#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AKAP11	11215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	42877120	42877120	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr13:42877120C>A	ENST00000025301.2	+	8	4413	c.4238C>A	c.(4237-4239)tCa>tAa	p.S1413*		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1413					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		TTAATGTTTTCAAACAAAGAG	0.383																																					p.S1413X		.											.	AKAP11	227	0			c.C4238A						.						48.0	51.0	50.0					13																	42877120		2203	4300	6503	SO:0001587	stop_gained	11215	exon8			TGTTTTCAAACAA	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.4238C>A	13.37:g.42877120C>A	ENSP00000025301:p.Ser1413*	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	17.0	NM_016248	O75124|Q9NUK7	Nonsense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	C	38	6.961113	0.97964	.	.	ENSG00000023516	ENST00000025301	.	.	.	5.58	4.55	0.56014	.	0.437976	0.20911	N	0.083466	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	3.6947	0.08360	0.0:0.1427:0.2294:0.628	.	.	.	.	X	1413	.	ENSP00000025301:S1413X	S	+	2	0	AKAP11	41775120	0.001000	0.12720	0.159000	0.22649	0.077000	0.17291	0.934000	0.28910	1.138000	0.42230	0.557000	0.71058	TCA	.		0.383	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
AMY2A	279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	104160673	104160673	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:104160673G>C	ENST00000414303.2	+	2	330	c.266G>C	c.(265-267)gGa>gCa	p.G89A		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	89					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	ACAAGATCTGGAAATGAAGAT	0.353																																					p.G89A		.											.	AMY2A	92	0			c.G266C						.						131.0	122.0	125.0					1																	104160673		2201	4275	6476	SO:0001583	missense	279	exon2			GATCTGGAAATGA	BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.266G>C	1.37:g.104160673G>C	ENSP00000397582:p.Gly89Ala	Somatic	189.0	0.0		WXS	Illumina HiSeq	Phase_I	1040.0	372.0	NM_000699	B9EJG1|Q9UBH3	Missense_Mutation	SNP	ENST00000414303.2	37	CCDS783.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.8|20.8	4.045045|4.045045	0.75846|0.75846	.|.	.|.	ENSG00000243480|ENSG00000243480	ENST00000414303;ENST00000393932|ENST00000423678	D|.	0.99929|.	-8.14|.	3.47|3.47	3.47|3.47	0.39725|0.39725	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87728|0.87728	0.6250|0.6250	H|H	0.99104|0.99104	4.43|4.43	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.92796|0.92796	0.6252|0.6252	10|5	0.87932|.	D|.	0|.	.|.	15.0729|15.0729	0.72053|0.72053	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	89;89|.	B9EJG1;P04746|.	.;AMYP_HUMAN|.	A|C	89|87	ENSP00000397582:G89A|.	ENSP00000377509:G89A|.	G|W	+|+	2|3	0|0	AMY2A|AMY2A	103962196|103962196	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.163000|9.163000	0.94750|0.94750	1.927000|1.927000	0.55829|0.55829	0.455000|0.455000	0.32223|0.32223	GGA|TGG	.		0.353	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030315.1	NM_000699	
ANKRD11	29123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	89349770	89349770	+	Silent	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:89349770T>C	ENST00000301030.4	-	9	3640	c.3180A>G	c.(3178-3180)aaA>aaG	p.K1060K	ANKRD11_ENST00000378330.2_Silent_p.K1060K	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1060	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCTTGGTATCTTTTTTCTCTT	0.378																																					p.K1060K		.											.	ANKRD11	139	0			c.A3180G						.						125.0	133.0	131.0					16																	89349770		2198	4300	6498	SO:0001819	synonymous_variant	29123	exon9			GGTATCTTTTTTC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.3180A>G	16.37:g.89349770T>C		Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	277.0	115.0	NM_001256183	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	9.261	1.043111	0.19748	.	.	ENSG00000167522	ENST00000330736	.	.	.	5.39	-2.32	0.06745	.	0.000000	0.85682	D	0.000000	T	0.69672	0.3137	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73056	-0.4103	6	0.87932	D	0	.	13.4948	0.61419	0.0:0.4567:0.0:0.5433	.	.	.	.	R	611	.	ENSP00000330815:K611R	K	-	2	0	ANKRD11	87877271	0.989000	0.36119	0.884000	0.34674	0.989000	0.77384	0.225000	0.17757	-0.377000	0.07930	0.533000	0.62120	AAG	.		0.378	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21245890	21245891	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr2:21245890_21245891insT	ENST00000233242.1	-	18	2755_2756	c.2628_2629insA	c.(2626-2631)aaacccfs	p.P877fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	877			P -> L (in dbSNP:rs12714097).		artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.P877S(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACACGGAGGGTTTTGCCACCA	0.475																																					p.P877fs		.											.	APOB	175	1	Substitution - Missense(1)	NS(1)	c.2629_2630insA						.																																			SO:0001589	frameshift_variant	338	exon18			CGGAGGGTTTTGC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2629dupA	2.37:g.21245894_21245894dupT	ENSP00000233242:p.Pro877fs	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	48.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.475	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
APOB	338	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	21231053	21231053	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr2:21231053G>A	ENST00000233242.1	-	26	8814	c.8687C>T	c.(8686-8688)cCc>cTc	p.P2896L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2896					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCCAGTTTGGGGATGTTCAA	0.433																																					p.P2896L		.											.	APOB	175	0			c.C8687T						.						176.0	173.0	174.0					2																	21231053		2203	4299	6502	SO:0001583	missense	338	exon26			AGTTTGGGGATGT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8687C>T	2.37:g.21231053G>A	ENSP00000233242:p.Pro2896Leu	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	232.0	100.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677007	0.88445	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01527	4.8	5.73	5.73	0.89815	.	0.000000	0.51477	D	0.000088	T	0.11623	0.0283	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00061	-1.2161	10	0.87932	D	0	.	19.5098	0.95137	0.0:0.0:1.0:0.0	.	2896	P04114	APOB_HUMAN	L	2896	ENSP00000233242:P2896L	ENSP00000233242:P2896L	P	-	2	0	APOB	21084558	1.000000	0.71417	0.975000	0.42487	0.996000	0.88848	9.803000	0.99136	2.707000	0.92482	0.555000	0.69702	CCC	.		0.433	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
AQR	9716	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	35198872	35198872	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr15:35198872G>T	ENST00000156471.5	-	18	1930	c.1705C>A	c.(1705-1707)Ccc>Acc	p.P569T		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	569					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		GGTTTTGTGGGACGTACGGTA	0.388																																					p.P569T		.											.	AQR	135	0			c.C1705A						.						126.0	113.0	117.0					15																	35198872		1901	4133	6034	SO:0001583	missense	9716	exon18			TTGTGGGACGTAC	AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.1705C>A	15.37:g.35198872G>T	ENSP00000156471:p.Pro569Thr	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	100.0	39.0	NM_014691	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	ENST00000156471.5	37	CCDS42013.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962361	0.74016	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.94232	-3.38	5.44	4.51	0.55191	.	0.047946	0.85682	N	0.000000	D	0.96917	0.8993	M	0.93763	3.455	0.48087	D	0.999589	D	0.69078	0.997	P	0.58210	0.835	D	0.97610	1.0129	10	0.72032	D	0.01	-11.5427	15.454	0.75299	0.0:0.0:0.8602:0.1398	.	569	O60306	AQR_HUMAN	T	569	ENSP00000156471:P569T	ENSP00000156471:P569T	P	-	1	0	AQR	32986164	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.416000	0.97383	1.252000	0.44001	0.591000	0.81541	CCC	.		0.388	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417526.2	NM_014691	
ARMC10	83787	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	102738867	102738867	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr7:102738867A>G	ENST00000323716.3	+	7	1291	c.899A>G	c.(898-900)cAg>cGg	p.Q300R	ARMC10_ENST00000428183.2_Missense_Mutation_p.Q241R|ARMC10_ENST00000441711.2_Missense_Mutation_p.Q265R|ARMC10_ENST00000425331.1_Missense_Mutation_p.Q241R|ARMC10_ENST00000541300.1_Missense_Mutation_p.Q182R|ARMC10_ENST00000454559.1_Missense_Mutation_p.Q206R	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	300					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						TTAGCTGTGCAGCCTACTTTC	0.403																																					p.Q300R		.											.	ARMC10	91	0			c.A899G						.						77.0	73.0	74.0					7																	102738867		2203	4298	6501	SO:0001583	missense	83787	exon7			CTGTGCAGCCTAC	AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.899A>G	7.37:g.102738867A>G	ENSP00000319412:p.Gln300Arg	Somatic	175.0	0.0		WXS	Illumina HiSeq	Phase_I	614.0	165.0	NM_031905	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	ENST00000323716.3	37	CCDS5728.1	.	.	.	.	.	.	.	.	.	.	A	3.673	-0.067130	0.07273	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000434153;ENST00000431642	T;T;T;T;T;T;T;T	0.53423	1.52;1.52;1.52;1.52;1.52;1.52;0.62;1.52	5.68	-0.724	0.11177	Armadillo-type fold (1);	0.554134	0.21062	N	0.080809	T	0.38427	0.1040	L	0.58669	1.825	0.09310	N	1	B;B;B;B;B;B;B	0.30236	0.004;0.004;0.274;0.116;0.004;0.008;0.008	B;B;B;B;B;B;B	0.27887	0.02;0.006;0.084;0.057;0.008;0.019;0.022	T	0.26155	-1.0111	10	0.30854	T	0.27	1.5325	10.9007	0.47049	0.6685:0.0:0.3315:0.0	.	241;182;206;228;241;265;300	B4DWJ8;F5GX65;Q8N2F6-4;C9J5N7;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;.;ARM10_HUMAN	R	300;241;265;206;241;182;228;142	ENSP00000319412:Q300R;ENSP00000396654:Q241R;ENSP00000413619:Q265R;ENSP00000405612:Q206R;ENSP00000397969:Q241R;ENSP00000440463:Q182R;ENSP00000398201:Q228R;ENSP00000406840:Q142R	ENSP00000319412:Q300R	Q	+	2	0	ARMC10	102526103	0.001000	0.12720	0.000000	0.03702	0.377000	0.30045	0.539000	0.23175	-0.070000	0.12908	0.482000	0.46254	CAG	.		0.403	ARMC10-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347882.1	NM_031905	
ATCAY	85300	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	3910853	3910853	+	Missense_Mutation	SNP	C	C	T	rs376658701		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr19:3910853C>T	ENST00000450849.2	+	8	1299	c.832C>T	c.(832-834)Cgg>Tgg	p.R278W	ATCAY_ENST00000600960.1_Missense_Mutation_p.R278W|ATCAY_ENST00000301260.6_Missense_Mutation_p.R278W|ATCAY_ENST00000398448.3_Missense_Mutation_p.R284W	NM_033064.4	NP_149053.1	Q86WG3	ATCAY_HUMAN	ataxia, cerebellar, Cayman type	278	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Mediates interaction with GLS.				apoptotic process (GO:0006915)|mitochondrion distribution (GO:0048311)|negative regulation of glutamate metabolic process (GO:2000212)|neuron projection development (GO:0031175)|regulation of protein localization (GO:0032880)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrial membrane (GO:0031966)|neuron projection (GO:0043005)|synapse (GO:0045202)	kinesin binding (GO:0019894)	p.R278W(1)		breast(1)|endometrium(2)|kidney(2)|lung(2)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		GTGGTTCATTCGGACTGTGCT	0.592																																					p.R278W		.											.	ATCAY	67	1	Substitution - Missense(1)	large_intestine(1)	c.C832T						.	C	TRP/ARG	0,4270		0,0,2135	119.0	127.0	124.0		832	4.3	1.0	19		124	1,8483		0,1,4241	no	missense	ATCAY	NM_033064.4	101	0,1,6376	TT,TC,CC		0.0118,0.0,0.0078	probably-damaging	278/372	3910853	1,12753	2135	4242	6377	SO:0001583	missense	85300	exon8			TTCATTCGGACTG		CCDS45923.1	19p13.3	2014-06-24	2008-07-18		ENSG00000167654	ENSG00000167654			779	protein-coding gene	gene with protein product	"""Cayman ataxia"", ""caytaxin"""	608179				8845847, 14556008	Standard	NM_033064		Approved		uc002lyy.4	Q86WG3	OTTHUMG00000181836	ENST00000450849.2:c.832C>T	19.37:g.3910853C>T	ENSP00000390941:p.Arg278Trp	Somatic	64.0	0.0		WXS	Illumina HiSeq	Phase_I	137.0	63.0	NM_033064	Q8NAQ2|Q8TAQ3|Q96HC6|Q96JF5	Missense_Mutation	SNP	ENST00000450849.2	37	CCDS45923.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366995	0.82463	0.0	1.18E-4	ENSG00000167654	ENST00000450849;ENST00000301260;ENST00000357694;ENST00000398448;ENST00000539301	T;T;T	0.67523	-0.27;-0.27;-0.27	4.35	4.35	0.52113	Cellular retinaldehyde-binding/triple function, C-terminal (4);	0.063315	0.64402	D	0.000008	D	0.84174	0.5414	M	0.91717	3.235	0.50813	D	0.999898	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.87653	0.2529	10	0.87932	D	0	-2.6229	12.7004	0.57029	0.165:0.835:0.0:0.0	.	284;278;278	B4DS11;Q86WG3-3;Q86WG3	.;.;ATCAY_HUMAN	W	278;278;278;284;256	ENSP00000390941:R278W;ENSP00000301260:R278W;ENSP00000381466:R284W	ENSP00000301260:R278W	R	+	1	2	ATCAY	3861853	0.998000	0.40836	0.999000	0.59377	0.977000	0.68977	3.866000	0.56040	1.970000	0.57323	0.456000	0.33151	CGG	.		0.592	ATCAY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457872.2		
ATP13A3	79572	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	194126804	194126804	+	Silent	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:194126804G>A	ENST00000439040.1	-	33	4316	c.3525C>T	c.(3523-3525)gcC>gcT	p.A1175A	ATP13A3_ENST00000256031.4_Silent_p.A1175A			Q9H7F0	AT133_HUMAN	ATPase type 13A3	1175						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TACAGCCCAGGGCCCAGGGTA	0.463																																					p.A1175A		.											.	ATP13A3	69	0			c.C3525T						.						122.0	115.0	117.0					3																	194126804		2023	4196	6219	SO:0001819	synonymous_variant	79572	exon32			GCCCAGGGCCCAG	AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.3525C>T	3.37:g.194126804G>A		Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	198.0	79.0	NM_024524	Q8NC11|Q96KS1	Silent	SNP	ENST00000439040.1	37	CCDS43187.1	.	.	.	.	.	.	.	.	.	.	G	4.813	0.151232	0.09185	.	.	ENSG00000133657	ENST00000429136	.	.	.	5.79	1.76	0.24704	.	.	.	.	.	T	0.53850	0.1822	.	.	.	0.42295	D	0.992155	.	.	.	.	.	.	T	0.44436	-0.9328	4	.	.	.	-12.1813	6.4084	0.21678	0.0796:0.3519:0.47:0.0985	.	.	.	.	S	111	.	.	P	-	1	0	ATP13A3	195608093	1.000000	0.71417	0.342000	0.25602	0.488000	0.33401	2.473000	0.45145	0.337000	0.23665	0.650000	0.86243	CCT	.		0.463	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342799.2	NM_024524	
ATP1A1	476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	116933025	116933025	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:116933025A>C	ENST00000295598.5	+	9	1466	c.1214A>C	c.(1213-1215)aAt>aCt	p.N405T	ATP1A1_ENST00000369496.4_Missense_Mutation_p.N374T|ATP1A1_ENST00000537345.1_Missense_Mutation_p.N405T	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	405					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	ACGACAGAGAATCAGAGTGGT	0.423																																					p.N405T		.											.	ATP1A1	91	0			c.A1214C						.						59.0	58.0	58.0					1																	116933025		2203	4300	6503	SO:0001583	missense	476	exon9			CAGAGAATCAGAG	D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1214A>C	1.37:g.116933025A>C	ENSP00000295598:p.Asn405Thr	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	66.0	NM_001160233	B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	ENST00000295598.5	37	CCDS887.1	.	.	.	.	.	.	.	.	.	.	A	18.43	3.622723	0.66787	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000339159;ENST00000369496	T;T;T	0.78816	-1.21;-1.21;-1.21	4.87	4.87	0.63330	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.59252	0.2180	N	0.20881	0.62	0.80722	D	1	B;B	0.14805	0.009;0.011	B;B	0.33960	0.108;0.173	T	0.61753	-0.6998	10	0.45353	T	0.12	.	14.6423	0.68734	1.0:0.0:0.0:0.0	.	405;405	F5H3A1;P05023	.;AT1A1_HUMAN	T	405;405;404;374	ENSP00000295598:N405T;ENSP00000445306:N405T;ENSP00000358508:N374T	ENSP00000295598:N405T	N	+	2	0	ATP1A1	116734548	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.126000	0.94411	2.068000	0.61886	0.528000	0.53228	AAT	.		0.423	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033481.5	NM_001160233	
ATP2B2	491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10443888	10443888	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:10443888C>A	ENST00000352432.4	-	3	611	c.542G>T	c.(541-543)gGc>gTc	p.G181V	ATP2B2_ENST00000397077.1_Missense_Mutation_p.G181V|ATP2B2_ENST00000383800.4_Missense_Mutation_p.G181V|ATP2B2_ENST00000343816.4_Missense_Mutation_p.G181V|ATP2B2_ENST00000360273.2_Missense_Mutation_p.G181V			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	181					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GCTCTGCAGGCCCCGGAACTG	0.592																																					p.G181V	Ovarian(125;1619 1709 15675 19819 38835)	.											.	ATP2B2	95	0			c.G542T						.						131.0	142.0	138.0					3																	10443888		2203	4300	6503	SO:0001583	missense	491	exon4			TGCAGGCCCCGGA	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.542G>T	3.37:g.10443888C>A	ENSP00000324172:p.Gly181Val	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	40.0	NM_001683	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	37	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013607	0.93404	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4;-2.4	5.44	5.44	0.79542	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.92935	0.7752	L	0.47078	1.49	0.80722	D	1	D;D;P	0.89917	1.0;0.991;0.946	D;D;P	0.97110	1.0;0.937;0.672	D	0.93482	0.6828	10	0.87932	D	0	-36.5231	19.2768	0.94034	0.0:1.0:0.0:0.0	.	181;193;181	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	V	181;181;181;181;181;147;68;181	ENSP00000324172:G181V;ENSP00000373311:G181V;ENSP00000380267:G181V;ENSP00000353414:G181V;ENSP00000344677:G181V;ENSP00000414854:G68V	ENSP00000342954:G181V	G	-	2	0	ATP2B2	10418888	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.550000	0.86006	0.467000	0.42956	GGC	.		0.592	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
ATP5G3	518	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	176044872	176044872	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr2:176044872A>T	ENST00000284727.4	-	3	3098	c.74T>A	c.(73-75)aTt>aAt	p.I25N	ATP5G3_ENST00000392541.3_Missense_Mutation_p.I25N|ATP5G3_ENST00000409194.1_Missense_Mutation_p.I25N	NM_001002258.4|NM_001689.4	NP_001002258.1|NP_001680.1	P48201	AT5G3_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)	25					ATP hydrolysis coupled proton transport (GO:0015991)|ATP synthesis coupled proton transport (GO:0015986)	integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|lipid binding (GO:0008289)|transporter activity (GO:0005215)			large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.147)			TGATGCAGAAATTGGTCTGTA	0.353																																					p.I25N	GBM(30;387 605 18606 28805 47989)	.											.	ATP5G3	91	0			c.T74A						.						111.0	110.0	110.0					2																	176044872		2203	4300	6503	SO:0001583	missense	518	exon3			GCAGAAATTGGTC	BC106881	CCDS2263.1	2q31.1	2012-10-12	2010-06-11		ENSG00000154518	ENSG00000154518		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	843	protein-coding gene	gene with protein product		602736	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9) isoform 3"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9)"""			7698763	Standard	NM_001002258		Approved		uc002ujz.4	P48201	OTTHUMG00000132425	ENST00000284727.4:c.74T>A	2.37:g.176044872A>T	ENSP00000284727:p.Ile25Asn	Somatic	62.0	1.0		WXS	Illumina HiSeq	Phase_I	92.0	35.0	NM_001190329	B2R4Z0|D3DPF0|Q4ZFX7	Missense_Mutation	SNP	ENST00000284727.4	37	CCDS2263.1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852862	0.71719	.	.	ENSG00000154518	ENST00000284727;ENST00000409194;ENST00000392541	T;T;T	0.25250	1.81;1.81;1.81	6.17	6.17	0.99709	.	0.241149	0.42964	D	0.000628	T	0.30417	0.0764	L	0.59436	1.845	0.51482	D	0.99992	B	0.09022	0.002	B	0.09377	0.004	T	0.02519	-1.1147	10	0.54805	T	0.06	-1.4242	16.8222	0.85835	1.0:0.0:0.0:0.0	.	25	P48201	AT5G3_HUMAN	N	25	ENSP00000284727:I25N;ENSP00000387317:I25N;ENSP00000376324:I25N	ENSP00000284727:I25N	I	-	2	0	ATP5G3	175753118	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.730000	0.91510	2.371000	0.80710	0.533000	0.62120	ATT	.		0.353	ATP5G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255563.1	NM_001689	
BCDIN3D	144233	ucsc.edu;bcgsc.ca	37	12	50232284	50232284	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr12:50232284A>G	ENST00000333924.4	-	2	790	c.749T>C	c.(748-750)tTt>tCt	p.F250S	BCDIN3D-AS1_ENST00000549124.1_RNA|BCDIN3D-AS1_ENST00000548872.1_RNA	NM_181708.2	NP_859059.1	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	250	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				miRNA metabolic process (GO:0010586)|negative regulation of pre-miRNA processing (GO:2000632)|RNA methylation (GO:0001510)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	O-methyltransferase activity (GO:0008171)|RNA methyltransferase activity (GO:0008173)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)	9						GGTGTTGCCAAAGCAACATAT	0.458																																					p.F250S		.											.	BCDIN3D	69	0			c.T749C						.						137.0	131.0	133.0					12																	50232284		2203	4300	6503	SO:0001583	missense	144233	exon2			TTGCCAAAGCAAC		CCDS8790.1	12q13.13	2008-03-12				ENSG00000186666			27050	protein-coding gene	gene with protein product							Standard	NM_181708		Approved		uc001rvh.3	Q7Z5W3	OTTHUMG00000169807	ENST00000333924.4:c.749T>C	12.37:g.50232284A>G	ENSP00000335201:p.Phe250Ser	Somatic	36.0	0.0		WXS	Illumina HiSeq	.	48.0	4.0	NM_181708	A8K829	Missense_Mutation	SNP	ENST00000333924.4	37	CCDS8790.1	.	.	.	.	.	.	.	.	.	.	A	16.03	3.006278	0.54361	.	.	ENSG00000186666	ENST00000333924	T	0.44482	0.92	5.44	5.44	0.79542	Bin3-type S-adenosyl-L-methionine binding domain (1);	0.000000	0.85682	D	0.000000	T	0.51618	0.1685	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.40905	-0.9538	10	0.20519	T	0.43	.	13.7318	0.62792	1.0:0.0:0.0:0.0	.	250	Q7Z5W3	BN3D2_HUMAN	S	250	ENSP00000335201:F250S	ENSP00000335201:F250S	F	-	2	0	BCDIN3D	48518551	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.186000	0.94906	2.193000	0.70182	0.402000	0.26972	TTT	.		0.458	BCDIN3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405982.1	NM_181708	
PRR27	401137	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	71024317	71024318	+	Frame_Shift_Ins	INS	-	-	T	rs148239542		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr4:71024317_71024318insT	ENST00000344526.5	+	3	537_538	c.348_349insT	c.(349-351)tttfs	p.F117fs	C4orf40_ENST00000502294.1_Frame_Shift_Ins_p.F117fs|C4orf40_ENST00000502441.2_3'UTR	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		117	Ala/Pro-rich.					extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						CTCCTTCAAGGTTTTTTTCAGC	0.55																																					p.R116fs		.											.	C4orf40	68	0			c.348_349insT						.																																			SO:0001589	frameshift_variant	401137	exon3			TTCAAGGTTTTTT																												ENST00000344526.5:c.355dupT	4.37:g.71024324_71024324dupT	ENSP00000343172:p.Phe117fs	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	108.0	28.0	NM_214711	A8MXP0|Q6MZR6	Frame_Shift_Ins	INS	ENST00000344526.5	37	CCDS3535.1																																																																																			.		0.550	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251558.1		
