENST00000429576.2_Missense_Mutation_p.T135A|MCTP1_ENST00000312216.8_Missense_Mutation_p.T135A	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	356					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		GTCACATCTGTGGGCCTGTGA	0.323																																					p.T356A		.											.	MCTP1	92	0			c.A1066G						.						114.0	115.0	115.0					5																	94275895		2203	4300	6503	SO:0001583	missense	79772	exon5			CATCTGTGGGCCT		CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1066A>G	5.37:g.94275895T>C	ENSP00000424126:p.Thr356Ala	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	16.0	6.0	NM_024717	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	ENST00000515393.1	37	CCDS34203.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.52|12.52	1.962190|1.962190	0.34659|0.34659	.|.	.|.	ENSG00000175471|ENSG00000175471	ENST00000503301|ENST00000515393;ENST00000429576;ENST00000312216;ENST00000508509;ENST00000512425;ENST00000505208;ENST00000415885;ENST00000507214;ENST00000514780	.|T;T;T;T;T;T;T;T	.|0.75589	.|-0.24;-0.24;-0.24;-0.24;-0.95;-0.24;-0.24;-0.24	5.63|5.63	5.63|5.63	0.86233|0.86233	.|C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	.|0.311612	.|0.35525	.|N	.|0.003147	T|T	0.65344|0.65344	0.2682|0.2682	L|L	0.29908|0.29908	0.895|0.895	0.37111|0.37111	D|D	0.900351|0.900351	.|B;B;B	.|0.19331	.|0.007;0.035;0.007	.|B;B;B	.|0.18263	.|0.008;0.021;0.016	T|T	0.65084|0.65084	-0.6254|-0.6254	5|10	.|0.39692	.|T	.|0.17	-2.3549|-2.3549	16.1297|16.1297	0.81418|0.81418	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|356;135;135	.|Q6DN14;Q6DN14-3;Q6DN14-2	.|MCTP1_HUMAN;.;.	R|A	164|356;135;135;135;17;135;97;117;116	.|ENSP00000424126:T356A;ENSP00000391639:T135A;ENSP00000308957:T135A;ENSP00000423410:T135A;ENSP00000431075:T17A;ENSP00000426438:T135A;ENSP00000424936:T117A;ENSP00000421543:T116A	.|ENSP00000308957:T135A	H|T	-|-	2|1	0|0	MCTP1|MCTP1	94301651|94301651	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.895000|0.895000	0.52256|0.52256	3.706000|3.706000	0.54830|0.54830	2.270000|2.270000	0.75569|0.75569	0.460000|0.460000	0.39030|0.39030	CAC|ACA	.		0.323	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
MKL1	57591	ucsc.edu;bcgsc.ca	37	22	40807623	40807623	+	Missense_Mutation	SNP	T	T	C	rs28661556		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr22:40807623T>C	ENST00000355630.3	-	15	3157	c.2567A>G	c.(2566-2568)cAc>cGc	p.H856R	MKL1_ENST00000407029.1_Missense_Mutation_p.H856R|MKL1_ENST00000396617.3_3'UTR|MKL1_ENST00000402042.1_Missense_Mutation_p.H806R	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1	856					negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						TGACGGGGGGTGGTCCAGGAT	0.632			T	RBM15	acute megakaryocytic leukemia																																p.H856R		.		Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	.	MKL1	948	0			c.A2567G						.						81.0	65.0	71.0					22																	40807623		2203	4300	6503	SO:0001583	missense	57591	exon15			GGGGGGTGGTCCA	AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146	ENST00000355630.3:c.2567A>G	22.37:g.40807623T>C	ENSP00000347847:p.His856Arg	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_020831	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	ENST00000355630.3	37	CCDS14003.1	.	.	.	.	.	.	.	.	.	.	T	16.40	3.111664	0.56398	.	.	ENSG00000196588	ENST00000355630;ENST00000402042;ENST00000407029;ENST00000499213	T;T;T	0.47177	0.85;0.86;0.85	4.65	4.65	0.58169	.	0.096778	0.64402	D	0.000001	T	0.48187	0.1486	L	0.47016	1.485	0.80722	D	1	D;B	0.53151	0.958;0.335	P;B	0.50082	0.63;0.115	T	0.35475	-0.9787	10	0.16896	T	0.51	-16.2869	14.5519	0.68073	0.0:0.0:0.0:1.0	.	806;856	B0QY83;Q969V6	.;MKL1_HUMAN	R	856;806;856;10	ENSP00000347847:H856R;ENSP00000385584:H806R;ENSP00000385835:H856R	ENSP00000347847:H856R	H	-	2	0	MKL1	39137569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.514000	0.81750	2.091000	0.63221	0.459000	0.35465	CAC	.		0.632	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321522.1	NM_020831	
MRPL22	29093	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	154346429	154346429	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:154346429G>A	ENST00000523037.1	+	7	634	c.593G>A	c.(592-594)cGc>cAc	p.R198H	MRPL22_ENST00000518364.1_3'UTR|MRPL22_ENST00000439747.3_Missense_Mutation_p.R224H|MRPL22_ENST00000265229.8_Missense_Mutation_p.R118H|MRPL22_ENST00000522038.1_Missense_Mutation_p.R204H	NM_014180.3	NP_054899.2	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22	198					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGCAGCTTCGCAGCCGGACC	0.438																																					p.R198H		.											.	MRPL22	90	0			c.G593A						.						54.0	47.0	50.0					5																	154346429		2203	4300	6503	SO:0001583	missense	29093	exon7			AGCTTCGCAGCCG	AB051622	CCDS4331.1, CCDS43391.1	5q33.2	2012-09-13			ENSG00000082515	ENSG00000082515		"""Mitochondrial ribosomal proteins / large subunits"""	14480	protein-coding gene	gene with protein product		611835					Standard	NM_014180		Approved	MRP-L25, RPML25, HSPC158	uc003lvy.4	Q9NWU5	OTTHUMG00000130190	ENST00000523037.1:c.593G>A	5.37:g.154346429G>A	ENSP00000431040:p.Arg198His	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	33.0	NM_014180	A6NGJ8|Q5H9Q1|Q96Q51|Q9P006	Missense_Mutation	SNP	ENST00000523037.1	37	CCDS4331.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506467	0.64410	.	.	ENSG00000082515	ENST00000523037;ENST00000265229;ENST00000439747;ENST00000522038	T;T;T;T	0.59772	0.28;0.4;0.24;0.27	5.8	5.8	0.92144	.	0.579484	0.18168	N	0.149546	T	0.74574	0.3734	M	0.79926	2.475	0.58432	D	0.999999	D	0.60575	0.988	P	0.55303	0.773	T	0.75958	-0.3134	10	0.54805	T	0.06	-1.2567	20.0415	0.97592	0.0:0.0:1.0:0.0	.	198	Q9NWU5	RM22_HUMAN	H	198;118;224;204	ENSP00000431040:R198H;ENSP00000265229:R118H;ENSP00000411177:R224H;ENSP00000429039:R204H	ENSP00000265229:R118H	R	+	2	0	MRPL22	154326622	0.996000	0.38824	0.800000	0.32199	0.138000	0.21146	4.728000	0.62000	2.745000	0.94114	0.563000	0.77884	CGC	.		0.438	MRPL22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252508.2		
MSH5	4439	broad.mit.edu;ucsc.edu	37	6	31729292	31729292	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:31729292T>C	ENST00000375755.3	+	22	2367	c.2081T>C	c.(2080-2082)cTg>cCg	p.L694P	MSH5_ENST00000375740.3_Missense_Mutation_p.L712P|MSH5_ENST00000375742.3_Missense_Mutation_p.L711P|MSH5_ENST00000375703.3_Missense_Mutation_p.L695P|MSH5_ENST00000431848.2_Missense_Mutation_p.L393P|MSH5_ENST00000534153.4_Missense_Mutation_p.L711P|SAPCD1_ENST00000415669.2_5'Flank|MSH5-SAPCD1_ENST00000493662.2_Missense_Mutation_p.L711P|SAPCD1-AS1_ENST00000419679.1_RNA|SAPCD1_ENST00000425424.1_5'Flank|MSH5_ENST00000375750.3_Missense_Mutation_p.L694P|MSH5_ENST00000395853.1_Missense_Mutation_p.L368P|MSH5-SAPCD1_ENST00000491552.1_3'UTR	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	694					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|ovary(2)|skin(2)	5						CGACACTGGCTGGCACGTGGA	0.602								Direct reversal of damage;Mismatch excision repair (MMR)																													p.L712P		.											.	MSH5	661	0			c.T2135C						.						71.0	70.0	70.0					6																	31729292		2203	4300	6503	SO:0001583	missense	4439	exon22			ACTGGCTGGCACG	AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.2081T>C	6.37:g.31729292T>C	ENSP00000364908:p.Leu694Pro	Somatic	62.0	1.0		WXS	Illumina HiSeq	Phase_I	26.0	4.0	NM_025259	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Missense_Mutation	SNP	ENST00000375755.3	37	CCDS4720.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.355152	0.82243	.	.	ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000204410;ENSG00000255152	ENST00000375755;ENST00000375742;ENST00000383401;ENST00000375750;ENST00000534153;ENST00000375703;ENST00000375740;ENST00000431848;ENST00000395853;ENST00000429846;ENST00000491552	D;D;D;D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	5.4	4.18	0.49190	DNA mismatch repair protein MutS, C-terminal (2);	0.509177	0.20801	N	0.085426	D	0.92678	0.7673	M	0.80028	2.48	0.36657	D	0.877708	D;D;D;D;D	0.67145	0.996;0.991;0.993;0.982;0.991	D;P;D;P;D	0.66196	0.939;0.904;0.942;0.891;0.929	D	0.92016	0.5622	9	0.42905	T	0.14	-11.2784	10.1158	0.42589	0.1491:0.0:0.0:0.8509	.	379;712;694;695;711	Q59EC5;O43196-4;O43196;O43196-2;O43196-3	.;.;MSH5_HUMAN;.;.	P	694;711;226;694;711;695;712;393;368;32;80	ENSP00000364908:L694P;ENSP00000364894:L711P;ENSP00000364903:L694P;ENSP00000431693:L711P;ENSP00000364855:L695P;ENSP00000364892:L712P;ENSP00000416784:L393P;ENSP00000379194:L368P;ENSP00000406849:L32P	ENSP00000364855:L695P	L	+	2	0	MSH5;MSH5-C6orf26	31837271	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	4.458000	0.60095	2.266000	0.75297	0.533000	0.62120	CTG	.		0.602	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076243.4		
MYO5A	4644	broad.mit.edu;bcgsc.ca	37	15	52656807	52656807	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr15:52656807A>G	ENST00000399231.3	-	24	3496	c.3253T>C	c.(3253-3255)Ttc>Ctc	p.F1085L	MYO5A_ENST00000356338.6_Missense_Mutation_p.F1085L|MYO5A_ENST00000553916.1_Missense_Mutation_p.F1085L|MYO5A_ENST00000358212.6_Missense_Mutation_p.F1085L|MYO5A_ENST00000399233.2_Missense_Mutation_p.F1085L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1085					actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		AGGCGACTGAACTCATTCAGA	0.353																																					p.F1085L		.											.	MYO5A	93	0			c.T3253C						.						157.0	146.0	150.0					15																	52656807		1853	4094	5947	SO:0001583	missense	4644	exon24			GACTGAACTCATT		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.3253T>C	15.37:g.52656807A>G	ENSP00000382177:p.Phe1085Leu	Somatic	199.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	6.0	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	37	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	A	17.35	3.368042	0.61513	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	T;T;T;T;T	0.19806	2.12;2.12;2.12;2.12;2.12	5.22	5.22	0.72569	.	0.153018	0.64402	D	0.000012	T	0.16041	0.0386	N	0.24115	0.695	0.34462	D	0.701906	B;B	0.25904	0.003;0.137	B;B	0.21917	0.004;0.037	T	0.14448	-1.0472	10	0.38643	T	0.18	.	15.3971	0.74805	1.0:0.0:0.0:0.0	.	1085;1085	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	L	1085;619;1085;1085;1085;715;1085	ENSP00000382177:F1085L;ENSP00000382179:F1085L;ENSP00000348693:F1085L;ENSP00000350945:F1085L;ENSP00000451109:F1085L	ENSP00000348693:F1085L	F	-	1	0	MYO5A	50444099	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.892000	0.69790	2.094000	0.63399	0.533000	0.62120	TTC	.		0.353	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
MYO9B	4650	ucsc.edu;bcgsc.ca	37	19	17212654	17212654	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:17212654A>G	ENST00000594824.1	+	2	274	c.127A>G	c.(127-129)Acc>Gcc	p.T43A	CTD-2528A14.5_ENST00000597045.1_RNA|MYO9B_ENST00000397274.2_Missense_Mutation_p.T43A|MYO9B_ENST00000595618.1_Missense_Mutation_p.T43A			Q13459	MYO9B_HUMAN	myosin IXB	43	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CAAGGACAGCACCACCTCGGA	0.652																																					p.T43A		.											.	MYO9B	67	0			c.A127G						.						43.0	47.0	46.0					19																	17212654		2151	4255	6406	SO:0001583	missense	4650	exon2			GACAGCACCACCT		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.127A>G	19.37:g.17212654A>G	ENSP00000471367:p.Thr43Ala	Somatic	59.0	1.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	A	16.87	3.240929	0.58995	.	.	ENSG00000099331	ENST00000397274	T	0.27890	1.64	4.93	4.93	0.64822	Ras-association (3);	0.000000	0.49916	D	0.000140	T	0.51534	0.1680	M	0.73962	2.25	0.40928	D	0.984362	D;D;D	0.69078	0.997;0.997;0.997	D;D;D	0.70016	0.967;0.967;0.967	T	0.57027	-0.7881	10	0.72032	D	0.01	.	9.2349	0.37459	0.8388:0.0:0.0:0.1612	.	43;43;49	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	A	43	ENSP00000380444:T43A	ENSP00000380444:T43A	T	+	1	0	MYO9B	17073654	1.000000	0.71417	0.968000	0.41197	0.599000	0.36880	6.961000	0.76042	1.837000	0.53436	0.533000	0.62120	ACC	.		0.652	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
NHS	4810	ucsc.edu;bcgsc.ca	37	X	17744747	17744747	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chrX:17744747T>C	ENST00000380060.3	+	6	2796	c.2458T>C	c.(2458-2460)Tct>Cct	p.S820P	NHS_ENST00000398097.3_Missense_Mutation_p.S664P	NM_198270.2	NP_938011.1	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome (congenital cataracts and dental anomalies)	841					cell differentiation (GO:0030154)|lens development in camera-type eye (GO:0002088)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(5)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(26)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	71	Hepatocellular(33;0.183)					ACCAAGCATCTCTTTCAGGAA	0.512																																					p.S820P		.											.	NHS	197	0			c.T2458C						.						120.0	115.0	117.0					X																	17744747		2203	4300	6503	SO:0001583	missense	4810	exon6			AGCATCTCTTTCA		CCDS14181.1, CCDS48087.1	Xp22.3-p21.1	2014-06-18			ENSG00000188158	ENSG00000188158			7820	protein-coding gene	gene with protein product		300457					Standard	NM_001136024		Approved		uc004cxx.3	Q6T4R5	OTTHUMG00000022799	ENST00000380060.3:c.2458T>C	X.37:g.17744747T>C	ENSP00000369400:p.Ser820Pro	Somatic	41.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_198270	B7ZVX8|E2DH69|Q5J7Q0|Q5J7Q1|Q68DR5	Missense_Mutation	SNP	ENST00000380060.3	37	CCDS14181.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.799072	0.50208	.	.	ENSG00000188158	ENST00000380060;ENST00000398097;ENST00000380057	T;T	0.69806	-0.43;-0.42	5.93	5.93	0.95920	.	0.049228	0.85682	D	0.000000	D	0.82531	0.5057	M	0.81497	2.545	0.58432	D	0.999999	P;P;P;D	0.89917	0.587;0.587;0.587;1.0	B;B;B;D	0.85130	0.274;0.178;0.178;0.997	D	0.84536	0.0636	10	0.59425	D	0.04	-14.5513	15.3234	0.74141	0.0:0.0:0.0:1.0	.	841;662;664;820	B7ZVX8;C9IYM8;Q6T4R5-2;Q6T4R5	.;.;.;NHS_HUMAN	P	820;664;662	ENSP00000369400:S820P;ENSP00000381170:S664P	ENSP00000369397:S662P	S	+	1	0	NHS	17654668	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.950000	0.56676	2.003000	0.58678	0.437000	0.28790	TCT	.		0.512	NHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059120.1	NM_198270	
NOTCH4	4855	ucsc.edu;bcgsc.ca	37	6	32169089	32169089	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:32169089A>G	ENST00000375023.3	-	22	4082	c.3944T>C	c.(3943-3945)cTg>cCg	p.L1315P		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1315					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CACCCGGGCCAGGGCAAACAG	0.652																																					p.L1315P		.											.	NOTCH4	1321	0			c.T3944C						.						39.0	44.0	42.0					6																	32169089		1508	2709	4217	SO:0001583	missense	4855	exon22			CGGGCCAGGGCAA		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3944T>C	6.37:g.32169089A>G	ENSP00000364163:p.Leu1315Pro	Somatic	85.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083428	0.55861	.	.	ENSG00000204301	ENST00000375023	D	0.82526	-1.62	4.37	4.37	0.52481	.	0.587614	0.12854	N	0.433708	T	0.65407	0.2688	L	0.29908	0.895	0.80722	D	1	B	0.21225	0.053	B	0.23574	0.047	T	0.67452	-0.5667	10	0.87932	D	0	.	11.615	0.51083	1.0:0.0:0.0:0.0	.	1315	Q99466	NOTC4_HUMAN	P	1315	ENSP00000364163:L1315P	ENSP00000364163:L1315P	L	-	2	0	NOTCH4	32277067	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	3.240000	0.51368	1.862000	0.54008	0.374000	0.22700	CTG	.		0.652	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
NOTCH4	4855	ucsc.edu;bcgsc.ca	37	6	32183154	32183154	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:32183154A>G	ENST00000375023.3	-	12	2008	c.1870T>C	c.(1870-1872)Tgt>Cgt	p.C624R	NOTCH4_ENST00000465528.1_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	624	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GGAACCTCACAGAGCTGGCCT	0.547																																					p.C624R		.											.	NOTCH4	1321	0			c.T1870C						.						67.0	52.0	57.0					6																	32183154		1510	2708	4218	SO:0001583	missense	4855	exon12			CCTCACAGAGCTG		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1870T>C	6.37:g.32183154A>G	ENSP00000364163:p.Cys624Arg	Somatic	92.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	ENST00000375023.3	37	CCDS34420.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.113575	0.56398	.	.	ENSG00000204301	ENST00000375023	D	0.96300	-3.97	4.23	4.23	0.50019	EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.47852	D	0.000206	D	0.98921	0.9634	H	0.99789	4.78	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	D	0.98389	1.0562	10	0.87932	D	0	.	9.8687	0.41160	1.0:0.0:0.0:0.0	.	624	Q99466	NOTC4_HUMAN	R	624	ENSP00000364163:C624R	ENSP00000364163:C624R	C	-	1	0	NOTCH4	32291132	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	4.802000	0.62539	1.902000	0.55061	0.459000	0.35465	TGT	.		0.547	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
NUDT21	11051	ucsc.edu;bcgsc.ca	37	16	56481870	56481870	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:56481870T>C	ENST00000300291.5	-	2	320	c.148A>G	c.(148-150)Aaa>Gaa	p.K50E		NM_007006.2	NP_008937.1	O43809	CPSF5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 21	50	Necessary for RNA-binding.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	AU-rich element binding (GO:0017091)|histone deacetylase binding (GO:0042826)|hydrolase activity (GO:0016787)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)	7						AGGGGCTCTTTTGTACCAAAA	0.418																																					p.K50E		.											.	NUDT21	90	0			c.A148G						.						70.0	67.0	68.0					16																	56481870		2198	4300	6498	SO:0001583	missense	11051	exon2			GCTCTTTTGTACC	AJ001810	CCDS10760.1	16q12.2	2013-06-18	2005-07-11	2005-07-11	ENSG00000167005	ENSG00000167005		"""Nudix motif containing"""	13870	protein-coding gene	gene with protein product	"""cleavage factor Im complex 25 kDa subunit"""	604978	"""cleavage and polyadenylation specific factor 5, 25 kDa"", ""cleavage and polyadenylation specific factor 5, 25 kD subunit"""	CPSF5		9659921	Standard	NM_007006		Approved	CFIM25	uc002eja.3	O43809	OTTHUMG00000133240	ENST00000300291.5:c.148A>G	16.37:g.56481870T>C	ENSP00000300291:p.Lys50Glu	Somatic	107.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_007006	Q6IB85|Q6NE84	Missense_Mutation	SNP	ENST00000300291.5	37	CCDS10760.1	.	.	.	.	.	.	.	.	.	.	T	33	5.242293	0.95272	.	.	ENSG00000167005	ENST00000300291;ENST00000535563	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.86335	0.5908	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89477	0.3747	9	0.59425	D	0.04	-21.2717	15.9822	0.80121	0.0:0.0:0.0:1.0	.	50	O43809	CPSF5_HUMAN	E	50	.	ENSP00000300291:K50E	K	-	1	0	NUDT21	55039371	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.186000	0.69663	0.533000	0.62120	AAA	.		0.418	NUDT21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256980.3	NM_007006	
NUP153	9972	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	17640200	17640200	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:17640200C>G	ENST00000262077.2	-	15	1815	c.1816G>C	c.(1816-1818)Gga>Cga	p.G606R	NUP153_ENST00000537253.1_Missense_Mutation_p.G637R	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	606					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			AGAACACTTCCTTCTTTCAGG	0.348																																					p.G606R		.											.	NUP153	637	0			c.G1816C						.						107.0	110.0	109.0					6																	17640200		2203	4300	6503	SO:0001583	missense	9972	exon15			CACTTCCTTCTTT	Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.1816G>C	6.37:g.17640200C>G	ENSP00000262077:p.Gly606Arg	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	78.0	24.0	NM_005124	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	ENST00000262077.2	37	CCDS4541.1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.880581	0.91740	.	.	ENSG00000124789	ENST00000262077;ENST00000537253	T;T	0.40476	1.03;1.03	5.42	5.42	0.78866	Nucleoporin, Nup153-like (1);	0.000000	0.50627	D	0.000107	T	0.62877	0.2464	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.65998	-0.6032	10	0.72032	D	0.01	-3.6872	19.5755	0.95441	0.0:1.0:0.0:0.0	.	637;606	F6QR24;P49790	.;NU153_HUMAN	R	606;637	ENSP00000262077:G606R;ENSP00000444029:G637R	ENSP00000262077:G606R	G	-	1	0	NUP153	17748179	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.774000	0.75012	2.700000	0.92200	0.585000	0.79938	GGA	.		0.348	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039953.1		
NYNRIN	57523	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24884257	24884257	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:24884257T>C	ENST00000382554.3	+	9	3620	c.3302T>C	c.(3301-3303)aTg>aCg	p.M1101T		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1101					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						ATGGGCTTCATGGACTCCCAC	0.612																																					p.M1101T		.											.	NYNRIN	3	0			c.T3302C						.						63.0	66.0	65.0					14																	24884257		2014	4197	6211	SO:0001583	missense	57523	exon9			GCTTCATGGACTC	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3302T>C	14.37:g.24884257T>C	ENSP00000371994:p.Met1101Thr	Somatic	89.0	0.0		WXS	Illumina HiSeq	Phase_I	76.0	27.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	37	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	T	6.859	0.527851	0.13127	.	.	ENSG00000205978	ENST00000382554	T	0.39787	1.06	4.45	3.29	0.37713	.	.	.	.	.	T	0.22781	0.0550	N	0.11201	0.11	0.27869	N	0.9401	B	0.06786	0.001	B	0.04013	0.001	T	0.14699	-1.0463	9	0.46703	T	0.11	.	6.6051	0.22721	0.0:0.1088:0.0:0.8912	.	1101	Q9P2P1	NYNRI_HUMAN	T	1101	ENSP00000371994:M1101T	ENSP00000371994:M1101T	M	+	2	0	NYNRIN	23954097	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	1.810000	0.38932	0.739000	0.32628	0.459000	0.35465	ATG	.		0.612	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
