#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_TTotCov	i_TVarCov	i_TranscriptID	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ABCG2	9429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	89039357	89039357	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:89039357T>C	ENST00000237612.3	-	7	1290	c.745A>G	c.(745-747)Atc>Gtc	p.I249V	ABCG2_ENST00000515655.1_Missense_Mutation_p.I249V	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	249	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	AACTTGAAGATGGAATATCGA	0.423																																					p.I249V		.											.	ABCG2	90	0			c.A745G						.						139.0	125.0	129.0					4																	89039357		2203	4300	6503	SO:0001583	missense	9429	exon7			TGAAGATGGAATA	AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.745A>G	4.37:g.89039357T>C	ENSP00000237612:p.Ile249Val	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	34.0	NM_004827	A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	ENST00000237612.3	37	CCDS3628.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.275027	0.80580	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	T;T	0.43688	0.94;0.94	5.45	4.25	0.50352	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.44685	0.1305	N	0.21508	0.67	0.50467	D	0.999873	D;D;D	0.62365	0.991;0.969;0.969	D;P;P	0.63877	0.919;0.589;0.589	T	0.21348	-1.0248	10	0.26408	T	0.33	-36.5828	11.6976	0.51553	0.1328:0.0:0.0:0.8672	.	249;249;249	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	V	249	ENSP00000426917:I249V;ENSP00000237612:I249V	ENSP00000237612:I249V	I	-	1	0	ABCG2	89258381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.666000	0.83877	0.981000	0.38548	0.533000	0.62120	ATC	.		0.423	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253051.1	NM_004827	
ADCY8	114	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	131797673	131797673	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:131797673C>T	ENST00000286355.5	-	16	5201	c.3109G>A	c.(3109-3111)Ggc>Agc	p.G1037S	ADCY8_ENST00000377928.3_Missense_Mutation_p.G906S	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	1037					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TAGGTGCTGCCAATGGTCTTA	0.483										HNSCC(32;0.087)																											p.G1037S		.											.	ADCY8	157	0			c.G3109A						.						112.0	99.0	103.0					8																	131797673		2203	4300	6503	SO:0001583	missense	114	exon16			TGCTGCCAATGGT	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.3109G>A	8.37:g.131797673C>T	ENSP00000286355:p.Gly1037Ser	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	109.0	9.0	NM_001115		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	.	.	.	.	.	.	.	.	.	.	C	36	5.714181	0.96830	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	D;D	0.97811	-4.55;-4.55	5.07	5.07	0.68467	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.98654	0.9549	M	0.79926	2.475	0.50632	D	0.99988	D;D	0.69078	0.997;0.997	D;D	0.75484	0.972;0.986	D	0.99572	1.0971	10	0.62326	D	0.03	.	17.8033	0.88595	0.0:1.0:0.0:0.0	.	906;1037	E7EVL1;P40145	.;ADCY8_HUMAN	S	1037;906	ENSP00000286355:G1037S;ENSP00000367161:G906S	ENSP00000286355:G1037S	G	-	1	0	ADCY8	131866855	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.770000	0.85390	2.535000	0.85469	0.591000	0.81541	GGC	.		0.483	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
ALAD	210	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	116151330	116151330	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:116151330C>G	ENST00000409155.3	-	11	1054	c.858G>C	c.(856-858)tgG>tgC	p.W286C	ALAD_ENST00000277315.5_Missense_Mutation_p.W269C|ALAD_ENST00000482001.1_5'Flank	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	286					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	GGGCTCCATGCCACAGCATGG	0.612																																					p.W286C		.											.	ALAD	90	0			c.G858C						.						41.0	38.0	39.0					9																	116151330		2203	4300	6503	SO:0001583	missense	210	exon11			TCCATGCCACAGC	M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.858G>C	9.37:g.116151330C>G	ENSP00000386284:p.Trp286Cys	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	70.0	12.0	NM_000031	A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Missense_Mutation	SNP	ENST00000409155.3	37	CCDS6794.2	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815140	0.50527	.	.	ENSG00000148218	ENST00000409155;ENST00000277315	D;D	0.86694	-2.16;-2.16	5.7	5.7	0.88788	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.85071	0.5613	L	0.48935	1.535	0.80722	D	1	B;B;B	0.18610	0.007;0.013;0.029	B;B;B	0.17722	0.007;0.014;0.019	T	0.81013	-0.1125	10	0.66056	D	0.02	-8.9224	18.4109	0.90550	0.0:1.0:0.0:0.0	.	286;269;315	P13716;B7Z3I9;P13716-2	HEM2_HUMAN;.;.	C	286;269	ENSP00000386284:W286C;ENSP00000277315:W269C	ENSP00000277315:W269C	W	-	3	0	ALAD	115191151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.216000	0.77974	2.688000	0.91661	0.655000	0.94253	TGG	.		0.612	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053724.3	NM_001003945	
ANGPT1	284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	108297062	108297062	+	Silent	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:108297062G>T	ENST00000520734.1	-	6	738	c.453C>A	c.(451-453)ccC>ccA	p.P151P	ANGPT1_ENST00000520052.1_Silent_p.P150P|ANGPT1_ENST00000518386.1_Intron			Q15389	ANGP1_HUMAN	angiopoietin 1	351					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			ATTCACCGGAGGGATTTCCAA	0.378																																					p.P351P		.											.	ANGPT1	521	0			c.C1053A						.						56.0	53.0	54.0					8																	108297062		2203	4300	6503	SO:0001819	synonymous_variant	284	exon7			ACCGGAGGGATTT	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.453C>A	8.37:g.108297062G>T		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	278.0	40.0	NM_001146	Q5HYA0	Silent	SNP	ENST00000520734.1	37																																																																																				.		0.378	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
ANO2	57101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	5936960	5936960	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:5936960G>A	ENST00000356134.5	-	8	929	c.858C>T	c.(856-858)gcC>gcT	p.A286A	ANO2_ENST00000546188.1_Silent_p.A286A|ANO2_ENST00000327087.8_Silent_p.A285A	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	290					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CTCGGGAGCAGGCTGTGCGCT	0.662																																					p.A285A		.											.	ANO2	139	0			c.C855T						.						33.0	39.0	37.0					12																	5936960		2026	4194	6220	SO:0001819	synonymous_variant	57101	exon7			GGAGCAGGCTGTG	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.858C>T	12.37:g.5936960G>A		Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	31.0	NM_020373	C4N787|Q9H847	Silent	SNP	ENST00000356134.5	37																																																																																				.		0.662	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373	
ANO4	121601	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	101365128	101365128	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:101365128C>T	ENST00000392977.3	+	6	711	c.501C>T	c.(499-501)gcC>gcT	p.A167A	ANO4_ENST00000299222.9_5'UTR|ANO4_ENST00000538618.1_Silent_p.A333A|ANO4_ENST00000392979.3_Silent_p.A132A			Q32M45	ANO4_HUMAN	anoctamin 4	167					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AGTTGCATGCCCCATGGGAAG	0.368										HNSCC(74;0.22)																											p.A132A		.											.	ANO4	96	0			c.C396T						.						145.0	140.0	142.0					12																	101365128		2203	4300	6503	SO:0001819	synonymous_variant	121601	exon5			GCATGCCCCATGG	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.501C>T	12.37:g.101365128C>T		Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	30.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	ENST00000392977.3	37																																																																																				.		0.368	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
ANP32A	8125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	69076893	69076893	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr15:69076893G>A	ENST00000465139.2	-	4	512	c.369C>T	c.(367-369)tgC>tgT	p.C123C	ANP32A_ENST00000560303.1_Silent_p.C123C|ANP32A_ENST00000483551.2_5'UTR	NM_006305.3	NP_006296.1	P39687	AN32A_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A	123	LRRCT.				gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|nucleocytoplasmic transport (GO:0006913)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						TGGTTACCTCGCAATTGAAAA	0.483																																					p.C123C		.											.	.	.	0			c.C369T						.						93.0	98.0	96.0					15																	69076893		2200	4298	6498	SO:0001819	synonymous_variant	8125	exon4			TACCTCGCAATTG	AF025684	CCDS45292.1	15q23	2008-05-14			ENSG00000140350	ENSG00000140350		"""ANP32 acidic nuclear phosphoproteins"""	13233	protein-coding gene	gene with protein product		600832		C15orf1		8970164, 9144194	Standard	NM_006305		Approved	LANP, PP32, I1PP2A, PHAPI, MAPM, mapmodulin	uc002arl.3	P39687	OTTHUMG00000154502	ENST00000465139.2:c.369C>T	15.37:g.69076893G>A		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	255.0	60.0	NM_006305	B2R6T4|Q53FK4|Q5J8L8|Q7M4N6	Silent	SNP	ENST00000465139.2	37	CCDS45292.1																																																																																			.		0.483	ANP32A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335525.2		
ARHGAP42	143872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	100792230	100792230	+	Silent	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:100792230T>C	ENST00000298815.8	+	6	495	c.492T>C	c.(490-492)gaT>gaC	p.D164D	ARHGAP42_ENST00000524892.2_Silent_p.D130D	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	164	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						TTTAGGCAGATACACAAATTG	0.348																																					p.D164D		.											.	.	.	0			c.T492C						.						106.0	88.0	93.0					11																	100792230		692	1591	2283	SO:0001819	synonymous_variant	143872	exon6			GGCAGATACACAA			11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.492T>C	11.37:g.100792230T>C		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	130.0	45.0	NM_152432	Q96M56	Silent	SNP	ENST00000298815.8	37																																																																																				.		0.348	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152432	
ARHGAP44	9912	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	12819314	12819314	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:12819314T>A	ENST00000379672.5	+	5	673	c.373T>A	c.(373-375)Ttt>Att	p.F125I	ARHGAP44_ENST00000262444.9_Missense_Mutation_p.F125I|ARHGAP44_ENST00000340825.3_Missense_Mutation_p.F125I|MIR1269B_ENST00000580405.1_RNA	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	125	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						TGAGCCCCTGTTTTTGCTGGC	0.522																																					p.F125I		.											.	ARHGAP44	90	0			c.T373A						.						80.0	81.0	80.0					17																	12819314		2080	4207	6287	SO:0001583	missense	9912	exon5			CCCCTGTTTTTGC		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.373T>A	17.37:g.12819314T>A	ENSP00000368994:p.Phe125Ile	Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	29.0	NM_014859	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	ENST00000379672.5	37	CCDS45616.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.667102	0.47677	.	.	ENSG00000006740	ENST00000379672;ENST00000340825	T;T	0.63096	-0.02;-0.02	5.92	5.92	0.95590	BAR (3);	0.182798	0.49916	D	0.000131	T	0.51398	0.1672	N	0.22421	0.69	0.41260	D	0.986773	P;B	0.38677	0.642;0.409	B;B	0.41135	0.316;0.348	T	0.50668	-0.8801	10	0.25106	T	0.35	.	14.3183	0.66468	0.0:0.0:0.0:1.0	.	125;125	A6NCP5;Q17R89	.;RHG44_HUMAN	I	125	ENSP00000368994:F125I;ENSP00000342566:F125I	ENSP00000342566:F125I	F	+	1	0	ARHGAP44	12760039	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	5.166000	0.64965	2.274000	0.75844	0.533000	0.62120	TTT	.		0.522	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
ASXL1	171023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31016044	31016044	+	Silent	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr20:31016044A>G	ENST00000375687.4	+	5	790	c.366A>G	c.(364-366)gaA>gaG	p.E122E	ASXL1_ENST00000542461.1_3'UTR|ASXL1_ENST00000306058.5_Silent_p.E117E|ASXL1_ENST00000470145.1_3'UTR	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	122					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TGAGTGGTGAAAACGATGGTA	0.517			"""F, N, Mis"""		"""MDS, CMML"""																																p.E122E		.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	2057	0			c.A366G						.						186.0	170.0	175.0					20																	31016044		2203	4300	6503	SO:0001819	synonymous_variant	171023	exon4			TGGTGAAAACGAT	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.366A>G	20.37:g.31016044A>G		Somatic	73.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	17.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	ENST00000375687.4	37	CCDS13201.1																																																																																			.		0.517	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	31314285	31314285	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr18:31314285C>T	ENST00000269197.5	+	10	988	c.988C>T	c.(988-990)Cca>Tca	p.P330S		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGAGTTTACCCCAGAAATGCA	0.308																																					p.P330S		.											.	ASXL3	49	0			c.C988T						.						51.0	50.0	50.0					18																	31314285		1798	4059	5857	SO:0001583	missense	80816	exon10			TTTACCCCAGAAA	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.988C>T	18.37:g.31314285C>T	ENSP00000269197:p.Pro330Ser	Somatic	126.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	56.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566279	0.86439	.	.	ENSG00000141431	ENST00000269197	T	0.25250	1.81	5.71	5.71	0.89125	.	0.227351	0.38492	N	0.001663	T	0.50735	0.1633	M	0.61703	1.905	0.54753	D	0.999986	D	0.89917	1.0	D	0.81914	0.995	T	0.34428	-0.9829	10	0.41790	T	0.15	.	19.8549	0.96755	0.0:1.0:0.0:0.0	.	330	Q9C0F0	ASXL3_HUMAN	S	330	ENSP00000269197:P330S	ENSP00000269197:P330S	P	+	1	0	ASXL3	29568283	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.365000	0.79537	2.699000	0.92147	0.460000	0.39030	CCA	.		0.308	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
ATG14	22863	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	55857663	55857663	+	Silent	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr14:55857663T>C	ENST00000247178.5	-	4	410	c.375A>G	c.(373-375)caA>caG	p.Q125Q		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	125					autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						TACATATTGTTTGTTTTAACT	0.333																																					p.Q125Q		.											.	ATG14	90	0			c.A375G						.						183.0	153.0	163.0					14																	55857663		2201	4298	6499	SO:0001819	synonymous_variant	22863	exon4			TATTGTTTGTTTT	AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.375A>G	14.37:g.55857663T>C		Somatic	117.0	1.0		WXS	Illumina HiSeq	Phase_I	216.0	29.0	NM_014924	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Silent	SNP	ENST00000247178.5	37	CCDS32087.1																																																																																			.		0.333	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	14	96809512	96809512	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr14:96809512A>T	ENST00000359933.4	-	5	1581	c.688T>A	c.(688-690)Tgg>Agg	p.W230R		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	230					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AACTCATCCCAGAAGAGAGAC	0.413																																					p.W230R		.											.	ATG2B	93	0			c.T688A						.						99.0	94.0	95.0					14																	96809512		1886	4117	6003	SO:0001583	missense	55102	exon5			CATCCCAGAAGAG	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.688T>A	14.37:g.96809512A>T	ENSP00000353010:p.Trp230Arg	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	192.0	14.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	20.7	4.032808	0.75504	.	.	ENSG00000066739	ENST00000359933	T	0.09817	2.94	5.31	5.31	0.75309	.	0.265541	0.33515	U	0.004839	T	0.19846	0.0477	N	0.22421	0.69	0.58432	D	0.999997	D	0.76494	0.999	D	0.85130	0.997	T	0.06607	-1.0817	10	0.30078	T	0.28	.	15.2648	0.73651	1.0:0.0:0.0:0.0	.	230	Q96BY7	ATG2B_HUMAN	R	230	ENSP00000353010:W230R	ENSP00000353010:W230R	W	-	1	0	ATG2B	95879265	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.730000	0.91510	2.007000	0.58848	0.482000	0.46254	TGG	.		0.413	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
ATP9A	10079	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	50287725	50287725	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr20:50287725C>T	ENST00000338821.5	-	12	1373	c.1109G>A	c.(1108-1110)gGg>gAg	p.G370E	ATP9A_ENST00000311637.5_Missense_Mutation_p.G234E|ATP9A_ENST00000402822.1_Missense_Mutation_p.G249E	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	370					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						AACCACGGTCCCGGGGATTTT	0.547																																					p.G370E		.											.	ATP9A	94	0			c.G1109A						.						94.0	80.0	85.0					20																	50287725		2203	4300	6503	SO:0001583	missense	10079	exon12			ACGGTCCCGGGGA	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1109G>A	20.37:g.50287725C>T	ENSP00000342481:p.Gly370Glu	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	30.0	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	37	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301899	0.40694	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.89485	-2.52;-2.52;-2.52	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.95108	0.8415	M	0.86028	2.79	0.80722	D	1	D;P	0.89917	1.0;0.691	D;B	0.87578	0.998;0.259	D	0.95410	0.8497	10	0.59425	D	0.04	-38.0659	18.6624	0.91475	0.0:1.0:0.0:0.0	.	249;370	O75110-2;O75110	.;ATP9A_HUMAN	E	234;370;249	ENSP00000309086:G234E;ENSP00000342481:G370E;ENSP00000385875:G249E	ENSP00000309086:G234E	G	-	2	0	ATP9A	49721132	1.000000	0.71417	0.988000	0.46212	0.105000	0.19272	5.704000	0.68347	2.397000	0.81536	0.313000	0.20887	GGG	.		0.547	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
BAP1	8314	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52440270	52440276	+	Splice_Site	DEL	TGCTGCA	TGCTGCA	-			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	TGCTGCA	TGCTGCA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:52440270_52440276delTGCTGCA	ENST00000460680.1	-	9	1247_1253	c.776_782delTGCAGCA	c.(775-783)ctgcagcag>cg	p.LQQ259fs	BAP1_ENST00000296288.5_Splice_Site_p.LQQ241fs	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q261*(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		GGCACCTACCTGCTGCAGAGCCTCTAG	0.57			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.259_261del	GBM(101;493 1458 7992 21037 25532)	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,NS,carcinoma,-1	BAP1	1032	1	Substitution - Nonsense(1)	breast(1)	c.776_782del						.																																			SO:0001630	splice_region_variant	8314	exon9			CCTACCTGCTGCA	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.783+1TGCAGCA>-	3.37:g.52440270_52440276delTGCTGCA		Somatic	61.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	14.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Frame_Shift_Del	DEL	ENST00000460680.1	37	CCDS2853.1																																																																																			.		0.570	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		Frame_Shift_Del
ATR	545	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	142215986	142215986	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:142215986C>T	ENST00000350721.4	-	33	5728	c.5607G>A	c.(5605-5607)caG>caA	p.Q1869Q	ATR_ENST00000383101.3_Silent_p.Q1805Q	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1869	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTGGAGAATGCTGGAAAAGTG	0.413								Other conserved DNA damage response genes																													p.Q1869Q		.											.	ATR	1139	0			c.G5607A						.						112.0	120.0	118.0					3																	142215986		2203	4300	6503	SO:0001819	synonymous_variant	545	exon33			AGAATGCTGGAAA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5607G>A	3.37:g.142215986C>T		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	42.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																			.		0.413	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
BLOC1S6	26258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45884374	45884374	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr15:45884374T>A	ENST00000220531.3	+	2	445	c.124T>A	c.(124-126)Ttg>Atg	p.L42M	BLOC1S6_ENST00000567461.1_Intron|BLOC1S6_ENST00000565323.1_Missense_Mutation_p.L47M|BLOC1S6_ENST00000564765.1_5'UTR|BLOC1S6_ENST00000568816.1_5'UTR|RP11-96O20.4_ENST00000564080.1_Intron|BLOC1S6_ENST00000565216.1_Intron|BLOC1S6_ENST00000565409.1_5'UTR|BLOC1S6_ENST00000566753.1_Missense_Mutation_p.L42M|Y_RNA_ENST00000363549.1_RNA|BLOC1S6_ENST00000562384.1_Intron|BLOC1S6_ENST00000567740.1_Intron	NM_012388.2	NP_036520.1	Q9UL45	BL1S6_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 6, pallidin	42					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|blood coagulation (GO:0007596)|endosome to melanosome transport (GO:0035646)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of pigment cell differentiation (GO:0050942)|post-Golgi vesicle-mediated transport (GO:0006892)|secretion of lysosomal enzymes (GO:0033299)|synaptic vesicle docking involved in exocytosis (GO:0016081)	BLOC-1 complex (GO:0031083)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|transport vesicle (GO:0030133)	actin filament binding (GO:0051015)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)										AATAGAGGACTTGACTATAGA	0.398																																					p.L42M		.											.	.	.	0			c.T124A						.						94.0	93.0	93.0					15																	45884374		2198	4298	6496	SO:0001583	missense	26258	exon2			GAGGACTTGACTA	AF080470	CCDS10126.1	15q21.1	2013-09-27	2012-08-07	2012-08-01	ENSG00000104164	ENSG00000104164		"""Biogenesis of lysosomal organelles complex-1 subunits"""	8549	protein-coding gene	gene with protein product		604310	"""pallid (mouse) homolog, pallidin"", ""pallidin homolog (mouse)"""	PA, PLDN		10610180	Standard	NM_012388		Approved	HPS9	uc001zvq.3	Q9UL45	OTTHUMG00000131477	ENST00000220531.3:c.124T>A	15.37:g.45884374T>A	ENSP00000220531:p.Leu42Met	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	25.0	NM_012388		Missense_Mutation	SNP	ENST00000220531.3	37	CCDS10126.1	.	.	.	.	.	.	.	.	.	.	T	17.76	3.467683	0.63625	.	.	ENSG00000104164	ENST00000220531	.	.	.	5.74	0.369	0.16151	.	0.559941	0.20041	N	0.100502	T	0.47563	0.1452	L	0.47716	1.5	0.58432	D	0.999999	P	0.40875	0.731	P	0.47528	0.549	T	0.39781	-0.9597	9	0.59425	D	0.04	1.1294	4.9159	0.13846	0.0:0.1755:0.295:0.5295	.	42	Q9UL45	PLDN_HUMAN	M	42	.	ENSP00000220531:L42M	L	+	1	2	PLDN	43671666	0.159000	0.22864	0.409000	0.26459	0.884000	0.51177	-0.555000	0.05999	0.085000	0.17107	0.460000	0.39030	TTG	.		0.398	BLOC1S6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254320.2	NM_012388	
BOC	91653	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	112969411	112969411	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:112969411C>T	ENST00000495514.1	+	4	811	c.107C>T	c.(106-108)cCt>cTt	p.P36L	BOC_ENST00000273395.4_Missense_Mutation_p.P36L|BOC_ENST00000355385.3_Missense_Mutation_p.P36L|BOC_ENST00000485230.1_Missense_Mutation_p.P36L|BOC_ENST00000484034.1_Missense_Mutation_p.P36L			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	36	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GACGAGGTCCCTCAGGTCACC	0.562																																					p.P36L		.											.	BOC	157	0			c.C107T						.						94.0	90.0	92.0					3																	112969411		2203	4300	6503	SO:0001583	missense	91653	exon4			AGGTCCCTCAGGT	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.107C>T	3.37:g.112969411C>T	ENSP00000418663:p.Pro36Leu	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	7.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	37	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	c	18.51	3.638988	0.67130	.	.	ENSG00000144857	ENST00000464546;ENST00000495514;ENST00000485230;ENST00000273395;ENST00000355385;ENST00000484034	D;T;T;T;T;T	0.84223	-1.82;-1.3;-1.3;-1.3;-1.3;-1.3	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.064498	0.64402	D	0.000007	D	0.89326	0.6683	M	0.75447	2.3	0.58432	D	0.999997	P;B;P;D	0.62365	0.724;0.282;0.529;0.991	B;B;P;P	0.58013	0.274;0.278;0.521;0.831	D	0.88822	0.3299	10	0.46703	T	0.11	.	10.8259	0.46631	0.0:0.8859:0.0:0.1141	.	36;36;36;36	C9J2L7;Q9BWV1-3;Q9BWV1;Q96DN7	.;.;BOC_HUMAN;.	L	36	ENSP00000417362:P36L;ENSP00000418663:P36L;ENSP00000420154:P36L;ENSP00000273395:P36L;ENSP00000347546:P36L;ENSP00000417337:P36L	ENSP00000273395:P36L	P	+	2	0	BOC	114452101	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	5.579000	0.67457	2.672000	0.90937	0.651000	0.88453	CCT	.		0.562	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
BRD4	23476	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15376412	15376412	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:15376412T>G	ENST00000263377.2	-	5	823	c.602A>C	c.(601-603)cAa>cCa	p.Q201P	BRD4_ENST00000371835.4_Missense_Mutation_p.Q201P|BRD4_ENST00000602230.1_5'Flank|BRD4_ENST00000360016.5_Missense_Mutation_p.Q201P	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	201					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			AGTCGATGCTTGAGTTGTGTT	0.577			T	C15orf55	lethal midline carcinoma of young people																																p.Q201P		.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	767	0			c.A602C						.						300.0	304.0	303.0					19																	15376412		2203	4300	6503	SO:0001583	missense	23476	exon5			GATGCTTGAGTTG	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.602A>C	19.37:g.15376412T>G	ENSP00000263377:p.Gln201Pro	Somatic	119.0	1.0		WXS	Illumina HiSeq	Phase_I	330.0	44.0	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	37	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.288834	0.40494	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.32515	1.45;3.12;3.09	5.28	4.26	0.50523	.	0.100619	0.44285	N	0.000466	T	0.21550	0.0519	L	0.41236	1.265	0.29136	N	0.879309	B;P;B	0.35982	0.0;0.531;0.0	B;B;B	0.35353	0.001;0.201;0.001	T	0.11060	-1.0603	10	0.25751	T	0.34	-4.6924	6.3276	0.21253	0.0:0.085:0.185:0.73	.	201;201;201	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	P	201	ENSP00000263377:Q201P;ENSP00000360901:Q201P;ENSP00000353112:Q201P	ENSP00000263377:Q201P	Q	-	2	0	BRD4	15237412	1.000000	0.71417	0.998000	0.56505	0.804000	0.45430	3.511000	0.53400	0.978000	0.38470	0.379000	0.24179	CAA	.		0.577	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
BZW2	28969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	16720997	16720997	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:16720997G>T	ENST00000433922.2	+	4	485	c.307G>T	c.(307-309)Gaa>Taa	p.E103*	BZW2_ENST00000405202.1_Nonsense_Mutation_p.E27*|BZW2_ENST00000258761.3_Nonsense_Mutation_p.E103*|BZW2_ENST00000452975.2_Nonsense_Mutation_p.E103*|BZW2_ENST00000432311.1_3'UTR	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	103					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)		p.E103K(1)		cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		TTCAGCAAATGAAGATCATGA	0.428																																					p.E103X		.											.	BZW2	92	1	Substitution - Missense(1)	cervix(1)	c.G307T						.						137.0	121.0	126.0					7																	16720997		2203	4300	6503	SO:0001587	stop_gained	28969	exon4			GCAAATGAAGATC	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.307G>T	7.37:g.16720997G>T	ENSP00000397249:p.Glu103*	Somatic	57.0	0.0		WXS	Illumina HiSeq	Phase_I	107.0	19.0	NM_014038	A4D123|Q3B779|Q96JW5|Q9H3F7	Nonsense_Mutation	SNP	ENST00000433922.2	37	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	G	39	7.514962	0.98332	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000452975;ENST00000405202;ENST00000446596;ENST00000438834;ENST00000430000	.	.	.	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-12.2543	20.2527	0.98410	0.0:0.0:1.0:0.0	.	.	.	.	X	103;103;103;103;27;103;103;103	.	ENSP00000258761:E103X	E	+	1	0	BZW2	16687522	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.810000	0.99221	2.788000	0.95919	0.557000	0.71058	GAA	.		0.428	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038	
C12orf42	374470	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	103696092	103696092	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:103696092G>A	ENST00000378113.2	-	6	1102	c.877C>T	c.(877-879)Cgg>Tgg	p.R293W	C12orf42_ENST00000548048.1_Missense_Mutation_p.R226W|C12orf42_ENST00000548883.1_Missense_Mutation_p.R293W|C12orf42_ENST00000315192.8_Intron	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	293										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						CTCCTGTCCCGCGGGGTATGA	0.652																																					p.R293W		.											.	C12orf42	91	0			c.C877T						.						33.0	38.0	37.0					12																	103696092		1946	4154	6100	SO:0001583	missense	374470	exon6			TGTCCCGCGGGGT	AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.877C>T	12.37:g.103696092G>A	ENSP00000367353:p.Arg293Trp	Somatic	45.0	0.0		WXS	Illumina HiSeq	Phase_I	75.0	10.0	NM_001099336	Q49A64|Q4G0S2	Missense_Mutation	SNP	ENST00000378113.2	37	CCDS44963.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.920532	0.52653	.	.	ENSG00000179088	ENST00000548883;ENST00000548048;ENST00000378113	T;T;T	0.49432	0.78;0.78;0.78	4.75	-4.14	0.03892	.	1.597520	0.04173	N	0.325091	T	0.26955	0.0660	N	0.24115	0.695	0.09310	N	1	B	0.27166	0.17	B	0.20184	0.028	T	0.23332	-1.0191	10	0.66056	D	0.02	-0.607	0.4303	0.00470	0.2949:0.1302:0.2716:0.3033	.	293	Q96LP6	CL042_HUMAN	W	293;226;293	ENSP00000447908:R293W;ENSP00000449362:R226W;ENSP00000367353:R293W	ENSP00000367353:R293W	R	-	1	2	C12orf42	102220222	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.312000	0.08113	-0.207000	0.10187	-0.211000	0.12701	CGG	.		0.652	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406754.1	NM_198521	
C2CD4C	126567	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	408227	408227	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:408227G>C	ENST00000332235.6	-	2	308	c.135C>G	c.(133-135)gaC>gaG	p.D45E		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	45										large_intestine(1)|pancreas(1)	2						CGGGGATCTTGTCGGGCGTCA	0.692																																					p.D45E		.											.	C2CD4C	46	0			c.C135G						.						31.0	39.0	37.0					19																	408227		692	1590	2282	SO:0001583	missense	126567	exon2			GATCTTGTCGGGC	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.135C>G	19.37:g.408227G>C	ENSP00000328677:p.Asp45Glu	Somatic	90.0	1.0		WXS	Illumina HiSeq	Phase_I	259.0	21.0	NM_001136263	Q8N3H7	Missense_Mutation	SNP	ENST00000332235.6	37	CCDS45890.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752649	0.31046	.	.	ENSG00000183186	ENST00000332235	T	0.80304	-1.36	3.22	1.81	0.25067	.	0.191601	0.43416	U	0.000574	T	0.74589	0.3736	L	0.61218	1.895	0.40486	D	0.980495	P	0.39282	0.666	B	0.37346	0.247	T	0.76127	-0.3073	10	0.51188	T	0.08	.	9.6326	0.39789	0.2132:0.0:0.7868:0.0	.	45	Q8TF44	C2C4C_HUMAN	E	45	ENSP00000328677:D45E	ENSP00000328677:D45E	D	-	3	2	C2CD4C	359227	1.000000	0.71417	0.999000	0.59377	0.775000	0.43874	2.228000	0.42981	1.332000	0.45431	0.556000	0.70494	GAC	.		0.692	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451789.2	XM_065166	
C2orf81	388963	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	74641896	74641896	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:74641896G>A	ENST00000517883.1	-	1	1814	c.1123C>T	c.(1123-1125)Ctg>Ttg	p.L375L	C2orf81_ENST00000290390.5_Silent_p.L443L			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	436										endometrium(3)|kidney(1)	4						GGGAGTGGCAGCTTTGACTCG	0.617																																					p.L443L		.											.	.	.	0			c.C1327T						.						120.0	133.0	129.0					2																	74641896		692	1591	2283	SO:0001819	synonymous_variant	388963	exon4			GTGGCAGCTTTGA	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.1123C>T	2.37:g.74641896G>A		Somatic	48.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	19.0	NM_001145054		Silent	SNP	ENST00000517883.1	37																																																																																				.		0.617	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