CAB39	51719	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	231624746	231624746	+	Silent	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr2:231624746A>G	ENST00000258418.5	+	2	459	c.30A>G	c.(28-30)aaA>aaG	p.K10K	CAB39_ENST00000410084.3_Silent_p.K10K|CAB39_ENST00000409788.3_Silent_p.K10K	NM_016289.3	NP_057373.1	Q9Y376	CAB39_HUMAN	calcium binding protein 39	10					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cellular hypotonic response (GO:0071476)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein heterooligomerization (GO:0051291)|signal transduction by phosphorylation (GO:0023014)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activator activity (GO:0043539)			central_nervous_system(1)|large_intestine(1)|skin(1)	3		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		AGTCTCACAAATCTCCAGCAG	0.498																																					p.K10K		.											.	CAB39	226	0			c.A30G						.						89.0	92.0	91.0					2																	231624746		2203	4300	6503	SO:0001819	synonymous_variant	51719	exon2			TCACAAATCTCCA	AF113536	CCDS2478.1	2q37.1	2008-02-05			ENSG00000135932	ENSG00000135932			20292	protein-coding gene	gene with protein product		612174					Standard	NM_016289		Approved	CGI-66, MO25	uc002vqx.3	Q9Y376	OTTHUMG00000133220	ENST00000258418.5:c.30A>G	2.37:g.231624746A>G		Somatic	100.0	0.0		WXS	Illumina HiSeq	Phase_I	267.0	114.0	NM_001130849	A8K8L7	Silent	SNP	ENST00000258418.5	37	CCDS2478.1																																																																																			.		0.498	CAB39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256955.2	NM_016289	
CACNA1B	774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	140880982	140880982	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr9:140880982G>T	ENST00000371372.1	+	14	2032	c.1887G>T	c.(1885-1887)caG>caT	p.Q629H	CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000277551.2_Missense_Mutation_p.Q629H|CACNA1B_ENST00000371355.4_Missense_Mutation_p.Q630H|CACNA1B_ENST00000371357.1_Missense_Mutation_p.Q630H|CACNA1B_ENST00000371363.1_Missense_Mutation_p.Q629H	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	629					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGGGATGCAGCTGTTTGGGG	0.612																																					p.Q629H		.											.	CACNA1B	138	0			c.G1887T						.						47.0	49.0	49.0					9																	140880982		2080	4229	6309	SO:0001583	missense	774	exon14			GATGCAGCTGTTT	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1887G>T	9.37:g.140880982G>T	ENSP00000360423:p.Gln629His	Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	298.0	110.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.221756	0.58560	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D	0.98996	-5.31;-5.31;-5.31;-5.31;-5.31	4.35	3.44	0.39384	.	0.000000	0.85682	D	0.000000	D	0.99205	0.9724	M	0.85710	2.77	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	D	0.99486	1.0949	10	0.87932	D	0	.	12.7997	0.57578	0.0816:0.0:0.9184:0.0	.	629;629	B1AQK4;B1AQK6	.;.	H	629;629;629;630;630	ENSP00000360423:Q629H;ENSP00000277551:Q629H;ENSP00000360414:Q629H;ENSP00000360408:Q630H;ENSP00000360406:Q630H	ENSP00000277551:Q629H	Q	+	3	2	CACNA1B	140000803	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.487000	0.60293	0.913000	0.36797	0.462000	0.41574	CAG	.		0.612	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
CCDC146	57639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	76909777	76909777	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr7:76909777A>G	ENST00000285871.4	+	14	1853	c.1726A>G	c.(1726-1728)Aac>Gac	p.N576D	CCDC146_ENST00000431197.1_Missense_Mutation_p.N290D|CCDC146_ENST00000415740.2_3'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	576										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				GAAACACGCCAACAATGTTAC	0.323																																					p.N576D		.											.	CCDC146	70	0			c.A1726G						.						49.0	43.0	45.0					7																	76909777		2203	4300	6503	SO:0001583	missense	57639	exon14			CACGCCAACAATG	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.1726A>G	7.37:g.76909777A>G	ENSP00000285871:p.Asn576Asp	Somatic	92.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	50.0	NM_020879	A8K8X6|Q9P223	Missense_Mutation	SNP	ENST00000285871.4	37	CCDS34671.1	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825269	0.71143	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	T;T	0.29655	1.56;1.56	6.17	6.17	0.99709	.	0.043557	0.85682	D	0.000000	T	0.50871	0.1641	M	0.61703	1.905	0.48632	D	0.999688	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.982	T	0.40459	-0.9562	10	0.13108	T	0.6	-22.5428	16.4837	0.84171	1.0:0.0:0.0:0.0	.	290;576	Q8IYE0-2;Q8IYE0	.;CC146_HUMAN	D	576;290	ENSP00000285871:N576D;ENSP00000413885:N290D	ENSP00000285871:N576D	N	+	1	0	AC007000.1	76747713	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.619000	0.61218	2.371000	0.80710	0.533000	0.62120	AAC	.		0.323	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
CES4A	283848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67038121	67038121	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:67038121G>T	ENST00000326686.5	+	9	1074	c.1074G>T	c.(1072-1074)ttG>ttT	p.L358F	CES4A_ENST00000540947.2_Missense_Mutation_p.L358F|CES4A_ENST00000541479.1_Missense_Mutation_p.L381F|CES4A_ENST00000338718.4_Missense_Mutation_p.L381F|CES4A_ENST00000398354.1_Missense_Mutation_p.L358F|CES4A_ENST00000535696.1_Missense_Mutation_p.L264F|CES4A_ENST00000540579.1_Missense_Mutation_p.L260F			Q5XG92	EST4A_HUMAN	carboxylesterase 4A	358						extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)			large_intestine(2)|liver(2)|lung(4)|ovary(1)	9						ATTGGCTCTTGCCTTATGTAA	0.517																																					p.L358F		.											.	CES4A	91	0			c.G1074T						.						149.0	141.0	144.0					16																	67038121		1981	4172	6153	SO:0001583	missense	283848	exon9			GCTCTTGCCTTAT	AK094783	CCDS42174.1, CCDS42174.2, CCDS54024.1, CCDS54025.1, CCDS42174.3	16q22.1	2011-10-25	2010-10-12	2010-10-12	ENSG00000172824	ENSG00000172824		"""Carboxylesterases"""	26741	protein-coding gene	gene with protein product			"""carboxylesterase 8 (putative)"""	CES8		12975309, 17364878, 20931200	Standard	NM_001190201		Approved	FLJ37464	uc010vix.2	Q5XG92		ENST00000326686.5:c.1074G>T	16.37:g.67038121G>T	ENSP00000314145:p.Leu358Phe	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	210.0	76.0	NM_173815	A8KAJ6|B7Z349|B7Z3L2|B7Z6R3|Q6UX55|Q8N9F4	Missense_Mutation	SNP	ENST00000326686.5	37		.	.	.	.	.	.	.	.	.	.	g	7.020	0.558476	0.13436	.	.	ENSG00000172824	ENST00000540947;ENST00000541479;ENST00000338718;ENST00000398354;ENST00000326686;ENST00000538199;ENST00000540579;ENST00000535696	T;T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	4.63	1.3	0.21679	Carboxylesterase, type B (1);	0.000000	0.35772	N	0.002995	T	0.69251	0.3090	L	0.56199	1.76	0.51767	D	0.999931	B;D;B;B	0.59767	0.026;0.986;0.0;0.001	B;P;B;B	0.59221	0.018;0.854;0.021;0.01	T	0.67684	-0.5607	10	0.87932	D	0	.	6.5077	0.22204	0.205:0.1878:0.6072:0.0	.	264;381;358;381	Q5XG92-7;F8WEE9;Q5XG92;F5H5S4	.;.;EST4A_HUMAN;.	F	358;381;381;358;358;321;260;264	ENSP00000444052:L358F;ENSP00000443175:L381F;ENSP00000340714:L381F;ENSP00000381397:L358F;ENSP00000314145:L358F;ENSP00000441103:L321F;ENSP00000441907:L260F;ENSP00000441644:L264F	ENSP00000314145:L358F	L	+	3	2	CES4A	65595622	0.910000	0.30920	0.908000	0.35775	0.142000	0.21351	-0.083000	0.11286	0.372000	0.24591	0.486000	0.48141	TTG	.		0.517	CES4A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173815	
CLSTN1	22883	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	9795606	9795606	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:9795606G>T	ENST00000377298.4	-	13	2594	c.1802C>A	c.(1801-1803)gCc>gAc	p.A601D	CLSTN1_ENST00000361311.4_Missense_Mutation_p.A591D|CLSTN1_ENST00000477264.1_5'Flank|CLSTN1_ENST00000377288.3_Missense_Mutation_p.A582D	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	601					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		GTGCTGCATGGCCTTATCCAA	0.517																																					p.A601D		.											.	CLSTN1	523	0			c.C1802A						.						164.0	154.0	157.0					1																	9795606		2203	4300	6503	SO:0001583	missense	22883	exon13			TGCATGGCCTTAT	AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.1802C>A	1.37:g.9795606G>T	ENSP00000366513:p.Ala601Asp	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	92.0	NM_001009566	A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Missense_Mutation	SNP	ENST00000377298.4	37	CCDS30580.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354559	0.61293	.	.	ENSG00000171603	ENST00000377298;ENST00000361311;ENST00000435891;ENST00000377288;ENST00000539822	T;T;T;T	0.36520	1.25;1.25;1.25;1.25	5.91	5.91	0.95273	.	0.053126	0.85682	D	0.000000	T	0.63780	0.2540	M	0.78049	2.395	0.58432	D	0.999996	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.68943	0.914;0.961;0.914	T	0.64748	-0.6334	10	0.66056	D	0.02	-49.4122	20.2985	0.98592	0.0:0.0:1.0:0.0	.	582;591;601	B4E3Q1;O94985-2;O94985	.;.;CSTN1_HUMAN	D	601;591;402;582;582	ENSP00000366513:A601D;ENSP00000354997:A591D;ENSP00000401934:A402D;ENSP00000366502:A582D	ENSP00000354997:A591D	A	-	2	0	CLSTN1	9718193	1.000000	0.71417	0.994000	0.49952	0.089000	0.18198	4.609000	0.61148	2.793000	0.96121	0.655000	0.94253	GCC	.		0.517	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004239.1		
CHRM3	1131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	240071370	240071370	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:240071370T>A	ENST00000255380.4	+	5	1398	c.619T>A	c.(619-621)Tgg>Agg	p.W207R		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	207					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CATCTTGTTCTGGCAATACTT	0.517																																					p.W207R		.											.	CHRM3	95	0			c.T619A						.						186.0	191.0	189.0					1																	240071370		2203	4300	6503	SO:0001583	missense	1131	exon5			TTGTTCTGGCAAT	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.619T>A	1.37:g.240071370T>A	ENSP00000255380:p.Trp207Arg	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	571.0	353.0	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	37	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	T	19.79	3.892572	0.72524	.	.	ENSG00000133019	ENST00000255380	T	0.37915	1.17	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.61776	0.2374	M	0.73753	2.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65853	-0.6067	10	0.87932	D	0	-8.7528	16.1388	0.81509	0.0:0.0:0.0:1.0	.	207	P20309	ACM3_HUMAN	R	207	ENSP00000255380:W207R	ENSP00000255380:W207R	W	+	1	0	CHRM3	238137993	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.205000	0.71048	0.528000	0.53228	TGG	.		0.517	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
CNKSR2	22866	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	21545015	21545015	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chrX:21545015G>A	ENST00000379510.3	+	10	1024	c.988G>A	c.(988-990)Gtt>Att	p.V330I	CNKSR2_ENST00000543067.1_Missense_Mutation_p.V281I|CNKSR2_ENST00000279451.4_Missense_Mutation_p.V330I|CNKSR2_ENST00000425654.2_Missense_Mutation_p.V330I	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	330					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CACAAGCAGCGTTGCCACGCC	0.453													G|||	1	0.000264901	0.0	0.0	3775	,	,		7043	0.0		0.0	False		,,,				2504	0.001				p.V330I		.											.	CNKSR2	625	0			c.G988A						.						222.0	211.0	215.0					X																	21545015		2203	4300	6503	SO:0001583	missense	22866	exon10			AGCAGCGTTGCCA	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.988G>A	X.37:g.21545015G>A	ENSP00000368824:p.Val330Ile	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	177.0	163.0	NM_001168647	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	ENST00000379510.3	37	CCDS14198.1	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384359	0.42308	.	.	ENSG00000149970	ENST00000425654;ENST00000543067;ENST00000279451;ENST00000379510	T;T;T;T	0.18502	2.5;2.25;2.21;2.48	5.58	4.66	0.58398	.	0.196899	0.43416	D	0.000563	T	0.06826	0.0174	N	0.02011	-0.69	0.24045	N	0.996062	B;B;B	0.20988	0.029;0.05;0.007	B;B;B	0.12156	0.007;0.003;0.002	T	0.29852	-0.9998	10	0.17832	T	0.49	-9.6134	14.3431	0.66641	0.0:0.0:0.8514:0.1485	.	330;281;330	B7ZLJ1;B4DGR4;Q8WXI2	.;.;CNKR2_HUMAN	I	330;281;330;330	ENSP00000397906:V330I;ENSP00000444633:V281I;ENSP00000279451:V330I;ENSP00000368824:V330I	ENSP00000279451:V330I	V	+	1	0	CNKSR2	21454936	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.870000	0.63035	2.338000	0.79540	0.544000	0.68410	GTT	.		0.453	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
CNOT11	55571	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	101885756	101885756	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr2:101885756A>T	ENST00000289382.3	+	7	1577	c.1414A>T	c.(1414-1416)Ata>Tta	p.I472L	RNF149_ENST00000485752.1_5'Flank	NM_017546.4	NP_060016.3	Q9UKZ1	CNO11_HUMAN	CCR4-NOT transcription complex, subunit 11	472					cell proliferation (GO:0008283)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|nucleus (GO:0005634)											GGATTTGTTTATAGAAGTGCA	0.383																																					p.I472L		.											.	.	.	0			c.A1414T						.						87.0	90.0	89.0					2																	101885756		2203	4300	6503	SO:0001583	missense	55571	exon7			TTGTTTATAGAAG	AF103798	CCDS2050.1	2q12.1	2013-01-24	2013-01-24	2013-01-24	ENSG00000158435	ENSG00000158435			25217	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 29"""	C2orf29		10497265, 23232451, 23303381	Standard	NM_017546		Approved	C40	uc002taw.4	Q9UKZ1	OTTHUMG00000130686	ENST00000289382.3:c.1414A>T	2.37:g.101885756A>T	ENSP00000289382:p.Ile472Leu	Somatic	94.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	74.0	NM_017546	Q6P2M9|Q8N681	Missense_Mutation	SNP	ENST00000289382.3	37	CCDS2050.1	.	.	.	.	.	.	.	.	.	.	A	34	5.383985	0.95967	.	.	ENSG00000158435	ENST00000289382	.	.	.	5.96	5.96	0.96718	.	0.087263	0.85682	D	0.000000	D	0.84234	0.5427	M	0.88310	2.945	0.80722	D	1	D	0.67145	0.996	D	0.68353	0.957	D	0.87008	0.2121	9	0.66056	D	0.02	-26.6738	16.4484	0.83959	1.0:0.0:0.0:0.0	.	472	Q9UKZ1	CB029_HUMAN	L	472	.	ENSP00000289382:I472L	I	+	1	0	C2orf29	101252188	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.210000	0.95106	2.285000	0.76669	0.533000	0.62120	ATA	.		0.383	CNOT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253181.1	NM_017546	
COG3	83548	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	46077408	46077408	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr13:46077408delG	ENST00000349995.5	+	14	1630	c.1518delG	c.(1516-1518)cagfs	p.Q506fs	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	506					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		AAGATGAACAGAAGAAGGTAC	0.373																																					p.Q506fs	Ovarian(150;1048 1859 18083 21577 42700)	.											.	COG3	154	0			c.1518delG						.						108.0	105.0	106.0					13																	46077408		2203	4300	6503	SO:0001589	frameshift_variant	83548	exon14			TGAACAGAAGAAG	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1518delG	13.37:g.46077408delG	ENSP00000258654:p.Gln506fs	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	16.0	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Frame_Shift_Del	DEL	ENST00000349995.5	37	CCDS9398.1																																																																																			.		0.373	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
COL12A1	1303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	75884785	75884785	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr6:75884785G>T	ENST00000322507.8	-	13	2988	c.2679C>A	c.(2677-2679)gaC>gaA	p.D893E	COL12A1_ENST00000416123.2_Missense_Mutation_p.D893E|COL12A1_ENST00000483888.2_Missense_Mutation_p.D893E|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	893	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CAAAGAGGGCGTCTCCAGCCC	0.468																																					p.D893E		.											.	COL12A1	142	0			c.C2679A						.						190.0	186.0	187.0					6																	75884785		1983	4159	6142	SO:0001583	missense	1303	exon13			GAGGGCGTCTCCA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2679C>A	6.37:g.75884785G>T	ENSP00000325146:p.Asp893Glu	Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	68.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.482005	0.01027	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.51817	0.69;0.69;0.69	5.94	-8.61	0.00885	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.463941	0.21967	N	0.066519	T	0.02304	0.0071	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.32771	-0.9894	10	0.05436	T	0.98	.	0.6516	0.00828	0.2097:0.1677:0.2157:0.4069	.	893	Q99715	COCA1_HUMAN	E	893	ENSP00000325146:D893E;ENSP00000412864:D893E;ENSP00000421216:D893E	ENSP00000325146:D893E	D	-	3	2	COL12A1	75941505	0.000000	0.05858	0.397000	0.26308	0.387000	0.30353	-3.514000	0.00445	-1.602000	0.01599	-2.049000	0.00408	GAC	.		0.468	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
COL15A1	1306	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	101749575	101749575	+	Splice_Site	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr9:101749575G>A	ENST00000375001.3	+	4	1071		c.e4-1			NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CTTTTCCCCAGGGCTCCCTCC	0.567																																					.		.											.	COL15A1	96	0			c.649-1G>A						.						185.0	169.0	174.0					9																	101749575		2203	4300	6503	SO:0001630	splice_region_variant	1306	exon4			TCCCCAGGGCTCC	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.649-1G>A	9.37:g.101749575G>A		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	27.0	NM_001855	Q5T6J4|Q9UDC5|Q9Y4W4	Splice_Site	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403198	0.83230	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3894	0.66968	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL15A1	100789396	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.435000	0.80391	2.524000	0.85096	0.655000	0.94253	.	.		0.567	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053386.3	NM_001855	Intron
COL6A5	256076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	130113755	130113755	+	Silent	SNP	C	C	T	rs541531354		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:130113755C>T	ENST00000432398.2	+	8	3509	c.3015C>T	c.(3013-3015)gaC>gaT	p.D1005D	COL6A5_ENST00000265379.6_Silent_p.D1005D	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1005	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AGGAAGCTGACGTGATTTTCC	0.333																																					p.D1005D		.											.	.	.	0			c.C3015T						.						72.0	58.0	62.0					3																	130113755		692	1591	2283	SO:0001819	synonymous_variant	256076	exon8			AGCTGACGTGATT	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.3015C>T	3.37:g.130113755C>T		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	47.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	ENST00000432398.2	37																																																																																				.		0.333	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CPA6	57094	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	68419048	68419048	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr8:68419048C>T	ENST00000297770.4	-	6	825	c.610G>A	c.(610-612)Gcc>Acc	p.A204T	CPA6_ENST00000518549.1_Missense_Mutation_p.A204T|CPA6_ENST00000297769.4_Missense_Mutation_p.A56T	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	204						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			TGACAAAAGGCAGGACCAATC	0.403																																					p.A204T		.											.	CPA6	92	0			c.G610A						.						169.0	147.0	155.0					8																	68419048		2203	4300	6503	SO:0001583	missense	57094	exon6			AAAAGGCAGGACC	AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.610G>A	8.37:g.68419048C>T	ENSP00000297770:p.Ala204Thr	Somatic	80.0	1.0		WXS	Illumina HiSeq	Phase_I	158.0	60.0	NM_020361	Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	ENST00000297770.4	37	CCDS6200.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.997508	0.93227	.	.	ENSG00000165078	ENST00000297769;ENST00000297770;ENST00000518549	T;T;T	0.12255	2.7;2.7;2.7	5.31	4.42	0.53409	Peptidase M14, carboxypeptidase A (2);	0.053610	0.85682	N	0.000000	T	0.29914	0.0748	M	0.85542	2.76	0.58432	D	0.999998	P;P;P	0.41450	0.573;0.75;0.686	B;B;P	0.47134	0.247;0.168;0.539	T	0.12993	-1.0526	10	0.72032	D	0.01	.	13.1672	0.59577	0.0:0.9204:0.0:0.0796	.	204;56;204	Q8N4T0-2;Q8N4T0-3;Q8N4T0	.;.;CBPA6_HUMAN	T	56;204;204	ENSP00000297769:A56T;ENSP00000297770:A204T;ENSP00000431112:A204T	ENSP00000297769:A56T	A	-	1	0	CPA6	68581602	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.959000	0.63666	1.206000	0.43276	0.655000	0.94253	GCC	.		0.403	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379296.2	NM_020361	
CREBBP	1387	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3778620	3778620	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:3778620T>C	ENST00000262367.5	-	31	7237	c.6428A>G	c.(6427-6429)aAt>aGt	p.N2143S	CREBBP_ENST00000382070.3_Missense_Mutation_p.N2105S	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2143					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CTGCATGGCATTCAGGTTCTG	0.682			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																														p.N2143S		.		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	.	CREBBP	1807	0			c.A6428G						.						56.0	60.0	58.0					16																	3778620		2197	4298	6495	SO:0001583	missense	1387	exon31			ATGGCATTCAGGT	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6428A>G	16.37:g.3778620T>C	ENSP00000262367:p.Asn2143Ser	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	63.0	18.0	NM_004380	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	ENST00000262367.5	37	CCDS10509.1	.	.	.	.	.	.	.	.	.	.	t	4.459	0.084939	0.08583	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.83163	-1.69;-1.58	5.11	3.99	0.46301	.	0.195425	0.44483	N	0.000447	T	0.60117	0.2244	N	0.08118	0	0.33369	D	0.573358	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.57894	-0.7732	10	0.10111	T	0.7	-9.9425	5.7003	0.17879	0.0:0.2769:0.0:0.7231	.	2173;2143	Q4LE28;Q92793	.;CBP_HUMAN	S	2143;2173;2105;678	ENSP00000262367:N2143S;ENSP00000371502:N2105S	ENSP00000262367:N2143S	N	-	2	0	CREBBP	3718621	0.098000	0.21812	0.904000	0.35570	0.512000	0.34134	1.013000	0.29937	1.934000	0.56057	0.533000	0.62120	AAT	.		0.682	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251591.2	NM_004380	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	41266093	41266107	+	In_Frame_Del	DEL	CCTGGACTCTGGAAT	CCTGGACTCTGGAAT	-	rs28931589|rs121913396|rs121913416|rs121913417|rs121913399|rs121913400|rs28931588		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	CCTGGACTCTGGAAT	CCTGGACTCTGGAAT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:41266093_41266107delCCTGGACTCTGGAAT	ENST00000349496.5	+	3	370_384	c.90_104delCCTGGACTCTGGAAT	c.(88-105)tacctggactctggaatc>tac	p.LDSGI31del	CTNNB1_ENST00000396183.3_In_Frame_Del_p.LDSGI31del|CTNNB1_ENST00000405570.1_In_Frame_Del_p.LDSGI31del|CTNNB1_ENST00000396185.3_In_Frame_Del_p.LDSGI31del|CTNNB1_ENST00000453024.1_In_Frame_Del_p.LDSGI24del	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	31			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.D32Y(128)|p.S33F(97)|p.G34R(87)|p.D32N(82)|p.G34E(73)|p.G34V(72)|p.D32G(65)|p.S33Y(60)|p.A5_A80del(53)|p.S33P(47)|p.D32H(40)|p.D32V(33)|p.I35S(20)|p.S33A(16)|p.D32A(16)|p.I35T(13)|p.A5_A80>D(7)|p.A5_Q143del(7)|p.WQQQSYLD25?(5)|p.Q28_H134del(5)|p.S33L(4)|p.W25_D32del(4)|p.L31L(4)|p.?(4)|p.W25_I140del(3)|p.V22_G38del(3)|p.T3_A126del(2)|p.S33N(2)|p.M5_N141>D(2)|p.D32_S47del(2)|p.Y30_S33del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5_Y142>D(2)|p.A5fs*7(2)|p.D32E(2)|p.Y30*(2)|p.L10_N141del(2)|p.Q28_Q61del(1)|p.S33T(1)|p.S33S(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.H24_L31del(1)|p.Y30_A97del(1)|p.A20_A80del(1)|p.Q28_A43del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.W25_I35del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.A13_R151del(1)|p.D32del(1)|p.M1_A87del(1)|p.I35_T41del(1)|p.I35K(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.S23_A39del(1)|p.A21_A80del(1)|p.I35_S37>T(1)|p.I35_K170del(1)|p.M14_S45del(1)|p.D32_H36>D(1)|p.S33_G34insGTS(1)|p.P16_K133del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.M8_A80del(1)|p.S33_S37del(1)|p.D32_S33insS(1)|p.Y30_T40del(1)|p.S33_G34insGI(1)|p.A5_Q143>E(1)|p.I35_G38del(1)|p.L31M(1)|p.Q28_D32>H(1)|p.L31Q(1)|p.Y30_A80del(1)|p.L31W(1)|p.D32fs*9(1)|p.Y30Y(1)|p.Q28fs*20(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S23_I35del(1)|p.V22_S71>A(1)|p.V22_Y64del(1)|p.I35N(1)|p.A20_S111del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		AACAGTCTTACCTGGACTCTGGAATCCATTCTGGT	0.484	D32N(KE39_STOMACH)|D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)|G34E(AGS_STOMACH)|S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.30_35del	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1	CTNNB1	24361	1197	Substitution - Missense(1031)|Deletion - In frame(126)|Complex - deletion inframe(18)|Unknown(7)|Substitution - coding silent(6)|Insertion - In frame(3)|Deletion - Frameshift(3)|Substitution - Nonsense(2)|Complex - frameshift(1)	liver(384)|central_nervous_system(201)|endometrium(138)|stomach(88)|pancreas(86)|pituitary(59)|large_intestine(58)|skin(44)|ovary(41)|soft_tissue(14)|lung(12)|salivary_gland(12)|prostate(11)|biliary_tract(9)|bone(9)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|NS(4)|breast(4)|adrenal_gland(4)|urinary_tract(3)|parathyroid(2)|small_intestine(2)|thyroid(1)|cervix(1)	c.90_104del						.																																			SO:0001651	inframe_deletion	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GTCTTACCTGGAC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.90_104delCCTGGACTCTGGAAT	3.37:g.41266093_41266107delCCTGGACTCTGGAAT	ENSP00000344456:p.Leu31_Ile35del	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	23.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	In_Frame_Del	DEL	ENST00000349496.5	37	CCDS2694.1																																																																																			.		0.484	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DAAM1	23002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	59820665	59820665	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:59820665T>A	ENST00000395125.1	+	19	2392	c.2369T>A	c.(2368-2370)gTg>gAg	p.V790E	DAAM1_ENST00000553966.1_Intron|DAAM1_ENST00000360909.3_Missense_Mutation_p.V780E|DAAM1_ENST00000351081.1_Missense_Mutation_p.V790E	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	790	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		GTGGCAGAAGTGAAACCTAAA	0.363																																					p.V790E		.											.	DAAM1	227	0			c.T2369A						.						98.0	87.0	91.0					14																	59820665		2203	4300	6503	SO:0001583	missense	23002	exon19			CAGAAGTGAAACC	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.2369T>A	14.37:g.59820665T>A	ENSP00000378557:p.Val790Glu	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	46.0	NM_014992	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	t	22.9	4.347348	0.82022	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000395125	T;T;T	0.19532	2.14;2.14;2.14	6.03	6.03	0.97812	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.050329	0.85682	D	0.000000	T	0.49949	0.1587	M	0.81802	2.56	0.58432	D	0.999995	D;D	0.69078	0.994;0.997	D;D	0.70227	0.949;0.968	T	0.54166	-0.8334	10	0.87932	D	0	.	16.5808	0.84714	0.0:0.0:0.0:1.0	.	780;790	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	E	780;790;790	ENSP00000354162:V780E;ENSP00000247170:V790E;ENSP00000378557:V790E	ENSP00000247170:V790E	V	+	2	0	DAAM1	58890418	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.183000	0.72002	2.317000	0.78254	0.524000	0.50904	GTG	.		0.363	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