OR11L1	391189	broad.mit.edu;bcgsc.ca	37	1	248004537	248004537	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:248004537A>G	ENST00000355784.2	-	1	717	c.662T>C	c.(661-663)aTt>aCt	p.I221T		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	221						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGAGGACACAATGAAAACATA	0.493																																					p.I221T		.											.	OR11L1	71	0			c.T662C						.						86.0	89.0	88.0					1																	248004537		2203	4300	6503	SO:0001583	missense	391189	exon1			GACACAATGAAAA	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.662T>C	1.37:g.248004537A>G	ENSP00000348033:p.Ile221Thr	Somatic	150.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	6.0	NM_001001959		Missense_Mutation	SNP	ENST00000355784.2	37	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	A	9.342	1.063319	0.20067	.	.	ENSG00000197591	ENST00000355784	T	0.00402	7.56	4.27	4.27	0.50696	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34828	U	0.003645	T	0.01730	0.0055	M	0.93978	3.48	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.09574	-1.0668	10	0.87932	D	0	.	13.5185	0.61553	1.0:0.0:0.0:0.0	.	221	Q8NGX0	O11L1_HUMAN	T	221	ENSP00000348033:I221T	ENSP00000348033:I221T	I	-	2	0	OR11L1	246071160	1.000000	0.71417	0.142000	0.22268	0.066000	0.16364	6.060000	0.71141	1.922000	0.55676	0.443000	0.29094	ATT	.		0.493	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959	
OR13J1	392309	ucsc.edu;bcgsc.ca	37	9	35869605	35869605	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:35869605T>C	ENST00000377981.2	-	1	856	c.794A>G	c.(793-795)aAg>aGg	p.K265R		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			GTGGGCTTCCTTACTCTTGGG	0.532																																					p.K265R		.											.	OR13J1	68	0			c.A794G						.						100.0	93.0	95.0					9																	35869605		2203	4300	6503	SO:0001583	missense	392309	exon1			GCTTCCTTACTCT		CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.794A>G	9.37:g.35869605T>C	ENSP00000367219:p.Lys265Arg	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_001004487	B2RN66|Q6IF20|Q96R40	Missense_Mutation	SNP	ENST00000377981.2	37	CCDS35011.1	.	.	.	.	.	.	.	.	.	.	T	18.47	3.631686	0.67015	.	.	ENSG00000168828	ENST00000377981	T	0.00115	8.71	4.5	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.100557	0.43579	N	0.000549	T	0.00144	0.0004	L	0.52573	1.65	0.30718	N	0.748515	P	0.41978	0.767	B	0.40782	0.34	T	0.32241	-0.9914	10	0.39692	T	0.17	.	6.9067	0.24313	0.0:0.1017:0.0:0.8983	.	265	Q8NGT2	O13J1_HUMAN	R	265	ENSP00000367219:K265R	ENSP00000367219:K265R	K	-	2	0	OR13J1	35859605	0.000000	0.05858	0.993000	0.49108	0.959000	0.62525	-0.099000	0.11007	1.061000	0.40601	0.528000	0.53228	AAG	.		0.532	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052381.1		
OR2J3	442186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	29080221	29080221	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:29080221C>A	ENST00000377169.1	+	1	554	c.554C>A	c.(553-555)cCa>cAa	p.P185Q		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						TGTGAAGTTCCAGCACTTCTG	0.458																																					p.P185Q		.											.	OR2J3	90	0			c.C554A						.						103.0	113.0	110.0					6																	29080221		1304	2585	3889	SO:0001583	missense	442186	exon1			AAGTTCCAGCACT		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.554C>A	6.37:g.29080221C>A	ENSP00000366374:p.Pro185Gln	Somatic	328.0	0.0		WXS	Illumina HiSeq	Phase_I	301.0	85.0	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	37	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	C	12.52	1.962058	0.34659	.	.	ENSG00000204701	ENST00000377169	T	0.00211	8.54	2.78	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00300	0.0009	M	0.86864	2.845	0.33794	D	0.625804	D	0.63880	0.993	D	0.74023	0.982	T	0.50092	-0.8868	9	0.87932	D	0	.	7.8712	0.29567	0.0:0.8763:0.0:0.1237	.	185	O76001	OR2J3_HUMAN	Q	185	ENSP00000366374:P185Q	ENSP00000366374:P185Q	P	+	2	0	OR2J3	29188200	0.000000	0.05858	0.999000	0.59377	0.286000	0.27126	-0.162000	0.10012	1.549000	0.49425	0.436000	0.28706	CCA	.		0.458	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
OR4D2	124538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	56247344	56247344	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:56247344G>T	ENST00000545221.1	+	1	328	c.328G>T	c.(328-330)Gcc>Tcc	p.A110S		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						TTTGGGAGGTGCCATGGTCTT	0.542																																					p.A110S		.											.	OR4D2	114	0			c.G328T						.						92.0	85.0	88.0					17																	56247344		2203	4300	6503	SO:0001583	missense	124538	exon1			GGAGGTGCCATGG		CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.328G>T	17.37:g.56247344G>T	ENSP00000441354:p.Ala110Ser	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	15.0	NM_001004707	Q6IFN8|Q96R75	Missense_Mutation	SNP	ENST00000545221.1	37	CCDS32688.1	.	.	.	.	.	.	.	.	.	.	G	4.915	0.169998	0.09339	.	.	ENSG00000255713	ENST00000545221	T	0.00882	5.58	5.71	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.242082	0.28612	N	0.014734	T	0.00784	0.0026	N	0.14661	0.345	0.09310	N	1	B	0.20368	0.044	B	0.20767	0.031	T	0.49634	-0.8919	10	0.40728	T	0.16	-23.9432	7.8601	0.29506	0.0806:0.0:0.7571:0.1622	.	110	P58180	OR4D2_HUMAN	S	110	ENSP00000441354:A110S	ENSP00000441354:A110S	A	+	1	0	OR4D2	53602343	0.000000	0.05858	0.988000	0.46212	0.208000	0.24298	-0.009000	0.12765	1.552000	0.49463	0.609000	0.83330	GCC	.		0.542	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1		
OTUD3	23252	ucsc.edu;bcgsc.ca	37	1	20234091	20234091	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:20234091A>G	ENST00000375120.3	+	8	1050	c.1049A>G	c.(1048-1050)cAg>cGg	p.Q350R		NM_015207.1	NP_056022.1	Q5T2D3	OTUD3_HUMAN	OTU deubiquitinase 3	350					protein K11-linked deubiquitination (GO:0035871)|protein K6-linked deubiquitination (GO:0044313)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(2)|large_intestine(4)|lung(1)|skin(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CGAGAACAGCAGTGGATGGAG	0.572																																					p.Q350R		.											.	.	.	0			c.A1049G						.						52.0	62.0	59.0					1																	20234091		2050	4209	6259	SO:0001583	missense	23252	exon8			AACAGCAGTGGAT	AB007928	CCDS41279.1	1p36.13	2014-02-24	2014-02-24		ENSG00000169914	ENSG00000169914		"""OTU domain containing"""	29038	protein-coding gene	gene with protein product		611758	"""OTU domain containing 3"""			9455484, 23827681	Standard	NM_015207		Approved	KIAA0459, DUBA4	uc001bcs.4	Q5T2D3	OTTHUMG00000002696	ENST00000375120.3:c.1049A>G	1.37:g.20234091A>G	ENSP00000364261:p.Gln350Arg	Somatic	55.0	1.0		WXS	Illumina HiSeq	.	22.0	5.0	NM_015207	O75047	Missense_Mutation	SNP	ENST00000375120.3	37	CCDS41279.1	.	.	.	.	.	.	.	.	.	.	A	19.28	3.796389	0.70567	.	.	ENSG00000169914	ENST00000375120	T	0.26223	1.75	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.37237	0.0996	L	0.59436	1.845	0.80722	D	1	D	0.62365	0.991	P	0.55455	0.776	T	0.13899	-1.0492	10	0.08599	T	0.76	.	15.2006	0.73132	1.0:0.0:0.0:0.0	.	350	Q5T2D3	OTUD3_HUMAN	R	350	ENSP00000364261:Q350R	ENSP00000364261:Q350R	Q	+	2	0	OTUD3	20106678	1.000000	0.71417	1.000000	0.80357	0.371000	0.29859	7.878000	0.87231	2.263000	0.75096	0.533000	0.62120	CAG	.		0.572	OTUD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007655.1		
OTX1	5013	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	63282697	63282698	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:63282697_63282698delAG	ENST00000282549.2	+	5	587_588	c.311_312delAG	c.(310-312)aagfs	p.K104fs	OTX1_ENST00000366671.3_Frame_Shift_Del_p.K104fs	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	104					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					AGCGGAACCAAGAGCCGCCCAG	0.649																																					p.104_104del		.											.	OTX1	70	0			c.311_312del						.																																			SO:0001589	frameshift_variant	5013	exon5			GAACCAAGAGCCG		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.311_312delAG	2.37:g.63282699_63282700delAG	ENSP00000282549:p.Lys104fs	Somatic	173.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	22.0	NM_014562	A6NHA2|B3KTJ4|Q53TG6	Frame_Shift_Del	DEL	ENST00000282549.2	37	CCDS1873.1																																																																																			.		0.649	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251617.1		
PAK2	5062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	196547330	196547330	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:196547330G>A	ENST00000327134.3	+	13	1564	c.1242G>A	c.(1240-1242)gtG>gtA	p.V414V		NM_002577.4	NP_002568.2	Q13177	PAK2_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 2	414	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:2001271)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of defense response to virus by virus (GO:0050690)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activator activity (GO:0030296)	p.V415F(1)|p.V414V(1)		breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)	12	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)		CACCAGAGGTGGTTACACGGA	0.488																																					p.V414V		.											.	PAK2	957	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)	c.G1242A						.						155.0	130.0	138.0					3																	196547330		2203	4300	6503	SO:0001819	synonymous_variant	5062	exon13			AGAGGTGGTTACA	U24153	CCDS3321.1	3q29	2008-06-17	2008-06-17			ENSG00000180370	2.7.11.1		8591	protein-coding gene	gene with protein product	"""S6/H4 kinase"""	605022	"""p21 (CDKN1A)-activated kinase 2"""			7744004, 7618083	Standard	NM_002577		Approved	PAK65, PAKgamma	uc003fwy.4	Q13177		ENST00000327134.3:c.1242G>A	3.37:g.196547330G>A		Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	40.0	NM_002577	Q13154|Q6ISC3	Silent	SNP	ENST00000327134.3	37	CCDS3321.1	.	.	.	.	.	.	.	.	.	.	G	9.873	1.199547	0.22121	.	.	ENSG00000180370	ENST00000426668	.	.	.	4.69	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7285	0.46083	0.0739:0.1311:0.795:0.0	.	.	.	.	X	157	.	.	W	+	2	0	PAK2	198031727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.432000	0.34936	1.303000	0.44873	0.655000	0.94253	TGG	.		0.488	PAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340548.1	NM_002577	
PALD1	27143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	72324191	72324191	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:72324191T>C	ENST00000263563.6	+	19	2602	c.2334T>C	c.(2332-2334)taT>taC	p.Y778Y		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	778						cytosol (GO:0005829)											TGGAGCGCTATGTCTGCCTGA	0.622																																					p.Y778Y		.											.	.	.	0			c.T2334C						.						123.0	118.0	120.0					10																	72324191		2203	4300	6503	SO:0001819	synonymous_variant	27143	exon19			GCGCTATGTCTGC	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.2334T>C	10.37:g.72324191T>C		Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	79.0	19.0	NM_014431	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Silent	SNP	ENST00000263563.6	37	CCDS31215.1	.	.	.	.	.	.	.	.	.	.	T	1.598	-0.527231	0.04141	.	.	ENSG00000107719	ENST00000426268	.	.	.	5.21	1.26	0.21427	.	.	.	.	.	T	0.57227	0.2039	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49899	-0.8890	4	.	.	.	-24.9332	8.8717	0.35320	0.0:0.6022:0.0:0.3978	.	.	.	.	R	159	.	.	C	+	1	0	KIAA1274	71994197	0.964000	0.33143	0.326000	0.25389	0.187000	0.23431	0.760000	0.26475	0.203000	0.20529	-0.375000	0.07067	TGT	.		0.622	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
PDCD11	22984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	105162878	105162878	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:105162878C>T	ENST00000369797.3	+	4	332	c.238C>T	c.(238-240)Ctg>Ttg	p.L80L		NM_014976.1	NP_055791.1	Q14690	RRP5_HUMAN	programmed cell death 11	80					mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	64		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		CTTCTAGTCCCTGTGTGAGGG	0.443																																					p.L80L		.											.	PDCD11	275	0			c.C238T						.						188.0	187.0	187.0					10																	105162878		2203	4300	6503	SO:0001819	synonymous_variant	22984	exon4			TAGTCCCTGTGTG	D80007	CCDS31276.1	10q24.32	2010-07-06			ENSG00000148843	ENSG00000148843			13408	protein-coding gene	gene with protein product		612333				10229231	Standard	XM_005269647		Approved	KIAA0185, ALG-4, RRP5	uc001kwy.1	Q14690	OTTHUMG00000018988	ENST00000369797.3:c.238C>T	10.37:g.105162878C>T		Somatic	348.0	0.0		WXS	Illumina HiSeq	Phase_I	216.0	59.0	NM_014976	Q2TA92|Q5W093|Q6P2J3|Q86VQ8|Q9H4P1	Silent	SNP	ENST00000369797.3	37	CCDS31276.1																																																																																			.		0.443	PDCD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050151.1		
PDZD2	23037	ucsc.edu;bcgsc.ca	37	5	32090075	32090075	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:32090075T>C	ENST00000438447.1	+	20	6909	c.6521T>C	c.(6520-6522)cTt>cCt	p.L2174P	PDZD2_ENST00000282493.3_Missense_Mutation_p.L2174P			O15018	PDZD2_HUMAN	PDZ domain containing 2	2174	Ser-rich.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TCCTCCTCCCTTCAAACAGCC	0.547																																					p.L2174P		.											.	PDZD2	563	0			c.T6521C						.						76.0	84.0	81.0					5																	32090075		2203	4300	6503	SO:0001583	missense	23037	exon19			CCTCCCTTCAAAC	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.6521T>C	5.37:g.32090075T>C	ENSP00000402033:p.Leu2174Pro	Somatic	100.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_178140	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	T	0.059	-1.229743	0.01518	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.08546	3.08;3.08	5.09	1.23	0.21249	.	0.677452	0.13603	N	0.375693	T	0.01800	0.0057	N	0.00436	-1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46884	-0.9159	10	0.14252	T	0.57	.	5.1903	0.15207	0.0:0.5933:0.1478:0.2589	.	2174	O15018	PDZD2_HUMAN	P	2174;1975;2174	ENSP00000402033:L2174P;ENSP00000282493:L2174P	ENSP00000282493:L2174P	L	+	2	0	PDZD2	32125832	0.784000	0.28713	0.006000	0.13384	0.007000	0.05969	0.582000	0.23834	-0.073000	0.12842	-0.252000	0.11476	CTT	.		0.547	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
PHC2	1912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	33799862	33799862	+	Silent	SNP	G	G	A	rs370099521		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:33799862G>A	ENST00000257118.5	-	9	1640	c.1587C>T	c.(1585-1587)acC>acT	p.T529T	PHC2_ENST00000419414.2_Silent_p.T530T|PHC2_ENST00000373422.3_Silent_p.T135T|PHC2_ENST00000431992.1_Silent_p.T500T|RN7SKP16_ENST00000410180.1_RNA|MIR3605_ENST00000583214.1_RNA|PHC2_ENST00000485928.1_5'UTR|PHC2_ENST00000373418.3_5'UTR|PHC2_ENST00000373416.1_5'UTR	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	529					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TGCTGAGGTCGGTCAGTGCAT	0.592																																					p.T529T		.											.	PHC2	227	0			c.C1587T						.						107.0	103.0	105.0					1																	33799862		2203	4300	6503	SO:0001819	synonymous_variant	1912	exon9			GAGGTCGGTCAGT	AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.1587C>T	1.37:g.33799862G>A		Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	48.0	NM_198040	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Silent	SNP	ENST00000257118.5	37	CCDS378.1																																																																																			.		0.592	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000011895.1	NM_198040	
PKD1	5310	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	2149979	2149979	+	Missense_Mutation	SNP	C	C	A	rs550467690		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:2149979C>A	ENST00000262304.4	-	29	10014	c.9806G>T	c.(9805-9807)cGg>cTg	p.R3269L	RP11-304L19.3_ENST00000565937.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.R3269L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3269					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACGAGGCGGCCGGTCCCATAT	0.632																																					p.R3269L		.											.	PKD1	91	0			c.G9806T						.						15.0	13.0	14.0					16																	2149979		2143	4220	6363	SO:0001583	missense	5310	exon29			GGCGGCCGGTCCC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.9806G>T	16.37:g.2149979C>A	ENSP00000262304:p.Arg3269Leu	Somatic	198.0	2.0		WXS	Illumina HiSeq	Phase_I	167.0	70.0	NM_000296	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798647	0.90538	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.49720	0.77;0.77	4.69	4.69	0.59074	.	0.056646	0.64402	D	0.000002	T	0.75781	0.3896	M	0.91612	3.225	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.82610	-0.0372	10	0.87932	D	0	.	17.8087	0.88609	0.0:1.0:0.0:0.0	.	3269;3269	P98161-3;P98161	.;PKD1_HUMAN	L	3269;3269;2604	ENSP00000262304:R3269L;ENSP00000399501:R3269L	ENSP00000262304:R3269L	R	-	2	0	PKD1	2089980	1.000000	0.71417	0.998000	0.56505	0.716000	0.41182	7.064000	0.76721	2.431000	0.82371	0.555000	0.69702	CGG	.		0.632	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
IST1	9798	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	71963537	71963537	+	IGR	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:71963537A>T	ENST00000378799.6	+	0	2654				PKD1L3_ENST00000534738.1_RNA|RP11-498D10.6_ENST00000573861.1_RNA			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)						abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										TTCCTAACAAATTTGAGAGCT	0.393																																					.		.											.	PKD1L3	68	0			.						.						246.0	204.0	217.0					16																	71963537		692	1591	2283	SO:0001628	intergenic_variant	342372	.			TAACAAATTTGAG	BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597		16.37:g.71963537A>T		Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	139.0	63.0	.	A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	RNA	SNP	ENST00000378799.6	37	CCDS59272.1																																																																																			.		0.393	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2	NM_014761	
PKM	5315	ucsc.edu;bcgsc.ca	37	15	72499166	72499166	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr15:72499166A>G	ENST00000335181.5	-	8	1146	c.1043T>C	c.(1042-1044)gTg>gCg	p.V348A	PKM_ENST00000568883.1_Missense_Mutation_p.V183A|PKM_ENST00000449901.2_Missense_Mutation_p.V333A|PKM_ENST00000565184.1_Missense_Mutation_p.V348A|PKM_ENST00000565154.1_Missense_Mutation_p.V348A|PKM_ENST00000319622.6_Missense_Mutation_p.V348A|PKM_ENST00000568459.1_Missense_Mutation_p.V348A|PKM_ENST00000389093.3_Missense_Mutation_p.V348A	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle	348	Interaction with POU5F1.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	TGCATTGGCCACATCACTGCC	0.572																																					p.V422A		.											.	.	.	0			c.T1265C						.						49.0	44.0	46.0					15																	72499166		2199	4297	6496	SO:0001583	missense	5315	exon9			TTGGCCACATCAC	M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.1043T>C	15.37:g.72499166A>G	ENSP00000334983:p.Val348Ala	Somatic	85.0	0.0		WXS	Illumina HiSeq	.	51.0	4.0	NM_001206796	A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Missense_Mutation	SNP	ENST00000335181.5	37	CCDS32284.1	.	.	.	.	.	.	.	.	.	.	A	31	5.063924	0.93898	.	.	ENSG00000067225	ENST00000319622;ENST00000335181;ENST00000434220;ENST00000327974;ENST00000389093;ENST00000449901	D;D;D;D	0.99730	-6.56;-6.56;-6.56;-6.56	5.23	5.23	0.72850	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.000000	0.85682	D	0.000000	D	0.99871	0.9939	H	0.99516	4.605	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.97110	0.994;1.0;1.0;0.996;1.0;0.999;0.996;1.0;0.996	D	0.96206	0.9149	10	0.87932	D	0	-21.6493	15.4105	0.74914	1.0:0.0:0.0:0.0	.	274;333;328;328;348;348;183;275;183	B4DNK4;B4DUU6;B4DRT3;E7EUQ8;P14618;P14618-2;Q504U3;E9PF79;E7EUJ4	.;.;.;.;KPYM_HUMAN;.;.;.;.	A	348;348;275;183;348;333	ENSP00000320171:V348A;ENSP00000334983:V348A;ENSP00000373745:V348A;ENSP00000403365:V333A	ENSP00000320171:V348A	V	-	2	0	PKM2	70286220	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.339000	0.96797	2.099000	0.63709	0.459000	0.35465	GTG	.		0.572	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420056.1		
PLA2G2E	30814	ucsc.edu;bcgsc.ca	37	1	20248851	20248851	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:20248851C>T	ENST00000375116.3	-	3	283	c.226G>A	c.(226-228)Ggc>Agc	p.G76S		NM_014589.1	NP_055404.1	Q9NZK7	PA2GE_HUMAN	phospholipase A2, group IIE	76					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|endometrium(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|GBM - Glioblastoma multiforme(114;0.000146)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aminosalicylic Acid(DB00233)	GGCTCACAGCCCAGCTTCTCC	0.592																																					p.G76S		.											.	PLA2G2E	90	0			c.G226A						.						56.0	55.0	55.0					1																	20248851		2203	4300	6503	SO:0001583	missense	30814	exon3			CACAGCCCAGCTT	AF189279	CCDS200.1	1p36.13	2008-09-19			ENSG00000188784	ENSG00000188784	3.1.1.4		13414	protein-coding gene	gene with protein product						10681567, 11922621	Standard	NM_014589		Approved		uc001bct.1	Q9NZK7	OTTHUMG00000002702	ENST00000375116.3:c.226G>A	1.37:g.20248851C>T	ENSP00000364257:p.Gly76Ser	Somatic	113.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_014589	Q5VXJ8	Missense_Mutation	SNP	ENST00000375116.3	37	CCDS200.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645063	0.67358	.	.	ENSG00000188784	ENST00000375116	T	0.27890	1.64	5.63	5.63	0.86233	Phospholipase A2 (3);	0.263677	0.33591	N	0.004745	T	0.46795	0.1411	L	0.52573	1.65	0.39042	D	0.960159	P	0.44429	0.835	P	0.57679	0.825	T	0.41378	-0.9512	10	0.56958	D	0.05	-32.7251	15.1663	0.72828	0.0:1.0:0.0:0.0	.	76	Q9NZK7	PA2GE_HUMAN	S	76	ENSP00000364257:G76S	ENSP00000364257:G76S	G	-	1	0	PLA2G2E	20121438	0.996000	0.38824	1.000000	0.80357	0.712000	0.41017	4.119000	0.57891	2.647000	0.89833	0.511000	0.50034	GGC	.		0.592	PLA2G2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007684.1	NM_014589	