CBX3	11335	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	26248077	26248077	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:26248077A>G	ENST00000337620.4	+	4	660	c.232A>G	c.(232-234)Aac>Gac	p.N78D	CBX3_ENST00000497498.1_3'UTR|CBX3_ENST00000409747.1_Intron|CBX3_ENST00000396386.2_Missense_Mutation_p.N78D	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3	78	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						AGCGTTTCTTAACTCTCAGAA	0.328																																					p.N78D		.											.	CBX3	227	0			c.A232G						.						53.0	60.0	58.0					7																	26248077		2202	4300	6502	SO:0001583	missense	11335	exon4			TTTCTTAACTCTC	U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.232A>G	7.37:g.26248077A>G	ENSP00000336687:p.Asn78Asp	Somatic	116.0	0.0		WXS	Illumina HiSeq	Phase_I	248.0	102.0	NM_016587	Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Missense_Mutation	SNP	ENST00000337620.4	37	CCDS5398.1	.	.	.	.	.	.	.	.	.	.	A	16.31	3.087128	0.55968	.	.	ENSG00000122565	ENST00000337620;ENST00000396386	T;T	0.70749	-0.51;-0.51	5.35	5.35	0.76521	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.091219	0.85682	D	0.000000	T	0.52354	0.1729	N	0.10629	0.01	0.80722	D	1	B	0.06786	0.001	B	0.14023	0.01	T	0.48317	-0.9046	10	0.31617	T	0.26	.	15.6276	0.76874	1.0:0.0:0.0:0.0	.	78	Q13185	CBX3_HUMAN	D	78	ENSP00000336687:N78D;ENSP00000379670:N78D	ENSP00000336687:N78D	N	+	1	0	CBX3	26214602	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.135000	0.57997	2.150000	0.67090	0.533000	0.62120	AAC	.		0.328	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214117.1	NM_007276	
CCNL2	81669	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	1322749	1322749	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:1322749C>T	ENST00000400809.3	-	11	1430	c.1425G>A	c.(1423-1425)gaG>gaA	p.E475E	CCNL2_ENST00000408952.5_Silent_p.E253E|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	475					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		TATCCGCCCGCTCCCGTGACC	0.562																																					p.E475E		.											.	CCNL2	70	0			c.G1425A						.						110.0	120.0	117.0					1																	1322749		2203	4296	6499	SO:0001819	synonymous_variant	81669	exon11			CGCCCGCTCCCGT	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.1425G>A	1.37:g.1322749C>T		Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	31.0	NM_030937	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Silent	SNP	ENST00000400809.3	37	CCDS30557.1																																																																																			.		0.562	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
CES3	23491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67006590	67006590	+	Silent	SNP	G	G	A	rs377447761		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr16:67006590G>A	ENST00000303334.4	+	12	1532	c.1461G>A	c.(1459-1461)gaG>gaA	p.E487E	CES3_ENST00000543856.1_Silent_p.E126E|CES3_ENST00000394037.1_Silent_p.E484E	NM_024922.5	NP_079198.2	Q6UWW8	EST3_HUMAN	carboxylesterase 3	487						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(3)|skin(1)	24		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0488)|Epithelial(162;0.127)		AGGCCACAGAGGAGGAGAAGC	0.587																																					p.E487E		.											.	CES3	517	0			c.G1461A						.	G	,,	1,4399	2.1+/-5.4	0,1,2199	83.0	76.0	78.0		378,1452,1461	2.0	1.0	16		78	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CES3	NM_001185176.1,NM_001185177.1,NM_024922.5	,,	0,1,6499	AA,AG,GG		0.0,0.0227,0.0077	,,	126/211,484/569,487/572	67006590	1,12999	2200	4300	6500	SO:0001819	synonymous_variant	23491	exon12			CACAGAGGAGGAG	AK025389	CCDS10826.1, CCDS54022.1, CCDS54023.1	16q22.1	2014-05-13	2008-07-25		ENSG00000172828	ENSG00000172828		"""Carboxylesterases"""	1865	protein-coding gene	gene with protein product	"""esterase 31"", ""brain carboxylesterase BR3"""	605279	"""carboxylesterase 3 (brain)"""			10518925, 14581373, 15100172, 20931200	Standard	NM_001185176		Approved	FLJ21736, ES31	uc002eqt.3	Q6UWW8	OTTHUMG00000137525	ENST00000303334.4:c.1461G>A	16.37:g.67006590G>A		Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	66.0	17.0	NM_024922	B2Z3W9|F5H242|Q7Z6J1|Q9H6X7	Silent	SNP	ENST00000303334.4	37	CCDS10826.1																																																																																			.		0.587	CES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268848.1	NM_024922	
CHAF1A	10036	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4408946	4408946	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:4408946C>T	ENST00000301280.5	+	3	251	c.150C>T	c.(148-150)gcC>gcT	p.A50A		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	50	Binds to CBX1 chromo shadow domain.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGGAAAGCCGATGACATGT	0.473								Chromatin Structure																													p.A50A		.											.	CHAF1A	92	0			c.C150T						.						126.0	127.0	126.0					19																	4408946		2203	4300	6503	SO:0001819	synonymous_variant	10036	exon3			GAAAGCCGATGAC	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.150C>T	19.37:g.4408946C>T		Somatic	58.0	0.0		WXS	Illumina HiSeq	Phase_I	129.0	16.0	NM_005483	Q6NXG5|Q7Z7K3|Q9UJY8	Silent	SNP	ENST00000301280.5	37	CCDS32875.1																																																																																			.		0.473	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483	
CKAP5	9793	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	46804849	46804849	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:46804849C>T	ENST00000529230.1	-	18	2270	c.2224G>A	c.(2224-2226)Gcc>Acc	p.A742T	CKAP5_ENST00000415402.1_Missense_Mutation_p.A742T|CKAP5_ENST00000354558.3_Missense_Mutation_p.A742T|CKAP5_ENST00000312055.5_Missense_Mutation_p.A742T			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	742					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TCTTTTATGGCATTTGATAGC	0.348																																					p.A742T	Ovarian(4;85 273 2202 4844 13323)	.											.	CKAP5	92	0			c.G2224A						.						90.0	84.0	86.0					11																	46804849		2201	4299	6500	SO:0001583	missense	9793	exon18			TTATGGCATTTGA		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.2224G>A	11.37:g.46804849C>T	ENSP00000432768:p.Ala742Thr	Somatic	43.0	0.0		WXS	Illumina HiSeq	Phase_I	56.0	6.0	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490969	0.84962	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.25	5.25	0.73442	Armadillo-type fold (1);	0.101087	0.64402	D	0.000002	T	0.75860	0.3907	M	0.64997	1.995	0.80722	D	1	B;D;B	0.67145	0.328;0.996;0.155	B;D;B	0.79784	0.176;0.993;0.043	T	0.72334	-0.4325	10	0.27082	T	0.32	-7.4117	17.0359	0.86476	0.0:1.0:0.0:0.0	.	742;742;742	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	T	742	ENSP00000432768:A742T;ENSP00000395302:A742T;ENSP00000310227:A742T;ENSP00000346566:A742T	ENSP00000310227:A742T	A	-	1	0	CKAP5	46761425	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.814000	0.86154	2.456000	0.83038	0.650000	0.86243	GCC	.		0.348	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
CLASP2	23122	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	33673843	33673843	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:33673843C>T	ENST00000468888.2	-	9	932	c.886G>A	c.(886-888)Gct>Act	p.A296T	CLASP2_ENST00000333778.6_Missense_Mutation_p.A72T|CLASP2_ENST00000307312.7_5'UTR|CLASP2_ENST00000359576.5_Missense_Mutation_p.A295T|CLASP2_ENST00000313350.6_Missense_Mutation_p.A68T|CLASP2_ENST00000539981.1_Intron|CLASP2_ENST00000482896.1_5'UTR|CLASP2_ENST00000461133.3_Missense_Mutation_p.A62T|CLASP2_ENST00000487200.1_Missense_Mutation_p.A68T|CLASP2_ENST00000399362.4_Missense_Mutation_p.A295T|CLASP2_ENST00000480013.1_Missense_Mutation_p.A62T			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	62					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						ACTGCTCCAGCACCTCCTTCC	0.363																																					p.A296T		.											.	CLASP2	93	0			c.G886A						.						47.0	47.0	47.0					3																	33673843		1861	4109	5970	SO:0001583	missense	23122	exon9			CTCCAGCACCTCC	AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.886G>A	3.37:g.33673843C>T	ENSP00000419974:p.Ala296Thr	Somatic	95.0	1.0		WXS	Illumina HiSeq	Phase_I	212.0	74.0	NM_015097	Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	ENST00000468888.2	37		.	.	.	.	.	.	.	.	.	.	C	28.7	4.940051	0.92526	.	.	ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000480013;ENST00000461133;ENST00000313350;ENST00000487200;ENST00000333778;ENST00000485378;ENST00000496954	T;T;T	0.23348	1.91;1.99;1.98	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.46288	0.1385	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.984;0.996	D;D;D;D	0.76071	0.971;0.979;0.92;0.987	T	0.37979	-0.9682	10	0.87932	D	0	-17.2058	17.6338	0.88116	0.0:1.0:0.0:0.0	.	72;68;68;295	E7ENG2;B3KR06;O75122-2;F5H604	.;.;.;.	T	296;295;295;62;62;68;68;72;68;63	ENSP00000419974:A296T;ENSP00000382297:A295T;ENSP00000352581:A295T	ENSP00000324364:A68T	A	-	1	0	CLASP2	33648847	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.317000	0.72862	2.604000	0.88044	0.555000	0.69702	GCT	.		0.363	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000344320.4	NM_001207044	
CLSTN2	64084	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	140140017	140140017	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:140140017G>C	ENST00000458420.3	+	5	878	c.688G>C	c.(688-690)Gag>Cag	p.E230Q		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	230	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						ACACCAGTATGAGATCCTGGT	0.512										HNSCC(16;0.037)																											p.E230Q	GBM(45;858 913 3709 36904 37282)	.											.	CLSTN2	157	0			c.G688C						.						164.0	151.0	155.0					3																	140140017		2203	4300	6503	SO:0001583	missense	64084	exon5			CAGTATGAGATCC	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.688G>C	3.37:g.140140017G>C	ENSP00000402460:p.Glu230Gln	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	8.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	37	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012485	0.35511	.	.	ENSG00000158258	ENST00000458420	T	0.54675	0.56	5.7	5.7	0.88788	Cadherin (5);Cadherin-like (1);	0.260319	0.37809	N	0.001938	T	0.48241	0.1489	L	0.49126	1.545	0.42028	D	0.99101	B	0.17268	0.021	B	0.19391	0.025	T	0.40942	-0.9536	10	0.14252	T	0.57	-4.5927	17.3368	0.87283	0.0:0.0:1.0:0.0	.	230	Q9H4D0	CSTN2_HUMAN	Q	230	ENSP00000402460:E230Q	ENSP00000402460:E230Q	E	+	1	0	CLSTN2	141622707	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.532000	0.45659	2.679000	0.91253	0.655000	0.94253	GAG	.		0.512	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
CLUH	23277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	2604781	2604781	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:2604781C>T	ENST00000570628.2	-	6	769	c.664G>A	c.(664-666)Gga>Aga	p.G222R	CLUH_ENST00000538975.1_Missense_Mutation_p.G222R|CLUH_ENST00000435359.1_Missense_Mutation_p.G222R			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	222					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											GGGTTCCATCCGCTCATGGTG	0.657																																					p.G222R		.											.	.	.	0			c.G664A						.						30.0	36.0	34.0					17																	2604781		1981	4154	6135	SO:0001583	missense	23277	exon6			TCCATCCGCTCAT	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.664G>A	17.37:g.2604781C>T	ENSP00000458986:p.Gly222Arg	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	18.0	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	ENST00000570628.2	37	CCDS45572.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.509303	0.85282	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.80738	-1.41;-1.41	4.75	4.75	0.60458	GSKIP/TIF31 domain (1);	0.048785	0.85682	D	0.000000	D	0.86802	0.6020	M	0.77820	2.39	0.80722	D	1	D;D	0.65815	0.988;0.995	P;P	0.54346	0.749;0.749	D	0.88515	0.3092	10	0.59425	D	0.04	.	16.898	0.86106	0.0:1.0:0.0:0.0	.	222;222	O75153;C9J6D7	K0664_HUMAN;.	R	222	ENSP00000388872:G222R;ENSP00000439628:G222R	ENSP00000320468:G222R	G	-	1	0	KIAA0664	2551531	1.000000	0.71417	0.994000	0.49952	0.833000	0.47200	5.862000	0.69560	2.476000	0.83614	0.591000	0.81541	GGA	.		0.657	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
COL4A2	1284	ucsc.edu;bcgsc.ca	37	13	111077155	111077155	+	Silent	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr13:111077155A>G	ENST00000360467.5	+	5	561	c.255A>G	c.(253-255)ggA>ggG	p.G85G		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	85					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GACTGCAGGGACGTAAAGGAG	0.607																																					p.G85G		.											.	COL4A2	95	0			c.A255G						.						86.0	96.0	93.0					13																	111077155		1924	4124	6048	SO:0001819	synonymous_variant	1284	exon5			GCAGGGACGTAAA	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.255A>G	13.37:g.111077155A>G		Somatic	30.0	0.0		WXS	Illumina HiSeq	.	27.0	4.0	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Silent	SNP	ENST00000360467.5	37	CCDS41907.1																																																																																			.		0.607	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
COL6A2	1292	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	47531490	47531492	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr21:47531490_47531492delAAC	ENST00000300527.4	+	2	204_206	c.100_102delAAC	c.(100-102)aacdel	p.N36del	COL6A2_ENST00000310645.5_In_Frame_Del_p.N36del|COL6A2_ENST00000357838.4_In_Frame_Del_p.N36del|COL6A2_ENST00000409416.1_In_Frame_Del_p.N36del|COL6A2_ENST00000397763.1_In_Frame_Del_p.N36del	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	36	Nonhelical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TACCGAGAGAAACAACAACTGCC	0.695																																					p.34_34del		.											.	COL6A2	515	0			c.100_102del						.																																			SO:0001651	inframe_deletion	1292	exon2			GAGAGAAACAACA	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.100_102delAAC	21.37:g.47531496_47531498delAAC	ENSP00000300527:p.Asn36del	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	22.0	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	In_Frame_Del	DEL	ENST00000300527.4	37	CCDS13728.1																																																																																			.		0.695	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
CPT1A	1374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	68530229	68530229	+	Splice_Site	SNP	C	C	A	rs201706909		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:68530229C>A	ENST00000265641.5	-	15	1895	c.1741G>T	c.(1741-1743)Gac>Tac	p.D581Y	CPT1A_ENST00000540367.1_Splice_Site_p.D581Y|CPT1A_ENST00000537756.2_5'UTR|CPT1A_ENST00000539743.1_Splice_Site_p.D581Y|CPT1A_ENST00000376618.2_Splice_Site_p.D581Y	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	581					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	TTGCCCATGTCCTGGGGAAAG	0.547																																					p.D581Y		.											.	CPT1A	149	0			c.G1741T						.						67.0	59.0	62.0					11																	68530229		2200	4294	6494	SO:0001630	splice_region_variant	1374	exon15			CCATGTCCTGGGG	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1741-1G>T	11.37:g.68530229C>A		Somatic	20.0	0.0		WXS	Illumina HiSeq	Phase_I	39.0	24.0	NM_001876	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.862602	0.71949	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.90079	0.6901	M	0.89785	3.06	0.80722	D	1	D;D	0.76494	0.977;0.999	D;D	0.70716	0.918;0.97	D	0.86645	0.1894	10	0.02654	T	1	.	19.912	0.97027	0.0:1.0:0.0:0.0	.	581;581	P50416;P50416-2	CPT1A_HUMAN;.	Y	581	ENSP00000439084:D581Y;ENSP00000365803:D581Y;ENSP00000265641:D581Y;ENSP00000446108:D581Y	ENSP00000265641:D581Y	D	-	1	0	CPT1A	68286805	1.000000	0.71417	1.000000	0.80357	0.268000	0.26511	7.364000	0.79526	2.783000	0.95769	0.655000	0.94253	GAC	C|0.999;T|0.001		0.547	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	Missense_Mutation
CUBN	8029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	17130262	17130262	+	Silent	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:17130262A>G	ENST00000377833.4	-	15	1913	c.1848T>C	c.(1846-1848)tgT>tgC	p.C616C		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	616	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAATCCAGACACAATCTCTTC	0.458																																					p.C616C		.											.	CUBN	166	0			c.T1848C						.						100.0	91.0	94.0					10																	17130262		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon15			CCAGACACAATCT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1848T>C	10.37:g.17130262A>G		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	140.0	28.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	37	CCDS7113.1																																																																																			.		0.458	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CYLC2	1539	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	105767037	105767037	+	Silent	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:105767037T>C	ENST00000374798.3	+	4	311	c.241T>C	c.(241-243)Tta>Cta	p.L81L	CYLC2_ENST00000487798.1_Silent_p.L81L	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	81	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				GTACCGTTCTTTAATGAGAAT	0.403																																					p.L81L		.											.	CYLC2	91	0			c.T241C						.						86.0	83.0	84.0					9																	105767037		2203	4300	6503	SO:0001819	synonymous_variant	1539	exon4			CGTTCTTTAATGA	Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.241T>C	9.37:g.105767037T>C		Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	35.0	NM_001340	B2R8F4|Q5VVJ9	Silent	SNP	ENST00000374798.3	37	CCDS35085.1																																																																																			.		0.403	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000053463.3	NM_001340	
DCHS2	54798	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	155278437	155278437	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:155278437T>C	ENST00000357232.4	-	6	733	c.734A>G	c.(733-735)aAc>aGc	p.N245S	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	245	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		tgctgaaaagttgacagcact	0.433																																					p.N245S		.											.	DCHS2	94	0			c.A734G						.						117.0	122.0	120.0					4																	155278437		2203	4300	6503	SO:0001583	missense	54798	exon6			GAAAAGTTGACAG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.734A>G	4.37:g.155278437T>C	ENSP00000349768:p.Asn245Ser	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	19.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	37	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.575094	0.00131	.	.	ENSG00000197410	ENST00000357232	T	0.55413	0.52	0.772	-0.951	0.10369	Cadherin (1);	.	.	.	.	T	0.28034	0.0691	N	0.22421	0.69	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.21415	-1.0246	9	0.09338	T	0.73	.	3.0531	0.06175	0.0:0.3566:0.0:0.6434	.	245	Q6V1P9	PCD23_HUMAN	S	245	ENSP00000349768:N245S	ENSP00000349768:N245S	N	-	2	0	DCHS2	155497887	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	-1.189000	0.03061	-0.333000	0.08476	-0.495000	0.04643	AAC	.		0.433	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DDX4	54514	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	55083699	55083699	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:55083699C>T	ENST00000505374.1	+	15	1135	c.1043C>T	c.(1042-1044)gCt>gTt	p.A348V	DDX4_ENST00000354991.5_Missense_Mutation_p.A314V|DDX4_ENST00000511853.1_Missense_Mutation_p.A199V|DDX4_ENST00000514278.2_Missense_Mutation_p.A328V|DDX4_ENST00000353507.5_Missense_Mutation_p.A314V	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	348	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				CCAATTTTGGCTCATATGATG	0.393																																					p.A348V		.											.	DDX4	227	0			c.C1043T						.						100.0	101.0	101.0					5																	55083699		2203	4300	6503	SO:0001583	missense	54514	exon15			TTTTGGCTCATAT	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1043C>T	5.37:g.55083699C>T	ENSP00000424838:p.Ala348Val	Somatic	81.0	0.0		WXS	Illumina HiSeq	Phase_I	128.0	30.0	NM_024415	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	37	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.156592	0.78114	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41	5.83	5.83	0.93111	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.175936	0.51477	D	0.000096	T	0.27524	0.0676	L	0.28344	0.845	0.35409	D	0.792272	B;D;P;D	0.76494	0.126;0.974;0.864;0.999	B;P;P;D	0.74023	0.113;0.777;0.713;0.982	T	0.18903	-1.0322	10	0.56958	D	0.05	-17.2683	12.0012	0.53232	0.1349:0.7351:0.13:0.0	.	328;199;314;348	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	V	314;328;348;328;314;199	ENSP00000334167:A314V;ENSP00000425359:A328V;ENSP00000424838:A348V;ENSP00000427167:A328V;ENSP00000347087:A314V;ENSP00000423123:A199V	ENSP00000334167:A314V	A	+	2	0	DDX4	55119456	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.937000	0.48979	2.756000	0.94617	0.655000	0.94253	GCT	.		0.393	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
DENND5A	23258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	9202573	9202573	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:9202573G>T	ENST00000328194.3	-	6	1516	c.1196C>A	c.(1195-1197)cCa>cAa	p.P399Q	DENND5A_ENST00000530044.1_Missense_Mutation_p.P399Q|DENND5A_ENST00000526523.1_5'Flank	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	399					positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGGGAACTGTGGCAAGTCCTC	0.468																																					p.P399Q		.											.	DENND5A	91	0			c.C1196A						.						67.0	68.0	68.0					11																	9202573		2201	4296	6497	SO:0001583	missense	23258	exon6			AACTGTGGCAAGT	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.1196C>A	11.37:g.9202573G>T	ENSP00000328524:p.Pro399Gln	Somatic	82.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	35.0	NM_001243254	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808638	0.90707	.	.	ENSG00000184014	ENST00000328194;ENST00000530044	T;T	0.05319	3.46;3.46	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.00740	-1.1586	10	0.87932	D	0	.	18.9552	0.92655	0.0:0.0:1.0:0.0	.	399;399	E9PS91;Q6IQ26	.;DEN5A_HUMAN	Q	399	ENSP00000328524:P399Q;ENSP00000435866:P399Q	ENSP00000328524:P399Q	P	-	2	0	DENND5A	9159149	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.810000	0.99221	2.550000	0.86006	0.563000	0.77884	CCA	.		0.468	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385910.2	NM_015213	
DIP2C	22982	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	436697	436697	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:436697T>A	ENST00000280886.6	-	11	1454	c.1367A>T	c.(1366-1368)gAg>gTg	p.E456V	DIP2C_ENST00000381496.3_Missense_Mutation_p.E349V	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	456						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CTGTGGGATCTCTCCCGTTGG	0.557																																					p.E456V		.											.	DIP2C	156	0			c.A1367T						.						210.0	191.0	197.0					10																	436697		2203	4300	6503	SO:0001583	missense	22982	exon11			GGGATCTCTCCCG	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.1367A>T	10.37:g.436697T>A	ENSP00000280886:p.Glu456Val	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	94.0	23.0	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394392	0.83011	.	.	ENSG00000151240	ENST00000280886;ENST00000381496	T;T	0.44083	0.93;0.93	5.41	5.41	0.78517	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.62441	0.2428	M	0.67953	2.075	0.58432	D	0.999998	D;B	0.64830	0.994;0.319	D;P	0.71656	0.974;0.513	T	0.64943	-0.6288	10	0.56958	D	0.05	-36.63	15.441	0.75181	0.0:0.0:0.0:1.0	.	349;456	E7EPU2;Q9Y2E4	.;DIP2C_HUMAN	V	456;349	ENSP00000280886:E456V;ENSP00000370907:E349V	ENSP00000280886:E456V	E	-	2	0	DIP2C	426697	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.997000	0.88414	2.046000	0.60703	0.254000	0.18369	GAG	.		0.557	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
DLEC1	9940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	38135225	38135225	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:38135225C>T	ENST00000308059.6	+	12	1907	c.1886C>T	c.(1885-1887)aCg>aTg	p.T629M	DLEC1_ENST00000346219.3_Missense_Mutation_p.T629M|DLEC1_ENST00000452631.2_Missense_Mutation_p.T629M					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		CTTCGGTCCACGGCTAGGAAG	0.502																																					p.T629M		.											.	DLEC1	161	0			c.C1886T						.						123.0	124.0	123.0					3																	38135225		1909	4135	6044	SO:0001583	missense	9940	exon12			GGTCCACGGCTAG	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1886C>T	3.37:g.38135225C>T	ENSP00000308597:p.Thr629Met	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	54.0	NM_007337		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	C	13.25	2.180990	0.38511	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.05996	3.37;3.36;3.6	5.08	3.25	0.37280	.	0.239343	0.42420	D	0.000702	T	0.07548	0.0190	L	0.53249	1.67	0.09310	N	0.999999	D;D;D	0.56521	0.976;0.976;0.976	P;B;P	0.44673	0.457;0.356;0.457	T	0.25745	-1.0123	10	0.34782	T	0.22	-12.8453	6.5019	0.22174	0.0:0.7237:0.0:0.2763	.	629;629;629	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	M	629	ENSP00000308597:T629M;ENSP00000315914:T629M;ENSP00000410427:T629M	ENSP00000308597:T629M	T	+	2	0	DLEC1	38110229	0.020000	0.18652	0.645000	0.29479	0.974000	0.67602	1.115000	0.31209	1.096000	0.41439	0.655000	0.94253	ACG	.		0.502	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
DMRT2	10655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	1056606	1056606	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:1056606G>T	ENST00000358146.2	+	3	1019	c.1019G>T	c.(1018-1020)aGa>aTa	p.R340I	DMRT2_ENST00000259622.6_3'UTR|DMRT2_ENST00000382251.3_Missense_Mutation_p.R340I|DMRT2_ENST00000302441.6_Missense_Mutation_p.R340I|DMRT2_ENST00000382255.3_3'UTR			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	340					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		TTGTCCTCAAGATTTTTAGTT	0.478																																					p.R340I		.											.	DMRT2	514	0			c.G1019T						.						100.0	105.0	103.0					9																	1056606		2203	4300	6503	SO:0001583	missense	10655	exon4			CCTCAAGATTTTT	AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.1019G>T	9.37:g.1056606G>T	ENSP00000350865:p.Arg340Ile	Somatic	66.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	22.0	NM_181872	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Missense_Mutation	SNP	ENST00000358146.2	37	CCDS6444.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725832	0.69074	.	.	ENSG00000173253	ENST00000382251;ENST00000302441;ENST00000358146	T;T;T	0.27557	1.66;1.66;1.66	5.62	5.62	0.85841	.	0.240668	0.40908	D	0.000985	T	0.53077	0.1774	L	0.59436	1.845	0.58432	D	0.999999	D;D	0.67145	0.994;0.996	P;D	0.66497	0.88;0.944	T	0.52366	-0.8585	10	0.72032	D	0.01	-15.4915	19.2806	0.94051	0.0:0.0:1.0:0.0	.	340;184	Q9Y5R5;Q5HYK2	DMRT2_HUMAN;.	I	340	ENSP00000371686:R340I;ENSP00000305785:R340I;ENSP00000350865:R340I	ENSP00000305785:R340I	R	+	2	0	DMRT2	1046606	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	9.153000	0.94687	2.665000	0.90641	0.650000	0.86243	AGA	.		0.478	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051492.1	NM_006557	
DNAH14	127602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	225147985	225147985	+	Intron	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:225147985T>C	ENST00000445597.2	+	6	748				DNAH14_ENST00000430092.1_Silent_p.P116P|DNAH14_ENST00000366850.3_Silent_p.P116P|DNAH14_ENST00000498360.1_3'UTR|DNAH14_ENST00000366849.1_Silent_p.P116P|DNAH14_ENST00000439375.2_Silent_p.P116P|DNAH14_ENST00000366848.1_Silent_p.P116P|DNAH14_ENST00000400952.3_Silent_p.P116P			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAGCCAGGCCTGTGTCCTATG	0.398																																					p.P116P		.											.	DNAH14	23	0			c.T348C						.						92.0	87.0	88.0					1																	225147985		1880	4112	5992	SO:0001627	intron_variant	127602	exon4			CAGGCCTGTGTCC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.749-4196T>C	1.37:g.225147985T>C		Somatic	79.0	0.0		WXS	Illumina HiSeq	Phase_I	150.0	37.0	NM_144989	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	37																																																																																				.		0.398	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
DNAH9	1770	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	11786904	11786904	+	Splice_Site	SNP	C	C	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:11786904C>A	ENST00000262442.4	+	56	10876	c.10808C>A	c.(10807-10809)tCc>tAc	p.S3603Y	DNAH9_ENST00000454412.2_Splice_Site_p.S3603Y|DNAH9_ENST00000608377.1_5'UTR|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3603	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TATTTGCAGTCCGATCTCACA	0.498																																					p.S3603Y		.											.	DNAH9	168	0			c.C10808A						.						112.0	99.0	103.0					17																	11786904		2203	4300	6503	SO:0001630	splice_region_variant	1770	exon56			TGCAGTCCGATCT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10807-1C>A	17.37:g.11786904C>A		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	73.0	15.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.197228	0.79015	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.27557	1.66;1.66	4.91	4.91	0.64330	.	0.200493	0.45361	D	0.000376	T	0.58708	0.2141	M	0.84948	2.725	0.80722	D	1	P	0.40211	0.707	P	0.55667	0.781	T	0.63323	-0.6663	10	0.72032	D	0.01	.	18.6493	0.91425	0.0:1.0:0.0:0.0	.	3603	Q9NYC9	DYH9_HUMAN	Y	3603;3603;2185	ENSP00000262442:S3603Y;ENSP00000414874:S3603Y	ENSP00000262442:S3603Y	S	+	2	0	DNAH9	11727629	0.998000	0.40836	0.984000	0.44739	0.961000	0.63080	3.923000	0.56469	2.709000	0.92574	0.655000	0.94253	TCC	.		0.498	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	Missense_Mutation
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169484584	169484584	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:169484584T>C	ENST00000256935.8	+	44	4461	c.4381T>C	c.(4381-4383)Tcc>Ccc	p.S1461P	DOCK2_ENST00000540750.1_Splice_Site_p.S522P|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Splice_Site_p.S953P	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1461	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCACGGACAGTCCATGTGGAT	0.567																																					p.S1461P		.											.	DOCK2	97	0			c.T4381C						.						106.0	88.0	94.0					5																	169484584		2203	4300	6503	SO:0001630	splice_region_variant	1794	exon44			GGACAGTCCATGT	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.4381-1T>C	5.37:g.169484584T>C		Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	101.0	17.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.943045	0.73672	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.18810	2.19;2.19;2.19	5.47	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.44456	0.1294	M	0.73598	2.24	0.43025	D	0.994583	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.91635	0.999;0.968;0.996	T	0.34700	-0.9818	10	0.48119	T	0.1	.	11.4863	0.50356	0.1348:0.0:0.0:0.8652	.	953;17;1461	E7ERW7;B3KY14;Q92608	.;.;DOCK2_HUMAN	P	1461;953;522	ENSP00000256935:S1461P;ENSP00000429283:S953P;ENSP00000438827:S522P	ENSP00000256935:S1461P	S	+	1	0	DOCK2	169417162	1.000000	0.71417	0.961000	0.40146	0.906000	0.53458	2.048000	0.41278	0.845000	0.35118	0.533000	0.62120	TCC	.		0.567	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	Missense_Mutation
DSG4	147409	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	28956907	28956907	+	Silent	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr18:28956907T>C	ENST00000308128.4	+	1	168	c.33T>C	c.(31-33)ctT>ctC	p.L11L	RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Silent_p.L11L|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	11					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ACATTTGCCTTTTGATCATTC	0.428																																					p.L11L		.											DSG4,NS,carcinoma,+1	DSG4	177	0			c.T33C						.						108.0	93.0	98.0					18																	28956907		2203	4300	6503	SO:0001819	synonymous_variant	147409	exon1			TTGCCTTTTGATC	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.33T>C	18.37:g.28956907T>C		Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	53.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Silent	SNP	ENST00000308128.4	37	CCDS11897.1																																																																																			.		0.428	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
DSEL	92126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	65180960	65180960	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr18:65180960G>A	ENST00000310045.7	-	2	2389	c.916C>T	c.(916-918)Cgc>Tgc	p.R306C	CTD-2541J13.2_ENST00000581951.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	296					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TTAAAATGGCGCTGGGCCAGA	0.398																																					p.R306C		.											.	DSEL	157	0			c.C916T						.						72.0	77.0	75.0					18																	65180960		2203	4300	6503	SO:0001583	missense	92126	exon2			AATGGCGCTGGGC	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.916C>T	18.37:g.65180960G>A	ENSP00000310565:p.Arg306Cys	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	36.0	NM_032160	Q17RH1|Q6P5Z3	Missense_Mutation	SNP	ENST00000310045.7	37	CCDS11995.1	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474135	0.63737	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.27720	1.65	4.62	3.75	0.43078	.	0.000000	0.85682	U	0.000000	T	0.36248	0.0960	M	0.78049	2.395	0.80722	D	1	B	0.13594	0.008	B	0.04013	0.001	T	0.34625	-0.9821	10	0.87932	D	0	.	12.9458	0.58371	0.0796:0.0:0.9204:0.0	.	296	Q8IZU8	DSEL_HUMAN	C	306;296	ENSP00000310565:R306C	ENSP00000310565:R306C	R	-	1	0	DSEL	63331940	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.761000	0.85260	1.093000	0.41377	0.462000	0.41574	CGC	.		0.398	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