DAZL	1618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	16639045	16639045	+	Silent	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:16639045A>G	ENST00000399444.2	-	4	539	c.246T>C	c.(244-246)taT>taC	p.Y82Y	DAZL_ENST00000250863.8_Silent_p.Y102Y	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	82	Homodimerization. {ECO:0000250}.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						AAACAAATCCATAGCTATAAA	0.289																																					p.Y102Y		.											.	DAZL	90	0			c.T306C						.						215.0	175.0	187.0					3																	16639045		1829	4082	5911	SO:0001819	synonymous_variant	1618	exon4			AAATCCATAGCTA	BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.246T>C	3.37:g.16639045A>G		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	198.0	68.0	NM_001190811	O15396|Q5HYB4|Q92909	Silent	SNP	ENST00000399444.2	37	CCDS43059.1																																																																																			.		0.289	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347261.2	NM_001351	
DDX59	83479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200635118	200635118	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:200635118A>T	ENST00000331314.6	-	2	964	c.751T>A	c.(751-753)Tca>Aca	p.S251T	DDX59_ENST00000367348.3_Missense_Mutation_p.S251T|DDX59_ENST00000447706.2_Missense_Mutation_p.S251T	NM_001031725.4	NP_001026895.2	Q5T1V6	DDX59_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 59	251	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(1)|lung(9)|ovary(3)	21						GTTTTTCCTGAGCCAGTATCT	0.418																																					p.S251T		.											.	DDX59	155	0			c.T751A						.						90.0	90.0	90.0					1																	200635118		2203	4300	6503	SO:0001583	missense	83479	exon2			TTCCTGAGCCAGT	BC041801	CCDS30964.1	1q32.1	2010-07-14			ENSG00000118197	ENSG00000118197		"""Zinc fingers, HIT-type"", ""DEAD-boxes"""	25360	protein-coding gene	gene with protein product		615464					Standard	NM_001031725		Approved	DKFZP564B1023, ZNHIT5	uc009wzk.3	Q5T1V6	OTTHUMG00000035725	ENST00000331314.6:c.751T>A	1.37:g.200635118A>T	ENSP00000330460:p.Ser251Thr	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	442.0	102.0	NM_001031725	Q6PJL2|Q8IVW3|Q9H0W3	Missense_Mutation	SNP	ENST00000331314.6	37	CCDS30964.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.724387	0.89298	.	.	ENSG00000118197	ENST00000447706;ENST00000367348;ENST00000331314	T;T;T	0.51574	0.7;0.7;0.7	5.33	5.33	0.75918	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56217	0.1970	L	0.27944	0.81	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.71656	0.974;0.974	T	0.61491	-0.7052	10	0.87932	D	0	-18.7333	15.3466	0.74343	1.0:0.0:0.0:0.0	.	251;251	B7Z5N6;Q5T1V6	.;DDX59_HUMAN	T	251	ENSP00000394367:S251T;ENSP00000356317:S251T;ENSP00000330460:S251T	ENSP00000330460:S251T	S	-	1	0	DDX59	198901741	1.000000	0.71417	0.990000	0.47175	0.976000	0.68499	9.320000	0.96346	2.021000	0.59480	0.529000	0.55759	TCA	.		0.418	DDX59-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086883.2	NM_001031725.4	
DGKZ	8525	ucsc.edu;bcgsc.ca	37	11	46397126	46397126	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr11:46397126C>A	ENST00000454345.1	+	21	2544	c.2419C>A	c.(2419-2421)Cag>Aag	p.Q807K	DGKZ_ENST00000343674.6_Missense_Mutation_p.Q635K|MIR4688_ENST00000577966.1_RNA|DGKZ_ENST00000532868.2_Missense_Mutation_p.Q623K|DGKZ_ENST00000395574.3_Missense_Mutation_p.Q585K|DGKZ_ENST00000528615.1_Missense_Mutation_p.Q397K|DGKZ_ENST00000318201.8_Missense_Mutation_p.Q596K|DGKZ_ENST00000543978.1_Intron|DGKZ_ENST00000421244.2_Missense_Mutation_p.Q619K|DGKZ_ENST00000456247.2_Missense_Mutation_p.Q618K|DGKZ_ENST00000527911.1_Missense_Mutation_p.Q619K	NM_001105540.1	NP_001099010.1	Q13574	DGKZ_HUMAN	diacylglycerol kinase, zeta	807					blood coagulation (GO:0007596)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of Ras protein signal transduction (GO:0046580)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|enzyme inhibitor activity (GO:0004857)|lipid kinase activity (GO:0001727)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein C-terminus binding (GO:0008022)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(12)|pancreas(1)|prostate(1)|skin(1)	25				GBM - Glioblastoma multiforme(35;0.0259)|Lung(87;0.141)		CCTGCGCAACCAGGCCACCAT	0.692																																					p.Q807K		.											.	DGKZ	676	0			c.C2419A						.						32.0	32.0	32.0					11																	46397126		2191	4294	6485	SO:0001583	missense	8525	exon21			CGCAACCAGGCCA	U51477	CCDS7918.1, CCDS41640.1, CCDS44579.1, CCDS44580.1, CCDS55757.1, CCDS55758.1, CCDS55759.1, CCDS44579.2	11p11.2	2010-11-24	2010-11-24		ENSG00000149091	ENSG00000149091	2.7.1.107		2857	protein-coding gene	gene with protein product		601441	"""diacylglycerol kinase, zeta 104kDa"""			8626588	Standard	NM_003646		Approved	DAGK5, hDGKzeta, DGK-ZETA, DAGK6	uc001ncn.1	Q13574	OTTHUMG00000166437	ENST00000454345.1:c.2419C>A	11.37:g.46397126C>A	ENSP00000412178:p.Gln807Lys	Somatic	28.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_001105540	B7Z2M9|B7Z6M3|E9PPW4|F6UCU9|G3V0F6|J3KNJ6|O00542|Q6ZVG7|Q8IVW9	Missense_Mutation	SNP	ENST00000454345.1	37	CCDS41640.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.285831	0.80803	.	.	ENSG00000149091	ENST00000343674;ENST00000528615;ENST00000395574;ENST00000532868;ENST00000527911;ENST00000456247;ENST00000421244;ENST00000318201;ENST00000454345	T;T;T;T;T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07;1.07	4.19	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.42877	0.1222	N	0.21324	0.655	0.80722	D	1	P;B;P;D;P;P;D;P;P	0.55172	0.719;0.41;0.949;0.97;0.772;0.858;0.966;0.942;0.876	B;B;P;P;B;B;P;P;B	0.56751	0.241;0.083;0.692;0.77;0.241;0.28;0.805;0.643;0.241	T	0.13953	-1.0490	10	0.14252	T	0.57	.	17.0913	0.86623	0.0:1.0:0.0:0.0	.	596;584;562;619;807;618;619;585;635	B7Z2M9;B7Z6M3;B7Z8F6;E9PPW4;Q13574;Q13574-2;G3V0F6;A8MVN1;Q6ZVG7	.;.;.;.;DGKZ_HUMAN;.;.;.;.	K	635;397;585;584;619;618;619;596;807	ENSP00000343065:Q635K;ENSP00000434719:Q397K;ENSP00000378941:Q585K;ENSP00000436273:Q584K;ENSP00000436291:Q619K;ENSP00000395684:Q618K;ENSP00000391021:Q619K;ENSP00000320340:Q596K;ENSP00000412178:Q807K	ENSP00000320340:Q596K	Q	+	1	0	DGKZ	46353702	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.565000	0.82337	2.350000	0.79820	0.462000	0.41574	CAG	.		0.692	DGKZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389772.1	NM_001105540	
DGAT2	84649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	75508294	75508294	+	Silent	SNP	T	T	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr11:75508294T>G	ENST00000228027.7	+	6	986	c.726T>G	c.(724-726)gcT>gcG	p.A242A	DGAT2_ENST00000376262.3_Silent_p.A199A	NM_032564.4	NP_115953.2	Q96PD7	DGAT2_HUMAN	diacylglycerol O-acyltransferase 2	242					acylglycerol acyl-chain remodeling (GO:0036155)|cellular lipid metabolic process (GO:0044255)|cellular response to oleic acid (GO:0071400)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|diacylglycerol metabolic process (GO:0046339)|fat pad development (GO:0060613)|fatty acid homeostasis (GO:0055089)|glycerol metabolic process (GO:0006071)|glycerophospholipid biosynthetic process (GO:0046474)|lipid storage (GO:0019915)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)|protein homodimerization activity (GO:0042803)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(5)|lung(5)|prostate(2)|skin(2)	17	Ovarian(111;0.103)					GGGGTGCGGCTGAGTCTCTGA	0.567																																					p.A242A	Melanoma(35;811 1096 8354 24009 39363)	.											.	DGAT2	226	0			c.T726G						.						145.0	125.0	132.0					11																	75508294		2200	4293	6493	SO:0001819	synonymous_variant	84649	exon6			TGCGGCTGAGTCT		CCDS31642.1, CCDS58162.1	11q13.3	2010-06-24	2010-06-24		ENSG00000062282	ENSG00000062282			16940	protein-coding gene	gene with protein product		606983	"""diacylglycerol O-acyltransferase homolog 2 (mouse)"""			11481335, 14970677	Standard	NM_032564		Approved		uc001oxa.3	Q96PD7	OTTHUMG00000165338	ENST00000228027.7:c.726T>G	11.37:g.75508294T>G		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	36.0	NM_032564	A6ND76|Q5U810|Q68CL3|Q68DJ0|Q8NDB7|Q96BS0|Q9BYE5	Silent	SNP	ENST00000228027.7	37	CCDS31642.1																																																																																			.		0.567	DGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383506.1	NM_032564	
DHRS4	10901	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	24435604	24435604	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:24435604T>G	ENST00000313250.5	+	6	847	c.644T>G	c.(643-645)aTc>aGc	p.I215S	DHRS4_ENST00000397075.3_Intron|DHRS4_ENST00000558263.1_Intron|DHRS4_ENST00000558581.1_Missense_Mutation_p.I181S|DHRS4_ENST00000421831.1_Missense_Mutation_p.I163S|DHRS4_ENST00000559632.1_Intron|DHRS4_ENST00000543741.2_Intron|DHRS4_ENST00000397073.2_Intron|DHRS4_ENST00000308178.8_Intron|DHRS4_ENST00000382761.3_Intron|DHRS4_ENST00000397074.3_Intron	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	215					alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)			central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CCTGGACTTATCAAGACTAGC	0.527																																					p.I215S		.											.	DHRS4	91	0			c.T644G						.						113.0	96.0	102.0					14																	24435604		2201	4297	6498	SO:0001583	missense	10901	exon6			GACTTATCAAGAC	AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.644T>G	14.37:g.24435604T>G	ENSP00000326219:p.Ile215Ser	Somatic	182.0	0.0		WXS	Illumina HiSeq	Phase_I	1264.0	258.0	NM_021004	B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Missense_Mutation	SNP	ENST00000313250.5	37	CCDS9605.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.988233	0.53934	.	.	ENSG00000157326	ENST00000313250;ENST00000421831	D;D	0.93307	-3.2;-3.2	3.53	3.53	0.40419	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96445	0.8840	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	0.997;1.0	P;D	0.97110	0.902;1.0	D	0.96377	0.9278	10	0.87932	D	0	.	10.3596	0.43984	0.0:0.0:0.0:1.0	.	181;215	Q9BTZ2-4;Q9BTZ2	.;DHRS4_HUMAN	S	215;163	ENSP00000326219:I215S;ENSP00000404147:I163S	ENSP00000326219:I215S	I	+	2	0	DHRS4	23505444	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.861000	0.75478	1.379000	0.46325	0.473000	0.43528	ATC	.		0.527	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071857.3		
DIP2C	22982	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	390969	390969	+	Missense_Mutation	SNP	C	C	A	rs200340134		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr10:390969C>A	ENST00000280886.6	-	27	3400	c.3313G>T	c.(3313-3315)Gtc>Ttc	p.V1105F		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1105						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CACGTCCTGACGTCCACAGCC	0.592																																					p.V1105F		.											.	DIP2C	156	0			c.G3313T						.						72.0	59.0	63.0					10																	390969		2203	4300	6503	SO:0001583	missense	22982	exon27			TCCTGACGTCCAC	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3313G>T	10.37:g.390969C>A	ENSP00000280886:p.Val1105Phe	Somatic	29.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	23.0	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	C	8.495	0.862866	0.17178	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.10668	2.85	5.59	4.69	0.59074	AMP-dependent synthetase/ligase (1);	0.188095	0.46145	D	0.000316	T	0.08670	0.0215	N	0.25380	0.74	0.80722	D	1	B	0.13594	0.008	B	0.28305	0.088	T	0.25572	-1.0128	10	0.23891	T	0.37	-31.7464	9.4456	0.38695	0.0:0.7807:0.0:0.2193	.	1105	Q9Y2E4	DIP2C_HUMAN	F	1105;30	ENSP00000280886:V1105F	ENSP00000280886:V1105F	V	-	1	0	DIP2C	380969	0.006000	0.16342	0.885000	0.34714	0.399000	0.30720	0.029000	0.13666	1.368000	0.46115	0.655000	0.94253	GTC	C|0.999;T|0.000		0.592	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
DKK2	27123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	107845310	107845310	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr4:107845310C>T	ENST00000285311.3	-	4	1286	c.581G>A	c.(580-582)tGc>tAc	p.C194Y	DKK2_ENST00000510463.1_Missense_Mutation_p.C148Y|DKK2_ENST00000513208.1_Missense_Mutation_p.C94Y	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	194	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.C194F(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		ACGAGCACAGCAAAACCCTTC	0.473																																					p.C194Y		.											.	DKK2	661	1	Substitution - Missense(1)	autonomic_ganglia(1)	c.G581A						.						118.0	109.0	112.0					4																	107845310		2203	4300	6503	SO:0001583	missense	27123	exon4			GCACAGCAAAACC	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.581G>A	4.37:g.107845310C>T	ENSP00000285311:p.Cys194Tyr	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	79.0	NM_014421	A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	37	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.610495	0.87258	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	D;T;T	0.81821	-1.54;-0.61;-1.14	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.90807	0.7113	M	0.82823	2.61	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.91523	0.5236	10	0.87932	D	0	-8.7032	19.6876	0.95986	0.0:1.0:0.0:0.0	.	194	Q9UBU2	DKK2_HUMAN	Y	194;94;148	ENSP00000285311:C194Y;ENSP00000421255:C94Y;ENSP00000423797:C148Y	ENSP00000285311:C194Y	C	-	2	0	DKK2	108064759	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.487000	0.81328	2.657000	0.90304	0.585000	0.79938	TGC	.		0.473	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4		
DPF3	8110	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	73159816	73159816	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:73159816G>A	ENST00000556509.1	-	7	709	c.710C>T	c.(709-711)tCc>tTc	p.S237F	DPF3_ENST00000546183.1_Missense_Mutation_p.S247F|DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000541685.1_Missense_Mutation_p.S237F	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	237					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GTTGGGTGGGGACCGAGTCTC	0.582																																					p.S237F		.											.	DPF3	1	0			c.C710T						.						203.0	204.0	204.0					14																	73159816		2067	4214	6281	SO:0001583	missense	8110	exon7			GGTGGGGACCGAG	U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.710C>T	14.37:g.73159816G>A	ENSP00000450518:p.Ser237Phe	Somatic	159.0	0.0		WXS	Illumina HiSeq	Phase_I	462.0	175.0	NM_012074	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Missense_Mutation	SNP	ENST00000556509.1	37		.	.	.	.	.	.	.	.	.	.	G	26.9	4.783260	0.90282	.	.	ENSG00000205683	ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	D;T;T	0.90900	-2.75;-0.25;-0.2	5.36	5.36	0.76844	.	.	.	.	.	D	0.92071	0.7487	L	0.47716	1.5	0.80722	D	1	P;D;D	0.61080	0.936;0.978;0.989	P;P;P	0.53912	0.729;0.729;0.737	D	0.92906	0.6343	9	0.87932	D	0	.	19.0841	0.93196	0.0:0.0:1.0:0.0	.	247;237;237	F5H575;Q92784-2;Q92784	.;.;DPF3_HUMAN	F	237;236;237;247	ENSP00000450518:S237F;ENSP00000441640:S237F;ENSP00000444662:S247F	ENSP00000381791:S292F	S	-	2	0	DPF3	72229569	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	9.335000	0.96500	2.504000	0.84457	0.462000	0.41574	TCC	.		0.582	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000413152.2		
DYRK3	8444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	206820946	206820946	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:206820946G>T	ENST00000367109.2	+	3	571	c.403G>T	c.(403-405)Gca>Tca	p.A135S	DYRK3_ENST00000489878.1_Intron|DYRK3_ENST00000367108.3_Missense_Mutation_p.A115S|DYRK3_ENST00000367106.1_Missense_Mutation_p.A115S	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	135					erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			TTCATCCAAGGCACCCAAAGT	0.413																																					p.A135S	Melanoma(164;427 2622 26826 51707)	.											.	DYRK3	333	0			c.G403T						.						79.0	79.0	79.0					1																	206820946		2203	4300	6503	SO:0001583	missense	8444	exon3			TCCAAGGCACCCA	Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.403G>T	1.37:g.206820946G>T	ENSP00000356076:p.Ala135Ser	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	287.0	177.0	NM_003582	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	ENST00000367109.2	37	CCDS30999.1	.	.	.	.	.	.	.	.	.	.	G	0.108	-1.142325	0.01728	.	.	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000441486;ENST00000367106	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.09	0.837	0.18896	.	0.946011	0.09044	N	0.856863	T	0.20618	0.0496	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.002;0.004	T	0.23190	-1.0195	10	0.12430	T	0.62	.	1.6353	0.02740	0.1512:0.1642:0.3442:0.3405	.	135;115	O43781;O43781-2	DYRK3_HUMAN;.	S	135;115;115;115	ENSP00000356076:A135S;ENSP00000356075:A115S;ENSP00000410187:A115S;ENSP00000356073:A115S	ENSP00000356073:A115S	A	+	1	0	DYRK3	204887569	0.007000	0.16637	0.004000	0.12327	0.759000	0.43091	-0.275000	0.08525	-0.005000	0.14395	0.579000	0.79373	GCA	.		0.413	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088458.1	NM_003582	
EIF4A2	1974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	186504304	186504304	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:186504304C>T	ENST00000323963.5	+	7	705	c.641C>T	c.(640-642)tCt>tTt	p.S214F	RP11-573D15.9_ENST00000577781.1_RNA|SNORA63_ENST00000363450.1_RNA|EIF4A2_ENST00000440191.2_Missense_Mutation_p.S215F|EIF4A2_ENST00000356531.5_Missense_Mutation_p.S119F|SNORA63_ENST00000363548.1_RNA|SNORA4_ENST00000584302.1_RNA|SNORA81_ENST00000408493.2_RNA|SNORD2_ENST00000459163.1_RNA			Q14240	IF4A2_HUMAN	eukaryotic translation initiation factor 4A2	214	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.S214C(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(2)|urinary_tract(1)	28	all_cancers(143;2.68e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.07e-20)	GBM - Glioblastoma multiforme(93;0.0704)		GTGTTGCTTTCTGCCACAATG	0.378			T	BCL6	NHL																																p.S214F		.		Dom	yes		3	3q27.3	1974	"""eukaryotic translation initiation factor 4A, isoform 2"""		L	.	EIF4A2	291	1	Substitution - Missense(1)	lung(1)	c.C641T						.						102.0	104.0	103.0					3																	186504304		2203	4299	6502	SO:0001583	missense	1974	exon7			TGCTTTCTGCCAC	D30655	CCDS3282.1	3q28	2012-02-23	2010-02-10		ENSG00000156976	ENSG00000156976	3.6.1.1	"""DEAD-boxes"""	3284	protein-coding gene	gene with protein product		601102	"""eukaryotic translation initiation factor 4A, isoform 2"""	EIF4F		8521730	Standard	NM_001967		Approved	DDX2B, EIF4A, BM-010	uc003fqs.3	Q14240	OTTHUMG00000156564	ENST00000323963.5:c.641C>T	3.37:g.186504304C>T	ENSP00000326381:p.Ser214Phe	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	405.0	154.0	NM_001967	D3DNU9|Q53XJ6|Q96B90|Q96EA8	Missense_Mutation	SNP	ENST00000323963.5	37	CCDS3282.1	.	.	.	.	.	.	.	.	.	.	C	19.90	3.911871	0.72983	.	.	ENSG00000156976	ENST00000323963;ENST00000440191;ENST00000356531	T;T;T	0.12774	2.65;2.65;2.65	5.13	5.13	0.70059	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56688	0.2002	H	0.98786	4.33	0.80722	D	1	D;D;D;D	0.76494	0.995;0.999;0.999;0.999	D;D;D;D	0.79108	0.943;0.992;0.946;0.968	T	0.74763	-0.3555	10	0.87932	D	0	-27.6825	16.4642	0.84073	0.0:1.0:0.0:0.0	.	70;119;215;214	B4DJX6;Q9NZE6;Q14240-2;Q14240	.;.;.;IF4A2_HUMAN	F	214;215;119	ENSP00000326381:S214F;ENSP00000398370:S215F;ENSP00000348925:S119F	ENSP00000326381:S214F	S	+	2	0	EIF4A2	187986998	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.075000	0.76798	2.827000	0.97445	0.650000	0.86243	TCT	.		0.378	EIF4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344609.1	NM_001967	
ESPNL	339768	broad.mit.edu;mdanderson.org	37	2	239009145	239009145	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr2:239009145C>T	ENST00000343063.3	+	1	348	c.85C>T	c.(85-87)Ccg>Tcg	p.P29S	ESPNL_ENST00000409169.1_Missense_Mutation_p.P29S	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	29										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		CGCCCTGGGCCCGGGCATCAC	0.716																																					p.P29S		.											.	ESPNL	69	0			c.C85T						.						9.0	14.0	12.0					2																	239009145		2185	4283	6468	SO:0001583	missense	339768	exon1			CTGGGCCCGGGCA	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.85C>T	2.37:g.239009145C>T	ENSP00000339115:p.Pro29Ser	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	24.0	11.0	NM_194312	Q66K27|Q6ZVG1|Q8IVU2	Missense_Mutation	SNP	ENST00000343063.3	37	CCDS2525.1	.	.	.	.	.	.	.	.	.	.	C	10.55	1.383001	0.25031	.	.	ENSG00000144488	ENST00000343063;ENST00000409169	T;T	0.64438	-0.1;0.67	4.37	4.37	0.52481	Ankyrin repeat-containing domain (4);	0.583823	0.15354	N	0.266813	T	0.60715	0.2290	M	0.73217	2.22	0.49213	D	0.999765	B	0.25048	0.117	B	0.27608	0.081	T	0.57562	-0.7790	10	0.09338	T	0.73	-4.4515	15.6905	0.77446	0.0:1.0:0.0:0.0	.	29	Q6ZVH7	ESPNL_HUMAN	S	29	ENSP00000339115:P29S;ENSP00000386577:P29S	ENSP00000339115:P29S	P	+	1	0	ESPNL	238673884	0.001000	0.12720	0.400000	0.26346	0.438000	0.31896	1.197000	0.32211	1.988000	0.58038	0.462000	0.41574	CCG	.		0.716	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257164.2	NM_194312	