PLEKHM3	389072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	208865840	208865840	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:208865840T>C	ENST00000427836.2	-	2	1013	c.524A>G	c.(523-525)cAg>cGg	p.Q175R	PLEKHM3_ENST00000457206.1_Missense_Mutation_p.Q175R|PLEKHM3_ENST00000389247.4_Missense_Mutation_p.Q175R	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	175	Poly-Gln.				intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AAGCAATGgctgctgctgttg	0.478																																					p.Q175R		.											.	PLEKHM3	23	0			c.A524G						.						26.0	34.0	32.0					2																	208865840		2134	4268	6402	SO:0001583	missense	389072	exon2			AATGGCTGCTGCT	AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.524A>G	2.37:g.208865840T>C	ENSP00000417003:p.Gln175Arg	Somatic	168.0	0.0		WXS	Illumina HiSeq	Phase_I	156.0	84.0	NM_001080475	B9EKV2|Q8WW68	Missense_Mutation	SNP	ENST00000427836.2	37	CCDS42808.1	.	.	.	.	.	.	.	.	.	.	T	6.520	0.464167	0.12402	.	.	ENSG00000178385	ENST00000427836;ENST00000389247;ENST00000457206	D;D;D	0.82984	-1.65;-1.65;-1.67	4.42	3.29	0.37713	.	0.335412	0.27563	N	0.018819	T	0.60130	0.2245	N	0.08118	0	0.09310	N	0.999994	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.39860	-0.9593	10	0.15952	T	0.53	.	4.9311	0.13917	0.0:0.2102:0.0:0.7898	.	175;175	C9J119;Q6ZWE6	.;PKHM3_HUMAN	R	175	ENSP00000417003:Q175R;ENSP00000373899:Q175R;ENSP00000400150:Q175R	ENSP00000373899:Q175R	Q	-	2	0	PLEKHM3	208574085	0.017000	0.18338	0.986000	0.45419	0.250000	0.25880	0.190000	0.17057	1.960000	0.56953	0.449000	0.29647	CAG	.		0.478	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337036.1	NM_001080475	
PPIP5K1	9677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43827486	43827486	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr15:43827486C>G	ENST00000396923.3	-	30	3809	c.3688G>C	c.(3688-3690)Gag>Cag	p.E1230Q	PPIP5K1_ENST00000420765.1_Missense_Mutation_p.E1230Q|PPIP5K1_ENST00000334933.4_Missense_Mutation_p.E1205Q|PPIP5K1_ENST00000360301.4_Missense_Mutation_p.E1205Q|PPIP5K1_ENST00000348806.6_Missense_Mutation_p.E1203Q|PPIP5K1_ENST00000381885.1_Missense_Mutation_p.E1226Q|PPIP5K1_ENST00000381879.4_Missense_Mutation_p.E1206Q|PPIP5K1_ENST00000360135.4_Missense_Mutation_p.E1203Q			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1230					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						AGCTCTTGCTCCCCTTCTATG	0.557																																					p.E1230Q		.											.	PPIP5K1	90	0			c.G3688C						.						94.0	92.0	92.0					15																	43827486		2201	4298	6499	SO:0001583	missense	9677	exon31			CTTGCTCCCCTTC	AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3688G>C	15.37:g.43827486C>G	ENSP00000380129:p.Glu1230Gln	Somatic	262.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	84.0	NM_001130858	O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Missense_Mutation	SNP	ENST00000396923.3	37	CCDS45252.1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.603608	0.00849	.	.	ENSG00000168781	ENST00000381885;ENST00000360301;ENST00000360135;ENST00000334933;ENST00000396923;ENST00000304953;ENST00000381878;ENST00000420765;ENST00000381879;ENST00000348806	T;T;T;T;T;T;T;T	0.22743	1.95;1.95;2.52;1.95;1.95;1.95;1.94;2.52	5.14	-1.33	0.09172	.	1.800900	0.02664	N	0.107860	T	0.08179	0.0204	N	0.01705	-0.755	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.002	T	0.25152	-1.0140	10	0.18276	T	0.48	0.7387	6.5571	0.22466	0.0:0.4178:0.2624:0.3198	.	1203;1230;1205	Q6PFW1-7;Q6PFW1;Q6PFW1-3	.;VIP1_HUMAN;.	Q	1226;1205;1203;1205;1230;1230;1205;1230;1206;1203	ENSP00000371309:E1226Q;ENSP00000353446:E1205Q;ENSP00000353253:E1203Q;ENSP00000334779:E1205Q;ENSP00000380129:E1230Q;ENSP00000400887:E1230Q;ENSP00000371303:E1206Q;ENSP00000308773:E1203Q	ENSP00000304750:E1230Q	E	-	1	0	PPIP5K1	41614778	.	.	0.001000	0.08648	0.038000	0.13279	.	.	-0.705000	0.05035	-1.945000	0.00491	GAG	.		0.557	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000132907.1	NM_014659	
POLG	5428	ucsc.edu;bcgsc.ca	37	15	89873328	89873328	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr15:89873328T>C	ENST00000268124.5	-	3	1172	c.839A>G	c.(838-840)gAg>gGg	p.E280G	POLG_ENST00000442287.2_Missense_Mutation_p.E280G|POLG_ENST00000525806.1_5'Flank	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	280					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CAGGTACTGCTCCCTGATATG	0.577								DNA polymerases (catalytic subunits)																													p.E280G	Colon(73;648 1203 11348 18386 27782)	.											.	POLG	228	0			c.A839G						.						81.0	71.0	74.0					15																	89873328		2200	4299	6499	SO:0001583	missense	5428	exon3			TACTGCTCCCTGA	X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.839A>G	15.37:g.89873328T>C	ENSP00000268124:p.Glu280Gly	Somatic	63.0	1.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_002693	Q8NFM2|Q92515	Missense_Mutation	SNP	ENST00000268124.5	37	CCDS10350.1	.	.	.	.	.	.	.	.	.	.	T	29.1	4.974799	0.92919	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.93953	-3.32;-3.32	5.62	5.62	0.85841	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	D	0.97458	0.9168	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.98459	1.0595	10	0.87932	D	0	-31.978	15.8271	0.78718	0.0:0.0:0.0:1.0	.	280	P54098	DPOG1_HUMAN	G	280	ENSP00000268124:E280G;ENSP00000399851:E280G	ENSP00000268124:E280G	E	-	2	0	POLG	87674332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.004000	0.88535	2.149000	0.67028	0.533000	0.62120	GAG	.		0.577	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000312854.2	NM_002693	
PPP1R1A	5502	ucsc.edu;bcgsc.ca	37	12	54975806	54975806	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:54975806T>C	ENST00000257905.8	-	5	527	c.357A>G	c.(355-357)ccA>ccG	p.P119P	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	119					glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						CTTCTGTGTCTGGGATCCCAG	0.602																																					p.P119P		.											.	PPP1R1A	226	0			c.A357G						.						76.0	76.0	76.0					12																	54975806		1896	4120	6016	SO:0001819	synonymous_variant	5502	exon5			TGTGTCTGGGATC	U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.357A>G	12.37:g.54975806T>C		Somatic	64.0	0.0		WXS	Illumina HiSeq	.	50.0	5.0	NM_006741	Q6IB01|Q8TBJ2|Q8WWV2	Silent	SNP	ENST00000257905.8	37	CCDS44912.1																																																																																			.		0.602	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406604.1	NM_006741	
PPP1R12A	4659	broad.mit.edu;bcgsc.ca	37	12	80175618	80175618	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:80175618A>G	ENST00000450142.2	-	23	3198	c.2932T>C	c.(2932-2934)Tca>Cca	p.S978P	PPP1R12A_ENST00000546369.1_Missense_Mutation_p.S891P|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.S943P|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.S922P|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.S978P	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	978					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TCCAACAGTGATCTATCAGCA	0.294																																					p.S978P		.											.	PPP1R12A	273	0			c.T2932C						.						43.0	39.0	40.0					12																	80175618		1764	4024	5788	SO:0001583	missense	4659	exon23			ACAGTGATCTATC	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.2932T>C	12.37:g.80175618A>G	ENSP00000389168:p.Ser978Pro	Somatic	152.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	5.0	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	ENST00000450142.2	37	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.369096	0.82463	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107	T;T;T;T;T	0.50277	0.76;0.76;0.87;0.79;0.75	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.59445	0.2194	L	0.38531	1.155	0.80722	D	1	D;D;D	0.69078	0.997;0.978;0.995	D;D;D	0.78314	0.991;0.979;0.979	T	0.63492	-0.6625	10	0.87932	D	0	.	15.1947	0.73078	1.0:0.0:0.0:0.0	.	943;922;978	O14974-2;O14974-3;O14974	.;.;MYPT1_HUMAN	P	978;978;943;922;919;978;943;891;922	ENSP00000261207:S978P;ENSP00000389168:S978P;ENSP00000416769:S943P;ENSP00000449514:S891P;ENSP00000446855:S922P	ENSP00000261207:S978P	S	-	1	0	PPP1R12A	78699749	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.523000	0.90576	2.041000	0.60428	0.482000	0.46254	TCA	.		0.294	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
PPP2R1A	5518	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52716334	52716334	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:52716334C>G	ENST00000322088.6	+	6	836	c.778C>G	c.(778-780)Cgc>Ggc	p.R260G	PPP2R1A_ENST00000462990.1_Missense_Mutation_p.R81G|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.R205G	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	260	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.R260C(1)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CTGGCGCGTCCGCTACATGGT	0.597			Mis		clear cell ovarian carcinoma																																p.R260G		.		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	PPP2R1A,NS,carcinoma,0	PPP2R1A	1666	1	Substitution - Missense(1)	ovary(1)	c.C778G						.						47.0	42.0	44.0					19																	52716334		2203	4300	6503	SO:0001583	missense	5518	exon6			CGCGTCCGCTACA		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.778C>G	19.37:g.52716334C>G	ENSP00000324804:p.Arg260Gly	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	27.0	13.0	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	37	CCDS12849.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079579	0.76528	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000444322	T;T	0.34667	1.35;1.35	4.59	4.59	0.56863	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.53938	D	0.000044	T	0.67439	0.2893	H	0.94658	3.565	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.74973	-0.3481	10	0.87932	D	0	-18.7024	10.3858	0.44138	0.1951:0.8049:0.0:0.0	.	205;260;260	F5H3X9;A8K7B7;P30153	.;.;2AAA_HUMAN	G	250;180;260;205	ENSP00000324804:R260G;ENSP00000415067:R205G	ENSP00000324804:R260G	R	+	1	0	PPP2R1A	57408146	1.000000	0.71417	0.934000	0.37439	0.980000	0.70556	4.860000	0.62961	2.550000	0.86006	0.655000	0.94253	CGC	.		0.597	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
PPP2R5D	5528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	42975774	42975774	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:42975774C>T	ENST00000485511.1	+	7	1007	c.828C>T	c.(826-828)atC>atT	p.I276I	PPP2R5D_ENST00000394110.3_Silent_p.I244I|PPP2R5D_ENST00000472118.1_Silent_p.I268I|PPP2R5D_ENST00000461010.1_Silent_p.I170I	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	276					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGGCTTATATCCGTAGGCAGA	0.542																																					p.I276I	Melanoma(63;587 1613 29742 31770)	.											.	PPP2R5D	1082	0			c.C828T						.						101.0	100.0	100.0					6																	42975774		2203	4300	6503	SO:0001819	synonymous_variant	5528	exon7			TTATATCCGTAGG	L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.828C>T	6.37:g.42975774C>T		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	70.0	NM_006245	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Silent	SNP	ENST00000485511.1	37	CCDS4878.1	.	.	.	.	.	.	.	.	.	.	C	8.759	0.923119	0.18056	.	.	ENSG00000112640	ENST00000470467	.	.	.	5.84	-1.0	0.10196	.	.	.	.	.	T	0.22322	0.0538	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.27434	-1.0074	4	.	.	.	-22.2167	0.9127	0.01298	0.3292:0.3139:0.0988:0.2582	.	.	.	.	S	196	.	.	P	+	1	0	PPP2R5D	43083752	0.967000	0.33354	0.994000	0.49952	0.995000	0.86356	0.071000	0.14594	-0.187000	0.10516	-0.302000	0.09304	CCG	.		0.542	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040573.3	NM_006245	
PRAMEF2	65122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	12920107	12920107	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:12920107C>T	ENST00000240189.2	+	3	934	c.847C>T	c.(847-849)Cac>Tac	p.H283Y		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	283					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTTCAGTGGGCACCTGGAACA	0.463																																					p.H283Y		.											.	PRAMEF2	68	0			c.C847T						.						80.0	81.0	81.0					1																	12920107		2202	4294	6496	SO:0001583	missense	65122	exon3			AGTGGGCACCTGG		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.847C>T	1.37:g.12920107C>T	ENSP00000240189:p.His283Tyr	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	58.0	20.0	NM_023014		Missense_Mutation	SNP	ENST00000240189.2	37	CCDS149.1	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.214119	0.01555	.	.	ENSG00000120952	ENST00000240189	T	0.00949	5.51	0.833	0.833	0.18875	.	1.018660	0.07819	N	0.959497	T	0.01124	0.0037	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.45659	-0.9246	10	0.39692	T	0.17	.	5.0256	0.14383	0.0:1.0:0.0:0.0	.	283	O60811	PRAM2_HUMAN	Y	283	ENSP00000240189:H283Y	ENSP00000240189:H283Y	H	+	1	0	PRAMEF2	12842694	0.000000	0.05858	0.004000	0.12327	0.007000	0.05969	-0.334000	0.07883	0.753000	0.32945	0.184000	0.17185	CAC	.		0.463	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005517.1	NM_023014	
PRKDC	5591	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	48839897	48839897	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:48839897C>T	ENST00000314191.2	-	21	2332	c.2276G>A	c.(2275-2277)gGc>gAc	p.G759D	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.G759D	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	759					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATAGCTCAGGCCCAGTTTGAA	0.363								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	.											.	PRKDC	1515	0			.						.						69.0	62.0	64.0					8																	48839897		1858	4096	5954	SO:0001583	missense	5591	.			CTCAGGCCCAGTT		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.2276G>A	8.37:g.48839897C>T	ENSP00000313420:p.Gly759Asp	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	31.0	.	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	ENST00000314191.2	37		.	.	.	.	.	.	.	.	.	.	C	26.5	4.744975	0.89663	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.39406	1.09;1.08	5.47	5.47	0.80525	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.72833	-0.4173	9	0.87932	D	0	.	19.3297	0.94281	0.0:1.0:0.0:0.0	.	759;759;759	P78527-2;E7EUY0;P78527	.;.;PRKDC_HUMAN	D	759	ENSP00000313420:G759D;ENSP00000345182:G759D	ENSP00000313420:G759D	G	-	2	0	PRKDC	49002450	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	7.085000	0.76875	2.571000	0.86741	0.462000	0.41574	GGC	.		0.363	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001081640	
PREX2	80243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	69021775	69021775	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:69021775A>T	ENST00000288368.4	+	25	3340	c.3063A>T	c.(3061-3063)gaA>gaT	p.E1021D		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1021					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAGACTTAGAAACCCAAGACA	0.463																																					p.E1021D		.											.	PREX2	390	0			c.A3063T						.						128.0	125.0	126.0					8																	69021775		2203	4300	6503	SO:0001583	missense	80243	exon25			CTTAGAAACCCAA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3063A>T	8.37:g.69021775A>T	ENSP00000288368:p.Glu1021Asp	Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	29.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	37	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302048	0.60195	.	.	ENSG00000046889	ENST00000288368	T	0.41400	1.0	5.72	4.57	0.56435	.	.	.	.	.	T	0.36468	0.0968	L	0.43923	1.385	0.40182	D	0.977305	B	0.14805	0.011	B	0.18871	0.023	T	0.18840	-1.0324	9	0.62326	D	0.03	.	11.4392	0.50086	0.9299:0.0:0.0701:0.0	.	1021	Q70Z35	PREX2_HUMAN	D	1021	ENSP00000288368:E1021D	ENSP00000288368:E1021D	E	+	3	2	PREX2	69184329	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.397000	0.44477	1.012000	0.39366	0.533000	0.62120	GAA	.		0.463	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PSD2	84249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	139189232	139189232	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:139189232T>C	ENST00000274710.3	+	2	412	c.207T>C	c.(205-207)caT>caC	p.H69H		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	69					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGCCTTCCATGGCCTCAGCC	0.642																																					p.H69H		.											.	PSD2	91	0			c.T207C						.						84.0	86.0	85.0					5																	139189232		2203	4300	6503	SO:0001819	synonymous_variant	84249	exon2			CTTCCATGGCCTC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.207T>C	5.37:g.139189232T>C		Somatic	231.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	88.0	NM_032289	D3DQD3|Q8N3J8	Silent	SNP	ENST00000274710.3	37	CCDS4216.1																																																																																			.		0.642	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
PSMD5	5711	ucsc.edu;bcgsc.ca	37	9	123595662	123595662	+	Silent	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:123595662C>A	ENST00000210313.3	-	2	320	c.246G>T	c.(244-246)cgG>cgT	p.R82R	PSMD5-AS1_ENST00000589026.1_RNA|PSMD5_ENST00000373904.5_Silent_p.R82R	NM_001270427.1|NM_005047.3	NP_001257356.1|NP_005038.1	Q16401	PSMD5_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 5	82					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome regulatory particle assembly (GO:0070682)|protein folding (GO:0006457)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)				endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|prostate(1)	10						CCCTGAGGTTCCGGGCCACGT	0.448																																					p.R82R		.											.	PSMD5	90	0			c.G246T						.						131.0	132.0	131.0					9																	123595662		2203	4300	6503	SO:0001819	synonymous_variant	5711	exon2			GAGGTTCCGGGCC	AK001065	CCDS6824.1, CCDS59143.1	9q34.11	2008-02-05			ENSG00000095261	ENSG00000095261		"""Proteasome (prosome, macropain) subunits"""	9563	protein-coding gene	gene with protein product		604452				7559544	Standard	NM_005047		Approved	S5B, KIAA0072	uc004bko.4	Q16401	OTTHUMG00000020573	ENST00000210313.3:c.246G>T	9.37:g.123595662C>A		Somatic	62.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_005047	B4DZM8|Q15045|Q4VXG8	Silent	SNP	ENST00000210313.3	37	CCDS6824.1																																																																																			.		0.448	PSMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053825.2	NM_005047	
PTEN	5728	ucsc.edu;bcgsc.ca	37	10	89711906	89711906	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:89711906T>C	ENST00000371953.3	+	6	1881	c.524T>C	c.(523-525)gTg>gCg	p.V175A		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	175	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(4)|p.V166fs*17(3)|p.G165fs*9(3)|p.Y27fs*1(2)|p.G165_*404del(1)|p.V175fs*3(1)|p.R172fs*5(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGGCGCTATGTGTATTATTAT	0.353		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.V175A		.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,carcinoma,+1	PTEN	17735	57	Whole gene deletion(37)|Deletion - Frameshift(12)|Unknown(4)|Complex - frameshift(3)|Deletion - In frame(1)	prostate(16)|central_nervous_system(13)|skin(9)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)|kidney(1)	c.T524C						.						135.0	138.0	137.0					10																	89711906		2203	4300	6503	SO:0001583	missense	5728	exon6	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	GCTATGTGTATTA	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.524T>C	10.37:g.89711906T>C	ENSP00000361021:p.Val175Ala	Somatic	71.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	37	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	T	29.3	4.997160	0.93167	.	.	ENSG00000171862	ENST00000371953	D	0.98889	-5.21	5.74	5.74	0.90152	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.99429	0.9798	H	0.96547	3.84	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.98397	1.0566	9	.	.	.	-2.4965	16.0449	0.80714	0.0:0.0:0.0:1.0	.	175	P60484	PTEN_HUMAN	A	175	ENSP00000361021:V175A	.	V	+	2	0	PTEN	89701886	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.615000	0.83006	2.198000	0.70561	0.482000	0.46254	GTG	.		0.353	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
PTPN14	5784	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	214557484	214557484	+	Missense_Mutation	SNP	G	G	A	rs200947677		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:214557484G>A	ENST00000366956.5	-	13	1908	c.1714C>T	c.(1714-1716)Cgg>Tgg	p.R572W	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	572	Poly-Pro.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GGTCGTGGCCGTGGGTAGGGG	0.652																																					p.R572W	Colon(92;557 1424 24372 34121 40073)	.											.	PTPN14	290	0			c.C1714T						.	G	TRP/ARG	0,4406		0,0,2203	42.0	46.0	45.0		1714	4.7	0.9	1		45	1,8599	1.2+/-3.3	0,1,4299	no	missense	PTPN14	NM_005401.4	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	572/1188	214557484	1,13005	2203	4300	6503	SO:0001583	missense	5784	exon13			GTGGCCGTGGGTA	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1714C>T	1.37:g.214557484G>A	ENSP00000355923:p.Arg572Trp	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	18.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	37	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850976	0.71719	0.0	1.16E-4	ENSG00000152104	ENST00000366956	T	0.68765	-0.35	5.61	4.68	0.58851	.	0.194784	0.45606	D	0.000350	T	0.72162	0.3426	L	0.47716	1.5	0.80722	D	1	D	0.69078	0.997	P	0.56434	0.798	T	0.72200	-0.4362	10	0.38643	T	0.18	.	16.3998	0.83635	0.0:0.0:0.8676:0.1324	.	572	Q15678	PTN14_HUMAN	W	572	ENSP00000355923:R572W	ENSP00000355923:R572W	R	-	1	2	PTPN14	212624107	0.883000	0.30277	0.857000	0.33713	0.992000	0.81027	3.487000	0.53222	1.482000	0.48325	0.650000	0.86243	CGG	G|0.999;A|0.001		0.652	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