DUSP27	92235	broad.mit.edu;mdanderson.org	37	1	167095361	167095361	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:167095361G>A	ENST00000361200.2	+	6	1159	c.993G>A	c.(991-993)aaG>aaA	p.K331K	DUSP27_ENST00000271385.5_Silent_p.K331K|DUSP27_ENST00000485151.1_3'UTR|DUSP27_ENST00000443333.1_Silent_p.K331K			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	331					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						CCCTGGGGAAGGCCACCCAGG	0.657																																					p.K331K		.											.	DUSP27	71	0			c.G993A						.						20.0	25.0	24.0					1																	167095361		2202	4295	6497	SO:0001819	synonymous_variant	92235	exon5			GGGGAAGGCCACC	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.993G>A	1.37:g.167095361G>A		Somatic	10.0	1.0		WXS	Illumina HiSeq	Phase_I	19.0	5.0	NM_001080426	A0AUM4|Q9C074	Silent	SNP	ENST00000361200.2	37	CCDS30932.1																																																																																			.		0.657	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
EHHADH	1962	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	184910999	184910999	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:184910999A>C	ENST00000231887.3	-	7	1262	c.1187T>G	c.(1186-1188)cTc>cGc	p.L396R	EHHADH_ENST00000456310.1_Missense_Mutation_p.L300R|EHHADH-AS1_ENST00000417720.1_RNA	NM_001166415.1|NM_001966.3	NP_001159887.1|NP_001957.2	Q08426	ECHP_HUMAN	enoyl-CoA, hydratase/3-hydroxyacyl CoA dehydrogenase	396	3-hydroxyacyl-CoA dehydrogenase.				fatty acid beta-oxidation (GO:0006635)|internal protein amino acid acetylation (GO:0006475)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|coenzyme binding (GO:0050662)|dodecenoyl-CoA delta-isomerase activity (GO:0004165)|enoyl-CoA hydratase activity (GO:0004300)|enzyme binding (GO:0019899)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(2)|skin(3)	24	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)			CACAGCTGAGAGTTCAGCAAA	0.443																																					p.L396R		.											.	EHHADH	93	0			c.T1187G						.						183.0	173.0	176.0					3																	184910999		2203	4300	6503	SO:0001583	missense	1962	exon7			GCTGAGAGTTCAG	L07077	CCDS33901.1, CCDS54694.1	3q26.3-q28	2012-07-13	2010-04-30		ENSG00000113790	ENSG00000113790	4.2.1.17, 1.1.1.35, 5.3.3.8		3247	protein-coding gene	gene with protein product		607037	"""enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase"""	ECHD		8188243	Standard	NM_001966		Approved		uc003fpf.3	Q08426	OTTHUMG00000156698	ENST00000231887.3:c.1187T>G	3.37:g.184910999A>C	ENSP00000231887:p.Leu396Arg	Somatic	98.0	0.0		WXS	Illumina HiSeq	Phase_I	169.0	64.0	NM_001966	A8K6Y3|B4DWG3|D3DNU0|Q58EZ5	Missense_Mutation	SNP	ENST00000231887.3	37	CCDS33901.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055404	0.75960	.	.	ENSG00000113790	ENST00000537544;ENST00000231887;ENST00000456310	D;D	0.81821	-1.54;-1.54	6.08	6.08	0.98989	3-hydroxyacyl-CoA dehydrogenase, NAD binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.93190	0.7831	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95085	0.8217	10	0.87932	D	0	-11.8271	16.6512	0.85203	1.0:0.0:0.0:0.0	.	396	Q08426	ECHP_HUMAN	R	396;396;300	ENSP00000231887:L396R;ENSP00000387746:L300R	ENSP00000231887:L396R	L	-	2	0	EHHADH	186393693	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	8.818000	0.91991	2.333000	0.79357	0.482000	0.46254	CTC	.		0.443	EHHADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345326.1		
EHMT1	79813	ucsc.edu;bcgsc.ca	37	9	140707934	140707934	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:140707934C>T	ENST00000460843.1	+	21	3159	c.3132C>T	c.(3130-3132)aaC>aaT	p.N1044N		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1044					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TCTCTCAGAACTGCGTGACGT	0.587																																					p.N1044N		.											.	EHMT1	154	0			c.C3132T						.						147.0	92.0	111.0					9																	140707934		2203	4300	6503	SO:0001819	synonymous_variant	79813	exon21			TCAGAACTGCGTG	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3132C>T	9.37:g.140707934C>T		Somatic	29.0	0.0		WXS	Illumina HiSeq	.	45.0	4.0	NM_024757	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	ENST00000460843.1	37	CCDS7050.2																																																																																			.		0.587	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757	
ELN	2006	ucsc.edu;bcgsc.ca	37	7	73459618	73459618	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:73459618C>T	ENST00000252034.7	+	10	935	c.536C>T	c.(535-537)gCt>gTt	p.A179V	ELN_ENST00000429192.1_Missense_Mutation_p.A184V|ELN_ENST00000357036.5_Missense_Mutation_p.A184V|ELN_ENST00000358929.4_Missense_Mutation_p.A179V|ELN_ENST00000320399.6_Missense_Mutation_p.A179V|ELN_ENST00000380553.4_Intron|ELN_ENST00000380584.4_Missense_Mutation_p.A179V|ELN_ENST00000414324.1_Missense_Mutation_p.A174V|ELN_ENST00000380575.4_Missense_Mutation_p.A169V|ELN_ENST00000458204.1_Missense_Mutation_p.A169V|ELN_ENST00000380576.5_Missense_Mutation_p.A179V|ELN_ENST00000320492.7_Missense_Mutation_p.A167V|ELN_ENST00000380562.4_Missense_Mutation_p.A179V|ELN_ENST00000445912.1_Missense_Mutation_p.A179V	NM_000501.2|NM_001278915.1	NP_000492.2|NP_001265844.1	P15502	ELN_HUMAN	elastin	179					blood circulation (GO:0008015)|blood vessel remodeling (GO:0001974)|cell proliferation (GO:0008283)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|organ morphogenesis (GO:0009887)|regulation of actin filament polymerization (GO:0030833)|respiratory gaseous exchange (GO:0007585)|skeletal muscle tissue development (GO:0007519)|stress fiber assembly (GO:0043149)	elastic fiber (GO:0071953)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(4)|pancreas(2)|prostate(1)|skin(2)|stomach(1)	32		Lung NSC(55;0.159)				aagcccaaggctccaggtatg	0.627			T	PAX5	B-ALL		"""Supravalvular Aortic Stenosis, Cutis laxa , Williams-Beuren Syndrome"""																														p.A184V		.		Dom	yes		7	7q11.23	2006	elastin	yes	L	.	ELN	95	0			c.C551T						.						47.0	47.0	47.0					7																	73459618		2203	4300	6503	SO:0001583	missense	2006	exon10			CCAAGGCTCCAGG		CCDS5562.2, CCDS43598.1, CCDS43599.1, CCDS47611.1, CCDS47612.1, CCDS64673.1, CCDS64674.1, CCDS64675.1, CCDS64676.1, CCDS64677.1, CCDS64678.1, CCDS75616.1, CCDS75617.1	7q11.1-q21.1	2008-08-01	2008-08-01		ENSG00000049540	ENSG00000049540			3327	protein-coding gene	gene with protein product	"""tropoelastin"", ""supravalvular aortic stenosis"", ""Williams-Beuren syndrome"""	130160				8096434	Standard	NM_001278939		Approved	WBS, WS, SVAS	uc003tzn.3	P15502	OTTHUMG00000150229	ENST00000252034.7:c.536C>T	7.37:g.73459618C>T	ENSP00000252034:p.Ala179Val	Somatic	29.0	0.0		WXS	Illumina HiSeq	.	39.0	4.0	NM_001081753	B3KTS6|O15336|O15337|Q14233|Q14234|Q14235|Q14238|Q6P0L4|Q6ZWJ6|Q75MU5|Q7Z316|Q7Z3F5|Q9UMF5	Missense_Mutation	SNP	ENST00000252034.7	37	CCDS5562.2	.	.	.	.	.	.	.	.	.	.	C	12.01	1.809488	0.31961	.	.	ENSG00000049540	ENST00000445912;ENST00000252034;ENST00000358929;ENST00000320492;ENST00000438906;ENST00000414324;ENST00000380562;ENST00000380575;ENST00000380584;ENST00000458204;ENST00000357036;ENST00000429192;ENST00000442462;ENST00000380576;ENST00000320399	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;1.49;0.9;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	3.58	0.593	0.17478	.	.	.	.	.	T	0.62307	0.2417	N	0.17474	0.49	0.27057	N	0.963641	B;B;B;B;B;B;B;B;B;B;B;B	0.09022	0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002	B;B;B;B;B;B;B;B;B;B;B;B	0.06405	0.002;0.001;0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002;0.002	T	0.46512	-0.9186	9	0.25751	T	0.34	-0.0055	6.3862	0.21561	0.0:0.655:0.0:0.345	.	179;148;167;174;169;179;169;184;184;179;179;179	E7ENM0;E9PBM4;G5E950;G3V0G6;E7EN65;P15502-1;P15502-7;P15502-12;P15502-5;P15502-13;P15502-8;P15502-2	.;.;.;.;.;.;.;.;.;.;.;.	V	179;179;179;167;167;174;179;169;179;169;184;184;148;179;179	ENSP00000389857:A179V;ENSP00000252034:A179V;ENSP00000351807:A179V;ENSP00000315607:A167V;ENSP00000406949:A167V;ENSP00000392575:A174V;ENSP00000369936:A179V;ENSP00000369949:A169V;ENSP00000369958:A179V;ENSP00000403162:A169V;ENSP00000349540:A184V;ENSP00000391129:A184V;ENSP00000369950:A179V;ENSP00000313565:A179V	ENSP00000252034:A179V	A	+	2	0	ELN	73097554	0.007000	0.16637	0.986000	0.45419	0.454000	0.32378	-0.153000	0.10144	0.003000	0.14656	0.467000	0.42956	GCT	.		0.627	ELN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316913.1	NM_000501	
EVPL	2125	ucsc.edu;bcgsc.ca	37	17	74006092	74006092	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:74006092T>C	ENST00000301607.3	-	22	3447	c.3194A>G	c.(3193-3195)aAg>aGg	p.K1065R	EVPL_ENST00000586740.1_Missense_Mutation_p.K1087R	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1065	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CACCTCCCTCTTCTCAAGGGC	0.607																																					p.K1065R		.											.	EVPL	93	0			c.A3194G						.						137.0	132.0	133.0					17																	74006092		2203	4300	6503	SO:0001583	missense	2125	exon22			TCCCTCTTCTCAA	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3194A>G	17.37:g.74006092T>C	ENSP00000301607:p.Lys1065Arg	Somatic	46.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	T	11.87	1.766604	0.31228	.	.	ENSG00000167880	ENST00000301607	T	0.63417	-0.04	5.17	0.468	0.16732	.	0.444884	0.24332	N	0.039442	T	0.26955	0.0660	N	0.01109	-1.01	0.21579	N	0.999635	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26052	-1.0114	10	0.22109	T	0.4	-21.2668	9.5792	0.39477	0.0:0.3977:0.0:0.6023	.	1087;1065	B7ZLH8;Q92817	.;EVPL_HUMAN	R	1065	ENSP00000301607:K1065R	ENSP00000301607:K1065R	K	-	2	0	EVPL	71517687	1.000000	0.71417	0.983000	0.44433	0.976000	0.68499	0.815000	0.27253	0.016000	0.14998	0.402000	0.26972	AAG	.		0.607	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
EXO1	9156	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	242035389	242035389	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:242035389G>A	ENST00000366548.3	+	12	1916	c.1323G>A	c.(1321-1323)aaG>aaA	p.K441K	EXO1_ENST00000348581.5_Silent_p.K441K|EXO1_ENST00000518483.1_Silent_p.K441K	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	441	Interaction with MLH1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TTACGAAGAAGACCAAGAAAA	0.358								Editing and processing nucleases																													p.K441K		.											.	EXO1	661	0			c.G1323A						.						44.0	45.0	45.0					1																	242035389		2203	4300	6503	SO:0001819	synonymous_variant	9156	exon12			GAAGAAGACCAAG	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1323G>A	1.37:g.242035389G>A		Somatic	140.0	0.0		WXS	Illumina HiSeq	Phase_I	376.0	32.0	NM_130398	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Silent	SNP	ENST00000366548.3	37	CCDS1620.1																																																																																			.		0.358	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027	
FAM169B	283777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	99023985	99023985	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr15:99023985C>G	ENST00000558256.1	-	4	277	c.28G>C	c.(28-30)Gtt>Ctt	p.V10L	FAM169B_ENST00000332908.4_Missense_Mutation_p.V10L	NM_182562.2	NP_872368.2	Q8N8A8	F169B_HUMAN	family with sequence similarity 169, member B	10										large_intestine(3)|lung(3)|urinary_tract(1)	7						AAAAGCACAACCCTTTCCCCA	0.373																																					p.V10L		.											.	.	.	0			c.G28C						.						72.0	69.0	70.0					15																	99023985		1864	4095	5959	SO:0001583	missense	283777	exon4			GCACAACCCTTTC		CCDS45360.1	15q26.3	2008-08-08			ENSG00000185087	ENSG00000185087			26835	protein-coding gene	gene with protein product							Standard	NM_182562		Approved	FLJ39743, KIAA0888L	uc002buk.1	Q8N8A8		ENST00000558256.1:c.28G>C	15.37:g.99023985C>G	ENSP00000453554:p.Val10Leu	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	105.0	29.0	NM_182562	B5MDL8	Missense_Mutation	SNP	ENST00000558256.1	37	CCDS45360.1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.608089	0.28623	.	.	ENSG00000185087	ENST00000332908	T	0.72282	-0.64	5.27	2.89	0.33648	.	0.290655	0.33110	N	0.005280	T	0.50411	0.1614	N	0.17082	0.46	0.26442	N	0.975758	B	0.02656	0.0	B	0.01281	0.0	T	0.39231	-0.9624	10	0.44086	T	0.13	-9.8168	7.3417	0.26640	0.0:0.0771:0.1438:0.7791	.	10	Q8N8A8	F169B_HUMAN	L	10	ENSP00000332615:V10L	ENSP00000332615:V10L	V	-	1	0	FAM169B	96841508	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	1.945000	0.40273	0.283000	0.22279	-0.294000	0.09567	GTT	.		0.373	FAM169B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415488.1	NM_182562	
FAM189B	10712	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155224577	155224577	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:155224577A>C	ENST00000361361.2	-	1	601	c.92T>G	c.(91-93)cTg>cGg	p.L31R	FAM189B_ENST00000472550.1_5'UTR|FAM189B_ENST00000350210.2_Missense_Mutation_p.L31R|SCAMP3_ENST00000472397.1_5'Flank|FAM189B_ENST00000368368.3_Missense_Mutation_p.L31R	NM_006589.2	NP_006580.2	P81408	F189B_HUMAN	family with sequence similarity 189, member B	31						integral component of membrane (GO:0016021)	WW domain binding (GO:0050699)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23						CAGGGCCTGCAGCCAGGGTCG	0.672																																					p.L31R		.											.	FAM189B	154	0			c.T92G						.						43.0	39.0	40.0					1																	155224577		2203	4300	6503	SO:0001583	missense	10712	exon1			GCCTGCAGCCAGG	AF070550	CCDS1103.1, CCDS1104.1, CCDS58035.1	1q21	2009-07-09	2009-07-09	2009-07-09	ENSG00000160767	ENSG00000160767			1233	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 2"""	C1orf2		9331372	Standard	NM_006589		Approved	cote1	uc001fjm.3	P81408	OTTHUMG00000035844	ENST00000361361.2:c.92T>G	1.37:g.155224577A>C	ENSP00000354958:p.Leu31Arg	Somatic	47.0	0.0		WXS	Illumina HiSeq	Phase_I	170.0	19.0	NM_001267608	B1AVS5|Q8IXL3|Q9BR66	Missense_Mutation	SNP	ENST00000361361.2	37	CCDS1103.1	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809219	0.70797	.	.	ENSG00000160767	ENST00000350210;ENST00000333966;ENST00000368368;ENST00000361361;ENST00000491082	T;T;T;T	0.24350	2.16;2.43;2.42;1.86	4.59	4.59	0.56863	.	0.195943	0.35013	N	0.003501	T	0.13200	0.0320	N	0.08118	0	0.32694	N	0.513739	D;D;D;D	0.65815	0.968;0.995;0.994;0.995	P;D;P;P	0.69142	0.724;0.962;0.81;0.884	T	0.07271	-1.0781	10	0.32370	T	0.25	.	6.958	0.24582	0.8987:0.0:0.1013:0.0	.	31;31;31;31	D6RD59;B1AVS5;P81408-2;P81408	.;.;.;F189B_HUMAN	R	31	ENSP00000307128:L31R;ENSP00000357352:L31R;ENSP00000354958:L31R;ENSP00000427011:L31R	ENSP00000333944:L31R	L	-	2	0	FAM189B	153491201	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.772000	0.55325	2.057000	0.61298	0.533000	0.62120	CTG	.		0.672	FAM189B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087224.1	NM_006589	
ERICH6B	220081	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	46135603	46135603	+	Silent	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr13:46135603A>G	ENST00000298738.2	-	11	1472	c.1308T>C	c.(1306-1308)ccT>ccC	p.P436P		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		436										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CAGGCTTCTCAGGTGTTGGTT	0.383																																					p.P436P		.											.	FAM194B	68	0			c.T1308C						.						284.0	230.0	246.0					13																	46135603		692	1591	2283	SO:0001819	synonymous_variant	220081	exon11			CTTCTCAGGTGTT																												ENST00000298738.2:c.1308T>C	13.37:g.46135603A>G		Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	382.0	35.0	NM_182542	Q96MB5	Silent	SNP	ENST00000298738.2	37	CCDS45045.1																																																																																			.		0.383	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
FAT2	2196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	150922777	150922777	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:150922777G>A	ENST00000261800.5	-	9	7923	c.7911C>T	c.(7909-7911)aaC>aaT	p.N2637N		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2637	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGTGACTGGGTTAATTTCAA	0.478																																					p.N2637N		.											.	FAT2	96	0			c.C7911T						.						142.0	139.0	140.0					5																	150922777		2203	4300	6503	SO:0001819	synonymous_variant	2196	exon9			GACTGGGTTAATT	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.7911C>T	5.37:g.150922777G>A		Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	18.0	NM_001447	O75091|Q9NSR7	Silent	SNP	ENST00000261800.5	37	CCDS4317.1																																																																																			.		0.478	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
FDXACB1	91893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	111746109	111746109	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:111746109A>G	ENST00000260257.4	-	5	1459	c.1412T>C	c.(1411-1413)aTc>aCc	p.I471T	FDXACB1_ENST00000542429.1_Missense_Mutation_p.I322T|ALG9_ENST00000524880.1_Intron|ALG9_ENST00000527377.1_Intron	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	471					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						GGCAGATGTGATAACAGACCC	0.373																																					p.I471T		.											.	FDXACB1	22	0			c.T1412C						.						67.0	66.0	66.0					11																	111746109		1897	4120	6017	SO:0001583	missense	91893	exon5			GATGTGATAACAG		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.1412T>C	11.37:g.111746109A>G	ENSP00000260257:p.Ile471Thr	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	85.0	48.0	NM_138378	A0PJW7|B4DUU2	Missense_Mutation	SNP	ENST00000260257.4	37	CCDS44729.1	.	.	.	.	.	.	.	.	.	.	A	0.024	-1.392498	0.01185	.	.	ENSG00000255561	ENST00000260257;ENST00000542429;ENST00000528274	T;T;T	0.71222	0.45;-0.55;0.99	5.22	-2.09	0.07232	.	1.085210	0.06820	N	0.792008	T	0.45935	0.1367	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20405	-1.0276	10	0.14252	T	0.57	.	1.1115	0.01705	0.4584:0.176:0.1633:0.2023	.	471	Q9BRP7	FDXA1_HUMAN	T	471;322;382	ENSP00000260257:I471T;ENSP00000441304:I322T;ENSP00000435572:I382T	ENSP00000260257:I471T	I	-	2	0	FDXACB1	111251319	0.003000	0.15002	0.520000	0.27837	0.563000	0.35712	-0.004000	0.12878	0.012000	0.14892	-0.132000	0.14878	ATC	.		0.373	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378	
FRAS1	80144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	79428611	79428611	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:79428611C>T	ENST00000264895.6	+	62	9793	c.9353C>T	c.(9352-9354)tCc>tTc	p.S3118F		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3114	Calx-beta 5.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GAGATCCTGTCCAATGAAGAC	0.473																																					p.S3118F		.											.	FRAS1	68	0			c.C9353T						.						110.0	103.0	105.0					4																	79428611		1984	4165	6149	SO:0001583	missense	80144	exon62			TCCTGTCCAATGA	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9353C>T	4.37:g.79428611C>T	ENSP00000264895:p.Ser3118Phe	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	179.0	51.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	37	CCDS54771.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.198610	0.38806	.	.	ENSG00000138759	ENST00000264895	T	0.28255	1.62	5.25	5.25	0.73442	.	0.126361	0.56097	D	0.000037	T	0.35711	0.0941	N	0.21097	0.63	0.80722	D	1	D;D	0.59767	0.983;0.986	P;P	0.58331	0.776;0.837	T	0.03335	-1.1047	10	0.10377	T	0.69	.	19.1854	0.93641	0.0:1.0:0.0:0.0	.	3117;3118	Q86XX4-2;E9PHH6	.;.	F	3118	ENSP00000264895:S3118F	ENSP00000264895:S3118F	S	+	2	0	FRAS1	79647635	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.648000	0.83479	2.612000	0.88384	0.591000	0.81541	TCC	.		0.473	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
FUS	2521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	31201608	31201608	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr16:31201608G>T	ENST00000254108.7	+	12	1286	c.1181G>T	c.(1180-1182)cGt>cTt	p.R394L	FUS_ENST00000568685.1_Missense_Mutation_p.R395L|FUS_ENST00000474990.1_3'UTR|FUS_ENST00000380244.3_Missense_Mutation_p.R393L	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein	394	Arg/Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		CCCATGGGCCgtggaggctat	0.567			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																p.R394L		.		Dom	yes		16	16p11.2	2521	"""fusion, derived from t(12;16) malignant liposarcoma"""		"""M, L"""	.	FUS	1719	0			c.G1181T						.						144.0	110.0	121.0					16																	31201608		2197	4300	6497	SO:0001583	missense	2521	exon12			TGGGCCGTGGAGG	AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.1181G>T	16.37:g.31201608G>T	ENSP00000254108:p.Arg394Leu	Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	168.0	29.0	NM_004960	Q9H4A8	Missense_Mutation	SNP	ENST00000254108.7	37	CCDS10707.1	.	.	.	.	.	.	.	.	.	.	G	15.08	2.726726	0.48833	.	.	ENSG00000089280	ENST00000254108;ENST00000380244;ENST00000394533	D	0.97114	-4.25	5.31	3.35	0.38373	.	0.360924	0.28796	N	0.014116	D	0.93976	0.8071	L	0.50333	1.59	0.58432	D	0.999991	B;P;P;P;P;P	0.44429	0.145;0.835;0.704;0.804;0.835;0.704	B;B;B;B;B;B	0.38985	0.073;0.264;0.149;0.287;0.264;0.149	D	0.90342	0.4360	10	0.24483	T	0.36	-1.1004	11.0266	0.47748	0.155:0.0:0.845:0.0	.	393;394;394;393;168;394	A8K4H1;Q8TBR3;Q6IBQ5;P35637-2;Q59H57;P35637	.;.;.;.;.;FUS_HUMAN	L	394;121;323	ENSP00000254108:R394L	ENSP00000254108:R394L	R	+	2	0	FUS	31109109	1.000000	0.71417	0.993000	0.49108	0.542000	0.35054	8.422000	0.90262	0.622000	0.30249	-0.150000	0.13652	CGT	.		0.567	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255526.2	NM_004960	
FTO	79068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	53878098	53878098	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr16:53878098T>A	ENST00000471389.1	+	4	1005	c.783T>A	c.(781-783)caT>caA	p.H261Q	FTO_ENST00000394647.3_5'UTR	NM_001080432.2	NP_001073901.1	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	261	Fe2OG dioxygenase domain.				adipose tissue development (GO:0060612)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|oxidative demethylation (GO:0070989)|oxidative single-stranded DNA demethylation (GO:0035552)|oxidative single-stranded RNA demethylation (GO:0035553)|regulation of lipid storage (GO:0010883)|regulation of multicellular organism growth (GO:0040014)|regulation of respiratory system process (GO:0044065)|regulation of white fat cell proliferation (GO:0070350)|RNA repair (GO:0042245)|temperature homeostasis (GO:0001659)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|oxidative DNA demethylase activity (GO:0035516)|oxidative RNA demethylase activity (GO:0035515)			endometrium(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						ATGACTCTCATCTCGAAGGCA	0.418																																					p.H261Q		.											.	FTO	68	0			c.T783A						.						149.0	137.0	141.0					16																	53878098		2198	4300	6498	SO:0001583	missense	79068	exon4			CTCTCATCTCGAA	BC003583	CCDS32448.1	16q12.2	2013-11-15			ENSG00000140718	ENSG00000140718		"""Alkylation repair homologs"""	24678	protein-coding gene	gene with protein product	"""AlkB homolog 9"", ""alpha-ketoglutarate-dependent dioxygenase"""	610966				17434869, 17991826, 22002720	Standard	NM_001080432		Approved	KIAA1752, MGC5149, ALKBH9	uc002ehr.3	Q9C0B1	OTTHUMG00000158780	ENST00000471389.1:c.783T>A	16.37:g.53878098T>A	ENSP00000418823:p.His261Gln	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	203.0	34.0	NM_001080432	A2RUH1|B2RNS0|Q0P676|Q7Z785	Missense_Mutation	SNP	ENST00000471389.1	37	CCDS32448.1	.	.	.	.	.	.	.	.	.	.	T	12.03	1.814678	0.32053	.	.	ENSG00000140718	ENST00000471389	T	0.62105	0.05	5.81	-8.48	0.00935	Alpha-ketoglutarate-dependent dioxygenase FTO, catalytic domain (1);	1.011690	0.07895	N	0.971788	T	0.22282	0.0537	N	0.02011	-0.69	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.17561	-1.0365	10	0.11182	T	0.66	-1.814	2.9424	0.05835	0.3523:0.1889:0.3573:0.1014	.	261	Q9C0B1	FTO_HUMAN	Q	261	ENSP00000418823:H261Q	ENSP00000418823:H261Q	H	+	3	2	FTO	52435599	0.000000	0.05858	0.000000	0.03702	0.535000	0.34838	-1.869000	0.01643	-1.627000	0.01550	0.533000	0.62120	CAT	.		0.418	FTO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352196.1	NM_001080432	
GPATCH8	23131	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	42475346	42475346	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:42475346C>T	ENST00000591680.1	-	8	4129	c.4099G>A	c.(4099-4101)Gcc>Acc	p.A1367T	GPATCH8_ENST00000434000.1_Missense_Mutation_p.A1289T	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	1367							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		GTGGCAGAGGCTGTAGCTGGC	0.607																																					p.A1367T		.											.	GPATCH8	94	0			c.G4099A						.						88.0	64.0	72.0					17																	42475346		2203	4300	6503	SO:0001583	missense	23131	exon8			CAGAGGCTGTAGC	AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.4099G>A	17.37:g.42475346C>T	ENSP00000467556:p.Ala1367Thr	Somatic	80.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	12.0	NM_001002909	B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	ENST00000591680.1	37	CCDS32666.1	.	.	.	.	.	.	.	.	.	.	C	18.94	3.730358	0.69074	.	.	ENSG00000186566	ENST00000335500;ENST00000434000	T	0.14391	2.51	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.31231	0.0790	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.01198	-1.1421	10	0.46703	T	0.11	-12.7618	18.199	0.89832	0.0:1.0:0.0:0.0	.	1367	Q9UKJ3	GPTC8_HUMAN	T	1367;1289	ENSP00000395016:A1289T	ENSP00000335486:A1367T	A	-	1	0	GPATCH8	39830872	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.327000	0.79147	2.391000	0.81399	0.305000	0.20034	GCC	.		0.607	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457797.1	NM_001002909	
GPR112	139378	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135453612	135453612	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chrX:135453612A>G	ENST00000394143.1	+	14	7813	c.7522A>G	c.(7522-7524)Atg>Gtg	p.M2508V	GPR112_ENST00000370652.1_Missense_Mutation_p.M2508V|GPR112_ENST00000287534.4_Missense_Mutation_p.M2306V|GPR112_ENST00000412101.1_Missense_Mutation_p.M2303V|GPR112_ENST00000394141.1_Missense_Mutation_p.M2303V	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2508					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TGAGATAAGTATGAACCTAAC	0.313																																					p.M2508V		.											.	GPR112	183	0			c.A7522G						.						65.0	59.0	61.0					X																	135453612		2203	4296	6499	SO:0001583	missense	139378	exon14			ATAAGTATGAACC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.7522A>G	X.37:g.135453612A>G	ENSP00000377699:p.Met2508Val	Somatic	138.0	0.0		WXS	Illumina HiSeq	Phase_I	191.0	86.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	37	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	8.194	0.796709	0.16327	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.27557	1.7;1.7;1.66;1.92;1.66	5.14	2.52	0.30459	.	.	.	.	.	T	0.14787	0.0357	N	0.14661	0.345	0.09310	N	0.999996	B;B	0.17667	0.023;0.002	B;B	0.14023	0.01;0.008	T	0.32375	-0.9909	9	0.14252	T	0.57	.	5.4056	0.16320	0.7028:0.1896:0.1076:0.0	.	2303;2508	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	V	2508;2508;2303;2306;2303	ENSP00000377699:M2508V;ENSP00000359686:M2508V;ENSP00000416526:M2303V;ENSP00000287534:M2306V;ENSP00000377697:M2303V	ENSP00000287534:M2306V	M	+	1	0	GPR112	135281278	0.986000	0.35501	1.000000	0.80357	0.981000	0.71138	0.168000	0.16622	0.612000	0.30071	0.483000	0.47432	ATG	.		0.313	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
GPR22	2845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107115448	107115448	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:107115448T>C	ENST00000304402.4	+	3	2286	c.943T>C	c.(943-945)Tct>Cct	p.S315P	COG5_ENST00000393603.2_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000347053.3_Intron|COG5_ENST00000297135.3_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	315					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						CTTCAGGATGTCTTTATTGAT	0.383																																					p.S315P		.											.	GPR22	92	0			c.T943C						.						118.0	120.0	119.0					7																	107115448		2203	4300	6503	SO:0001583	missense	2845	exon3			AGGATGTCTTTAT	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.943T>C	7.37:g.107115448T>C	ENSP00000302676:p.Ser315Pro	Somatic	153.0	0.0		WXS	Illumina HiSeq	Phase_I	330.0	109.0	NM_005295	O14554	Missense_Mutation	SNP	ENST00000304402.4	37	CCDS5744.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.514345	0.64522	.	.	ENSG00000172209	ENST00000304402	T	0.37915	1.17	5.66	5.66	0.87406	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.59432	0.2193	M	0.65498	2.005	0.80722	D	1	D	0.63880	0.993	D	0.79108	0.992	T	0.62900	-0.6756	10	0.87932	D	0	-9.5576	15.8804	0.79201	0.0:0.0:0.0:1.0	.	315	Q99680	GPR22_HUMAN	P	315	ENSP00000302676:S315P	ENSP00000302676:S315P	S	+	1	0	GPR22	106902684	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.040000	0.89188	2.160000	0.67779	0.477000	0.44152	TCT	.		0.383	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337598.1		
GPRC6A	222545	broad.mit.edu;ucsc.edu;mdanderson.org	37	6	117150115	117150115	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr6:117150115C>T	ENST00000310357.3	-	1	83	c.62G>A	c.(61-63)tGc>tAc	p.C21Y	GPRC6A_ENST00000368549.3_Missense_Mutation_p.C21Y|GPRC6A_ENST00000530250.1_Missense_Mutation_p.C21Y	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	21					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		AGGGGTCTGGCAAGGCTGTGA	0.398																																					p.C21Y		.											.	GPRC6A	96	0			c.G62A						.						95.0	96.0	96.0					6																	117150115		2203	4300	6503	SO:0001583	missense	222545	exon1			GTCTGGCAAGGCT	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.62G>A	6.37:g.117150115C>T	ENSP00000309493:p.Cys21Tyr	Somatic	77.0	1.0		WXS	Illumina HiSeq	Phase_I	173.0	25.0	NM_148963	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	37	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.399041	0.62177	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.91464	-2.58;-2.85;-2.85	5.18	4.31	0.51392	.	0.076546	0.53938	D	0.000047	D	0.83741	0.5320	N	0.08118	0	0.26625	N	0.972581	D;P;D	0.76494	0.999;0.607;0.999	D;B;D	0.68943	0.961;0.419;0.956	T	0.80279	-0.1449	10	0.51188	T	0.08	.	12.0711	0.53618	0.0:0.9211:0.0:0.0789	.	21;21;21	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	Y	21	ENSP00000309493:C21Y;ENSP00000357537:C21Y;ENSP00000433465:C21Y	ENSP00000309493:C21Y	C	-	2	0	GPRC6A	117256808	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.930000	0.48924	1.426000	0.47256	0.655000	0.94253	TGC	.		0.398	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
HAUS5	23354	ucsc.edu;bcgsc.ca	37	19	36106246	36106246	+	Missense_Mutation	SNP	A	A	G	rs199705430		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:36106246A>G	ENST00000203166.5	+	6	468	c.443A>G	c.(442-444)cAg>cGg	p.Q148R	AC002115.9_ENST00000589603.1_lincRNA|HAUS5_ENST00000379045.2_Missense_Mutation_p.Q148R	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	148					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						GATCCCATGCAGCGGCTGCAG	0.632																																					p.Q148R		.											.	HAUS5	68	0			c.A443G						.						18.0	21.0	20.0					19																	36106246		2011	4186	6197	SO:0001583	missense	23354	exon6			CCATGCAGCGGCT	AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.443A>G	19.37:g.36106246A>G	ENSP00000439056:p.Gln148Arg	Somatic	30.0	0.0		WXS	Illumina HiSeq	.	43.0	4.0	NM_015302	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	ENST00000203166.5	37	CCDS42550.1	.	.	.	.	.	.	.	.	.	.	A	7.878	0.729709	0.15507	.	.	ENSG00000249115	ENST00000203166;ENST00000379045	T;T	0.29655	1.56;1.56	5.84	3.74	0.42951	.	0.401338	0.25887	N	0.027659	T	0.28400	0.0702	M	0.71581	2.175	0.29019	N	0.886429	B	0.20671	0.047	B	0.19946	0.027	T	0.25950	-1.0117	10	0.25106	T	0.35	-18.3122	5.4691	0.16660	0.7662:0.0:0.082:0.1518	.	148	O94927	HAUS5_HUMAN	R	148	ENSP00000439056:Q148R;ENSP00000444373:Q148R	ENSP00000439056:Q148R	Q	+	2	0	HAUS5	40798086	0.037000	0.19845	0.637000	0.29366	0.123000	0.20343	0.937000	0.28951	0.445000	0.26639	-0.344000	0.07964	CAG	A|0.999;C|0.001		0.632	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459055.2		