FEM1C	56929	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	114861063	114861063	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr5:114861063A>C	ENST00000274457.3	-	3	1357	c.796T>G	c.(796-798)Ttg>Gtg	p.L266V		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	266					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		CAGTATTTCAAAGCCCCAAGC	0.398																																					p.L266V		.											.	FEM1C	155	0			c.T796G						.						122.0	118.0	119.0					5																	114861063		2202	4300	6502	SO:0001583	missense	56929	exon3			ATTTCAAAGCCCC		CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.796T>G	5.37:g.114861063A>C	ENSP00000274457:p.Leu266Val	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	64.0	NM_020177	B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	ENST00000274457.3	37	CCDS4118.1	.	.	.	.	.	.	.	.	.	.	A	6.694	0.496617	0.12762	.	.	ENSG00000145780	ENST00000274457	T	0.74947	-0.89	5.76	2.16	0.27623	.	0.000000	0.64402	D	0.000001	T	0.62551	0.2437	L	0.53617	1.68	0.42902	D	0.994231	P	0.39940	0.696	B	0.32022	0.139	T	0.60073	-0.7334	10	0.46703	T	0.11	-11.6108	8.9579	0.35829	0.7232:0.0:0.2768:0.0	.	266	Q96JP0	FEM1C_HUMAN	V	266	ENSP00000274457:L266V	ENSP00000274457:L266V	L	-	1	2	FEM1C	114888962	0.989000	0.36119	0.999000	0.59377	0.519000	0.34347	1.705000	0.37867	0.456000	0.26937	0.528000	0.53228	TTG	.		0.398	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250857.3	NM_020177	
FLNB	2317	broad.mit.edu;bcgsc.ca	37	3	58097919	58097919	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:58097919G>T	ENST00000295956.4	+	18	2784	c.2619G>T	c.(2617-2619)aaG>aaT	p.K873N	FLNB_ENST00000429972.2_Missense_Mutation_p.K873N|FLNB_ENST00000419752.2_Missense_Mutation_p.K704N|FLNB_ENST00000357272.4_Missense_Mutation_p.K873N|FLNB_ENST00000348383.5_Missense_Mutation_p.K873N|FLNB_ENST00000490882.1_Missense_Mutation_p.K873N|FLNB_ENST00000493452.1_Missense_Mutation_p.K704N|FLNB_ENST00000358537.3_Missense_Mutation_p.K873N	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	873					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TCTACACCAAGGGGGCTGGGA	0.488																																					p.K873N		.											.	FLNB	593	0			c.G2619T						.						107.0	111.0	110.0					3																	58097919		2203	4300	6503	SO:0001583	missense	2317	exon18			CACCAAGGGGGCT	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.2619G>T	3.37:g.58097919G>T	ENSP00000295956:p.Lys873Asn	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	6.0	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469099	0.63625	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	5.29	0.251	0.15540	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.90823	0.7118	M	0.67569	2.06	0.58432	D	0.999994	D;D;D;D;D;D	0.89917	1.0;0.988;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.934;0.999;0.994;0.999;0.999	D	0.89077	0.3473	10	0.59425	D	0.04	.	11.0292	0.47763	0.4145:0.0:0.5855:0.0	.	873;873;704;704;873;873	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	N	873;873;873;873;873;873;704;704	ENSP00000295956:K873N;ENSP00000420213:K873N;ENSP00000351339:K873N;ENSP00000415599:K873N;ENSP00000232447:K873N;ENSP00000349819:K873N;ENSP00000418510:K704N;ENSP00000414532:K704N	ENSP00000295956:K873N	K	+	3	2	FLNB	58072959	0.997000	0.39634	0.996000	0.52242	0.996000	0.88848	0.519000	0.22862	0.129000	0.18514	0.655000	0.94253	AAG	.		0.488	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
FLT4	2324	broad.mit.edu;mdanderson.org	37	5	180045886	180045886	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr5:180045886G>T	ENST00000261937.6	-	21	2963	c.2885C>A	c.(2884-2886)gCc>gAc	p.A962D	FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000393347.3_Missense_Mutation_p.A962D|FLT4_ENST00000502649.1_Missense_Mutation_p.A962D	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	962	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCCACCATGGCGCGGAAGCG	0.721																																					p.A962D	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4	1490	0			c.C2885A						.						8.0	11.0	10.0					5																	180045886		2155	4260	6415	SO:0001583	missense	2324	exon21			ACCATGGCGCGGA	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2885C>A	5.37:g.180045886G>T	ENSP00000261937:p.Ala962Asp	Somatic	11.0	0.0		WXS	Illumina HiSeq	Phase_I	33.0	7.0	NM_182925	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	G	8.908	0.957892	0.18507	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649	T;T;T	0.76448	-1.02;-1.02;-1.02	4.92	4.05	0.47172	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.62514	0.2434	N	0.16266	0.395	0.32183	N	0.580105	B;B	0.23540	0.087;0.009	B;B	0.29440	0.102;0.027	T	0.60576	-0.7236	9	0.15066	T	0.55	.	10.9936	0.47563	0.0882:0.0:0.9118:0.0	.	962;962	E9PD35;P35916	.;VGFR3_HUMAN	D	962	ENSP00000261937:A962D;ENSP00000377016:A962D;ENSP00000426057:A962D	ENSP00000261937:A962D	A	-	2	0	FLT4	179978492	1.000000	0.71417	0.947000	0.38551	0.442000	0.32017	4.039000	0.57325	1.197000	0.43143	0.555000	0.69702	GCC	.		0.721	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
FNDC7	163479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	109270564	109270564	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:109270564G>A	ENST00000370017.3	+	7	1523	c.1246G>A	c.(1246-1248)Gac>Aac	p.D416N	FNDC7_ENST00000271311.2_Missense_Mutation_p.D417N	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	416	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		TGAGTGCAATGACACTACTCC	0.488																																					p.D416N		.											.	FNDC7	92	0			c.G1246A						.						288.0	244.0	259.0					1																	109270564		2203	4300	6503	SO:0001583	missense	163479	exon7			TGCAATGACACTA		CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.1246G>A	1.37:g.109270564G>A	ENSP00000359034:p.Asp416Asn	Somatic	96.0	0.0		WXS	Illumina HiSeq	Phase_I	200.0	91.0	NM_001144937	A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	ENST00000370017.3	37	CCDS44185.1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933047	0.92458	.	.	ENSG00000143107	ENST00000370017;ENST00000271311	T;T	0.23950	1.88;1.88	5.73	5.73	0.89815	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.041024	0.85682	D	0.000000	T	0.41073	0.1143	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.03875	-1.0996	10	0.19147	T	0.46	-16.3329	19.9068	0.97010	0.0:0.0:1.0:0.0	.	417;416	Q5VTL7;E9PAZ5	FNDC7_HUMAN;.	N	416;417	ENSP00000359034:D416N;ENSP00000271311:D417N	ENSP00000271311:D417N	D	+	1	0	FNDC7	109072087	1.000000	0.71417	1.000000	0.80357	0.619000	0.37552	9.068000	0.93961	2.710000	0.92621	0.561000	0.74099	GAC	.		0.488	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030589.4	NM_173532	
FOXG1	2290	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	14	29237348	29237348	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:29237348G>A	ENST00000313071.4	+	1	1062	c.863G>A	c.(862-864)cGc>cAc	p.R288H	RP11-966I7.1_ENST00000551395.1_RNA|RP11-966I7.1_ENST00000546560.1_RNA|RP11-966I7.1_ENST00000549487.1_RNA|FOXG1_ENST00000382535.3_Missense_Mutation_p.R288H	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	288				FKRGAR -> AFRWCA (in Ref. 1; CAA52241). {ECO:0000305}.	aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		GCCTTCAAGCGCGGTGCGCGC	0.716																																					p.R288H		.											.	FOXG1	660	0			c.G863A						.						32.0	39.0	37.0					14																	29237348		2202	4299	6501	SO:0001583	missense	2290	exon1			TCAAGCGCGGTGC		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.863G>A	14.37:g.29237348G>A	ENSP00000339004:p.Arg288His	Somatic	9.0	0.0		WXS	Illumina HiSeq	Phase_I	37.0	16.0	NM_005249	A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	37	CCDS9636.1	.	.	.	.	.	.	.	.	.	.	G	32	5.174455	0.94807	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.94687	-3.49;-3.49	4.05	4.05	0.47172	.	0.265561	0.30850	U	0.008757	D	0.95121	0.8419	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	D	0.96016	0.9005	10	0.87932	D	0	.	15.7834	0.78281	0.0:0.0:1.0:0.0	.	288	P55316	FOXG1_HUMAN	H	288	ENSP00000371975:R288H;ENSP00000339004:R288H	ENSP00000339004:R288H	R	+	2	0	FOXG1	28307099	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.725000	0.84808	1.777000	0.52277	0.313000	0.20887	CGC	.		0.716	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
FUZ	80199	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50314913	50314913	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr19:50314913A>G	ENST00000313777.4	-	4	525	c.362T>C	c.(361-363)gTg>gCg	p.V121A	AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000445575.2_Missense_Mutation_p.V121A|FUZ_ENST00000528094.1_Missense_Mutation_p.V85A|FUZ_ENST00000526575.1_3'UTR|FUZ_ENST00000533418.1_Missense_Mutation_p.V71A|FUZ_ENST00000534008.1_5'UTR	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	121					cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		CAGTCTCTCCACGTTGCGGAT	0.527																																					p.V121A		.											.	FUZ	90	0			c.T362C						.						379.0	343.0	355.0					19																	50314913		2203	4300	6503	SO:0001583	missense	80199	exon4			CTCTCCACGTTGC	BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.362T>C	19.37:g.50314913A>G	ENSP00000313309:p.Val121Ala	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	195.0	73.0	NM_025129	B2RD86|B5MDH0|Q6PJY0|Q9H613	Missense_Mutation	SNP	ENST00000313777.4	37	CCDS12781.1	.	.	.	.	.	.	.	.	.	.	A	17.40	3.380908	0.61845	.	.	ENSG00000010361	ENST00000528094;ENST00000533418;ENST00000529634;ENST00000313777;ENST00000377092;ENST00000445575;ENST00000529004;ENST00000421740	T;T;T;T;T	0.72942	2.21;2.21;2.21;-0.7;2.21	4.83	4.83	0.62350	.	0.233514	0.33875	N	0.004474	T	0.69305	0.3096	L	0.49350	1.555	0.48341	D	0.999632	P;P;B	0.49961	0.93;0.787;0.202	P;B;B	0.47915	0.561;0.359;0.059	T	0.73360	-0.4007	10	0.87932	D	0	-11.0074	10.7112	0.45984	1.0:0.0:0.0:0.0	.	121;85;121	B4DHF8;Q9BT04-3;Q9BT04	.;.;FUZZY_HUMAN	A	85;71;121;121;21;121;71;121	ENSP00000435177:V85A;ENSP00000431731:V71A;ENSP00000313309:V121A;ENSP00000366296:V21A;ENSP00000408018:V121A	ENSP00000313309:V121A	V	-	2	0	FUZ	55006725	0.713000	0.27926	0.988000	0.46212	0.970000	0.65996	5.556000	0.67307	2.026000	0.59711	0.379000	0.24179	GTG	.		0.527	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393986.1	NM_025129	
GGA2	23062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	23489767	23489767	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:23489767G>A	ENST00000309859.4	-	13	1296	c.1214C>T	c.(1213-1215)cCa>cTa	p.P405L	GGA2_ENST00000567468.1_Intron|GGA2_ENST00000569182.1_5'UTR	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	405	Unstructured hinge.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		ACCACCGCCTGGCAGCGTGCT	0.532																																					p.P405L		.											.	GGA2	91	0			c.C1214T						.						110.0	99.0	103.0					16																	23489767		2197	4300	6497	SO:0001583	missense	23062	exon13			CCGCCTGGCAGCG	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.1214C>T	16.37:g.23489767G>A	ENSP00000311962:p.Pro405Leu	Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	44.0	NM_015044	D3DWF0|O14564|Q9NYN2|Q9UPS2	Missense_Mutation	SNP	ENST00000309859.4	37	CCDS10611.1	.	.	.	.	.	.	.	.	.	.	G	9.964	1.223606	0.22457	.	.	ENSG00000103365	ENST00000309859	T	0.14893	2.47	4.11	2.0	0.26442	.	487.764000	0.00166	N	0.000000	T	0.19208	0.0461	L	0.54323	1.7	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19614	-1.0300	10	0.34782	T	0.22	-0.0382	5.4904	0.16773	0.2876:0.0:0.7124:0.0	.	405	Q9UJY4	GGA2_HUMAN	L	405	ENSP00000311962:P405L	ENSP00000311962:P405L	P	-	2	0	GGA2	23397268	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.371000	0.20450	0.403000	0.25479	-0.345000	0.07892	CCA	.		0.532	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		
GPRIN3	285513	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	90170546	90170546	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr4:90170546G>A	ENST00000609438.1	-	2	1234	c.716C>T	c.(715-717)aCt>aTt	p.T239I	GPRIN3_ENST00000333209.4_Missense_Mutation_p.T239I	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	239								p.T239N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		AGATTCTCTAGTTAGAGGTTT	0.552																																					p.T239I		.											.	GPRIN3	71	1	Substitution - Missense(1)	kidney(1)	c.C716T						.						50.0	55.0	53.0					4																	90170546		2203	4300	6503	SO:0001583	missense	285513	exon2			TCTCTAGTTAGAG	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.716C>T	4.37:g.90170546G>A	ENSP00000476603:p.Thr239Ile	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	39.0	NM_198281	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	37	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318807	0.23994	.	.	ENSG00000185477	ENST00000333209	T	0.10860	2.83	4.93	0.83	0.18854	.	0.807286	0.10088	N	0.717539	T	0.04452	0.0122	N	0.14661	0.345	0.09310	N	1	B	0.30824	0.296	B	0.20955	0.032	T	0.40270	-0.9572	10	0.27785	T	0.31	0.635	1.468	0.02410	0.1827:0.1254:0.4522:0.2398	.	239	Q6ZVF9	GRIN3_HUMAN	I	239	ENSP00000328672:T239I	ENSP00000328672:T239I	T	-	2	0	GPRIN3	90389569	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.754000	0.26390	0.311000	0.23014	-0.142000	0.14014	ACT	.		0.552	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
GYPE	2996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	144801632	144801632	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr4:144801632G>T	ENST00000358615.4	-	2	119	c.68C>A	c.(67-69)aCt>aAt	p.T23N	GYPE_ENST00000437468.2_Missense_Mutation_p.T23N	NM_198682.2	NP_941391.2	P15421	GLPE_HUMAN	glycophorin E (MNS blood group)	23						integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	all_hematologic(180;0.158)					TGCCACACCAGTGGTACTTGA	0.378																																					p.T23N		.											.	.	.	0			c.C68A						.						214.0	223.0	220.0					4																	144801632		2203	4300	6503	SO:0001583	missense	2996	exon2			ACACCAGTGGTAC		CCDS47138.1	4q31.21	2010-01-19	2010-01-19		ENSG00000197465	ENSG00000197465		"""Blood group antigens"""	4705	protein-coding gene	gene with protein product		138590	"""glycophorin E"""				Standard	NM_198682		Approved	GPE, MNS	uc003ijj.3	P15421	OTTHUMG00000161402	ENST00000358615.4:c.68C>A	4.37:g.144801632G>T	ENSP00000351430:p.Thr23Asn	Somatic	188.0	0.0		WXS	Illumina HiSeq	Phase_I	1142.0	206.0	NM_198682	D3DNZ5	Missense_Mutation	SNP	ENST00000358615.4	37	CCDS47138.1	.	.	.	.	.	.	.	.	.	.	G	10.43	1.348990	0.24426	.	.	ENSG00000197465	ENST00000358615;ENST00000437468;ENST00000428604	T;T	0.06371	3.31;3.31	1.75	-1.39	0.08997	.	.	.	.	.	T	0.09024	0.0223	.	.	.	0.09310	N	1	D	0.62365	0.991	P	0.50136	0.632	T	0.19811	-1.0294	8	0.87932	D	0	.	5.159	0.15050	0.5471:0.0:0.4529:0.0	.	23	P15421	GLPE_HUMAN	N	23	ENSP00000351430:T23N;ENSP00000400698:T23N	ENSP00000351430:T23N	T	-	2	0	GYPE	145021082	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.369000	0.07533	-0.448000	0.07128	0.134000	0.15878	ACT	.		0.378	GYPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364780.1	NM_002102	
H6PD	9563	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	9305494	9305494	+	Nonsense_Mutation	SNP	G	G	A	rs559063919		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:9305494G>A	ENST00000377403.2	+	2	803	c.501G>A	c.(499-501)tgG>tgA	p.W167*	H6PD_ENST00000602477.1_Nonsense_Mutation_p.W178*	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	167	Glucose 1-dehydrogenase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CGGGCGCCTGGCTGCGGGTTG	0.597																																					p.W167X		.											.	H6PD	90	0			c.G501A						.						46.0	55.0	52.0					1																	9305494		2203	4300	6503	SO:0001587	stop_gained	9563	exon2			CGCCTGGCTGCGG	AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.501G>A	1.37:g.9305494G>A	ENSP00000366620:p.Trp167*	Somatic	30.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	20.0	NM_004285	Q4TT33|Q66I35|Q68DT3	Nonsense_Mutation	SNP	ENST00000377403.2	37	CCDS101.1	.	.	.	.	.	.	.	.	.	.	G	40	8.156138	0.98680	.	.	ENSG00000049239	ENST00000377403	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.7585	18.3309	0.90268	0.0:0.0:1.0:0.0	.	.	.	.	X	167	.	ENSP00000366620:W167X	W	+	3	0	H6PD	9228081	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.358000	0.97109	2.641000	0.89580	0.591000	0.81541	TGG	.		0.597	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004928.2	NM_004285	
HERC2	8924	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	28446674	28446674	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr15:28446674G>C	ENST00000261609.7	-	48	7752	c.7644C>G	c.(7642-7644)agC>agG	p.S2548R		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGTACGTCTGGCTCTCCGTCA	0.368																																					p.S2548R		.											.	HERC2	234	0			c.C7644G						.						125.0	114.0	118.0					15																	28446674		2203	4300	6503	SO:0001583	missense	8924	exon48			CGTCTGGCTCTCC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.7644C>G	15.37:g.28446674G>C	ENSP00000261609:p.Ser2548Arg	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	378.0	146.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	37	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263445	0.59431	.	.	ENSG00000128731	ENST00000261609	T	0.38887	1.11	5.18	3.3	0.37823	.	0.043831	0.85682	D	0.000000	T	0.55800	0.1943	L	0.56769	1.78	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.75484	0.986;0.979	T	0.49532	-0.8930	10	0.25106	T	0.35	.	11.6869	0.51492	0.1348:0.0:0.8652:0.0	.	15;2548	A8KAQ8;O95714	.;HERC2_HUMAN	R	2548	ENSP00000261609:S2548R	ENSP00000261609:S2548R	S	-	3	2	HERC2	26120269	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.798000	0.38814	0.691000	0.31592	0.561000	0.74099	AGC	.		0.368	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
ICAM5	7087	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	10404754	10404754	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr19:10404754T>C	ENST00000221980.4	+	8	1813	c.1750T>C	c.(1750-1752)Tgg>Cgg	p.W584R		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	584	Ig-like C2-type 7.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CCCCAGCAATTGGACATGGGT	0.647																																					p.W584R		.											.	ICAM5	153	0			c.T1750C						.						48.0	56.0	54.0					19																	10404754		2196	4277	6473	SO:0001583	missense	7087	exon8			AGCAATTGGACAT	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.1750T>C	19.37:g.10404754T>C	ENSP00000221980:p.Trp584Arg	Somatic	42.0	1.0		WXS	Illumina HiSeq	Phase_I	83.0	23.0	NM_003259	Q9Y6F3	Missense_Mutation	SNP	ENST00000221980.4	37	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.097452	0.56075	.	.	ENSG00000105376	ENST00000221980	T	0.73789	-0.78	4.69	4.69	0.59074	Immunoglobulin-like fold (1);	0.150046	0.31784	N	0.007072	T	0.76652	0.4017	M	0.65498	2.005	0.37291	D	0.90825	D	0.54397	0.966	P	0.50440	0.641	T	0.80901	-0.1175	10	0.48119	T	0.1	-14.8652	10.4509	0.44522	0.0:0.0:0.0:1.0	.	584	Q9UMF0	ICAM5_HUMAN	R	584	ENSP00000221980:W584R	ENSP00000221980:W584R	W	+	1	0	ICAM5	10265754	0.987000	0.35691	0.999000	0.59377	0.753000	0.42808	1.632000	0.37102	1.968000	0.57251	0.448000	0.29417	TGG	.		0.647	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451217.1	NM_003259	
IFNA8	3445	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	21409564	21409564	+	Missense_Mutation	SNP	T	T	C	rs28383787		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr9:21409564T>C	ENST00000380205.1	+	1	419	c.389T>C	c.(388-390)aTa>aCa	p.I130T		NM_002170.3	NP_002161.2	P32881	IFNA8_HUMAN	interferon, alpha 8	130					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		GTGGGGGTGATAGAGTCTCCC	0.478																																					p.I130T		.											.	IFNA8	90	0			c.T389C						.						144.0	142.0	142.0					9																	21409564		2203	4300	6503	SO:0001583	missense	3445	exon1			GGGTGATAGAGTC		CCDS6507.1	9p22	2010-08-24			ENSG00000120242	ENSG00000120242		"""Interferons"""	5429	protein-coding gene	gene with protein product	"""interferon alpha-B''"", ""interferon alpha type 201"""	147568				1385305	Standard	NM_002170		Approved	IFN-alphaB	uc003zpc.1	P32881	OTTHUMG00000019677	ENST00000380205.1:c.389T>C	9.37:g.21409564T>C	ENSP00000369553:p.Ile130Thr	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	258.0	110.0	NM_002170	P01565|P09236|Q5VWV7|Q5VYQ3	Missense_Mutation	SNP	ENST00000380205.1	37	CCDS6507.1	.	.	.	.	.	.	.	.	.	.	T	5.842	0.339510	0.11069	.	.	ENSG00000120242	ENST00000380205	T	0.05081	3.5	3.48	-2.49	0.06403	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	2.002250	0.01939	N	0.041792	T	0.01661	0.0053	N	0.00347	-1.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38436	-0.9661	10	0.40728	T	0.16	.	1.2648	0.02009	0.3469:0.3593:0.1167:0.1771	.	130	P32881	IFNA8_HUMAN	T	130	ENSP00000369553:I130T	ENSP00000369553:I130T	I	+	2	0	IFNA8	21399564	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.378000	0.07446	-0.568000	0.06038	-2.123000	0.00347	ATA	.		0.478	IFNA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051906.1	NM_002170	
IL12RB2	3595	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	67861669	67861669	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:67861669T>C	ENST00000262345.1	+	16	3126	c.2486T>C	c.(2485-2487)cTt>cCt	p.L829P	IL12RB2_ENST00000371000.1_3'UTR|IL12RB2_ENST00000544434.1_Missense_Mutation_p.L743P	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	829					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CACATCTCCCTTTCTGTTTTC	0.512																																					p.L829P		.											.	IL12RB2	92	0			c.T2486C						.						310.0	295.0	300.0					1																	67861669		2203	4300	6503	SO:0001583	missense	3595	exon16			TCTCCCTTTCTGT	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.2486T>C	1.37:g.67861669T>C	ENSP00000262345:p.Leu829Pro	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	335.0	124.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	ENST00000262345.1	37	CCDS638.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.085356	0.36758	.	.	ENSG00000081985	ENST00000262345;ENST00000544434	T;T	0.49139	0.79;1.71	5.29	4.15	0.48705	.	0.892298	0.09923	N	0.738230	T	0.16769	0.0403	L	0.27053	0.805	0.20196	N	0.999927	B;B	0.33637	0.42;0.028	B;B	0.29176	0.099;0.014	T	0.10132	-1.0643	10	0.66056	D	0.02	-6.8301	7.2723	0.26264	0.0:0.0981:0.0:0.9019	.	743;829	F5H7L6;Q99665	.;I12R2_HUMAN	P	829;743	ENSP00000262345:L829P;ENSP00000442443:L743P	ENSP00000262345:L829P	L	+	2	0	IL12RB2	67634257	0.013000	0.17824	0.012000	0.15200	0.388000	0.30384	2.086000	0.41643	2.135000	0.66039	0.482000	0.46254	CTT	.		0.512	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
IL21R	50615	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27460101	27460101	+	Missense_Mutation	SNP	G	G	T	rs36031126		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:27460101G>T	ENST00000337929.3	+	9	1587	c.1114G>T	c.(1114-1116)Ggc>Tgc	p.G372C	IL21R_ENST00000564089.1_Missense_Mutation_p.G372C|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395755.1_Missense_Mutation_p.G372C|IL21R_ENST00000395754.4_Missense_Mutation_p.G372C	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	372					interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						TCGGCCATACGGCCTGGTGTC	0.627			T	BCL6	NHL																																p.G394C		.		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	.	IL21R	660	0			c.G1180T						.						65.0	62.0	63.0					16																	27460101		2197	4300	6497	SO:0001583	missense	50615	exon10			CCATACGGCCTGG	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.1114G>T	16.37:g.27460101G>T	ENSP00000338010:p.Gly372Cys	Somatic	19.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	19.0	NM_181079	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	ENST00000337929.3	37	CCDS10630.1	.	.	.	.	.	.	.	.	.	.	G	13.77	2.337208	0.41398	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.44083	0.93;0.93;0.93	5.19	5.19	0.71726	.	7.212420	0.00166	N	0.000004	T	0.69851	0.3157	M	0.69823	2.125	0.29219	N	0.874075	D	0.89917	1.0	D	0.97110	1.0	T	0.54118	-0.8341	10	0.72032	D	0.01	-25.7504	14.2483	0.66001	0.0:0.0:1.0:0.0	.	372	Q9HBE5	IL21R_HUMAN	C	372	ENSP00000338010:G372C;ENSP00000379104:G372C;ENSP00000379103:G372C	ENSP00000338010:G372C	G	+	1	0	IL21R	27367602	0.997000	0.39634	0.040000	0.18447	0.036000	0.12997	3.922000	0.56462	2.426000	0.82243	0.561000	0.74099	GGC	G|0.986;A|0.014		0.627	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254578.2	NM_181078	