PTPRT	11122	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	40714481	40714481	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr20:40714481A>G	ENST00000373187.1	-	28	3858	c.3859T>C	c.(3859-3861)Tac>Cac	p.Y1287H	PTPRT_ENST00000373184.1_Missense_Mutation_p.Y1297H|PTPRT_ENST00000373198.4_Missense_Mutation_p.Y1306H|PTPRT_ENST00000373193.3_Missense_Mutation_p.Y1290H|PTPRT_ENST00000356100.2_Missense_Mutation_p.Y1296H|PTPRT_ENST00000373201.1_Missense_Mutation_p.Y1277H|PTPRT_ENST00000373190.1_Missense_Mutation_p.Y1286H			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1287	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCAGGCCAGTACTGCATACAG	0.498																																					p.Y1306H		.											.	PTPRT	664	0			c.T3916C						.						66.0	67.0	67.0					20																	40714481		1933	4138	6071	SO:0001583	missense	11122	exon29			GCCAGTACTGCAT	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3859T>C	20.37:g.40714481A>G	ENSP00000362283:p.Tyr1287His	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	30.0	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	37	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.834450	0.91036	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	D;D;D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27;-3.27;-3.27	5.31	5.31	0.75309	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.136624	0.51477	D	0.000097	D	0.98317	0.9442	H	0.99379	4.54	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.983;0.99	D	0.99694	1.1002	10	0.87932	D	0	.	15.4285	0.75072	1.0:0.0:0.0:0.0	.	1309;1287	O14522-1;O14522	.;PTPRT_HUMAN	H	1286;1287;1290;1296;1309;1297;1277	ENSP00000362286:Y1286H;ENSP00000362283:Y1287H;ENSP00000362289:Y1290H;ENSP00000348408:Y1296H;ENSP00000362294:Y1309H;ENSP00000362280:Y1297H;ENSP00000362297:Y1277H	ENSP00000348408:Y1296H	Y	-	1	0	PTPRT	40147895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.040000	0.93783	2.232000	0.73038	0.533000	0.62120	TAC	.		0.498	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
RAB34	83871	ucsc.edu;bcgsc.ca	37	17	27042076	27042076	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr17:27042076T>C	ENST00000395245.3	-	8	1204	c.578A>G	c.(577-579)gAg>gGg	p.E193G	RAB34_ENST00000447716.1_Missense_Mutation_p.E250G|RAB34_ENST00000301043.6_Missense_Mutation_p.E193G|RAB34_ENST00000415040.2_Missense_Mutation_p.E171G|RAB34_ENST00000450529.1_Missense_Mutation_p.E185G|RAB34_ENST00000395243.3_Missense_Mutation_p.E185G|RAB34_ENST00000453384.3_Intron|RAB34_ENST00000436730.3_Missense_Mutation_p.E193G|RAB34_ENST00000395242.2_Missense_Mutation_p.E194G	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family	193					antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					TGCCCAGTACTCAGCCTTCAT	0.587																																					p.E250G	Pancreas(175;216 2049 29940 32498 41589)	.											.	RAB34	227	0			c.A749G						.						86.0	72.0	77.0					17																	27042076		2203	4300	6503	SO:0001583	missense	83871	exon9			CAGTACTCAGCCT	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680	ENST00000395245.3:c.578A>G	17.37:g.27042076T>C	ENSP00000378666:p.Glu193Gly	Somatic	63.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001144943	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Missense_Mutation	SNP	ENST00000395245.3	37	CCDS11240.1	.	.	.	.	.	.	.	.	.	.	T	17.70	3.454797	0.63290	.	.	ENSG00000109113	ENST00000447716;ENST00000301043;ENST00000395243;ENST00000415040;ENST00000450529;ENST00000395242;ENST00000395245;ENST00000436730;ENST00000430132;ENST00000412625;ENST00000353676	T;T;T;T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;-1.33	5.16	5.16	0.70880	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.86331	0.5907	L	0.50919	1.6	0.49687	D	0.999811	D;D;D;D;D;D	0.89917	0.997;0.995;0.969;1.0;0.996;0.969	D;D;P;D;D;P	0.79108	0.911;0.947;0.795;0.992;0.969;0.795	D	0.89157	0.3527	9	0.66056	D	0.02	-31.2302	13.9672	0.64216	0.0:0.0:0.0:1.0	.	171;185;216;208;194;193	E9PEJ9;Q9BZG1-2;C9JI96;B4DNC0;A8MYQ9;Q9BZG1	.;.;.;.;.;RAB34_HUMAN	G	250;193;185;171;208;194;193;216;194;193;193	ENSP00000410403:E250G;ENSP00000301043:E193G;ENSP00000378664:E185G;ENSP00000410279:E171G;ENSP00000378663:E194G;ENSP00000378666:E193G;ENSP00000398706:E193G;ENSP00000226259:E193G	ENSP00000301043:E193G	E	-	2	0	RAB34	24066203	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.538000	0.82048	2.170000	0.68504	0.379000	0.24179	GAG	.		0.587	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345906.1	NM_031934	
RBBP5	5929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	205084043	205084043	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:205084043G>A	ENST00000264515.6	-	3	233	c.92C>T	c.(91-93)aCc>aTc	p.T31I	RBBP5_ENST00000367164.1_Missense_Mutation_p.T31I|RBBP5_ENST00000484379.1_5'UTR	NM_001193273.1|NM_005057.3	NP_001180202.1|NP_005048.2	Q15291	RBBP5_HUMAN	retinoblastoma binding protein 5	31					cellular response to DNA damage stimulus (GO:0006974)|histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	methylated histone binding (GO:0035064)|transcription regulatory region DNA binding (GO:0044212)			cervix(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	27	Breast(84;0.0505)		BRCA - Breast invasive adenocarcinoma(75;0.0923)			CCTGTTAAAGGTGCAAGTCAA	0.408																																					p.T31I		.											.	RBBP5	226	0			c.C92T						.						53.0	48.0	49.0					1																	205084043		2203	4298	6501	SO:0001583	missense	5929	exon3			TTAAAGGTGCAAG	BC053856	CCDS30983.1, CCDS53463.1	1q32	2013-01-10	2001-11-28		ENSG00000117222	ENSG00000117222		"""WD repeat domain containing"""	9888	protein-coding gene	gene with protein product	"""SWD1, Set1c WD40 repeat protein, homolog (S. cerevisiae)"""	600697	"""retinoblastoma-binding protein 5"""			7558034	Standard	NM_005057		Approved	RBQ3, SWD1	uc001hbu.2	Q15291	OTTHUMG00000037104	ENST00000264515.6:c.92C>T	1.37:g.205084043G>A	ENSP00000264515:p.Thr31Ile	Somatic	192.0	0.0		WXS	Illumina HiSeq	Phase_I	369.0	120.0	NM_005057	A8K272|Q7Z6D8|Q8NDZ7	Missense_Mutation	SNP	ENST00000264515.6	37	CCDS30983.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226673	0.79576	.	.	ENSG00000117222	ENST00000264515;ENST00000367164	T;T	0.59502	0.26;0.26	5.82	5.82	0.92795	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.64560	0.2609	M	0.64170	1.965	0.80722	D	1	P;B;P	0.43169	0.687;0.397;0.8	P;B;B	0.45232	0.474;0.098;0.248	T	0.67078	-0.5761	10	0.66056	D	0.02	.	19.6939	0.96016	0.0:0.0:1.0:0.0	.	66;31;31	B4DMM7;Q15291-2;Q15291	.;.;RBBP5_HUMAN	I	31	ENSP00000264515:T31I;ENSP00000356132:T31I	ENSP00000264515:T31I	T	-	2	0	RBBP5	203350666	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.735000	0.98825	2.764000	0.94973	0.650000	0.86243	ACC	.		0.408	RBBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090077.1	NM_005057	
RBM6	10180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	50095360	50095360	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:50095360G>A	ENST00000266022.4	+	9	2152	c.1893G>A	c.(1891-1893)agG>agA	p.R631R	RBM6_ENST00000422955.1_Silent_p.R109R|RBM6_ENST00000443081.1_Silent_p.R499R|RBM6_ENST00000442092.1_Silent_p.R109R|RBM6_ENST00000539992.1_5'UTR|RBM6_ENST00000441115.1_3'UTR	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	631					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CTTCTCGAAGGGAAGGGCCAA	0.507																																					p.R631R		.											.	RBM6	280	0			c.G1893A						.						81.0	78.0	79.0					3																	50095360		2203	4300	6503	SO:0001819	synonymous_variant	10180	exon9			TCGAAGGGAAGGG	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1893G>A	3.37:g.50095360G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	52.0	35.0	NM_005777	O60549|O75524|Q86SS3	Silent	SNP	ENST00000266022.4	37	CCDS2809.1																																																																																			.		0.507	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
RET	5979	ucsc.edu;bcgsc.ca	37	10	43613903	43613903	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:43613903A>G	ENST00000355710.3	+	13	2599	c.2367A>G	c.(2365-2367)aaA>aaG	p.K789K	RET_ENST00000340058.5_Silent_p.K789K	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	789	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	ATGTCATCAAATTGTATGGGG	0.597		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.K789K	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)	.	yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	.	RET	4507	0			c.A2367G						.						56.0	48.0	51.0					10																	43613903		2203	4300	6503	SO:0001819	synonymous_variant	5979	exon13	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	CATCAAATTGTAT	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2367A>G	10.37:g.43613903A>G		Somatic	86.0	0.0		WXS	Illumina HiSeq	.	52.0	5.0	NM_020975	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	ENST00000355710.3	37	CCDS7200.1																																																																																			.		0.597	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047694.2	NM_020975	
RGS22	26166	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	101118126	101118126	+	Splice_Site	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:101118126C>A	ENST00000360863.6	-	1	218	c.24G>T	c.(22-24)gcG>gcT	p.A8A	RGS22_ENST00000523437.1_Splice_Site_p.A8A|RGS22_ENST00000523287.1_5'Flank	NM_015668.3	NP_056483.3	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	8					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)		RGS22/SYCP1(2)	breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(33)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	68			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			GCCACCTACCCGCGGTGAGCC	0.751																																					p.A8A		.											.	RGS22	140	0			c.G24T						.						7.0	15.0	12.0					8																	101118126		1344	2930	4274	SO:0001630	splice_region_variant	26166	exon1			CCTACCCGCGGTG	AY009106	CCDS43758.1, CCDS69521.1, CCDS75775.1	8q22.2	2014-01-21	2007-08-14		ENSG00000132554	ENSG00000132554		"""Regulators of G-protein signaling"""	24499	protein-coding gene	gene with protein product		615650	"""regulator of G-protein signalling 22"""				Standard	XM_005250856		Approved	DKFZP434I092, PRTD-NY2, CT145	uc003yjb.1	Q8NE09	OTTHUMG00000164802	ENST00000360863.6:c.25+1G>T	8.37:g.101118126C>A		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	34.0	NM_015668	A8K944|Q569L2|Q86Y71|Q9BYZ4|Q9UFN6	Silent	SNP	ENST00000360863.6	37	CCDS43758.1																																																																																			.		0.751	RGS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380365.1	NM_015668	Silent
RHBDF1	64285	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	111695	111695	+	Splice_Site	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr16:111695C>T	ENST00000262316.6	-	9	1351		c.e9-1		RHBDF1_ENST00000454039.2_Splice_Site	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GAAGAAGGGCCTGCGGGGTGG	0.677																																					.		.											.	RHBDF1	92	0			c.1209-1G>A						.						54.0	53.0	53.0					16																	111695		2203	4300	6503	SO:0001630	splice_region_variant	64285	exon10			AAGGGCCTGCGGG	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1209-1G>A	16.37:g.111695C>T		Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	21.0	NM_022450	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Splice_Site	SNP	ENST00000262316.6	37	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	c	15.27	2.784646	0.49997	.	.	ENSG00000007384	ENST00000262316;ENST00000454039	.	.	.	4.43	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5704	0.84611	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RHBDF1	51695	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.312000	0.78968	2.448000	0.82819	0.462000	0.41574	.	.		0.677	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2	NM_022450	Intron
RING1	6015	broad.mit.edu;bcgsc.ca	37	6	33178961	33178961	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:33178961C>T	ENST00000374656.4	+	5	690	c.482C>T	c.(481-483)cCa>cTa	p.P161L	RING1_ENST00000478431.1_3'UTR	NM_002931.3	NP_002922.2	Q06587	RING1_HUMAN	ring finger protein 1	161	Necessary for transcriptional repression. {ECO:0000250}.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|histone H2A monoubiquitination (GO:0035518)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(5)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|skin(4)	17						CGGCCGATACCAGGGTCAGAT	0.547																																					p.P161L		.											.	RING1	159	0			c.C482T						.						167.0	208.0	193.0					6																	33178961		1509	2707	4216	SO:0001583	missense	6015	exon5			CGATACCAGGGTC		CCDS34424.1	6p21.3	2013-01-09			ENSG00000204227	ENSG00000204227		"""RING-type (C3HC4) zinc fingers"""	10018	protein-coding gene	gene with protein product		602045				1906426	Standard	NM_002931		Approved	RNF1	uc003odk.3	Q06587	OTTHUMG00000031278	ENST00000374656.4:c.482C>T	6.37:g.33178961C>T	ENSP00000363787:p.Pro161Leu	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	23.0	3.0	NM_002931	A8JZZ0|Q5JP96|Q5SQW2|Q86V19	Missense_Mutation	SNP	ENST00000374656.4	37	CCDS34424.1	.	.	.	.	.	.	.	.	.	.	C	11.66	1.704970	0.30232	.	.	ENSG00000204227	ENST00000374656	T	0.77620	-1.11	4.16	4.16	0.48862	.	0.178405	0.35585	N	0.003115	T	0.42494	0.1205	N	0.14661	0.345	0.49582	D	0.9998	B	0.18741	0.03	B	0.15870	0.014	T	0.40232	-0.9574	10	0.13853	T	0.58	-23.194	11.842	0.52359	0.0:1.0:0.0:0.0	.	161	Q06587	RING1_HUMAN	L	161	ENSP00000363787:P161L	ENSP00000363787:P161L	P	+	2	0	RING1	33286939	0.976000	0.34144	0.919000	0.36401	0.937000	0.57800	2.425000	0.44723	2.146000	0.66826	0.478000	0.44815	CCA	.		0.547	RING1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076609.2		
RNF216	54476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	5662625	5662625	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:5662625T>C	ENST00000425013.2	-	17	2691	c.2467A>G	c.(2467-2469)Atg>Gtg	p.M823V	RNF216_ENST00000389902.3_Missense_Mutation_p.M880V|RNF216_ENST00000469375.1_5'UTR	NM_207111.3|NM_207116.2	NP_996994.1|NP_996999.1	Q9NWF9	RN216_HUMAN	ring finger protein 216	823	Pro-rich.				apoptotic process (GO:0006915)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of defense response to virus by host (GO:0050691)|regulation of interferon-beta production (GO:0032648)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)		FBXL18/RNF216(2)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|urinary_tract(4)	33		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		ATAGGCCCCATGTTGAGTGGG	0.632																																					p.M880V		.											.	RNF216	274	0			c.A2638G						.						90.0	94.0	93.0					7																	5662625		2203	4300	6503	SO:0001583	missense	54476	exon17			GCCCCATGTTGAG	AY062174	CCDS34594.1, CCDS34595.1	7p22.1	2014-02-12	2007-08-20		ENSG00000011275	ENSG00000011275		"""RING-type (C3HC4) zinc fingers"""	21698	protein-coding gene	gene with protein product		609948					Standard	NM_207111		Approved	TRIAD3, UBCE7IP1, ZIN	uc003sox.2	Q9NWF9	OTTHUMG00000155500	ENST00000425013.2:c.2467A>G	7.37:g.5662625T>C	ENSP00000404602:p.Met823Val	Somatic	115.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	17.0	NM_207111	Q6Y691|Q75ML7|Q7Z2H7|Q7Z7C1|Q8NHW7|Q9NYT1	Missense_Mutation	SNP	ENST00000425013.2	37	CCDS34595.1	.	.	.	.	.	.	.	.	.	.	T	7.905	0.735170	0.15574	.	.	ENSG00000011275	ENST00000425013;ENST00000389902;ENST00000458425	T;T	0.41758	0.99;1.0	5.04	0.817	0.18773	.	0.264571	0.41938	D	0.000795	T	0.25975	0.0633	L	0.29908	0.895	0.27953	N	0.937071	B;B	0.12013	0.004;0.005	B;B	0.10450	0.003;0.005	T	0.12578	-1.0542	10	0.42905	T	0.14	-6.3676	6.4203	0.21740	0.3737:0.0:0.1296:0.4967	.	823;880	Q9NWF9;Q9NWF9-1	RN216_HUMAN;.	V	823;880;635	ENSP00000404602:M823V;ENSP00000374552:M880V	ENSP00000374552:M880V	M	-	1	0	RNF216	5629151	1.000000	0.71417	1.000000	0.80357	0.123000	0.20343	1.296000	0.33389	0.292000	0.22492	0.459000	0.35465	ATG	.		0.632	RNF216-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000340374.1	NM_207111	
RRP1B	23076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	45089836	45089836	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr21:45089836C>A	ENST00000340648.4	+	2	319	c.202C>A	c.(202-204)Ccc>Acc	p.P68T		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	68					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		GCAGGATGAACCCCTTCTACA	0.483																																					p.P68T		.											.	RRP1B	91	0			c.C202A						.						112.0	108.0	109.0					21																	45089836		2203	4300	6503	SO:0001583	missense	23076	exon2			GATGAACCCCTTC	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.202C>A	21.37:g.45089836C>A	ENSP00000339145:p.Pro68Thr	Somatic	310.0	0.0		WXS	Illumina HiSeq	Phase_I	192.0	103.0	NM_015056	Q8TBZ4	Missense_Mutation	SNP	ENST00000340648.4	37	CCDS33577.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.371033	0.61624	.	.	ENSG00000160208	ENST00000340648	T	0.52295	0.67	5.84	4.01	0.46588	.	0.048335	0.85682	D	0.000000	T	0.66287	0.2774	M	0.92507	3.315	0.58432	D	0.999997	P	0.47604	0.898	P	0.51974	0.686	T	0.74034	-0.3794	10	0.87932	D	0	-0.1797	10.3306	0.43820	0.0:0.7944:0.1334:0.0723	.	68	Q14684	RRP1B_HUMAN	T	68	ENSP00000339145:P68T	ENSP00000339145:P68T	P	+	1	0	RRP1B	43914264	1.000000	0.71417	0.972000	0.41901	0.813000	0.45954	2.301000	0.43628	1.473000	0.48159	-0.150000	0.13652	CCC	.		0.483	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
SASH1	23328	ucsc.edu;bcgsc.ca	37	6	148869462	148869462	+	Missense_Mutation	SNP	G	G	T	rs143577116	byFrequency	TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:148869462G>T	ENST00000367467.3	+	20	3987	c.3512G>T	c.(3511-3513)cGa>cTa	p.R1171L		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1171					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GAAATCTGCCGAAAGCCCGTC	0.517																																					p.R1171L		.											.	SASH1	90	0			c.G3512T						.						92.0	88.0	89.0					6																	148869462		2203	4300	6503	SO:0001583	missense	23328	exon20			TCTGCCGAAAGCC	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.3512G>T	6.37:g.148869462G>T	ENSP00000356437:p.Arg1171Leu	Somatic	57.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_015278	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	ENST00000367467.3	37	CCDS5212.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789618	0.90367	.	.	ENSG00000111961	ENST00000367467;ENST00000537769	D	0.82803	-1.65	5.22	5.22	0.72569	Sterile alpha motif/pointed domain (1);	0.000000	0.85682	D	0.000000	D	0.84110	0.5400	L	0.27053	0.805	0.51767	D	0.99993	D	0.89917	1.0	D	0.85130	0.997	D	0.86645	0.1894	10	0.66056	D	0.02	-20.4211	18.7994	0.92010	0.0:0.0:1.0:0.0	.	1171	O94885	SASH1_HUMAN	L	1171;581	ENSP00000356437:R1171L	ENSP00000356437:R1171L	R	+	2	0	SASH1	148911155	1.000000	0.71417	0.050000	0.19076	0.988000	0.76386	9.224000	0.95209	2.451000	0.82905	0.561000	0.74099	CGA	G|0.999;A|0.001		0.517	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042619.1	NM_015278	
SATB1	6304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	18436227	18436227	+	Silent	SNP	A	A	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr3:18436227A>T	ENST00000338745.6	-	7	2667	c.933T>A	c.(931-933)ccT>ccA	p.P311P	SATB1_ENST00000454909.2_Silent_p.P311P|SATB1_ENST00000417717.2_Silent_p.P311P|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000475083.1_5'Flank	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	311					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						GAGGACTGATAGGTGTTGATA	0.567																																					p.P311P		.											.	SATB1	228	0			c.T933A						.						149.0	138.0	142.0					3																	18436227		2203	4300	6503	SO:0001819	synonymous_variant	6304	exon7			ACTGATAGGTGTT		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.933T>A	3.37:g.18436227A>T		Somatic	156.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	60.0	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Silent	SNP	ENST00000338745.6	37	CCDS2631.1																																																																																			.		0.567	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
SETDB2	83852	ucsc.edu;bcgsc.ca	37	13	50054356	50054356	+	Splice_Site	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr13:50054356A>G	ENST00000317257.8	+	8	1732	c.907A>G	c.(907-909)Aca>Gca	p.T303A	SETDB2_ENST00000258672.5_Splice_Site_p.T291A|SETDB2_ENST00000354234.4_Splice_Site_p.T291A	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	303	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		GCCTTTTAGAACAAAATGTGC	0.358																																					p.T303A		.											.	SETDB2	91	0			c.A907G						.						120.0	129.0	126.0					13																	50054356		2203	4300	6503	SO:0001630	splice_region_variant	83852	exon8			TTTAGAACAAAAT	AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.906-1A>G	13.37:g.50054356A>G		Somatic	118.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_031915	Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	ENST00000317257.8	37	CCDS9417.1	.	.	.	.	.	.	.	.	.	.	A	13.98	2.397963	0.42512	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	T;T;T	0.75938	-0.98;-0.98;-0.98	5.63	0.18	0.15068	Pre-SET domain (2);	0.533144	0.22814	N	0.055316	T	0.54806	0.1881	L	0.36672	1.1	0.26050	N	0.981499	P;P;P	0.41131	0.739;0.649;0.698	B;B;B	0.36989	0.225;0.153;0.238	T	0.45731	-0.9241	10	0.25751	T	0.34	.	4.7235	0.12929	0.5604:0.0:0.2289:0.2108	.	303;291;303	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	A	291;303;291	ENSP00000346175:T291A;ENSP00000326477:T303A;ENSP00000258672:T291A	ENSP00000258672:T291A	T	+	1	0	SETDB2	48952357	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	0.955000	0.29188	0.431000	0.26258	-0.256000	0.11100	ACA	.		0.358	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044925.1	NM_031915	Missense_Mutation