HBS1L	10767	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	135358101	135358102	+	Intron	INS	-	-	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr6:135358101_135358102insT	ENST00000367837.5	-	4	637				HBS1L_ENST00000367822.5_Frame_Shift_Ins_p.N498fs|HBS1L_ENST00000415177.2_Intron|HBS1L_ENST00000367820.2_Intron|HBS1L_ENST00000367826.2_Intron|HBS1L_ENST00000367824.4_Intron|HBS1L_ENST00000445176.2_Intron|HBS1L_ENST00000314674.3_Intron	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase						signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		CAAAATCTGGGTTTTTTATAAG	0.376																																					p.N498fs		.											.	HBS1L	92	0			c.1494_1495insA						.																																			SO:0001627	intron_variant	10767	exon5			ATCTGGGTTTTTT	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.430+2608->A	6.37:g.135358107_135358107dupT		Somatic	109.0	0.0		WXS	Illumina HiSeq	Phase_I	142.0	34.0	NM_001145207	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Frame_Shift_Ins	INS	ENST00000367837.5	37	CCDS5173.1																																																																																			.		0.376	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2		
HCFC1	3054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153222832	153222832	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chrX:153222832C>T	ENST00000310441.7	-	13	3252	c.2286G>A	c.(2284-2286)aaG>aaA	p.K762K	HCFC1_ENST00000369984.4_Silent_p.K762K|HCFC1_ENST00000354233.3_Silent_p.K693K|HCFC1_ENST00000461098.1_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	762	Interaction with ZBTB17.				cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCGTGCCGGGCTTGGTGGTAC	0.642																																					p.K762K		.											.	HCFC1	132	0			c.G2286A						.						116.0	127.0	123.0					X																	153222832		2147	4204	6351	SO:0001819	synonymous_variant	3054	exon13			GCCGGGCTTGGTG		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.2286G>A	X.37:g.153222832C>T		Somatic	111.0	0.0		WXS	Illumina HiSeq	Phase_I	211.0	89.0	NM_005334	Q6P4G5	Silent	SNP	ENST00000310441.7	37	CCDS44020.1																																																																																			.		0.642	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
HIST1H3I	8354	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	27839822	27839822	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr6:27839822A>G	ENST00000328488.2	-	1	277	c.272T>C	c.(271-273)aTg>aCg	p.M91T		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	91					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTGCAGCGCCATCACCGCCGA	0.567																																					p.M91T		.											.	HIST1H3I	91	0			c.T272C						.						82.0	88.0	86.0					6																	27839822		2203	4300	6503	SO:0001583	missense	8354	exon1			AGCGCCATCACCG	X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.272T>C	6.37:g.27839822A>G	ENSP00000329554:p.Met91Thr	Somatic	65.0	0.0		WXS	Illumina HiSeq	Phase_I	180.0	85.0	NM_003533	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000328488.2	37	CCDS4636.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.582648	0.28180	.	.	ENSG00000182572	ENST00000328488	T	0.66995	-0.24	4.12	4.12	0.48240	.	.	.	.	.	T	0.64182	0.2575	.	.	.	0.41515	D	0.988361	.	.	.	.	.	.	T	0.65105	-0.6249	6	0.39692	T	0.17	.	13.3331	0.60500	1.0:0.0:0.0:0.0	.	.	.	.	T	91	ENSP00000329554:M91T	ENSP00000329554:M91T	M	-	2	0	HIST1H3I	27947801	1.000000	0.71417	0.995000	0.50966	0.668000	0.39293	4.395000	0.59678	2.086000	0.62901	0.528000	0.53228	ATG	.		0.567	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1	NM_003533	
IDE	3416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	94223595	94223595	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:94223595T>A	ENST00000265986.6	-	21	2710	c.2654A>T	c.(2653-2655)cAc>cTc	p.H885L	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.H330L	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	885					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TGCCTGAATGTGTTTTTGGAA	0.413																																					p.H885L		.											.	IDE	92	0			c.A2654T						.						234.0	227.0	230.0					10																	94223595		2203	4300	6503	SO:0001583	missense	3416	exon21			TGAATGTGTTTTT	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2654A>T	10.37:g.94223595T>A	ENSP00000265986:p.His885Leu	Somatic	163.0	0.0		WXS	Illumina HiSeq	Phase_I	521.0	78.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	37	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936385	0.73442	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.06768	3.26;3.26	5.61	5.61	0.85477	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	M	0.93720	3.45	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79784	0.96;0.993	T	0.50415	-0.8831	10	0.46703	T	0.11	-16.1168	16.0994	0.81158	0.0:0.0:0.0:1.0	.	885;330	P14735;B3KSB8	IDE_HUMAN;.	L	885;330	ENSP00000265986:H885L;ENSP00000360637:H330L	ENSP00000265986:H885L	H	-	2	0	IDE	94213575	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.760000	0.85248	2.261000	0.74972	0.533000	0.62120	CAC	.		0.413	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
IFNA4	3441	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	21187344	21187344	+	Missense_Mutation	SNP	C	C	G	rs142712065	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:21187344C>G	ENST00000421715.1	-	1	254	c.187G>C	c.(187-189)Gag>Cag	p.E63Q		NM_021068.2	NP_066546.1	P05014	IFNA4_HUMAN	interferon, alpha 4	63					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		AACTCCTCCTCGGGGAATCCG	0.517																																					p.E63Q	NSCLC(154;890 1986 23660 27800 51138)	.											.	IFNA4	92	0			c.G187C						.						114.0	114.0	114.0					9																	21187344		2203	4300	6503	SO:0001583	missense	3441	exon1			CCTCCTCGGGGAA		CCDS6498.1	9p22	2010-08-24			ENSG00000236637	ENSG00000236637		"""Interferons"""	5425	protein-coding gene	gene with protein product		147564				1385305	Standard	NM_021068		Approved	MGC142200, IFN-alpha4a	uc003zon.2	P05014	OTTHUMG00000019660	ENST00000421715.1:c.187G>C	9.37:g.21187344C>G	ENSP00000412897:p.Glu63Gln	Somatic	135.0	0.0		WXS	Illumina HiSeq	Phase_I	326.0	103.0	NM_021068	P13358|Q14CS4|Q5VV15	Missense_Mutation	SNP	ENST00000421715.1	37	CCDS6498.1	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.794798	0.00617	.	.	ENSG00000236637	ENST00000421715	T	0.03242	4.0	2.96	-2.48	0.06423	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.591514	0.17433	N	0.174416	T	0.00552	0.0018	N	0.00084	-2.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39502	-0.9611	10	0.02654	T	1	.	2.3247	0.04220	0.1004:0.2772:0.342:0.2804	.	63	P05014	IFNA4_HUMAN	Q	63	ENSP00000412897:E63Q	ENSP00000412897:E63Q	E	-	1	0	IFNA4	21177344	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.618000	0.02049	-0.623000	0.05618	-0.332000	0.08345	GAG	.		0.517	IFNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051889.1	NM_021068	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	4732940	4732940	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:4732940G>A	ENST00000443694.2	+	29	3896	c.3896G>A	c.(3895-3897)cGg>cAg	p.R1299Q	ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.R1314Q|ITPR1_ENST00000302640.8_Missense_Mutation_p.R1299Q|ITPR1_ENST00000357086.4_Missense_Mutation_p.R1305Q|ITPR1_ENST00000456211.2_Missense_Mutation_p.R1290Q|ITPR1_ENST00000423119.2_Missense_Mutation_p.R1305Q			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1314					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	ACTCACGGTCGGAATGTCCAG	0.408																																					p.R1305Q		.											.	ITPR1	710	0			c.G3914A						.						89.0	87.0	88.0					3																	4732940		1917	4149	6066	SO:0001583	missense	3708	exon32			ACGGTCGGAATGT	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.3896G>A	3.37:g.4732940G>A	ENSP00000401671:p.Arg1299Gln	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	225.0	67.0	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	34	5.351730	0.95830	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.96802	-4.13;-4.13;-4.13;-4.13;-4.13;-4.13	5.24	5.24	0.73138	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.98229	0.9414	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.968;0.979	D	0.98763	1.0725	10	0.56958	D	0.05	.	18.8583	0.92262	0.0:0.0:1.0:0.0	.	1314;1305	Q14643;G5E9P1	ITPR1_HUMAN;.	Q	1314;1299;1314;1305;1305;1290;1299	ENSP00000306253:R1299Q;ENSP00000346595:R1314Q;ENSP00000405934:R1305Q;ENSP00000349597:R1305Q;ENSP00000397885:R1290Q;ENSP00000401671:R1299Q	ENSP00000306253:R1299Q	R	+	2	0	ITPR1	4707940	1.000000	0.71417	0.849000	0.33467	0.941000	0.58515	9.778000	0.99011	2.437000	0.82529	0.655000	0.94253	CGG	.		0.408	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
JMJD1C	221037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	64950774	64950774	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:64950774G>A	ENST00000399262.2	-	17	6389	c.6171C>T	c.(6169-6171)tcC>tcT	p.S2057S	JMJD1C_ENST00000402544.1_Silent_p.S1820S|JMJD1C_ENST00000542921.1_Silent_p.S1875S|JMJD1C_ENST00000399251.1_3'UTR	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2057					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CATTATTCTGGGACACAAGAG	0.433																																					p.S2057S		.											.	JMJD1C	275	0			c.C6171T						.						263.0	256.0	258.0					10																	64950774		1907	4116	6023	SO:0001819	synonymous_variant	221037	exon17			ATTCTGGGACACA	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.6171C>T	10.37:g.64950774G>A		Somatic	151.0	0.0		WXS	Illumina HiSeq	Phase_I	529.0	161.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Silent	SNP	ENST00000399262.2	37	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	G	8.568	0.879284	0.17467	.	.	ENSG00000171988	ENST00000327520	.	.	.	5.52	-0.906	0.10524	.	.	.	.	.	T	0.57475	0.2056	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53387	-0.8446	4	.	.	.	-1.3648	10.5664	0.45175	0.5247:0.0:0.4753:0.0	.	.	.	.	L	604	.	.	P	-	2	0	JMJD1C	64620780	0.955000	0.32602	0.764000	0.31436	0.855000	0.48748	-0.005000	0.12855	-0.121000	0.11787	0.650000	0.86243	CCC	.		0.433	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
JMJD1C	221037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	64966479	64966479	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:64966479G>C	ENST00000399262.2	-	10	5168	c.4950C>G	c.(4948-4950)taC>taG	p.Y1650*	JMJD1C_ENST00000402544.1_Nonsense_Mutation_p.Y1431*|JMJD1C_ENST00000542921.1_Nonsense_Mutation_p.Y1468*|JMJD1C_ENST00000399251.1_Nonsense_Mutation_p.Y1431*	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	1650					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GCTTCTTTTTGTAAGTTGGCT	0.378																																					p.Y1650X		.											.	JMJD1C	275	0			c.C4950G						.						173.0	151.0	158.0					10																	64966479		1852	4106	5958	SO:0001587	stop_gained	221037	exon10			CTTTTTGTAAGTT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.4950C>G	10.37:g.64966479G>C	ENSP00000382204:p.Tyr1650*	Somatic	174.0	0.0		WXS	Illumina HiSeq	Phase_I	525.0	161.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Nonsense_Mutation	SNP	ENST00000399262.2	37	CCDS41532.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	49|49	15.123811|15.123811	0.99823|0.99823	.|.	.|.	ENSG00000171988|ENSG00000171988	ENST00000327520|ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	.|.	.|.	.|.	5.62|5.62	-2.44|-2.44	0.06502|0.06502	.|.	.|0.059320	.|0.64402	.|D	.|0.000001	T|.	0.23572|.	0.0570|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.42155|.	-0.9468|.	3|.	.|0.02654	.|T	.|1	-8.1512|-8.1512	13.2443|13.2443	0.60014|0.60014	0.5054:0.0:0.4946:0.0|0.5054:0.0:0.4946:0.0	.|.	.|.	.|.	.|.	R|X	336|1650;1431;1431;1468	.|.	.|ENSP00000382195:Y1431X	T|Y	-|-	2|3	0|2	JMJD1C|JMJD1C	64636485|64636485	0.998000|0.998000	0.40836|0.40836	0.983000|0.983000	0.44433|0.44433	0.986000|0.986000	0.74619|0.74619	0.404000|0.404000	0.20999|0.20999	-0.391000|-0.391000	0.07763|0.07763	-0.225000|-0.225000	0.12378|0.12378	ACA|TAC	.		0.378	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
KIAA0556	23247	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	27761333	27761333	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr16:27761333A>G	ENST00000261588.4	+	16	3071	c.3052A>G	c.(3052-3054)Atc>Gtc	p.I1018V		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1018						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						CCCTCCCGATATCAATATTTT	0.527																																					p.I1018V		.											.	KIAA0556	141	0			c.A3052G						.						41.0	40.0	40.0					16																	27761333		2197	4300	6497	SO:0001583	missense	23247	exon16			CCCGATATCAATA	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3052A>G	16.37:g.27761333A>G	ENSP00000261588:p.Ile1018Val	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	14.0	NM_015202	A7E2C2	Missense_Mutation	SNP	ENST00000261588.4	37	CCDS32415.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.844112	0.51164	.	.	ENSG00000047578	ENST00000261588	T	0.15834	2.39	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.22975	0.0555	L	0.39147	1.195	0.42620	D	0.993346	P	0.40302	0.712	P	0.47573	0.55	T	0.01617	-1.1311	10	0.34782	T	0.22	-11.2124	15.0765	0.72080	1.0:0.0:0.0:0.0	.	1018	O60303	K0556_HUMAN	V	1018	ENSP00000261588:I1018V	ENSP00000261588:I1018V	I	+	1	0	KIAA0556	27668834	1.000000	0.71417	1.000000	0.80357	0.324000	0.28378	7.377000	0.79668	2.085000	0.62840	0.533000	0.62120	ATC	.		0.527	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433724.1	NM_015202	
KIF20B	9585	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	91474892	91474892	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:91474892A>G	ENST00000371728.3	+	8	958	c.893A>G	c.(892-894)aAg>aGg	p.K298R	KIF20B_ENST00000394289.2_Missense_Mutation_p.K298R|KIF20B_ENST00000416354.1_Missense_Mutation_p.K298R|KIF20B_ENST00000260753.4_Missense_Mutation_p.K298R	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	298	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CAAAAGAGAAAGATGCTGCGC	0.303																																					p.K298R		.											.	KIF20B	93	0			c.A893G						.						44.0	48.0	47.0					10																	91474892		2199	4285	6484	SO:0001583	missense	9585	exon8			AGAGAAAGATGCT	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.893A>G	10.37:g.91474892A>G	ENSP00000360793:p.Lys298Arg	Somatic	107.0	0.0		WXS	Illumina HiSeq	Phase_I	174.0	64.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	37		.	.	.	.	.	.	.	.	.	.	A	18.39	3.613542	0.66672	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99	5.36	5.36	0.76844	Kinesin, motor domain (4);	0.000000	0.49916	D	0.000125	T	0.70509	0.3232	L	0.28649	0.875	0.43313	D	0.995325	B;B	0.32862	0.387;0.055	B;B	0.44163	0.443;0.273	T	0.71695	-0.4515	10	0.51188	T	0.08	-17.2908	11.6171	0.51096	0.9281:0.0:0.0719:0.0	.	298;298	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	R	298	ENSP00000260753:K298R;ENSP00000411545:K298R;ENSP00000377830:K298R;ENSP00000360793:K298R	ENSP00000260753:K298R	K	+	2	0	KIF20B	91464872	0.521000	0.26258	0.999000	0.59377	0.991000	0.79684	1.162000	0.31786	2.160000	0.67779	0.528000	0.53228	AAG	.		0.303	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
LILRA1	11024	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55106781	55106781	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:55106781G>A	ENST00000251372.3	+	5	757	c.575G>A	c.(574-576)aGg>aAg	p.R192K	LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000453777.1_Missense_Mutation_p.R192K|LILRB1_ENST00000418536.2_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	192	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		CCGAGTCGCAGGTGGTCGTAC	0.572																																					p.R192K		.											.	LILRA1	93	0			c.G575A						.						157.0	162.0	160.0					19																	55106781		2203	4300	6503	SO:0001583	missense	11024	exon5			GTCGCAGGTGGTC	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.575G>A	19.37:g.55106781G>A	ENSP00000251372:p.Arg192Lys	Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	376.0	65.0	NM_006863	O75018|Q3MJA6	Missense_Mutation	SNP	ENST00000251372.3	37	CCDS12901.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.045528	0.36085	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.03181	4.02;4.02	2.24	-4.48	0.03515	Immunoglobulin-like fold (1);	0.777662	0.11613	N	0.546521	T	0.07503	0.0189	M	0.84082	2.675	0.09310	N	1	P;P	0.45715	0.865;0.512	P;P	0.48270	0.572;0.569	T	0.05257	-1.0896	10	0.54805	T	0.06	.	3.8719	0.09041	0.2278:0.4018:0.3704:0.0	.	192;192	O75019-2;O75019	.;LIRA1_HUMAN	K	192	ENSP00000251372:R192K;ENSP00000413715:R192K	ENSP00000251372:R192K	R	+	2	0	LILRA1	59798593	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-0.310000	0.08135	-0.489000	0.06716	0.194000	0.17425	AGG	.		0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
LPIN2	9663	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	2925247	2925247	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr18:2925247G>C	ENST00000261596.4	-	14	2151	c.1913C>G	c.(1912-1914)tCt>tGt	p.S638C		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	638	C-LIP.				cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		GAGGCGGAGAGACTTCTTATA	0.493																																					p.S638C		.											.	LPIN2	227	0			c.C1913G						.						98.0	95.0	96.0					18																	2925247		2203	4300	6503	SO:0001583	missense	9663	exon14			CGGAGAGACTTCT	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1913C>G	18.37:g.2925247G>C	ENSP00000261596:p.Ser638Cys	Somatic	88.0	0.0		WXS	Illumina HiSeq	Phase_I	186.0	53.0	NM_014646	A7MD25|D3DUH3	Missense_Mutation	SNP	ENST00000261596.4	37	CCDS11829.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998856	0.54147	.	.	ENSG00000101577	ENST00000261596	D	0.82433	-1.61	4.41	4.41	0.53225	.	0.117372	0.64402	D	0.000012	D	0.91690	0.7373	M	0.88775	2.98	0.80722	D	1	D	0.67145	0.996	P	0.62813	0.907	D	0.93294	0.6671	10	0.62326	D	0.03	-17.4867	17.9017	0.88906	0.0:0.0:1.0:0.0	.	638	Q92539	LPIN2_HUMAN	C	638	ENSP00000261596:S638C	ENSP00000261596:S638C	S	-	2	0	LPIN2	2915247	1.000000	0.71417	0.997000	0.53966	0.084000	0.17831	9.214000	0.95140	2.366000	0.80165	0.563000	0.77884	TCT	.		0.493	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254363.2	NM_014646	
LRRC31	79782	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	169557828	169557828	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:169557828T>C	ENST00000316428.5	-	9	1658	c.1601A>G	c.(1600-1602)gAa>gGa	p.E534G	LRRC31_ENST00000523069.1_3'UTR|LRRC31_ENST00000264676.5_Missense_Mutation_p.E478G	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	534										cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			GTCAAAGCATTCTAGTTCTTC	0.403																																					p.D534G		.											.	LRRC31	93	0			c.A1601G						.						132.0	117.0	122.0					3																	169557828		1878	4103	5981	SO:0001583	missense	79782	exon9			AAGCATTCTAGTT	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.1601A>G	3.37:g.169557828T>C	ENSP00000325978:p.Glu534Gly	Somatic	151.0	1.0		WXS	Illumina HiSeq	Phase_I	472.0	30.0	NM_024727	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Missense_Mutation	SNP	ENST00000316428.5	37	CCDS43167.1	.	.	.	.	.	.	.	.	.	.	T	10.25	1.299214	0.23650	.	.	ENSG00000114248	ENST00000316428;ENST00000264676	T;T	0.08984	3.03;3.11	4.87	0.989	0.19802	.	1.000500	0.08067	N	0.999171	T	0.05502	0.0145	N	0.17082	0.46	0.09310	N	0.999998	B;B	0.14805	0.01;0.011	B;B	0.15052	0.009;0.012	T	0.42799	-0.9430	10	0.51188	T	0.08	1.8094	4.8308	0.13439	0.0:0.2322:0.1487:0.6191	.	478;534	Q6UY01-2;Q6UY01	.;LRC31_HUMAN	G	534;478	ENSP00000325978:E534G;ENSP00000264676:E478G	ENSP00000264676:E478G	E	-	2	0	LRRC31	171040522	0.057000	0.20700	0.000000	0.03702	0.001000	0.01503	1.076000	0.30729	-0.060000	0.13132	-0.263000	0.10527	GAA	.		0.403	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378699.1	NM_024727	
LRRC43	254050	ucsc.edu;bcgsc.ca	37	12	122676081	122676081	+	Silent	SNP	C	C	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:122676081C>A	ENST00000339777.4	+	6	1084	c.1056C>A	c.(1054-1056)ggC>ggA	p.G352G	LRRC43_ENST00000425921.1_Silent_p.G167G	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	352	Glu-rich.									NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		ATGAAGAAGGCGAAATGAATG	0.552											OREG0022219	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G352G		.											.	LRRC43	135	0			c.C1056A						.						85.0	85.0	85.0					12																	122676081		1914	4113	6027	SO:0001819	synonymous_variant	254050	exon6			AGAAGGCGAAATG	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1056C>A	12.37:g.122676081C>A		Somatic	32.0	0.0	1520	WXS	Illumina HiSeq	.	46.0	4.0	NM_001098519	Q6ZVT9	Silent	SNP	ENST00000339777.4	37	CCDS45001.1																																																																																			.		0.552	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
LYAR	55646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	4275388	4275388	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:4275388C>T	ENST00000343470.4	-	8	1081	c.841G>A	c.(841-843)Gat>Aat	p.D281N	LYAR_ENST00000452476.1_Missense_Mutation_p.D281N	NM_017816.2	NP_060286	Q9NX58	LYAR_HUMAN	Ly1 antibody reactive	281	Lys-rich.					nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(6)|liver(2)|lung(5)|ovary(1)|prostate(1)	17				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TTCTTAGAATCTGTTTCAACT	0.403																																					p.D281N		.											.	LYAR	90	0			c.G841A						.						78.0	80.0	79.0					4																	4275388		2203	4300	6503	SO:0001583	missense	55646	exon8			TAGAATCTGTTTC	AL136750	CCDS3374.1	4p16.3	2013-01-10	2012-12-07		ENSG00000145220	ENSG00000145220		"""Zinc fingers, C2HC-type containing"""	26021	protein-coding gene	gene with protein product			"""Ly1 antibody reactive homolog (mouse)"""			11230166, 8491376	Standard	NM_001145725		Approved	ZC2HC2, ZLYAR	uc003ght.3	Q9NX58	OTTHUMG00000125477	ENST00000343470.4:c.841G>A	4.37:g.4275388C>T	ENSP00000345917:p.Asp281Asn	Somatic	76.0	0.0		WXS	Illumina HiSeq	Phase_I	149.0	40.0	NM_017816	D3DVS4|Q6FI78|Q9NYS1	Missense_Mutation	SNP	ENST00000343470.4	37	CCDS3374.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.862908	0.32884	.	.	ENSG00000145220	ENST00000343470;ENST00000452476	T;T	0.32515	1.45;1.45	5.24	1.32	0.21799	.	1.811300	0.01927	N	0.040948	T	0.19604	0.0471	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.12630	-1.0540	10	0.23302	T	0.38	-3.6287	3.4773	0.07589	0.176:0.5217:0.0:0.3022	.	281	Q9NX58	LYAR_HUMAN	N	281	ENSP00000345917:D281N;ENSP00000397367:D281N	ENSP00000345917:D281N	D	-	1	0	LYAR	4326289	0.000000	0.05858	0.000000	0.03702	0.581000	0.36288	0.130000	0.15850	0.245000	0.21373	-0.366000	0.07423	GAT	.		0.403	LYAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246800.2	NM_017816	
LYST	1130	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	235904821	235904821	+	Silent	SNP	C	C	T	rs116017878	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:235904821C>T	ENST00000389794.3	-	31	8433	c.8259G>A	c.(8257-8259)tcG>tcA	p.S2753S	LYST_ENST00000389793.2_Silent_p.S2753S			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2753					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CGTGGGCTGGCGACAAAATAT	0.448													C|||	2	0.000399361	0.0008	0.0	5008	,	,		19464	0.0		0.0	False		,,,				2504	0.001				p.S2753S		.											.	LYST	143	0			c.G8259A						.						171.0	149.0	157.0					1																	235904821		2203	4300	6503	SO:0001819	synonymous_variant	1130	exon31			GGCTGGCGACAAA	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.8259G>A	1.37:g.235904821C>T		Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	313.0	27.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	37	CCDS31062.1																																																																																			C|0.999;T|0.001		0.448	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
MAP7	9053	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	136742909	136742909	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr6:136742909C>T	ENST00000354570.3	-	2	506	c.96G>A	c.(94-96)aaG>aaA	p.K32K	MAP7_ENST00000454590.1_Silent_p.K54K|MAP7_ENST00000544465.1_Silent_p.K17K|MAP7_ENST00000438100.2_Silent_p.K54K|MAP7_ENST00000432797.2_5'UTR	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	32					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		AGGCATTTTTCTTATCTTGCA	0.378																																					p.K54K		.											.	MAP7	90	0			c.G162A						.						126.0	124.0	125.0					6																	136742909		2203	4300	6503	SO:0001819	synonymous_variant	9053	exon2			ATTTTTCTTATCT	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.96G>A	6.37:g.136742909C>T		Somatic	127.0	2.0		WXS	Illumina HiSeq	Phase_I	319.0	78.0	NM_001198611	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Silent	SNP	ENST00000354570.3	37	CCDS5178.1																																																																																			.		0.378	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
MED12L	116931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	150873991	150873991	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:150873991C>T	ENST00000474524.1	+	5	638	c.600C>T	c.(598-600)gcC>gcT	p.A200A	MED12L_ENST00000273432.4_Silent_p.A200A|MED12L_ENST00000309237.4_Silent_p.A200A|MED12L_ENST00000422248.2_Silent_p.A200A	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	200						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGCAGTTGGCCAAGATTTCTG	0.458																																					p.A200A		.											.	MED12L	576	0			c.C600T						.						104.0	100.0	101.0					3																	150873991		2203	4300	6503	SO:0001819	synonymous_variant	116931	exon5			GTTGGCCAAGATT	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.600C>T	3.37:g.150873991C>T		Somatic	41.0	0.0		WXS	Illumina HiSeq	Phase_I	87.0	27.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Silent	SNP	ENST00000474524.1	37	CCDS33876.1																																																																																			.		0.458	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
MMEL1	79258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	2535696	2535696	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:2535696T>C	ENST00000378412.3	-	10	1002	c.841A>G	c.(841-843)Atg>Gtg	p.M281V	MMEL1_ENST00000502556.1_Intron|MMEL1_ENST00000288709.6_Missense_Mutation_p.M272V			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	281						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		ACTGACACCATGAACTGCAGG	0.652																																					p.M281V		.											.	MMEL1	90	0			c.A841G						.						63.0	65.0	64.0					1																	2535696		2202	4299	6501	SO:0001583	missense	79258	exon10			ACACCATGAACTG	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.841A>G	1.37:g.2535696T>C	ENSP00000367668:p.Met281Val	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	126.0	82.0	NM_033467	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	ENST00000378412.3	37	CCDS30569.2	.	.	.	.	.	.	.	.	.	.	T	18.27	3.585868	0.66105	.	.	ENSG00000142606	ENST00000288709;ENST00000378412	T;T	0.75050	-0.9;-0.9	4.43	4.43	0.53597	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.85639	0.5743	M	0.82823	2.61	0.80722	D	1	D	0.76494	0.999	D	0.69654	0.965	D	0.87970	0.2736	10	0.87932	D	0	-31.6286	13.1682	0.59583	0.0:0.0:0.0:1.0	.	281	Q495T6	MMEL1_HUMAN	V	272;281	ENSP00000288709:M272V;ENSP00000367668:M281V	ENSP00000288709:M272V	M	-	1	0	MMEL1	2525556	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	3.567000	0.53813	1.741000	0.51731	0.397000	0.26171	ATG	.		0.652	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	
MMP16	4325	broad.mit.edu;bcgsc.ca	37	8	89179912	89179912	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:89179912T>A	ENST00000286614.6	-	4	976	c.695A>T	c.(694-696)aAt>aTt	p.N232I	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	232					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	ATGATTAGGATTTCCTAGTGT	0.363																																					p.N232I		.											.	MMP16	231	0			c.A695T						.						91.0	77.0	82.0					8																	89179912		2203	4300	6503	SO:0001583	missense	4325	exon4			TTAGGATTTCCTA	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.695A>T	8.37:g.89179912T>A	ENSP00000286614:p.Asn232Ile	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	146.0	6.0	NM_005941	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	37	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.686397	0.88639	.	.	ENSG00000156103	ENST00000286614	T	0.51325	0.71	5.54	5.54	0.83059	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.67363	0.2885	M	0.80616	2.505	0.80722	D	1	P;P	0.51351	0.944;0.633	P;P	0.58520	0.84;0.714	T	0.72491	-0.4277	10	0.72032	D	0.01	.	15.6862	0.77411	0.0:0.0:0.0:1.0	.	232;232	P51512-2;P51512	.;MMP16_HUMAN	I	232	ENSP00000286614:N232I	ENSP00000286614:N232I	N	-	2	0	MMP16	89249028	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.974000	0.88039	2.107000	0.64212	0.528000	0.53228	AAT	.		0.363	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
MROH8	140699	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	35757451	35757451	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr20:35757451G>A	ENST00000400441.3	-	14	1768	c.1769C>T	c.(1768-1770)gCa>gTa	p.A590V	MROH8_ENST00000441008.2_Missense_Mutation_p.A576V|MROH8_ENST00000217333.8_Missense_Mutation_p.A419V			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	475																	AGCCACATATGCCATCTTCTC	0.557																																					.		.											.	.	.	0			.						.						82.0	81.0	82.0					20																	35757451		1972	4169	6141	SO:0001583	missense	140699	.			ACATATGCCATCT	AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1769C>T	20.37:g.35757451G>A	ENSP00000383291:p.Ala590Val	Somatic	54.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	12.0	.	Q5JYQ6	Missense_Mutation	SNP	ENST00000400441.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.46|18.46	3.628713|3.628713	0.67015|0.67015	.|.	.|.	ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441;ENST00000217333|ENST00000343811;ENST00000400440	T;T;T|.	0.33438|.	4.04;4.31;1.41|.	5.35|5.35	3.33|3.33	0.38152|0.38152	.|.	0.557989|.	0.17315|.	N|.	0.178726|.	T|T	0.48537|0.48537	0.1505|0.1505	L|L	0.60455|0.60455	1.87|1.87	0.29588|0.29588	N|N	0.848638|0.848638	D;D;D;D|.	0.89917|.	0.999;0.999;1.0;0.994|.	D;D;D;D|.	0.74023|.	0.941;0.974;0.982;0.917|.	T|T	0.47275|0.47275	-0.9130|-0.9130	10|5	0.42905|.	T|.	0.14|.	-5.1846|-5.1846	6.8136|6.8136	0.23819|0.23819	0.0912:0.0:0.7361:0.1727|0.0912:0.0:0.7361:0.1727	.|.	590;475;600;424|.	E7ETR9;Q9H579;Q6PF12;Q9H579-2|.	.;CT132_HUMAN;.;.|.	V|Y	576;590;419|617;621	ENSP00000392144:A576V;ENSP00000383291:A590V;ENSP00000217333:A419V|.	ENSP00000217333:A419V|.	A|H	-|-	2|1	0|0	C20orf132|C20orf132	35190865|35190865	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.690000|0.690000	0.40134|0.40134	1.207000|1.207000	0.32333|0.32333	1.266000|1.266000	0.44231|0.44231	0.655000|0.655000	0.94253|0.94253	GCA|CAT	.		0.557	MROH8-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152503	
MTIF2	4528	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	55473534	55473534	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:55473534C>T	ENST00000263629.4	-	10	1360	c.1045G>A	c.(1045-1047)Gca>Aca	p.A349T	MTIF2_ENST00000403721.1_Missense_Mutation_p.A349T|MTIF2_ENST00000394600.3_Missense_Mutation_p.A349T	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	349					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						TTGGGATCTGCTTTCAATTCT	0.378																																					p.A349T		.											.	MTIF2	91	0			c.G1045A						.						169.0	155.0	159.0					2																	55473534		2203	4300	6503	SO:0001583	missense	4528	exon10			GATCTGCTTTCAA	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1045G>A	2.37:g.55473534C>T	ENSP00000263629:p.Ala349Thr	Somatic	125.0	0.0		WXS	Illumina HiSeq	Phase_I	256.0	24.0	NM_002453	D6W5D0	Missense_Mutation	SNP	ENST00000263629.4	37	CCDS1853.1	.	.	.	.	.	.	.	.	.	.	C	35	5.553310	0.96501	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823;ENST00000535023	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.33	5.33	0.75918	.	0.110995	0.64402	D	0.000010	T	0.63558	0.2521	M	0.85710	2.77	0.80722	D	1	P	0.38978	0.652	P	0.49829	0.623	T	0.66779	-0.5837	10	0.52906	T	0.07	-15.7217	19.0262	0.92932	0.0:1.0:0.0:0.0	.	349	P46199	IF2M_HUMAN	T	349;349;349;69;349	ENSP00000384481:A349T;ENSP00000263629:A349T;ENSP00000378099:A349T;ENSP00000403492:A69T	ENSP00000263629:A349T	A	-	1	0	MTIF2	55327038	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.268000	0.78473	2.505000	0.84491	0.655000	0.94253	GCA	.		0.378	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
MTMR6	9107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25823570	25823570	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr13:25823570A>C	ENST00000381801.5	-	14	2427	c.1666T>G	c.(1666-1668)Tca>Gca	p.S556A	MTMR6_ENST00000540661.1_Intron|AL590787.1_ENST00000408397.1_RNA	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	556					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		GGATGAACTGAATGTAACAAT	0.368																																					p.S556A		.											.	MTMR6	94	0			c.T1666G						.						149.0	142.0	145.0					13																	25823570		2203	4300	6503	SO:0001583	missense	9107	exon14			GAACTGAATGTAA	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1666T>G	13.37:g.25823570A>C	ENSP00000371221:p.Ser556Ala	Somatic	141.0	0.0		WXS	Illumina HiSeq	Phase_I	237.0	58.0	NM_004685	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	CCDS9313.1	.	.	.	.	.	.	.	.	.	.	A	0.011	-1.711226	0.00712	.	.	ENSG00000139505	ENST00000381801;ENST00000319298	D	0.94046	-3.34	5.87	0.686	0.18015	.	0.861348	0.10383	N	0.681302	D	0.86539	0.5957	L	0.39147	1.195	0.45490	D	0.998459	B	0.02656	0.0	B	0.04013	0.001	T	0.74751	-0.3559	10	0.23302	T	0.38	.	2.6648	0.05041	0.5311:0.2354:0.1255:0.108	.	556	Q9Y217	MTMR6_HUMAN	A	556;124	ENSP00000371221:S556A	ENSP00000317987:S124A	S	-	1	0	MTMR6	24721570	0.096000	0.21769	0.012000	0.15200	0.023000	0.10783	0.591000	0.23969	0.182000	0.20032	0.533000	0.62120	TCA	.		0.368	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044225.1	NM_004685	