IMPA1	3612	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	82591405	82591405	+	Silent	SNP	T	T	C	rs374631061		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr8:82591405T>C	ENST00000256108.5	-	4	723	c.258A>G	c.(256-258)acA>acG	p.T86T	IMPA1_ENST00000449740.2_Silent_p.T145T|IMPA1_ENST00000311489.4_Silent_p.T86T|IMPA1_ENST00000523710.1_5'UTR	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1	86					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	CAATGATCCATGTGGGGTTGT	0.353																																					p.T145T		.											.	IMPA1	226	0			c.A435G						.	T	,,	0,4406		0,0,2203	132.0	132.0	132.0		435,258,258	-10.1	0.2	8		132	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	IMPA1	NM_001144878.1,NM_001144879.1,NM_005536.3	,,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,,	145/337,86/199,86/278	82591405	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	3612	exon5			GATCCATGTGGGG		CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.258A>G	8.37:g.82591405T>C		Somatic	106.0	1.0		WXS	Illumina HiSeq	Phase_I	169.0	66.0	NM_001144878	B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Silent	SNP	ENST00000256108.5	37	CCDS6231.1	.	.	.	.	.	.	.	.	.	.	T	7.269	0.606815	0.14002	0.0	1.16E-4	ENSG00000133731	ENST00000523942	.	.	.	5.06	-10.1	0.00402	.	.	.	.	.	T	0.44222	0.1283	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53180	-0.8475	4	.	.	.	-6.0854	6.4783	0.22049	0.1398:0.0871:0.1233:0.6498	.	.	.	.	V	111	.	.	M	-	1	0	IMPA1	82753960	0.000000	0.05858	0.207000	0.23584	0.868000	0.49771	-3.311000	0.00517	-2.802000	0.00351	-0.463000	0.05309	ATG	.		0.353	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379723.1		
IRS4	8471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	107976586	107976586	+	Missense_Mutation	SNP	G	G	A	rs189095515		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chrX:107976586G>A	ENST00000372129.2	-	1	3065	c.2989C>T	c.(2989-2991)Ctt>Ttt	p.L997F	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	997					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						AGGGGAGGAAGTGGCCACCTA	0.488													G|||	1	0.000264901	0.0008	0.0	3775	,	,		15059	0.0		0.0	False		,,,				2504	0.0				p.L997F		.											.	IRS4	623	0			c.C2989T						.						106.0	95.0	98.0					X																	107976586		2203	4300	6503	SO:0001583	missense	8471	exon1			GAGGAAGTGGCCA	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2989C>T	X.37:g.107976586G>A	ENSP00000361202:p.Leu997Phe	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	103.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	37	CCDS14544.1	1	6.027727546714888E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	2.531	-0.308598	0.05458	.	.	ENSG00000133124	ENST00000372129	T	0.37058	1.22	4.72	1.96	0.26148	.	0.899723	0.09428	N	0.803467	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33420	-0.9869	10	0.08381	T	0.77	-0.102	6.3186	0.21204	0.4393:0.0:0.5607:0.0	.	997	O14654	IRS4_HUMAN	F	997	ENSP00000361202:L997F	ENSP00000361202:L997F	L	-	1	0	IRS4	107863242	1.000000	0.71417	0.064000	0.19789	0.130000	0.20726	0.864000	0.27926	0.086000	0.17137	0.600000	0.82982	CTT	G|0.999;A|0.001		0.488	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
KCNB2	9312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	73848335	73848335	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr8:73848335C>G	ENST00000523207.1	+	3	1333	c.745C>G	c.(745-747)Ctt>Gtt	p.L249V		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	249					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CATGGAGTACCTTTTGCGATT	0.458																																					p.L249V		.											.	KCNB2	158	0			c.C745G						.						195.0	168.0	177.0					8																	73848335		2203	4300	6503	SO:0001583	missense	9312	exon3			GAGTACCTTTTGC	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.745C>G	8.37:g.73848335C>G	ENSP00000430846:p.Leu249Val	Somatic	124.0	0.0		WXS	Illumina HiSeq	Phase_I	294.0	111.0	NM_004770	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760784	0.69763	.	.	ENSG00000182674	ENST00000523207	D	0.98419	-4.92	5.93	5.93	0.95920	Ion transport (1);	0.000000	0.40818	N	0.001009	D	0.97654	0.9231	N	0.17631	0.505	0.80722	D	1	P	0.49696	0.927	P	0.61397	0.888	D	0.97710	1.0190	10	0.39692	T	0.17	.	20.3507	0.98813	0.0:1.0:0.0:0.0	.	249	Q92953	KCNB2_HUMAN	V	249	ENSP00000430846:L249V	ENSP00000430846:L249V	L	+	1	0	KCNB2	74010889	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	7.818000	0.86416	2.808000	0.96608	0.655000	0.94253	CTT	.		0.458	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
KCNJ11	3767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	17409285	17409285	+	Silent	SNP	C	C	T	rs140636367	byFrequency	TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr11:17409285C>T	ENST00000339994.4	-	1	921	c.354G>A	c.(352-354)tcG>tcA	p.S118S	KCNJ11_ENST00000528731.1_Silent_p.S31S|KCNJ11_ENST00000526747.1_5'Flank	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	118					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	GGAAGGCAGACGAGAAGGAGT	0.612																																					p.S118S		.											.	KCNJ11	91	0			c.G354A						.	C	,	3,4397	6.2+/-15.9	0,3,2197	127.0	101.0	109.0		354,93	-10.3	0.0	11	dbSNP_134	109	4,8582	3.7+/-12.6	0,4,4289	no	coding-synonymous,coding-synonymous	KCNJ11	NM_000525.3,NM_001166290.1	,	0,7,6486	TT,TC,CC		0.0466,0.0682,0.0539	,	118/391,31/304	17409285	7,12979	2200	4293	6493	SO:0001819	synonymous_variant	3767	exon1			GGCAGACGAGAAG	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.354G>A	11.37:g.17409285C>T		Somatic	42.0	0.0		WXS	Illumina HiSeq	Phase_I	71.0	13.0	NM_000525	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Silent	SNP	ENST00000339994.4	37	CCDS31436.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.708568	0.00712	6.82E-4	4.66E-4	ENSG00000187486	ENST00000528992	.	.	.	5.14	-10.3	0.00346	.	.	.	.	.	T	0.44726	0.1307	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73845	-0.3854	4	.	.	.	.	6.1124	0.20108	0.1463:0.3383:0.3755:0.1399	.	.	.	.	H	124	.	.	R	-	2	0	KCNJ11	17365861	0.000000	0.05858	0.000000	0.03702	0.374000	0.29953	-3.117000	0.00597	-7.824000	0.00000	-2.994000	0.00078	CGT	C|0.999;T|0.001		0.612	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387037.1	NM_000525	
KCNT2	343450	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	196309631	196309631	+	Silent	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:196309631T>C	ENST00000294725.9	-	16	2538	c.1623A>G	c.(1621-1623)cgA>cgG	p.R541R	KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000367433.5_Silent_p.R541R|KCNT2_ENST00000451324.2_Silent_p.R152R|KCNT2_ENST00000367431.4_Silent_p.R491R|KCNT2_ENST00000609185.1_Silent_p.R491R			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	541	RCK N-terminal.				potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCATAATGTATCGAGGACCTG	0.328																																					p.R541R		.											.	KCNT2	159	0			c.A1623G						.						73.0	73.0	73.0					1																	196309631		2203	4299	6502	SO:0001819	synonymous_variant	343450	exon16			AATGTATCGAGGA	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1623A>G	1.37:g.196309631T>C		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	199.0	42.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	ENST00000294725.9	37	CCDS1384.1																																																																																			.		0.328	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
LRP12	29967	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	105510097	105510097	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr8:105510097T>C	ENST00000276654.5	-	5	791	c.683A>G	c.(682-684)aAa>aGa	p.K228R	LRP12_ENST00000424843.2_Missense_Mutation_p.K209R|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	228	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AGTGTAAACTTTGGTAAAACG	0.453																																					p.K228R		.											.	LRP12	90	0			c.A683G						.						141.0	130.0	134.0					8																	105510097		2203	4300	6503	SO:0001583	missense	29967	exon5			TAAACTTTGGTAA	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.683A>G	8.37:g.105510097T>C	ENSP00000276654:p.Lys228Arg	Somatic	110.0	0.0		WXS	Illumina HiSeq	Phase_I	221.0	105.0	NM_013437	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	T	9.298	1.052444	0.19907	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	D;D	0.83591	-1.74;-1.67	5.66	5.66	0.87406	.	0.049986	0.85682	D	0.000000	T	0.63721	0.2535	N	0.04508	-0.205	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.62728	-0.6793	10	0.02654	T	1	-29.6762	15.9017	0.79384	0.0:0.0:0.0:1.0	.	209;228	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	R	209;228	ENSP00000399148:K209R;ENSP00000276654:K228R	ENSP00000276654:K228R	K	-	2	0	LRP12	105579273	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.365000	0.59486	2.153000	0.67306	0.460000	0.39030	AAA	.		0.453	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
MTPN	136319	ucsc.edu;bcgsc.ca	37	7	135612338	135612338	+	3'UTR	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr7:135612338A>G	ENST00000393085.3	-	0	2908				LUZP6_ENST00000589735.1_5'Flank|AC015987.2_ENST00000416501.1_Missense_Mutation_p.N11D|AC015987.1_ENST00000419211.1_RNA	NM_001128619.2|NM_145808.3	NP_001122091.2|NP_665807.1	P58546	MTPN_HUMAN	myotrophin						catecholamine metabolic process (GO:0006584)|cell growth (GO:0016049)|cerebellar granule cell differentiation (GO:0021707)|neuron differentiation (GO:0030182)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell growth (GO:0030307)|positive regulation of macromolecule biosynthetic process (GO:0010557)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein metabolic process (GO:0051247)|regulation of barbed-end actin filament capping (GO:2000812)|regulation of striated muscle tissue development (GO:0016202)|regulation of translation (GO:0006417)|skeletal muscle tissue regeneration (GO:0043403)|striated muscle cell differentiation (GO:0051146)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|nucleus (GO:0005634)				endometrium(1)|lung(4)|prostate(1)	6						TCAAAATATGAACATTAAGTG	0.328																																					.		.											.	.	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	767558	.			AATATGAACATTA	AC015987	CCDS5842.1	7q33-q35	2013-01-10			ENSG00000105887	ENSG00000105887		"""Ankyrin repeat domain containing"""	15667	protein-coding gene	gene with protein product	"""granule cell differentiation protein"""	606484				11474205	Standard	NM_145808		Approved	MYOTROPHIN, GCDP, V-1		P58546	OTTHUMG00000155627	ENST00000393085.3:c.*2336T>C	7.37:g.135612338A>G		Somatic	42.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	.		Missense_Mutation	SNP	ENST00000393085.3	37	CCDS5842.1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.823169	0.32237	.	.	ENSG00000236338	ENST00000416501	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	T	0.72399	0.3455	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75947	-0.3138	5	0.87932	D	0	.	11.7479	0.51830	1.0:0.0:0.0:0.0	.	.	.	.	D	11	.	ENSP00000396652:N11D	N	+	1	0	AC015987.1	135262878	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.826000	0.39092	2.068000	0.61886	0.528000	0.53228	AAC	.		0.328	MTPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340921.1	NM_145808	
MAPK8IP3	23162	ucsc.edu;bcgsc.ca	37	16	1816752	1816752	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:1816752T>C	ENST00000250894.4	+	24	3122	c.2965T>C	c.(2965-2967)Tgg>Cgg	p.W989R	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.W983R	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	989					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						TGTGGCCAACTGGAAGAAGTG	0.677																																					p.W989R		.											.	MAPK8IP3	1109	0			c.T2965C						.						63.0	67.0	66.0					16																	1816752		2047	4185	6232	SO:0001583	missense	23162	exon24			GCCAACTGGAAGA	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2965T>C	16.37:g.1816752T>C	ENSP00000250894:p.Trp989Arg	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	48.0	6.0	NM_015133	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	ENST00000250894.4	37	CCDS10442.2	.	.	.	.	.	.	.	.	.	.	T	17.19	3.326586	0.60743	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.62639	0.01;0.01	4.03	2.9	0.33743	WD40 repeat-like-containing domain (1);	0.070365	0.64402	D	0.000006	T	0.76212	0.3956	M	0.79475	2.455	0.80722	D	1	P;D;D	0.76494	0.879;0.999;0.999	P;D;D	0.87578	0.676;0.985;0.998	T	0.76179	-0.3054	10	0.87932	D	0	-12.0081	9.5424	0.39260	0.1579:0.0:0.0:0.8421	.	990;983;989	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	R	989;983	ENSP00000250894:W989R;ENSP00000348290:W983R	ENSP00000250894:W989R	W	+	1	0	MAPK8IP3	1756753	1.000000	0.71417	0.996000	0.52242	0.838000	0.47535	7.819000	0.86621	0.523000	0.28482	-0.468000	0.05107	TGG	.		0.677	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250508.2	NM_001040439	
MARK2	2011	broad.mit.edu;bcgsc.ca	37	11	63665732	63665732	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr11:63665732T>C	ENST00000509502.2	+	4	681	c.218T>C	c.(217-219)gTt>gCt	p.V73A	MARK2_ENST00000413835.2_Missense_Mutation_p.V106A|MARK2_ENST00000508192.1_Missense_Mutation_p.V106A|MARK2_ENST00000402010.2_Missense_Mutation_p.V106A|MARK2_ENST00000513765.2_Missense_Mutation_p.V73A|MARK2_ENST00000361128.5_Missense_Mutation_p.V106A|MARK2_ENST00000425897.2_Missense_Mutation_p.V73A|MARK2_ENST00000350490.7_Missense_Mutation_p.V106A|MARK2_ENST00000502399.3_Missense_Mutation_p.V106A|MARK2_ENST00000377809.4_Missense_Mutation_p.V106A|MARK2_ENST00000377810.3_Missense_Mutation_p.V73A|MARK2_ENST00000315032.8_Missense_Mutation_p.V106A|MARK2_ENST00000408948.3_Missense_Mutation_p.V73A	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2											autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						ATAATGAAGGTTTTGAATCAT	0.478																																					p.V106A		.											.	MARK2	766	0			c.T317C						.						196.0	189.0	191.0					11																	63665732		2201	4297	6498	SO:0001583	missense	2011	exon4			TGAAGGTTTTGAA	BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.218T>C	11.37:g.63665732T>C	ENSP00000423974:p.Val73Ala	Somatic	109.0	1.0		WXS	Illumina HiSeq	Phase_I	197.0	8.0	NM_001163296		Missense_Mutation	SNP	ENST00000509502.2	37	CCDS41665.1	.	.	.	.	.	.	.	.	.	.	T	14.04	2.415304	0.42817	.	.	ENSG00000072518	ENST00000402010;ENST00000315032;ENST00000377809;ENST00000413835;ENST00000377810;ENST00000508192;ENST00000361128;ENST00000350490;ENST00000502399;ENST00000543220;ENST00000540169;ENST00000509502;ENST00000513765;ENST00000408948;ENST00000425897	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1;-0.1	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.149970	0.43579	D	0.000556	T	0.35480	0.0933	N	0.01729	-0.75	0.51233	D	0.999915	B;B;B;P;B;B	0.35774	0.011;0.104;0.017;0.519;0.01;0.088	B;B;B;B;B;B	0.32022	0.045;0.026;0.012;0.139;0.073;0.071	T	0.49862	-0.8894	10	0.56958	D	0.05	.	14.1235	0.65205	0.0:0.0:0.0:1.0	.	73;73;106;106;106;106	E7ETY4;Q7KZI7-14;Q7KZI7-15;Q7KZI7-5;Q7KZI7;Q7KZI7-16	.;.;.;.;MARK2_HUMAN;.	A	106;106;106;106;73;106;106;106;106;73;73;73;73;73;73	ENSP00000385751:V106A;ENSP00000326632:V106A;ENSP00000367040:V106A;ENSP00000389184:V106A;ENSP00000367041:V73A;ENSP00000425765:V106A;ENSP00000355091:V106A;ENSP00000294247:V106A;ENSP00000444956:V73A;ENSP00000437509:V73A;ENSP00000423974:V73A;ENSP00000421075:V73A;ENSP00000386128:V73A;ENSP00000415494:V73A	ENSP00000326632:V106A	V	+	2	0	MARK2	63422308	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.849000	0.86908	2.171000	0.68590	0.460000	0.39030	GTT	.		0.478	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360862.2	NM_017490	
MAST2	23139	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	46488584	46488584	+	Missense_Mutation	SNP	A	A	G	rs375425588		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:46488584A>G	ENST00000361297.2	+	13	1709	c.1426A>G	c.(1426-1428)Atg>Gtg	p.M476V	MAST2_ENST00000372009.2_Missense_Mutation_p.M406V	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GTTTCCAGAAATGGCCCAGTT	0.483																																					p.M476V		.											.	MAST2	581	0			c.A1426G						.	A	VAL/MET	0,4102		0,0,2051	144.0	140.0	141.0		1426	5.1	1.0	1		141	1,8393		0,1,4196	no	missense	MAST2	NM_015112.2	21	0,1,6247	GG,GA,AA		0.0119,0.0,0.0080	benign	476/1799	46488584	1,12495	2051	4197	6248	SO:0001583	missense	23139	exon13			CCAGAAATGGCCC	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.1426A>G	1.37:g.46488584A>G	ENSP00000354671:p.Met476Val	Somatic	121.0	1.0		WXS	Illumina HiSeq	Phase_I	337.0	143.0	NM_015112		Missense_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.517737	0.44763	0.0	1.19E-4	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000432341;ENST00000372008	T;T;T	0.27557	1.66;1.66;1.66	6.17	5.05	0.67936	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.087668	0.85682	N	0.000000	T	0.19725	0.0474	N	0.17248	0.465	0.52099	D	0.999949	B;B;B;B;B	0.15930	0.001;0.0;0.0;0.003;0.015	B;B;B;B;B	0.19946	0.013;0.0;0.006;0.007;0.027	T	0.04991	-1.0913	10	0.21540	T	0.41	-19.5704	12.3382	0.55079	0.9347:0.0:0.0653:0.0	.	150;406;150;406;476	B3KU51;Q6P0Q8-2;E7EWL1;E7ERL6;Q6P0Q8	.;.;.;.;MAST2_HUMAN	V	476;406;150;361	ENSP00000354671:M476V;ENSP00000361079:M406V;ENSP00000361078:M361V	ENSP00000354671:M476V	M	+	1	0	MAST2	46261171	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.234000	0.78134	1.161000	0.42604	0.533000	0.62120	ATG	.		0.483	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
MCM2	4171	ucsc.edu;bcgsc.ca	37	3	127323790	127323790	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:127323790A>G	ENST00000265056.7	+	4	708	c.464A>G	c.(463-465)gAg>gGg	p.E155G		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	155	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						CGCCAGGTGGAGCGGGCCACG	0.647																																					p.E155G		.											.	MCM2	230	0			c.A464G						.						40.0	38.0	38.0					3																	127323790		2203	4300	6503	SO:0001583	missense	4171	exon4			AGGTGGAGCGGGC	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.464A>G	3.37:g.127323790A>G	ENSP00000265056:p.Glu155Gly	Somatic	33.0	0.0		WXS	Illumina HiSeq	.	44.0	4.0	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	37	CCDS3043.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.4|26.4	4.738318|4.738318	0.89573|0.89573	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142|ENST00000491422	T|.	0.26067|.	1.76|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.747940|.	0.13349|.	N|.	0.394577|.	T|T	0.77877|0.77877	0.4196|0.4196	M|M	0.84219|0.84219	2.685|2.685	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.996;0.981;1.0|.	D;D;D|.	0.75484|.	0.986;0.932;0.986|.	T|T	0.80256|0.80256	-0.1458|-0.1458	10|5	0.42905|.	T|.	0.14|.	-38.1678|-38.1678	15.2415|15.2415	0.73474|0.73474	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	136;25;155|.	F5H1E9;B4DSV5;P49736|.	.;.;MCM2_HUMAN|.	G|G	155;59;136|18	ENSP00000265056:E155G|.	ENSP00000265056:E155G|.	E|S	+|+	2|1	0|0	MCM2|MCM2	128806480|128806480	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	8.707000|8.707000	0.91367|0.91367	1.997000|1.997000	0.58415|0.58415	0.482000|0.482000	0.46254|0.46254	GAG|AGC	.		0.647	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
MED13	9969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	60088347	60088347	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr17:60088347T>C	ENST00000397786.2	-	9	1607	c.1531A>G	c.(1531-1533)Atc>Gtc	p.I511V		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	511					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TTAGTTCGGATATTTGAAAAT	0.473																																					p.I511V		.											.	MED13	136	0			c.A1531G						.						174.0	169.0	171.0					17																	60088347		1998	4172	6170	SO:0001583	missense	9969	exon9			TTCGGATATTTGA	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.1531A>G	17.37:g.60088347T>C	ENSP00000380888:p.Ile511Val	Somatic	155.0	0.0		WXS	Illumina HiSeq	Phase_I	539.0	148.0	NM_005121	B2RU05|O60334	Missense_Mutation	SNP	ENST00000397786.2	37	CCDS42366.1	.	.	.	.	.	.	.	.	.	.	T	9.364	1.068753	0.20147	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	T	0.73469	-0.75	6.16	5.07	0.68467	.	0.182595	0.56097	D	0.000025	T	0.65144	0.2663	L	0.44542	1.39	0.45733	D	0.998636	B;B	0.30193	0.069;0.272	B;B	0.26864	0.068;0.074	T	0.59700	-0.7405	10	0.25751	T	0.34	-6.9427	12.7623	0.57372	0.0:0.0:0.2583:0.7417	.	24;511	Q9P0Q5;Q9UHV7	.;MED13_HUMAN	V	511;510	ENSP00000380888:I511V	ENSP00000262436:I510V	I	-	1	0	MED13	57443129	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	2.423000	0.44705	1.117000	0.41842	0.528000	0.53228	ATC	.		0.473	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1	NM_005121	
MED13L	23389	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	116429410	116429410	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr12:116429410C>T	ENST00000281928.3	-	17	3555	c.3349G>A	c.(3349-3351)Gat>Aat	p.D1117N		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1117						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		ATCACGGAATCGGAGAGAATC	0.527																																					p.D1117N		.											.	MED13L	232	0			c.G3349A						.						61.0	60.0	61.0					12																	116429410		2203	4300	6503	SO:0001583	missense	23389	exon17			CGGAATCGGAGAG	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.3349G>A	12.37:g.116429410C>T	ENSP00000281928:p.Asp1117Asn	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	48.0	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	37	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708388	0.68615	.	.	ENSG00000123066	ENST00000281928	D	0.86097	-2.07	5.18	5.18	0.71444	.	0.140018	0.64402	D	0.000006	D	0.83312	0.5227	M	0.64997	1.995	0.80722	D	1	P	0.39551	0.678	B	0.33339	0.162	D	0.86056	0.1529	10	0.87932	D	0	.	18.8897	0.92395	0.0:1.0:0.0:0.0	.	1117	Q71F56	MD13L_HUMAN	N	1117	ENSP00000281928:D1117N	ENSP00000281928:D1117N	D	-	1	0	MED13L	114913793	1.000000	0.71417	0.935000	0.37517	0.843000	0.47879	7.320000	0.79064	2.699000	0.92147	0.460000	0.39030	GAT	.		0.527	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
MEIS1	4211	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	66667100	66667100	+	Missense_Mutation	SNP	C	C	A	rs561384504		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr2:66667100C>A	ENST00000272369.9	+	3	822	c.365C>A	c.(364-366)gCc>gAc	p.A122D	MEIS1-AS1_ENST00000454595.1_RNA|MEIS1_ENST00000398506.2_Missense_Mutation_p.A120D|MEIS1_ENST00000488550.1_Missense_Mutation_p.A122D|MEIS1-AS2_ENST00000439433.1_RNA|MEIS1_ENST00000444274.2_Missense_Mutation_p.A90D|MEIS1_ENST00000495021.2_Missense_Mutation_p.A57D|MEIS1_ENST00000560281.2_Missense_Mutation_p.A122D|MEIS1_ENST00000407092.2_Missense_Mutation_p.A122D	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	122					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						GAAGATATAGCCGTGTTCGCC	0.532																																					p.A122D		.											.	MEIS1	226	0			c.C365A						.						40.0	38.0	38.0					2																	66667100		1836	4082	5918	SO:0001583	missense	4211	exon3			ATATAGCCGTGTT		CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.365C>A	2.37:g.66667100C>A	ENSP00000272369:p.Ala122Asp	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	26.0	NM_002398	A8MV50	Missense_Mutation	SNP	ENST00000272369.9	37	CCDS46309.1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650991	0.67472	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000444274;ENST00000495021	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.49253	0.1546	L	0.49571	1.57	0.80722	D	1	B;D;P;D	0.63046	0.016;0.992;0.895;0.984	B;D;P;D	0.65140	0.017;0.932;0.652;0.917	T	0.26950	-1.0088	9	.	.	.	.	18.7057	0.91637	0.0:1.0:0.0:0.0	.	57;120;122;122	F5GYS8;O00470-2;O00470;F8W8U3	.;.;MEIS1_HUMAN;.	D	122;122;120;90;57	ENSP00000272369:A122D;ENSP00000384461:A122D;ENSP00000381518:A120D;ENSP00000403206:A90D;ENSP00000440571:A57D	.	A	+	2	0	MEIS1	66520604	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.623000	0.83113	2.735000	0.93741	0.655000	0.94253	GCC	.		0.532	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319725.4	NM_002398	