SFXN3	81855	ucsc.edu;bcgsc.ca	37	10	102794566	102794566	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:102794566T>C	ENST00000224807.5	+	3	583	c.127T>C	c.(127-129)Tcc>Ccc	p.S43P	SFXN3_ENST00000393459.1_Missense_Mutation_p.S39P	NM_030971.3	NP_112233.2	Q9BWM7	SFXN3_HUMAN	sideroflexin 3	43					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		TCTGCTGCTGTCCGGGGCACA	0.512																																					p.S43P		.											.	SFXN3	91	0			c.T127C						.						95.0	100.0	98.0					10																	102794566		2203	4300	6503	SO:0001583	missense	81855	exon3			CTGCTGTCCGGGG	AK074707	CCDS7508.2	10q24.32	2008-09-04			ENSG00000107819	ENSG00000107819		"""Sideroflexins"""	16087	protein-coding gene	gene with protein product		615571					Standard	NM_030971		Approved	SFX3	uc001ksp.3	Q9BWM7	OTTHUMG00000018921	ENST00000224807.5:c.127T>C	10.37:g.102794566T>C	ENSP00000224807:p.Ser43Pro	Somatic	90.0	0.0		WXS	Illumina HiSeq	.	55.0	5.0	NM_030971	Q8NCJ0|Q9NTP4	Missense_Mutation	SNP	ENST00000224807.5	37	CCDS7508.2	.	.	.	.	.	.	.	.	.	.	T	13.47	2.248195	0.39697	.	.	ENSG00000107819	ENST00000393459;ENST00000224807	T;T	0.35973	1.28;1.28	5.86	4.7	0.59300	.	0.108121	0.64402	D	0.000003	T	0.41627	0.1167	M	0.68728	2.09	0.51767	D	0.999936	B;B;B	0.27700	0.186;0.091;0.091	B;B;B	0.37387	0.248;0.097;0.097	T	0.21759	-1.0236	10	0.33940	T	0.23	-17.8245	11.0579	0.47929	0.1383:0.0:0.0:0.8617	.	43;43;43	B4DRS6;A6NCZ6;Q9BWM7	.;.;SFXN3_HUMAN	P	39;43	ENSP00000377103:S39P;ENSP00000224807:S43P	ENSP00000224807:S43P	S	+	1	0	SFXN3	102784556	0.958000	0.32768	0.958000	0.39756	0.549000	0.35272	1.762000	0.38451	1.003000	0.39130	0.533000	0.62120	TCC	.		0.512	SFXN3-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_030971	
SH3GL2	6456	ucsc.edu;bcgsc.ca	37	9	17786386	17786386	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:17786386A>G	ENST00000380607.4	+	4	315	c.195A>G	c.(193-195)agA>agG	p.R65R	SH3GL2_ENST00000537391.1_Silent_p.R18R	NM_003026.2	NP_003017.1	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	65	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Binds and tubulates liposomes. {ECO:0000250}.|Required for dimerization upon membrane association. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of receptor internalization (GO:0002090)|signal transduction (GO:0007165)|synaptic vesicle endocytosis (GO:0048488)	clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		CAGCTTCCAGAGCTAAGCTCA	0.542																																					p.R65R		.											.	SH3GL2	91	0			c.A195G						.						86.0	84.0	85.0					9																	17786386		2203	4300	6503	SO:0001819	synonymous_variant	6456	exon4			TTCCAGAGCTAAG	X99657	CCDS6483.1	9p22	2008-02-05			ENSG00000107295	ENSG00000107295			10831	protein-coding gene	gene with protein product		604465				9169142	Standard	XM_005251549		Approved	SH3P4, SH3D2A, CNSA2, EEN-B1	uc003zna.3	Q99962	OTTHUMG00000019601	ENST00000380607.4:c.195A>G	9.37:g.17786386A>G		Somatic	77.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_003026	B2R618|Q9NQK5	Silent	SNP	ENST00000380607.4	37	CCDS6483.1																																																																																			.		0.542	SH3GL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051796.1	NM_003026	
SIGIRR	59307	ucsc.edu;bcgsc.ca	37	11	408175	408175	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:408175A>G	ENST00000431843.2	-	4	544	c.238T>C	c.(238-240)Tcc>Ccc	p.S80P	SIGIRR_ENST00000529486.1_5'UTR|SIGIRR_ENST00000382520.2_Missense_Mutation_p.S80P|SIGIRR_ENST00000332725.3_Missense_Mutation_p.S80P|SIGIRR_ENST00000397632.3_Missense_Mutation_p.S80P|SIGIRR_ENST00000531205.1_Missense_Mutation_p.S80P	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	80	Ig-like C2-type.				acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGACACTGGACACAAGCACC	0.587																																					p.S80P		.											.	SIGIRR	90	0			c.T238C						.						116.0	108.0	111.0					11																	408175		2202	4300	6502	SO:0001583	missense	59307	exon4			CACTGGACACAAG		CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.238T>C	11.37:g.408175A>G	ENSP00000403104:p.Ser80Pro	Somatic	43.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_021805	Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	ENST00000431843.2	37	CCDS31325.1	.	.	.	.	.	.	.	.	.	.	a	12.39	1.924314	0.34002	.	.	ENSG00000185187	ENST00000431843;ENST00000397632;ENST00000332725;ENST00000531205;ENST00000382520	T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51	3.0	3.0	0.34707	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.579755	0.16764	N	0.200495	T	0.75213	0.3819	M	0.62723	1.935	0.47065	D	0.999306	D;D	0.71674	0.998;0.993	P;P	0.59288	0.852;0.855	T	0.74839	-0.3528	10	0.54805	T	0.06	.	6.6413	0.22911	0.7247:0.2753:0.0:0.0	.	80;80	C9JFX4;Q6IA17	.;SIGIR_HUMAN	P	80	ENSP00000403104:S80P;ENSP00000380756:S80P;ENSP00000333656:S80P;ENSP00000433022:S80P;ENSP00000371960:S80P	ENSP00000333656:S80P	S	-	1	0	SIGIRR	398175	0.109000	0.22037	0.947000	0.38551	0.044000	0.14063	0.373000	0.20484	1.618000	0.50286	0.254000	0.18369	TCC	.		0.587	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383884.3	NM_021805	
SLC19A2	10560	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	169446920	169446920	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:169446920A>G	ENST00000236137.5	-	2	516	c.280T>C	c.(280-282)Tac>Cac	p.Y94H	SLC19A2_ENST00000367804.4_Intron	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	94					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	TAACGGAGGTAGTCTGTGGCA	0.423																																					p.Y94H		.											.	SLC19A2	90	0			c.T280C						.						52.0	49.0	50.0					1																	169446920		2203	4300	6503	SO:0001583	missense	10560	exon2			GGAGGTAGTCTGT	AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.280T>C	1.37:g.169446920A>G	ENSP00000236137:p.Tyr94His	Somatic	141.0	2.0		WXS	Illumina HiSeq	Phase_I	180.0	57.0	NM_006996	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Missense_Mutation	SNP	ENST00000236137.5	37	CCDS1280.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.195537	0.78902	.	.	ENSG00000117479	ENST00000236137;ENST00000367802	T;T	0.80738	-1.41;-1.41	4.57	4.57	0.56435	Major facilitator superfamily domain, general substrate transporter (1);	0.186528	0.48767	D	0.000173	D	0.88969	0.6582	M	0.88450	2.955	0.41522	D	0.988408	D	0.89917	1.0	D	0.76071	0.987	D	0.90986	0.4831	9	0.59425	D	0.04	-8.566	14.3959	0.67010	1.0:0.0:0.0:0.0	.	94	O60779	S19A2_HUMAN	H	94	ENSP00000236137:Y94H;ENSP00000356776:Y94H	ENSP00000236137:Y94H	Y	-	1	0	SLC19A2	167713544	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.087000	0.94110	2.048000	0.60808	0.528000	0.53228	TAC	.		0.423	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1	NM_006996	
SLC35A2	7355	ucsc.edu;bcgsc.ca	37	X	48763797	48763797	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chrX:48763797A>G	ENST00000247138.5	-	3	301	c.298T>C	c.(298-300)Ttc>Ctc	p.F100L	SLC35A2_ENST00000376515.3_Missense_Mutation_p.F76L|SLC35A2_ENST00000376512.1_Missense_Mutation_p.F100L|SLC35A2_ENST00000413561.2_Missense_Mutation_p.F39L|SLC35A2_ENST00000445167.2_Missense_Mutation_p.F100L|SLC35A2_ENST00000376529.3_Missense_Mutation_p.F100L|SLC35A2_ENST00000376521.1_Missense_Mutation_p.F100L|SLC35A2_ENST00000452555.2_Missense_Mutation_p.F128L	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	100					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						TCATGGAGGAAGAGAACCAGG	0.547																																					p.F100L		.											.	SLC35A2	193	0			c.T298C						.						142.0	101.0	115.0					X																	48763797		2203	4300	6503	SO:0001583	missense	7355	exon3			GGAGGAAGAGAAC	D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.298T>C	X.37:g.48763797A>G	ENSP00000247138:p.Phe100Leu	Somatic	52.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_001042498	A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Missense_Mutation	SNP	ENST00000247138.5	37	CCDS14311.1	.	.	.	.	.	.	.	.	.	.	A	10.08	1.250957	0.22880	.	.	ENSG00000102100	ENST00000247138;ENST00000376529;ENST00000376521;ENST00000445167;ENST00000413561;ENST00000376515;ENST00000452555;ENST00000446885;ENST00000376512	T;T;T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04;1.04	5.57	5.57	0.84162	.	0.150204	0.51477	D	0.000100	T	0.15998	0.0385	N	0.01297	-0.9	0.32774	N	0.503346	B;B;B;B;B;B;B;B	0.20780	0.048;0.003;0.001;0.01;0.03;0.027;0.0;0.001	B;B;B;B;B;B;B;B	0.24006	0.048;0.01;0.01;0.007;0.05;0.012;0.006;0.001	T	0.20075	-1.0286	10	0.08179	T	0.78	-29.0415	12.1882	0.54252	1.0:0.0:0.0:0.0	.	113;39;128;113;28;100;100;100	B4DSH7;B4DE11;E7EW45;B4DE15;Q8NBD6;P78381-3;P78381-2;P78381	.;.;.;.;.;.;.;S35A2_HUMAN	L	100;100;100;100;39;76;128;28;100	ENSP00000247138:F100L;ENSP00000365712:F100L;ENSP00000365704:F100L;ENSP00000402726:F100L;ENSP00000393233:F39L;ENSP00000365698:F76L;ENSP00000416002:F128L;ENSP00000415518:F28L;ENSP00000365695:F100L	ENSP00000247138:F100L	F	-	1	0	SLC35A2	48648741	0.986000	0.35501	0.996000	0.52242	0.671000	0.39405	2.617000	0.46385	1.864000	0.54056	0.486000	0.48141	TTC	.		0.547	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060790.1	NM_005660	
SLC44A2	57153	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10753056	10753056	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:10753056G>A	ENST00000335757.5	+	21	2319	c.1943G>A	c.(1942-1944)gGc>gAc	p.G648D	SLC44A2_ENST00000586078.1_Missense_Mutation_p.G648D|SLC44A2_ENST00000588214.1_3'UTR|SLC44A2_ENST00000407327.4_Missense_Mutation_p.G646D			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	648					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	GTGATCGTTGGCTCCTACTTG	0.577																																					p.G648D		.											.	SLC44A2	91	0			c.G1943A						.						317.0	201.0	240.0					19																	10753056		2203	4300	6503	SO:0001583	missense	57153	exon21			TCGTTGGCTCCTA	AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1943G>A	19.37:g.10753056G>A	ENSP00000336888:p.Gly648Asp	Somatic	310.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	82.0	NM_020428	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	ENST00000335757.5	37	CCDS12245.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382023	0.82792	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.24350	1.86;1.86	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.63462	0.2513	M	0.93375	3.41	0.80722	D	1	D;D;D	0.71674	0.998;0.996;0.995	D;D;D	0.78314	0.991;0.953;0.985	T	0.72478	-0.4281	10	0.62326	D	0.03	-3.4702	18.5195	0.90947	0.0:0.0:1.0:0.0	.	648;648;646	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	D	646;648;648	ENSP00000385135:G646D;ENSP00000336888:G648D	ENSP00000336888:G648D	G	+	2	0	SLC44A2	10614056	1.000000	0.71417	0.995000	0.50966	0.480000	0.33159	9.300000	0.96151	2.668000	0.90789	0.655000	0.94253	GGC	.		0.577	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452045.1		
SLC8A2	6543	ucsc.edu;bcgsc.ca	37	19	47935595	47935595	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:47935595C>T	ENST00000236877.6	-	9	2613	c.2218G>A	c.(2218-2220)Gtg>Atg	p.V740M	SLC8A2_ENST00000539381.1_Missense_Mutation_p.V203M|SLC8A2_ENST00000542837.1_Missense_Mutation_p.V496M|SLC8A2_ENST00000601757.1_5'Flank	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	740					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		GTGGGGGGCACACAGGCGAAG	0.647																																					p.V740M		.											.	SLC8A2	94	0			c.G2218A						.						102.0	88.0	92.0					19																	47935595		2203	4300	6503	SO:0001583	missense	6543	exon9			GGGGCACACAGGC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.2218G>A	19.37:g.47935595C>T	ENSP00000236877:p.Val740Met	Somatic	40.0	0.0		WXS	Illumina HiSeq	.	32.0	4.0	NM_015063	B4DYQ9	Missense_Mutation	SNP	ENST00000236877.6	37	CCDS33065.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981996	0.74474	.	.	ENSG00000118160	ENST00000391903;ENST00000236877;ENST00000539381;ENST00000542837	T;T;T	0.68331	1.17;-0.32;1.02	4.23	4.23	0.50019	.	0.000000	0.64402	D	0.000016	D	0.84492	0.5484	M	0.90705	3.14	0.80722	D	1	D;D	0.76494	0.999;0.993	D;P	0.85130	0.997;0.855	D	0.87972	0.2737	10	0.66056	D	0.02	.	15.9664	0.79974	0.0:1.0:0.0:0.0	.	568;740	E9PGS7;Q9UPR5	.;NAC2_HUMAN	M	568;740;203;496	ENSP00000236877:V740M;ENSP00000440588:V203M;ENSP00000437536:V496M	ENSP00000236877:V740M	V	-	1	0	SLC8A2	52627407	1.000000	0.71417	0.997000	0.53966	0.639000	0.38242	7.623000	0.83113	2.377000	0.81083	0.558000	0.71614	GTG	.		0.647	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466997.1		
MIEF1	54471	ucsc.edu;bcgsc.ca	37	22	39910017	39910017	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr22:39910017T>C	ENST00000325301.2	+	6	1505	c.1081T>C	c.(1081-1083)Tct>Cct	p.S361P	MIEF1_ENST00000404569.1_Missense_Mutation_p.S361P|MIEF1_ENST00000402881.1_Missense_Mutation_p.S361P	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	361					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										GGGCTGCCGATCTCTGTGCCT	0.642											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S361P		.											.	SMCR7L	90	0			c.T1081C						.						60.0	54.0	56.0					22																	39910017		2203	4300	6503	SO:0001583	missense	54471	exon6			TGCCGATCTCTGT	AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.1081T>C	22.37:g.39910017T>C	ENSP00000327124:p.Ser361Pro	Somatic	39.0	0.0	889	WXS	Illumina HiSeq	.	21.0	4.0	NM_019008	Q7L890|Q9BUI3	Missense_Mutation	SNP	ENST00000325301.2	37	CCDS13995.1	.	.	.	.	.	.	.	.	.	.	T	12.76	2.033077	0.35893	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	T;T;T	0.08193	3.12;3.12;3.12	6.07	3.75	0.43078	.	0.297927	0.42548	D	0.000683	T	0.09818	0.0241	L	0.36672	1.1	0.09310	N	1	B;P	0.42203	0.077;0.773	B;B	0.42827	0.097;0.399	T	0.09997	-1.0649	10	0.39692	T	0.17	-8.3618	14.4071	0.67090	0.0:0.0:0.2414:0.7585	.	361;361	Q9NQG6;B0QY95	MID51_HUMAN;.	P	361	ENSP00000385110:S361P;ENSP00000327124:S361P;ENSP00000385191:S361P	ENSP00000327124:S361P	S	+	1	0	SMCR7L	38239963	0.535000	0.26370	0.520000	0.27837	0.992000	0.81027	2.196000	0.42686	1.079000	0.41038	0.533000	0.62120	TCT	.		0.642	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321325.1	NM_019008	
SMNDC1	10285	ucsc.edu;bcgsc.ca	37	10	112063292	112063292	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:112063292T>C	ENST00000369603.5	-	2	257	c.54A>G	c.(52-54)caA>caG	p.Q18Q	SMNDC1_ENST00000471297.1_5'UTR|SMNDC1_ENST00000369592.1_Silent_p.Q18Q	NM_005871.3	NP_005862.1	O75940	SPF30_HUMAN	survival motor neuron domain containing 1	18					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	4		Breast(234;0.174)		Epithelial(162;6.86e-05)|all cancers(201;0.00149)|BRCA - Breast invasive adenocarcinoma(275;0.119)		CAGCTTCAACTTGCTGGAGCT	0.363																																					p.Q18Q		.											.	SMNDC1	91	0			c.A54G						.						84.0	86.0	85.0					10																	112063292		2203	4300	6503	SO:0001819	synonymous_variant	10285	exon2			TTCAACTTGCTGG	AF083385	CCDS7565.1	10q23	2013-01-23			ENSG00000119953	ENSG00000119953		"""Tudor domain containing"""	16900	protein-coding gene	gene with protein product	"""splicing factor 30, survival of motor neuron-related"", ""tudor domain containing 16C"""	603519				9731529, 9817934	Standard	NM_005871		Approved	SPF30, SMNR, TDRD16C	uc001kzc.4	O75940	OTTHUMG00000019036	ENST00000369603.5:c.54A>G	10.37:g.112063292T>C		Somatic	70.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_005871	B2RA27|D3DRB1|Q5T3K6	Silent	SNP	ENST00000369603.5	37	CCDS7565.1																																																																																			.		0.363	SMNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050325.2	NM_005871	
SORCS2	57537	ucsc.edu;bcgsc.ca	37	4	7716009	7716009	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:7716009A>G	ENST00000507866.2	+	16	2141	c.2032A>G	c.(2032-2034)Aga>Gga	p.R678G	SORCS2_ENST00000329016.9_Missense_Mutation_p.R506G	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	678					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						TTTCCGGAAAAGAAAGTCCAC	0.607																																					p.R678G		.											.	SORCS2	91	0			c.A2032G						.						47.0	51.0	50.0					4																	7716009		2049	4200	6249	SO:0001583	missense	57537	exon16			CGGAAAAGAAAGT	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2032A>G	4.37:g.7716009A>G	ENSP00000422185:p.Arg678Gly	Somatic	48.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_020777	Q9P2L7	Missense_Mutation	SNP	ENST00000507866.2	37	CCDS47008.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.989222	0.53934	.	.	ENSG00000184985	ENST00000507866;ENST00000329016	T;T	0.45276	0.9;0.9	4.01	1.38	0.22167	VPS10 (1);	0.000000	0.85682	D	0.000000	T	0.62502	0.2433	M	0.89601	3.045	0.52501	D	0.999952	D;D	0.71674	0.998;0.998	P;P	0.59115	0.767;0.852	T	0.67019	-0.5776	10	0.87932	D	0	.	10.4275	0.44387	0.6858:0.3142:0.0:0.0	.	506;678	B5MED8;Q96PQ0	.;SORC2_HUMAN	G	678;506	ENSP00000422185:R678G;ENSP00000329124:R506G	ENSP00000329124:R506G	R	+	1	2	SORCS2	7766909	1.000000	0.71417	0.599000	0.28851	0.334000	0.28698	2.978000	0.49305	0.102000	0.17638	0.533000	0.62120	AGA	.		0.607	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	
SORL1	6653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	121383718	121383718	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:121383718T>C	ENST00000260197.7	+	7	1075	c.946T>C	c.(946-948)Ttg>Ctg	p.L316L	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	316					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GCAGCATCTCTTGGGCAGTGA	0.443																																					p.L316L		.											.	SORL1	228	0			c.T946C						.						70.0	69.0	70.0					11																	121383718		2203	4299	6502	SO:0001819	synonymous_variant	6653	exon7			CATCTCTTGGGCA	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.946T>C	11.37:g.121383718T>C		Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	32.0	NM_003105	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	37	CCDS8436.1																																																																																			.		0.443	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	16257658	16257658	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:16257658T>G	ENST00000375759.3	+	11	5127	c.4923T>G	c.(4921-4923)agT>agG	p.S1641R		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1641					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGCCTCCAAGTGTCACAGTCG	0.478																																					p.S1641R		.											.	SPEN	298	0			c.T4923G						.						154.0	165.0	161.0					1																	16257658		2203	4300	6503	SO:0001583	missense	23013	exon11			TCCAAGTGTCACA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.4923T>G	1.37:g.16257658T>G	ENSP00000364912:p.Ser1641Arg	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	20.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	T	10.67	1.415399	0.25552	.	.	ENSG00000065526	ENST00000375759	T	0.09538	2.97	5.28	-4.5	0.03493	.	.	.	.	.	T	0.04679	0.0127	N	0.19112	0.55	0.09310	N	1	P	0.34780	0.468	B	0.32864	0.154	T	0.38693	-0.9649	9	0.30854	T	0.27	0.6893	2.3616	0.04308	0.1527:0.3313:0.0862:0.4298	.	1641	Q96T58	MINT_HUMAN	R	1641	ENSP00000364912:S1641R	ENSP00000364912:S1641R	S	+	3	2	SPEN	16130245	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.769000	0.04710	-0.291000	0.09012	0.383000	0.25322	AGT	.		0.478	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
SPTB	6710	ucsc.edu;bcgsc.ca	37	14	65239594	65239594	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:65239594A>G	ENST00000389721.5	-	25	5289	c.5257T>C	c.(5257-5259)Ttc>Ctc	p.F1753L	SPTB_ENST00000556626.1_Missense_Mutation_p.F1753L|SPTB_ENST00000542895.1_Missense_Mutation_p.F1753L|SPTB_ENST00000389720.3_Missense_Mutation_p.F1753L|SPTB_ENST00000389722.3_Missense_Mutation_p.F1753L	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1753					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CGCTCGATGAAGGCATTCACA	0.632																																					p.F1753L		.											.	SPTB	100	0			c.T5257C						.						48.0	42.0	44.0					14																	65239594		2203	4300	6503	SO:0001583	missense	6710	exon25			CGATGAAGGCATT		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5257T>C	14.37:g.65239594A>G	ENSP00000374371:p.Phe1753Leu	Somatic	67.0	0.0		WXS	Illumina HiSeq	.	41.0	4.0	NM_001024858	Q15510|Q15519	Missense_Mutation	SNP	ENST00000389721.5	37	CCDS32100.1	.	.	.	.	.	.	.	.	.	.	A	7.397	0.631997	0.14322	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96	5.21	-3.38	0.04883	.	0.622831	0.17060	N	0.188605	T	0.07638	0.0192	N	0.00403	-1.54	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.34875	-0.9811	10	0.06757	T	0.87	.	3.9659	0.09431	0.3768:0.2138:0.0:0.4094	.	537;1753;1757	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	L	1757;1753;537;418;1753;1753;1753;1753	ENSP00000374372:F1753L;ENSP00000451324:F418L;ENSP00000451752:F1753L;ENSP00000374371:F1753L;ENSP00000443882:F1753L;ENSP00000374370:F1753L	ENSP00000334218:F537L	F	-	1	0	SPTB	64309347	0.000000	0.05858	0.097000	0.21041	0.796000	0.44982	-1.856000	0.01662	-0.508000	0.06540	-1.281000	0.01382	TTC	.		0.632	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