MTOR	2475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11204794	11204794	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:11204794T>C	ENST00000361445.4	-	34	4859	c.4783A>G	c.(4783-4785)Atg>Gtg	p.M1595V	MTOR-AS1_ENST00000420480.1_RNA|MTOR_ENST00000495435.1_5'UTR|MTOR-AS1_ENST00000445982.1_RNA	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	1595	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TCGGACAGCATGTGGCAAGAA	0.483																																					p.M1595V		.											.	MTOR	1439	0			c.A4783G						.						92.0	83.0	86.0					1																	11204794		2203	4300	6503	SO:0001583	missense	2475	exon34			ACAGCATGTGGCA	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.4783A>G	1.37:g.11204794T>C	ENSP00000354558:p.Met1595Val	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	28.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	37	CCDS127.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.157965	0.78114	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.71579	-0.58	5.6	5.6	0.85130	PIK-related kinase (1);PIK-related kinase, FAT (1);Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	D	0.85323	0.5670	M	0.93763	3.455	0.80722	D	1	P	0.35542	0.508	P	0.48795	0.59	D	0.87752	0.2592	10	0.72032	D	0.01	-11.5413	15.7961	0.78412	0.0:0.0:0.0:1.0	.	1595	P42345	MTOR_HUMAN	V	1595	ENSP00000354558:M1595V	ENSP00000354558:M1595V	M	-	1	0	MTOR	11127381	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.665000	0.83852	2.131000	0.65755	0.533000	0.62120	ATG	.		0.483	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
MUC1	4582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	155160803	155160803	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:155160803C>T	ENST00000368395.1	-	3	795	c.724G>A	c.(724-726)Gta>Ata	p.V242I	MUC1_ENST00000368398.3_Intron|MUC1_ENST00000457295.2_Intron|MUC1_ENST00000462215.1_Splice_Site|MUC1_ENST00000368392.3_Intron|MUC1_ENST00000337604.5_Intron|RP11-201K10.3_ENST00000473363.2_5'Flank|MUC1_ENST00000438413.1_Intron|MUC1_ENST00000343256.5_Intron|MUC1_ENST00000342482.4_Intron|MUC1_ENST00000368389.2_Intron|MUC1_ENST00000368393.3_Intron|MUC1_ENST00000368396.4_Intron|MUC1_ENST00000338684.5_Intron|MUC1_ENST00000368390.3_Intron	NM_001204285.1|NM_001204286.1	NP_001191214.1|NP_001191215.1	P15941	MUC1_HUMAN	mucin 1, cell surface associated	1022	42 X 20 AA approximate tandem repeats of P-A-P-G-S-T-A-P-P-A-H-G-V-T-S-A-P-D-T-R.				cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of transcription by competitive promoter binding (GO:0010944)|O-glycan processing (GO:0016266)|positive regulation of histone H4 acetylation (GO:0090240)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|post-translational protein modification (GO:0043687)|regulation of transcription from RNA polymerase II promoter in response to stress (GO:0043618)|response to hypoxia (GO:0001666)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|nuclear chromatin (GO:0000790)|vesicle (GO:0031982)	p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|skin(2)	10	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGAGGAGGTACCGTGCTATGG	0.498			T	IGH@	B-NHL																																p.V251I		.		Dom	yes		1	1q21	4582	"""mucin 1, transmembrane"""		L	.	MUC1	1147	0			c.G751A						.						42.0	48.0	46.0					1																	155160803		2197	4297	6494	SO:0001583	missense	4582	exon4			GAGGTACCGTGCT	J05581	CCDS1098.1, CCDS30882.1, CCDS30883.1, CCDS41408.1, CCDS41409.1, CCDS55640.1, CCDS55641.1, CCDS55642.1, CCDS55640.2, CCDS72933.1, CCDS72934.1, CCDS72935.1, CCDS72936.1	1q22	2014-01-31	2006-03-14		ENSG00000185499	ENSG00000185499		"""CD molecules"", ""Mucins"""	7508	protein-coding gene	gene with protein product		158340	"""mucin 1, transmembrane"", ""medullary cystic kidney disease 1 (autosomal dominant)"""	PUM, MCKD1		1697589, 23396133	Standard	NM_002456		Approved	CD227, PEM, ADMCKD, ADMCKD1, MCKD, MCD	uc031ppv.1	P15941	OTTHUMG00000035681	ENST00000368395.1:c.724G>A	1.37:g.155160803C>T	ENSP00000357380:p.Val242Ile	Somatic	143.0	0.0		WXS	Illumina HiSeq	Phase_I	509.0	90.0	NM_001204286	A5YRV1|A6ZID9|A6ZIE0|B1AVQ8|B1AVR0|B6ECA1|E7ESE5|E7EUG9|P13931|P15942|P17626|Q0VAP5|Q0VAP6|Q14128|Q14876|Q16437|Q16442|Q16615|Q6S4Y3|Q7Z547|Q7Z548|Q7Z550|Q7Z552|Q9BXA4|Q9UE75|Q9UE76|Q9UQL1|Q9Y4J2	Missense_Mutation	SNP	ENST00000368395.1	37	CCDS55640.1	.	.	.	.	.	.	.	.	.	.	C	5.638	0.302342	0.10678	.	.	ENSG00000185499	ENST00000368395;ENST00000425082	T	0.17213	2.29	3.46	2.53	0.30540	.	1.764090	0.03886	N	0.277917	T	0.03136	0.0092	N	0.14661	0.345	0.09310	N	0.999991	B;B;B	0.28880	0.123;0.226;0.11	B;B;B	0.28709	0.026;0.093;0.039	T	0.31943	-0.9925	10	0.20519	T	0.43	3.0263	4.7736	0.13167	0.0:0.7446:0.0:0.2554	.	1019;328;242	P15941-3;B4DWK6;B1AVQ5	.;.;.	I	242;328	ENSP00000357380:V242I	ENSP00000357380:V242I	V	-	1	0	MUC1	153427427	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	1.455000	0.35190	1.944000	0.56390	0.467000	0.42956	GTA	.		0.498	MUC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086735.1	NM_002456	
MUC17	140453	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	100678400	100678400	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:100678400G>T	ENST00000306151.4	+	3	3767	c.3703G>T	c.(3703-3705)Gag>Tag	p.E1235*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1235	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GGCCAGTTCTGAGGCTAGCAC	0.517																																					p.E1235X		.											.	MUC17	95	0			c.G3703T						.						304.0	291.0	296.0					7																	100678400		2203	4300	6503	SO:0001587	stop_gained	140453	exon3			AGTTCTGAGGCTA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3703G>T	7.37:g.100678400G>T	ENSP00000302716:p.Glu1235*	Somatic	67.0	0.0		WXS	Illumina HiSeq	Phase_I	102.0	21.0	NM_001040105	O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	G	38	6.641995	0.97726	.	.	ENSG00000169876	ENST00000306151	.	.	.	0.471	0.471	0.16752	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	.	.	.	.	.	.	.	X	1235	.	ENSP00000302716:E1235X	E	+	1	0	MUC17	100465120	0.000000	0.05858	0.005000	0.12908	0.037000	0.13140	0.216000	0.17585	0.558000	0.29135	0.134000	0.15878	GAG	.		0.517	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
MYH1	4619	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10404577	10404577	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:10404577C>T	ENST00000226207.5	-	27	3682	c.3588G>A	c.(3586-3588)ctG>ctA	p.L1196L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1196					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GCTTCTTCCTCAGGGTGGCCG	0.562																																					p.L1196L		.											.	MYH1	171	0			c.G3588A						.						88.0	86.0	87.0					17																	10404577		2203	4300	6503	SO:0001819	synonymous_variant	4619	exon27			CTTCCTCAGGGTG		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3588G>A	17.37:g.10404577C>T		Somatic	103.0	0.0		WXS	Illumina HiSeq	Phase_I	183.0	51.0	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	37	CCDS11155.1																																																																																			.		0.562	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MYOF	26509	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	95123767	95123767	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:95123767C>T	ENST00000359263.4	-	27	2818	c.2819G>A	c.(2818-2820)cGc>cAc	p.R940H	MYOF_ENST00000371501.4_Missense_Mutation_p.R940H|MYOF_ENST00000371502.4_Missense_Mutation_p.R940H|MYOF_ENST00000358334.5_Missense_Mutation_p.R927H	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	940					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CCCGGGGTAGCGGCTCTCGTT	0.607																																					p.R940H		.											.	MYOF	93	0			c.G2819A						.						67.0	67.0	67.0					10																	95123767		1953	4146	6099	SO:0001583	missense	26509	exon27			GGGTAGCGGCTCT	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.2819G>A	10.37:g.95123767C>T	ENSP00000352208:p.Arg940His	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	48.0	19.0	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	37	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	C	34	5.300298	0.95574	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.87029	-2.19;-2.18;-2.18;-2.2	5.65	5.65	0.86999	Ferlin/Peroxisome membrane (1);	0.049306	0.85682	N	0.000000	D	0.94673	0.8282	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94683	0.7867	10	0.87932	D	0	-14.6837	19.9142	0.97043	0.0:1.0:0.0:0.0	.	927;940	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	H	927;940;940;940	ENSP00000351094:R927H;ENSP00000352208:R940H;ENSP00000360556:R940H;ENSP00000360557:R940H	ENSP00000351094:R927H	R	-	2	0	MYOF	95113757	1.000000	0.71417	1.000000	0.80357	0.678000	0.39670	7.651000	0.83577	2.941000	0.99782	0.655000	0.94253	CGC	.		0.607	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
NOS1	4842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	117710212	117710212	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:117710212T>C	ENST00000338101.4	-	9	1821	c.1817A>G	c.(1816-1818)aAc>aGc	p.N606S	NOS1_ENST00000317775.6_Missense_Mutation_p.N606S|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GTAGCGGGAGTTGTCACAGTA	0.587																																					p.N606S	Esophageal Squamous(162;1748 2599 51982 52956)	.											.	NOS1	154	0			c.A1817G						.						78.0	87.0	84.0					12																	117710212		2193	4296	6489	SO:0001583	missense	4842	exon10			CGGGAGTTGTCAC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1817A>G	12.37:g.117710212T>C	ENSP00000337459:p.Asn606Ser	Somatic	51.0	0.0		WXS	Illumina HiSeq	Phase_I	96.0	8.0	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	37	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	T	6.547	0.469221	0.12461	.	.	ENSG00000089250	ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.20598	2.06;2.06	4.7	2.36	0.29203	Nitric oxide synthase, oxygenase domain (2);	0.224065	0.52532	N	0.000067	T	0.04407	0.0121	N	0.00268	-1.735	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27673	-1.0067	10	0.18276	T	0.48	-19.7626	8.3814	0.32474	0.0:0.2441:0.0:0.7559	.	606	P29475	NOS1_HUMAN	S	606	ENSP00000320758:N606S;ENSP00000337459:N606S	ENSP00000320758:N606S	N	-	2	0	NOS1	116194595	0.990000	0.36364	0.988000	0.46212	0.990000	0.78478	0.231000	0.17872	0.324000	0.23333	0.533000	0.62120	AAC	.		0.587	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
NYAP1	222950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100085893	100085893	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:100085893C>T	ENST00000300179.2	+	4	708	c.549C>T	c.(547-549)ggC>ggT	p.G183G	NYAP1_ENST00000423930.1_Silent_p.G183G|NYAP1_ENST00000454988.1_Silent_p.G126G	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	183	Involved in CYFIP1- and NCKAP1-binding. {ECO:0000250}.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												GCCCCCCAGGCCCCTCTCCTC	0.652																																					p.G183G		.											.	.	.	0			c.C549T						.						59.0	68.0	65.0					7																	100085893		2203	4300	6503	SO:0001819	synonymous_variant	222950	exon4			CCCAGGCCCCTCT	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.549C>T	7.37:g.100085893C>T		Somatic	50.0	0.0		WXS	Illumina HiSeq	Phase_I	67.0	23.0	NM_173564	Q6U9Y3|Q8N1V0	Silent	SNP	ENST00000300179.2	37	CCDS5696.1																																																																																			.		0.652	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
OCA2	4948	ucsc.edu;bcgsc.ca	37	15	28235793	28235793	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr15:28235793T>C	ENST00000354638.3	-	10	1200	c.1045A>G	c.(1045-1047)Atc>Gtc	p.I349V	OCA2_ENST00000382996.2_Splice_Site_p.I349V|OCA2_ENST00000353809.5_Intron	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	349					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		CTGTGCACGATCTGGAAAGAA	0.552									Oculocutaneous Albinism																												p.I349V		.											.	OCA2	135	0			c.A1045G						.						135.0	114.0	121.0					15																	28235793		2203	4300	6503	SO:0001630	splice_region_variant	4948	exon10	Familial Cancer Database		GCACGATCTGGAA		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.1045-1A>G	15.37:g.28235793T>C		Somatic	36.0	0.0		WXS	Illumina HiSeq	.	19.0	4.0	NM_000275	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	37	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	T	15.08	2.727987	0.48833	.	.	ENSG00000104044	ENST00000354638;ENST00000382996	D;D	0.90504	-2.68;-2.68	5.91	4.79	0.61399	Divalent ion symporter (1);	0.000000	0.85682	D	0.000000	D	0.86826	0.6026	N	0.21545	0.675	0.48975	D	0.999736	P	0.38223	0.623	P	0.46917	0.531	T	0.82985	-0.0185	10	0.25751	T	0.34	-23.0398	11.069	0.47993	0.0:0.0719:0.0:0.9281	.	349	Q04671	P_HUMAN	V	349	ENSP00000346659:I349V;ENSP00000372457:I349V	ENSP00000346659:I349V	I	-	1	0	OCA2	25909388	1.000000	0.71417	0.978000	0.43139	0.158000	0.22134	4.123000	0.57917	1.081000	0.41110	0.533000	0.62120	ATC	.		0.552	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	Missense_Mutation
OR10K1	391109	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	158435704	158435704	+	Missense_Mutation	SNP	T	T	C	rs145698229	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:158435704T>C	ENST00000289451.2	+	1	433	c.353T>C	c.(352-354)aTg>aCg	p.M118T		NM_001004473.1	NP_001004473.1	Q8NGX5	O10K1_HUMAN	olfactory receptor, family 10, subfamily K, member 1	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	27	all_hematologic(112;0.0378)					CTGGCAGCCATGGGCTATGAT	0.532													T|||	17	0.00339457	0.0121	0.0014	5008	,	,		22244	0.0		0.0	False		,,,				2504	0.0				p.M118T		.											.	OR10K1	69	0			c.T353C						.	T	THR/MET	36,4370	40.8+/-73.8	0,36,2167	174.0	171.0	172.0		353	4.5	1.0	1	dbSNP_134	172	4,8596	3.7+/-12.6	0,4,4296	yes	missense	OR10K1	NM_001004473.1	81	0,40,6463	CC,CT,TT		0.0465,0.8171,0.3076	probably-damaging	118/314	158435704	40,12966	2203	4300	6503	SO:0001583	missense	391109	exon1			CAGCCATGGGCTA	AP002532	CCDS30897.1	1q23.1	2012-08-09			ENSG00000173285	ENSG00000173285		"""GPCR / Class A : Olfactory receptors"""	14693	protein-coding gene	gene with protein product							Standard	NM_001004473		Approved		uc010pij.2	Q8NGX5	OTTHUMG00000017517	ENST00000289451.2:c.353T>C	1.37:g.158435704T>C	ENSP00000289451:p.Met118Thr	Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	407.0	68.0	NM_001004473	Q6IFS2	Missense_Mutation	SNP	ENST00000289451.2	37	CCDS30897.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	t	14.37	2.515096	0.44763	0.008171	4.65E-4	ENSG00000173285	ENST00000289451	T	0.01145	5.27	4.5	4.5	0.54988	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000074	T	0.05914	0.0154	H	0.94542	3.55	0.37106	D	0.900115	D	0.65815	0.995	D	0.71184	0.972	T	0.01105	-1.1450	10	0.87932	D	0	.	12.9199	0.58226	0.0:0.0:0.0:1.0	.	118	Q8NGX5	O10K1_HUMAN	T	118	ENSP00000289451:M118T	ENSP00000289451:M118T	M	+	2	0	OR10K1	156702328	1.000000	0.71417	1.000000	0.80357	0.290000	0.27261	7.345000	0.79337	1.873000	0.54277	0.455000	0.32223	ATG	T|0.997;C|0.003		0.532	OR10K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046367.1		
OPTC	26254	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	203468895	203468895	+	Silent	SNP	G	G	T	rs114294638	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:203468895G>T	ENST00000367222.2	+	5	764	c.648G>T	c.(646-648)ctG>ctT	p.L216L		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	216					negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			TGGAAGCTCTGCCCGTGCTGC	0.567																																					p.L216L		.											.	OPTC	492	0			c.G648T						.						177.0	173.0	175.0					1																	203468895		2203	4300	6503	SO:0001819	synonymous_variant	26254	exon5			AGCTCTGCCCGTG	AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.648G>T	1.37:g.203468895G>T		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	188.0	114.0	NM_014359	Q5T2G4	Silent	SNP	ENST00000367222.2	37	CCDS1439.1																																																																																			G|0.998;A|0.002		0.567	OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087964.1	NM_014359	
OR13C9	286362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	107379994	107379994	+	Silent	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:107379994T>C	ENST00000259362.1	-	1	491	c.492A>G	c.(490-492)gtA>gtG	p.V164V		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						AAGGCAATTGTACTACAAATG	0.438																																					p.V164V		.											.	OR13C9	68	0			c.A492G						.						121.0	104.0	110.0					9																	107379994		2203	4300	6503	SO:0001819	synonymous_variant	286362	exon1			CAATTGTACTACA		CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.492A>G	9.37:g.107379994T>C		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	206.0	67.0	NM_001001956	Q6IFL2	Silent	SNP	ENST00000259362.1	37	CCDS35093.1																																																																																			.		0.438	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053490.1		
OR2B6	26212	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	27925139	27925139	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr6:27925139G>A	ENST00000244623.1	+	1	121	c.121G>A	c.(121-123)Ggc>Agc	p.G41S		NM_012367.1	NP_036499.1	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B, member 6	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GACCATCTTTGGCAATCTGAC	0.428																																					p.G41S		.											.	OR2B6	69	0			c.G121A						.						187.0	175.0	179.0					6																	27925139		2203	4300	6503	SO:0001583	missense	26212	exon1			ATCTTTGGCAATC	U86275	CCDS4642.1	6p22.1	2012-08-09			ENSG00000124657	ENSG00000124657		"""GPCR / Class A : Olfactory receptors"""	8241	protein-coding gene	gene with protein product				OR2B6P, OR2B1, OR2B1P, OR2B5		9500546	Standard	NM_012367		Approved	OR6-31, dJ408B20.2, OR5-40, OR5-41	uc011dkx.2	P58173	OTTHUMG00000014497	ENST00000244623.1:c.121G>A	6.37:g.27925139G>A	ENSP00000244623:p.Gly41Ser	Somatic	147.0	0.0		WXS	Illumina HiSeq	Phase_I	385.0	16.0	NM_012367	O43883|Q6IF89|Q9H5B0	Missense_Mutation	SNP	ENST00000244623.1	37	CCDS4642.1	.	.	.	.	.	.	.	.	.	.	g	13.19	2.164266	0.38217	.	.	ENSG00000124657	ENST00000244623	T	0.04275	3.66	3.78	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34088	U	0.004270	T	0.05868	0.0153	M	0.88105	2.93	0.29422	N	0.860477	B	0.26081	0.141	B	0.37508	0.252	T	0.05649	-1.0872	10	0.72032	D	0.01	.	9.8937	0.41304	0.1074:0.0:0.8926:0.0	.	41	P58173	OR2B6_HUMAN	S	41	ENSP00000244623:G41S	ENSP00000244623:G41S	G	+	1	0	OR2B6	28033118	0.036000	0.19791	0.995000	0.50966	0.669000	0.39330	1.997000	0.40786	0.864000	0.35578	-0.244000	0.11960	GGC	.		0.428	OR2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040165.1		
OR6C74	254783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	55641327	55641327	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:55641327G>A	ENST00000343870.4	+	1	346	c.256G>A	c.(256-258)Ggt>Agt	p.G86S		NM_001005490.1	NP_001005490.1	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C, member 74	86			G -> D (in dbSNP:rs6581025).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	12						TATGGCAACAGGTGATAAGAC	0.393																																					p.G86S		.											.	OR6C74	68	0			c.G256A						.						197.0	199.0	198.0					12																	55641327		2203	4300	6503	SO:0001583	missense	254783	exon1			GCAACAGGTGATA		CCDS31816.1	12q13.13	2012-08-09			ENSG00000197706	ENSG00000197706		"""GPCR / Class A : Olfactory receptors"""	31303	protein-coding gene	gene with protein product							Standard	NM_001005490		Approved		uc010spg.2	A6NCV1	OTTHUMG00000165162	ENST00000343870.4:c.256G>A	12.37:g.55641327G>A	ENSP00000342836:p.Gly86Ser	Somatic	108.0	0.0		WXS	Illumina HiSeq	Phase_I	260.0	70.0	NM_001005490		Missense_Mutation	SNP	ENST00000343870.4	37	CCDS31816.1	.	.	.	.	.	.	.	.	.	.	g	15.46	2.841617	0.51057	.	.	ENSG00000197706	ENST00000343870	T	0.02916	4.11	5.36	3.5	0.40072	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000062	T	0.04634	0.0126	L	0.51422	1.61	0.09310	N	1	P	0.39759	0.687	B	0.44133	0.442	T	0.22417	-1.0217	10	0.87932	D	0	.	6.9684	0.24635	0.1567:0.2468:0.5965:0.0	.	86	A6NCV1	O6C74_HUMAN	S	86	ENSP00000342836:G86S	ENSP00000342836:G86S	G	+	1	0	OR6C74	53927594	0.000000	0.05858	0.217000	0.23759	0.954000	0.61252	0.637000	0.24659	1.371000	0.46172	0.551000	0.68910	GGT	.		0.393	OR6C74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382312.1		
OR6K6	128371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158725609	158725609	+	Missense_Mutation	SNP	A	A	G	rs559439148		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:158725609A>G	ENST00000368144.2	+	1	1100	c.1004A>G	c.(1003-1005)cAg>cGg	p.Q335R		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	335						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TTCCACTATCAGAAGAGGGCT	0.418													A|||	1	0.000199681	0.0	0.0	5008	,	,		19386	0.0		0.0	False		,,,				2504	0.001				p.Q335R		.											.	OR6K6	69	0			c.A1004G						.						83.0	87.0	86.0					1																	158725609		2203	4300	6503	SO:0001583	missense	128371	exon1			ACTATCAGAAGAG	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.1004A>G	1.37:g.158725609A>G	ENSP00000357126:p.Gln335Arg	Somatic	118.0	0.0		WXS	Illumina HiSeq	Phase_I	301.0	46.0	NM_001005184	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	A	7.484	0.649280	0.14516	.	.	ENSG00000180433	ENST00000368144	T	0.35048	1.33	5.26	2.92	0.33932	.	0.634090	0.12974	N	0.423879	T	0.05502	0.0145	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41288	-0.9517	10	0.27082	T	0.32	-1.0501	7.7691	0.28997	0.8182:0.0:0.1818:0.0	.	335	Q8NGW6	OR6K6_HUMAN	R	335	ENSP00000357126:Q335R	ENSP00000357126:Q335R	Q	+	2	0	OR6K6	156992233	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	1.190000	0.32126	0.440000	0.26502	-0.274000	0.10170	CAG	.		0.418	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
OR6M1	390261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	123676275	123676275	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:123676275C>T	ENST00000309154.2	-	1	820	c.783G>A	c.(781-783)caG>caA	p.Q261Q		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GTGAGGAGTTCTGATTGGGTC	0.502																																					p.Q261Q		.											.	OR6M1	70	0			c.G783A						.						110.0	101.0	104.0					11																	123676275		2202	4299	6501	SO:0001819	synonymous_variant	390261	exon1			GGAGTTCTGATTG	AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.783G>A	11.37:g.123676275C>T		Somatic	84.0	0.0		WXS	Illumina HiSeq	Phase_I	161.0	81.0	NM_001005325	B2RNK0|Q6IEW9|Q96R37	Silent	SNP	ENST00000309154.2	37	CCDS31696.1																																																																																			.		0.502	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387437.1	NM_001005325	
PABPC1L	80336	broad.mit.edu;bcgsc.ca	37	20	43545448	43545448	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr20:43545448A>G	ENST00000217073.2	+	3	439	c.439A>G	c.(439-441)Acc>Gcc	p.T147A	PABPC1L_ENST00000255136.3_Missense_Mutation_p.T147A|PABPC1L_ENST00000537323.1_Missense_Mutation_p.T147A|PABPC1L_ENST00000217074.4_Missense_Mutation_p.T147A			Q4VXU2	PAP1L_HUMAN	poly(A) binding protein, cytoplasmic 1-like	147	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|oocyte maturation (GO:0001556)	extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20						CCATTTTGAGACCCATGAGGC	0.612																																					p.T147A		.											.	PABPC1L	47	0			c.A439G						.						147.0	132.0	136.0					20																	43545448		1568	3582	5150	SO:0001583	missense	80336	exon3			TTTGAGACCCATG	AK026760	CCDS42878.1	20q12-q13.1	2013-02-12	2007-11-21	2007-11-21	ENSG00000101104	ENSG00000101104		"""RNA binding motif (RRM) containing"""	15797	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 119"""	C20orf119		11549316	Standard	NM_001124756		Approved	dJ1069P2.3, PABPC1L1, ePAB	uc010ggv.1	Q4VXU2	OTTHUMG00000032553	ENST00000217073.2:c.439A>G	20.37:g.43545448A>G	ENSP00000217073:p.Thr147Ala	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	193.0	8.0	NM_001124756	Q4VY17	Missense_Mutation	SNP	ENST00000217073.2	37	CCDS42878.1	.	.	.	.	.	.	.	.	.	.	A	16.90	3.250161	0.59212	.	.	ENSG00000101104	ENST00000217074;ENST00000255136;ENST00000537323;ENST00000217073	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.11	5.11	0.69529	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.90765	0.7101	M	0.64080	1.96	0.80722	D	1	D	0.58268	0.982	P	0.58013	0.831	D	0.91893	0.5525	10	0.87932	D	0	.	14.9098	0.70746	1.0:0.0:0.0:0.0	.	147	Q4VXU2	PAP1L_HUMAN	A	147	ENSP00000217074:T147A;ENSP00000255136:T147A;ENSP00000445661:T147A;ENSP00000217073:T147A	ENSP00000217073:T147A	T	+	1	0	PABPC1L	42978862	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	9.210000	0.95106	1.924000	0.55735	0.460000	0.39030	ACC	.		0.612	PABPC1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127816.2		
PAPOLB	56903	hgsc.bcm.edu;broad.mit.edu	37	7	4899906	4899913	+	Frame_Shift_Del	DEL	TTCTGTTG	TTCTGTTG	-			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	TTCTGTTG	TTCTGTTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:4899906_4899913delTTCTGTTG	ENST00000404991.1	-	1	1712_1719	c.1526_1533delCAACAGAA	c.(1525-1533)tcaacagaafs	p.STE509fs	RADIL_ENST00000536091.1_Intron|RADIL_ENST00000399583.3_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	509					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		ATCTTCTACCTTCTGTTGAGTGTGCTTT	0.428																																					p.510_512del		.											.	PAPOLB	493	0			c.1529_1536del						.																																			SO:0001589	frameshift_variant	56903	exon1			TCTACCTTCTGTT	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.1526_1533delCAACAGAA	7.37:g.4899906_4899913delTTCTGTTG	ENSP00000384700:p.Ser509fs	Somatic	22.0	0.0		WXS	Illumina HiSeq	Phase_I	65.0	11.0	NM_020144	Q75LH1|Q8NE14	Frame_Shift_Del	DEL	ENST00000404991.1	37																																																																																				.		0.428	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1	NM_020144	
PAPOLB	56903	hgsc.bcm.edu;broad.mit.edu	37	7	4899915	4899927	+	Frame_Shift_Del	DEL	GTGTGCTTTCTTG	GTGTGCTTTCTTG	-	rs376279221		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	GTGTGCTTTCTTG	GTGTGCTTTCTTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:4899915_4899927delGTGTGCTTTCTTG	ENST00000404991.1	-	1	1698_1710	c.1512_1524delCAAGAAAGCACAC	c.(1510-1524)gacaagaaagcacacfs	p.DKKAH504fs	RADIL_ENST00000536091.1_Intron|RADIL_ENST00000399583.3_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	504					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		CTTCTGTTGAGTGTGCTTTCTTGTCCTGAAGCA	0.423																																					p.505_509del		.											.	PAPOLB	493	0			c.1515_1527del						.																																			SO:0001589	frameshift_variant	56903	exon1			TGTTGAGTGTGCT	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.1512_1524delCAAGAAAGCACAC	7.37:g.4899915_4899927delGTGTGCTTTCTTG	ENSP00000384700:p.Asp504fs	Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	62.0	11.0	NM_020144	Q75LH1|Q8NE14	Frame_Shift_Del	DEL	ENST00000404991.1	37																																																																																				.		0.423	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000323797.1	NM_020144	
PCDHA2	56146	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140175842	140175842	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:140175842C>T	ENST00000526136.1	+	1	1293	c.1293C>T	c.(1291-1293)ggC>ggT	p.G431G	PCDHA2_ENST00000520672.2_Silent_p.G431G|PCDHA2_ENST00000378132.1_Silent_p.G431G|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	431	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGACGGGGGCTCGCCTTCAC	0.622																																					p.G431G		.											.	PCDHA2	94	0			c.C1293T						.						85.0	83.0	84.0					5																	140175842		2203	4300	6503	SO:0001819	synonymous_variant	56146	exon1			CGGGGGCTCGCCT	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1293C>T	5.37:g.140175842C>T		Somatic	66.0	1.0		WXS	Illumina HiSeq	Phase_I	110.0	16.0	NM_031495	O75287|Q9BTV3	Silent	SNP	ENST00000526136.1	37	CCDS54914.1																																																																																			.		0.622	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHA4	56144	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140188279	140188279	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:140188279G>A	ENST00000530339.1	+	1	1507	c.1507G>A	c.(1507-1509)Gcg>Acg	p.A503T	PCDHA4_ENST00000356878.4_Missense_Mutation_p.A503T|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.A503T|PCDHA2_ENST00000526136.1_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	503	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGGAGCGCGCGCTGTCGAG	0.662																																					p.A503T		.											.	PCDHA4	96	0			c.G1507A						.						54.0	55.0	55.0					5																	140188279		2203	4300	6503	SO:0001583	missense	56144	exon1			GAGCGCGCGCTGT	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1507G>A	5.37:g.140188279G>A	ENSP00000435300:p.Ala503Thr	Somatic	40.0	0.0		WXS	Illumina HiSeq	Phase_I	112.0	36.0	NM_031500	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	37	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	g	10.70	1.422976	0.25639	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.52983	0.7;0.64;0.68	4.18	-1.28	0.09318	Cadherin (4);Cadherin-like (1);	0.515141	0.14366	U	0.324099	T	0.23094	0.0558	N	0.10874	0.06	0.09310	N	1	B;P;B	0.35033	0.362;0.481;0.416	B;B;B	0.37550	0.072;0.253;0.113	T	0.14811	-1.0459	10	0.62326	D	0.03	.	1.7485	0.02967	0.1824:0.4049:0.1981:0.2145	.	503;503;503	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	T	503	ENSP00000423470:A503T;ENSP00000349344:A503T;ENSP00000435300:A503T	ENSP00000349344:A503T	A	+	1	0	PCDHA4	140168463	0.000000	0.05858	0.470000	0.27216	0.651000	0.38670	-0.431000	0.06965	-0.017000	0.14103	0.580000	0.79431	GCG	.		0.662	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
PCDHGA3	56112	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140723657	140723657	+	Silent	SNP	C	C	T	rs200693710		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:140723657C>T	ENST00000253812.6	+	1	57	c.57C>T	c.(55-57)ctC>ctT	p.L19L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	19					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGCGCGCTCCTGGGGACGC	0.542											OREG0016855	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L19L		.											.	PCDHGA3	68	0			c.C57T						.						124.0	137.0	133.0					5																	140723657		2077	4234	6311	SO:0001819	synonymous_variant	56112	exon1			CGCGCTCCTGGGG	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.57C>T	5.37:g.140723657C>T		Somatic	47.0	0.0	1658	WXS	Illumina HiSeq	Phase_I	61.0	17.0	NM_032011	Q9Y5D4	Silent	SNP	ENST00000253812.6	37	CCDS47290.1																																																																																			C|0.999;G|0.000		0.542	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
PFKFB3	5209	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	6258734	6258734	+	Silent	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:6258734T>C	ENST00000379775.4	+	5	762	c.432T>C	c.(430-432)aaT>aaC	p.N144N	PFKFB3_ENST00000379789.4_Silent_p.N124N|PFKFB3_ENST00000536985.1_Silent_p.N124N|PFKFB3_ENST00000379785.1_Silent_p.N144N|PFKFB3_ENST00000360521.2_Silent_p.N144N|PFKFB3_ENST00000317350.4_Silent_p.N144N|PFKFB3_ENST00000379782.3_Silent_p.N144N|PFKFB3_ENST00000540253.1_Silent_p.N158N	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	144	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						CCAAAGAAAATGACTTTAAGG	0.498																																					p.N144N		.											.	PFKFB3	117	0			c.T432C						.						197.0	190.0	193.0					10																	6258734		2203	4300	6503	SO:0001819	synonymous_variant	5209	exon5			AGAAAATGACTTT		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.432T>C	10.37:g.6258734T>C		Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	83.0	30.0	NM_004566	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Silent	SNP	ENST00000379775.4	37	CCDS7078.1																																																																																			.		0.498	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1		