MLH1	4292	broad.mit.edu;bcgsc.ca	37	3	37048518	37048518	+	Silent	SNP	T	T	C	rs587779015		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:37048518T>C	ENST00000231790.2	+	5	633	c.417T>C	c.(415-417)ccT>ccC	p.P139P	MLH1_ENST00000492474.1_3'UTR|MLH1_ENST00000435176.1_Silent_p.P41P|MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000455445.2_5'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	139					ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						AAGCCCCTCCTAAACCATGTG	0.363		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.P139P		.	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	.	MLH1	2559	1	Whole gene deletion(1)	ovary(1)	c.T417C						.						76.0	81.0	79.0					3																	37048518		2203	4300	6503	SO:0001819	synonymous_variant	4292	exon5	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CCCTCCTAAACCA	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.417T>C	3.37:g.37048518T>C		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	92.0	5.0	NM_000249	B4DI13|B4DQ11|E9PCU2	Silent	SNP	ENST00000231790.2	37	CCDS2663.1	.	.	.	.	.	.	.	.	.	.	T	11.31	1.601459	0.28534	.	.	ENSG00000076242	ENST00000383761;ENST00000456676	.	.	.	6.16	0.941	0.19519	.	.	.	.	.	T	0.42359	0.1199	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23833	-1.0177	4	.	.	.	-14.0916	1.5893	0.02650	0.1329:0.2955:0.1382:0.4334	.	.	.	.	P	4;131	.	.	L	+	2	0	MLH1	37023522	0.996000	0.38824	0.999000	0.59377	0.996000	0.88848	0.292000	0.19011	0.207000	0.20607	0.528000	0.53228	CTA	.		0.363	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253337.2	NM_000249	
KMT2C	58508	ucsc.edu;bcgsc.ca	37	7	151935910	151935910	+	Splice_Site	SNP	C	C	T	rs4024419	byFrequency	TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr7:151935910C>T	ENST00000262189.6	-	15	2752	c.2534G>A	c.(2533-2535)gGg>gAg	p.G845E	KMT2C_ENST00000355193.2_Splice_Site_p.G845E	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	845					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ACTCCAAGCCCCCTAGGATAT	0.448																																					p.G845E		.											.	MLL3	1398	0			c.G2534A						.						54.0	57.0	56.0					7																	151935910		2202	4296	6498	SO:0001630	splice_region_variant	58508	exon15			CAAGCCCCCTAGG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2533-1G>A	7.37:g.151935910C>T		Somatic	82.0	0.0		WXS	Illumina HiSeq	.	178.0	36.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.836347	0.71373	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.85339	-1.97;-1.97	5.53	5.53	0.82687	.	0.000000	0.44902	D	0.000406	D	0.91178	0.7221	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91202	0.4992	10	0.66056	D	0.02	.	19.8258	0.96617	0.0:1.0:0.0:0.0	rs4024419	845	Q8NEZ4	MLL3_HUMAN	E	845	ENSP00000262189:G845E;ENSP00000347325:G845E	ENSP00000262189:G845E	G	-	2	0	MLL3	151566843	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.601000	0.67606	2.749000	0.94314	0.650000	0.86243	GGG	C|0.967;T|0.033		0.448	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		Missense_Mutation
MMP19	4327	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56231749	56231750	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr12:56231749_56231750delCA	ENST00000322569.4	-	7	1028_1029	c.937_938delTG	c.(937-939)tggfs	p.W313fs	TMEM198B_ENST00000478241.1_RNA|MMP19_ENST00000548629.1_Frame_Shift_Del_p.W290fs|MMP19_ENST00000394182.1_Frame_Shift_Del_p.W27fs|MMP19_ENST00000409200.3_Frame_Shift_Del_p.V266fs	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	313					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	TGATACAGTCCACACATAGTCC	0.545																																					p.313_313del		.											.	MMP19	227	0			c.937_938del						.																																			SO:0001589	frameshift_variant	4327	exon7			ACAGTCCACACAT	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.937_938delTG	12.37:g.56231753_56231754delCA	ENSP00000313437:p.Trp313fs	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	84.0	33.0	NM_002429	B4E030|O15278|O95606|Q99580	Frame_Shift_Del	DEL	ENST00000322569.4	37	CCDS8895.1																																																																																			.		0.545	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408023.1	NM_002429	
MRPL49	740	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	64889822	64889822	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr11:64889822G>C	ENST00000279242.2	+	1	23	c.4G>C	c.(4-6)Gca>Cca	p.A2P	FAU_ENST00000434372.2_5'Flank|FAU_ENST00000529259.1_5'Flank|FAU_ENST00000529639.1_5'UTR|MRPL49_ENST00000534078.1_Missense_Mutation_p.A2P|FAU_ENST00000531743.1_5'Flank|MRPL49_ENST00000526171.1_Missense_Mutation_p.A2P|FAU_ENST00000527548.1_5'Flank|MRPL49_ENST00000531705.1_Missense_Mutation_p.A2P|FAU_ENST00000525297.1_5'Flank|MRPL49_ENST00000524482.1_Intron|FAU_ENST00000279259.3_5'Flank	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49	2					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						GGTAAAGATGGCAGCTACCAT	0.677																																					p.A2P		.											.	MRPL49	90	0			c.G4C						.						103.0	80.0	88.0					11																	64889822		2201	4297	6498	SO:0001583	missense	740	exon1			AAGATGGCAGCTA		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608	ENST00000279242.2:c.4G>C	11.37:g.64889822G>C	ENSP00000279242:p.Ala2Pro	Somatic	30.0	1.0		WXS	Illumina HiSeq	Phase_I	58.0	18.0	NM_004927	B2R4G6	Missense_Mutation	SNP	ENST00000279242.2	37	CCDS8096.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.973022	0.34848	.	.	ENSG00000149792	ENST00000534078;ENST00000526171;ENST00000279242;ENST00000531705	T;T;T;T	0.63744	-0.06;0.39;0.59;0.47	4.69	4.69	0.59074	.	0.404475	0.26244	N	0.025494	T	0.72479	0.3465	L	0.47716	1.5	0.42313	D	0.992223	D	0.89917	1.0	D	0.83275	0.996	T	0.74919	-0.3500	10	0.87932	D	0	-1.6937	13.3021	0.60332	0.0:0.0:1.0:0.0	.	2	Q13405	RM49_HUMAN	P	2	ENSP00000434222:A2P;ENSP00000437177:A2P;ENSP00000279242:A2P;ENSP00000436740:A2P	ENSP00000279242:A2P	A	+	1	0	MRPL49	64646398	1.000000	0.71417	0.998000	0.56505	0.030000	0.12068	2.735000	0.47377	2.595000	0.87683	0.563000	0.77884	GCA	.		0.677	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
MTMR14	64419	ucsc.edu;bcgsc.ca	37	3	9731800	9731800	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:9731800G>C	ENST00000296003.4	+	17	1708	c.1586G>C	c.(1585-1587)aGc>aCc	p.S529T	MTMR14_ENST00000420925.1_Intron|MTMR14_ENST00000353332.5_Missense_Mutation_p.S529T|MTMR14_ENST00000351233.5_Intron	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	529					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					AGGATGGGTAGCAGTCCCCTG	0.582																																					p.S529T		.											.	MTMR14	91	0			c.G1586C						.						35.0	38.0	37.0					3																	9731800		1870	4092	5962	SO:0001583	missense	64419	exon17			TGGGTAGCAGTCC	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1586G>C	3.37:g.9731800G>C	ENSP00000296003:p.Ser529Thr	Somatic	27.0	0.0		WXS	Illumina HiSeq	.	46.0	4.0	NM_001077526	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	ENST00000296003.4	37	CCDS43043.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773465	0.90108	.	.	ENSG00000163719	ENST00000353332;ENST00000296003	T	0.26067	1.76	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	L	0.38953	1.18	0.80722	D	1	D;D	0.69078	0.992;0.997	D;D	0.74674	0.984;0.98	T	0.04360	-1.0957	10	0.12103	T	0.63	-11.1383	19.7405	0.96228	0.0:0.0:1.0:0.0	.	529;529	Q8NCE2-2;Q8NCE2	.;MTMRE_HUMAN	T	529	ENSP00000296003:S529T	ENSP00000296003:S529T	S	+	2	0	MTMR14	9706800	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.806000	0.91930	2.655000	0.90218	0.655000	0.94253	AGC	.		0.582	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338435.1	NM_022485	
MRPS22	56945	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	139062911	139062911	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:139062911A>T	ENST00000495075.1	+	3	475	c.43A>T	c.(43-45)Agg>Tgg	p.R15W	MRPS22_ENST00000478464.1_5'Flank|MRPS22_ENST00000310776.4_Missense_Mutation_p.R15W|MRPS22_ENST00000465056.1_Missense_Mutation_p.R15W			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	15						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						GAGCCTCTTGAGGAGTTCTCC	0.602																																					p.R15W		.											.	MRPS22	93	0			c.A43T						.						51.0	51.0	51.0					3																	139062911		2203	4300	6503	SO:0001583	missense	56945	exon1			CTCTTGAGGAGTT	AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.43A>T	3.37:g.139062911A>T	ENSP00000418008:p.Arg15Trp	Somatic	26.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	18.0	NM_020191	Q9H3I1	Missense_Mutation	SNP	ENST00000495075.1	37	CCDS3107.1	.	.	.	.	.	.	.	.	.	.	A	14.19	2.461464	0.43736	.	.	ENSG00000175110	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000465373	D;D;D;T	0.82984	-1.67;-1.67;-1.67;-1.09	4.01	1.49	0.22878	.	3.538940	0.00815	N	0.001535	T	0.70168	0.3193	N	0.14661	0.345	0.09310	N	1	P;P	0.47106	0.89;0.824	B;B	0.40285	0.325;0.173	T	0.63341	-0.6659	10	0.59425	D	0.04	8.1781	2.9878	0.05973	0.6673:0.0:0.1186:0.2141	.	15;15	G5E9V5;P82650	.;RT22_HUMAN	W	15;15;15;11	ENSP00000418008:R15W;ENSP00000310785:R15W;ENSP00000418233:R15W;ENSP00000419920:R11W	ENSP00000310785:R15W	R	+	1	2	MRPS22	140545601	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.067000	0.11579	0.197000	0.20387	0.482000	0.46254	AGG	.		0.602	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358120.1	NM_020191	
MYNN	55892	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	169504351	169504351	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:169504351A>G	ENST00000349841.5	+	8	2381	c.1718A>G	c.(1717-1719)cAt>cGt	p.H573R	MYNN_ENST00000356716.4_Missense_Mutation_p.H573R|MYNN_ENST00000544106.1_Missense_Mutation_p.H544R	NM_018657.4	NP_061127.1	Q9NPC7	MYNN_HUMAN	myoneurin	573					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			ACTGAGGACCATCACATGCTT	0.408																																					p.H573R		.											.	MYNN	91	0			c.A1718G						.						125.0	118.0	120.0					3																	169504351		2203	4300	6503	SO:0001583	missense	55892	exon9			AGGACCATCACAT	AF148848	CCDS3207.1, CCDS54671.1	3q26.31	2013-01-09			ENSG00000085274	ENSG00000085274		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	14955	protein-coding gene	gene with protein product		606042				10873615	Standard	NM_001185118		Approved	SBBIZ1, ZBTB31, ZNF902	uc010hwo.3	Q9NPC7		ENST00000349841.5:c.1718A>G	3.37:g.169504351A>G	ENSP00000326240:p.His573Arg	Somatic	125.0	1.0		WXS	Illumina HiSeq	Phase_I	297.0	92.0	NM_001185118	B2R6C9|Q6QHA6|Q6QHA7|Q6R3G1|Q6R3G2|Q6R4A0|Q7Z716|Q7Z717|Q86Z11|Q86Z12|Q9NS01|Q9UIW8	Missense_Mutation	SNP	ENST00000349841.5	37	CCDS3207.1	.	.	.	.	.	.	.	.	.	.	A	15.89	2.967242	0.53507	.	.	ENSG00000085274	ENST00000356716;ENST00000349841;ENST00000544106	T;T;T	0.09817	3.12;3.12;2.94	5.34	5.34	0.76211	.	0.083162	0.50627	D	0.000106	T	0.16085	0.0387	N	0.24115	0.695	0.80722	D	1	D;P	0.52996	0.957;0.932	P;P	0.58520	0.743;0.84	T	0.01684	-1.1296	10	0.72032	D	0.01	.	11.3507	0.49585	0.8483:0.1517:0.0:0.0	.	544;573	Q9NPC7-2;Q9NPC7	.;MYNN_HUMAN	R	573;573;544	ENSP00000349150:H573R;ENSP00000326240:H573R;ENSP00000440637:H544R	ENSP00000326240:H573R	H	+	2	0	MYNN	170987045	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	3.854000	0.55949	2.039000	0.60335	0.459000	0.35465	CAT	.		0.408	MYNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467801.1	NM_018657	
NPY2R	4887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	156135578	156135578	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr4:156135578C>G	ENST00000329476.3	+	2	976	c.487C>G	c.(487-489)Cga>Gga	p.R163G	NPY2R_ENST00000506608.1_Missense_Mutation_p.R163G	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	163					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	GATCTCCAAGCGAATCAGCTT	0.552																																					p.R163G		.											.	NPY2R	523	0			c.C487G						.						55.0	51.0	52.0					4																	156135578		2203	4300	6503	SO:0001583	missense	4887	exon2			TCCAAGCGAATCA	U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.487C>G	4.37:g.156135578C>G	ENSP00000332591:p.Arg163Gly	Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	19.0	NM_000910	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	ENST00000329476.3	37	CCDS3791.1	.	.	.	.	.	.	.	.	.	.	C	8.336	0.827495	0.16749	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.42131	0.98;0.98	5.74	1.05	0.20165	GPCR, rhodopsin-like superfamily (1);	0.627067	0.16311	N	0.220016	T	0.44993	0.1320	M	0.67953	2.075	0.09310	N	1	B	0.22683	0.073	B	0.28553	0.091	T	0.47935	-0.9078	10	0.46703	T	0.11	.	16.4727	0.84115	0.5564:0.4436:0.0:0.0	.	163	P49146	NPY2R_HUMAN	G	163	ENSP00000332591:R163G;ENSP00000426366:R163G	ENSP00000332591:R163G	R	+	1	2	NPY2R	156355028	0.035000	0.19736	0.221000	0.23827	0.744000	0.42396	0.458000	0.21892	0.190000	0.20209	0.643000	0.83706	CGA	.		0.552	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365128.1	NM_000910	
NUP88	4927	ucsc.edu;bcgsc.ca	37	17	5319994	5319994	+	Silent	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr17:5319994A>G	ENST00000573584.1	-	2	815	c.306T>C	c.(304-306)ctT>ctC	p.L102L	RPAIN_ENST00000536255.2_5'Flank|RPAIN_ENST00000381208.5_5'Flank|RPAIN_ENST00000381209.3_5'Flank	NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	102					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)			endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						GATTTATGCAAAGCAATCTCT	0.318																																					p.L102L		.											.	NUP88	204	0			c.T306C						.						89.0	86.0	87.0					17																	5319994		2203	4299	6502	SO:0001819	synonymous_variant	4927	exon2			TATGCAAAGCAAT	Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.306T>C	17.37:g.5319994A>G		Somatic	59.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_002532	D3DTM2|Q9BWE5	Silent	SNP	ENST00000573584.1	37	CCDS11070.1																																																																																			.		0.318	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216918.3	NM_002532	
OGDHL	55753	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	50947868	50947868	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr10:50947868C>A	ENST00000374103.4	-	17	2243	c.2158G>T	c.(2158-2160)Gcc>Tcc	p.A720S	OGDHL_ENST00000419399.1_Missense_Mutation_p.A663S|OGDHL_ENST00000490844.1_5'Flank|OGDHL_ENST00000432695.1_Missense_Mutation_p.A511S	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	720					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CTGGCCATGGCATAGCCCAGC	0.547																																					p.A720S		.											.	OGDHL	69	0			c.G2158T						.						65.0	59.0	61.0					10																	50947868		2203	4300	6503	SO:0001583	missense	55753	exon17			CCATGGCATAGCC	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2158G>T	10.37:g.50947868C>A	ENSP00000363216:p.Ala720Ser	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	29.0	NM_018245	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	37	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	C	6.641	0.486774	0.12641	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.96491	-4.03;-4.03;-4.03	4.61	3.71	0.42584	Transketolase-like, pyrimidine-binding domain (2);	0.057465	0.64402	D	0.000002	D	0.85414	0.5691	N	0.01289	-0.905	0.80722	D	1	B;B;B	0.10296	0.002;0.001;0.003	B;B;B	0.23018	0.025;0.006;0.043	T	0.79825	-0.1640	10	0.02654	T	1	.	12.479	0.55831	0.0:0.9183:0.0:0.0817	.	663;511;720	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	S	720;663;511	ENSP00000363216:A720S;ENSP00000401356:A663S;ENSP00000390240:A511S	ENSP00000363216:A720S	A	-	1	0	OGDHL	50617874	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.811000	0.86092	0.950000	0.37743	0.446000	0.29264	GCC	.		0.547	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
PAM	5066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	102203011	102203011	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr5:102203011T>A	ENST00000438793.3	+	2	594	c.124T>A	c.(124-126)Tgt>Agt	p.C42S	PAM_ENST00000304400.7_Missense_Mutation_p.C42S|PAM_ENST00000274392.9_5'UTR|PAM_ENST00000455264.2_Missense_Mutation_p.C42S|PAM_ENST00000348126.2_Missense_Mutation_p.C42S|PAM_ENST00000513648.1_3'UTR|PAM_ENST00000346918.2_Missense_Mutation_p.C42S|PAM_ENST00000379787.4_5'UTR	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	42	Peptidylglycine alpha-hydroxylating monooxygenase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TTCCAATGAATGTCTTGGTAC	0.383																																					p.C42S		.											.	PAM	68	0			c.T124A						.						143.0	128.0	133.0					5																	102203011		2203	4300	6503	SO:0001583	missense	5066	exon2			AATGAATGTCTTG	AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.124T>A	5.37:g.102203011T>A	ENSP00000396493:p.Cys42Ser	Somatic	78.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	66.0	NM_138822	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	ENST00000438793.3	37	CCDS54885.1	.	.	.	.	.	.	.	.	.	.	T	19.53	3.845756	0.71603	.	.	ENSG00000145730	ENST00000511839;ENST00000511477;ENST00000509832;ENST00000438793;ENST00000346918;ENST00000348126;ENST00000304400;ENST00000455264	T;T;T;T;T;T;T	0.71579	-0.56;-0.58;0.93;0.81;0.85;0.93;0.82	5.68	5.68	0.88126	PHM/PNGase F domain (1);	0.000000	0.85682	D	0.000000	T	0.77678	0.4166	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.999;0.999;0.999;0.999	D;D;D;D;D	0.81914	0.988;0.995;0.995;0.995;0.993	T	0.80169	-0.1494	10	0.72032	D	0.01	.	15.9313	0.79663	0.0:0.0:0.0:1.0	.	42;42;42;42;42	P19021;P19021-4;P19021-3;P19021-5;P19021-2	AMD_HUMAN;.;.;.;.	S	42	ENSP00000426448:C42S;ENSP00000423763:C42S;ENSP00000396493:C42S;ENSP00000282992:C42S;ENSP00000314638:C42S;ENSP00000306100:C42S;ENSP00000403461:C42S	ENSP00000306100:C42S	C	+	1	0	PAM	102230910	1.000000	0.71417	1.000000	0.80357	0.443000	0.32047	5.804000	0.69135	2.163000	0.67991	0.402000	0.26972	TGT	.		0.383	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250640.2	NM_000919	
PBRM1	55193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	52662939	52662939	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr3:52662939G>A	ENST00000296302.7	-	12	1415	c.1414C>T	c.(1414-1416)Cga>Tga	p.R472*	PBRM1_ENST00000337303.4_Nonsense_Mutation_p.R472*|PBRM1_ENST00000409114.3_Nonsense_Mutation_p.R472*|PBRM1_ENST00000356770.4_Nonsense_Mutation_p.R440*|PBRM1_ENST00000394830.3_Nonsense_Mutation_p.R472*|PBRM1_ENST00000410007.1_Nonsense_Mutation_p.R472*|PBRM1_ENST00000409057.1_Nonsense_Mutation_p.R472*|PBRM1_ENST00000409767.1_Nonsense_Mutation_p.R472*			Q86U86	PB1_HUMAN	polybromo 1	472					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTAGAACTCGCTTGTAGATG	0.318			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.R472X		.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	575	0			c.C1414T						.						101.0	95.0	97.0					3																	52662939		2203	4300	6503	SO:0001587	stop_gained	55193	exon13			GAACTCGCTTGTA	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1414C>T	3.37:g.52662939G>A	ENSP00000296302:p.Arg472*	Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	60.0	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Nonsense_Mutation	SNP	ENST00000296302.7	37		.	.	.	.	.	.	.	.	.	.	G	37	6.182101	0.97352	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351;ENST00000446103	.	.	.	5.4	1.45	0.22620	.	0.136047	0.50627	D	0.000116	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-21.0362	11.5495	0.50713	0.0:0.1018:0.3723:0.5259	.	.	.	.	X	440;472;472;472;472;472;472;472;472;416	.	ENSP00000296302:R472X	R	-	1	2	PBRM1	52637979	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	2.206000	0.42779	-0.016000	0.14127	-0.309000	0.09137	CGA	.		0.318	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
PCDHGA12	26025	hgsc.bcm.edu;mdanderson.org	37	5	140871440	140871440	+	Intron	SNP	A	A	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr5:140871440A>T	ENST00000252085.3	+	2	2566				PCDHGB4_ENST00000519479.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGC5_ENST00000252087.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA11_ENST00000518882.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAGTGGCCGATTAAGGGATG	0.652																																					p.D878V		.											.	PCDHGC5	25	0			c.A2633T						.						11.0	15.0	13.0					5																	140871440		1085	2153	3238	SO:0001627	intron_variant	56097	exon1			TGGCCGATTAAGG	AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.2425-2934A>T	5.37:g.140871440A>T		Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	141.0	28.0	NM_032407	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	ENST00000252085.3	37	CCDS4260.1																																																																																			.		0.652	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251806.2	NM_003735	
PDE4DIP	9659	broad.mit.edu;bcgsc.ca	37	1	144915562	144915562	+	Silent	SNP	C	C	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:144915562C>T	ENST00000369354.3	-	14	2052	c.1863G>A	c.(1861-1863)caG>caA	p.Q621Q	PDE4DIP_ENST00000479408.2_Silent_p.Q408Q|PDE4DIP_ENST00000369356.4_Silent_p.Q621Q|PDE4DIP_ENST00000369351.3_Silent_p.Q621Q|PDE4DIP_ENST00000313431.9_Silent_p.Q784Q|PDE4DIP_ENST00000313382.9_Silent_p.Q687Q|PDE4DIP_ENST00000369349.3_Silent_p.Q621Q|PDE4DIP_ENST00000530740.1_Silent_p.Q758Q|PDE4DIP_ENST00000529945.1_Silent_p.Q784Q|PDE4DIP_ENST00000369359.4_Silent_p.Q758Q			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	621					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TTTCCTTTCGCTGTAGACGCT	0.483			T	PDGFRB	MPD																																p.Q784Q		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	663	0			c.G2352A						.						217.0	197.0	204.0					1																	144915562		2203	4296	6499	SO:0001819	synonymous_variant	9659	exon10			CTTTCGCTGTAGA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1863G>A	1.37:g.144915562C>T		Somatic	136.0	1.0		WXS	Illumina HiSeq	Phase_I	532.0	59.0	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	37	CCDS30824.1																																																																																			.		0.483	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
PEAK1	79834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	15	77425574	77425574	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr15:77425574C>A	ENST00000560626.2	-	6	4325	c.3850G>T	c.(3850-3852)Gag>Tag	p.E1284*	PEAK1_ENST00000312493.4_Nonsense_Mutation_p.E1284*			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1284					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										ACTACTTCCTCCCGATTCTCA	0.532																																					p.E1284X		.											.	.	.	0			c.G3850T						.						147.0	143.0	144.0					15																	77425574		1877	4106	5983	SO:0001587	stop_gained	0	exon7			CTTCCTCCCGATT		CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.3850G>T	15.37:g.77425574C>A	ENSP00000452796:p.Glu1284*	Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	234.0	85.0	NM_024776	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Nonsense_Mutation	SNP	ENST00000560626.2	37	CCDS42062.1	.	.	.	.	.	.	.	.	.	.	C	46	12.343992	0.99659	.	.	ENSG00000173517	ENST00000312493	.	.	.	5.61	5.61	0.85477	.	0.107611	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-9.2526	12.908	0.58164	0.0:0.9258:0.0:0.0742	.	.	.	.	X	1284	.	ENSP00000309230:E1284X	E	-	1	0	AC087465.1	75212629	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.091000	0.71406	2.642000	0.89623	0.655000	0.94253	GAG	.		0.532	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419483.3		