SUCLG1	8802	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	84660559	84660559	+	Splice_Site	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:84660559C>T	ENST00000393868.2	-	6	800	c.590G>A	c.(589-591)gGc>gAc	p.G197D	SUCLG1_ENST00000491123.1_5'Flank	NM_003849.3	NP_003840.2	P53597	SUCA_HUMAN	succinate-CoA ligase, alpha subunit	197					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|succinate-CoA ligase complex (GDP-forming) (GO:0045244)	ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)|succinate-CoA ligase (GDP-forming) activity (GO:0004776)			kidney(4)|large_intestine(4)|lung(2)	10					Succinic acid(DB00139)	GGACACAATGCCTTAACGAAA	0.393																																					p.G197D	Ovarian(48;203 1101 37206 40305 50790)	.											.	SUCLG1	90	0			c.G590A						.						70.0	64.0	66.0					2																	84660559		2203	4300	6503	SO:0001630	splice_region_variant	8802	exon6			ACAATGCCTTAAC	Z68204	CCDS1967.2	2p11.3	2008-02-05	2008-01-08		ENSG00000163541	ENSG00000163541	6.2.1.4		11449	protein-coding gene	gene with protein product		611224	"""succinate-CoA ligase, GDP-forming, alpha subunit"""			9128182	Standard	NM_003849		Approved		uc002son.3	P53597	OTTHUMG00000130023	ENST00000393868.2:c.590-1G>A	2.37:g.84660559C>T		Somatic	172.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	34.0	NM_003849	Q9BWB0|Q9UNP6	Missense_Mutation	SNP	ENST00000393868.2	37	CCDS1967.2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985575	0.93044	.	.	ENSG00000163541	ENST00000393868	D	0.86030	-2.06	5.83	5.83	0.93111	Succinyl-CoA synthetase-like (2);	0.046728	0.85682	D	0.000000	D	0.96084	0.8724	H	0.99877	4.88	0.80722	D	1	D;D	0.67145	0.991;0.996	P;P	0.62014	0.658;0.897	D	0.97912	1.0309	10	0.87932	D	0	.	17.6146	0.88064	0.0:1.0:0.0:0.0	.	197;197	B7Z438;P53597	.;SUCA_HUMAN	D	197	ENSP00000377446:G197D	ENSP00000377446:G197D	G	-	2	0	SUCLG1	84514070	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	7.818000	0.86416	2.758000	0.94735	0.655000	0.94253	GGC	.		0.393	SUCLG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252298.2	NM_003849	Missense_Mutation
ST3GAL5	8869	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	86075030	86075030	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:86075030C>T	ENST00000377332.3	-	4	724	c.616G>A	c.(616-618)Gga>Aga	p.G206R	ST3GAL5_ENST00000393808.3_Missense_Mutation_p.G183R|ST3GAL5_ENST00000393805.1_Missense_Mutation_p.G178R	NM_003896.3	NP_003887.3	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 5	206					carbohydrate metabolic process (GO:0005975)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	lactosylceramide alpha-2,3-sialyltransferase activity (GO:0047291)|neolactotetraosylceramide alpha-2,3-sialyltransferase activity (GO:0004513)|sialyltransferase activity (GO:0008373)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15						AGTTCTAATCCGTGCAGTATT	0.433																																					p.G206R		.											.	ST3GAL5	90	0			c.G616A						.						127.0	120.0	123.0					2																	86075030		2203	4300	6503	SO:0001583	missense	8869	exon4			CTAATCCGTGCAG	AB018356	CCDS1986.2, CCDS42705.1	2p11.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000115525	ENSG00000115525	2.4.99.9	"""Sialyltransferases"""	10872	protein-coding gene	gene with protein product		604402	"""sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase)"""	SIAT9		9822625	Standard	NM_003896		Approved	ST3GalV, SIATGM3S	uc002sqq.1	Q9UNP4	OTTHUMG00000130171	ENST00000377332.3:c.616G>A	2.37:g.86075030C>T	ENSP00000366549:p.Gly206Arg	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	36.0	5.0	NM_003896	B3KM82|D6W5L9|O94902|Q53QU1|Q6NZX4|Q6YFL1	Missense_Mutation	SNP	ENST00000377332.3	37	CCDS1986.2	.	.	.	.	.	.	.	.	.	.	C	16.37	3.102886	0.56183	.	.	ENSG00000115525	ENST00000393808;ENST00000393805;ENST00000377332	T;T;T	0.33438	1.41;1.41;1.41	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.58323	0.2114	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.61744	-0.7000	10	0.54805	T	0.06	-20.7513	17.5419	0.87850	0.0:1.0:0.0:0.0	.	178;206;183	Q9UNP4-2;Q9UNP4;Q9UNP4-3	.;SIAT9_HUMAN;.	R	183;178;206	ENSP00000377397:G183R;ENSP00000377394:G178R;ENSP00000366549:G206R	ENSP00000366549:G206R	G	-	1	0	ST3GAL5	85928541	1.000000	0.71417	0.413000	0.26509	0.236000	0.25371	7.067000	0.76741	2.388000	0.81334	0.555000	0.69702	GGA	.		0.433	ST3GAL5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252486.1	NM_003896	
SYNE3	161176	ucsc.edu;bcgsc.ca	37	14	95906121	95906121	+	Splice_Site	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr14:95906121T>C	ENST00000334258.5	-	12	2088	c.2074A>G	c.(2074-2076)Agg>Ggg	p.R692G	SYNE3_ENST00000557275.1_Splice_Site_p.R692G|SYNE3_ENST00000554873.1_Splice_Site_p.R449G	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	692					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GCCACCAGCCTCTAAAGGACA	0.602																																					p.R692G		.											.	.	.	0			c.A2074G						.						40.0	43.0	42.0					14																	95906121		2203	4300	6503	SO:0001630	splice_region_variant	161176	exon12			CCAGCCTCTAAAG	AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.2074-1A>G	14.37:g.95906121T>C		Somatic	44.0	0.0		WXS	Illumina HiSeq	.	21.0	4.0	NM_152592	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	ENST00000334258.5	37	CCDS9935.1	.	.	.	.	.	.	.	.	.	.	T	15.75	2.925692	0.52759	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275	T;T;T	0.51071	0.72;0.72;0.72	5.34	1.5	0.22942	.	0.146500	0.31624	N	0.007330	T	0.51210	0.1661	L	0.60455	1.87	0.80722	D	1	D;D	0.56968	0.973;0.978	P;P	0.57425	0.725;0.82	T	0.44907	-0.9297	10	0.42905	T	0.14	-8.4042	5.146	0.14985	0.0:0.1673:0.1532:0.6795	.	692;692	Q6ZMZ3-2;Q6ZMZ3	.;SYNE3_HUMAN	G	692;449;692	ENSP00000334308:R692G;ENSP00000452154:R449G;ENSP00000450562:R692G	ENSP00000334308:R692G	R	-	1	2	C14orf49	94975874	0.695000	0.27747	0.937000	0.37676	0.892000	0.51952	0.825000	0.27393	0.356000	0.24157	0.459000	0.35465	AGG	.		0.602	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420529.2	NM_152592	Missense_Mutation
TACR3	6870	ucsc.edu;bcgsc.ca	37	4	104640338	104640338	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:104640338A>G	ENST00000304883.2	-	1	635	c.495T>C	c.(493-495)ccT>ccC	p.P165P		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	165					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		CAGCTGTGATAGGAAAGAAGT	0.527																																					p.P165P		.											.	TACR3	525	0			c.T495C						.						67.0	64.0	65.0					4																	104640338		2203	4300	6503	SO:0001819	synonymous_variant	6870	exon1			TGTGATAGGAAAG	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.495T>C	4.37:g.104640338A>G		Somatic	75.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_001059	Q0P510	Silent	SNP	ENST00000304883.2	37	CCDS3664.1																																																																																			.		0.527	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
TAL1	6886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47685719	47685719	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:47685719G>A	ENST00000294339.3	-	4	1245	c.669C>T	c.(667-669)ctC>ctT	p.L223L	TAL1_ENST00000459729.1_5'UTR|TAL1_ENST00000371883.3_Silent_p.L225L|TAL1_ENST00000371884.2_Silent_p.L223L	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	223	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						CATTCTTGCTGAGCTTCTTGT	0.592			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																p.L223L		.		Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	.	TAL1	1082	0			c.C669T						.						64.0	62.0	63.0					1																	47685719		2203	4300	6503	SO:0001819	synonymous_variant	6886	exon4			CTTGCTGAGCTTC	M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.669C>T	1.37:g.47685719G>A		Somatic	224.0	0.0		WXS	Illumina HiSeq	Phase_I	178.0	71.0	NM_003189	D3DQ24	Silent	SNP	ENST00000294339.3	37	CCDS547.1																																																																																			.		0.592	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021640.1	NM_003189	
TANC1	85461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	160053178	160053178	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:160053178C>T	ENST00000263635.6	+	18	3276	c.3039C>T	c.(3037-3039)caC>caT	p.H1013H	TANC1_ENST00000454300.1_Silent_p.H907H	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	1013					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TACGGGGCCACGGTGACATTC	0.627																																					p.H1013H		.											.	TANC1	92	0			c.C3039T						.						59.0	64.0	62.0					2																	160053178		2103	4204	6307	SO:0001819	synonymous_variant	85461	exon18			GGGCCACGGTGAC	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.3039C>T	2.37:g.160053178C>T		Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	34.0	NM_033394	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1																																																																																			.		0.627	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
TASP1	55617	ucsc.edu;bcgsc.ca	37	20	13610722	13610722	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr20:13610722T>C	ENST00000337743.4	-	2	124	c.4A>G	c.(4-6)Acc>Gcc	p.T2A	TASP1_ENST00000544472.1_Missense_Mutation_p.T2A|TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000539805.1_Missense_Mutation_p.T2A	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	2					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						TTCTCCATGGTCATTCTCCAA	0.448																																					p.T2A		.											.	TASP1	90	0			c.A4G						.						98.0	90.0	93.0					20																	13610722		2203	4300	6503	SO:0001583	missense	55617	exon2			CCATGGTCATTCT	AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.4A>G	20.37:g.13610722T>C	ENSP00000338624:p.Thr2Ala	Somatic	68.0	0.0		WXS	Illumina HiSeq	.	32.0	6.0	NM_017714	B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	ENST00000337743.4	37	CCDS13116.1	.	.	.	.	.	.	.	.	.	.	T	15.77	2.932530	0.52866	.	.	ENSG00000089123	ENST00000539805;ENST00000378157;ENST00000337743;ENST00000455532;ENST00000544472	D;D	0.92199	-2.99;-2.84	5.38	5.38	0.77491	.	0.329187	0.26598	N	0.023498	D	0.83653	0.5301	N	0.08118	0	0.25510	N	0.987469	B;B;B	0.28801	0.223;0.002;0.002	B;B;B	0.26310	0.068;0.004;0.004	T	0.75071	-0.3447	10	0.38643	T	0.18	-3.7818	15.678	0.77344	0.0:0.0:0.0:1.0	.	2;2;2	B7Z963;Q9H6P5;Q5JWM4	.;TASP1_HUMAN;.	A	2	ENSP00000338624:T2A;ENSP00000400580:T2A	ENSP00000338624:T2A	T	-	1	0	TASP1	13558722	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.101000	0.57769	2.152000	0.67230	0.528000	0.53228	ACC	.		0.448	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078041.2	NM_017714	
TBC1D9	23158	ucsc.edu;bcgsc.ca	37	4	141622704	141622704	+	Silent	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:141622704G>T	ENST00000442267.2	-	2	269	c.195C>A	c.(193-195)atC>atA	p.I65I	Y_RNA_ENST00000384426.1_RNA	NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	65							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				TCTGGTACAAGATTCGGTAAG	0.512																																					p.I65I		.											.	TBC1D9	23	0			c.C195A						.						64.0	63.0	63.0					4																	141622704		1895	4112	6007	SO:0001819	synonymous_variant	23158	exon2			GTACAAGATTCGG	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.195C>A	4.37:g.141622704G>T		Somatic	89.0	0.0		WXS	Illumina HiSeq	.	26.0	4.0	NM_015130	A6H8U8|D3DNZ1|O94958	Silent	SNP	ENST00000442267.2	37	CCDS47136.1																																																																																			.		0.512	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	
TENC1	23371	ucsc.edu;bcgsc.ca	37	12	53453408	53453408	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:53453408A>G	ENST00000314250.6	+	18	2273	c.1983A>G	c.(1981-1983)ccA>ccG	p.P661P	TENC1_ENST00000451358.1_Silent_p.P661P|TENC1_ENST00000314276.3_Silent_p.P671P|TENC1_ENST00000549700.1_Silent_p.P661P|TENC1_ENST00000546602.1_Silent_p.P661P|TENC1_ENST00000552570.1_Silent_p.P661P|TENC1_ENST00000379902.3_Silent_p.P537P	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	661					cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						TGGGGAAACCAGCCACTGGGG	0.667																																					p.P671P		.											.	TENC1	92	0			c.A2013G						.						46.0	48.0	48.0					12																	53453408		2203	4300	6503	SO:0001819	synonymous_variant	23371	exon18			GAAACCAGCCACT	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.1983A>G	12.37:g.53453408A>G		Somatic	58.0	0.0		WXS	Illumina HiSeq	.	36.0	4.0	NM_015319	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Silent	SNP	ENST00000314250.6	37	CCDS8843.1																																																																																			.		0.667	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
TENC1	23371	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	12	53457144	53457144	+	Missense_Mutation	SNP	G	G	A	rs201129709		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:53457144G>A	ENST00000314250.6	+	27	4294	c.4004G>A	c.(4003-4005)cGc>cAc	p.R1335H	TENC1_ENST00000451358.1_Missense_Mutation_p.R1325H|TENC1_ENST00000314276.3_Missense_Mutation_p.R1345H|TENC1_ENST00000549700.1_Missense_Mutation_p.R1270H|TENC1_ENST00000546602.1_Missense_Mutation_p.R1238H|TENC1_ENST00000552570.1_Missense_Mutation_p.R1333H|TENC1_ENST00000379902.3_Missense_Mutation_p.R1211H	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	1335					cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						CTCTTCTTTCGCCGCCATTAT	0.557													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13918	0.0		0.0	False		,,,				2504	0.0				p.R1345H		.											.	TENC1	92	0			c.G4034A						.						133.0	133.0	133.0					12																	53457144		2203	4300	6503	SO:0001583	missense	23371	exon27			TCTTTCGCCGCCA	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.4004G>A	12.37:g.53457144G>A	ENSP00000319684:p.Arg1335His	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	56.0	NM_015319	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	ENST00000314250.6	37	CCDS8843.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	25.2	4.608951	0.87258	.	.	ENSG00000111077	ENST00000379902;ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62	4.59	3.62	0.41486	Phosphotyrosine interaction domain (1);Pleckstrin homology-type (1);Tensin phosphotyrosine-binding domain (1);	0.000000	0.64402	D	0.000001	T	0.70150	0.3191	M	0.87827	2.91	0.45452	D	0.99842	P;P;D;P;D	0.89917	0.656;0.65;1.0;0.833;0.963	P;P;D;P;P	0.83275	0.723;0.542;0.996;0.77;0.83	T	0.75977	-0.3127	10	0.87932	D	0	.	12.0971	0.53761	0.0:0.1749:0.8251:0.0	.	1333;1335;1238;1335;1345	Q63HR2-6;A7E2A6;Q63HR2-2;Q63HR2;Q63HR2-4	.;.;.;TENC1_HUMAN;.	H	1211;1345;1335;1325;707;1238;1333;1270	ENSP00000369232:R1211H;ENSP00000319756:R1345H;ENSP00000319684:R1335H;ENSP00000393362:R1325H;ENSP00000449363:R1238H;ENSP00000447021:R1333H;ENSP00000449361:R1270H	ENSP00000319684:R1335H	R	+	2	0	TENC1	51743411	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.353000	0.59411	2.282000	0.76494	0.511000	0.50034	CGC	G|0.999;A|0.000		0.557	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
TCHP	84260	ucsc.edu;bcgsc.ca	37	12	110341849	110341849	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr12:110341849C>T	ENST00000312777.5	+	3	510	c.296C>T	c.(295-297)gCc>gTc	p.A99V	TCHP_ENST00000405876.4_Missense_Mutation_p.A99V	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						GACCTGCTGGCCAGAGAACTG	0.567																																					p.A99V		.											.	TCHP	91	0			c.C296T						.						52.0	47.0	49.0					12																	110341849		2201	4299	6500	SO:0001583	missense	84260	exon3			TGCTGGCCAGAGA	AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.296C>T	12.37:g.110341849C>T	ENSP00000324404:p.Ala99Val	Somatic	59.0	0.0		WXS	Illumina HiSeq	.	28.0	4.0	NM_001143852		Missense_Mutation	SNP	ENST00000312777.5	37	CCDS9137.1	.	.	.	.	.	.	.	.	.	.	C	4.697	0.129565	0.08981	.	.	ENSG00000139437	ENST00000405876;ENST00000536868;ENST00000312777;ENST00000536408	T;T;T	0.46819	1.48;1.48;0.86	4.95	3.13	0.36017	.	0.187401	0.45361	N	0.000364	T	0.37945	0.1022	L	0.60455	1.87	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.17077	-1.0381	10	0.31617	T	0.26	-0.1475	4.9446	0.13984	0.167:0.6537:0.0:0.1793	.	99	Q9BT92	TCHP_HUMAN	V	99	ENSP00000384520:A99V;ENSP00000324404:A99V;ENSP00000441835:A99V	ENSP00000324404:A99V	A	+	2	0	TCHP	108826232	0.891000	0.30450	0.914000	0.36105	0.965000	0.64279	1.328000	0.33758	0.614000	0.30107	-0.143000	0.13931	GCC	.		0.567	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403289.1	NM_032300	
TENM2	57451	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	167674101	167674101	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:167674101A>G	ENST00000518659.1	+	27	6196	c.6157A>G	c.(6157-6159)Aac>Gac	p.N2053D	TENM2_ENST00000545108.1_Missense_Mutation_p.N2052D|TENM2_ENST00000520394.1_Missense_Mutation_p.N1814D|TENM2_ENST00000403607.2_Missense_Mutation_p.N1877D|TENM2_ENST00000519204.1_Missense_Mutation_p.N1932D	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2053					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GAAGATGGTCAACCTCCAAAG	0.527																																					p.N2044D		.											.	.	.	0			c.A6130G						.						80.0	79.0	80.0					5																	167674101		1943	4144	6087	SO:0001583	missense	57451	exon27			ATGGTCAACCTCC	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6157A>G	5.37:g.167674101A>G	ENSP00000429430:p.Asn2053Asp	Somatic	60.0	1.0		WXS	Illumina HiSeq	Phase_I	36.0	15.0	NM_001122679	Q9ULU2	Missense_Mutation	SNP	ENST00000518659.1	37		.	.	.	.	.	.	.	.	.	.	A	18.44	3.623890	0.66901	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.89681	-2.08;-2.07;-2.18;-2.51;-2.55	5.44	5.44	0.79542	.	0.039655	0.85682	D	0.000000	D	0.94198	0.8138	M	0.80028	2.48	0.45541	D	0.998494	D;D;D	0.89917	1.0;1.0;0.99	D;D;D	0.91635	0.999;0.998;0.979	D	0.93643	0.6966	10	0.36615	T	0.2	.	15.4825	0.75539	1.0:0.0:0.0:0.0	.	2052;2053;1814	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	D	2053;2052;1932;1814;1877	ENSP00000429430:N2053D;ENSP00000438635:N2052D;ENSP00000428964:N1932D;ENSP00000427874:N1814D;ENSP00000384905:N1877D	ENSP00000384905:N1877D	N	+	1	0	ODZ2	167606679	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.339000	0.96797	2.070000	0.61991	0.459000	0.35465	AAC	.		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
TENM3	55714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	183675952	183675952	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:183675952G>C	ENST00000511685.1	+	22	4555	c.4432G>C	c.(4432-4434)Gct>Cct	p.A1478P	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.A1478P			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1478					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATCCTCCCTGGCTGCTTCTCC	0.473																																					p.A1478P		.											.	.	.	0			c.G4432C						.						82.0	83.0	83.0					4																	183675952		1987	4161	6148	SO:0001583	missense	55714	exon21			TCCCTGGCTGCTT	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.4432G>C	4.37:g.183675952G>C	ENSP00000424226:p.Ala1478Pro	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	21.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435939	0.83885	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.92647	-3.08;-3.08	5.16	5.16	0.70880	Six-bladed beta-propeller, TolB-like (1);	.	.	.	.	D	0.94735	0.8301	H	0.95151	3.63	0.80722	D	1	P	0.51791	0.948	B	0.41135	0.348	D	0.96381	0.9281	9	0.87932	D	0	.	18.8456	0.92205	0.0:0.0:1.0:0.0	.	1478	Q9P273	TEN3_HUMAN	P	1478	ENSP00000424226:A1478P;ENSP00000385276:A1478P	ENSP00000385276:A1478P	A	+	1	0	ODZ3	183912946	1.000000	0.71417	0.385000	0.26158	0.926000	0.56050	9.657000	0.98554	2.698000	0.92095	0.563000	0.77884	GCT	.		0.473	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TENM3	55714	ucsc.edu;bcgsc.ca	37	4	183713755	183713755	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:183713755T>C	ENST00000511685.1	+	26	6053	c.5930T>C	c.(5929-5931)cTa>cCa	p.L1977P	TENM3_ENST00000406950.2_Missense_Mutation_p.L1977P			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1977					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GCAGGAGTCCTAAAGACAGTA	0.408																																					p.L1977P		.											.	.	.	0			c.T5930C						.						199.0	188.0	192.0					4																	183713755		1899	4126	6025	SO:0001583	missense	55714	exon25			GAGTCCTAAAGAC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5930T>C	4.37:g.183713755T>C	ENSP00000424226:p.Leu1977Pro	Somatic	49.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	T	14.21	2.467633	0.43839	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.87571	-2.27;-2.27	4.74	4.74	0.60224	.	.	.	.	.	D	0.89726	0.6798	M	0.65320	2	0.80722	D	1	D	0.64830	0.994	P	0.55713	0.782	D	0.88903	0.3354	9	0.35671	T	0.21	.	14.6876	0.69059	0.0:0.0:0.0:1.0	.	1977	Q9P273	TEN3_HUMAN	P	1977	ENSP00000424226:L1977P;ENSP00000385276:L1977P	ENSP00000385276:L1977P	L	+	2	0	ODZ3	183950749	1.000000	0.71417	0.287000	0.24848	0.606000	0.37113	7.798000	0.85924	2.108000	0.64289	0.482000	0.46254	CTA	.		0.408	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TM2D2	83877	ucsc.edu;bcgsc.ca	37	8	38851161	38851161	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:38851161T>C	ENST00000456397.2	-	3	427	c.334A>G	c.(334-336)Agc>Ggc	p.S112G	TM2D2_ENST00000412303.1_Missense_Mutation_p.S69G|TM2D2_ENST00000522434.1_5'UTR|TM2D2_ENST00000456845.2_Missense_Mutation_p.S69G|TM2D2_ENST00000397070.2_Missense_Mutation_p.S69G	NM_078473.2	NP_510882.1	Q9BX73	TM2D2_HUMAN	TM2 domain containing 2	112						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		all_lung(54;0.00338)|Lung NSC(58;0.0133)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			TCCACGTCGCTGTAGGCCTGA	0.433																																					p.S112G		.											.	TM2D2	90	0			c.A334G						.						71.0	62.0	65.0					8																	38851161		2203	4300	6503	SO:0001583	missense	83877	exon3			CGTCGCTGTAGGC	AF353991	CCDS6111.1, CCDS43733.1	8p11.23	2005-08-09				ENSG00000169490			24127	protein-coding gene	gene with protein product		610081				11278849	Standard	XM_005273657		Approved	BLP1	uc003xmk.3	Q9BX73		ENST00000456397.2:c.334A>G	8.37:g.38851161T>C	ENSP00000416050:p.Ser112Gly	Somatic	56.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_078473	B2RBK4|D3DSX8|Q8N0X9	Missense_Mutation	SNP	ENST00000456397.2	37	CCDS6111.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.326182	0.41197	.	.	ENSG00000169490	ENST00000456845;ENST00000456397;ENST00000412303;ENST00000397070;ENST00000522142	.	.	.	5.69	3.3	0.37823	.	0.857398	0.11327	N	0.575390	T	0.16811	0.0404	N	0.03608	-0.345	0.26449	N	0.975632	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25117	-1.0141	9	0.27785	T	0.31	-1.3774	8.6155	0.33829	0.0:0.2842:0.0:0.7158	.	69;112	Q9BX73-2;Q9BX73	.;TM2D2_HUMAN	G	69;112;69;69;69	.	ENSP00000380260:S69G	S	-	1	0	TM2D2	38970318	0.961000	0.32948	0.995000	0.50966	0.965000	0.64279	1.032000	0.30178	0.508000	0.28173	0.533000	0.62120	AGC	.		0.433	TM2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377280.1	NM_031940	