PGLYRP1	8993	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	46525997	46525997	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:46525997A>T	ENST00000008938.4	-	1	326	c.283T>A	c.(283-285)Tac>Aac	p.Y95N		NM_005091.2	NP_005082.1	O75594	PGRP1_HUMAN	peptidoglycan recognition protein 1	95					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	10		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		ACTCACTTGTAGCCCACGTCG	0.657																																					p.Y95N		.											.	PGLYRP1	92	0			c.T283A						.						48.0	50.0	50.0					19																	46525997		2203	4298	6501	SO:0001583	missense	8993	exon1			ACTTGTAGCCCAC	AF076483	CCDS12680.1	19q13.2-q13.3	2008-02-05	2004-03-17	2004-03-19		ENSG00000008438			8904	protein-coding gene	gene with protein product		604963	"""peptidoglycan recognition protein"""	TNFSF3L, PGLYRP		9707603, 12669421	Standard	NM_005091		Approved	TAG7, PGRP, PGRP-S, PGRPS	uc002pdx.2	O75594		ENST00000008938.4:c.283T>A	19.37:g.46525997A>T	ENSP00000008938:p.Tyr95Asn	Somatic	85.0	0.0		WXS	Illumina HiSeq	Phase_I	278.0	20.0	NM_005091	Q4VB36	Missense_Mutation	SNP	ENST00000008938.4	37	CCDS12680.1	.	.	.	.	.	.	.	.	.	.	A	19.84	3.902747	0.72754	.	.	ENSG00000008438	ENST00000008938	T	0.58060	0.36	4.38	4.38	0.52667	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.113326	0.38492	N	0.001671	T	0.76898	0.4052	M	0.93720	3.45	0.40078	D	0.976098	D	0.89917	1.0	D	0.97110	1.0	T	0.82309	-0.0521	10	0.87932	D	0	.	9.9415	0.41583	1.0:0.0:0.0:0.0	.	95	O75594	PGRP1_HUMAN	N	95	ENSP00000008938:Y95N	ENSP00000008938:Y95N	Y	-	1	0	PGLYRP1	51217837	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	4.748000	0.62148	1.849000	0.53698	0.472000	0.43445	TAC	.		0.657	PGLYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461695.1	NM_005091	
PHLDB2	90102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	111688738	111688738	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:111688738A>T	ENST00000431670.2	+	16	3928	c.3517A>T	c.(3517-3519)Aca>Tca	p.T1173S	PHLDB2_ENST00000495180.1_Missense_Mutation_p.T664S|PHLDB2_ENST00000481953.1_Missense_Mutation_p.T1130S|PHLDB2_ENST00000412622.1_Missense_Mutation_p.T1130S|PHLDB2_ENST00000393925.3_Missense_Mutation_p.T1173S|PHLDB2_ENST00000393923.3_Missense_Mutation_p.T1157S	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	1173	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						GAACAAGCGAACATTCTCTTA	0.378																																					p.T1173S		.											.	PHLDB2	96	0			c.A3517T						.						130.0	134.0	132.0					3																	111688738		2203	4300	6503	SO:0001583	missense	90102	exon16			AAGCGAACATTCT		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.3517A>T	3.37:g.111688738A>T	ENSP00000405405:p.Thr1173Ser	Somatic	72.0	0.0		WXS	Illumina HiSeq	Phase_I	123.0	39.0	NM_001134439	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	ENST00000431670.2	37	CCDS46886.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049472	0.75846	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89;-0.89	5.09	3.92	0.45320	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.056069	0.64402	D	0.000001	T	0.72574	0.3477	N	0.12443	0.215	0.50813	D	0.999894	D;P;P;D;D	0.76494	0.999;0.558;0.856;0.991;0.991	D;B;P;D;D	0.83275	0.996;0.262;0.722;0.981;0.952	T	0.74061	-0.3786	10	0.52906	T	0.07	.	10.3965	0.44203	0.8532:0.0:0.0:0.1468	.	285;664;1173;1130;1157	Q658P8;E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;.;PHLB2_HUMAN;.;.	S	1157;1173;1130;1173;1130;664	ENSP00000377500:T1157S;ENSP00000405405:T1173S;ENSP00000405292:T1130S;ENSP00000377502:T1173S;ENSP00000418319:T1130S;ENSP00000420303:T664S	ENSP00000377500:T1157S	T	+	1	0	PHLDB2	113171428	1.000000	0.71417	0.924000	0.36721	0.992000	0.81027	8.718000	0.91430	0.938000	0.37419	0.477000	0.44152	ACA	.		0.378	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354337.1	NM_145753	
PKNOX2	63876	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	125237764	125237764	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:125237764C>T	ENST00000298282.9	+	5	381	c.110C>T	c.(109-111)cCc>cTc	p.P37L	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Intron	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	37					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		GCCCAGCCACCCTCCAAGGCC	0.662																																					p.P37L		.											.	PKNOX2	93	0			c.C110T						.						53.0	65.0	61.0					11																	125237764		2090	4202	6292	SO:0001583	missense	63876	exon5			AGCCACCCTCCAA	AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.110C>T	11.37:g.125237764C>T	ENSP00000298282:p.Pro37Leu	Somatic	59.0	0.0		WXS	Illumina HiSeq	Phase_I	93.0	20.0	NM_022062	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	ENST00000298282.9	37	CCDS41730.1	.	.	.	.	.	.	.	.	.	.	C	17.68	3.448842	0.63178	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000527238;ENST00000531212;ENST00000535518	T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66	5.49	5.49	0.81192	.	0.130686	0.52532	D	0.000062	T	0.52141	0.1716	N	0.08118	0	0.80722	D	1	B	0.16603	0.018	B	0.14578	0.011	T	0.48479	-0.9032	10	0.16896	T	0.51	-18.5915	18.1483	0.89665	0.0:1.0:0.0:0.0	.	37	Q96KN3	PKNX2_HUMAN	L	8;8;37;37;37;25	ENSP00000434732:P8L;ENSP00000433971:P8L;ENSP00000298282:P37L;ENSP00000434255:P37L	ENSP00000298282:P37L	P	+	2	0	PKNOX2	124742974	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.210000	0.58500	2.564000	0.86499	0.563000	0.77884	CCC	.		0.662	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386866.3		
PLCB1	23236	broad.mit.edu;bcgsc.ca	37	20	8713939	8713939	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr20:8713939A>G	ENST00000338037.6	+	19	1970	c.1943A>G	c.(1942-1944)tAc>tGc	p.Y648C	PLCB1_ENST00000494924.1_3'UTR|PLCB1_ENST00000378637.2_Missense_Mutation_p.Y648C|PLCB1_ENST00000378641.3_Missense_Mutation_p.Y648C	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	648	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AAGAGTGGCTACAGATTGAAG	0.408																																					p.L648R		.											.	PLCB1	297	0			c.T1943G						.						130.0	119.0	123.0					20																	8713939		2203	4300	6503	SO:0001583	missense	23236	exon19			GTGGCTACAGATT	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1943A>G	20.37:g.8713939A>G	ENSP00000338185:p.Tyr648Cys	Somatic	82.0	1.0		WXS	Illumina HiSeq	Phase_I	193.0	11.0	NM_015192	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.521050	0.44866	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.72835	-0.69;-0.69;-0.69	5.13	5.13	0.70059	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific, Y domain (3);	0.063724	0.64402	D	0.000004	D	0.90854	0.7127	H	0.99197	4.465	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	D	0.94626	0.7817	10	0.87932	D	0	.	15.227	0.73359	1.0:0.0:0.0:0.0	.	648;648	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	C	648;648;648;568;568	ENSP00000367908:Y648C;ENSP00000338185:Y648C;ENSP00000367904:Y648C	ENSP00000338185:Y648C	Y	+	2	0	PLCB1	8661939	1.000000	0.71417	0.998000	0.56505	0.141000	0.21300	6.032000	0.70918	2.047000	0.60756	0.491000	0.48974	TAC	.		0.408	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
PLEKHG4B	153478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	181677	181677	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:181677T>C	ENST00000283426.6	+	17	3433	c.3383T>C	c.(3382-3384)tTc>tCc	p.F1128S		NM_052909.3	NP_443141.3	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4B	1128							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(1)|large_intestine(2)|lung(2)|prostate(3)|skin(3)	11			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		AACCAGCCATTCATGGATGTC	0.527																																					p.F1128S		.											.	PLEKHG4B	228	0			c.T3383C						.						97.0	96.0	96.0					5																	181677		2203	4300	6503	SO:0001583	missense	153478	exon17			AGCCATTCATGGA	BC008352	CCDS34124.1	5p15.33	2013-01-11			ENSG00000153404	ENSG00000153404		"""Pleckstrin homology (PH) domain containing"""	29399	protein-coding gene	gene with protein product						11572484	Standard	NM_052909		Approved	KIAA1909	uc003jak.2	Q96PX9	OTTHUMG00000161570	ENST00000283426.6:c.3383T>C	5.37:g.181677T>C	ENSP00000283426:p.Phe1128Ser	Somatic	49.0	0.0		WXS	Illumina HiSeq	Phase_I	99.0	25.0	NM_052909		Missense_Mutation	SNP	ENST00000283426.6	37	CCDS34124.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.879233	0.33162	.	.	ENSG00000153404	ENST00000283426	T	0.35789	1.29	3.64	2.45	0.29901	Pleckstrin homology-type (1);	.	.	.	.	T	0.54549	0.1865	M	0.83223	2.63	0.34532	D	0.709334	D	0.89917	1.0	D	0.72625	0.978	T	0.60994	-0.7152	9	0.20519	T	0.43	.	7.071	0.25179	0.0:0.1158:0.0:0.8842	.	1128	Q96PX9	PKH4B_HUMAN	S	1128	ENSP00000283426:F1128S	ENSP00000283426:F1128S	F	+	2	0	PLEKHG4B	234677	1.000000	0.71417	0.005000	0.12908	0.045000	0.14185	4.841000	0.62824	0.301000	0.22738	0.377000	0.23210	TTC	.		0.527	PLEKHG4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365359.1	NM_052909	
PLEKHM1	9842	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	43552916	43552916	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:43552916G>T	ENST00000430334.3	-	4	606	c.473C>A	c.(472-474)gCt>gAt	p.A158D	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.A69D	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	158	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GCCCTCCTCAGCATCCCGGAG	0.597																																					p.A158D		.											.	PLEKHM1	90	0			c.C473A						.						45.0	43.0	44.0					17																	43552916		2202	4300	6502	SO:0001583	missense	9842	exon4			TCCTCAGCATCCC	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.473C>A	17.37:g.43552916G>T	ENSP00000389913:p.Ala158Asp	Somatic	71.0	0.0		WXS	Illumina HiSeq	Phase_I	114.0	8.0	NM_014798	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782605	0.31502	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.10477	2.87;2.87	5.03	5.03	0.67393	RUN (3);	0.123631	0.53938	D	0.000054	T	0.19565	0.0470	L	0.28504	0.86	0.50813	D	0.999891	D;D	0.69078	0.993;0.997	P;D	0.69824	0.854;0.966	T	0.05818	-1.0862	10	0.11794	T	0.64	.	17.1001	0.86647	0.0:0.0:1.0:0.0	.	69;158	F8W648;Q9Y4G2	.;PKHM1_HUMAN	D	158;107;69	ENSP00000389913:A158D;ENSP00000414352:A69D	ENSP00000414352:A69D	A	-	2	0	PLEKHM1	40908699	0.983000	0.35010	0.671000	0.29857	0.293000	0.27360	6.217000	0.72218	2.608000	0.88229	0.655000	0.94253	GCT	.		0.597	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
POLQ	10721	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	121207657	121207657	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:121207657G>A	ENST00000264233.5	-	16	4249	c.4121C>T	c.(4120-4122)cCt>cTt	p.P1374L		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1374					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		AGCAGGAAAAGGAATGTGACA	0.443								DNA polymerases (catalytic subunits)																													p.P1374L	Pancreas(152;907 1925 26081 31236 36904)	.											.	POLQ	664	0			c.C4121T						.						175.0	161.0	166.0					3																	121207657		2203	4300	6503	SO:0001583	missense	10721	exon16			GGAAAAGGAATGT	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.4121C>T	3.37:g.121207657G>A	ENSP00000264233:p.Pro1374Leu	Somatic	144.0	0.0		WXS	Illumina HiSeq	Phase_I	405.0	46.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	37	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452007	0.26074	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.45668	0.89	5.16	-0.725	0.11174	.	1.325950	0.05226	N	0.509359	T	0.20373	0.0490	N	0.08118	0	0.09310	N	1	B;B	0.23442	0.085;0.0	B;B	0.19666	0.026;0.0	T	0.17899	-1.0354	10	0.14252	T	0.57	.	5.9899	0.19454	0.5432:0.0:0.29:0.1668	.	1374;546	O75417;O75417-2	DPOLQ_HUMAN;.	L	997;1374;1510	ENSP00000264233:P1374L	ENSP00000264233:P1374L	P	-	2	0	POLQ	122690347	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.091000	0.11146	-0.048000	0.13401	0.655000	0.94253	CCT	.		0.443	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
PPT2	9374	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	32123651	32123651	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr6:32123651C>T	ENST00000324816.6	+	5	1005	c.437C>T	c.(436-438)aCg>aTg	p.T146M	PPT2_ENST00000361568.2_Missense_Mutation_p.T152M|PPT2_ENST00000395523.1_Missense_Mutation_p.T146M|PPT2_ENST00000445576.2_Missense_Mutation_p.T146M|PPT2_ENST00000437001.2_Missense_Mutation_p.T23M|PPT2-EGFL8_ENST00000453656.2_3'UTR|PPT2-EGFL8_ENST00000422437.1_Missense_Mutation_p.T146M|PPT2_ENST00000493548.1_3'UTR|PPT2_ENST00000375137.2_Missense_Mutation_p.T146M|PPT2_ENST00000375143.2_Missense_Mutation_p.T146M|PRRT1_ENST00000375150.2_5'Flank			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2	146					cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						TTGCCAGACACGGACTACTTG	0.527																																					p.T152M		.											.	PPT2	44	0			c.C455T						.						159.0	130.0	140.0					6																	32123651		1511	2709	4220	SO:0001583	missense	9374	exon5			CAGACACGGACTA	AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257	ENST00000324816.6:c.437C>T	6.37:g.32123651C>T	ENSP00000320528:p.Thr146Met	Somatic	95.0	0.0		WXS	Illumina HiSeq	Phase_I	351.0	73.0	NM_138717	A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	Missense_Mutation	SNP	ENST00000324816.6	37	CCDS4742.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.780951	0.90282	.	.	ENSG00000221988	ENST00000414204;ENST00000361568;ENST00000395523;ENST00000445576;ENST00000324816;ENST00000437001;ENST00000375137;ENST00000375143;ENST00000424499;ENST00000436118	T;D;D;D;D;D;D;D;D	0.96232	-0.25;-3.95;-3.95;-3.95;-3.95;-3.38;-3.95;-3.95;-3.38	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.97666	0.9235	M	0.74258	2.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.985;0.992;0.992	D	0.98139	1.0435	10	0.62326	D	0.03	-4.8314	16.689	0.85316	0.0:1.0:0.0:0.0	.	146;146;152	Q9UMR5-2;Q9UMR5;B0S872	.;PPT2_HUMAN;.	M	146;152;146;146;146;23;146;146;68;146	ENSP00000398847:T146M;ENSP00000354608:T152M;ENSP00000378894:T146M;ENSP00000412381:T146M;ENSP00000320528:T146M;ENSP00000415350:T23M;ENSP00000364279:T146M;ENSP00000364285:T146M;ENSP00000409877:T68M	ENSP00000320528:T146M	T	+	2	0	PPT2	32231629	1.000000	0.71417	0.995000	0.50966	0.949000	0.60115	6.997000	0.76270	2.527000	0.85204	0.557000	0.71058	ACG	.		0.527	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076552.4	NM_138717	
PRAMEF4	400735	ucsc.edu;bcgsc.ca	37	1	12943156	12943156	+	Silent	SNP	T	T	C	rs3121080	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:12943156T>C	ENST00000235349.5	-	2	130	c.60A>G	c.(58-60)ctA>ctG	p.L20L		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	20					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CTTGGTCCCTTAGCAGGCTCC	0.572																																					p.L20L		.											.	PRAMEF4	45	0			c.A60G						.						132.0	134.0	134.0					1																	12943156		2186	4282	6468	SO:0001819	synonymous_variant	400735	exon2			GTCCCTTAGCAGG		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.60A>G	1.37:g.12943156T>C		Somatic	85.0	0.0		WXS	Illumina HiSeq	.	71.0	15.0	NM_001009611	Q5LJB5	Silent	SNP	ENST00000235349.5	37	CCDS30592.1																																																																																			T|0.950;C|0.050		0.572	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
PROM1	8842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	16035130	16035130	+	Silent	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:16035130A>G	ENST00000510224.1	-	5	554	c.306T>C	c.(304-306)atT>atC	p.I102I	PROM1_ENST00000543373.1_Silent_p.I93I|PROM1_ENST00000502943.1_5'UTR|PROM1_ENST00000539194.1_Silent_p.I102I|PROM1_ENST00000505450.1_Silent_p.I93I|PROM1_ENST00000540805.1_Silent_p.I102I|PROM1_ENST00000447510.2_Silent_p.I102I|PROM1_ENST00000508167.1_Silent_p.I93I			O43490	PROM1_HUMAN	prominin 1	102					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						CATAGTAGACAATCTGCAATT	0.343																																					p.I102I		.											.	PROM1	207	0			c.T306C						.						36.0	33.0	34.0					4																	16035130		1866	4111	5977	SO:0001819	synonymous_variant	8842	exon4			GTAGACAATCTGC	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.306T>C	4.37:g.16035130A>G		Somatic	75.0	0.0		WXS	Illumina HiSeq	Phase_I	172.0	46.0	NM_006017	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Silent	SNP	ENST00000510224.1	37	CCDS47029.1																																																																																			.		0.343	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	
PROSC	11212	ucsc.edu;bcgsc.ca	37	8	37633525	37633525	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:37633525C>A	ENST00000328195.3	+	7	754	c.687C>A	c.(685-687)ttC>ttA	p.F229L		NM_007198.3	NP_009129.1	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog (bacterial)	229					alpha-amino acid metabolic process (GO:1901605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)	pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)	CCGCGGATTTCCAGCATGCGG	0.572																																					p.F229L		.											.	PROSC	90	0			c.C687A						.						130.0	121.0	124.0					8																	37633525		2203	4300	6503	SO:0001583	missense	11212	exon7			GGATTTCCAGCAT	AB018566	CCDS6096.1	8p11.2	2008-01-07	2001-12-04		ENSG00000147471	ENSG00000147471			9457	protein-coding gene	gene with protein product		604436	"""proline synthetase co-transcribed (bacterial homolog)"""				Standard	NM_007198		Approved		uc003xkh.3	O94903	OTTHUMG00000164024	ENST00000328195.3:c.687C>A	8.37:g.37633525C>A	ENSP00000333551:p.Phe229Leu	Somatic	26.0	0.0		WXS	Illumina HiSeq	.	45.0	6.0	NM_007198	Q6FI94	Missense_Mutation	SNP	ENST00000328195.3	37	CCDS6096.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.5|23.5	4.422788|4.422788	0.83559|0.83559	.|.	.|.	ENSG00000147471|ENSG00000147471	ENST00000328195;ENST00000517377|ENST00000521494	T|.	0.46063|.	0.88|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Alanine racemase, N-terminal (1);|.	0.046027|.	0.85682|.	D|.	0.000000|.	T|T	0.62804|0.62804	0.2458|0.2458	L|L	0.48986|0.48986	1.54|1.54	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.69078|.	0.997|.	D|.	0.75020|.	0.985|.	T|T	0.57969|0.57969	-0.7719|-0.7719	10|5	0.54805|.	T|.	0.06|.	-1.2603|-1.2603	13.4513|13.4513	0.61172|0.61172	0.0:0.9283:0.0:0.0717|0.0:0.9283:0.0:0.0717	.|.	229|.	O94903|.	PROSC_HUMAN|.	L|Y	229;7|198	ENSP00000333551:F229L|.	ENSP00000333551:F229L|.	F|S	+|+	3|2	2|0	PROSC|PROSC	37752683|37752683	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	1.251000|1.251000	0.32862|0.32862	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	TTC|TCC	.		0.572	PROSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376796.1	NM_007198	
PSG1	5669	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	43382236	43382236	+	Missense_Mutation	SNP	C	C	G	rs1058661	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:43382236C>G	ENST00000436291.2	-	2	375	c.259G>C	c.(259-261)Gaa>Caa	p.E87Q	PSG1_ENST00000312439.6_Missense_Mutation_p.E87Q|PSG1_ENST00000403380.3_Missense_Mutation_p.E87Q|PSG1_ENST00000244296.2_Missense_Mutation_p.E87Q|PSG1_ENST00000595356.1_Missense_Mutation_p.E87Q|PSG1_ENST00000595124.1_Missense_Mutation_p.E87Q|PSG1_ENST00000601073.1_5'UTR	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	87	Ig-like V-type.		E -> Q (in dbSNP:rs1058661).		female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				ATAATTATTTCACCGTCTACT	0.453																																					p.E87Q		.											.	PSG1	70	0			c.G259C						.						262.0	255.0	258.0					19																	43382236		2202	4299	6501	SO:0001583	missense	5669	exon2			TTATTTCACCGTC		CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.259G>C	19.37:g.43382236C>G	ENSP00000413041:p.Glu87Gln	Somatic	99.0	0.0		WXS	Illumina HiSeq	Phase_I	189.0	36.0	NM_001184826	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	ENST00000436291.2	37	CCDS54275.1	.	.	.	.	.	.	.	.	.	.	N	0.001	-3.014542	0.00042	.	.	ENSG00000231924	ENST00000270059;ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.01538	4.79;4.79;4.79;4.79	1.64	-3.28	0.05033	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.01029	0.0034	N	0.17082	0.46	0.09310	N	1	B;B;B;B;B;B;B;B;B	0.12013	0.005;0.0;0.0;0.0;0.0;0.0;0.001;0.003;0.0	B;B;B;B;B;B;B;B;B	0.16722	0.016;0.001;0.001;0.001;0.002;0.001;0.002;0.012;0.002	T	0.46541	-0.9184	9	0.02654	T	1	.	6.1783	0.20457	0.0:0.1996:0.5902:0.2102	rs1058661;rs3199315;rs17173161	87;87;87;87;87;87;87;87;87	O75238;P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;Q9UPK8;O75237;P11464-2	.;.;.;PSG1_HUMAN;.;.;.;.;.	Q	87	ENSP00000413041:E87Q;ENSP00000385386:E87Q;ENSP00000308970:E87Q;ENSP00000244296:E87Q	ENSP00000244296:E87Q	E	-	1	0	PSG1	48074076	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.278000	0.02809	-3.999000	0.00083	-3.418000	0.00038	GAA	C|1.000;G|0.000		0.453	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321426.1		
PTPN9	5780	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	75762179	75762180	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr15:75762179_75762180delAG	ENST00000306726.2	-	12	2032_2033	c.1520_1521delCT	c.(1519-1521)cctfs	p.P507fs		NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	507	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGGGTGGCTCAGGGCACTGCCC	0.574																																					p.507_507del		.											.	PTPN9	226	0			c.1520_1521del						.																																			SO:0001589	frameshift_variant	5780	exon12			TGGCTCAGGGCAC		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.1520_1521delCT	15.37:g.75762179_75762180delAG	ENSP00000303554:p.Pro507fs	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	125.0	37.0	NM_002833	Q53XR9	Frame_Shift_Del	DEL	ENST00000306726.2	37	CCDS10280.1																																																																																			.		0.574	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		
PTPRC	5788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	198721876	198721876	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:198721876A>G	ENST00000367376.2	+	31	3649	c.3478A>G	c.(3478-3480)Agt>Ggt	p.S1160G	PTPRC_ENST00000348564.6_Missense_Mutation_p.S1001G|PTPRC_ENST00000442510.2_Missense_Mutation_p.S1162G|PTPRC_ENST00000594404.1_Missense_Mutation_p.S999G|PTPRC_ENST00000352140.3_Missense_Mutation_p.S1112G	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1160	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GCATCACAAGAGTACACCTCT	0.433																																					p.S1162G		.											.	PTPRC	295	0			c.A3484G						.						66.0	62.0	63.0					1																	198721876		2203	4299	6502	SO:0001583	missense	5788	exon31			CACAAGAGTACAC	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.3478A>G	1.37:g.198721876A>G	ENSP00000356346:p.Ser1160Gly	Somatic	36.0	0.0		WXS	Illumina HiSeq	Phase_I	89.0	13.0	NM_002838	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	ENST00000367376.2	37		.	.	.	.	.	.	.	.	.	.	A	11.12	1.543897	0.27563	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	D	0.84298	-1.83	6.02	3.7	0.42460	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.685138	0.13231	N	0.403621	T	0.75064	0.3799	N	0.25332	0.735	0.24376	N	0.994813	B;B;B	0.14805	0.011;0.011;0.011	B;B;B	0.19666	0.026;0.026;0.018	T	0.62558	-0.6829	10	0.35671	T	0.21	.	7.2685	0.26244	0.7741:0.1523:0.0736:0.0	.	1001;1112;1160	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	G	1162;1112;1160;999	ENSP00000193532:S1112G	ENSP00000306782:S999G	S	+	1	0	PTPRC	196988499	0.801000	0.28930	0.250000	0.24296	0.447000	0.32167	1.536000	0.36072	1.078000	0.41014	0.528000	0.53228	AGT	.		0.433	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
PTRF	284119	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	17	40574856	40574856	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:40574856T>A	ENST00000357037.5	-	1	679	c.260A>T	c.(259-261)cAg>cTg	p.Q87L		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		CTGGATGCTCTGCACTGCGCC	0.627																																					p.Q87L		.											.	PTRF	153	0			c.A260T						.						54.0	37.0	43.0					17																	40574856		2203	4300	6503	SO:0001583	missense	284119	exon1			ATGCTCTGCACTG	AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.260A>T	17.37:g.40574856T>A	ENSP00000349541:p.Gln87Leu	Somatic	44.0	0.0		WXS	Illumina HiSeq	Phase_I	98.0	24.0	NM_012232		Missense_Mutation	SNP	ENST00000357037.5	37	CCDS11425.1	.	.	.	.	.	.	.	.	.	.	T	14.88	2.667526	0.47677	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.58940	0.3	5.12	5.12	0.69794	.	0.749618	0.13072	N	0.416048	T	0.39200	0.1069	N	0.22421	0.69	0.27481	N	0.952569	B;B	0.12013	0.005;0.003	B;B	0.14023	0.01;0.01	T	0.21930	-1.0231	10	0.49607	T	0.09	-42.1904	2.4995	0.04630	0.1369:0.082:0.2341:0.547	.	87;87	B4DNU9;Q6NZI2	.;PTRF_HUMAN	L	87;42	ENSP00000349541:Q87L	ENSP00000349541:Q87L	Q	-	2	0	PTRF	37828382	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.907000	0.39897	1.917000	0.55516	0.454000	0.30748	CAG	.		0.627	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449938.1	NM_012232	
RAPH1	65059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	204326584	204326584	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:204326584G>A	ENST00000319170.5	-	5	1096	c.797C>T	c.(796-798)gCa>gTa	p.A266V	RAPH1_ENST00000308091.4_Missense_Mutation_p.A318V|RAPH1_ENST00000453034.1_Missense_Mutation_p.A318V|RAPH1_ENST00000439222.1_Missense_Mutation_p.A291V|RAPH1_ENST00000374488.2_Missense_Mutation_p.A291V|RAPH1_ENST00000419464.1_Missense_Mutation_p.A266V|RAPH1_ENST00000374493.3_Missense_Mutation_p.A318V|RAPH1_ENST00000423104.1_Missense_Mutation_p.A293V|RAPH1_ENST00000418114.1_Missense_Mutation_p.A266V|RAPH1_ENST00000374489.2_Missense_Mutation_p.A293V|RAPH1_ENST00000457812.1_Missense_Mutation_p.A266V	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	266					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TTTCACTTGTGCCTCTTTAAT	0.368																																					p.A318V		.											.	RAPH1	1151	0			c.C953T						.						132.0	123.0	127.0					2																	204326584		2202	4300	6502	SO:0001583	missense	65059	exon7			ACTTGTGCCTCTT	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.797C>T	2.37:g.204326584G>A	ENSP00000316543:p.Ala266Val	Somatic	114.0	0.0		WXS	Illumina HiSeq	Phase_I	474.0	24.0	NM_203365	Q96Q37|Q9C0I2	Missense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	G	34	5.346929	0.95807	.	.	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201	T;T;T;T;T;T;T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95;-0.95;-0.95;-0.95;-0.95;-0.95;-0.95	5.65	5.65	0.86999	.	0.000000	0.45606	D	0.000345	D	0.83677	0.5306	L	0.48642	1.525	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.999	D;D;D	0.91635	0.999;0.985;0.994	D	0.84257	0.0481	10	0.87932	D	0	-20.7348	19.7068	0.96076	0.0:0.0:1.0:0.0	.	318;318;266	Q70E73-6;C9K0J5;Q70E73	.;.;RAPH1_HUMAN	V	266;266;318;293;291;318;291;266;293;318;291;266;293	ENSP00000392854:A266V;ENSP00000316543:A266V;ENSP00000363617:A318V;ENSP00000363613:A293V;ENSP00000363612:A291V;ENSP00000311293:A318V;ENSP00000411138:A291V;ENSP00000390578:A266V;ENSP00000397751:A293V;ENSP00000406662:A318V;ENSP00000396711:A266V	ENSP00000311293:A318V	A	-	2	0	RAPH1	204034829	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.924000	0.87555	2.824000	0.97209	0.655000	0.94253	GCA	.		0.368	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256363.2	NM_025252	
RBP3	5949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	48388579	48388579	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:48388579G>A	ENST00000224600.4	-	1	2412	c.2299C>T	c.(2299-2301)Ctg>Ttg	p.L767L	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	767	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TGCCATACCAGCCGCACCAGC	0.632																																					p.L767L		.											.	RBP3	153	0			c.C2299T						.						30.0	29.0	29.0					10																	48388579		2202	4300	6502	SO:0001819	synonymous_variant	5949	exon1			ATACCAGCCGCAC	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.2299C>T	10.37:g.48388579G>A		Somatic	24.0	0.0		WXS	Illumina HiSeq	Phase_I	90.0	38.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	ENST00000224600.4	37	CCDS7218.1																																																																																			.		0.632	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
RFX7	64864	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	56387953	56387953	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr15:56387953T>C	ENST00000559447.2	-	9	1953	c.1682A>G	c.(1681-1683)aAa>aGa	p.K561R	RFX7_ENST00000423270.1_Missense_Mutation_p.K658R|RFX7_ENST00000317318.6_Missense_Mutation_p.K658R|RFX7_ENST00000422057.1_Missense_Mutation_p.K561R			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	561					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGACAGTCGTTTTCTTGGGCT	0.448																																					p.K658R		.											.	RFX7	90	0			c.A1973G						.						97.0	94.0	95.0					15																	56387953		1901	4113	6014	SO:0001583	missense	64864	exon9			AGTCGTTTTCTTG			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.1682A>G	15.37:g.56387953T>C	ENSP00000453281:p.Lys561Arg	Somatic	87.0	0.0		WXS	Illumina HiSeq	Phase_I	151.0	55.0	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	37		.	.	.	.	.	.	.	.	.	.	T	21.2	4.119947	0.77323	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.54675	0.56;0.56;0.56	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000001	T	0.54415	0.1857	N	0.24115	0.695	0.58432	D	0.999991	D;D	0.67145	0.996;0.996	P;P	0.60609	0.877;0.877	T	0.51513	-0.8696	10	0.26408	T	0.33	-15.3416	14.6501	0.68792	0.0:0.0:0.0:1.0	.	561;561	Q2KHR2;C9JU50	RFX7_HUMAN;.	R	561;658;658	ENSP00000387504:K561R;ENSP00000313299:K658R;ENSP00000397644:K658R	ENSP00000313299:K658R	K	-	2	0	RFX7	54175245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.193000	0.77780	2.030000	0.59900	0.533000	0.62120	AAA	.		0.448	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
RCN2	5955	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	77227917	77227917	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr15:77227917G>A	ENST00000394885.3	+	3	524	c.301G>A	c.(301-303)Gaa>Aaa	p.E101K	RCN2_ENST00000320963.5_Missense_Mutation_p.E101K|RCN2_ENST00000394883.3_Intron	NM_002902.2	NP_002893.1	Q14257	RCN2_HUMAN	reticulocalbin 2, EF-hand calcium binding domain	101	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(2)|large_intestine(2)|lung(1)	7						TGCTATGCAAGAAGCAAAACA	0.348																																					p.E101K		.											.	RCN2	90	0			c.G301A						.						165.0	146.0	153.0					15																	77227917		2196	4294	6490	SO:0001583	missense	5955	exon3			ATGCAAGAAGCAA	X78669	CCDS10291.1, CCDS61719.1	15q22.33-q24.1	2013-01-10			ENSG00000117906	ENSG00000117906		"""EF-hand domain containing"""	9935	protein-coding gene	gene with protein product	"""Reticulocalbin 2, EF-hand calcium binding domain (endoplasmic reticulum calcium-binding protein, 55kD)"""	602584				9533013, 7624774	Standard	NM_002902		Approved	ERC-55, E6BP, ERC55, TCBP49	uc002bcd.3	Q14257	OTTHUMG00000143730	ENST00000394885.3:c.301G>A	15.37:g.77227917G>A	ENSP00000378349:p.Glu101Lys	Somatic	53.0	0.0		WXS	Illumina HiSeq	Phase_I	74.0	20.0	NM_002902	A8MTG6|F8WCY5|Q53XN8	Missense_Mutation	SNP	ENST00000394885.3	37	CCDS10291.1	.	.	.	.	.	.	.	.	.	.	G	34	5.408127	0.96051	.	.	ENSG00000117906	ENST00000394885;ENST00000320963	T;T	0.74315	-0.83;-0.83	5.47	5.47	0.80525	EF-hand-like domain (1);	0.048133	0.85682	D	0.000000	T	0.81475	0.4830	M	0.80183	2.485	0.80722	D	1	D;P	0.53462	0.96;0.92	P;P	0.47603	0.497;0.551	D	0.84779	0.0772	10	0.72032	D	0.01	-22.0183	19.328	0.94270	0.0:0.0:1.0:0.0	.	101;101	F8WCY5;Q14257	.;RCN2_HUMAN	K	101	ENSP00000378349:E101K;ENSP00000319739:E101K	ENSP00000319739:E101K	E	+	1	0	RCN2	75014972	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.789000	0.91839	2.559000	0.86315	0.591000	0.81541	GAA	.		0.348	RCN2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289795.1	NM_002902	
SEZ6L	23544	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	26688528	26688528	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr22:26688528T>C	ENST00000248933.6	+	2	346	c.251T>C	c.(250-252)gTg>gCg	p.V84A	SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000343706.4_Missense_Mutation_p.V84A|SEZ6L_ENST00000529632.2_Missense_Mutation_p.V84A|SEZ6L_ENST00000404234.3_Missense_Mutation_p.V84A|SEZ6L_ENST00000360929.3_Missense_Mutation_p.V84A			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	84					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GGCGAGCTGGTGCTGGATGGG	0.657																																					p.V84A		.											.	SEZ6L	95	0			c.T251C						.						62.0	52.0	56.0					22																	26688528		2203	4300	6503	SO:0001583	missense	23544	exon2			AGCTGGTGCTGGA	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.251T>C	22.37:g.26688528T>C	ENSP00000248933:p.Val84Ala	Somatic	23.0	0.0		WXS	Illumina HiSeq	Phase_I	40.0	10.0	NM_021115	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	37	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	A	10.21	1.288511	0.23478	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	4.15	-3.41	0.04839	.	1.150010	0.06840	N	0.795474	T	0.12774	0.0310	N	0.08118	0	0.09310	N	0.999999	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.001;0.0;0.0	T	0.31223	-0.9951	10	0.16420	T	0.52	.	6.1891	0.20513	0.1777:0.615:0.0948:0.1125	.	84;84;84;84;84;84	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	A	84	ENSP00000384772:V84A;ENSP00000437037:V84A;ENSP00000354185:V84A;ENSP00000248933:V84A;ENSP00000342661:V84A	ENSP00000248933:V84A	V	+	2	0	SEZ6L	25018528	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.020000	0.12525	-0.792000	0.04480	-0.455000	0.05494	GTG	.		0.657	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