PEG10	23089	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	94293700	94293700	+	Missense_Mutation	SNP	C	C	T	rs376581536		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr7:94293700C>T	ENST00000482108.1	+	2	1311	c.832C>T	c.(832-834)Cgc>Tgc	p.R278C	PEG10_ENST00000488574.1_Missense_Mutation_p.R278C	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	278					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			GGGAGGTGCCCGCATGCGCCT	0.597																																					p.R354C		.											PEG10,brain,glioma,-1	PEG10	23	0			c.C1060T						.	C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	0,3974		0,0,1987	18.0	24.0	22.0		832,1060,1060,934,934,832	4.3	1.0	7		22	1,8303		0,1,4151	no	missense,missense,missense,missense,missense,missense	PEG10	NM_001040152.1,NM_001172437.1,NM_001172438.1,NM_001184961.1,NM_001184962.1,NM_015068.3	180,180,180,180,180,180	0,1,6138	TT,TC,CC		0.012,0.0,0.0081	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	278/326,354/785,354/402,312/743,312/360,278/709	94293700	1,12277	1987	4152	6139	SO:0001583	missense	23089	exon2			GGTGCCCGCATGC	AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.832C>T	7.37:g.94293700C>T	ENSP00000417587:p.Arg278Cys	Somatic	16.0	0.0		WXS	Illumina HiSeq	Phase_I	50.0	18.0	NM_001172438	Q96A68|Q9UPV1	Missense_Mutation	SNP	ENST00000482108.1	37	CCDS55126.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927626	0.73327	0.0	1.2E-4	ENSG00000242265	ENST00000482108;ENST00000488574	T;T	0.15139	2.45;2.45	4.34	4.34	0.51931	.	.	.	.	.	T	0.29652	0.0740	L	0.34521	1.04	0.40084	D	0.976172	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.948	T	0.03619	-1.1019	9	0.56958	D	0.05	.	14.7868	0.69810	0.0:1.0:0.0:0.0	.	354;278	B4DSP0;Q86TG7	.;PEG10_HUMAN	C	278	ENSP00000417587:R278C;ENSP00000418944:R278C	ENSP00000417587:R278C	R	+	1	0	PEG10	94131636	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.330000	0.43885	2.429000	0.82318	0.555000	0.69702	CGC	.		0.597	PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340751.1	NM_015068	
PHF10	55274	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	170105298	170105298	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr6:170105298T>C	ENST00000339209.4	-	11	1465	c.1342A>G	c.(1342-1344)Atg>Gtg	p.M448V	PHF10_ENST00000366780.4_Missense_Mutation_p.M446V|C6orf120_ENST00000332290.2_3'UTR	NM_018288.3|NM_133325.2	NP_060758.2|NP_579866.2	Q8WUB8	PHF10_HUMAN	PHD finger protein 10	448					nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	npBAF complex (GO:0071564)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|liver(3)|lung(4)|prostate(2)|urinary_tract(1)	14		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.4e-21)|BRCA - Breast invasive adenocarcinoma(81;1.4e-07)|GBM - Glioblastoma multiforme(31;0.00176)		CAGAACATCATTTCTTCTTCA	0.373																																					p.M448V		.											.	PHF10	226	0			c.A1342G						.						186.0	161.0	169.0					6																	170105298		2203	4300	6503	SO:0001583	missense	55274	exon11			ACATCATTTCTTC	AF338735	CCDS5308.2, CCDS5309.2	6q27	2014-05-13			ENSG00000130024	ENSG00000130024		"""Zinc fingers, PHD-type"""	18250	protein-coding gene	gene with protein product		613069				11827455	Standard	NM_018288		Approved	FLJ10975, XAP135, BAF45a	uc011egy.2	Q8WUB8	OTTHUMG00000016058	ENST00000339209.4:c.1342A>G	6.37:g.170105298T>C	ENSP00000341805:p.Met448Val	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	160.0	54.0	NM_018288	Q2YDA3|Q53HG8|Q9BXD2|Q9NV26	Missense_Mutation	SNP	ENST00000339209.4	37	CCDS5308.2	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652033	0.67472	.	.	ENSG00000130024	ENST00000366780;ENST00000339209	D;D	0.88664	-2.41;-2.41	5.91	5.91	0.95273	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.035139	0.85682	D	0.000000	D	0.89996	0.6877	M	0.80332	2.49	0.58432	D	0.999998	P;B	0.46064	0.872;0.392	P;P	0.48304	0.522;0.573	D	0.91696	0.5370	10	0.87932	D	0	-27.6999	15.5248	0.75894	0.0:0.0:0.0:1.0	.	446;448	Q8WUB8-2;Q8WUB8	.;PHF10_HUMAN	V	446;448	ENSP00000355743:M446V;ENSP00000341805:M448V	ENSP00000341805:M448V	M	-	1	0	PHF10	169847223	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.457000	0.80775	2.269000	0.75478	0.533000	0.62120	ATG	.		0.373	PHF10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346732.1	NM_018288	
PHLPP2	23035	ucsc.edu;bcgsc.ca	37	16	71703179	71703179	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:71703179T>C	ENST00000568954.1	-	11	2005	c.1627A>G	c.(1627-1629)Aga>Gga	p.R543G	PHLPP2_ENST00000360429.3_Splice_Site_p.R543G|PHLPP2_ENST00000393524.2_Splice_Site_p.R543G|PHLPP2_ENST00000567016.1_Splice_Site_p.R578G|PHLPP2_ENST00000356272.3_Splice_Site_p.R543G			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	543					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						CACACATACCTCACGGGAACC	0.393																																					p.R543G		.											.	PHLPP2	91	0			c.A1627G						.						87.0	90.0	89.0					16																	71703179		2198	4300	6498	SO:0001630	splice_region_variant	23035	exon10			CATACCTCACGGG	BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.1628+1A>G	16.37:g.71703179T>C		Somatic	33.0	0.0		WXS	Illumina HiSeq	.	35.0	4.0	NM_015020	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	ENST00000568954.1	37	CCDS32479.1	.	.	.	.	.	.	.	.	.	.	T	14.97	2.694064	0.48202	.	.	ENSG00000040199	ENST00000299971;ENST00000360429;ENST00000356272;ENST00000393524	T;T;T	0.33216	1.42;1.46;2.33	5.23	4.12	0.48240	.	0.000000	0.85682	D	0.000000	T	0.39627	0.1085	L	0.31845	0.965	0.54753	D	0.99998	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.07443	-1.0772	10	0.20519	T	0.43	-12.2313	10.538	0.45016	0.0:0.0:0.3119:0.6881	.	543;543	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	G	350;543;543;543	ENSP00000353610:R543G;ENSP00000348611:R543G;ENSP00000377159:R543G	ENSP00000299971:R350G	R	-	1	2	PHLPP2	70260680	0.997000	0.39634	0.956000	0.39512	0.310000	0.27922	2.673000	0.46858	0.804000	0.34136	0.460000	0.39030	AGA	.		0.393	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000434139.1	NM_015020	Missense_Mutation
PIK3C2G	5288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	18534747	18534747	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr12:18534747A>T	ENST00000266497.5	+	12	1843	c.1805A>T	c.(1804-1806)gAg>gTg	p.E602V	PIK3C2G_ENST00000538779.1_Missense_Mutation_p.E643V|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.E602V			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	602	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TTACAGAGTGAGCCTCCCGTA	0.473																																					p.E602V		.											.	PIK3C2G	1312	0			c.A1805T						.						136.0	129.0	131.0					12																	18534747		1917	4132	6049	SO:0001583	missense	5288	exon13			AGAGTGAGCCTCC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1805A>T	12.37:g.18534747A>T	ENSP00000266497:p.Glu602Val	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	120.0	51.0	NM_004570	A1L3U0	Missense_Mutation	SNP	ENST00000266497.5	37	CCDS44839.1	.	.	.	.	.	.	.	.	.	.	A	14.44	2.535389	0.45176	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.71341	-0.56;-0.56;-0.56	4.35	3.17	0.36434	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.871539	0.10193	N	0.704434	T	0.78541	0.4299	M	0.65975	2.015	0.33065	D	0.534569	D;D;D	0.58620	0.983;0.978;0.965	P;P;P	0.62382	0.901;0.84;0.83	T	0.75213	-0.3397	10	0.32370	T	0.25	-12.1363	7.9803	0.30179	0.7924:0.2076:0.0:0.0	.	642;643;602	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	V	602;602;643	ENSP00000404845:E602V;ENSP00000266497:E602V;ENSP00000445381:E643V	ENSP00000266497:E602V	E	+	2	0	PIK3C2G	18426014	0.996000	0.38824	1.000000	0.80357	0.650000	0.38633	1.407000	0.34657	0.957000	0.37930	0.460000	0.39030	GAG	.		0.473	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
PLCB4	5332	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	9319627	9319627	+	Silent	SNP	A	A	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr20:9319627A>C	ENST00000378493.1	+	4	327	c.312A>C	c.(310-312)acA>acC	p.T104T	PLCB4_ENST00000414679.2_Silent_p.T104T|PLCB4_ENST00000378501.2_Silent_p.T104T|PLCB4_ENST00000278655.4_Silent_p.T104T|PLCB4_ENST00000378473.3_Silent_p.T104T|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000334005.3_Silent_p.T104T			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	104					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						GCAGTGGCACAGATCTAGTGA	0.433																																					p.T104T		.											.	PLCB4	274	0			c.A312C						.						151.0	135.0	140.0					20																	9319627		2203	4300	6503	SO:0001819	synonymous_variant	5332	exon5			TGGCACAGATCTA		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.312A>C	20.37:g.9319627A>C		Somatic	60.0	2.0		WXS	Illumina HiSeq	Phase_I	126.0	42.0	NM_182797	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	37	CCDS13105.1																																																																																			.		0.433	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
PROX2	283571	broad.mit.edu;ucsc.edu;mdanderson.org	37	14	75330524	75330524	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:75330524G>T	ENST00000445876.1	-	1	13	c.14C>A	c.(13-15)tCc>tAc	p.S5Y	PROX2_ENST00000556489.2_Missense_Mutation_p.S5Y|PROX2_ENST00000556084.2_Missense_Mutation_p.S5Y			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	5					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		AAGCAAGATGGAGTTTGGATC	0.552																																					p.S5Y		.											.	PROX2	69	0			c.C14A						.						66.0	68.0	67.0					14																	75330524		1986	4153	6139	SO:0001583	missense	283571	exon1			AAGATGGAGTTTG		CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.14C>A	14.37:g.75330524G>T	ENSP00000405932:p.Ser5Tyr	Somatic	10.0	0.0		WXS	Illumina HiSeq	Phase_I	21.0	9.0	NM_001080408	C9J5W1|Q8N9Q3	Missense_Mutation	SNP	ENST00000445876.1	37	CCDS45136.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.84|17.84	3.488935|3.488935	0.64074|0.64074	.|.	.|.	ENSG00000119608|ENSG00000119608	ENST00000556084|ENST00000556489;ENST00000389664;ENST00000424024;ENST00000445876	.|T;T	.|0.47177	.|0.85;0.85	4.76|4.76	1.83|1.83	0.25207|0.25207	.|.	.|1.400140	.|0.04728	.|N	.|0.420662	T|T	0.32346|0.32346	0.0826|0.0826	L|L	0.36672|0.36672	1.1|1.1	0.09310|0.09310	N|N	1|1	.|P	.|0.40398	.|0.716	.|B	.|0.34242	.|0.178	T|T	0.22871|0.22871	-1.0204|-1.0204	5|10	.|0.29301	.|T	.|0.29	-1.0645|-1.0645	2.3974|2.3974	0.04393|0.04393	0.2244:0.1309:0.5105:0.1342|0.2244:0.1309:0.5105:0.1342	.|.	.|5	.|G3V3G0	.|.	T|Y	5|5	.|ENSP00000451223:S5Y;ENSP00000405932:S5Y	.|ENSP00000374315:S5Y	P|S	-|-	1|2	0|0	PROX2|PROX2	74400277|74400277	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.970000|0.970000	0.65996|0.65996	0.616000|0.616000	0.24344|0.24344	0.607000|0.607000	0.29982|0.29982	0.561000|0.561000	0.74099|0.74099	CCA|TCC	.		0.552	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
PTPN3	5774	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	112200499	112200499	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr9:112200499T>C	ENST00000374541.2	-	8	586	c.482A>G	c.(481-483)tAt>tGt	p.Y161C	PTPN3_ENST00000262539.3_Missense_Mutation_p.Y52C|PTPN3_ENST00000446349.1_Missense_Mutation_p.Y30C|PTPN3_ENST00000412145.1_Missense_Mutation_p.Y30C	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	161	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GGAAGAATTATAGTCTCCAAA	0.353																																					p.Y161C		.											.	PTPN3	229	0			c.A482G						.						71.0	75.0	74.0					9																	112200499		2203	4300	6503	SO:0001583	missense	5774	exon8			GAATTATAGTCTC		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.482A>G	9.37:g.112200499T>C	ENSP00000363667:p.Tyr161Cys	Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	35.0	11.0	NM_001145368	A0AUW9|E7EN99|E9PGU7	Missense_Mutation	SNP	ENST00000374541.2	37	CCDS6776.1	.	.	.	.	.	.	.	.	.	.	T	16.14	3.038533	0.55003	.	.	ENSG00000070159	ENST00000394831;ENST00000412145;ENST00000446349;ENST00000374541;ENST00000262539	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.96	4.81	0.61882	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.290359	0.38663	N	0.001618	D	0.84215	0.5423	M	0.78344	2.41	0.80722	D	1	P;D;D	0.59357	0.932;0.985;0.974	P;D;D	0.67103	0.714;0.949;0.925	D	0.85094	0.0953	10	0.87932	D	0	.	10.6503	0.45645	0.1684:0.0:0.0:0.8316	.	52;161;161	B7Z3H5;B7Z9V1;P26045	.;.;PTN3_HUMAN	C	161;30;30;161;52	ENSP00000416654:Y30C;ENSP00000395384:Y30C;ENSP00000363667:Y161C;ENSP00000262539:Y52C	ENSP00000262539:Y52C	Y	-	2	0	PTPN3	111240320	0.952000	0.32445	0.759000	0.31340	0.554000	0.35429	1.687000	0.37680	1.047000	0.40274	0.533000	0.62120	TAT	.		0.353	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
PTPRQ	374462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	80998958	80998958	+	Splice_Site	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr12:80998958C>A	ENST00000266688.5	+	32	4718	c.4718C>A	c.(4717-4719)tCg>tAg	p.S1573*				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1619	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GATGTCAAATCGGTAAGGCAT	0.363																																					p.S1405X		.											.	.	.	0			c.C4214A						.						169.0	131.0	142.0					12																	80998958		692	1590	2282	SO:0001630	splice_region_variant	374462	exon24			TCAAATCGGTAAG	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4719+1C>A	12.37:g.80998958C>A		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	34.0	NM_001145026		Nonsense_Mutation	SNP	ENST00000266688.5	37		.	.	.	.	.	.	.	.	.	.	C	44	10.555321	0.99427	.	.	ENSG00000139304	ENST00000266688	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	.	.	.	X	1573	.	ENSP00000266688:S1573X	S	+	2	0	PTPRQ	79523089	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.276000	0.65580	2.836000	0.97738	0.655000	0.94253	TCG	.		0.363	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	Nonsense_Mutation
RFXAP	5994	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	37399580	37399580	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr13:37399580A>G	ENST00000255476.2	+	2	750	c.616A>G	c.(616-618)Ata>Gta	p.I206V	RFXAP_ENST00000472888.1_3'UTR	NM_000538.3	NP_000529.1	O00287	RFXAP_HUMAN	regulatory factor X-associated protein	206					positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;3.5e-07)|Epithelial(112;1.27e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.0069)|BRCA - Breast invasive adenocarcinoma(63;0.0116)|GBM - Glioblastoma multiforme(144;0.0405)		TGCAGATAACATACTCTCCAT	0.323																																					p.I206V		.											.	RFXAP	91	0			c.A616G						.						96.0	97.0	97.0					13																	37399580		2203	4298	6501	SO:0001583	missense	5994	exon2			GATAACATACTCT	Y12812	CCDS9359.1	13q14	2014-09-17			ENSG00000133111	ENSG00000133111			9988	protein-coding gene	gene with protein product		601861				9118943	Standard	NM_000538		Approved		uc001uvu.1	O00287	OTTHUMG00000016738	ENST00000255476.2:c.616A>G	13.37:g.37399580A>G	ENSP00000255476:p.Ile206Val	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	72.0	19.0	NM_000538	B2R9T8|Q5VZM6|Q8TC40	Missense_Mutation	SNP	ENST00000255476.2	37	CCDS9359.1	.	.	.	.	.	.	.	.	.	.	A	2.616	-0.289716	0.05568	.	.	ENSG00000133111	ENST00000255476	.	.	.	5.92	-1.86	0.07760	.	0.310059	0.35262	N	0.003335	T	0.17746	0.0426	L	0.36672	1.1	0.09310	N	0.999997	B	0.29988	0.264	B	0.28011	0.085	T	0.36286	-0.9754	9	0.02654	T	1	-6.2063	6.5682	0.22523	0.3427:0.1933:0.0:0.464	.	206	O00287	RFXAP_HUMAN	V	206	.	ENSP00000255476:I206V	I	+	1	0	RFXAP	36297580	0.797000	0.28877	0.260000	0.24451	0.993000	0.82548	0.430000	0.21428	-0.108000	0.12066	0.533000	0.62120	ATA	.		0.323	RFXAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044521.1	NM_000538	
RPS6KL1	83694	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	75376302	75376303	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:75376302_75376303insC	ENST00000555647.1	-	8	1500_1501	c.1213_1214insG	c.(1213-1215)gagfs	p.E405fs	RPS6KL1_ENST00000554900.1_5'Flank|RPS6KL1_ENST00000557413.1_Frame_Shift_Ins_p.E405fs|RPS6KL1_ENST00000354625.2_Frame_Shift_Ins_p.E374fs|RPS6KL1_ENST00000358328.4_Frame_Shift_Ins_p.E405fs			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	405	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		CACCCCCTGCTCGTGCAGCGCC	0.703																																					p.E405fs		.											.	RPS6KL1	359	0			c.1214_1215insG						.																																			SO:0001589	frameshift_variant	83694	exon7			CCCTGCTCGTGCA	BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.1214dupG	14.37:g.75376303_75376303dupC	ENSP00000452027:p.Glu405fs	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	32.0	NM_031464	A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Frame_Shift_Ins	INS	ENST00000555647.1	37	CCDS9834.2																																																																																			.		0.703	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413732.1		
SIAH1	6477	hgsc.bcm.edu;broad.mit.edu	37	16	48395633	48395644	+	In_Frame_Del	DEL	CAAGTCAATCGT	CAAGTCAATCGT	-	rs112217260	byFrequency	TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	CAAGTCAATCGT	CAAGTCAATCGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr16:48395633_48395644delCAAGTCAATCGT	ENST00000380006.2	-	1	2149_2160	c.696_707delACGATTGACTTG	c.(694-708)cgacgattgacttgg>cgg	p.RLTW233del	LONP2_ENST00000564259.1_3'UTR|SIAH1_ENST00000356721.3_In_Frame_Del_p.RLTW264del|SIAH1_ENST00000394725.2_In_Frame_Del_p.RLTW233del			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	233	SBD.				anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				AGTCGCTTCCCAAGTCAATCGTCGCCTATGAC	0.453																																					p.263_267del		.											.	SIAH1	415	0			c.789_800del						.																																			SO:0001651	inframe_deletion	6477	exon2			GCTTCCCAAGTCA	U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.696_707delACGATTGACTTG	16.37:g.48395633_48395644delCAAGTCAATCGT	ENSP00000369343:p.Arg233_Trp236del	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	163.0	12.0	NM_001006610	A0FKF3|O43269|Q49A58|Q92880	In_Frame_Del	DEL	ENST00000380006.2	37	CCDS10735.1																																																																																			.		0.453	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256842.12		
SIPA1L1	26037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	72190408	72190408	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:72190408G>A	ENST00000555818.1	+	16	4664	c.4316G>A	c.(4315-4317)aGt>aAt	p.S1439N	SIPA1L1_ENST00000537413.1_Missense_Mutation_p.S893N|SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.S1418N|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.S1418N	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1439	Ser-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GTTTTCACCAGTGCCCGGAGT	0.537																																					p.S1439N		.											.	SIPA1L1	156	0			c.G4316A						.						135.0	111.0	119.0					14																	72190408		2203	4300	6503	SO:0001583	missense	26037	exon16			TCACCAGTGCCCG	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4316G>A	14.37:g.72190408G>A	ENSP00000450832:p.Ser1439Asn	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	124.0	41.0	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	ENST00000555818.1	37	CCDS9807.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674277	0.88445	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;D	0.85484	-1.17;-1.2;-1.17;-1.99	5.54	5.54	0.83059	.	0.170379	0.64402	D	0.000004	D	0.86029	0.5835	N	0.19112	0.55	0.58432	D	0.999999	D;P;D;D;D	0.65815	0.995;0.895;0.989;0.974;0.988	P;B;P;P;P	0.61070	0.836;0.264;0.854;0.796;0.883	D	0.85171	0.0998	10	0.35671	T	0.21	-16.5037	19.8379	0.96666	0.0:0.0:1.0:0.0	.	893;1439;893;1418;1439	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	N	1418;1439;1418;893	ENSP00000370630:S1418N;ENSP00000450832:S1439N;ENSP00000351352:S1418N;ENSP00000440682:S893N	ENSP00000351352:S1439N	S	+	2	0	SIPA1L1	71260161	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.938000	0.70170	2.765000	0.95021	0.655000	0.94253	AGT	.		0.537	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
SKIV2L2	23517	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	54635850	54635850	+	Silent	SNP	A	A	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr5:54635850A>G	ENST00000230640.5	+	6	782	c.528A>G	c.(526-528)gcA>gcG	p.A176A	SKIV2L2_ENST00000545714.1_Silent_p.A75A	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	176	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				ATGCCATTGCATTGGCCTTAA	0.308																																					p.A176A	Melanoma(2;92 134 23744 29976 33782)	.											.	SKIV2L2	92	0			c.A528G						.						106.0	101.0	103.0					5																	54635850		2203	4300	6503	SO:0001819	synonymous_variant	23517	exon6			CATTGCATTGGCC	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.528A>G	5.37:g.54635850A>G		Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	198.0	108.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	ENST00000230640.5	37	CCDS3967.1																																																																																			.		0.308	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
SLITRK1	114798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	84454266	84454266	+	Silent	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr13:84454266G>A	ENST00000377084.2	-	1	2262	c.1377C>T	c.(1375-1377)atC>atT	p.I459I		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	459					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GGATGAGCTGGATAGCGTTGT	0.542																																					p.I459I		.											.	SLITRK1	94	0			c.C1377T						.						92.0	82.0	86.0					13																	84454266		2203	4300	6503	SO:0001819	synonymous_variant	114798	exon1			GAGCTGGATAGCG	AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1377C>T	13.37:g.84454266G>A		Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	153.0	51.0	NM_052910	Q5U5I6|Q96SF9	Silent	SNP	ENST00000377084.2	37	CCDS9464.1																																																																																			.		0.542	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045396.1	NM_052910	
SPTBN5	51332	ucsc.edu;bcgsc.ca	37	15	42154364	42154364	+	Silent	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr15:42154364T>C	ENST00000320955.6	-	44	7739	c.7512A>G	c.(7510-7512)gaA>gaG	p.E2504E		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2504					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TACGCCGGGCTTCCACAGGGC	0.627																																					p.E2469E		.											.	SPTBN5	91	0			c.A7407G						.						24.0	27.0	26.0					15																	42154364		2048	4171	6219	SO:0001819	synonymous_variant	51332	exon44			CCGGGCTTCCACA	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.7512A>G	15.37:g.42154364T>C		Somatic	35.0	0.0		WXS	Illumina HiSeq	.	63.0	5.0	NM_016642		Silent	SNP	ENST00000320955.6	37																																																																																				.		0.627	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
SSC4D	136853	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	76029847	76029847	+	Silent	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr7:76029847G>T	ENST00000275560.3	-	4	578	c.231C>A	c.(229-231)ggC>ggA	p.G77G	ZP3_ENST00000336517.4_Intron	NM_080744.1	NP_542782.1														autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						TGCCCCAGGAGCCACCGTGCA	0.701																																					p.G77G		.											.	SRCRB4D	91	0			c.C231A						.						11.0	9.0	10.0					7																	76029847		2123	4163	6286	SO:0001819	synonymous_variant	136853	exon4			CCAGGAGCCACCG																												ENST00000275560.3:c.231C>A	7.37:g.76029847G>T		Somatic	14.0	0.0		WXS	Illumina HiSeq	Phase_I	45.0	18.0	NM_080744		Silent	SNP	ENST00000275560.3	37	CCDS5585.1																																																																																			.		0.701	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253001.3		