TMEM225	338661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123753908	123753908	+	Silent	SNP	A	A	T	rs369698336		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:123753908A>T	ENST00000375026.2	-	4	831	c.615T>A	c.(613-615)cgT>cgA	p.R205R		NM_001013743.1	NP_001013765.1	Q6GV28	TM225_HUMAN	transmembrane protein 225	205					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(2)|lung(12)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	28						CAGTGTGTGCACGGACAATGC	0.398																																					p.R205R		.											TMEM225,mouth,carcinoma,-1	TMEM225	93	0			c.T615A						.						180.0	164.0	170.0					11																	123753908		2202	4299	6501	SO:0001819	synonymous_variant	338661	exon4			GTGTGCACGGACA	AY634366	CCDS31697.1	11q24.1	2014-06-13			ENSG00000204300	ENSG00000204300			32390	protein-coding gene	gene with protein product	"""PMP22 claudin domain containing"", ""protein phosphatase 1, regulatory subunit 154"""						Standard	XM_006718832		Approved	PMP22CD, PPP1R154	uc001pzi.3	Q6GV28	OTTHUMG00000165959	ENST00000375026.2:c.615T>A	11.37:g.123753908A>T		Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	94.0	NM_001013743		Silent	SNP	ENST00000375026.2	37	CCDS31697.1																																																																																			.		0.398	TMEM225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387260.1	NM_001013743	
TMEM254	80195	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	81850592	81850592	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:81850592G>C	ENST00000372281.3	+	4	321	c.291G>C	c.(289-291)tgG>tgC	p.W97C	TMEM254_ENST00000372274.1_3'UTR|TMEM254_ENST00000467529.1_3'UTR|TMEM254_ENST00000372275.1_3'UTR	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254	97						integral component of membrane (GO:0016021)											AGCTACTCTGGTTCCTACAGA	0.403																																					p.W121C		.											.	.	.	0			c.G363C						.						161.0	146.0	151.0					10																	81850592		2203	4300	6503	SO:0001583	missense	80195	exon4			ACTCTGGTTCCTA	BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.291G>C	10.37:g.81850592G>C	ENSP00000361355:p.Trp97Cys	Somatic	186.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	31.0	NM_001270367	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	Missense_Mutation	SNP	ENST00000372281.3	37	CCDS7363.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.74|16.74|16.74	3.207456|3.207456|3.207456	0.58343|0.58343|0.58343	.|.|.	.|.|.	ENSG00000133678|ENSG00000133678|ENSG00000133678	ENST00000372273|ENST00000450179|ENST00000372281	.|.|.	.|.|.	.|.|.	4.07|4.07|4.07	4.07|4.07|4.07	0.47477|0.47477|0.47477	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.80221|0.80221|0.80221	0.4583|0.4583|0.4583	M|M|M	0.86420|0.86420|0.86420	2.815|2.815|2.815	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D	.|.|0.89917	.|.|1.0;1.0	.|.|D;D	.|.|0.91635	.|.|0.999;0.999	D|D|D	0.83751|0.83751|0.83751	0.0209|0.0209|0.0209	5|5|9	.|.|0.87932	.|.|D	.|.|0	-15.4804|-15.4804|-15.4804	12.4851|12.4851|12.4851	0.55868|0.55868|0.55868	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|121;97	.|.|E7ERB9;Q8TBM7	.|.|.;CJ057_HUMAN	A|L|C	118|75|97	.|.|.	.|.|ENSP00000361355:W97C	G|V|W	+|+|+	2|1|3	0|0|0	C10orf57|C10orf57|C10orf57	81840572|81840572|81840572	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.953000|0.953000|0.953000	0.61014|0.61014|0.61014	3.985000|3.985000|3.985000	0.56930|0.56930|0.56930	2.224000|2.224000|2.224000	0.72417|0.72417|0.72417	0.557000|0.557000|0.557000	0.71058|0.71058|0.71058	GGT|GTT|TGG	.		0.403	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049030.1	NM_025125	
TNKS	8658	ucsc.edu;bcgsc.ca	37	8	9622231	9622231	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:9622231A>G	ENST00000310430.6	+	23	3404	c.3378A>G	c.(3376-3378)caA>caG	p.Q1126Q	TNKS_ENST00000518281.1_Silent_p.Q889Q	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1126	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		TGTAGATGCAAAGTACTATTC	0.323																																					p.Q1126Q		.											.	TNKS	660	0			c.A3378G						.						105.0	103.0	104.0					8																	9622231		2203	4300	6503	SO:0001819	synonymous_variant	8658	exon23			GATGCAAAGTACT	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3378A>G	8.37:g.9622231A>G		Somatic	86.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_003747	O95272|Q4G0F2	Silent	SNP	ENST00000310430.6	37	CCDS5974.1																																																																																			.		0.323	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
TNPO2	30000	ucsc.edu;bcgsc.ca	37	19	12817572	12817572	+	Silent	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:12817572C>A	ENST00000592287.1	-	13	1416	c.1308G>T	c.(1306-1308)ctG>ctT	p.L436L	TNPO2_ENST00000425528.1_Silent_p.L436L|TNPO2_ENST00000450764.2_Silent_p.L436L|TNPO2_ENST00000356861.5_Silent_p.L436L|SNORD41_ENST00000386967.1_RNA|TNPO2_ENST00000588216.1_Silent_p.L436L|TNPO2_ENST00000441499.1_Silent_p.L436L	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	436					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GGTGCGGGATCAGCTCAGGCA	0.622																																					p.L436L		.											.	TNPO2	227	0			c.G1308T						.						26.0	26.0	26.0					19																	12817572		2161	4270	6431	SO:0001819	synonymous_variant	30000	exon13			CGGGATCAGCTCA	AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1308G>T	19.37:g.12817572C>A		Somatic	70.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_013433	O14655|Q6IN77	Silent	SNP	ENST00000592287.1	37	CCDS45991.1																																																																																			.		0.622	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
TRAPPC9	83696	ucsc.edu;bcgsc.ca	37	8	141034128	141034128	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr8:141034128T>C	ENST00000438773.2	-	18	2738	c.2605A>G	c.(2605-2607)Act>Gct	p.T869A	TRAPPC9_ENST00000389327.3_Missense_Mutation_p.T860A|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.T967A	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	869					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						TATCCTTCAGTGTGGCCCGGG	0.453																																					p.T967A		.											.	TRAPPC9	228	0			c.A2899G						.						76.0	78.0	78.0					8																	141034128		2203	4300	6503	SO:0001583	missense	83696	exon18			CTTCAGTGTGGCC	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2605A>G	8.37:g.141034128T>C	ENSP00000405060:p.Thr869Ala	Somatic	78.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_031466	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	ENST00000438773.2	37	CCDS55278.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.039|9.039	0.989093|0.989093	0.18966|0.18966	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000520857|ENST00000389328;ENST00000389327;ENST00000438773	.|.	.|.	.|.	5.35|5.35	0.209|0.209	0.15226|0.15226	.|.	.|0.551930	.|0.17885	.|N	.|0.158720	T|T	0.23649|0.23649	0.0572|0.0572	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.09022	.|0.0;0.001;0.002;0.0	.|B;B;B;B	.|0.14023	.|0.0;0.01;0.007;0.001	T|T	0.28235|0.28235	-1.0050|-1.0050	6|9	0.12103|0.08837	T|T	0.63|0.75	.|.	9.2109|9.2109	0.37318|0.37318	0.0:0.6006:0.0:0.3994|0.0:0.6006:0.0:0.3994	.|.	.|967;869;860;967	.|A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2	.|.;TPPC9_HUMAN;.;.	R|A	712|967;860;869	.|.	ENSP00000430116:H712R|ENSP00000373978:T860A	H|T	-|-	2|1	0|0	TRAPPC9|TRAPPC9	141103310|141103310	0.001000|0.001000	0.12720|0.12720	0.039000|0.039000	0.18376|0.18376	0.986000|0.986000	0.74619|0.74619	1.038000|1.038000	0.30254|0.30254	-0.040000|-0.040000	0.13580|0.13580	0.383000|0.383000	0.25322|0.25322	CAC|ACT	.		0.453	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377749.1	NM_031466	
TRDN	10345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	123825006	123825006	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr6:123825006C>A	ENST00000398178.3	-	8	672	c.651G>T	c.(649-651)aaG>aaT	p.K217N	TRDN_ENST00000334268.4_Missense_Mutation_p.K217N|TRDN_ENST00000546248.1_Missense_Mutation_p.K217N	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	217					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CCTTTTTAGTCTTTTCTTCAC	0.323																																					p.K217N		.											.	TRDN	91	0			c.G651T						.						174.0	149.0	157.0					6																	123825006		1828	4081	5909	SO:0001583	missense	10345	exon8			TTTAGTCTTTTCT	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.651G>T	6.37:g.123825006C>A	ENSP00000381240:p.Lys217Asn	Somatic	510.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	209.0	NM_001256020	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	37	CCDS55053.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.81|13.81	2.348001|2.348001	0.41599|0.41599	.|.	.|.	ENSG00000186439|ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000333613|ENST00000361029	T;T;D|.	0.97575|.	-0.09;-0.09;-4.44|.	5.3|5.3	4.43|4.43	0.53597|0.53597	Aspartyl beta-hydroxylase/Triadin domain (1);|.	0.222762|.	0.39834|.	N|.	0.001257|.	T|T	0.54143|0.54143	0.1840|0.1840	M|M	0.75447|0.75447	2.3|2.3	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D;D|.	0.89917|.	0.99;0.999;0.999;1.0|.	P;D;D;D|.	0.72982|.	0.814;0.969;0.969;0.979|.	T|T	0.58278|0.58278	-0.7664|-0.7664	10|5	0.72032|.	D|.	0.01|.	-8.974|-8.974	8.1933|8.1933	0.31381|0.31381	0.0:0.8163:0.0:0.1837|0.0:0.8163:0.0:0.1837	.|.	217;217;217;217|.	F5H2W7;Q5SWK9;Q8IVK2;Q13061|.	.;.;.;TRDN_HUMAN|.	N|I	217;217;217;217;217;217;122|56	ENSP00000381240:K217N;ENSP00000333984:K217N;ENSP00000439281:K217N|.	ENSP00000329278:K122N|.	K|R	-|-	3|2	2|0	TRDN|TRDN	123866705|123866705	0.917000|0.917000	0.31117|0.31117	0.950000|0.950000	0.38849|0.38849	0.930000|0.930000	0.56654|0.56654	1.573000|1.573000	0.36472|0.36472	1.215000|1.215000	0.43411|0.43411	0.467000|0.467000	0.42956|0.42956	AAG|AGA	.		0.323	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TRIO	7204	ucsc.edu;bcgsc.ca	37	5	14502722	14502722	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr5:14502722A>G	ENST00000344204.4	+	54	8391	c.8367A>G	c.(8365-8367)aaA>aaG	p.K2789K	TRIO_ENST00000537187.1_Silent_p.K2613K|TRIO_ENST00000344135.5_Silent_p.K288K	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2789					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TGACCTGGAAAGACAACTTTG	0.527																																					p.K2789K		.											.	TRIO	562	0			c.A8367G						.						147.0	116.0	127.0					5																	14502722		2203	4300	6503	SO:0001819	synonymous_variant	7204	exon54			CTGGAAAGACAAC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.8367A>G	5.37:g.14502722A>G		Somatic	58.0	0.0		WXS	Illumina HiSeq	.	38.0	4.0	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	CCDS3883.1																																																																																			.		0.527	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
TTC3	7267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	38572587	38572587	+	Missense_Mutation	SNP	G	G	A	rs200071342		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr21:38572587G>A	ENST00000399017.2	+	45	8652	c.5905G>A	c.(5905-5907)Gtg>Atg	p.V1969M	TTC3_ENST00000354749.2_Missense_Mutation_p.V1969M|TTC3_ENST00000355666.1_Missense_Mutation_p.V1969M|TTC3_ENST00000479930.1_3'UTR	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1969					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				ATCAAAAAACGTGCGTGTGCT	0.413																																					p.V1969M	Ovarian(38;194 1649 35661)	.											.	TTC3	590	0			c.G5905A						.						90.0	78.0	82.0					21																	38572587		2203	4300	6503	SO:0001583	missense	7267	exon45			AAAAACGTGCGTG	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.5905G>A	21.37:g.38572587G>A	ENSP00000381981:p.Val1969Met	Somatic	210.0	0.0		WXS	Illumina HiSeq	Phase_I	138.0	57.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	37	CCDS13651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.29|13.29	2.192723|2.192723	0.38707|0.38707	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000428693|ENST00000355666;ENST00000399017;ENST00000354749	.|T;T;T	.|0.71817	.|-0.6;-0.6;-0.6	5.58|5.58	-2.2|-2.2	0.06994|0.06994	.|Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.|1.130140	.|0.06565	.|N	.|0.747410	T|T	0.55940|0.55940	0.1952|0.1952	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	1|1	.|P	.|0.39404	.|0.672	.|B	.|0.30943	.|0.122	T|T	0.42447|0.42447	-0.9451|-0.9451	5|10	.|0.19147	.|T	.|0.46	-1.4936|-1.4936	4.8143|4.8143	0.13358|0.13358	0.4155:0.2861:0.2984:0.0|0.4155:0.2861:0.2984:0.0	.|.	.|1969	.|P53804	.|TTC3_HUMAN	H|M	260|1969	.|ENSP00000347889:V1969M;ENSP00000381981:V1969M;ENSP00000346791:V1969M	.|ENSP00000346791:V1969M	R|V	+|+	2|1	0|0	TTC3|TTC3	37494457|37494457	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.975000|0.975000	0.68041|0.68041	-0.537000|-0.537000	0.06128|0.06128	-0.233000|-0.233000	0.09797|0.09797	0.655000|0.655000	0.94253|0.94253	CGT|GTG	G|0.999;A|0.001		0.413	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		
TTI1	9675	ucsc.edu;bcgsc.ca	37	20	36641352	36641352	+	Silent	SNP	G	G	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr20:36641352G>T	ENST00000373448.2	-	3	1105	c.867C>A	c.(865-867)atC>atA	p.I289I	TTI1_ENST00000449821.1_Silent_p.I289I|TTI1_ENST00000487362.1_Intron|TTI1_ENST00000373447.3_Silent_p.I289I	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	289					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						TTTTAATAAGGATAGTCAACT	0.443																																					p.I289I		.											.	TTI1	94	0			c.C867A						.						171.0	176.0	174.0					20																	36641352		2203	4300	6503	SO:0001819	synonymous_variant	9675	exon3			AATAAGGATAGTC	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.867C>A	20.37:g.36641352G>T		Somatic	42.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Silent	SNP	ENST00000373448.2	37	CCDS13300.1																																																																																			.		0.443	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
TTPAL	79183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43108685	43108685	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr20:43108685T>G	ENST00000372904.3	+	3	189	c.46T>G	c.(46-48)Tca>Gca	p.S16A	TTPAL_ENST00000262605.4_Missense_Mutation_p.S16A|TTPAL_ENST00000372906.2_Missense_Mutation_p.S16A	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	16						intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						TTCTGTGGCCTCACTCTCTGA	0.537																																					p.S16A		.											.	TTPAL	153	0			c.T46G						.						67.0	66.0	66.0					20																	43108685		2203	4300	6503	SO:0001583	missense	79183	exon2			GTGGCCTCACTCT	BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.46T>G	20.37:g.43108685T>G	ENSP00000361995:p.Ser16Ala	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	35.0	NM_001039199	E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Missense_Mutation	SNP	ENST00000372904.3	37	CCDS13332.2	.	.	.	.	.	.	.	.	.	.	T	13.33	2.205585	0.39003	.	.	ENSG00000124120	ENST00000262605;ENST00000372904;ENST00000372906;ENST00000456317	T;T;D;D	0.94184	-1.21;-1.21;-3.37;-2.19	5.18	5.18	0.71444	.	0.350651	0.30168	N	0.010255	D	0.85124	0.5625	N	0.14661	0.345	0.28410	N	0.918245	B	0.29378	0.243	B	0.27380	0.079	T	0.76740	-0.2848	10	0.25106	T	0.35	-14.1751	10.4353	0.44433	0.1453:0.0:0.0:0.8547	.	16	Q9BTX7	TTPAL_HUMAN	A	16	ENSP00000262605:S16A;ENSP00000361995:S16A;ENSP00000361997:S16A;ENSP00000412720:S16A	ENSP00000262605:S16A	S	+	1	0	TTPAL	42542099	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	3.034000	0.49751	2.164000	0.68074	0.533000	0.62120	TCA	.		0.537	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106886.2	NM_024331	
USP40	55230	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	234394614	234394614	+	Silent	SNP	G	G	A	rs369926451		TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr2:234394614G>A	ENST00000427112.2	-	28	3239	c.3204C>T	c.(3202-3204)gaC>gaT	p.D1068D	USP40_ENST00000496298.1_5'UTR|USP40_ENST00000251722.6_Silent_p.D1068D|USP40_ENST00000450966.1_Silent_p.D1080D			Q9NVE5	UBP40_HUMAN	ubiquitin specific peptidase 40	1068					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|endometrium(6)|kidney(5)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		TCAGCAGCACGTCCTGGGGGC	0.597																																					p.D1080D		.											.	USP40	455	0			c.C3240T						.	G		1,3995		0,1,1997	10.0	11.0	11.0		3240	0.6	0.7	2		11	0,8296		0,0,4148	no	coding-synonymous	USP40	NM_018218.2		0,1,6145	AA,AG,GG		0.0,0.025,0.0081		1080/1248	234394614	1,12291	1998	4148	6146	SO:0001819	synonymous_variant	55230	exon28			CAGCACGTCCTGG	AK001647	CCDS46547.1	2q37.1	2005-08-08	2005-08-08		ENSG00000085982	ENSG00000085982		"""Ubiquitin-specific peptidases"""	20069	protein-coding gene	gene with protein product		610570	"""ubiquitin specific protease 40"""			12838346	Standard	NM_018218		Approved	FLJ10785	uc010zmr.2	Q9NVE5	OTTHUMG00000153199	ENST00000427112.2:c.3204C>T	2.37:g.234394614G>A		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	9.0	9.0	NM_018218	Q6NX38|Q70EL0	Silent	SNP	ENST00000427112.2	37	CCDS46547.1	.	.	.	.	.	.	.	.	.	.	G	8.169	0.791253	0.16258	2.5E-4	0.0	ENSG00000085982	ENST00000454354	.	.	.	5.75	0.614	0.17603	.	.	.	.	.	T	0.41442	0.1159	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22034	-1.0228	4	.	.	.	.	0.8175	0.01105	0.2516:0.3156:0.218:0.2148	.	.	.	.	M	36	.	.	T	-	2	0	USP40	234059353	0.002000	0.14202	0.666000	0.29783	0.995000	0.86356	-0.184000	0.09698	-0.176000	0.10707	0.650000	0.86243	ACG	.		0.597	USP40-017	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397235.1	XM_114294	
VANGL2	57216	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	160388869	160388869	+	Silent	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:160388869C>T	ENST00000368061.2	+	4	744	c.270C>T	c.(268-270)cgC>cgT	p.R90R		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	90					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACCTCACACGCATCGCCAAGG	0.622																																					p.R90R		.											.	VANGL2	91	0			c.C270T						.						117.0	113.0	114.0					1																	160388869		2203	4300	6503	SO:0001819	synonymous_variant	57216	exon4			CACACGCATCGCC	AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.270C>T	1.37:g.160388869C>T		Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	115.0	21.0	NM_020335	D3DVE9|Q5T212	Silent	SNP	ENST00000368061.2	37	CCDS30915.1																																																																																			.		0.622	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080677.1	NM_020335	
VCL	7414	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	75830792	75830792	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr10:75830792delG	ENST00000211998.4	+	4	544	c.450delG	c.(448-450)gtgfs	p.V151fs	VCL_ENST00000372755.3_Frame_Shift_Del_p.V151fs|VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_Intron	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	151	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					TGGCAGAGGTGGTGGAGACTA	0.358																																					p.V150fs		.											.	VCL	93	0			c.450delG						.						114.0	118.0	116.0					10																	75830792		2203	4300	6503	SO:0001589	frameshift_variant	7414	exon4			AGAGGTGGTGGAG	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.450delG	10.37:g.75830792delG	ENSP00000211998:p.Val151fs	Somatic	201.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	61.0	NM_003373	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Frame_Shift_Del	DEL	ENST00000211998.4	37	CCDS7341.1																																																																																			.		0.358	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
VWCE	220001	ucsc.edu;bcgsc.ca	37	11	61036446	61036446	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:61036446G>A	ENST00000335613.5	-	15	2216	c.1830C>T	c.(1828-1830)tcC>tcT	p.S610S	VWCE_ENST00000535710.1_Silent_p.S75S	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	610	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GGTGAGGGCAGGAGTCCACAC	0.647																																					p.S610S		.											.	VWCE	91	0			c.C1830T						.						101.0	81.0	88.0					11																	61036446		2203	4299	6502	SO:0001819	synonymous_variant	220001	exon15			AGGGCAGGAGTCC	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1830C>T	11.37:g.61036446G>A		Somatic	45.0	0.0		WXS	Illumina HiSeq	.	20.0	4.0	NM_152718	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	ENST00000335613.5	37	CCDS8002.1																																																																																			.		0.647	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398811.1	NM_152718	