SGCZ	137868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	13948074	13948074	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:13948074A>T	ENST00000382080.1	-	8	1532	c.817T>A	c.(817-819)Tcc>Acc	p.S273T	SGCZ_ENST00000421524.2_Missense_Mutation_p.S226T	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	260					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		GAACTTGAGGAGCTGGGTGAA	0.433																																					p.S273T		.											.	SGCZ	93	0			c.T817A						.						130.0	121.0	124.0					8																	13948074		2203	4300	6503	SO:0001583	missense	137868	exon8			TTGAGGAGCTGGG	AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.817T>A	8.37:g.13948074A>T	ENSP00000371512:p.Ser273Thr	Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	60.0	26.0	NM_139167	Q6REU0	Missense_Mutation	SNP	ENST00000382080.1	37	CCDS5992.2	.	.	.	.	.	.	.	.	.	.	A	8.987	0.976707	0.18812	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	T;T	0.11385	2.78;2.78	5.5	4.33	0.51752	.	0.385763	0.30177	N	0.010225	T	0.06005	0.0156	N	0.20807	0.61	0.31984	N	0.605484	B;B	0.09022	0.002;0.001	B;B	0.11329	0.006;0.001	T	0.27262	-1.0079	10	0.10377	T	0.69	.	7.1543	0.25628	0.7793:0.146:0.0747:0.0	.	226;273	Q08AT0;Q96LD1-2	.;.	T	273;226	ENSP00000371512:S273T;ENSP00000405224:S226T	ENSP00000371512:S273T	S	-	1	0	SGCZ	13992445	0.999000	0.42202	0.998000	0.56505	0.997000	0.91878	2.276000	0.43408	1.028000	0.39785	0.533000	0.62120	TCC	.		0.433	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207636.2	NM_139167	
SIGLEC9	27180	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51633303	51633303	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:51633303C>A	ENST00000250360.3	+	7	1426	c.1359C>A	c.(1357-1359)gaC>gaA	p.D453E	SIGLEC9_ENST00000440804.3_Intron	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	453					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		AGGCCACTGACACCGAGTACT	0.582																																					p.D453E		.											.	SIGLEC9	91	0			c.C1359A						.						66.0	63.0	64.0					19																	51633303		2203	4300	6503	SO:0001583	missense	27180	exon7			CACTGACACCGAG	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.1359C>A	19.37:g.51633303C>A	ENSP00000250360:p.Asp453Glu	Somatic	42.0	1.0		WXS	Illumina HiSeq	Phase_I	110.0	59.0	NM_014441	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	3.752	-0.051342	0.07407	.	.	ENSG00000129450	ENST00000250360	T	0.04603	3.59	1.96	0.0794	0.14416	.	.	.	.	.	T	0.04048	0.0113	L	0.40543	1.245	0.09310	N	1	B	0.16166	0.016	B	0.09377	0.004	T	0.42699	-0.9436	9	0.31617	T	0.26	.	4.5426	0.12066	0.0:0.7115:0.0:0.2885	.	453	Q9Y336	SIGL9_HUMAN	E	453	ENSP00000250360:D453E	ENSP00000250360:D453E	D	+	3	2	SIGLEC9	56325115	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.858000	0.27845	0.078000	0.16900	0.514000	0.50259	GAC	.		0.582	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
SIPA1L1	26037	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	72054832	72054832	+	Silent	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr14:72054832A>T	ENST00000555818.1	+	2	591	c.243A>T	c.(241-243)gcA>gcT	p.A81A	SIPA1L1_ENST00000381232.3_Silent_p.A81A|SIPA1L1_ENST00000358550.2_Silent_p.A81A	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	81					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CAAGGATTGCAGATTGGCCCC	0.493																																					p.A81A		.											.	SIPA1L1	156	0			c.A243T						.						87.0	95.0	92.0					14																	72054832		2203	4300	6503	SO:0001819	synonymous_variant	26037	exon2			GATTGCAGATTGG	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.243A>T	14.37:g.72054832A>T		Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	103.0	46.0	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	37	CCDS9807.1																																																																																			.		0.493	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
SLC12A9	56996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	100452001	100452001	+	Splice_Site	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:100452001G>T	ENST00000354161.3	+	2	306		c.e2+1		SLC12A9_ENST00000428758.1_Splice_Site|RP11-126L15.4_ENST00000412754.1_RNA|SLC12A9_ENST00000415287.1_Splice_Site|SLC12A9_ENST00000540482.1_Splice_Site|SLC12A9_ENST00000275729.3_Splice_Site	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTGAGGATTGGTGAGTGGGTC	0.577																																					.		.											.	SLC12A9	90	0			c.181+1G>T						.						120.0	119.0	120.0					7																	100452001		2203	4300	6503	SO:0001630	splice_region_variant	56996	exon2			GGATTGGTGAGTG	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.181+1G>T	7.37:g.100452001G>T		Somatic	158.0	0.0		WXS	Illumina HiSeq	Phase_I	499.0	133.0	NM_020246	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Splice_Site	SNP	ENST00000354161.3	37	CCDS5707.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655266	0.67472	.	.	ENSG00000146828	ENST00000540482;ENST00000428758;ENST00000275729;ENST00000415287;ENST00000354161;ENST00000416675;ENST00000434158	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7812	0.69769	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC12A9	100289937	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.406000	0.80017	2.340000	0.79590	0.407000	0.27541	.	.		0.577	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246	Intron
SLC15A1	6564	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	99371494	99371494	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr13:99371494G>A	ENST00000376503.5	-	8	692	c.637C>T	c.(637-639)Ctg>Ttg	p.L213L		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	213					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CACTTACTCAGGGCTACAGCC	0.443																																					p.L213L		.											.	SLC15A1	91	0			c.C637T						.						128.0	131.0	130.0					13																	99371494		2203	4300	6503	SO:0001819	synonymous_variant	6564	exon8			TACTCAGGGCTAC	U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.637C>T	13.37:g.99371494G>A		Somatic	25.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	18.0	NM_005073	Q5VW82	Silent	SNP	ENST00000376503.5	37	CCDS9489.1																																																																																			.		0.443	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045560.3	NM_005073	
SLC19A3	80704	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	228567037	228567037	+	Splice_Site	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:228567037C>T	ENST00000258403.3	-	2	70		c.e2-1		SLC19A3_ENST00000541617.1_Splice_Site|SLC19A3_ENST00000409287.1_Splice_Site	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3						small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)			breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	CAATCCATGGCTGATCAAATG	0.373																																					.		.											.	SLC19A3	92	0			.						.						80.0	87.0	85.0					2																	228567037		2203	4300	6503	SO:0001630	splice_region_variant	80704	.			CCATGGCTGATCA	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.2-1G>A	2.37:g.228567037C>T		Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	53.0	6.0	.		Splice_Site	SNP	ENST00000258403.3	37	CCDS2468.1																																																																																			.		0.373	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		Intron
SLC1A6	6511	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	15063807	15063807	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:15063807T>C	ENST00000221742.3	-	8	1439	c.1432A>G	c.(1432-1434)Att>Gtt	p.I478V	SLC1A6_ENST00000430939.2_Missense_Mutation_p.I414V|SLC1A6_ENST00000600144.1_Missense_Mutation_p.I400V	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	478					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						GTAAGCACAATGACCATGGTG	0.617																																					p.I478V		.											.	SLC1A6	186	0			c.A1432G						.						161.0	133.0	143.0					19																	15063807		2203	4300	6503	SO:0001583	missense	6511	exon8			GCACAATGACCAT		CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.1432A>G	19.37:g.15063807T>C	ENSP00000221742:p.Ile478Val	Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	217.0	42.0	NM_005071	Q8N753	Missense_Mutation	SNP	ENST00000221742.3	37	CCDS12321.1	.	.	.	.	.	.	.	.	.	.	-	23.9	4.469352	0.84533	.	.	ENSG00000105143	ENST00000430939;ENST00000221742	T;T	0.57907	0.37;0.37	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.50480	0.1618	L	0.50333	1.59	0.80722	D	1	P;P	0.47350	0.865;0.894	B;P	0.44647	0.196;0.456	T	0.57306	-0.7834	10	0.87932	D	0	-20.4835	11.9112	0.52739	0.0:0.0:0.0:1.0	.	414;478	E7EV13;P48664	.;EAA4_HUMAN	V	414;478	ENSP00000409386:I414V;ENSP00000221742:I478V	ENSP00000221742:I478V	I	-	1	0	SLC1A6	14924807	1.000000	0.71417	0.990000	0.47175	0.943000	0.58893	5.943000	0.70211	1.983000	0.57843	0.366000	0.22137	ATT	.		0.617	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466283.1	NM_005071	
SLC22A15	55356	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	116563474	116563474	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:116563474A>G	ENST00000369503.4	+	4	696	c.566A>G	c.(565-567)gAa>gGa	p.E189G	SLC22A15_ENST00000369502.1_Missense_Mutation_p.E189G	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	189					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TTGCTTAATGAATGTGTGGGC	0.488											OREG0013699	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E189G		.											.	SLC22A15	67	0			c.A566G						.						106.0	104.0	105.0					1																	116563474		1984	4168	6152	SO:0001583	missense	55356	exon4			TTAATGAATGTGT	AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.566A>G	1.37:g.116563474A>G	ENSP00000358515:p.Glu189Gly	Somatic	136.0	0.0	1474	WXS	Illumina HiSeq	Phase_I	366.0	150.0	NM_018420	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	ENST00000369503.4	37	CCDS44198.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.919801	0.92249	.	.	ENSG00000163393	ENST00000369503;ENST00000369502	D;T	0.86694	-2.16;0.33	5.84	5.84	0.93424	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.95752	0.8618	H	0.98256	4.185	0.58432	D	0.99999	D;D	0.58268	0.974;0.982	D;D	0.70487	0.969;0.959	D	0.97366	0.9973	10	0.87932	D	0	.	16.2254	0.82286	1.0:0.0:0.0:0.0	.	189;189	Q8IZD6;Q8IZD6-2	S22AF_HUMAN;.	G	189	ENSP00000358515:E189G;ENSP00000358514:E189G	ENSP00000358514:E189G	E	+	2	0	SLC22A15	116364997	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.980000	0.88113	2.225000	0.72522	0.528000	0.53228	GAA	.		0.488	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033220.2	NM_018420	
SMARCA4	6597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11141502	11141502	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:11141502G>A	ENST00000429416.3	+	26	3760	c.3479G>A	c.(3478-3480)gGg>gAg	p.G1160E	SMARCA4_ENST00000344626.4_Missense_Mutation_p.G1160E|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G1160E|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G1160E|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G1160E|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G1160E|SMARCA4_ENST00000589677.1_Missense_Mutation_p.G1160E|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G1160E|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G1160E	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	1160	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CGGGCTGGGGGGCTCGGCCTG	0.607			"""F, N, Mis"""		NSCLC																																p.G1160E		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	SMARCA4,NS,carcinoma,+1	SMARCA4	1523	1	Unknown(1)	lung(1)	c.G3479A						.						25.0	26.0	26.0					19																	11141502		2197	4298	6495	SO:0001583	missense	6597	exon25			CTGGGGGGCTCGG	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.3479G>A	19.37:g.11141502G>A	ENSP00000395654:p.Gly1160Glu	Somatic	28.0	0.0		WXS	Illumina HiSeq	Phase_I	54.0	31.0	NM_003072	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785160	0.90282	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	T;T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	4.59	4.59	0.56863	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.93458	0.7913	H	0.99425	4.56	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.96329	0.9242	10	0.87932	D	0	-48.5831	16.3247	0.82975	0.0:0.0:1.0:0.0	.	1160;1160;1160;1160;1160;380;1160;1160	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	E	1160;1160;1224;1160;1160;1160;1160;1160	ENSP00000395654:G1160E;ENSP00000350720:G1160E;ENSP00000343896:G1160E;ENSP00000445036:G1160E;ENSP00000392837:G1160E;ENSP00000397783:G1160E;ENSP00000414727:G1160E	ENSP00000343896:G1160E	G	+	2	0	SMARCA4	11002502	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.356000	0.97091	2.389000	0.81357	0.563000	0.77884	GGG	.		0.607	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
SMARCA5	8467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	144467138	144467138	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:144467138A>G	ENST00000283131.3	+	19	2920	c.2458A>G	c.(2458-2460)Att>Gtt	p.I820V		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	820					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					ACAGCTTAAAATTGATGAAGC	0.348																																					p.I820V		.											.	SMARCA5	227	0			c.A2458G						.						86.0	90.0	88.0					4																	144467138		2203	4300	6503	SO:0001583	missense	8467	exon19			CTTAAAATTGATG	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.2458A>G	4.37:g.144467138A>G	ENSP00000283131:p.Ile820Val	Somatic	102.0	0.0		WXS	Illumina HiSeq	Phase_I	243.0	82.0	NM_003601		Missense_Mutation	SNP	ENST00000283131.3	37	CCDS3761.1	.	.	.	.	.	.	.	.	.	.	A	17.30	3.354537	0.61293	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	D	0.91464	-2.85	5.3	5.3	0.74995	ATPase, nucleosome remodelling ISWI, HAND domain (2);	0.000000	0.85682	D	0.000000	D	0.88912	0.6566	L	0.56769	1.78	0.58432	D	0.999999	B	0.20368	0.044	B	0.22152	0.038	D	0.85626	0.1267	10	0.37606	T	0.19	-19.4602	15.5566	0.76200	1.0:0.0:0.0:0.0	.	820	O60264	SMCA5_HUMAN	V	820;763;763	ENSP00000283131:I820V	ENSP00000283131:I820V	I	+	1	0	SMARCA5	144686588	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.680000	0.91225	2.136000	0.66102	0.533000	0.62120	ATT	.		0.348	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365077.3		
SMCHD1	23347	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	18	2795979	2795979	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr18:2795979A>T	ENST00000320876.6	+	46	6090	c.5752A>T	c.(5752-5754)Aaa>Taa	p.K1918*	RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1918					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TGCTGTGTGCAAACTAGACAG	0.358																																					p.K1918X		.											.	SMCHD1	46	0			c.A5752T						.						49.0	44.0	46.0					18																	2795979		1881	4109	5990	SO:0001587	stop_gained	23347	exon46			GTGTGCAAACTAG	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.5752A>T	18.37:g.2795979A>T	ENSP00000326603:p.Lys1918*	Somatic	130.0	0.0		WXS	Illumina HiSeq	Phase_I	281.0	80.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Nonsense_Mutation	SNP	ENST00000320876.6	37	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	47	13.308776	0.99733	.	.	ENSG00000101596	ENST00000320876	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.6976	14.5973	0.68415	1.0:0.0:0.0:0.0	.	.	.	.	X	1918	.	ENSP00000326603:K1918X	K	+	1	0	SMCHD1	2785979	0.996000	0.38824	0.185000	0.23176	0.281000	0.26958	6.053000	0.71089	2.174000	0.68829	0.533000	0.62120	AAA	.		0.358	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
SORL1	6653	broad.mit.edu;bcgsc.ca	37	11	121421354	121421354	+	Silent	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr11:121421354A>G	ENST00000260197.7	+	16	2370	c.2241A>G	c.(2239-2241)ggA>ggG	p.G747G		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	747					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GACTGGAAGGAGAGCTGGTCC	0.537																																					p.G747G		.											.	SORL1	228	0			c.A2241G						.						119.0	101.0	107.0					11																	121421354		2203	4299	6502	SO:0001819	synonymous_variant	6653	exon16			GGAAGGAGAGCTG	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2241A>G	11.37:g.121421354A>G		Somatic	57.0	1.0		WXS	Illumina HiSeq	Phase_I	95.0	7.0	NM_003105	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	37	CCDS8436.1																																																																																			.		0.537	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
SPATA12	353324	broad.mit.edu;bcgsc.ca	37	3	57108184	57108184	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:57108184G>T	ENST00000334325.1	+	2	1137	c.462G>T	c.(460-462)gaG>gaT	p.E154D	ARHGEF3_ENST00000338458.4_Intron	NM_181727.1	NP_859078.1	Q7Z6I5	SPT12_HUMAN	spermatogenesis associated 12	154										large_intestine(2)|lung(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0111)|Kidney(284;0.0129)		tagatgccgagcccagtagca	0.468																																					p.E154D		.											.	SPATA12	90	0			c.G462T						.						96.0	95.0	95.0					3																	57108184		2203	4300	6503	SO:0001583	missense	353324	exon2			TGCCGAGCCCAGT	AY221117	CCDS2879.1	3p21.2	2012-09-19			ENSG00000186451	ENSG00000186451			23221	protein-coding gene	gene with protein product		609869				22981541, 17251597	Standard	NM_181727		Approved		uc003dij.1	Q7Z6I5	OTTHUMG00000158862	ENST00000334325.1:c.462G>T	3.37:g.57108184G>T	ENSP00000335392:p.Glu154Asp	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	9.0	NM_181727	A0AVA8|B2RMW1	Missense_Mutation	SNP	ENST00000334325.1	37	CCDS2879.1	.	.	.	.	.	.	.	.	.	.	G	8.839	0.941732	0.18281	.	.	ENSG00000186451	ENST00000334325	.	.	.	2.49	2.49	0.30216	.	.	.	.	.	T	0.17492	0.0420	N	0.08118	0	0.09310	N	1	P	0.46512	0.879	B	0.42916	0.402	T	0.06770	-1.0808	8	0.87932	D	0	.	8.5813	0.33630	0.0:0.0:1.0:0.0	.	154	Q7Z6I5	SPT12_HUMAN	D	154	.	ENSP00000335392:E154D	E	+	3	2	SPATA12	57083224	0.009000	0.17119	0.006000	0.13384	0.016000	0.09150	2.668000	0.46816	1.713000	0.51359	0.563000	0.77884	GAG	.		0.468	SPATA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352457.2	NM_181727	
SPHKAP	80309	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	228884727	228884727	+	Silent	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:228884727A>T	ENST00000392056.3	-	7	889	c.843T>A	c.(841-843)atT>atA	p.I281I	SPHKAP_ENST00000344657.5_Silent_p.I281I	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	281						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GTTCTGTTTTAATCAATGGTG	0.443																																					p.I281I		.											.	SPHKAP	167	0			c.T843A						.						236.0	251.0	246.0					2																	228884727		2203	4300	6503	SO:0001819	synonymous_variant	80309	exon7			TGTTTTAATCAAT		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.843T>A	2.37:g.228884727A>T		Somatic	187.0	0.0		WXS	Illumina HiSeq	Phase_I	1095.0	145.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	ENST00000392056.3	37	CCDS46537.1																																																																																			.		0.443	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
SRFBP1	153443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	121358098	121358098	+	Silent	SNP	C	C	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr5:121358098C>G	ENST00000339397.4	+	7	1173	c.1101C>G	c.(1099-1101)tcC>tcG	p.S367S	SRFBP1_ENST00000504881.1_3'UTR	NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		AAACAAGATCCCTAGGTATGT	0.303																																					p.S367S		.											.	SRFBP1	90	0			c.C1101G						.						64.0	59.0	60.0					5																	121358098		1813	4069	5882	SO:0001819	synonymous_variant	153443	exon7			AAGATCCCTAGGT	AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.1101C>G	5.37:g.121358098C>G		Somatic	93.0	0.0		WXS	Illumina HiSeq	Phase_I	110.0	35.0	NM_152546		Silent	SNP	ENST00000339397.4	37	CCDS43354.1																																																																																			.		0.303	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371200.1	NM_152546	
SRRT	51593	ucsc.edu;bcgsc.ca	37	7	100485882	100485882	+	Silent	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:100485882T>C	ENST00000347433.4	+	19	2591	c.2433T>C	c.(2431-2433)ggT>ggC	p.G811G	SRRT_ENST00000432932.1_Silent_p.G806G|SRRT_ENST00000388793.4_Silent_p.G810G|SRRT_ENST00000457580.2_Silent_p.G807G			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	811	Pro-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TCATAGCTGGTGCTGTCCGCC	0.552																																					p.G811G		.											.	SRRT	92	0			c.T2433C						.						74.0	78.0	77.0					7																	100485882		2203	4300	6503	SO:0001819	synonymous_variant	51593	exon19			AGCTGGTGCTGTC		CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2433T>C	7.37:g.100485882T>C		Somatic	26.0	0.0		WXS	Illumina HiSeq	.	40.0	4.0	NM_015908	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Silent	SNP	ENST00000347433.4	37	CCDS34709.1	.	.	.	.	.	.	.	.	.	.	T	9.417	1.081926	0.20309	.	.	ENSG00000087087	ENST00000342198	.	.	.	4.11	4.11	0.48088	.	.	.	.	.	T	0.56016	0.1957	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50980	-0.8763	5	0.25751	T	0.34	.	9.6521	0.39904	0.0:0.0:0.0:1.0	.	.	.	.	R	176	.	ENSP00000344670:C176R	C	+	1	0	SRRT	100323818	0.998000	0.40836	1.000000	0.80357	0.953000	0.61014	0.935000	0.28924	1.850000	0.53721	0.397000	0.26171	TGC	.		0.552	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347168.1	NM_015908	
STK32B	55351	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	5170120	5170120	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:5170120T>A	ENST00000282908.5	+	3	625	c.203T>A	c.(202-204)gTt>gAt	p.V68D	STK32B_ENST00000510398.1_Missense_Mutation_p.V21D|STK32B_ENST00000512636.1_Missense_Mutation_p.V21D	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						GTTCGGAATGTTTTCCGGGAG	0.532																																					p.V68D		.											.	STK32B	1002	0			c.T203A						.						105.0	94.0	98.0					4																	5170120		2203	4300	6503	SO:0001583	missense	55351	exon3			GGAATGTTTTCCG	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.203T>A	4.37:g.5170120T>A	ENSP00000282908:p.Val68Asp	Somatic	56.0	0.0		WXS	Illumina HiSeq	Phase_I	176.0	34.0	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	37	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561482	0.65538	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.26518	1.73;1.73;1.73	5.03	5.03	0.67393	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.38778	U	0.001569	T	0.58119	0.2100	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68062	-0.5508	10	0.87932	D	0	.	13.9602	0.64175	0.0:0.0:0.0:1.0	.	68	Q9NY57	ST32B_HUMAN	D	68;21;21	ENSP00000282908:V68D;ENSP00000423209:V21D;ENSP00000420984:V21D	ENSP00000282908:V68D	V	+	2	0	STK32B	5221021	1.000000	0.71417	0.988000	0.46212	0.331000	0.28603	7.552000	0.82192	1.890000	0.54733	0.533000	0.62120	GTT	.		0.532	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
STRAP	11171	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	16035698	16035698	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:16035698delT	ENST00000419869.2	+	1	370	c.57delT	c.(55-57)gatfs	p.D19fs	STRAP_ENST00000025399.6_Frame_Shift_Del_p.D19fs|STRAP_ENST00000538352.1_5'UTR	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein	19					maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				CCGTGGTTGATTTGGCCTTCA	0.617																																					p.D19fs		.											.	STRAP	228	0			c.57delT						.						62.0	55.0	57.0					12																	16035698		2203	4300	6503	SO:0001589	frameshift_variant	11171	exon1			GGTTGATTTGGCC	AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.57delT	12.37:g.16035698delT	ENSP00000392270:p.Asp19fs	Somatic	33.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	28.0	NM_007178	B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Frame_Shift_Del	DEL	ENST00000419869.2	37	CCDS8676.1																																																																																			.		0.617	STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401114.1	NM_007178	
SUSD1	64420	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	114820918	114820918	+	Silent	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:114820918A>T	ENST00000374270.3	-	14	2071	c.1899T>A	c.(1897-1899)tcT>tcA	p.S633S	SUSD1_ENST00000374263.3_Silent_p.S633S|SUSD1_ENST00000374264.2_Silent_p.S633S	NM_022486.3	NP_071931.2	Q6UWL2	SUSD1_HUMAN	sushi domain containing 1	633						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)		SUSD1/ROD1(2)	central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						CAGAATCACAAGAAAATGTGC	0.483																																					p.S633S		.											.	SUSD1	90	0			c.T1899A						.						96.0	100.0	99.0					9																	114820918		2203	4300	6503	SO:0001819	synonymous_variant	64420	exon14			ATCACAAGAAAAT	AL137432	CCDS6783.1, CCDS65105.1, CCDS65106.1	9q31.3-q33.1	2008-02-05			ENSG00000106868	ENSG00000106868			25413	protein-coding gene	gene with protein product						12975309	Standard	NM_022486		Approved	DKFZP761E1824	uc004bfu.3	Q6UWL2	OTTHUMG00000020499	ENST00000374270.3:c.1899T>A	9.37:g.114820918A>T		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	97.0	28.0	NM_022486	A1A4C5|A8KA03|Q5T8V6|Q5T8V7|Q6P9G7|Q8WU83|Q96DM9|Q9H6V2|Q9NTA7	Silent	SNP	ENST00000374270.3	37	CCDS6783.1	.	.	.	.	.	.	.	.	.	.	A	3.405	-0.121499	0.06838	.	.	ENSG00000106868	ENST00000355396	.	.	.	5.44	1.18	0.20946	.	.	.	.	.	T	0.55641	0.1933	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47787	-0.9090	4	.	.	.	-0.135	8.3921	0.32535	0.6833:0.2432:0.0735:0.0	.	.	.	.	M	617	.	.	L	-	1	2	SUSD1	113860739	0.668000	0.27493	0.998000	0.56505	0.165000	0.22458	0.976000	0.29462	0.327000	0.23409	0.459000	0.35465	TTG	.		0.483	SUSD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053668.3	NM_022486	
TDRD5	163589	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	179621325	179621325	+	Missense_Mutation	SNP	G	G	A	rs375929466		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:179621325G>A	ENST00000367614.1	+	13	2512	c.2153G>A	c.(2152-2154)cGt>cAt	p.R718H	TDRD5_ENST00000444136.1_Missense_Mutation_p.R718H|TDRD5_ENST00000294848.8_Missense_Mutation_p.R718H	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	718					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AGTGAGTTACGTATCTTGGTA	0.348																																					p.R718H		.											.	TDRD5	94	0			c.G2153A						.	A	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405	825.9+/-416.6	0,1,2202	81.0	79.0	80.0		2153,818,2153,2153,2153	-0.7	0.0	1		80	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	TDRD5	NM_173533.3,NM_001199092.1,NM_001199091.1,NM_001199089.1,NM_001199085.1	29,29,29,29,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign,benign,benign	718/982,273/537,718/982,718/1036,718/1036	179621325	1,13005	2203	4300	6503	SO:0001583	missense	163589	exon13			AGTTACGTATCTT	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2153G>A	1.37:g.179621325G>A	ENSP00000356586:p.Arg718His	Somatic	106.0	0.0		WXS	Illumina HiSeq	Phase_I	239.0	23.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	37	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	A	11.01	1.513657	0.27123	2.27E-4	0.0	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.30182	2.76;2.76;2.92;1.54	4.75	-0.711	0.11230	.	1.820450	0.03225	N	0.178189	T	0.13372	0.0324	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.11227	-1.0596	10	0.20519	T	0.43	.	0.2658	0.00225	0.325:0.1442:0.2511:0.2797	.	718;718	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	H	718;718;718;174	ENSP00000356586:R718H;ENSP00000294848:R718H;ENSP00000406052:R718H;ENSP00000410744:R174H	ENSP00000294848:R718H	R	+	2	0	TDRD5	177887948	0.000000	0.05858	0.000000	0.03702	0.383000	0.30230	-0.429000	0.06982	-0.227000	0.09884	-0.381000	0.06696	CGT	.		0.348	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
TENM1	10178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	123517526	123517526	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chrX:123517526A>T	ENST00000371130.3	-	29	7297	c.7234T>A	c.(7234-7236)Tac>Aac	p.Y2412N	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.Y2419N	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2412					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCAACTGGGTAGTTATTTTCA	0.358																																					p.Y2419N		.											.	.	.	0			c.T7255A						.						116.0	113.0	114.0					X																	123517526		2203	4300	6503	SO:0001583	missense	10178	exon30			CTGGGTAGTTATT	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7234T>A	X.37:g.123517526A>T	ENSP00000360171:p.Tyr2412Asn	Somatic	97.0	0.0		WXS	Illumina HiSeq	Phase_I	133.0	28.0	NM_001163278	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	A	3.347	-0.133446	0.06711	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.83992	-1.79;-1.76	5.97	5.97	0.96955	.	0.058909	0.64402	D	0.000001	T	0.61862	0.2381	N	0.00329	-1.635	0.53688	D	0.999979	D;D;B	0.62365	0.991;0.991;0.012	P;P;B	0.52109	0.69;0.69;0.003	T	0.71307	-0.4632	10	0.06236	T	0.91	.	15.388	0.74718	1.0:0.0:0.0:0.0	.	2418;2419;2412	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	N	2412;2419	ENSP00000360171:Y2412N;ENSP00000403954:Y2419N	ENSP00000360171:Y2412N	Y	-	1	0	ODZ1	123345207	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.750000	0.62162	2.018000	0.59344	0.486000	0.48141	TAC	.		0.358	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
TG	7038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	133961019	133961019	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:133961019A>G	ENST00000220616.4	+	27	5273		c.e27-1		TG_ENST00000377869.1_Splice_Site|TG_ENST00000542445.1_Splice_Site	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin						hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TGTGATTCTCAGGTGCCATCA	0.498																																					.		.											.	TG	145	0			c.5234-2A>G						.						189.0	173.0	179.0					8																	133961019		2203	4300	6503	SO:0001630	splice_region_variant	7038	exon27			ATTCTCAGGTGCC	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.5234-1A>G	8.37:g.133961019A>G		Somatic	90.0	0.0		WXS	Illumina HiSeq	Phase_I	266.0	63.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Splice_Site	SNP	ENST00000220616.4	37	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296961	0.23650	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000519178;ENST00000542445	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.4081	0.55451	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TG	134030201	0.998000	0.40836	0.751000	0.31187	0.003000	0.03518	4.592000	0.61027	2.246000	0.74042	0.533000	0.62120	.	.		0.498	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	Intron
TMCC1	23023	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	129389440	129389440	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr3:129389440G>T	ENST00000393238.3	-	4	1584	c.1244C>A	c.(1243-1245)cCa>cAa	p.P415Q	TMCC1_ENST00000426664.2_Missense_Mutation_p.P301Q|TMCC1_ENST00000329333.5_Missense_Mutation_p.P236Q|TMCC1_ENST00000432054.2_Missense_Mutation_p.P91Q	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	415						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						ACCATATTTTGGGCTAGACTG	0.507																																					p.P415Q		.											.	TMCC1	91	0			c.C1244A						.						101.0	95.0	97.0					3																	129389440		2203	4300	6503	SO:0001583	missense	23023	exon4			TATTTTGGGCTAG	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1244C>A	3.37:g.129389440G>T	ENSP00000376930:p.Pro415Gln	Somatic	119.0	0.0		WXS	Illumina HiSeq	Phase_I	269.0	32.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.934937	0.73442	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.21	5.21	0.72293	.	0.093329	0.85682	D	0.000000	T	0.68650	0.3024	M	0.81497	2.545	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.72625	0.978;0.967	T	0.64723	-0.6340	10	0.12430	T	0.62	-16.0998	19.1112	0.93317	0.0:0.0:1.0:0.0	.	236;415	B4DE04;O94876	.;TMCC1_HUMAN	Q	91;415;301;236	ENSP00000404711:P91Q;ENSP00000376930:P415Q;ENSP00000389892:P301Q;ENSP00000327349:P236Q	ENSP00000327349:P236Q	P	-	2	0	TMCC1	130872130	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.301000	0.96167	2.581000	0.87130	0.591000	0.81541	CCA	.		0.507	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