SYNGR1	9145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	39777778	39777778	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr22:39777778C>A	ENST00000328933.5	+	4	576	c.561C>A	c.(559-561)gaC>gaA	p.D187E		NM_004711.4	NP_004702.2	O43759	SNG1_HUMAN	synaptogyrin 1	187					protein targeting (GO:0006605)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle membrane (GO:0030672)				endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	7	Melanoma(58;0.04)					ACTACATGGACCCCAGCCAGG	0.687																																					p.D187E		.											.	SYNGR1	90	0			c.C561A						.						49.0	50.0	50.0					22																	39777778		2203	4300	6503	SO:0001583	missense	9145	exon4			CATGGACCCCAGC	AJ002303	CCDS13989.1, CCDS13990.1, CCDS13991.1	22q13	2008-06-10			ENSG00000100321	ENSG00000100321			11498	protein-coding gene	gene with protein product		603925				9760194, 10595519	Standard	NM_004711		Approved			O43759	OTTHUMG00000030978	ENST00000328933.5:c.561C>A	22.37:g.39777778C>A	ENSP00000332287:p.Asp187Glu	Somatic	27.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	36.0	NM_004711	A6NP69|A8K0E2|O43757|O43758|Q53Y02|Q96J56|Q9UGZ4	Missense_Mutation	SNP	ENST00000328933.5	37	CCDS13989.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155681	0.57259	.	.	ENSG00000100321	ENST00000328933	T	0.65732	-0.17	4.52	-0.00232	0.14030	.	0.047898	0.85682	D	0.000000	T	0.54351	0.1853	M	0.74647	2.275	0.80722	D	1	P	0.48089	0.905	B	0.39152	0.292	T	0.52939	-0.8508	10	0.33141	T	0.24	.	9.3548	0.38159	0.0:0.7044:0.0:0.2956	.	187	O43759	SNG1_HUMAN	E	187	ENSP00000332287:D187E	ENSP00000332287:D187E	D	+	3	2	SYNGR1	38107724	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	2.340000	0.43974	-0.063000	0.13065	0.462000	0.41574	GAC	.		0.687	SYNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075866.2	NM_004711	
TAF7L	54457	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	100547906	100547906	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chrX:100547906T>A	ENST00000372907.3	-	1	139	c.128A>T	c.(127-129)tAt>tTt	p.Y43F	TAF7L_ENST00000356784.1_5'Flank|TAF7L_ENST00000372905.2_5'UTR	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	43					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						GCTGCTTTCATAGGTGGTTTC	0.527																																					p.Y43F	Ovarian(104;431 1530 3210 15406 18594)	.											.	TAF7L	130	0			c.A128T						.						175.0	172.0	173.0					X																	100547906		2203	4300	6503	SO:0001583	missense	54457	exon1			CTTTCATAGGTGG	AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.128A>T	X.37:g.100547906T>A	ENSP00000361998:p.Tyr43Phe	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	236.0	213.0	NM_024885	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	ENST00000372907.3	37	CCDS35347.1	.	.	.	.	.	.	.	.	.	.	T	1.946	-0.442518	0.04604	.	.	ENSG00000102387	ENST00000372907	T	0.13901	2.55	3.67	0.913	0.19354	.	1.853500	0.03176	N	0.171455	T	0.06872	0.0175	N	0.08118	0	0.09310	N	0.999998	B	0.14012	0.009	B	0.12156	0.007	T	0.32322	-0.9911	10	0.10111	T	0.7	6.0409	5.3638	0.16103	0.0:0.5947:0.0:0.4053	.	43	Q5H9L4	TAF7L_HUMAN	F	43	ENSP00000361998:Y43F	ENSP00000361998:Y43F	Y	-	2	0	TAF7L	100434562	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.444000	0.02403	0.060000	0.16281	-0.183000	0.12914	TAT	.		0.527	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057526.2		
TBCK	93627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	107092414	107092414	+	Silent	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr4:107092414T>C	ENST00000273980.5	-	24	2520	c.2073A>G	c.(2071-2073)gaA>gaG	p.E691E	TBCK_ENST00000361687.4_Silent_p.E628E|TBCK_ENST00000394706.3_Silent_p.E652E|TBCK_ENST00000514689.1_5'UTR|TBCK_ENST00000394708.2_Silent_p.E691E|TBCK_ENST00000432496.2_Silent_p.E691E					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						TCACACAGCGTTCAATGTCAA	0.353																																					p.E691E		.											.	TBCK	336	0			c.A2073G						.						116.0	115.0	116.0					4																	107092414		2203	4300	6503	SO:0001819	synonymous_variant	93627	exon23			ACAGCGTTCAATG		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.2073A>G	4.37:g.107092414T>C		Somatic	112.0	0.0		WXS	Illumina HiSeq	Phase_I	255.0	96.0	NM_001163436		Silent	SNP	ENST00000273980.5	37	CCDS54788.1																																																																																			.		0.353	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
TCEA1	6917	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	54912542	54912542	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr8:54912542C>A	ENST00000521604.2	-	3	598	c.195G>T	c.(193-195)ttG>ttT	p.L65F	TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000518784.1_Missense_Mutation_p.L65F|TCEA1_ENST00000396401.3_Missense_Mutation_p.L44F|TCEA1_ENST00000520534.1_Missense_Mutation_p.L65F|TCEA1_ENST00000522635.1_Intron	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	65	TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			GAGACTTTGCCAAAGATGTAA	0.323			T	PLAG1	salivary adenoma																																p.L65F		.		Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	.	TCEA1	661	0			c.G195T						.						96.0	88.0	91.0					8																	54912542		1824	4074	5898	SO:0001583	missense	6917	exon3			CTTTGCCAAAGAT	X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.195G>T	8.37:g.54912542C>A	ENSP00000428426:p.Leu65Phe	Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	393.0	141.0	NM_006756	A6NF25|A8K339|Q15563|Q6FG87	Missense_Mutation	SNP	ENST00000521604.2	37	CCDS47858.1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.504383	0.44558	.	.	ENSG00000187735	ENST00000396401;ENST00000521604;ENST00000520534;ENST00000518784	.	.	.	5.63	3.28	0.37604	Transcription factor IIS, N-terminal (4);Transcription elongation factor, TFIIS/CRSP70, N-terminal, sub-type (1);	0.000000	0.64402	D	0.000003	T	0.75968	0.3922	M	0.78049	2.395	0.54753	D	0.999983	D;D	0.89917	1.0;0.997	D;D	0.78314	0.991;0.99	T	0.75216	-0.3396	9	0.72032	D	0.01	-7.9292	9.0457	0.36345	0.0:0.154:0.0:0.846	.	44;65	P23193-2;P23193	.;TCEA1_HUMAN	F	44;65;65;65	.	ENSP00000395483:L44F	L	-	3	2	TCEA1	55075095	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	0.479000	0.22228	0.433000	0.26313	-0.312000	0.09012	TTG	.		0.323	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377975.2	NM_006756	
TRAPPC8	22878	broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	29426694	29426694	+	Silent	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr18:29426694T>C	ENST00000283351.4	-	26	4157	c.3822A>G	c.(3820-3822)tcA>tcG	p.S1274S	RP11-210K20.2_ENST00000582269.1_RNA|TRAPPC8_ENST00000582539.1_Silent_p.S1220S	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	1274					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TCTGAGGATATGAAAAGGCTT	0.363																																					p.S1274S		.											.	TRAPPC8	159	0			c.A3822G						.						195.0	197.0	196.0					18																	29426694		2203	4300	6503	SO:0001819	synonymous_variant	22878	exon26			AGGATATGAAAAG	AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.3822A>G	18.37:g.29426694T>C		Somatic	81.0	1.0		WXS	Illumina HiSeq	Phase_I	135.0	10.0	NM_014939	A0JP15|B3KME5|Q9H0L2	Silent	SNP	ENST00000283351.4	37	CCDS11901.1																																																																																			.		0.363	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255355.1	NM_014939	
TRIM46	80128	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155151089	155151089	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr1:155151089G>T	ENST00000334634.4	+	7	1285	c.1285G>T	c.(1285-1287)Gtg>Ttg	p.V429L	TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368382.1_Splice_Site_p.V406L|TRIM46_ENST00000543729.1_Splice_Site_p.G436C|TRIM46_ENST00000368385.4_Splice_Site_p.V429L|TRIM46_ENST00000392451.2_Splice_Site_p.G429C|TRIM46_ENST00000368383.3_Splice_Site_p.V429L|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000545012.1_Splice_Site_p.V303L	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	429	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTTCCTGCGAGGTAAGGAGAT	0.657																																					p.V429L		.											.	TRIM46	228	0			c.G1285T						.						77.0	69.0	72.0					1																	155151089		2203	4300	6503	SO:0001630	splice_region_variant	80128	exon7			CTGCGAGGTAAGG		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1285+1G>T	1.37:g.155151089G>T		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	19.0	NM_025058	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Missense_Mutation	SNP	ENST00000334634.4	37	CCDS1097.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.82|13.82	2.351221|2.351221	0.41700|0.41700	.|.	.|.	ENSG00000163462|ENSG00000163462	ENST00000543729;ENST00000392451|ENST00000430513;ENST00000368385;ENST00000545012;ENST00000368383;ENST00000368382;ENST00000334634	T;T|T;T;T;T;T	0.50548|0.43294	0.8;0.74|0.95;0.95;0.95;0.95;0.95	3.51|3.51	3.51|3.51	0.40186|0.40186	.|Fibronectin, type III (1);	.|0.168925	.|0.37955	.|U	.|0.001863	T|T	0.11367|0.11367	0.0277|0.0277	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B;B;B;P	.|0.37500	.|0.329;0.143;0.176;0.597	.|B;B;B;B	.|0.34779	.|0.148;0.039;0.096;0.189	T|T	0.08106|0.08106	-1.0738|-1.0738	7|10	0.72032|0.51188	D|T	0.01|0.08	.|.	10.7031|10.7031	0.45939|0.45939	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|429;406;429;429	.|Q5VT61;B1AVQ4;Q7Z4K8;Q7Z4K8-2	.|.;.;TRI46_HUMAN;.	C|L	436;429|387;429;303;429;406;429	ENSP00000442719:G436C;ENSP00000376245:G429C|ENSP00000357369:V429L;ENSP00000440254:V303L;ENSP00000357367:V429L;ENSP00000357366:V406L;ENSP00000334657:V429L	ENSP00000376245:G429C|ENSP00000334657:V429L	G|V	+|+	1|1	0|0	TRIM46|TRIM46	153417713|153417713	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.944000|0.944000	0.59088|0.59088	6.194000|6.194000	0.72082|0.72082	1.952000|1.952000	0.56665|0.56665	0.313000|0.313000	0.20887|0.20887	GGC|GTG	.		0.657	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086728.1	NM_025058	Missense_Mutation
TRPV3	162514	ucsc.edu;bcgsc.ca	37	17	3427525	3427525	+	Silent	SNP	C	C	T			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr17:3427525C>T	ENST00000576742.1	-	13	2031	c.1710G>A	c.(1708-1710)caG>caA	p.Q570Q	TRPV3_ENST00000572519.1_Silent_p.Q570Q|TRPV3_ENST00000301365.4_Silent_p.Q570Q	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	570					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	TGCCCATGGACTGGAAACCCC	0.577																																					p.Q570Q		.											.	TRPV3	94	0			c.G1710A						.						152.0	143.0	146.0					17																	3427525		2203	4300	6503	SO:0001819	synonymous_variant	162514	exon13			CATGGACTGGAAA	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1710G>A	17.37:g.3427525C>T		Somatic	28.0	0.0		WXS	Illumina HiSeq	.	40.0	5.0	NM_001258205	Q8NDW7|Q8NET9|Q8NFH2	Silent	SNP	ENST00000576742.1	37	CCDS11029.1																																																																																			.		0.577	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
TYMS	7298	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	671451	671451	+	Splice_Site	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr18:671451G>A	ENST00000323274.10	+	6	943	c.804G>A	c.(802-804)caG>caA	p.Q268Q	TYMS_ENST00000323250.5_Splice_Site_p.Q185Q|TYMS_ENST00000323224.7_Splice_Site_p.Q234Q|TYMS_ENST00000581920.1_3'UTR|ENOSF1_ENST00000583973.1_5'Flank	NM_001071.2	NP_001062.1	P04818	TYSY_HUMAN	thymidylate synthetase	268					aging (GO:0007568)|cartilage development (GO:0051216)|circadian rhythm (GO:0007623)|deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|developmental growth (GO:0048589)|dTMP biosynthetic process (GO:0006231)|dTTP biosynthetic process (GO:0006235)|dUMP metabolic process (GO:0046078)|G1/S transition of mitotic cell cycle (GO:0000082)|immortalization of host cell by virus (GO:0019088)|intestinal epithelial cell maturation (GO:0060574)|mitotic cell cycle (GO:0000278)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|organ regeneration (GO:0031100)|polysaccharide metabolic process (GO:0005976)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to organophosphorus (GO:0046683)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|response to vitamin A (GO:0033189)|small molecule metabolic process (GO:0044281)|tetrahydrofolate metabolic process (GO:0046653)|uracil metabolic process (GO:0019860)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cofactor binding (GO:0048037)|drug binding (GO:0008144)|folic acid binding (GO:0005542)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|thymidylate synthase activity (GO:0004799)			endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(2)	8					Capecitabine(DB01101)|Floxuridine(DB00322)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Leucovorin(DB00650)|Methotrexate(DB00563)|Pemetrexed(DB00642)|Pralatrexate(DB06813)|Raltitrexed(DB00293)|Trifluridine(DB00432)|Trimethoprim(DB00440)	TGAAAATTCAGGTAAGAATTA	0.413																																					p.Q268Q		.											.	TYMS	227	0			c.G804A						.						101.0	99.0	100.0					18																	671451		2203	4300	6503	SO:0001630	splice_region_variant	7298	exon6			AATTCAGGTAAGA	X02308	CCDS11821.1	18p11.31-p11.21	2014-09-17			ENSG00000176890	ENSG00000176890	2.1.1.45		12441	protein-coding gene	gene with protein product		188350		TS			Standard	NM_001071		Approved	Tsase, TMS, HsT422	uc010dka.1	P04818	OTTHUMG00000131473	ENST00000323274.10:c.804+1G>A	18.37:g.671451G>A		Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	57.0	NM_001071	Q8WYK3|Q8WYK4	Silent	SNP	ENST00000323274.10	37	CCDS11821.1																																																																																			.		0.413	TYMS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254316.1	NM_001071	Silent
UGT2B7	7364	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	69962823	69962825	+	In_Frame_Del	DEL	TGT	TGT	-			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	TGT	TGT	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr4:69962823_69962825delTGT	ENST00000508661.1	+	1	612_614	c.585_587delTGT	c.(583-588)cctgtt>cct	p.V197del	UGT2B7_ENST00000305231.7_In_Frame_Del_p.V197del|UGT2B7_ENST00000509763.1_Intron			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	197					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)	p.V196I(1)		autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCTACGTACCTGTTGTTATGTCA	0.365																																					p.195_196del		.											.	UGT2B7	92	1	Substitution - Missense(1)	lung(1)	c.585_587del						.																																			SO:0001651	inframe_deletion	7364	exon1			CGTACCTGTTGTT	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.585_587delTGT	4.37:g.69962826_69962828delTGT	ENSP00000427659:p.Val197del	Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	305.0	88.0	NM_001074	B2R810|Q6GTW0	In_Frame_Del	DEL	ENST00000508661.1	37																																																																																				.		0.365	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074	
USP49	25862	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	6	41773689	41773689	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr6:41773689T>G	ENST00000394253.3	-	3	1362	c.1033A>C	c.(1033-1035)Atc>Ctc	p.I345L	USP49_ENST00000297229.2_Missense_Mutation_p.I345L|USP49_ENST00000373006.1_Missense_Mutation_p.I345L|USP49_ENST00000373009.3_Missense_Mutation_p.I345L|USP49_ENST00000373010.1_Missense_Mutation_p.I345L			Q70CQ1	UBP49_HUMAN	ubiquitin specific peptidase 49	345	USP.				histone H2B conserved C-terminal lysine deubiquitination (GO:0035616)|mRNA splicing, via spliceosome (GO:0000398)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)|skin(2)	23	Ovarian(28;0.0919)|Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000309)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTGTTCTGGATGAGCTCCAGA	0.607																																					p.I345L		.											.	USP49	523	0			c.A1033C						.						44.0	46.0	45.0					6																	41773689		2203	4300	6503	SO:0001583	missense	25862	exon4			TCTGGATGAGCTC	AJ586139	CCDS4861.1, CCDS69111.1	6p12.1	2008-02-05	2005-08-08		ENSG00000164663	ENSG00000164663		"""Ubiquitin-specific peptidases"""	20078	protein-coding gene	gene with protein product			"""ubiquitin specific protease 49"""			14715245	Standard	NM_018561		Approved	MGC20741	uc003ori.3	Q70CQ1	OTTHUMG00000014688	ENST00000394253.3:c.1033A>C	6.37:g.41773689T>G	ENSP00000377797:p.Ile345Leu	Somatic	15.0	0.0		WXS	Illumina HiSeq	Phase_I	34.0	13.0	NM_018561	Q5T3D9|Q5T3E0|Q96CK4	Missense_Mutation	SNP	ENST00000394253.3	37		.	.	.	.	.	.	.	.	.	.	T	16.64	3.180024	0.57800	.	.	ENSG00000164663	ENST00000394253;ENST00000373010;ENST00000373009;ENST00000373006;ENST00000297229	T;T;T;T;T	0.73575	3.76;3.27;3.76;-0.76;-0.76	5.1	5.1	0.69264	.	0.128325	0.64402	D	0.000007	T	0.50240	0.1604	N	0.26130	0.795	0.35841	D	0.826048	P	0.36330	0.548	B	0.41466	0.358	T	0.53387	-0.8446	10	0.11485	T	0.65	-17.1117	14.8356	0.70180	0.0:0.0:0.0:1.0	.	345	Q70CQ1-2	.	L	345	ENSP00000377797:I345L;ENSP00000362101:I345L;ENSP00000362100:I345L;ENSP00000362097:I345L;ENSP00000297229:I345L	ENSP00000297229:I345L	I	-	1	0	USP49	41881667	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.898000	0.63238	2.039000	0.60335	0.533000	0.62120	ATC	.		0.607	USP49-007	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000316513.3	NM_018561	
VPS4B	9525	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	61067824	61067824	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr18:61067824T>C	ENST00000238497.5	-	6	800	c.597A>G	c.(595-597)atA>atG	p.I199M	VPS4B_ENST00000591383.1_5'UTR	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	199					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						CAGAGGAAGATATTGAAAAAA	0.373																																					p.I199M		.											.	VPS4B	91	0			c.A597G						.						115.0	115.0	115.0					18																	61067824		2203	4300	6503	SO:0001583	missense	9525	exon6			GGAAGATATTGAA	AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.597A>G	18.37:g.61067824T>C	ENSP00000238497:p.Ile199Met	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	88.0	NM_004869	Q69HW4|Q9GZS7	Missense_Mutation	SNP	ENST00000238497.5	37	CCDS11983.1	.	.	.	.	.	.	.	.	.	.	T	18.02	3.529046	0.64860	.	.	ENSG00000119541	ENST00000238497	D	0.95853	-3.83	6.11	4.95	0.65309	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.173761	0.64402	D	0.000009	D	0.96383	0.8820	M	0.64567	1.98	0.80722	D	1	B;B;P	0.34837	0.295;0.295;0.472	P;P;P	0.51385	0.668;0.668;0.668	D	0.95892	0.8908	10	0.87932	D	0	-15.9957	12.4617	0.55734	0.0:0.0653:0.0:0.9347	.	199;199;199	A8K5D8;A8K4G7;O75351	.;.;VPS4B_HUMAN	M	199	ENSP00000238497:I199M	ENSP00000238497:I199M	I	-	3	3	VPS4B	59218804	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.712000	0.37940	1.119000	0.41883	0.533000	0.62120	ATA	.		0.373	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256198.2	NM_004869	
ZFYVE26	23503	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	68274238	68274238	+	Missense_Mutation	SNP	G	G	A	rs267604034		TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr14:68274238G>A	ENST00000347230.4	-	5	901	c.763C>T	c.(763-765)Cgg>Tgg	p.R255W	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.R255W	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	255					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		CGCTCCTCCCGCAGGGGACTC	0.627																																					p.R255W		.											.	ZFYVE26	162	0			c.C763T						.						32.0	34.0	33.0					14																	68274238		2203	4300	6503	SO:0001583	missense	23503	exon5			CCTCCCGCAGGGG	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.763C>T	14.37:g.68274238G>A	ENSP00000251119:p.Arg255Trp	Somatic	38.0	0.0		WXS	Illumina HiSeq	Phase_I	64.0	21.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	37	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.960569	0.53400	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.30714	1.67;1.52	5.43	2.48	0.30137	.	0.598447	0.16810	N	0.198585	T	0.38585	0.1046	L	0.40543	1.245	0.09310	N	1	D;D;D	0.76494	0.999;0.998;0.978	P;P;B	0.53861	0.736;0.736;0.425	T	0.32508	-0.9904	10	0.72032	D	0.01	-0.1957	14.9491	0.71057	0.0:0.0:0.3349:0.6651	.	255;255;255	Q68DK2-4;G3V2D8;Q68DK2	.;.;ZFY26_HUMAN	W	255;234;255	ENSP00000251119:R255W;ENSP00000450603:R255W	ENSP00000251119:R255W	R	-	1	2	ZFYVE26	67343991	0.064000	0.20934	0.177000	0.23020	0.681000	0.39784	1.485000	0.35519	0.215000	0.20761	0.491000	0.48974	CGG	.		0.627	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
ZNF441	126068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11888443	11888443	+	Silent	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr19:11888443G>A	ENST00000357901.4	+	2	123	c.21G>A	c.(19-21)gaG>gaA	p.E7E	ZNF441_ENST00000454339.2_5'UTR	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	7	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGGCATTTGAGGATGTGGCTA	0.438																																					p.E7E		.											.	ZNF441	69	0			c.G21A						.						112.0	94.0	100.0					19																	11888443		692	1591	2283	SO:0001819	synonymous_variant	126068	exon2			ATTTGAGGATGTG	AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.21G>A	19.37:g.11888443G>A		Somatic	104.0	0.0		WXS	Illumina HiSeq	Phase_I	223.0	78.0	NM_152355		Silent	SNP	ENST00000357901.4	37	CCDS12266.2																																																																																			.		0.438	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335273.3	NM_152355	
Unknown	0	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	7	63680468	63680468	+	IGR	SNP	C	C	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr7:63680468C>A								GUSBP6 (69369 upstream) : ZNF679 (8383 downstream)																							TAAGATAATTCATACTGGAGA	0.408																																					p.H347N		.											.	.	.	0			c.C1039A						.						47.0	53.0	51.0					7																	63680468		692	1591	2283	SO:0001628	intergenic_variant	730291	exon4			ATAATTCATACTG																													7.37:g.63680468C>A		Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	31.0	9.0	NM_001159524		Missense_Mutation	SNP		37																																																																																				.	0	0.408								
ZSCAN1	284312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58565348	58565348	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EA-01A-11D-A12Z-10	TCGA-DD-A1EA-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f2f6ebbe-5e4e-48ff-9782-de22a56fc3c3	ebf27981-4bd7-4636-ad4e-e6153fba6e66	g.chr19:58565348G>A	ENST00000282326.1	+	6	1403	c.1156G>A	c.(1156-1158)Ggg>Agg	p.G386R		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	386					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TAGCGTCTGCGGGAAGGCCTT	0.692																																					p.G386R		.											.	ZSCAN1	92	0			c.G1156A						.						23.0	26.0	25.0					19																	58565348		2201	4298	6499	SO:0001583	missense	284312	exon6			GTCTGCGGGAAGG	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.1156G>A	19.37:g.58565348G>A	ENSP00000282326:p.Gly386Arg	Somatic	31.0	0.0		WXS	Illumina HiSeq	Phase_I	43.0	10.0	NM_182572	Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	37	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506740	0.64410	.	.	ENSG00000152467	ENST00000282326	T	0.59224	0.28	0.993	0.993	0.19825	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67239	0.2872	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67309	-0.5703	9	0.87932	D	0	.	7.8299	0.29336	0.0:0.0:1.0:0.0	.	386	Q8NBB4	ZSCA1_HUMAN	R	386	ENSP00000282326:G386R	ENSP00000282326:G386R	G	+	1	0	ZSCAN1	63257160	0.996000	0.38824	0.016000	0.15963	0.376000	0.30014	1.137000	0.31479	0.835000	0.34877	0.313000	0.20887	GGG	.		0.692	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	