WDR17	116966	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	177017675	177017675	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr4:177017675C>T	ENST00000280190.4	+	2	161	c.5C>T	c.(4-6)gCt>gTt	p.A2V	WDR17_ENST00000393643.2_Intron|SNORA51_ENST00000364646.1_RNA|WDR17_ENST00000507824.2_Missense_Mutation_p.A2V|WDR17_ENST00000508596.1_Intron|WDR17_ENST00000509792.1_Intron			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	2										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CATTCTATGGCTTGGATGACT	0.343																																					p.A2V		.											.	WDR17	95	0			c.C5T						.						146.0	147.0	147.0					4																	177017675		2203	4300	6503	SO:0001583	missense	116966	exon2			CTATGGCTTGGAT	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.5C>T	4.37:g.177017675C>T	ENSP00000280190:p.Ala2Val	Somatic	121.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	17.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	37	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.121595	0.77436	.	.	ENSG00000150627	ENST00000280190;ENST00000507824	T	0.58358	0.34	5.1	4.25	0.50352	.	0.483821	0.18772	N	0.131581	T	0.34221	0.0890	N	0.08118	0	0.80722	D	1	B	0.21452	0.056	B	0.25405	0.06	T	0.28839	-1.0031	10	0.87932	D	0	-21.5603	12.3889	0.55348	0.0:0.9169:0.0:0.0831	.	2	Q8IZU2	WDR17_HUMAN	V	2	ENSP00000280190:A2V	ENSP00000280190:A2V	A	+	2	0	WDR17	177254669	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.879000	0.48522	2.814000	0.96858	0.655000	0.94253	GCT	.		0.343	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
WDR18	57418	ucsc.edu;bcgsc.ca	37	19	994280	994280	+	Silent	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:994280G>A	ENST00000251289.5	+	10	1259	c.1236G>A	c.(1234-1236)ctG>ctA	p.L412L	WDR18_ENST00000587001.2_Silent_p.L389L	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	412					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGCAACCTGCGCAAGATCA	0.692																																					p.L412L		.											.	WDR18	91	0			c.G1236A						.						67.0	50.0	56.0					19																	994280		2199	4297	6496	SO:0001819	synonymous_variant	57418	exon10			CAACCTGCGCAAG		CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.1236G>A	19.37:g.994280G>A		Somatic	63.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_024100	O60390|Q9BWR2	Silent	SNP	ENST00000251289.5	37	CCDS12051.1																																																																																			.		0.692	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458225.2		
CFAP57	149465	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	43649280	43649280	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:43649280G>C	ENST00000372492.4	+	4	817	c.493G>C	c.(493-495)Gat>Cat	p.D165H	WDR65_ENST00000528956.1_Missense_Mutation_p.D165H	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		165										NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CAGTCCACAGGATAACACTCA	0.388																																					p.D165H		.											.	WDR65	91	0			c.G493C						.						74.0	76.0	75.0					1																	43649280		2203	4300	6503	SO:0001583	missense	149465	exon4			CCACAGGATAACA																												ENST00000372492.4:c.493G>C	1.37:g.43649280G>C	ENSP00000361570:p.Asp165His	Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	40.0	NM_001195831	A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	ENST00000372492.4	37		.	.	.	.	.	.	.	.	.	.	G	21.3	4.121368	0.77436	.	.	ENSG00000243710	ENST00000372492;ENST00000528956;ENST00000529956	T;T;T	0.32515	4.96;1.45;4.96	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.051667	0.85682	D	0.000000	T	0.64494	0.2603	M	0.88704	2.975	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.81914	0.994;0.995	T	0.69206	-0.5206	10	0.56958	D	0.05	.	19.7559	0.96291	0.0:0.0:1.0:0.0	.	165;165	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	H	165	ENSP00000361570:D165H;ENSP00000435310:D165H;ENSP00000434133:D165H	ENSP00000361570:D165H	D	+	1	0	WDR65	43421867	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.232000	0.78116	2.656000	0.90262	0.655000	0.94253	GAT	.		0.388	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
WTIP	126374	ucsc.edu;bcgsc.ca	37	19	34986661	34986661	+	Silent	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:34986661A>G	ENST00000590071.2	+	7	1474	c.1137A>G	c.(1135-1137)gcA>gcG	p.A379A	WTIP_ENST00000270288.6_Silent_p.A603A	NM_001080436.1	NP_001073905.1	A6NIX2	WTIP_HUMAN	Wilms tumor 1 interacting protein	379	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cytoskeleton organization (GO:0007010)|gene silencing by miRNA (GO:0035195)|negative regulation of hippo signaling (GO:0035331)|positive regulation of gene silencing by miRNA (GO:2000637)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)	4	all_lung(56;5.94e-07)|Lung NSC(56;9.35e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			ACCACGTGGCATGTTACCACT	0.612																																					p.A379A		.											.	WTIP	68	0			c.A1137G						.						70.0	70.0	70.0					19																	34986661		2203	4300	6503	SO:0001819	synonymous_variant	126374	exon7			CGTGGCATGTTAC	AK130059	CCDS59375.1	19q13.11	2012-03-16			ENSG00000142279	ENSG00000142279			20964	protein-coding gene	gene with protein product	"""WT1-interacting protein"""	614790				14736876	Standard	NM_001080436		Approved		uc002nvm.3	A6NIX2		ENST00000590071.2:c.1137A>G	19.37:g.34986661A>G		Somatic	75.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001080436		Silent	SNP	ENST00000590071.2	37	CCDS59375.1																																																																																			.		0.612	WTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459381.3	XM_059037	
ZBTB7C	201501	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	45555810	45555810	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr18:45555810G>A	ENST00000588982.1	-	4	2182	c.1681C>T	c.(1681-1683)Cgc>Tgc	p.R561C	ZBTB7C_ENST00000535628.2_Missense_Mutation_p.R561C|ZBTB7C_ENST00000590800.1_Missense_Mutation_p.R561C|ZBTB7C_ENST00000332053.2_Missense_Mutation_p.R561C|ZBTB7C_ENST00000586438.1_Missense_Mutation_p.R561C			A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	561							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(8)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						AGCTGCGCGCGCCCGAACAGC	0.721																																					p.R561C		.											.	ZBTB7C	91	0			c.C1681T						.						10.0	11.0	11.0					18																	45555810		2188	4265	6453	SO:0001583	missense	201501	exon3			GCGCGCGCCCGAA	Y14591	CCDS32830.1	18q21.1	2013-01-08		2005-04-07	ENSG00000184828	ENSG00000184828		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	31700	protein-coding gene	gene with protein product			"""zinc finger and BTB domain containing 36"""	ZBTB36			Standard	NM_001039360		Approved	ZNF857C	uc002ldb.3	A1YPR0		ENST00000588982.1:c.1681C>T	18.37:g.45555810G>A	ENSP00000468782:p.Arg561Cys	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	26.0	10.0	NM_001039360	O73453	Missense_Mutation	SNP	ENST00000588982.1	37	CCDS32830.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761613	0.49468	.	.	ENSG00000184828	ENST00000535628;ENST00000332053	T;T	0.11604	2.76;2.76	4.51	2.45	0.29901	.	0.659005	0.12970	N	0.424205	T	0.06690	0.0171	N	0.14661	0.345	0.43852	D	0.996445	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18209	-1.0344	10	0.87932	D	0	.	7.5778	0.27946	0.0966:0.0:0.6156:0.2878	.	561;561	B2RG49;A1YPR0	.;ZBT7C_HUMAN	C	561	ENSP00000439781:R561C;ENSP00000328732:R561C	ENSP00000328732:R561C	R	-	1	0	ZBTB7C	43809808	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	3.350000	0.52224	0.886000	0.36113	0.555000	0.69702	CGC	.		0.721	ZBTB7C-025	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450731.1	NM_001039360	
ZNF214	7761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	7021165	7021165	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr11:7021165T>G	ENST00000278314.4	-	3	2064	c.1749A>C	c.(1747-1749)aaA>aaC	p.K583N	ZNF214_ENST00000536068.1_Missense_Mutation_p.K583N|ZNF214_ENST00000531083.1_5'Flank	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	583					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		ATTCACGGCATTTGTAAGGTT	0.343																																					p.K583N	Ovarian(22;251 657 736 21522 46864)	.											.	ZNF214	91	0			c.A1749C						.						75.0	79.0	78.0					11																	7021165		2200	4295	6495	SO:0001583	missense	7761	exon3			ACGGCATTTGTAA	AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.1749A>C	11.37:g.7021165T>G	ENSP00000278314:p.Lys583Asn	Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	22.0	NM_013249	B2R8Q1	Missense_Mutation	SNP	ENST00000278314.4	37	CCDS31418.1	.	.	.	.	.	.	.	.	.	.	T	6.273	0.418459	0.11870	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.61859	0.07;0.07	3.84	2.72	0.32119	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000208	T	0.54319	0.1851	M	0.61387	1.9	0.09310	N	1	P	0.48016	0.904	P	0.45167	0.472	T	0.51276	-0.8726	10	0.66056	D	0.02	.	7.5285	0.27668	0.0:0.1056:0.0:0.8944	.	583	Q9UL59	ZN214_HUMAN	N	583	ENSP00000278314:K583N;ENSP00000445373:K583N	ENSP00000278314:K583N	K	-	3	2	ZNF214	6977741	0.000000	0.05858	0.323000	0.25347	0.670000	0.39368	-0.570000	0.05895	0.845000	0.35118	0.454000	0.30748	AAA	.		0.343	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385349.1		
ZNF682	91120	bcgsc.ca;mdanderson.org	37	19	20117276	20117276	+	Silent	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:20117276T>C	ENST00000397165.2	-	4	1195	c.1035A>G	c.(1033-1035)gaA>gaG	p.E345E	ZNF682_ENST00000358523.5_Silent_p.E313E|ZNF682_ENST00000397162.1_Silent_p.E313E|ZNF682_ENST00000596019.1_Intron|ZNF682_ENST00000595736.1_Silent_p.E269E|ZNF682_ENST00000597972.1_Silent_p.E351E	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						CTTTGCCACATTCTTCACATT	0.368																																					p.E345E		.											.	ZNF682	92	0			c.A1035G						.						55.0	59.0	58.0					19																	20117276		2143	4263	6406	SO:0001819	synonymous_variant	91120	exon4			GCCACATTCTTCA	AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.1035A>G	19.37:g.20117276T>C		Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_1	38.0	5.0	NM_033196	B3KU64|E9PFJ5|Q96JV9	Silent	SNP	ENST00000397165.2	37	CCDS42533.1																																																																																			.		0.368	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462888.1	NM_033196	
ZNF493	284443	ucsc.edu;bcgsc.ca	37	19	21607674	21607674	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:21607674A>G	ENST00000355504.4	+	2	2095	c.1829A>G	c.(1828-1830)gAc>gGc	p.D610G	ZNF493_ENST00000392288.2_Missense_Mutation_p.D738G|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	610					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						CATACTGGAGACAAACCCTAC	0.353																																					p.D738G		.											.	ZNF493	516	0			c.A2213G						.						41.0	42.0	41.0					19																	21607674		2203	4298	6501	SO:0001583	missense	284443	exon4			CTGGAGACAAACC	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1829A>G	19.37:g.21607674A>G	ENSP00000347691:p.Asp610Gly	Somatic	64.0	0.0		WXS	Illumina HiSeq	.	47.0	4.0	NM_001076678	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	12.78	2.040006	0.35989	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.18502	2.21;2.21	1.02	1.02	0.19986	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06690	0.0171	N	0.02420	-0.555	0.80722	D	1	B;P	0.44344	0.001;0.833	B;B	0.41236	0.006;0.351	T	0.33548	-0.9864	9	0.66056	D	0.02	.	6.9898	0.24750	1.0:0.0:0.0:0.0	.	610;738	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	G	738;610	ENSP00000376110:D738G;ENSP00000347691:D610G	ENSP00000347691:D610G	D	+	2	0	ZNF493	21399514	0.611000	0.26992	0.360000	0.25837	0.361000	0.29550	1.466000	0.35310	0.378000	0.24764	0.372000	0.22366	GAC	.		0.353	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
ZNF420	147923	ucsc.edu;bcgsc.ca	37	19	37619509	37619509	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:37619509C>T	ENST00000337995.3	+	5	1831	c.1616C>T	c.(1615-1617)gCc>gTc	p.A539V	ZNF585A_ENST00000588723.1_Intron|ZNF420_ENST00000304239.7_Intron|CTC-454I21.4_ENST00000587645.1_RNA	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420	539					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTGGAAAGGCCTTTGCGCGT	0.403																																					p.A539V		.											.	ZNF420	90	0			c.C1616T						.						90.0	91.0	91.0					19																	37619509		2203	4300	6503	SO:0001583	missense	147923	exon5			GAAAGGCCTTTGC	AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.1616C>T	19.37:g.37619509C>T	ENSP00000338770:p.Ala539Val	Somatic	89.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_144689	B2RDY6|Q96ML5	Missense_Mutation	SNP	ENST00000337995.3	37	CCDS12498.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.762320	0.49468	.	.	ENSG00000197050	ENST00000337995	T	0.36340	1.26	4.2	3.15	0.36227	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41305	0.1153	N	0.20357	0.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.13495	-1.0507	8	.	.	.	.	11.9099	0.52733	0.0:0.5088:0.4912:0.0	.	539	Q8TAQ5	ZN420_HUMAN	V	539	ENSP00000338770:A539V	.	A	+	2	0	ZNF420	42311349	0.001000	0.12720	0.790000	0.31976	0.974000	0.67602	0.668000	0.25127	0.961000	0.38030	-0.176000	0.13171	GCC	.		0.403	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109587.3	NM_144689	
ZNF695	57116	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247162655	247162655	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr1:247162655T>C	ENST00000339986.7	-	3	401	c.254A>G	c.(253-255)cAc>cGc	p.H85R	ZNF695_ENST00000498046.2_Intron|ZNF695_ENST00000487338.2_Missense_Mutation_p.H85R	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	85	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CCTACCTGAGTGTCTGGCTGT	0.483																																					p.H85R		.											.	.	.	0			c.A254G						.						112.0	115.0	114.0					1																	247162655		2037	4235	6272	SO:0001583	missense	57116	exon3			CCTGAGTGTCTGG		CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.254A>G	1.37:g.247162655T>C	ENSP00000341236:p.His85Arg	Somatic	310.0	0.0		WXS	Illumina HiSeq	Phase_I	196.0	85.0	NM_001204221	Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Missense_Mutation	SNP	ENST00000339986.7	37	CCDS44344.1	.	.	.	.	.	.	.	.	.	.	T	0.898	-0.723208	0.03158	.	.	ENSG00000197472	ENST00000487338;ENST00000391780;ENST00000339986	T;T	0.05996	5.9;3.36	0.149	0.149	0.14863	Krueppel-associated box (1);	.	.	.	.	T	0.01905	0.0060	N	0.00972	-1.085	0.09310	N	1	P;P;P	0.42735	0.462;0.788;0.667	B;B;B	0.37989	0.227;0.124;0.262	T	0.41662	-0.9496	8	0.45353	T	0.12	.	.	.	.	.	85;73;85	Q8IW36;F2Z2N8;Q8IW36-1	ZN695_HUMAN;.;.	R	85	ENSP00000429736:H85R;ENSP00000341236:H85R	ENSP00000428213:H73R	H	-	2	0	ZNF695	245229278	0.287000	0.24315	0.114000	0.21550	0.115000	0.19883	0.939000	0.28978	0.166000	0.19597	0.164000	0.16699	CAC	.		0.483	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097823.5	NM_020394	
ZNF713	349075	ucsc.edu;bcgsc.ca	37	7	56007647	56007647	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:56007647A>G	ENST00000429591.2	+	4	1279	c.1241A>G	c.(1240-1242)gAa>gGa	p.E414G	MRPS17_ENST00000426595.1_Intron	NM_182633.1	NP_872439.1	Q8N859	ZN713_HUMAN	zinc finger protein 713	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AAATTATGTGAATATAAATGT	0.378																																					p.E414G		.											.	ZNF713	92	0			c.A1241G						.						48.0	49.0	49.0					7																	56007647		2203	4300	6503	SO:0001583	missense	349075	exon4			TATGTGAATATAA	AK097282	CCDS34639.1	7p11.2	2013-01-08			ENSG00000178665	ENSG00000178665		"""Zinc fingers, C2H2-type"", ""-"""	22043	protein-coding gene	gene with protein product							Standard	NM_182633		Approved	FLJ39963	uc003trc.1	Q8N859	OTTHUMG00000156175	ENST00000429591.2:c.1241A>G	7.37:g.56007647A>G	ENSP00000416662:p.Glu414Gly	Somatic	50.0	0.0		WXS	Illumina HiSeq	.	50.0	4.0	NM_182633		Missense_Mutation	SNP	ENST00000429591.2	37	CCDS34639.1	.	.	.	.	.	.	.	.	.	.	A	4.065	0.009919	0.07912	.	.	ENSG00000178665	ENST00000429591	T	0.07114	3.22	3.54	2.34	0.29019	.	0.419960	0.17566	N	0.169637	T	0.09949	0.0244	M	0.62723	1.935	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.19353	-1.0308	10	0.87932	D	0	.	7.742	0.28848	0.57:0.43:0.0:0.0	.	414	Q8N859	ZN713_HUMAN	G	414	ENSP00000416662:E414G	ENSP00000416662:E414G	E	+	2	0	ZNF713	55975141	0.000000	0.05858	0.217000	0.23759	0.287000	0.27160	0.713000	0.25794	0.695000	0.31675	0.383000	0.25322	GAA	.		0.378	ZNF713-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343297.1	NM_182633	
ZNF782	158431	ucsc.edu;bcgsc.ca	37	9	99581617	99581617	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr9:99581617G>A	ENST00000481138.1	-	6	1349	c.688C>T	c.(688-690)Ctt>Ttt	p.L230F	ZNF782_ENST00000535338.1_Missense_Mutation_p.L98F|ZNF782_ENST00000466833.1_5'Flank	NM_001001662.1	NP_001001662.1	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	230					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(8)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)	33		Acute lymphoblastic leukemia(62;0.0527)				GATGTAACAAGGGCAGCCTTT	0.333																																					p.L230F		.											.	ZNF782	90	0			c.C688T						.						61.0	65.0	64.0					9																	99581617		2202	4298	6500	SO:0001583	missense	158431	exon6			TAACAAGGGCAGC	AK131468	CCDS35075.1	9q22.33	2013-01-08			ENSG00000196597	ENSG00000196597		"""Zinc fingers, C2H2-type"", ""-"""	33110	protein-coding gene	gene with protein product							Standard	NM_001001662		Approved	FLJ16636	uc004awp.1	Q6ZMW2	OTTHUMG00000020310	ENST00000481138.1:c.688C>T	9.37:g.99581617G>A	ENSP00000419397:p.Leu230Phe	Somatic	93.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001001662	B2RNR0	Missense_Mutation	SNP	ENST00000481138.1	37	CCDS35075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.642|8.642	0.896170|0.896170	0.17686|0.17686	.|.	.|.	ENSG00000196597|ENSG00000196597	ENST00000481138;ENST00000535338|ENST00000289032	T;T|.	0.06142|.	3.45;3.34|.	3.53|3.53	-1.85|-1.85	0.07784|0.07784	.|.	0.964674|.	0.08396|.	N|.	0.952104|.	T|T	0.25382|0.25382	0.0617|0.0617	L|L	0.42245|0.42245	1.32|1.32	0.09310|0.09310	N|N	1|1	B|.	0.14805|.	0.011|.	B|.	0.14023|.	0.01|.	T|T	0.28933|0.28933	-1.0028|-1.0028	10|5	0.41790|.	T|.	0.15|.	.|.	0.9265|0.9265	0.01326|0.01326	0.3857:0.1559:0.2992:0.1592|0.3857:0.1559:0.2992:0.1592	.|.	230|.	Q6ZMW2|.	ZN782_HUMAN|.	F|L	230;98|218	ENSP00000419397:L230F;ENSP00000440624:L98F|.	ENSP00000419397:L230F|.	L|P	-|-	1|2	0|0	ZNF782|ZNF782	98621438|98621438	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.263000|0.263000	0.26337|0.26337	-0.080000|-0.080000	0.11339|0.11339	-0.384000|-0.384000	0.07845|0.07845	0.650000|0.650000	0.86243|0.86243	CTT|CCT	.		0.333	ZNF782-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356810.1	NM_001001662	
ZNF804B	219578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	88966173	88966173	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr7:88966173C>T	ENST00000333190.4	+	4	4486	c.3877C>T	c.(3877-3879)Cct>Tct	p.P1293S		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1293							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGCATTTATTCCTACATTGTT	0.453										HNSCC(36;0.09)																											p.P1293S		.											.	ZNF804B	101	0			c.C3877T						.						207.0	191.0	197.0					7																	88966173		2203	4300	6503	SO:0001583	missense	219578	exon4			TTTATTCCTACAT	AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3877C>T	7.37:g.88966173C>T	ENSP00000329638:p.Pro1293Ser	Somatic	211.0	0.0		WXS	Illumina HiSeq	Phase_I	127.0	62.0	NM_181646	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	ENST00000333190.4	37	CCDS5613.1	.	.	.	.	.	.	.	.	.	.	C	19.17	3.776524	0.70107	.	.	ENSG00000182348	ENST00000333190	T	0.14766	2.48	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000006	T	0.42063	0.1186	M	0.77103	2.36	0.52099	D	0.999945	D	0.89917	1.0	D	0.91635	0.999	T	0.25502	-1.0130	10	0.72032	D	0.01	-15.2313	19.3813	0.94536	0.0:1.0:0.0:0.0	.	1293	A4D1E1	Z804B_HUMAN	S	1293	ENSP00000329638:P1293S	ENSP00000329638:P1293S	P	+	1	0	ZNF804B	88804109	1.000000	0.71417	0.998000	0.56505	0.489000	0.33432	6.985000	0.76193	2.798000	0.96311	0.655000	0.94253	CCT	.		0.453	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253683.2	NM_181646	
ZNF99	7652	ucsc.edu;bcgsc.ca	37	19	22941840	22941840	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A11C-01A-11D-A12Z-10	TCGA-DD-A11C-11A-11D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a9cde9a5-c0ff-4c01-8182-81c9ef3920e6	d5d8c783-db2c-487c-9cce-1b76137ddc15	g.chr19:22941840C>T	ENST00000596209.1	-	4	961	c.871G>A	c.(871-873)Ggc>Agc	p.G291S	ZNF99_ENST00000397104.3_Missense_Mutation_p.G200S	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AAAGCTTTGCCACATTCTTCA	0.353																																					p.G291S		.											.	ZNF99	24	0			c.G871A						.						34.0	37.0	36.0					19																	22941840		2124	4256	6380	SO:0001583	missense	7652	exon4			CTTTGCCACATTC	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.871G>A	19.37:g.22941840C>T	ENSP00000472969:p.Gly291Ser	Somatic	73.0	0.0		WXS	Illumina HiSeq	.	42.0	4.0	NM_001080409	M0R335	Missense_Mutation	SNP	ENST00000596209.1	37	CCDS59369.1	.	.	.	.	.	.	.	.	.	.	-	11.11	1.542169	0.27563	.	.	ENSG00000213973	ENST00000397104	T	0.01455	4.87	1.34	-1.82	0.07857	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03011	0.0089	M	0.73598	2.24	0.21878	N	0.999495	B	0.34264	0.446	B	0.36186	0.219	T	0.22626	-1.0211	9	0.54805	T	0.06	.	6.6155	0.22774	0.0:0.7128:0.0:0.2872	.	200	A8MXY4	ZNF99_HUMAN	S	200	ENSP00000380293:G200S	ENSP00000380293:G200S	G	-	1	0	ZNF99	22733680	0.808000	0.29022	0.000000	0.03702	0.012000	0.07955	1.445000	0.35079	-0.805000	0.04404	-0.711000	0.03637	GGC	.		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