TMEM102	284114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7339378	7339378	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr17:7339378C>T	ENST00000323206.1	+	2	461	c.188C>T	c.(187-189)gCc>gTc	p.A63V	FGF11_ENST00000293829.4_5'Flank|FGF11_ENST00000575235.1_5'Flank|TMEM102_ENST00000396568.1_Missense_Mutation_p.A63V|RP11-104H15.9_ENST00000570444.1_RNA|RP11-104H15.7_ENST00000575310.1_RNA	NM_178518.2	NP_848613.1	Q8N9M5	TM102_HUMAN	transmembrane protein 102	63					apoptotic process (GO:0006915)|positive regulation of cell adhesion (GO:0045785)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell migration (GO:2000406)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|protein complex (GO:0043234)				kidney(1)|lung(3)|skin(1)	5		Prostate(122;0.173)				CTCCTCCGGGCCAAGGACTTT	0.632																																					p.A63V		.											.	TMEM102	90	0			c.C188T						.						88.0	114.0	105.0					17																	7339378		2203	4299	6502	SO:0001583	missense	284114	exon2			TCCGGGCCAAGGA	AK094197	CCDS11104.1	17p13.1	2008-04-21			ENSG00000181284	ENSG00000181284			26722	protein-coding gene	gene with protein product		613936				12477932	Standard	NM_178518		Approved	FLJ36878	uc002ggx.1	Q8N9M5	OTTHUMG00000132901	ENST00000323206.1:c.188C>T	17.37:g.7339378C>T	ENSP00000315387:p.Ala63Val	Somatic	46.0	0.0		WXS	Illumina HiSeq	Phase_I	132.0	46.0	NM_178518	D3DTP8	Missense_Mutation	SNP	ENST00000323206.1	37	CCDS11104.1	.	.	.	.	.	.	.	.	.	.	C	33	5.232363	0.95207	.	.	ENSG00000181284	ENST00000323206;ENST00000396568	T;T	0.54479	0.57;0.57	5.66	5.66	0.87406	.	0.000000	0.56097	D	0.000039	T	0.72087	0.3417	M	0.72894	2.215	0.51012	D	0.999909	D	0.89917	1.0	D	0.74674	0.984	T	0.74237	-0.3730	10	0.72032	D	0.01	-8.6371	17.2341	0.86994	0.0:1.0:0.0:0.0	.	63	Q8N9M5	TM102_HUMAN	V	63	ENSP00000315387:A63V;ENSP00000379815:A63V	ENSP00000315387:A63V	A	+	2	0	TMEM102	7280102	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.801000	0.62532	2.652000	0.90054	0.655000	0.94253	GCC	.		0.632	TMEM102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256405.1	NM_178518	
TPTE	7179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	10921977	10921977	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr21:10921977A>G	ENST00000361285.4	-	18	1375	c.1046T>C	c.(1045-1047)gTt>gCt	p.V349A	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.V311A|TPTE_ENST00000298232.7_Missense_Mutation_p.V331A	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	349	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GAAGGCACAAACCATAGTTCC	0.333																																					p.V349A		.											.	TPTE	344	0			c.T1046C						.						137.0	117.0	124.0					21																	10921977		2203	4299	6502	SO:0001583	missense	7179	exon18			GCACAAACCATAG	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1046T>C	21.37:g.10921977A>G	ENSP00000355208:p.Val349Ala	Somatic	149.0	0.0		WXS	Illumina HiSeq	Phase_I	321.0	13.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	8.949	0.967657	0.18659	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98947	-5.26;-5.26;-5.26	2.26	2.26	0.28386	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.203904	0.40554	N	0.001072	D	0.96941	0.9001	L	0.53617	1.68	0.31777	N	0.631393	B;P;B	0.37101	0.378;0.582;0.31	B;B;B	0.42163	0.169;0.251;0.378	D	0.96828	0.9609	10	0.87932	D	0	-17.2387	6.5011	0.22170	1.0:0.0:0.0:0.0	.	311;331;349	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	A	331;349;311	ENSP00000298232:V331A;ENSP00000355208:V349A;ENSP00000344441:V311A	ENSP00000298232:V331A	V	-	2	0	TPTE	9943848	0.582000	0.26749	0.967000	0.41034	0.031000	0.12232	1.270000	0.33086	1.075000	0.40932	0.102000	0.15555	GTT	.		0.333	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179548789	179548789	+	Missense_Mutation	SNP	C	C	T	rs72650032	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:179548789C>T	ENST00000591111.1	-	131	32016	c.31792G>A	c.(31792-31794)Gct>Act	p.A10598T	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A10915T|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A9671T|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGGACAGCTCTCTTCGGT	0.363																																					p.A10915T		.											.	TTN	636	0			c.G32743A						.						82.0	81.0	81.0					2																	179548789		1809	4072	5881	SO:0001583	missense	7273	exon133			GGACAGCTCTCTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.31792G>A	2.37:g.179548789C>T	ENSP00000465570:p.Ala10598Thr	Somatic	91.0	0.0		WXS	Illumina HiSeq	Phase_I	181.0	115.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	13.37	2.217774	0.39201	.	.	ENSG00000155657	ENST00000342992	T	0.64438	-0.1	5.58	2.76	0.32466	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.43500	0.1250	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.35798	-0.9774	9	0.87932	D	0	.	9.9864	0.41843	0.0:0.6767:0.1633:0.16	.	10598	Q8WZ42	TITIN_HUMAN	T	9671	ENSP00000343764:A9671T	ENSP00000343764:A9671T	A	-	1	0	TTN	179257034	0.405000	0.25336	0.999000	0.59377	0.829000	0.46940	0.190000	0.17057	0.744000	0.32741	0.563000	0.77884	GCT	C|0.143;G|0.857		0.363	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179575865	179575865	+	Missense_Mutation	SNP	G	G	C	rs374930292		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:179575865G>C	ENST00000591111.1	-	95	27371	c.27147C>G	c.(27145-27147)agC>agG	p.S9049R	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S9366R|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S8122R|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13187	Ig-like 73.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCCTGCAAGGCTCCGGTCAG	0.428																																					p.S9366R		.											.	TTN	636	0			c.C28098G						.	G	,,,ARG/SER	1,3677		0,1,1838	121.0	121.0	121.0		,,,24366	2.9	1.0	2		121	0,8180		0,0,4090	no	intron,intron,intron,missense	TTN	NM_003319.4,NM_133432.3,NM_133437.3,NM_133378.4	,,,110	0,1,5928	CC,CG,GG		0.0,0.0272,0.0084	,,,benign	,,,8122/33424	179575865	1,11857	1839	4090	5929	SO:0001583	missense	7273	exon97			TGCAAGGCTCCGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27147C>G	2.37:g.179575865G>C	ENSP00000465570:p.Ser9049Arg	Somatic	70.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	13.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	11.61	1.691391	0.30052	2.72E-4	0.0	ENSG00000155657	ENST00000342992	T	0.46819	0.86	5.76	2.91	0.33838	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.41696	0.1170	L	0.50993	1.605	0.80722	D	1	B	0.02656	0.0	B	0.09377	0.004	T	0.31668	-0.9935	9	0.87932	D	0	.	10.9549	0.47351	0.203:0.0:0.797:0.0	.	9049	Q8WZ42	TITIN_HUMAN	R	8122	ENSP00000343764:S8122R	ENSP00000343764:S8122R	S	-	3	2	TTN	179284110	0.995000	0.38212	0.996000	0.52242	0.989000	0.77384	0.372000	0.20467	0.409000	0.25649	0.655000	0.94253	AGC	.		0.428	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
UBE2H	7328	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	129520790	129520790	+	Silent	SNP	A	A	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr7:129520790A>G	ENST00000355621.3	-	2	468	c.75T>C	c.(73-75)gtT>gtC	p.V25V	UBE2H_ENST00000473814.2_Silent_p.V25V	NM_001202498.1|NM_003344.3	NP_001189427.1|NP_003335.1	P62256	UBE2H_HUMAN	ubiquitin-conjugating enzyme E2H	25					protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|skin(1)	10	Melanoma(18;0.0435)					CCAGGATCGTAACCTCATGTT	0.403																																					p.V25V		.											.	UBE2H	226	0			c.T75C						.						138.0	121.0	127.0					7																	129520790		2203	4300	6503	SO:0001819	synonymous_variant	7328	exon2			GATCGTAACCTCA	BC006277	CCDS5814.1, CCDS47710.1	7q32	2012-07-20	2011-05-19		ENSG00000186591	ENSG00000186591	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12484	protein-coding gene	gene with protein product	"""GID complex subunit 3, UBC8 homolog (S. cerevisiae)"""	601082	"""ubiquitin-conjugating enzyme E2H (homologous to yeast UBC8)"", ""ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast)"""			8132613	Standard	NM_003344		Approved	UBCH, UBC8, GID3	uc003vpf.2	P62256	OTTHUMG00000157650	ENST00000355621.3:c.75T>C	7.37:g.129520790A>G		Somatic	61.0	1.0		WXS	Illumina HiSeq	Phase_I	111.0	36.0	NM_182697	A4D1L6|C9JY93|P37286|Q7Z6F4	Silent	SNP	ENST00000355621.3	37	CCDS5814.1																																																																																			.		0.403	UBE2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349327.2	NM_003344	
UBR5	51366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	103293516	103293516	+	Splice_Site	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:103293516C>T	ENST00000520539.1	-	41	6534		c.e41+1		UBR5_ENST00000521922.1_Splice_Site|UBR5_ENST00000220959.4_Splice_Site	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5						cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AGAATGGATACCTTTTGCGTT	0.368																																					.	Ovarian(131;96 1741 5634 7352 27489)	.											.	UBR5	761	0			c.5927+1G>A						.						95.0	75.0	82.0					8																	103293516		2203	4300	6503	SO:0001630	splice_region_variant	51366	exon42			TGGATACCTTTTG	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.5927+1G>A	8.37:g.103293516C>T		Somatic	146.0	0.0		WXS	Illumina HiSeq	Phase_I	727.0	219.0	NM_015902	B2RP24|J3KMW7|O94970|Q9NPL3	Splice_Site	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.547843	0.86022	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.692	0.88271	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UBR5	103362692	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	7.772000	0.85439	2.152000	0.67230	0.563000	0.77884	.	.		0.368	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000380075.2	NM_015902	Intron
UBXN2A	165324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24194229	24194229	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:24194229A>T	ENST00000309033.4	+	3	369	c.125A>T	c.(124-126)gAg>gTg	p.E42V	UBXN2A_ENST00000535786.1_Missense_Mutation_p.E42V|UBXN2A_ENST00000446425.2_3'UTR|UBXN2A_ENST00000404924.1_Missense_Mutation_p.E42V	NM_181713.3	NP_859064.2	P68543	UBX2A_HUMAN	UBX domain protein 2A	42					regulation of gene expression (GO:0010468)|regulation of protein catabolic process (GO:0042176)|regulation of protein ubiquitination (GO:0031396)	cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)				endometrium(1)|large_intestine(3)|liver(1)|lung(6)	11						AGCCTTTTTGAGGAAGCTCAG	0.333																																					p.E42V		.											.	UBXN2A	90	0			c.A125T						.						128.0	135.0	133.0					2																	24194229		2203	4300	6503	SO:0001583	missense	165324	exon3			TTTTTGAGGAAGC	BC037901	CCDS1704.1	2p24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000173960	ENSG00000173960		"""UBX domain containing"""	27265	protein-coding gene	gene with protein product			"""UBX domain containing 4"""	UBXD4		12477932	Standard	NM_181713		Approved		uc002ren.3	P68543	OTTHUMG00000125497	ENST00000309033.4:c.125A>T	2.37:g.24194229A>T	ENSP00000312107:p.Glu42Val	Somatic	69.0	0.0		WXS	Illumina HiSeq	Phase_I	106.0	64.0	NM_181713	A8K577|B7ZKP8|Q569G8	Missense_Mutation	SNP	ENST00000309033.4	37	CCDS1704.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.948036	0.73787	.	.	ENSG00000173960	ENST00000404924;ENST00000309033;ENST00000535786	T;T;T	0.51574	0.75;0.75;0.7	4.53	4.53	0.55603	.	0.096452	0.64402	D	0.000001	T	0.54951	0.1890	L	0.32530	0.975	0.41646	D	0.989103	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.957	T	0.52533	-0.8563	10	0.33940	T	0.23	-0.4989	12.105	0.53807	1.0:0.0:0.0:0.0	.	42;42	B7ZKP8;P68543	.;UBX2A_HUMAN	V	42	ENSP00000385525:E42V;ENSP00000312107:E42V;ENSP00000440533:E42V	ENSP00000312107:E42V	E	+	2	0	UBXN2A	24047733	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.240000	0.65378	2.011000	0.59026	0.524000	0.50904	GAG	.		0.333	UBXN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246824.2	NM_181713	
USP24	23358	broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	55573092	55573092	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:55573092C>T	ENST00000294383.6	-	40	4581	c.4582G>A	c.(4582-4584)Gag>Aag	p.E1528K	USP24_ENST00000407756.1_Missense_Mutation_p.E1368K	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1528					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CTTAACTGCTCCATTTCTGAA	0.393																																					p.E1528K		.											.	USP24	521	0			c.G4582A						.						68.0	61.0	63.0					1																	55573092		1894	4122	6016	SO:0001583	missense	23358	exon40			ACTGCTCCATTTC	AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.4582G>A	1.37:g.55573092C>T	ENSP00000294383:p.Glu1528Lys	Somatic	68.0	0.0		WXS	Illumina HiSeq	Phase_I	80.0	8.0	NM_015306	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	ENST00000294383.6	37	CCDS44154.2	.	.	.	.	.	.	.	.	.	.	C	16.14	3.039616	0.55003	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.66995	-0.24;-0.24	5.92	5.92	0.95590	.	0.208078	0.48767	D	0.000168	T	0.55909	0.1950	N	0.25647	0.755	0.80722	D	1	B	0.18863	0.031	B	0.14023	0.01	T	0.50591	-0.8810	10	0.14656	T	0.56	.	20.3081	0.98638	0.0:1.0:0.0:0.0	.	1368	B7WPF4	.	K	1528;1368	ENSP00000294383:E1528K;ENSP00000385700:E1368K	ENSP00000294383:E1528K	E	-	1	0	USP24	55345680	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.795000	0.96236	0.655000	0.94253	GAG	.		0.393	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022275.2		
VWF	7450	broad.mit.edu;ucsc.edu	37	12	6128892	6128892	+	Missense_Mutation	SNP	T	T	G	rs61749368	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:6128892T>G	ENST00000261405.5	-	28	3946	c.3692A>C	c.(3691-3693)aAc>aCc	p.N1231T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1231					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	ACAGGTGAGGTTGACAACATC	0.542													T|||	25	0.00499201	0.0113	0.0029	5008	,	,		19607	0.003		0.001	False		,,,				2504	0.0041				p.N1231T		.											.	VWF	163	0			c.A3692C						.						13.0	16.0	15.0					12																	6128892		2201	4292	6493	SO:0001583	missense	7450	exon28			GTGAGGTTGACAA		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3692A>C	12.37:g.6128892T>G	ENSP00000261405:p.Asn1231Thr	Somatic	13.0	0.0		WXS	Illumina HiSeq	Phase_I	29.0	10.0	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	8	0.003663003663003663	6	0.012195121951219513	0	0.0	2	0.0034965034965034965	0	0.0	.	11.77	1.736361	0.30774	.	.	ENSG00000110799	ENST00000261405	T	0.35789	1.29	4.94	2.59	0.31030	.	0.135413	0.33959	N	0.004386	T	0.22085	0.0532	L	0.55213	1.73	0.80722	D	1	B	0.16802	0.019	B	0.17979	0.02	T	0.05241	-1.0897	10	0.22706	T	0.39	.	8.2423	0.31667	0.0:0.1634:0.0:0.8366	rs61749368	1231	P04275	VWF_HUMAN	T	1231	ENSP00000261405:N1231T	ENSP00000261405:N1231T	N	-	2	0	VWF	5999153	1.000000	0.71417	0.910000	0.35882	0.800000	0.45204	2.450000	0.44943	0.383000	0.24910	0.454000	0.30748	AAC	.		0.542	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
VWF	7450	broad.mit.edu;ucsc.edu	37	12	6128898	6128898	+	Missense_Mutation	SNP	A	A	C	rs61749367	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr12:6128898A>C	ENST00000261405.5	-	28	3940	c.3686T>G	c.(3685-3687)gTt>gGt	p.V1229G		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1229					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GAGGTTGACAACATCACAGTG	0.537													C|||	45	0.00898562	0.0204	0.0072	5008	,	,		19564	0.003		0.001	False		,,,				2504	0.0092				p.V1229G		.											.	VWF	163	0			c.T3686G						.	C	GLY/VAL	11,4391		0,11,2190	13.0	15.0	14.0		3686	4.9	0.9	12		14	1,8579		0,1,4289	no	missense	VWF	NM_000552.3	109	0,12,6479	CC,CA,AA		0.0117,0.2499,0.0924	benign	1229/2814	6128898	12,12970	2201	4290	6491	SO:0001583	missense	7450	exon28			TTGACAACATCAC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3686T>G	12.37:g.6128898A>C	ENSP00000261405:p.Val1229Gly	Somatic	13.0	0.0		WXS	Illumina HiSeq	Phase_I	20.0	7.0	NM_000552	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	11	0.005036630036630037	7	0.014227642276422764	2	0.0055248618784530384	2	0.0034965034965034965	0	0.0	.	1.685	-0.505481	0.04261	0.002499	1.17E-4	ENSG00000110799	ENST00000261405	T	0.35236	1.32	4.94	4.94	0.65067	.	0.152029	0.30859	N	0.008725	T	0.04182	0.0116	N	0.00025	-2.685	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42832	-0.9428	10	0.02654	T	1	.	13.6756	0.62451	0.1559:0.8441:0.0:0.0	rs61749367	1229	P04275	VWF_HUMAN	G	1229	ENSP00000261405:V1229G	ENSP00000261405:V1229G	V	-	2	0	VWF	5999159	0.997000	0.39634	0.856000	0.33681	0.796000	0.44982	3.166000	0.50785	1.332000	0.45431	-0.225000	0.12378	GTT	.		0.537	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
WDR33	55339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	128474768	128474768	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr2:128474768G>T	ENST00000322313.4	-	17	2988	c.2830C>A	c.(2830-2832)Ccc>Acc	p.P944T		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	944					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TTCAGAGGGGGAATGCGACCT	0.488																																					p.P944T		.											.	WDR33	90	0			c.C2830A						.						42.0	40.0	41.0					2																	128474768		2203	4300	6503	SO:0001583	missense	55339	exon17			GAGGGGGAATGCG		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2830C>A	2.37:g.128474768G>T	ENSP00000325377:p.Pro944Thr	Somatic	60.0	0.0		WXS	Illumina HiSeq	Phase_I	152.0	97.0	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.564656	0.45694	.	.	ENSG00000136709	ENST00000322313	D	0.89343	-2.5	5.27	5.27	0.74061	.	0.200449	0.35970	N	0.002871	T	0.78451	0.4285	N	0.08118	0	0.80722	D	1	B	0.27498	0.18	B	0.17098	0.017	T	0.78074	-0.2346	10	0.72032	D	0.01	-4.998	14.8293	0.70135	0.0:0.1867:0.8133:0.0	.	944	Q9C0J8	WDR33_HUMAN	T	944	ENSP00000325377:P944T	ENSP00000325377:P944T	P	-	1	0	WDR33	128191238	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.230000	0.58632	2.473000	0.83533	0.563000	0.77884	CCC	.		0.488	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
ZFPM2	23414	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	106331179	106331179	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr8:106331179C>T	ENST00000407775.2	+	1	260	c.10C>T	c.(10-12)Cga>Tga	p.R4*	ZFPM2_ENST00000520492.1_5'Flank	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	4					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			GATGTCCCGGCGAAAGCAAAG	0.741																																					p.R4X		.											.	ZFPM2	139	0			c.C10T						.						4.0	5.0	5.0					8																	106331179		1410	3262	4672	SO:0001587	stop_gained	23414	exon1			TCCCGGCGAAAGC	AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.10C>T	8.37:g.106331179C>T	ENSP00000384179:p.Arg4*	Somatic	37.0	0.0		WXS	Illumina HiSeq	Phase_I	205.0	30.0	NM_012082	Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Nonsense_Mutation	SNP	ENST00000407775.2	37	CCDS47908.1	.	.	.	.	.	.	.	.	.	.	C	40	7.932149	0.98568	.	.	ENSG00000169946	ENST00000407775	.	.	.	3.5	2.46	0.29980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.6804	0.28509	0.5355:0.4645:0.0:0.0	.	.	.	.	X	4	.	ENSP00000384179:R4X	R	+	1	2	ZFPM2	106400355	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.329000	0.52060	1.491000	0.48482	0.460000	0.39030	CGA	.		0.741	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380614.1		
ZNF100	163227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	21910792	21910792	+	Splice_Site	SNP	C	C	G			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:21910792C>G	ENST00000358296.6	-	5	521		c.e5-1		ZNF100_ENST00000305570.6_Splice_Site	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						GAACATATAACTGAAAGAAAT	0.303																																					.		.											.	ZNF100	90	0			c.323-1G>C						.						20.0	19.0	19.0					19																	21910792		1852	4082	5934	SO:0001630	splice_region_variant	163227	exon6			ATATAACTGAAAG	BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.323-1G>C	19.37:g.21910792C>G		Somatic	55.0	0.0		WXS	Illumina HiSeq	Phase_I	77.0	8.0	NM_173531	Q7M4M0	Splice_Site	SNP	ENST00000358296.6	37	CCDS42538.1	.	.	.	.	.	.	.	.	.	.	C	4.678	0.126049	0.08931	.	.	ENSG00000197020	ENST00000358296	.	.	.	0.131	0.131	0.14755	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.741	0.28841	0.0:0.9999:0.0:1.0E-4	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF100	21702632	0.000000	0.05858	0.220000	0.23810	0.218000	0.24690	-0.194000	0.09559	0.171000	0.19730	0.174000	0.16983	.	.		0.303	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464087.1	NM_173531	Intron
ZNF189	7743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	104171115	104171115	+	Silent	SNP	G	G	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr9:104171115G>A	ENST00000339664.2	+	3	1194	c.1065G>A	c.(1063-1065)cgG>cgA	p.R355R	ZNF189_ENST00000374861.3_Silent_p.R341R|ZNF189_ENST00000259395.4_Silent_p.R313R	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	355					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				GTTTCAGTCGGAGCTCATTCC	0.408																																					p.R355R		.											.	ZNF189	229	0			c.G1065A						.						83.0	89.0	87.0					9																	104171115		2203	4300	6503	SO:0001819	synonymous_variant	7743	exon3			CAGTCGGAGCTCA	AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.1065G>A	9.37:g.104171115G>A		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	81.0	19.0	NM_003452	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Silent	SNP	ENST00000339664.2	37	CCDS6754.1																																																																																			.		0.408	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053447.1	NM_003452	
ZNF284	342909	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44590091	44590091	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:44590091A>C	ENST00000421176.3	+	5	676	c.460A>C	c.(460-462)Aaa>Caa	p.K154Q	RNU6-902P_ENST00000517212.1_RNA|ZNF223_ENST00000591793.1_3'UTR	NM_001037813.2	NP_001032902.1	Q2VY69	ZN284_HUMAN	zinc finger protein 284	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0435)				GAAGTGTAAAAAATTCTTCAG	0.418																																					p.K154Q		.											.	.	.	0			c.A460C						.						60.0	59.0	59.0					19																	44590091		2122	4271	6393	SO:0001583	missense	342909	exon5			TGTAAAAAATTCT	AY166789	CCDS46099.1	19q13.32	2013-01-08				ENSG00000186026		"""Zinc fingers, C2H2-type"", ""-"""	13078	protein-coding gene	gene with protein product						12743021	Standard	NM_001037813		Approved	DKFZp781F1775	uc002oyg.1	Q2VY69		ENST00000421176.3:c.460A>C	19.37:g.44590091A>C	ENSP00000411032:p.Lys154Gln	Somatic	63.0	0.0		WXS	Illumina HiSeq	Phase_I	95.0	9.0	NM_001037813	Q86WM1	Missense_Mutation	SNP	ENST00000421176.3	37	CCDS46099.1	.	.	.	.	.	.	.	.	.	.	A	2.020	-0.424865	0.04734	.	.	ENSG00000186026	ENST00000421176	T	0.35973	1.28	2.29	-4.58	0.03410	.	.	.	.	.	T	0.31513	0.0799	M	0.72576	2.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34576	-0.9823	9	0.56958	D	0.05	.	5.812	0.18471	0.4256:0.1435:0.4309:0.0	.	154	Q2VY69	ZN284_HUMAN	Q	154	ENSP00000411032:K154Q	ENSP00000411032:K154Q	K	+	1	0	ZNF284	49281931	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	0.270000	0.18607	-1.315000	0.02297	-0.648000	0.03929	AAA	.		0.418	ZNF284-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460473.1	NM_001037813	
ZNF285	26974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44890916	44890916	+	Silent	SNP	T	T	C	rs548413151		TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:44890916T>C	ENST00000330997.4	-	4	1555	c.1491A>G	c.(1489-1491)tcA>tcG	p.S497S	ZNF285_ENST00000544719.2_Silent_p.S497S|CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Silent_p.S504S	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						AGTGAAAATATGAACTGTAAC	0.378													T|||	1	0.000199681	0.0008	0.0	5008	,	,		24359	0.0		0.0	False		,,,				2504	0.0				p.S497S		.											.	ZNF285	94	0			c.A1491G						.						84.0	86.0	86.0					19																	44890916		2203	4300	6503	SO:0001819	synonymous_variant	26974	exon4			AAAATATGAACTG	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1491A>G	19.37:g.44890916T>C		Somatic	105.0	0.0		WXS	Illumina HiSeq	Phase_I	215.0	116.0	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	ENST00000330997.4	37	CCDS12638.1																																																																																			.		0.378	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
ZNF519	162655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	14105690	14105690	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr18:14105690C>T	ENST00000590202.1	-	3	1001	c.849G>A	c.(847-849)caG>caA	p.Q283Q	ZNF519_ENST00000589203.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	283					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						TATGAATTTTCTGATGTCCAA	0.368																																					p.Q283Q		.											.	ZNF519	90	0			c.G849A						.						49.0	54.0	52.0					18																	14105690		2203	4299	6502	SO:0001819	synonymous_variant	162655	exon3			AATTTTCTGATGT	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.849G>A	18.37:g.14105690C>T		Somatic	52.0	0.0		WXS	Illumina HiSeq	Phase_I	42.0	7.0	NM_145287		Silent	SNP	ENST00000590202.1	37	CCDS32797.1																																																																																			.		0.368	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1	NM_145287	
ZNF681	148213	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23926971	23926971	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:23926971G>C	ENST00000402377.3	-	4	1522	c.1381C>G	c.(1381-1383)Cag>Gag	p.Q461E	ZNF681_ENST00000395385.3_Missense_Mutation_p.Q392E	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	461					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTGAGAACTGGTTAAAGGCT	0.368																																					p.Q461E		.											.	.	.	0			c.C1381G						.						51.0	54.0	53.0					19																	23926971		2203	4299	6502	SO:0001583	missense	148213	exon4			AGAACTGGTTAAA	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1381C>G	19.37:g.23926971G>C	ENSP00000384000:p.Gln461Glu	Somatic	35.0	0.0		WXS	Illumina HiSeq	Phase_I	69.0	10.0	NM_138286	B3KVF7	Missense_Mutation	SNP	ENST00000402377.3	37	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	2.531	-0.308544	0.05458	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.07327	3.2;3.2	1.51	-2.25	0.06888	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04907	0.0132	L	0.42744	1.35	0.09310	N	1	B	0.32753	0.383	B	0.18561	0.022	T	0.37572	-0.9700	9	0.33141	T	0.24	.	2.0035	0.03472	0.4171:0.0:0.3248:0.2581	.	461	Q96N22	ZN681_HUMAN	E	461;392	ENSP00000384000:Q461E;ENSP00000378783:Q392E	ENSP00000378783:Q392E	Q	-	1	0	ZNF681	23718811	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.382000	0.02546	-0.077000	0.12752	0.313000	0.20887	CAG	.		0.368	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
ZNF681	148213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	23927977	23927977	+	Silent	SNP	T	T	A			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr19:23927977T>A	ENST00000402377.3	-	4	516	c.375A>T	c.(373-375)ggA>ggT	p.G125G	ZNF681_ENST00000395385.3_Silent_p.G56G	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	125					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				CATTATAACCTCCTTTTTGCA	0.299																																					p.G125G		.											.	.	.	0			c.A375T						.						59.0	57.0	58.0					19																	23927977		2202	4300	6502	SO:0001819	synonymous_variant	148213	exon4			ATAACCTCCTTTT	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.375A>T	19.37:g.23927977T>A		Somatic	74.0	0.0		WXS	Illumina HiSeq	Phase_I	118.0	48.0	NM_138286	B3KVF7	Silent	SNP	ENST00000402377.3	37	CCDS12414.2																																																																																			.		0.299	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
ZNF721	170960	broad.mit.edu;ucsc.edu;mdanderson.org	37	4	436527	436527	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	T	T	.	.	.	.	.	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:436527T>C	ENST00000338977.5	-	2	1741	c.1693A>G	c.(1693-1695)Aga>Gga	p.R565G	ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Missense_Mutation_p.R577G			Q8TF20	ZN721_HUMAN	zinc finger protein 721	565					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						GTATGAATTCTCCTATGTACA	0.403																																					p.P577A		.											.	ZNF721	47	0			c.C1729G						.						114.0	126.0	122.0					4																	436527		2127	4259	6386	SO:0001583	missense	170960	exon3			GAATTCTCCTATG	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1693A>G	4.37:g.436527T>C	ENSP00000340524:p.Arg565Gly	Somatic	70.0	1.0		WXS	Illumina HiSeq	Phase_I	177.0	28.0	NM_133474	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	T	15.90	2.968593	0.53614	.	.	ENSG00000182903	ENST00000338977;ENST00000511833	T;T	0.24723	1.84;1.84	1.28	1.28	0.21552	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38772	0.1053	M	0.81497	2.545	0.30713	N	0.749093	D;P;P	0.54601	0.967;0.907;0.887	P;P;P	0.52672	0.635;0.706;0.582	T	0.43180	-0.9407	9	0.66056	D	0.02	.	6.3325	0.21279	0.0:0.0:0.0:1.0	.	565;577;577	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	G	565;577	ENSP00000340524:R565G;ENSP00000428878:R577G	ENSP00000340524:R565G	R	-	1	2	ZNF721	426527	0.000000	0.05858	0.013000	0.15412	0.275000	0.26752	-1.427000	0.02441	0.561000	0.29186	0.155000	0.16302	AGA	.		0.403	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
ZNF827	152485	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	146686272	146686272	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr4:146686272A>T	ENST00000508784.1	-	13	3325	c.3098T>A	c.(3097-3099)aTg>aAg	p.M1033K	ZNF827_ENST00000379448.4_Missense_Mutation_p.M1033K|ZNF827_ENST00000513320.1_Missense_Mutation_p.M683K			Q17R98	ZN827_HUMAN	zinc finger protein 827	1033					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	all_hematologic(180;0.151)					ACGCTCAAACATGTTCTTCGT	0.522																																					p.M1033K		.											.	ZNF827	22	0			c.T3098A						.						87.0	79.0	82.0					4																	146686272		2203	4300	6503	SO:0001583	missense	152485	exon13			TCAAACATGTTCT	AK091130	CCDS34072.1	4q31.22	2013-01-08			ENSG00000151612	ENSG00000151612		"""Zinc fingers, C2H2-type"""	27193	protein-coding gene	gene with protein product						12477932	Standard	NM_178835		Approved		uc003ikm.3	Q17R98	OTTHUMG00000161362	ENST00000508784.1:c.3098T>A	4.37:g.146686272A>T	ENSP00000421863:p.Met1033Lys	Somatic	62.0	0.0		WXS	Illumina HiSeq	Phase_I	104.0	20.0	NM_178835	B7ZL52|Q7Z4S7|Q8N279	Missense_Mutation	SNP	ENST00000508784.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.3|20.3	3.969817|3.969817	0.74246|0.74246	.|.	.|.	ENSG00000151612|ENSG00000151612	ENST00000511659|ENST00000508784;ENST00000513320;ENST00000379448;ENST00000281318;ENST00000440280	.|T;T;T	.|0.59772	.|0.24;0.24;0.24	4.83|4.83	4.83|4.83	0.62350|0.62350	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52354|0.52354	0.1729|0.1729	N|N	0.03177|0.03177	-0.4|-0.4	0.58432|0.58432	D|D	0.999997|0.999997	.|D;D;D;P	.|0.54772	.|0.96;0.968;0.96;0.932	.|D;D;D;P	.|0.70487	.|0.948;0.969;0.948;0.888	T|T	0.57539|0.57539	-0.7794|-0.7794	5|10	.|0.23891	.|T	.|0.37	-18.7384|-18.7384	14.7219|14.7219	0.69314|0.69314	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|683;1033;1033;683	.|G5E9Z1;Q17R98;Q17R98-2;E7ESI8	.|.;ZN827_HUMAN;.;.	S|K	134|1033;683;1033;1032;683	.|ENSP00000421863:M1033K;ENSP00000423130:M683K;ENSP00000368761:M1033K	.|ENSP00000281318:M1032K	C|M	-|-	1|2	0|0	ZNF827|ZNF827	146905722|146905722	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.910000|8.910000	0.92685|0.92685	1.920000|1.920000	0.55613|0.55613	0.533000|0.533000	0.62120|0.62120	TGT|ATG	.		0.522	ZNF827-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000364654.2	NM_178835	
ZWINT	11130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	58118598	58118598	+	Silent	SNP	C	C	T			TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr10:58118598C>T	ENST00000373944.3	-	6	629	c.591G>A	c.(589-591)caG>caA	p.Q197Q	ZWINT_ENST00000318387.2_Silent_p.Q77Q|ZWINT_ENST00000361148.6_Intron|ZWINT_ENST00000460654.1_5'UTR|ZWINT_ENST00000395405.1_Silent_p.Q197Q			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	197					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						GTTCTGCCTGCTGCTTCAGGT	0.537																																					p.Q197Q		.											.	ZWINT	227	0			c.G591A						.						136.0	133.0	134.0					10																	58118598		2203	4300	6503	SO:0001819	synonymous_variant	11130	exon6			TGCCTGCTGCTTC	AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.591G>A	10.37:g.58118598C>T		Somatic	120.0	0.0		WXS	Illumina HiSeq	Phase_I	272.0	49.0	NM_007057	A6NNV6|Q0D2I3|Q9BWD0	Silent	SNP	ENST00000373944.3	37	CCDS7249.1																																																																																			.		0.537	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048132.1		
OR2T4	127074	ucsc.edu;bcgsc.ca	37	1	248525290	248525291	+	Missense_Mutation	DNP	CG	CG	TC	rs386642002|rs28540568|rs374193555|rs141576206|rs57728407|rs202028348	byFrequency	TCGA-DD-A1EF-01A-11D-A12Z-10	TCGA-DD-A1EF-10A-01D-A12Z-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	93e828cc-f42a-438f-a94b-9c2208e1988e	a3a82e8b-83d5-4f74-8f92-4ccb2b2ee0e4	g.chr1:248525290_248525291CG>TC	ENST00000366475.1	+	1	408_409	c.408_409CG>TC	c.(406-411)taCGtg>taTCtg	p.V137L		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.Y136*(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGTTCTTCTACGTGACACTAGC	0.52																																					p.V137L		.											.	.	.	1	Substitution - Nonsense(1)	lung(1)	.						.																																			SO:0001583	missense	127074	.			CTTCTACGTGACA	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	Exception_encountered	1.37:g.248525290_248525291delinsTC	ENSP00000355431:p.Val137Leu	Somatic	159.0	1.0		WXS	Illumina HiSeq	.	963.0	114.0	.	Q6IEZ8	Missense_Mutation	DNP	ENST00000366475.1	37	CCDS31113.1																																																																																			.		0.520	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
